#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 02, 2020; 17:57 GMT TreeBASE (cc) 1994-2008 Study reference: Unmack P.J., Hammer M., Adams M., & Dowling T.E. 2011. A Phylogenetic Analysis of Pygmy Perches (Teleostei: Percichthyidae) with an Assessment of the Major Historical Influences on Aquatic Biogeography in Southern Australia. Systematic Biology, 60(6): 797-812. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S11103] BEGIN TAXA; TITLE Taxa; DIMENSIONS NTAX=24; TAXLABELS 'Bostockia_porosa_BPO3' 'Bostockia_porosa_BPO4' 'Nannatherina_balstoni_NBA3A' 'Nannatherina_balstoni_NBA3B' 'Nannoperca_australis_NAU11' 'Nannoperca_australis_NAU21' 'Nannoperca_australis_NAU22' 'Nannoperca_australis_NAU24' 'Nannoperca_australis_NAU28' 'Nannoperca_australis_NAU29' 'Nannoperca_australis_NAU30' 'Nannoperca_australis_NAU9' 'Nannoperca_obscura_NOB17' 'Nannoperca_obscura_NOB21' 'Nannoperca_obscura_NOB26' 'Nannoperca_obscura_NOB7' 'Nannoperca_oxleyana_NOX31' 'Nannoperca_oxleyana_NOX34' 'Nannoperca_variegata_NVAR18' 'Nannoperca_variegata_NVAR19' 'Nannoperca_vittata_NVI1' 'Nannoperca_vittata_NVI2' 'Nannoperca_vittata_NVI3' 'Nannoperca_vittata_NVI6' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7386] TITLE Character_Matrix_S7; LINK TAXA = Taxa; DIMENSIONS NCHAR=1344; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Bostockia_porosa_BPO3' TTTCGCTGGATTGGCTTTTCTCTTCCAAAATGCGCCTTAATGTCTTTTGATATTTGTGCTCGTCTATAATAACGCACATTAAGACTCGGATATCTTAGATTATGTGGTTTGTGGGGACGGATGGCTAGTTTATGTCACGAAATTGAGCGTAGTA-AGAGGTGCTCCGGTGAAAGGGTTCTTGTAACGGGGAGTAGTTAGCAGGCCGTGCACGTGTTCAGATAGCAGCTACAGCAAC------------------ACTGAATATACGAGCCTCTGTGAACGAGT---TTCATTACAAATAAGACCAGTTACTGTTGTTGACCCACATAAAACCCCACAGCTAAACTGTAGCAGAGATAAGTGACAACCGGATACGTTATTTTAGATAGCTAGCGTTCATTCTAGCCTAGCTATAACTTAAAT-CTAGCTAGCATGCAGTTTGTTTTTCGTGTGGTTGTAGGCTA-GTTATTTTTTT--------------ATTT---ATTTTTGTCAAATATAGTTCC-TGCAGTGGCTATGCCTGTGAGTTAG--TCCT--------TTAGCATTGAGCTGGTTAGCCTAGCGCGGATCATGCTGGTTT-GAAGGAGCTCTTCCAGGACTCATGTGA------------TAGGAGATGTCAGGCT------ACCGGTTTATTTAAGTAAACCACATGTCTG-TATTTCTCTTC-GCAGAGACATAGGCCGATCTCCCAGGTAAGAGGACCAGGCTTCAGCCCATCA---CATCATGT--TTTACGTAATTGTAGAGTTTGTTTTTTTTTGTCAACCTGCATGTAGAGTCTGACTGCTCGTGCTAAAATGATAACTGGTTGTGGTACATGCAGCAGCAGAGA---TTTGAGAGAAATTGCAGTAAAAGTCAGAATTA---TGA-TGG-ACT--------GTAAAATCCTAATGTTCAGATATCTCCTA---CACATATTGAACACCACA----------CATGCTTCCCTTATGTATGAGGTCAGTCTTAACTAAAGCCAGTATATAATAATATAAAT-----------TGTAGAT--AGTTTTTAAAGTGTCAG---ATTGGGTTAGAAGTTGAATGCTTGAGGGAAACTA----TGAAA-------------------CT-AAACT--------------------GTAAAAAG-------------------------------------------------------------------------------------------------------------------AAAAATACAGATATCCCACACAGATTTTACATGTCTCCCTGCAG 'Bostockia_porosa_BPO4' TTTCGCTGGATTGGCTTTTCTCTTCCAAAATGCGCCTTAATGTCTTTTGATATTTGTGCTCGTCTATAATAACGCACATTAAGACTCGGATATCTTAGATTATGTGGTTTGTGGGGACGGATGGCTAGTTTATGTCACGAAATTGAGCGTAGTA-AGAGGTGCTCCGGTGAAAGGGTTCTTGTAACGGGGAGTAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCTACAGCAAC------------------ACTGAATATACGAGCCTCTGTGAACGAGT---TTCATTACAAATAAGACCAGTTACTGTTGTTGACCCACATAAAACCCCACAGCTAAACTGTAGCAGAGATAAGTGACAACCGGATACGTTATTTTAGATAGCTAGCGTTCATTCTAGCCTAGCTATAACTTAAAT-CTAGCTAGCATGCAGTTTGTTTTTCGTGTGGCTGTAGGCTA-GTTATTTTTTT--------------ATTT---ATTTTTGTCAAATATAGTTCC-TGCAGTGGCTATGCCTGTGAGTTAG--TCCT--------TTAGCATTGAGCTGGTTAGCCTAGCGCGGATCATGCTGGTTT-GAAGGAGCTCTTCCAGGACTCATGTGA------------TAGGAGATGTCAGGCT------ACCGGTTTATTTAAGTAAACCACATGTCTG-TATTTCTCTTC-GCAGAGACATAGGCCGATCTCCCAGGTAAGAGGACCAGGCTTCAGCCCATCA---CATCATGT--TTTACGTAATTGTAGAGTTTGTTTTTTTTTGTCAACCTGCATGTAGAGTCTGACTGCTCGTGCTAAAATGATAACTGGTTGTGGTACATGCAGCAGCAGAGA---TTTGAGAGAAATTGCAGTAAAAGTCAGAATTA---TGA-TGG-ACT--------GTAAAATCCTAATGTTCAGATATCTCCTA---CACATATTGAACACCACA----------CATGCTTCCCTTATGTATGAGGTCAGTCTTAACTAAAGCCAGTATATAATAATATAAAT-----------TGTAGATACAGTTTTTAAAGTGTCAG---ATTGGGTTAGAAGTTGAATGCTTAAGGGAAACTA----TGAAA-------------------CT-AAACT--------------------GTAAAAAG-------------------------------------------------------------------------------------------------------------------AAAAATACAGATATCCCACACAGATTTTACATGTCTCCCTGCAG 'Nannatherina_balstoni_NBA3A' TTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACTTTAATGTTGTTTGATATTCGTGTTTGTCTTTAATAAAGACCCTTAAGTCTCGGATACTTTAGATTATGTGGTTTTTAGGGACGGATGGCTTGTTTTTGTCACAAAATCCAGCGTAGTAGCGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCTTTAGCAACGACAAGATAAAGTAGTAGTCTGAATATACAAAGATACGTGAACGAGTCGTTTCATGTAAAATAAAACCAGTTACTGTTGTT-AGCCACGTGAAAC--TACAGCTAAAATGTAGCAGAGATAAATGACAACCAGCTAAGTTATTTTAGCTAGCTAATGTTCCTTCTAGCCTAGCCCTAACTTTAATTCTAGCTAACAAGCACTTTGTTTTT--AGAGGTTTCAGAGTATGTGTCTTTT--CCACGTGGCTGTAAGTTGGGTATTTCTGTCAAAAACCCTTCCCTATATTGACTATCCTGGTGAGTTAGCCTGCTGCTACCGGTTAGCATCGAGTTGGTTTCCCAGACACGGTTCATGCTGGTTTTCAATGAGCTCTTCCAGGATTCATGTGA-----------------GATGTCAGACTT-----ACATG----CGCATGTAACCCACATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCTCCCAGGTAAGAGGACCTGGTTTCA----ATCATCAGATCATCTC-----------------------------------ACCTGCATGTAGA----TGCTGTTCATGCTAAAGAAGTAGTTGTTTGTGATGCA----------GAG-CTTTTTAAGATAAATTACAGTAA--GTCAGAATCTCGTTGACTCGTACTGTCAGACAGTAAAATCCTAATGTTCAGA-----CATAAGAGAAATATTTAACACCACAAAACCCGAATTCTTGTTCCCTCCTGTATGAGGTCAGTCTTAACTAAAGCCAGTAAATAACTCTATAAATGACTT----CTTATAGATGCAGTTTT-AAAGTGTCAGTAGATGGAGTCAGAAGTTGAATGCTGGAGGGAAACGACGTGTGAAATGTCTGTACATGAATTTGCCTCAAACTAAATCCTCTGGACTTGTTGAGTGAACAGGTCGCTGTTTCTAAGTAGGAGTATGATTCTGCTCAATTGCATGTAAACAAACTAAATAGAAACTGCTAATTGCTAAACTATTGCAGCGTGTGGGAGATGTGGGAGGGAGTTGTGTAA---TACTGGCAT-------------GACTTGTCTCCCCACAG 'Nannatherina_balstoni_NBA3B' TTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACCTTAATGTTGTTTGATATTCGTGTTTGTCTTTAATAAAGAACCTTAAGTCTCGGATACTTTAGATTATGTGGTTTTTAGGGACGGATGGCTTGTTTTTGTCACAAAATCCAGCGTAGTAGCGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCTTTAGCAACGACAAGATAAAGTAGTAGTCTGAATATACAAAGATACGTGAACGAGTCGTTTCATGTAAAATAAAACCAGTTACTGCTGTT-AGCCACGTGAAAC--TACAGCTAGAATGTAGCAGAGATAAATGACAACCAGCTAAGTTATTTTAGCTAGCTAATGTTCCTTCTAGCCTAGCCCTAACTTTAATTCTAGCTAACAAGCACTTTGTTTTT--AGAGGTTTCAGAGTATGTGTCTTTTC-CCACGTGGCTGTAAGTTGGGTATTTCTGTCAAAAACCCTTCCCTATATTGACTATCCTGGTGAGTTAGCCTGCTGCTACCGGTTAGCATCGAGTTGGTTTCCCAGACACGGTTCATGCTGGTTTTCAATGAGCTCTTCCAGGATTCATGTGA-----------------GATGTCAGACTT-----ACATG----CGCATGTAACCCACATGTCTCTTATTTCTCTTTNGCAGAGACATAGGCCGATCTCCCAGGTAAGAGGACCTGGTTTCA----ATCATCAGATCATCTC-----------------------------------ACCTGCATGTAGA----TGCTGTTCATGCTAAAGAAGTAGTTGTTTGTGATGCA----------GAG-CTTTTTAAGATAAATTACAGTAA--GTCAGAATCTCGTTGACTCGTACTGTCAGACAGTAAAATCCTAATGTTCAGACAT--AAGA---GAAATATTTAACACCACAAAACCCGAATTCTTGTTCCCTCCTGTATGAGGTCAGTCTTAACTAAAGCCAGTAAATAACTCTATAAATGACTT----CTTATAGATGCAGTTTT-AAAGTGTCAGTAGATGGAGTCAGAAGTTGAATGCTGGAGGGAAACGACGTGTGAAATGTCTGTACATGAATTTGCCTCAAACTAAATCCTCTGGACTTGTTGAGTGAACAGGTCGCTGTTTCTAAGTAGGAGTATGATTCTGCTCAATTGCATGTAAACAAACTAAATAGAAACTGCTAATTGCTAAACTATTGCAGCGTGTGGGAGATGTGGGAGGGAGTTGTGTAA---TACTGGCAT-------------GACTTGTCTCCCCACAG 'Nannoperca_australis_NAU11' TTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACCTTAATGTTGTTTCATATTCGTGTTTGTCTTTAATAAAGCACATTAAGTCTTGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGTTTGTTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGAGAGCAGCGTTAGCTACGACAAGAGAAAGTAGTAGTCTGAATACACAAAGCTTTGTGAACGAGTCGTTTCGTGTAAAATAAAACTAGTTACTGCCGTT-AGCCACGTGAAAC--TACAGCTAAAATGTAGCAGA--TAAATTACAACCAGCTAAGTTATTTTAGCTAGCTAATGTTCTTTCTGGCATAGCTCTAACTTTAATTCTAGCTAACAAGCGCTTTGTTTTT--AGAGGTTTCAGAATAAGTCTCTTTTTT-GACGTAGCTGTAAGTTTGTAATTTCTGTCCTTATCTGCTCCCTAAATTGGCTATCCTTGTGAGTTAGCCTGCTGCTACCAGTTAGCATCGAGTTGGTTTCCCTGGCGCAGTTCATGCTGGTTTTGAAGGAGGTCTTCCAGGATTCATGTGA-----------------GATGTCAGACTT-----ACCCG----CGCATGTAGCTCACATGTCTT--ATTTCTTTT--GCAGAGACATAGGCCGATCTCCCAGGTAAGAGGACCCGGATTCA----ATCATCACATCATGTCTTTTACTTTATTGTAGTTTTAGT----------CAACCTGCATGTAGA----TGCTGCTCATACTAAAATGGTGGTCGTTTGTAGTGCA----------GAGAC-TTTT-AGATAA------------GTCAGAATCACGTTGACTCGT-----CAGACAGTAAAATCCTAATGTTCAGACAT--CACA---GAAATATTTAACACCACAAAACTTGTATTCTTGTTCCCTCCTGTATG--GTCAGTCTTAACTAAAGCCAGTAAATAATTCTATAAATCACTTCATCATCATAG-----------------------------------------ATGCTGGAGGAAAACG--GTGTGAAGTGTCTCTACATAAATTTGTCTTATACTAAATCCTCT---------------------------------------------------------------------------------------ACTGTTAAACTGTTGCAGCGTGT---AAATGT--GAGGGAGTTGTGTAAAAATACAGGCGT-------------GACTTGTCTCCCTACAG 'Nannoperca_australis_NAU21' TTTCGCTGGAATGCTGTTTATCTTCCAAAATGTACCTTAATGTTGTTTCATATTCGTGTTTGTCTTTAATAAAGCACATTAAGTCTTGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGTTTTTTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGAGAGCAGCGTTAGCTACGACAAGAGAAAGTAGTAGTCTGAATACACAAAGCTTTGTGAACGAGTCGTTTCGTGTAAAATAAAACTAGTTACTGCCTTT-AGCCACGTGAAAC--TACAGCTAAAATGTAGCAGA--TAAATTACAACCAGCTAAGTTATTTTAGCTAGCTAATGTTCTTTCTGGCATAGCTCTAACTTTAATTCTAGCTAACAAGCGCTTTGTTTTT--AGAGGTTTCAGAATAAGTCTCTTTTTTTGACGTAGCTGTAAGTTTGTAATTTCTGTCCTTATCTGCTCCCTAAATTGGCTATCCTTGTGAGTTAGCCTGCTGCTACCAGTTAGCATCGAGTTGGTTTCCCTGGCGCAGTTCATGCTGGTTTTGAAGGAGGTCTTCCAGGATTCATGTGA-----------------GATGTCAGACTT-----ACCCG----CGCATGTAGCTCACATGTCTT--ATTTCTTTT--GCAGAGACATAGGCCGATCTCCCAGGTAAGAGGACCCGGATTCA----ATCATCACATCATGTCTTTTACTTTATTGTAGTTTTAGT----------CAACCTGCATGTAGA----TGCTGTTCATACTAAAATGGTGGTCGTTTGTAGTGCA----------GAGAC-TTTT-AGATAA------------GTCAGAATCACGTTGACTCGT-----CAGACAGTAAAATCCTAATGTTCAGACAT--CACA---GAAATATTTAACACCACAAAACTTGTGTTCTTGTTCCCTCCTGTATG--GTCAGTCTTAACTAAAGCCAGTAAATAATTCTATAAATCACTTCATCATCATAG-----------------------------------------ATGCTGGAGGAAAACG--GTGTGAAGTGTCTCTACATAAATTTGTCTTATACTAAATCCTCT---------------------------------------------------------------------------------------ACTGTTAAACTGTTGCAGCGTGT---AAATGT--GAGGGAGTTGTGTAAAAATACAGGCGT-------------GACTTGTCTCCCTACAG 'Nannoperca_australis_NAU22' TTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACCTTAATGTTGTTTCATATTCGTGTTTGTCTTTAATAAAGCACATTAAGTCTTGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGTTT{GT}TTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGT{CT}CAGAGAGCAGCGTTAGCTACGACAAGAGAAAGTAGTAGTCTGAATACACAAAGCTTTGTGAACGAGTCGTTTCGTGTAAAATAAAACTAGTTACTGCCTTT-AGCCACGTGAAAC--TACAGCTAAAATGTAGCAGA--TAAATTACAACCAGCTAAGTTATTTTAGCTAGCTAATGTTCTTTCTAGCATAGCTCTAACTTTAATTCTAGCTAACAAGCGCTTTGT{AT}TTT--AGAGGTTTCAGAATAAGTCTCTTTTTT-GACGTAGCTGTAAGTTTGTAATTTCTGTCCTTATCTGCTCCCTAAATTGGCTATCCTTGTGAGTTAGCCTGCTGCTACCAGTTAGCATCGAGTTGGTTTCCCTGGCGCAGTTCATGCTGGTTTTGAAGGAGGTCTTCCAGGATTCATGTGA-----------------GATGTCAGACTT-----ACCCG----CGCATGTAGCTCACATGTCTT--ATTTCTTTT--GCAGAGACATAGGCCGATCTCCCAGGTAAGAGGACCCGGATTCA----ATCATCACATCATGTCTTTTACTTTATTGTAGTTTTAGT----------CAACCTGCATGTAGA----TGCTGTTCATACTAAAATGGTGGTCGTTTGTAGTGCA----------GAGAC-TTTT-AGATAA------------GTCAGAATCACGTTGACTCGT-----CAGACAGTAAAATCCTAATGTTCAGACAT--CACA---GAAATATTTAACACCACAAAACTTGTATTCTTGTTCCCTCCTGTATG--GTCAGTCTTAACTAAAGCCAGTAAATAATTCTATAAATCACTTCATCATCATAG-----------------------------------------ATGCTGGAGGAAAACG--GTGTGAAGTGTCTCTACATAAATTTGTCTTATACTAAATCCTCT---------------------------------------------------------------------------------------ACTGTTAAACTGTTGCAGCGTGT---AAATGT--GAGGGAGTTGTGTAAAAATACAGGCGT-------------GACTTGTCTCCCTACAG 'Nannoperca_australis_NAU24' TTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACCTTAATGTTGTTTCATATTCGTGTTTGTCTTTAATAAAGCACATTAAGTCTTGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGTTT{GT}TTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGAGAGCAGCGTTAGCTACGACAAGAGAAAGTAGTAGTCTGAATACACAAAGCTTTGTGAACGAGTCGTTTCGTGTAAAATAAAACTAGTTACTGCCTTT-AGCCACGTGAAAC--TACAGCTAAAATGTAGCAGA--TAAATTACAACCAGCTAAGTTATTTTAGCTAGCTAATGTTCTTTCTGGCATAGCTCTAACTTTAATTCTAGCTAACAAGCGCTTTGTTTTT--AGAGGTTTCAGAATAAGTCTCTTTTTTTGACGTAGCTGTAAGTTTGTAATTTCTGTCCTTATCTGCTCCCTAAATTGGCTATCCTTGTGAGTTAGCCTGCTGCTACCAGTTAGCATCGAGTTGGTTTCCCTGGCGCAGTTCATGCTGGTTTTGAAGGAGGTCTTCCAGGATTCATGTGA-----------------GATGTCAGACTT-----ACCCG----CGCATGTAGCTCACATGTCTT--ATTTCTTTT--GCAGAGACATAGGCCGATCTCCCAGGTAAGAGGACCCGGATTCA----ATCATCACATCATGTCTTTTACTTTATTGTAGTTTTAGT----------CAACCTGCATGTAGA----TGCTGTTCATACTAAAATGGTGGTCGTTTGTAGTGCA----------GAGAC-TTTT-AGATAA------------GTCAGAATCACGTTGACTCGT-----CAGACAGTAAAATCCTAATGTTCAGACAT--CACA---GAAATATTTAACACCACAAAACTTGTGTTCTTGTTCCCTCCTGTATG--GTCAGTCTTAACTAAAGCCAGTAAATAATTCTATAAATCACTTCATCATCATAG-----------------------------------------ATGCTGGAGGAAAACG--GTGTGAAGTGTCTCTACATAAATTTGTCTTATACTAAATCCTCT---------------------------------------------------------------------------------------ACTGTTAAACTGTTGCAGCGTGT---AAATGT--GAGGGAGTTGTGTAAAAATACAGGCGT-------------GACTTGTCTCCCTACAG 'Nannoperca_australis_NAU28' TTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACCTTAATGTTGTTTCATATTCGTGTTTGTCTTTAATAAAGCACATTAAGTCTCGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGTTTGTTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGAGAGCAGCGTTAGCTACGACAAGAGAAAGTAGTAGTCTGAATACACAAAGCTTTGTGAACGAGTCGTTTCGTGTAAAATAAAACTAGTTACTGCCGTT-AGCCACGTGAAAC--TACAGCTAAAATGTAGCAGA--TAAATTACAACCAGCAAAGTTATTTTAGCTAGCTAATGTTCTTTCTGGCATAGCTCTAACTTTAATTCTAGCTAAGAAGCGCTTTGTTTTT--AGAGGTTTCAGAATAAGTCTCTTTTTT-GACGTGGCTGTAAGTTTGTAATTTCTGTCCTTAACTGCTCCCTATATTGGCTATCCTTGTGAGTTAGCCTGCTGCTACCGGTTAGCATCGAGTTGGTTTCCCTGGCGCAGTTCATGCTGGTTTTGAAGGAGGTCTTCCAGGATTCATGTGA-----------------GATGTCAGACTT-----ACCCG----CGCATGTAGCTCACATGTCTT--ATTTCTTTT--GCAGAGACATAGGCCGATCTCCCAGGTAAGAGGACCCGGATTCA----ATCATCACAT---GTCTTTTACGTTATTGTAGTTTTAGT----------CAACCTGCATGTAGA----TGCTGTTCATACTAAAATGGTGGTCGTTTGTAGTGCA----------GAGAC-TTT-AAGATAAATTACAGTAA--GTCAGAATCACGTTGACTCGT-----CAGAC---AAAATCCTAATGTTCAGACAT--CACA---GAAATATTTAACAACACAA--CTTGTATTCTTGTTCCCTCTTGTATG--GTCAGTCTTAACTAAAGCCAGTAAATAATTCTATAAATCACTTCATCATCATAG-----------------------------------------ATGCTGGAGGAAAACG--GTGTGAAGTGTCT--ACATAAATTTGTCTTATACTAAATCCTCT---------------------------------------------------------------------------------------ACTGTTAAACTGTTGCAGCGTGT---AAATGT--GAGGGAGTTGTGTAAAAATACAGGCGT-------------GACTTGTCTCCCTACAG 'Nannoperca_australis_NAU29' TTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACCTTAATGTTGTTTCATATTCGTGTTTGTCTTTAATAAAGCACATTAAGTCTCGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGTTTGTTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGAGAGCAGCGTTAGCTACGACAAGAGAAAGTAGTAGTCTGAATACACAAAGCTTTGTGAACGAGTCGTTTCGTGTAAAATAAAACTAGTTACTGCCGTT-AGCCACGTGAAAC--TACAGCTAAAATGTAGCAGA--TAAATTACAACCAGCTAAGTTATTTTAGCTAGCTAATGTTCTTTCTGGCATAGCTCAAACTTTAATTATATCTAAGAAGCGCTTTGTTTTT--AGAGGTTTCAGAATAAGTCTCT{AT}TTTT-GACGTGGCTGTAA{AG}TTTGTAATTTCTGTC{AC}TTAACTGCTCCCTATATTGGCTATCCTTGTGAGTTAGCCTGCTGCTACCGGTTAGCATCGAGTTGGTTTCCCTGGCGCAGTTCATGCTGGTTTTGAAGGAGGTCTTCCAGGATTCATGTGA-----------------GATGTCAGACTT-----ACCCG----CGCATGTAGCTCACATGTCTT--ATTTCTTTT--GCAGAGACATAGGCCGATCTCCCAGGTAAGAGGACCCGGATTCA----ATCATCACATCATGTCTTTTACGTTATTGTAGTTTTAGT----------CAACCTGCATGTAGA----TGCTGTTCATACTAAAATGGTGGTCGTTTGTAGTGCA----------GAGAC-TTT-AAGATAAATTACAGTAA--GTCAGAATCACGTTGACTCGT-----CAGAC---AAAATCCTAATGTTCAGACAT--CACA---GAAATATTTAACAACACAA--CTTGTATTCTTGTTCCCTCTTGTATG--GTCAGTCTTAACTAAAGCCAGTAAATAATTCTATAAATCACTTCATCATCATAG-----------------------------------------ATGCTGGAGGAAAACG--GTGTGAAGTGTCT--ACATAAATTTGTCTTATACTAAATCCTCT---------------------------------------------------------------------------------------ACTGTTAAACTGTTGCAGCGTGT---AAA{CT}GT--GAGGGAGTTGTGTAAAAATACAGGCGT-------------GACTTGTCTCCCTACAG 'Nannoperca_australis_NAU30' TTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACCTTAATGTTGTTTCATATTCGTGTTTGTCTTTAATAAAGCACATTAAGTCTCGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGTTTGTTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGAGAGCAGCGTTAGCTACGACAAGAGAAAGTAGTAGTCTGAATACACAAAGCTTTGTGAACGAGTCGTTTCGTGTAAAATAAAACTAGTTACTGCCGTT-AGCCACGTGAAAC--TACAGCTAAAATGTAGCAGAGATAAATTACAACCAGCTAAGTTATTTTAGCTAGCTAATGTTCTTTCTGGCATAGCTCAAACTTTAATTCTAGCTAAGAAGCGCTTTGTTTTT--AGAGGTTTCAGAATAAGTCTCTTTTTT-GACGTGGCTGTAAATTTGTAATTTCTGTCCTTAACTGCTCCCTATATTGGCTATCCTTGTGAGTTAACCTGCTGCTACCGGTTAGCATCGAGTTGGTTTCCCTGGCGCAGTTCATGCTGGTTTTGAAGGAGGTCTTCCAGGATTCATGTGA-----------------GATGTCAGACTT-----ACCCG----CGCATGTAGCTCACATGTCTT--ATTTCTTTT--GCAGAGACATAGGCCGATCTCCCAGGTAAGAGGACCCGGATTCA----ATCATCACATCATGTCTTTTACGTTATTGTAGTTTTAGT----------CAACCTGCATGTAGA----TGCTGTTCATACTAAAATGGTGGTCGTTTGTAGTGCA----------GAGAC-TTT-AAGATAAATTACAGTAA--GTCAGAATCACGTTGACTCGT-----CAGAC---AAAATCCTAATGTTCAGACAT--CACA---GAAATATTTAACAACACAA--CTTGTATTCTTGTTCCCTCTTGTATG--GTCAGTCTTAACTAAAGCCAGTAAATAATTCTATAAATCACTTCATCATCATAG-----------------------------------------ATGCTGGAGGAAAACG--GTGTGAAGTGTCT--ACATAAATTTGTCTTATACTAAATCCTCT---------------------------------------------------------------------------------------ACTGTTAAACTGTTGCAGCGTGT---AAATGT--GAGGGAGTTGTGTAAAAATACAGGCGT-------------GACTTGTCTCCCTACAG 'Nannoperca_australis_NAU9' TTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACCTTAATGTTGTTTCATATTCGTGTTTGTCTTTAATAAAGCACATTAAGTCTTGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGTTTGTTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGAGAGCAGCGTTAGCTACGACAAGAGAAAGTAGTAGTCTGAATACACAAAGCTTTGTGAACGAGTCGTTTCGTGTAAAATAAAACTAGTTACTGCCTTT-AGCCACGTGAAAC--TACAGCTAAAATGTAGCAGA--TAAATTACAACCAGCTAAGTTATTTTAGCTAGCTAATGTTCTTTCTAGCATAGCTCTAACTTTAATTCTAGCTAACAAGCGCTTTGTTTTT--AGAGGTTTCAGAATAAGTCTCTTTTTT-GACGTAGCTGTAAGTTTGTAATTTCTGTCCTTATCTGCTCCCTAAATTGGCTATCCTTGTGAGTTAGCCTGCTGCTACCGGTTAGCATCGAGTTGGTTTCCCTGGCGCAGTTCATGCTGGTTTTGAAGGAGGTCTTCCAGGATTCATGTGA-----------------GATGTCAGACTT-----ACCCG----CGCATGTAGCTCACATGTCTT--ATTTCTTTT--GCAGAGACATAGGCCGATCTCCCAGGTAAGAGGACCCGGATTCA----ATCATCACATCATGTCTTTTACTTTATTGTAGTTTTAGT----------CAACCTGCATGTAGA----TGCTGTTCATACTAAAATGGTGGTCGTTTGTAGTGCA----------GAGAC-TTTT-AGATAA------------GTCAGAATCACGTTGACTCGT-----CAGACAGTAAAATCCTAATGTTCAGACAT--CACA---GAAATATTTAACACCACAAAACTTGTGTTCTTGTTCCCTCCTGTATG--GTCAGTCTTAACTAAAGCCAGTAAATAATTCTATAAATCACTTCATCATCATAG-----------------------------------------ATGCTGGAGGAAAACG--G{CT}GTGAAGTGTCTCTACATAAATTTGTCTTATACTAAATCCTCT---------------------------------------------------------------------------------------ACTGTTAAACTGTTGCAGCGTGT---AAATGT--GAGGGAGTTGTGTAAAAATACAGGCGT-------------GACTTGTCTCCCTACAG 'Nannoperca_obscura_NOB17' CTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACCTTAATGTTGTTTGATATTCGTGTTTGTCTTTAATAAAGCACCTTCAGTCTCGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGTTTGTTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGAGAGCAGCGTTAGCAACGACAAGACAAAGTAGT---CTGAATACACA--GCTTTGTGAACGAGTCGTTTTGTGTAAAATAAAACTAGTTAATGCTGTT-AGCCACGTGAAAC--TACAGCTTAAGTTTAGCAGAGATAAATGACAACCAGCTAAGTTATTTTAGCTAGCTAACGTTCCTTCTAGCATAGCTCTAACTTTAATTCTAGCTAACAAGCGCTTTGTTTTT--AGAGGTTTCAGAGTAAGT---TTTTT-CCACGCGGCTGTAAGTTTGTAATTTCTGTCCAAAACTGCTCCTTATATTGGCTATCCTTGAGAGTTAGCCTGCTGCTACCGGTAAGCATCGAGTTGGTTTCCCTGGCGCAGTTCATGCTGGTTTTAAAGGAGGTCTTCCAGGATTCATCTGA-----------------GATGTCAGACTT-----ACCTG----CGCATGTAACCCACATGTCTT--ATTTCCTTT--GCAGAGACATAGGCCGATCTCCCAGGTAAGAGGGCCCGGATTCA----ATCATCAAATCCTGTCTTTTACTTTATTGTAGGTTTAGT----------AAACCTGCATGTAGA----TGCTGTTCATACTAAAAT---TGTCGTTTGTAGTGCA----------GAGAC---TTAAGATAAATTGCAGTAA--GTCAGAATCACGTTGACTCAT-----CAGACAGTAAAATCCTAATGTTCAGACAT--CACA---GAAATATTTAACACCACAA--CTTGTATTCTTGTTCCCTCCTGTATGAGGTCAGTCTTGACTAAAGCCAGTAAATAATTCTATAAATCACTT-------ACAG-----------------------------------------ATGCTGGAGGAAAACG--GTGTGAAGTGTCTCTACATAAATTTGTCTTATACTAAACCCTCT---------------------------------------------------------------------------------------ACTGTTAAACTGTTGCAGCGTGT---AAATGT--G-------------------CAGGCGT-------------GACTTGTCTCCCTACAG 'Nannoperca_obscura_NOB21' CTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACCTTAATGTTGTTTGATATTCGTGTTTGTCTTTAATAAAGCACCTTCAGTCTCGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGTTTGTTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGAGAGCAGCGTTAGCAACGACAAGACAAAGTAGT---CTGAATACACA--GCTTTGTGAACGAGTCGTTTTGTGTAAAATAAAACTAGTTAATGCTGTT-AGCCACGTGAAAC--TACAGCTTAAGTTTAGCAGAGATAAATGACAACCAGCTAAGTTATTTTAGCTAGCTAACGTTCCTTCTAGCATAGCTCTAACTTTAATTCTAGCTAACAAGCGCTTTGTTTTT--AGAGGTTTCAGAGTAAGT---TTTTT-CCACGCGGCTGTAAGTTTGTAATTTCTGTCCAAAACTGCTCCTTATATTGGCTATCCTTGAGAGTTAGCCTGCTGCTACCGGTAAGCATCGAGTTGGTTTCCCTGGCGCAGTTCATGCTGGTTTTAAAGGAGGTCTTCCAGGATTCATCTGA-----------------GATGTCAGACTT-----ACCTG----CGCATGTAACCCACATGTCTT--ATTTCCTTT--GCAGAGACATAGGCCGATCTCCCAGGTAAGAGGGCCCGGATTCA----ATCATCAAATCCTGTCTTTTACTTTATTGTAGGTTTAGT----------AAACCTGCATGTAGA----TGCTGTTCATACTAAAAT---TGTCGTTTGTAGTGCA----------GAGAC---TTAAGATAAATTGCAGTAA--GTCAGAATCACGTTGACTCAT-----CAGACAGTAAAATCCTAATGTTCAGACAT--CACA---GAAATATTTAACACCACAA--CTTGTATTCTTGTTCCCTCCTGTATGAGGTCAGTCTTGAC{CT}AAAGCCAGTAAATAATTCTATAAATCACTT-------ACAG-----------------------------------------ATGCTGGAGGAAAACG--GTGTGAAGTGTCTCTACATAAATTTGTCTTATACTAAACCCTCT---------------------------------------------------------------------------------------ACTGTTAAACTGTTGCAGCGTGT---AAATGT--G-------------------CAGGCGT-------------GACTTGTCTCCCTACAG 'Nannoperca_obscura_NOB26' CTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACCTTAATGTTGTTTGATATTCGTGTTTGTCTTTAATAAAGCACCTTCAGTCTCGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGTTTGTTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGAGAGCAGCGTTAGCAACGACAAGACAAAGTAGT---CTGAATACACA--GCTTTGTGAACGAGTCGTTTTGTGTAAAATAAAACTAGTTAATGCTGTT-AGCCACGTGAAAC--TACAGCTTAAGTTTAGCAGAGATAAATGACAACCAGCTAAGTTATTTTAGCTAGCTAACGTTCCTTCTAGCATAGCTCTAACTTTAATTCTAGCTAACAAGCGCTTTGTTTTT--AGAGGTTTCAGAGTAAGT---TTTTTTCCACGCGGCTGTAAGTTTGTAATTTCTGTCCAAAACTGCTCCTTATATTGGCTATCCTTGAGAGTTAGCCTGCTGCTACCGGTTAGCATCGAGTTGGTTTCCCTGGCGCAGTTCATGCTGGTTTTAAAGGAGGTCTTCCAGGATTCATCTGA-----------------GATGTCAGACTT-----ACCTG----CGCATGTAACCCACATGTCTT--ATTTCCTTT--GCAGAGACATAGGCCGATCTCCCAGGTAAGAGGGCCCGGATTCA----ATCATCAAATCCTGTCTTTTACTTTATTGTAGGTTTAGT----------AAACCTGCATGTAGA----TGCTGTTCATACTAAAAT---TGTCGTTTGTAGTGCA----------GAGAC---TTAAGATAAATTGCAGTAA--GTCAGAATCACGTTGACTCAT-----CAGACAGTAAAATCCTAATGTTCAGACAT--CACA---GAAATATTTAACACCACAA--CTTGTATTCTTGTTCCCTCCTGTATGAGGTCAGTCTTGACTAAAGCCAGTAAATAATTCTATAAATCACTT-------ACAG-----------------------------------------ATGCTGGAGGAAAACG--GTGTGAAGTGTCTCTACATAAATTTGTCTTATACTAAACCCTCT---------------------------------------------------------------------------------------ACTGTTAAACTGTTGCAGCGTGT---AAATGT--G-------------------CAGGCGT-------------GACTTGTCTCCCTACAG 'Nannoperca_obscura_NOB7' CTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACCTTAATGTTGTTTGATATTCGTGTTTGTCTTTAATAAAGCACCTTCAGTCTCGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGTTTGTTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGAGAGCAGCGTTAGCAACGACAAGACAAAGTAGT---CTGAATACACA--GCTTTGTGAACGAGTCGTTTTGTGTAAAATAAAACTAGTTAATGCTGTT-AGCCACGTGAAAC--TACAGCTTAAGTTTAGCAGAGATAAATGACAACCAGCTAAGTTATTTTAGCTAGCTAACGTTCCTTCTAGCATAGCTCTAACTTTAATTCTAGCTAACAAGCGCTTTGTTTTT--AGAGGTTTCAGAGTAAGT---TTTTT-CCACGCGGCTGTAAGTTTGTAATTTCTGTCCAAAACTGCTCCTTATATTGGCTATCCTTGAGAGTTAGCCTGCTGCTACCGGTAAGCATCGAGTTGGTTTCCCTGGCGCAGTTCATGCTGGTTTTAAAGGAGGTCTTCCAGGATTCATCTGA-----------------GATGTCAGACTT-----ACCTG----CGCATGTAACCCACATGTCTT--ATTTCCTTT--GCAGAGACATAGGCCGATCTCCCAGGTAAGAGGGCCCGGATTCA----ATCATCAAATCCTGTCTTTTACTTTATTGTAGGTTTAGT----------AAACCTGCATGTAGA----TGCTGTTCATACTAAAAT---TGTCGTTTGTAGTGCA----------GAGAC---TTAAGATAAATTGCAGTAA--GTCAGAATCACGTTGACTCAT-----CAGACAGTAAAATCCTAATGTTCAGACAT--CACA---GAAATATTTAACACCACAA--CTTGTATTCTTGTTCCCTCCTGTATGAGGTCAGTCTTGACTAAAGCCAGTAAATAATTCTATAAATCACTT-------ACAG-----------------------------------------ATGCTGGAGGAAAACG--GTGTGAAGTGTCTCTACATAAATTTGTCTTATACTAAACCCTCT---------------------------------------------------------------------------------------ACTGTTAAACTGTTGCAGCGTGT---AAATGT--G-------------------CAGGCGT-------------GACTTGTCTCCCTACAG 'Nannoperca_oxleyana_NOX31' TTTCGCTGGACTGCTGTTTATCTTCCTAAATGTACCTTAATGTTGTTTGATATTCGTGTTTGTCCTTAATAAAGCACCTTAAGCCTCGGATACTTTAGATTATGTGGCTTGTGGGGACGGATGGTTTGTTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGAGAGCAGCGTTAGCAACGACAAAAGAAAGTAGT---CTGAATACACAGGGCTTTGTGGACGAGTCGTCTAATGTAAAATAAAATTAGTTATTGCTGTT-CGCCACGTGAAAC--TACAGCTAAAATGTAGCAGAGATAAATGACAACCAGCTAAGTTACTTTCGCCAGCTAACGTTCCTTCTAGCATAGCTCCAACTTTAATTCTAGCTAACAAGCGCTTTGTTTTT--AGAGGTTTCAGAGTAAGTTTCATTT--CCACGGGGCTGTAAGTTTATAATTTCTGTTCAAAACTGCTCCCTATATTGGCTATCCT--TGAGTTAGCCTGCTGCTACCGGTTAGCATCGAGTTGGTTTCCCTGGCGCAGTTAATGCTGGTTTTGAAGGAGGTCTTCAAGGATTCATGTGA-----------------GATGTCAGACTT-ACAGACCTG----TGCATGTAACCCACATGTCTT--ATTTCCTTT--GCAGAGACATAGGCCGATCTCCCAGGTAAGAGGACCTGGATTCA----ATCATCAAATCCTGTCTTTTACTTTATTGTAGGTTTAGT----------AAACCTGCATGTAGA----TGCTGTTCATACTAAAATTATGGTCGTTTGTAGTGCA----------GAGAC---TTAACATAAATTGCAGTAA--GTCAGAATCACATTGATTCGT-----CAGACAGTACAAACCTTATGTTCAGACAT--CACA---GAAATATTTAACACCACAAAACTTTTATTGTTGTTTCCTCCTGTATGAGGTCAGTCTTAACTAAAGCCAGTAAATAATTCTATAAATCACTT-------ATAG-----------------------------------------ATGCTGGAGGAAAACG--GTGTGAAGTGTCTCTACATAAATTT----TATACTAAACCCTCT---------------------------------------------------------------------------------------ACTGTTAAACTGTTGCAGCGTGT---AAATGT--GAGGGAGTTGTGTAAAAATACAGGTGT-------------GCCTTGTCTCCCTACAG 'Nannoperca_oxleyana_NOX34' TTTCGCTGGACTGCTGTTTATCTTCCTAAATGTACCTTAATGTTGTTTGATATTCGTGTTTGTCCTTAATAAAGCACCTTAAGCCTCGGATACTTTAGATTATGTGGCTTGTGGGGACGGATGGTTTGTTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGAGAGCAGCGTTAGCAACGACAAGAGAAAGTAGT---CTGAATACACAGGGCTTTGTGGACGAGTCGTCTAATGTAAAATAAAATTAGTTATTGCTGTT-CGCCACGTGAAAC--TACAGCTAAAATGTAGCAGAGATAAATGACAACCAGCTAAGTTACTTTCGCCAGCTAACGTTCCTTCTAGCATAGCTCCAACTTTAATTCTAGCTAACAAGCGCTTTGTTTTT--AGAGGTTTCAGAGTAAGTTTCATTT--CCACGGGGCTGTAAGTTTATAATTTCTGTTCAAAACTGCTCCCTATATTGGCTATCCT--TGAGTTAGCCTGCTGCTACCGGTTAGCATCGAGTTGGTTTCCCTGGCGCAGTTAATGCTGGTTTTGAAGGAGGTCTTCAAGGATTCATGTGA-----------------GATGTCAGACTT-ACAGACCTG----TGCATGTAACCCACATGTCTT--ATTTCCTTT--GCAGAGACATAGGCCGATCTCCCAGGTAAGAGGACCTGGATTCA----ATCACCAAATCCTGTCTTTTACTTTATTGTAGGTTTAGT----------AAACCTGCATGTAGA----TGCTGTTCATACTAAAATTATGGTCGTTTGTAGTGCA----------GAGAC---TTAACATAAATTGCAGTAA--GTCAGAATCACATTGATTCGT-----CAGACAGTACAAACCTTATGTTCAGACAT--CACA---GAAATATTTAACACCACAAAACTTTTATTGTTGTTTCCTCCTGTATGAGGTCAGTCTTAACTAAAGCCAGTAAATAATTCTATAAATCACTT-------ATAG-----------------------------------------ATGCTGGAGGAAAACG--GTGTGAAGTGTCTCTACATAAATTT----TATACTAAACCCTCT---------------------------------------------------------------------------------------ACTGTTAAACTGTTGCAGCGTGT---AAATGT--GAGGGAGTTGTGTAAAAATACAGGTGT-------------GCCTTGTCTCCCTACAG 'Nannoperca_variegata_NVAR18' TTTCGCTGGACTGCTGTTTATATTCCAAAATGTACCTTAATGTTGTTTGATATTTCTGTTTGTCTTTAATAAA-CCCCTTATATCTTGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGCTTGTCTATGTCACAAAATCCAGCGTAGTAGAGATTCACCCCGGCGAAGGGGTTCTTGTAACGGGGAACAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCTTTAGCAACGACAAGAGAAAGTATTGGTCTGCATACACAGAGCTTTGTGAACGAGTCGTTTCATGTAAAATAAAACTAGTTACTGCTGTT-AGCCACGTGAAAC--TACAGCTAAAATGTAGCAGTGATAAATGACAACCAGCTAAGTTATTTTAGCTAGCTAACGTTCCTTCTAGCTTAGCTCTCACTTTAATTGTAGCTAACATGCACTTTGTTTTT--AGAGGTTTCAGAGTAAGTGTCTGTTT--CACGTGGCTGTAAGCTTGTAATTTCTGTC--AAACTCTTCCCTACATTGGCTATCCTAGTGAGTTAGCCTGCTGCTACCGGTTAGCATCGAGTTAGTTTCCCAGGCGCGGTTCATGCTGGTTGTGAAGGAGCTCTTCCAGGATTCAGGTGAAGCCAGGCGTCCTAGGAGATGCTAGATATCCTAGACCTG----CGCATGTAACCCGCATGTCTTTTATTTCTGTTTTGCAGAGACATAGGCCGATCTCCCAGGTAAGAGCACCGGTTTTCA----ATCATCGAATCAAGTCTTTCACTTTATTGTACTTT-AGT----------CAACCTCCATGTAGA----TGCTGTTCATGCTAAAATGGTAGTAGTTTGTGGTGCA----------GAGA---TTTAAGATAAATTACAGTAA--GTCAGAATCGCGTTGACTTTTACTGTC--ACAGTAAAATCCGTATGTGCAGACAT--CACA-GAGAAACATTTAACACAGCAAAACGTGTGTTCTTGGTCCCTCCTGTATGAAGTCAGCCTTAACTAAAGCCAGTAAATAATTCTATAAATGACTT------TATAGATGCAGTTTT-AAAGTGTCAGT----------TGAAGTTGAATGCTGGAGGGAAACGA----TGAAATGTCT--ACATGAATTTGCCTTATACTAAATCCTCTGGACTTGTTGACTGAATGGGTCGCTGTTGTTAAGCGGGAGTCAGATTCT---CGGTTGCACGTGAAC----TGAAGAGAAGCCGGTAATTGTTAAACTATTGCAGCGTGT---AAATGT--GAGGGAGTTGATT--------AGACGT-------------GACTTGTCTCCCTACAG 'Nannoperca_variegata_NVAR19' TTTCGCTGGACTGCTGTTTATATTCCAAAATGTACCTTAATGTTGTTTGATATTTCTGTTTGTCTTTAATAAA-CCCCTTATATCTTGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGCTTGTCTATGTCACAAAATCCAGCGTAGTAGAGATTCACCCCGGCGAAGGGGTTCTTGTAACGGGGAACAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCTTTAGCAACGACAAGAGAAAGTATTGGTCTGCATACACAGAGCTTTGTGAACGAGTCGTTTCATGTAAAATAAAACTAGTTACTGCTGTT-AGCCACGTGAAAC--TACAGCTAAAATGTAGCAGTGATAAATGACAACCAGCTAAGTTATTTTAGCTAGCTAACGTTCCTTCTAGCTTAGCTCTCACTTTAATTGTAGCTAACATGCACTTTGTTTTT--AGAGGTTTCAGAGTAAGTGTCTGTTT--CACGTGGCTGTAAGCTTGTAATTTCTGTC--AAACTCTTCCCTACATTGGCTATCCTAGTGAGTTAGCCTGCTGCTACCGGTTAGCATCGAGTTAGTTTCCCAGGCGCGGTTCATGCTGGTTGTGAAGGAGCTCTTCCAGGATTCAGGTGAAGCCAGGCGTCCTAGGAGATGCTAGATATCCTAGACCTG----CGCATGTAACCCGCATGTCTTTTATTTCTGTTTTGCAGAGACATAGGCCGATCTCCCAGGTAAGAGCACCGGTTTTCA----ATCATCGAATCAAGTCTTTCACTTTATTGTACTTT-AGT----------CAACCTCCATGTAGA----TGCTGTTCATGCTAAAATGGTAGTAGTTTGTGGTGCA----------GAGA---TTTAAGATAAATTACAGTAA--GTCAGAATCGCGTTGACTTTTACTGTC--ACAGTAAAATCCGTATGTGCAGACAT--CACA-GAGAAACATTTAACACAGCAAAACGTGTGTTCTTGGTCCCTCCTGTATGAAGTCAGCCTTAACTAAAGCCAGTAAATAATTCTATAAATGACTT------TATAGATGCAGTTTT-AAAGTGTCAGT----------TGAAGTTGAATGCTGGAGGGAAACGA----TGAAATGTCT--ACATGAATTTGCCTTATACTAAATCCTCTGGACTTGTTGACTGAATGGGTCGCTGTTGTTAAGCGGGAGTCAGATTCT---CGGTTGCACGTGAAC----TGAAGAGAAGCCGGTAATTGTTAAACTATTGCAGCGTGT---AAATGT--GAGGGAGTTGATT--------AGACGT-------------GACTTGTCTCCCTACAA 'Nannoperca_vittata_NVI1' TTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACCTAAATGTTGTTTGATATTCGTGTTCGTCTTTAATAAAGCACCTTAAGTCTCGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGTTTGTTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGTTAGCAACGACAAGAGAAAGTAGT---CTGAATACACAAAGCTTTGTGAACGAGTCGTTTCATGTAAAATCAAACTAGTTACTGCTGTT-AGCCACGTGAAAC--TACAGCTAAAACGTAGCAGAGATAAATGACAACCAGCTAAGTTATTTTAGCTAGCTAACGTTCCTTGTAGCCTAGCTCTAACTTTAATTCTAGCTAACAAGCACTTTG-TTTT--AGAGATTTCAGAGTAGGTTTCTTTT--CCACGTTGCTGTAAATTTGTAATTTCTTTC--AAACAGTTCCCTATATTGGCTATCCTAGTGAGTTAGCATGCTGCTACCGGTTAGCATCGAGTTGGTTTCCCTGGCGCAGTTCATGCTGGTTTTGAAGGAGGTCTTCTAGGATTCATGTGA-----------------GATGTCAGACTT-----ACCTG----CGCATGTAACCCACATGTCTTTTATTTCTCTTTTGNAGAGACATAGGCCGATCTCCCAGGTAAGAG-------TTTCA----ATCA---AATCATGTCTTTTACTTTATAGTAGTTTTAGT----------CAACCTGCATTTAGA----TGCTGTTCATACTAAAATTCCAGTTGTTTGTAGTGCA----------GAGAC-TTTTAAGATGAATTACAGTAA--GTCAGAATTGCATTGACTCGTACTGTCAGACAGTAAAATCCTAATGTTCAGACAT--CACA-----AATATTTAACACCACAAAACCTGTATTCTTGTTCCCTCCTGTATGAGGTCAGTCTTAAATAAAGCCAGTAAATAATTCTATAAATCACTT----ATTATAG-----------------------------------------ATGCTGGAGAAAAACG--GTGTGAAGTGTCT--ACATAAATTTGCCTTATACGAAGTCCTCTGG-------------------------------------------------------------------------------------ACTCTTAAACTGTTGCAGCGTGT---AAATGT--GAGGGAGTTGTGTAAAAATACAGGCGT-------------GACTTGTGTCCCTACAG 'Nannoperca_vittata_NVI2' TTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACCTAAATGTTGTTTGATATTCGTGTTCGTCTTTAATAAAGCACCTTAAGTCTCGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGTTTGTTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTCCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGTTAGCAACGACAAGAGAAAGTAGT---CTGAATACACAAAGCTTTGTGAACGAGTCGTTTCATGTAAAATCAAACTAGTTACTGCTGTT-AGCCACGTGAAAC--TACAGCTAAAACGTAGCAGAGATAAATGACAACCAGCTAAGTTATTTTAGCTAGCTAACGTTCCTGGTAGCCTAGCTCAAACTTTAATTCTAGCTAACAAGCACTTTG-TTTT--AGAGGTTTCAGAGTAGGTTTCTTTT--CCACGTGGCTGTAAATTTGTAATTTCTGTC--AAACAGTTCCCTATATTGGCTATCCTAGTGAGTTAGCCTGCTGCTACCGGTTAGCATCGAGTTGGTTTCCCTGGCGCAGTTCATGCTGGTTTTGAAGGAGGTCTTCTAGGATTCATGTGA-----------------GATGTCAGACTT-----ACCTG----CGCATGTAACCCACATGTCTTTTATTTCTCTTTTGCAGAGACATAGGCCGATCTCCCAGGTAAGAG-------TTTCA----ATCA---AATCATGTCTTTTACTTTATAGTAGTTTTAGT----------{CT}AACCTGCATGTAGA----TGCTGTTCATACTAAAATTCCAGTTGTTTGTA{GT}TGCA----------GAGAC-TTTTAAGATGAATTACAGTAA--GTCAGAATTGCATTGACTCGTACTGTC--ACAGTAAAATCCTAATGTTCAGACAT--CACA-----NNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGTTCCCTCCTGTATGAGGTCAGTCTTAAATAAAGCCAGTAAATAATTCTA{AT}AAATCACTT----ATTATAG-----------------------------------------ATGCTGGAGAAAAACG--GTGT{CG}AAGTGTCT--ACATAAATTTGCCTTATAC{GT}AAGTCCTCTGG-------------------------------------------------------------------------------------{AT}CT{CG}TTAAACTGTTGCAGCGTGT---AAATGT--GAGGGAGTTGTGTAAAAATACAGGCGT-------------GACTTGTGTCCCTACAG 'Nannoperca_vittata_NVI3' TTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACCTAAATGTTGTTTGATATTCGTGTTCGTCTTTAATAAAGCATCTTAAGTCTCGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGTTTGTTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTGCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGTTAGCAACGACAAGAGAAAGTAGT---CTGAATACACAAAGCTTTGTGAACGAGTCGTTTCATGTAAAATCAAACTAGTTTCTGCTGTT-AGCCACGTGAAAC--TACAACTAAAACGTAGCAGAGATAAATGACAACCAGCTAAGTTATTTTAGCTAGCTAACGTTCCTGGTGGCCTAGCTCTAACTTTAATTCTAGCTAACAAGCACTTTG-TTTT--AGAGGTTTCAGAGTAGGTTTCTTTT--CCATGTGGCTGTAAATTTGTAATTTCTGTC--AAACAGTTTCCTATATTGGCTATCCTAGTGAGTTAGCCTGCTGCTACCGGTTAGCATCGAGTTGGTTTCCCTGGCGCAGTTCATGCTGGTTTTGAAGGAGGTCTTCTAGGATTCATGTGA-----------------GATGTCAGACTT-----ACCTG----CGCATGTAACCCACATGTCTTTTATTTCTCTTTTGCAGAGACATAGGCCGATCTCCCAGGTAAGAG-------TTTCA----ATCA---AATGATGTCTTTTACTTTATAGTAATTTTAGT----------CAACCTGCATGTAGA----TGCTGTTCATACTAAAATTGTAGTTGTTTGTAGTGCA----------GAGAC---TTAAGATAAATTACAGTAA--GTCA--TTTGCGTTG-----TACTGTC--ACAGTAAAATCCTAATGTTCAGACAT--CACA----AATATTTAACACCACA-----CCAAA-CCTTGTTCCCTCCTGTATGATGTCAGTCTTAACTAAAGCCAGTAAATAATTCTATAAATCACTT----ATTATAG-----------------------------------------ATGCTGGAGGAAAACG--GTGTGAA---------------TTTGCCTTATACTAAATCCTCTGG-------------------------------------------------------------------------------------ACTGTTAAACTGTTGCAGCGTGT---AAATGT--GAGGGAGTTGTGT------------------------------------CCCTACAG 'Nannoperca_vittata_NVI6' TTTCGCTGGACTGCTGTTTATCTTCCAAAATGTACCTAAATGTTGTTTGATATTCGTGTTCGTCTTTAATAAAGCATCTTAAGTCTCGGATACTTTAGATTATGTGGTTTGTGGGGACGGATGGTTTGTTTATGTCACAAAATCCAGCGTAGTAGAGATTCACTGCGGTGAATGGGTTCTTGTAACGGGGAATAGTTAGCAGGCCGTGCATGTGTTCAGATAGCAGCGTTAGCAACGACAAGAGAAAGTAGT---CTGAATACACAAAGCTTTGTGAACGAGTCGTTTCATGTAAAATCAAACTAGTTTCTGCTGTT-AGCCACGTGAAAC--TACAACTAAAACGTAGCAGAGATAAATGACAACCAGCTAAGTTATTTTAGCTAGCTAACGTTCCTGGTGGCCTAGCTCTAACTTTAATTCTAGCTAACAAGCACTTTG-TTTT--AGAGGTTTCAGAGTAGGTTTCTTTT--CCATGTGGCTGTAAATTTGTAATTTCTGTC--AAACAGTTTCCTATATTGGCTATCCTAGTGAGTTAGCCTGCTGCTACCGGTTAGCATCGAGTTGGTTTCCCTGGCGCAGTTCATGCTGGTTTTGAAGGAGGTCTTCTAGGATTCATGTGA-----------------GATGTCAGACTT-----ACCTG----CGCATGTAACCCACATGTCTTTTATTTCTCTTTTGCAGAGACATAGGCCGATCTCCCAGGTAAGAG-------TTTCA----ATCA---AATGATGTCTTTTACTTTATAGTAATTTTAGT----------CAACCTGCATGTAGA----TGCTGTTCATACTAAAATTGTAGTTGTTTGTAGTGCA----------GAGAC---TTAAGATAAATTACAGTAA--GTCA--TTTGCGTTG-----TACTGTC--ACAGTAAAATCCTAATGTTCAGACAT--CACA----AATATTTAACACCACA-----CCAAA-CCTTGTTCCCTCCTGTATGATGTCAGTCTTAACTAAAGCCAGTAAATAATTCTATAAATCACTT----ATTATAG-----------------------------------------ATGCTGGAGGAAAACG--GTGTGAA---------------TTTGCCTTATACTAAATCCTCTGG-------------------------------------------------------------------------------------ACTGTTAAACTGTTGCAGCGTGT---AAATGT--GAGGGAGTTGTGT------------------------------------CCCTACAG ; END;