#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on September 25, 2020; 23:30 GMT TreeBASE (cc) 1994-2008 Study reference: Blanco O., Crespo A., Divakar P.K., Elix J., & Lumbsch H. 2004. Molecular phylogeny of parmotremoid lichens (Ascomycota, Parmeliaceae). Mycologia, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1170] BEGIN TAXA; TITLE combined; DIMENSIONS NTAX=30; TAXLABELS Canomaculina_pilosa Canomaculina_subcaperata Canomaculina_subtinctoria Canoparmelia_crozalsiana Canoparmelia_haitiensis Concamarella_fistulata Flavoparmelia_aff._caperata Flavoparmelia_baltimorensis_1 Flavoparmelia_baltimorensis_2 Flavoparmelia_caperata Flavoparmelia_flaventior_1 Flavoparmelia_flaventior_2 Flavoparmelia_soredians Parmelaria_subthomsonii Parmotrema_chinense Parmotrema_crinitum Parmotrema_hypoleucinum Parmotrema_perforatum Parmotrema_robustum Parmotrema_tinctorum Punctelia_borreri Punctelia_pseudocoralloidea Punctelia_rudecta Punctelia_rudecta_2 Punctelia_subflava Punctelia_subrudecta Rimelia_cetrata Rimelia_clavulifera Rimelia_pseudoreticulata Rimelia_reticulata ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2489] TITLE combined; LINK TAXA = combined; DIMENSIONS NCHAR=1892; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=- GAP= #; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Canomaculina_pilosa GAGGAATGTATAGCAATAGCTACTTGTATCATT-----AATGATGCAAGCTCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTA----AAAGAATAAAAGGGACTAATTCGCTAGAGTTACTTACGAGGGGGCTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAGAATAACGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCATGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGACGTCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACTGAGAGAGGGGCTTCGCGCTCCCGGGGGTCTCGGCCCCCAACTCTTCACCCTATGTGTACCTACCTTTGTTGCTTTGACGGACCTCGGGGGCCTCCTCCGCACCGGTCTTCGGGTCGGTGAGCGTCCGTCAGAGGCCTATCTAAATCCTGTTTATCAGTGTCGTCCGAGTACAATA--T-AAATAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCTTGGCTTGGTATTGGGTCCTCGCCCCCGCGGCGTGCCCGAAAAGCAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAATTTCAATCCCGCTTTGAAAGTTCGCGTCGTGGCCTGCCAGGCAACACCACGTAGTCCAATAAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGCGACCGTGGATCGAACCCATGTGAAACCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACCTGCCCGCAGACGATCAACCGCTGTTCTCAGCGGTGCACTCGTGCTGCGATCAGGCCAGTATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTCTCTTTCGGGGGAGTTTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGGTAGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Canomaculina_subcaperata GAGGAATGTATAGCAATAGCTACTTGTATCATTATAGTAATGATACAAGCTCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAGTCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTC-AATAAATAAAAAAAGGGACTAATTCGCTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAGAATTATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCATGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGATGTCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACTGAGAGAGGGGCTTCGCGCTCCCGGGGGTCTCGGCCCCCACCTCTTCACCCTGTGTGTACCTACCTTTGTTGCTTTGGCGGACCTCGGGGTCTTCCTCCGCACCGCCTTT-GGGTCGGTGAGCGTCCGTCAGAGGTCCATTTAATTCCGTCTTATCAGTGTCGTCCGAGTACAAAAC-AAAATAAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTATTGGGCCTTCGCCCCTGCGGCGTGCCCGAAACGCAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAAAACTTATCCCGCTTTGAAAGATCGCGTCGTGGCTCGCCAGGCAACCCCACGTATTCCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGACTGCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGTGACCGCGGATCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGACGATCAGCCGCTGTTCTCAGCGGTGCACTCGTTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCTCGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Canomaculina_subtinctoria GAGGAATGTATAGCAATAGCTACTTGTATCATT-----AATGATGCAAGCTCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTAAAATAAAGAATAAAAGGGACTAATTCGCTAGAGTTACTTACGAGGGGGCTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAGAATAACGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCATGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGACGTCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACTGAGAGAGGGGCTTCGCGCTCCCGGGGGTCTCGGCCCCCATCTCCTCACCCTGTGTGTATCTACCTTTGTTGCTTTGGCGGACCTCGGGGGTCCCCCTCGCACTGGCTTTAGGGTCGGTGAGCGTCCGTCAGAGGCCCATTTAAATTCT-TTTATTAGTGTCGTCCGAGTACAAAACATGAATTAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCATTCAAGCTTGGCTTGGTATTGGGCCCTCGCCCCTGCGGCGTGCCCGAAAAGCAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAATATCAATCCCGCTTTGAAAGTTCGCGTCGAGGCTTGCCAGGCAACCCCACGGAGTCCAATAAGGGATTACCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGGGACCGCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGTGACCGCGGATCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTCGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Canoparmelia_crozalsiana GAGGAATGTATAGCAATAGCTACTTGTATCGTTGTAAAGATGATGCAAGATCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTAGAATAAAGAAAAAAAAGTACTAATTCACTAGAGTTACTTACGAGGGGGCATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTAATACCTGTCT--GAA--CAGACATATGGCACAGGTATAGGCGAAGGCATCCCCTTATG---TAACTGACGTTGAAGGACGAAGGCTTTGTATAACAAACAGGATTAGATACCCTAGTAGTTAAAGCAGAAAATGATGAATGTCATAGATTAGATGTATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACCGAGAGAGGGGCCTTGAGCTCCCGGGGGTTTCGGCCCCCAACTCTTCACCCTGTGCGTACCTACCTTTGTTGCTTTGGCGGACCTCGGGATTGTCTCCCGGGTCGACTTCCGGGTCGGCCAGCGTTCGTCAGAGGCCCATTCAAATTCTATTAATTAGTGTTGTCTGAATATAAA-CATCAATCAAATCAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGTATAACTTGGTACTGGGC-ATCGCCCCCGAGGCGTGCCCGAAAGTCAGTGGCGGTCCGGTGTGACTTTAAGCGTCGTAAAT-CTAATCCCGCTTTGAAAGCTCGCGTCGCGGCTGGCCAGATAACCCCAAAACTTTCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCCTCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGTGAGACCACGGTCTAAGTCCATTGGAACATGGTGTCGTAGAGGGTGAGAATCCCGTATGTGACCGTGGATCAAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGGAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAACCGCTGTTTTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCCTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Canoparmelia_haitiensis GAGGAATGTATAGCAATAGCTACTTGTATCATT-----AATGATGCAAGCTCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTA----AAAGAATAAAAGGGACTAATTCGCTAGAGTTACTTACGAGGGGGCTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAGAATAACGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCATGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGACGTCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACTGAGAGAGGGGCTTCGCGCTCCCGGGGGTCTCGGCCCCCATCTCCTCACCCTGTGTGTATCTACCTTTGTTGCTTTGGCGGACCTCGGGGGTCCCCCTCGCACTGGCTTTAGGGTCGGTGAGCGTCCGTCAGAGGCCCATTTAAATTCT-TTTATTAGTGTCGTCCGAGTACAAAACATGAATTAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCATTCAAGCTTGGCTTGGTATTGGGCCCTCGCCCCTGCGGCGTGCCCGAAAAGCAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAATATCAATCCCGCTTTGAAAGTTCGCGTCGAGGCTTGCCAGGCAACCCCACGGAGTCCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGGGACCGCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGTGACCGCGGATCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCCCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAAGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGGTAGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Concamarella_fistulata GAGGAATGTATAGCAATAGCTACTTGTATCATT-----AATGATGCAAGCTCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTA-AATAAATAAGAAAAGGGACTAATTTACTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCGT-TAATGAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGACGTCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACTGAGAGAGGGGCTTCGCGCTCCCGGGGGGCTCGGCCCCCACCTCTTCACCCTGTGTGTATCTACCTTTGTTGCTTTGGCGGACCTCGGGGGTCTCCTCCGCACTGGTTTTCGGGTCGGTGAGCGTCCGTCAGAGGCCCATCTAAATTCTGTT--TCAGTGTCGTCCGAGTACAGATTATA-AATAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTATTGGGCTTTCGCCCCCGCGGCGTGCCCGAAAAGCAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAATTTCAATCCCGCTTTGAAAGTTCGCGTCGTGGCTCGCCAGGCAACCCCACGTCGTTCAATAAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGTGACCGTGGATCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGCGCTGCGTTCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGGCAGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Flavoparmelia_aff._caperata GAGGAATGTATAGCAATAGCTACTTGCATCATAGTTAATATGATGCAAGCTCGACTAAGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGGAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTGGTGTAAATAATAAAAACCACTAATTTACTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGGGCTAACTGACGTTGAGGGACGAAGGCTTCATGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACCGAGAGCGGGGCCTCGCGCTCCCGGGGGCTTCGGCCCCCAACTCTTCACCCTGTGTGTACCCATCTTAGTTGCTTTGACGGGCCCCGGGGGTCTCTTTCGCGCCGGCCCGGGGCTCGGTGAGCGTCCGTCAGATGCCTTCCTAAATACTGCTTATCAGTGCCGTCCGAGTATCAAT-ATACAATATATTAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTATTGGGCCCTCGCCCCCGCGGCGTGCCCGAAAAGCAGTGGCGGTCCAGCGTGACTTTAAGCGTAGTAAACTT--ATCCCGCTTTGAAAGTTCGCGTC-CGGCCGGCCAGA-AGCTCTATATGCTTTAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTCTGTGACCGCGGATCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACCTGCCCGTGGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGTTCCACGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTTGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGGTAGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Flavoparmelia_baltimorensis_1 GAGGAATGTATAGCAATAGCTACTTGCATCATAGTTAATATGATGCAAGCTCGACTAAGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTGGTGTAAATAATAAAAACCACTAATTTACTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGGGCTAACTGACGTTGAAGGACGAAGGCTTCATGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACCGAGAGCGGGGCCTCGCGCTCCCGGGGGCTTCGGCCCCTAACTCTTCACCCCGTGTGTACCTACACTAGTTGCTTTGACGGGCCCCGGGGATCTCTTTCGCGCCGGCCCGGGGCTCGGTGAGCGTCCGTCAGATGCCTTCCTAAATACTGCTTATCAGTGCCGTCCGAGTATCAAT-ATACAATATATTAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTATTGGGCCCTCGCCCCCGCGGCGTGCCCGAAAAGCAGTGGCGGTCTGGCGTGACTTTAAGCGTAGTAAATTT--ATCCCGCTTTGAAAGTCCGCGTC-AGGCCGGCCAGA-AGCCCTATATGCTTTAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTCTGTGACCGCGGATCAAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACCTGCCCGTGGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGTTCCACGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTTGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCAGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Flavoparmelia_baltimorensis_2 GAGGAATGTATAGCAATAGCTACTTGCATCATAGTTAATATGATGCAAGCTCGACTAAGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTGGTGTAAATAATAAAAACCACTAATTTACTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGGGCTAACTGACGTTGAGGGACGAAGGCTTCATGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCC-CCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACCGAGAGCGGGGCCTCGCGCTCCCGGGGGCTTCGGCCCCCAACTCTTCACCCCGTGTGTACCTACACTAGTTGCTTTGACGGGCCCCGGGGATCTCTTTCGCGCCGGCCCGGGGCTCGGTGAGCGTCCGTCAGATGCCTTCCTAAATACTGCTTATCAGTGCCGTCCGAGTATCAAT-ATACAATATATTAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTATTGGGCCCTCGCCCCCGCGGCGTGCCCGAAAAGCAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAATTT--ATCCCGCTTTGAAAGTCCGCGTC-AGGCCGGCCAGA-AACCCTATATGCTTTAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTCTGTGACCGCGGATCAAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACCTGCCCGTGGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGTTCCACGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTTGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Flavoparmelia_caperata GAGGAATGTATAGCAATAGCTACTTGCATCATAGTTAATATGATGCAAGCTCGACTAAGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGGAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTGGTGTAAATAATAAAAACCACTAATTTACTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGGGCTAACTGACGTTGAGGGACGAAGGCTTCATGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACCGAGAGCGGGGCCTCGCGCTCCCGGGGGCTTCGGCCCCCAACTCTTCACCCTGTGTGTACCCATCTTAGTTGCTTTGACGGGCCCCGGGGGTCTCTTTCGCGCCGGCCCGGGGCTCGGTGAGCGTCCGTCAGATGCCTTCCTAAATACTGCTTATCAGTGCCGTCCGAGTATCAAT-ATACAATATATTAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTATTGGGCTCTCGCCCCCGCGGCGTGCCCGAAAAGCAGTGGCGGTCCAGCGTGACTTTAAGCGTAGTAAACTT--ATCCCGCTTTGAAAGTTCGCGTC-CGGCCGGCCAGA-AGCTCTATATGCTCTAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTCTGTGACCGCGGATCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACCTGCCCGTGGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGTTCCACGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTTGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGGTAGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Flavoparmelia_flaventior_1 GAGGAATGTATAGCAATAGCTACTTGCATCATTGTACAGATGATGCAAGATCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAGATCAAGCTTTCA-GAAAAGAATGAAAGGGACTAATTTACTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCGTGTAACAAACAGGATTAGATACCCTAGTAGTTGGAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACCGAGAGAGGGGCCTCGAGCTCCCGGGGGCTTCGGCCCCCAACTCTTCACCCTTTGTCTACCTACCTTTGTTGCTTTGGCGGACCTCGGG-TTCCTTCTCGCGCTGGCCTCCGGGTCGGTGAGCGTCCGTCAGAGGCCCATTTAAATTCAAATCATCAGTGATGTCTGAG---CGAAAACACAATTAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGTCCTCGCCCCTGCGGCGTACCCGAAAATCAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAATTCT-CTCCCGCTTTGAAAGTTCGCGGCGTGATCGGCCAGACAACCCCAATCGCTTCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTTCGGGGCCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGTGAGACCACGGTCTAAGTCCATTGGAACACGGTGTCATAGAGGGTGAGAATCCCGTATGTGACCGTGGATCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGGCGGATAAAGGCCTTGGGAATGTAGCTCCTTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Flavoparmelia_flaventior_2 GAGGAATGTATAGCAATAGCTACTTGCATCATTGTACAGATGATGCAAGATCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAGATCAAGCTTTCA-GAAAAGAATCAAAAGGACTAATTTACTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCGTGTAACAAACAGGATTAGATACCCTAGTAGTTGGAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACCGAGAGAGGGGCTTTGAGCTCCCGGGGGCTTCGGCCCCCAACTCTTCACCCTTTGTCTACCTACCTTTGTTGCTTTGGCGGACCTCGGG-TTCCTTCCCGCGCCGGCCTCCGGGTCGGTGTGCGTCCGTCAGAGGCCCATTTAAATTCAATTTCTTAGTGATGTCTGAG---CGAAAACACAATTAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGTCCTCGCCCCTGCGGCGTACCCGAAAATCAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAATTCT-CTCCCGCTTTGAAAGTTCGCGGCGTGATCGGCCAGACAACCCCAATTGCTTCAATAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Flavoparmelia_soredians GAGGAATGTATAGCAATAGCTACTTGCATCATAGTTAATATGATGCAAGCTCGACTAAGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTCGTGTAAATAATAAAAACCACTAATTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGCTAACTGACGTTGAGGGACGAAGGCTTCATGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGATATCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACTGAGAGAGGGGCCTCGCGCTCCCGGGGGCTTCGGCCCCCAACTCTTCACCCT-TGTGTACTTGTCTGTGTTGCTTTGGCGGGCCTTGGGGGTCTCTCTTGCGCCGGCTCCCGGGTCGGTGGGCGCCCGTCAGATGCGTTCCTAAATCCTGTTAATCAGTGTTGTCCGAGTATCAAAC---AAATATATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTATTGGGCTCTCGTCCCCGTGGCGTGCCCGAAAATCAGTGGCGGTCCGGCGTGACATTGAGCGTAGTAAACTTT--TCCCGCTTTGAAAGCTCGCGTC-CGGTCGGCCAGA-AAC-CCATATGCTTCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCTTAGAGGGTGAGAATCCCGTACGTGACCGCGGATCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACCTGCCCGTGGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGTTCCGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAACCCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Parmelaria_subthomsonii GAGGAATGTATAGCAATAGCTACTTGTATCATT-----AATGATGCAAGCTCTGCTATGTTGAATAAAGTTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTAGAATAAAGAAGAAAAGGGACTAATTCGCTAGAGTTACTTACGAGGGGGTAGTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAACGAAAAATTATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCGTGGAACAAACAGGATTAGGTACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGACGTCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACTGAGAGAGGGGCCTCGCGCTCCCGGGGGTCTCGGCCCCCAACTCTTCACCCTGTGTCTACCTACCTTTGTTGCTTTGACGGACCCCGGGGGTGTCCTCCGCACCGGCTTTTGGGTCGGTGAGCGTCCGTCAGAGGCCTATTTAAATTCTGTT--TTAGTGTTGTCCGAGTATAAAAC--AAAATAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGAAGCTTGGTATTGGGCCCTCGCCCCCGTGGCGTGCCCGAAAAGCAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAATTAC-ATCCCGCTTTGAAAGTTCGCGTGGTGGCTTGCCAGACAACTGCGTAGATTCCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCCCCCCTGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGACCCCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGTGACCGCGGATCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGCTCTACGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTTTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTGAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGGTTGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Parmotrema_chinense GAGGAATGTATAGCAATAGCTACTTGTATCATT-----AATGATGCAAGCTCGACTATGTTGAATAAAGTTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTAAAATAAATAAGAAAAGGGACTAATTCGCTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCGTGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGACGTCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAGGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACCGAGAGAGGGGCCTCGCGCTC-CGGGGGTTTCGGCCCCCAACTCTTCACCCTGTGTGTACCTATCTTTGTTGCTTTGGCGGACCTCGGGGGTCTCCTTCGCACCGGCTTCCGGGTCGGTGAGTGTCCGCCAGAGGCCCATCTAAATTCCGTTTATCAGTGTTGTCCGAGTCCAAAAT---AAATAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATACCTGTTCGAGCGTCATTGCACCCCTCAAGCTTCGCTTGGTATTGGGC-CTCGCCCCCGCGGCGTGCCCGAAAAACAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAATTTTGATCCCGCTTTGAAAGCTCGCGTTGTGACTCGCCAGGCAACCCCACGTA---------GGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGAGCGCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGCGACCGCGAATCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTGAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGGTCGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Parmotrema_crinitum GAGGAATGTATAGCAATAGCTACTTGTATCATT-----AATGATGCAAGCTCGACTATGTTGAATAAAGTTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTAAATTAAATAAGAAAAGGGACTAATTCGCTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCGTGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGACGTCTAAGTTTCTTCTATAAATGAAAGTGTAAGCATTCCACCTCAGGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACCGAGAGAGGGGCCTCGCGCTC-CGGGGGTTTCGGCCCCCAACTCTTCACCCTGTGTGTACCTATCTTTGTTGCTTTGGCGGACCTCGGGGGTCTCCTTCGCACCGGCTTCCGGGTCGGTGAGTGTCCGTCAGAGGCCCATCTAAATTCCGTTTATCAGTGTTGTCCGAGTCCAAAAT---AAATAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTCGCTTGGTATTGGGC-CTCGCCCCCGCGGCGTGCCCGAAAAACAGTGGCGATCCGGCGTGACTTTAAGCGTAGTAAACTTTGATCCCGCTTTGAAAGCTCGCGTTGTGGCTCGCCAGGCAACCCCACGTATTCCATT--GGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGAGCGCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGCGACCGCGAATCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTGAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Parmotrema_hypoleucinum GAGGAATGTATAGCAATAGCTACTTGTATCATAGTAGAAATGATGCAAGCTCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGGATCAAGCTTTT--CTAAATCAGAAAAAGGACTAATTCGCTAGAGTTACTTACGAGGGGGCATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCGTGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGATGTTTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACCGAGAGAGGGGCCAAGCGCCCCCGGGGGTCTCGGCCCCCAACTCTTCACCCTGTGTGTACTCACCTTTGTTGCTTTGGCGGACCTCGGGGGTCTCCCCCGCACCGGCTCCCGGGCCGGCGCGCGTCCGTCGAAGGCCCACCGAAATTCCATTTTCCAGTATCGTCCGAGTACCAAAACACAATGAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCTCTCAAGCTTGGCTTGGTATTGGGCTCTCGCCCCCGCGGCGGGCCCGAAAGGCAGTGGCGGTCCGGCGTTACTTTAAGCGTAGTAAAGATCCATCCCGCTTTGAAAGTTCGCGTCGCGGCTCGCCAGGCAACCCCGCGTGTCCCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGAGTGCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTACGTGACCGCGGATCGAACCCGTGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGCCCGTAGGCGATCAACCGCTGTTCTCAGCGGTGCACTCGTTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTGAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGGTAAGCAGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATC-TCAAATTTGGGTATAG Parmotrema_perforatum GAGGAATGTATAGCAATAGCTACTTGTATCATAGTAGAAATGATGCAAGCTCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGGATCAAGCTTTT--CTAAATCAGAAAAAGGACTAATTCGCTAGAGTTACTTACGAGGGGGCATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCGTGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGATGTTTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACCGAGAGAGGGGCTTCGCGCTCCCGGGGGCCTCGGCCCCCAACTCTTCACCCTGTGTGTACCCACCTTTGTTGCTTTGGCGGACCTCGGGTGTCTCCCCCGCGCCGGCTCCCGGGCTGGCGCGCGTCCGTCGAAGGCCCACCGAAATTCCATTTTTCAGTGCCGTCCGAGTACCAAAACACAATGAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGTGGCTTGGTATTGGGCTCTCGCCCCCGCGGCGGGCCCGAAAGGCAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAAGACCCATCCCGCTTTGAAAGTTCGCGTCGCGGCCGGCCAGGCAACCCCGCGTATT-------GGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGATGGCGGTCTAAGTCCATTGGAACATGGTGTCAGAGAGGGTGAGAATCCCGTACGTGACCGCGGATCGAGCCCGTGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGCCCGTGGGCGATCAACCGCTGTTCTCAGCGGTGCACTCGTTCCGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTCCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTGAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGGTAAGAAGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Parmotrema_robustum GAGGAATGTATAGCAATAGCTACTTGTATCATT-----AATGATGCAAGCTCGACTATGTTGAATAAAGTTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTTAAATAAATAAGAAAAGGGACTAATTCGCTAGAGTTACTTACGAGGGGGTTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAGAATAATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCGTGGAACAAACAGGATTAGGTACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGACGTCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAGGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACTGAGAGAGGGGCTTCGCGCTCCCGGGGGCCTCGGCCCCCAACTCCTCACCCTATGTGTACCTACCTCTGTTGCTTTGGCGGACCTCGAGGGCCTCCTTCGCACTGGCTTTCGGGTCGGTGAGCGTCCGTCAGAAGCCCACTTAAATTCTGTTAATCAGTGTCGTCCGAGT--CGAAAATGAATAAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCCTGGCTTGGTATTGGGCGTTCGCCCCTGCGGCGTGCCCGAAAAGCAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAATTATAATCCTGCTTTGAAAGTTCGCGTTGTGGCTCGCCAGATAACCCCACGCAGTCCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGTGTCAGAGAGGGTGAGAATCCCGTATGTGACCGCGGATCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTTTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGTCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTTAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGGTAAATAGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Parmotrema_tinctorum GAGGAATGTATAGCAATAGCTACTTGTATCATT-----AATGATGCAAGCTCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGCAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTAGAATAAAGAAGAAAAGGGACTAATTCGCTAGAGTTACTTACGAGGGGGCATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTT-CGAAAGAAAAATTACGGCACGGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGACGTCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACTGAGAGAGGGGCTTCGCGCTCCCGGGGGTCTCGGCCCCCAACTCTTCACCCTGTGTGTACCTACCTTTGTTGCTTTGGCGGGCCTCGGGGGTCTCCTCCGCGTCGGCTTTCGGGTCGATGAGCGTCCGTCAGAGGCCCATTTACATTCTGTTTATCAGCGTCGTCCGAGTACAAAAT---GAATAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCTCTCAAGCTTCGCTTGGTATTGGGTATTCGCCCCCGAGGCGTACCCGAAAAGCAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAATTACCATCCCGCTTTGAAAGTTCGCGTTGTGGCTCGCCAGACAACCCCATATAGTCCAATAAGG--TTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGACTGCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGTGACCGCGGATCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCTGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTCTCGGGGGAGTTTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTTGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Punctelia_borreri GAGGAATGTATAGCAATAGCTACTTGCATCATTGTACAGATGATGCAAGATCGACTAAGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGTAGACTAGTGTTATTCATGT-TAATCGGTTTAAAGGGTACCTAGACGGTAGATCAAGCTTTTATATATAAATTATAAAGGACTAATTTACTAGAGTTACTTACGAGGGGGCATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAGTCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTCCTGAAACCAGATCATTACCGAGAGAGGGGCTTCGCGCTCCCGGGGGCTTCGGCCCCCAACTCTTCACCCATTGTTCATTGACCCTTGTTGCTTTGGCGGACCTCGGGG-CTTCTCCCGCGCTGGCCTCCGGGTCAGTGAGCGTCCGTCAGAGGCCCATTCAAATCCTTTTTATCCGTGACGTCCGAGTATATATATAAAAATTAATCAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCCCCCCTCAAGCGCAGCTTGGTATTGGGTTCTCGCCCCGGTGGCGTGCCCGAAAAGCAGTGGCGGTCCGGCGAGACTTTAAGCGTAGTAAATTTT-CTCCCGCTTTGAAAGCTCGCGCCGTGGCCGGCCAGACAACCCCATTAGCTTCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGTGAGGCCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACCGTGGATCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGCCGGATAAAGGCCTTGGGAATGTAGCTCTCTTTTGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAG Punctelia_pseudocoralloidea GAGGAATGTATAGCAATAGCTACTTGCATCATTGTACAGATGATGCAAGATCG-CTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAGATCAAGCTTTTACATATAAAATGAAAAGGACTAATTTACTAGAGTTACTTACGAGGGGGCATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACCGAGAGAGGGGCTTCCCGCTCCCGGGGGTTTCGGCCCCCAACTCTTCACCCTTTGTCTACCTACCTTTGTTGCTTTGGCGGACCTCGGGGTC--CCCCCGCGCTGGCTCTCGGGTCGGTGAGCGTCCGTCGGAGGCCCATCCAAATTCTCTTTATCAGTGACGTCCGAGTATATAT---AAAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGCCTTCGCCCCTGCGGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGTGACTTTAAGCGTAGTAAATTTT-CTCCCGCTTTGAAAGCTCACGCTGTGGCCGGCCAGACAACCCCATTAGCTTCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCCCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGTGAGGCCGCGGTCTAAGTCCATTGGAACAGGGCGTCATAGAGGGTGAGAACCCCGTATGTGACCGTGGACCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGTGGTGCACCCGCCCTGCGATCAGGCCAGCATCGGTTTCGGCGGCCGGATAAAGGCCTTGGGAATGTAGCTCCCTTTCGGGGGAGTCTTATAGCCCTTGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGGTGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Punctelia_rudecta GAGGAATGTATAGCAATAGCTACTTGCATCATTGTACAGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAGATCAAGCTTTTACATATAAATTATAAAGGACTAATTTGCTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAAGGACGAAGGCTTTGTGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAGGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACCGAGAGAGGGGCTTTGCGCTCCCGGGGGTTTCGGCCCCCAACTCTTCACCCACTGTATACGTACCTTTGTTGCTTTGGCGGACTTCGGGG-TCT-TTCCGCGCTGACTTTCGGGTCGGTGAGCGTCCGTCAGAGGCCCATTCAAATCCGCTTTATCAGTGACGTCCGAGTATATATAAAAAAA-TAGTCAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGTACCCCTCAAGCGTAGCTTGGTATTGGGCTCTCGCCCCCGCGGCGTGCCCGAAAAGCAGTGGCGGTTCGGTGCGACTTTAAGCGTTGTAAATTCT-ATCCCGCTTTGAAAGCTCGCGCCGTGGCCGGCCAGACAACCCTATTAGCTTCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGTGAGGACACGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACCGTGGATCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTCCGTAGGCGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTTGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTGAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGGTAGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Punctelia_rudecta_2 GAGGAATGTATAGCAATAGCTACTTGCATCATTGTACAGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAGATCAAGCTTTTACATATAAATTATAAAGGACTAATTTGCTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAGGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACCGAGAGAGGGGCTTTGCGCTCCCGGGGGCTTCGGCCCCCAACTCTTCACCCACTGTCTACGTACCTTTGTTGCTTTGGCGGACCTCGGGGTCC--TCCCGCGCCGACTTTCGGGTCGGTGAGCGTCCGTCAGAGTCCCATTCAAATCCGCTTTATCAGTGACGTCCGAGTATATAT-ATAAAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGTACCCCTCAAGCGTAGCTTGGTATTGGGCTCTCGCCCCTGCGGCGTGCCCGAAAAGCAGTGGCGGTCCGGCGTGACTTTAAGCGTTGTAAATTCT-ATCCCGCTTTGAAAGCTCGCGCCGTGGCCGGCCAGACAACCCTATTAGCTTCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGTGAGGACACGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACCGTGGATCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTCCGTAGGCGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTTGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTGAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGGTAGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Punctelia_subflava GAGGAATGTATAGCAATAGCTACTTGCATCATTGTACAGATGATGCAAGATCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAGATCAAGCTTTTACATATAAAATGAAAAGGACTAATTTACTAGAGTTACTTACGAGGGGGCATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACCGAGAGAGGGGCTTCGCGCTCCCGGGGGTTTCGGCCCCCAACTCTTCACCCTTTGTCTACCTACCTTTGTTGCTTTGGCGGACCTCGGGGTG--CCCCCGCGCTGGCTCTCGGGTCGGTGAGCGTCCGTCGGAGGCCCATTCAAATTCTCTTTATCAGTGACGTCCGAGTATATAT---AAAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGCCTTCGCCCCTGCGGCGTGCCCGAAAAGCAATGGCGGTCCGGTGTGACTTTAAGCGTAGTAAATTTT-CTCCCGCTTTGAAAGCTCACGCTGTGGCCGGCCAGACAACCCCATTAGCTTCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCCCCTTCGGGGTTCGAGTTGTAATTTGTAGAGAGTGTTTCGGGTGAGGCCGCGGTCTAAGTCCATTGGAACAGGGCGTCATAGAGGGTGAGAACCCCGTATGTGACCGTGGATCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGCCGGATAAAGGCCTTGGGAATGTAGCTCCCTTTTGGGGGAGTCTTATAGCCCTTGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGGTGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Punctelia_subrudecta GAGGAATGTATAGCAATAGCTACTTGCATCATTGTACAGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAGATCAAGCTTTCATATAAATAATAAAAGGGACTAATT-GCTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCGTGTAACAAACAGGATTAGATACCCTAGTAGTTGGAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACTGAGAGAGGGGCCTCGCGCTCCCGGGGGTTTCGGCCCCCAACTCTTCACCCACTGCCTACATACCTTTGTTGCTTTGGCGGACCTCGGGGTTC-CTCCCGCGCTGTCTTTCGGGTCGGTGAGCGTCCGTCAGAGGCCTATTTAAACCCTCTTTAATAGTGACGTCCGAGAGTATAT-ATAAA--TAGTCAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGCCTTCGCCCCCGAGGCGTGCCCGAAAAGCAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAATTTT-CTCCCGCTTTGAAAGCTCGCGCCGTGGCCGGCCAGACAACCCCATTAGCTTCTATAAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGTGAGGACCCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACCGTGGATCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTCCCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGTCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTGAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Rimelia_cetrata GAGGAATGTATAGCAATAGCTACTTGTATCATT-----AATGATGCAAGCTCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTA-AATAAATAAGAAAAGGGACTAATTTACTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGACGTCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACTGAGAGAGGGGCTTCGCGCTCCCGGGGGTCTCGGCCCCCAACTCTTCACCCTGTGTGTACCTACCTTTGTTGCTTTGGCGGACCTCGGGGGCCTCCTCCGCACCGGCTTCCGGGTCGGTGAGTGTCCGTCAGAGGCCCATTTAAATTCCGTTTATCAGTGTCGTCCGAGTACAAATTAT-AATTAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTATTGGGCTCTCGCCCCCGCGGCGTGCCCGAAAAGCAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAATTTCAATCCCGCTTTGAAAGTTCGCGTCGTGGCTTGCCAGGCAACCCTACGTACTTCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGTGACCGTGGATTGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Rimelia_clavulifera GAGGAATGTATAGCAATAGCTACTTGTATCATT-----AATGATGCAAGCTCGACTATGTTGAATAAAGTTCTAGGTAGAATTATGATGATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTAAAATAAATAAGAAAAGGGACTAATTCGCTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATAATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCGTGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGACGTCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACTGAGAGAGGGGCTTCGCGCTCCCGGGGATCTCGGCCCCCAACTCTTCACCCTGTGTGTATCTACCTTTGTTGCTTTGGCGGACCTTGGAGGTCCCCTCCGCACCGGCTTTCGGGTCGGTGAGTGTCCGTCAGAGTCCTATTTAAATTCTGTTTATCAGTGCCGTCCGAGTATAAACTATAAATTAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCTTAGCTTGGTATTGGGTCCTCGTCCCCGTGGCGTGCCCGAAAAGCAGTGGCGGTCCGACGTGACTTTAAGCGTAGTAAATATCAATCCCGCTTTGAAAGCTTGCGTCGTGGCTCGCCAGACAACCCTACGTATTTCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGTGACCGTGGATCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGCCCGTAGGCGATCAGTCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Rimelia_pseudoreticulata GAGGAATGTATAGCAATAGCTACTTGTATCATT-----AATGATGCAAGCTCGACTATGTTGAATAAAGTTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTAAAATAAAGAAGAAA-AGGACTAATTCGCTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCGTGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGACGTCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACTGAGAGAGGGGCTTCGCGCTCCCGGGGGTCTCGGCCCCCAACTCTTCACCCTGTGTGTACCTACCTTTGTTGCTTTGGCGGACCTCGGGGGTCCCCTCCGCATCGGCTTTCGGGTCGGTGAGTGTCCGTCAGAGTTCTATTTAAATTCTGTTTATCAGTGCCGTCCGAGTACCAAATACAAATTAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCCTGGCTTGGTATTGGGTCCTCGCCCCCGTGGCGTGCCTGAAAAGCAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAACTTCAATCCCGCTTTGAAAGTTCGCGTCGTGGCTCGCCAGGTAACCCTACGTACTTCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGGGACCGCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGTGACCGTGGATCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGCCCGTAGGCGATCAGTCACTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG Rimelia_reticulata GAGGAATGTATAGCAATAGCTACTTGTATCATT-----AATGATGCAAGCTCGACTATGTTGAATAAAGTTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTAAAATAAATAAGAAA-AGGACTAATTCGCTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCGTGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGACGTCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGATCATTACTGAGAGAGGGGCTTCGCGCTCCCGGGGGTCTCGGCCCCCAACTCTTCACCCTGTGTGTATCTACCTTTGTTGCTTTGGCGGACCTCGGGGGTCCCCTTCGCACTGGCTTTCGGGTCGGTGAGTGTCCGCCAGAGTCCTATTTAAATTCTGTTTATCAGTGCCGTCCGAGTACCAAATATAAATTAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTATTGGGCTCTCGCCCCCGTGGCGGGCCCGAAAAGCAGTGGCGGTCCGGCGTGACTTTAAGCGTAGTAAATTTCAATCCCGCTTTGAAAGTTCGCGTCGTGGCTCGCCAGGCAACCTTACGTATTTCAATAAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGTTCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGTGACCGTGGATCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGCCCGTAGGCGATCAGTCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTCCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGATCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = combined) = N: 1-1892; CODONPOSSET CodonPositions (CHARACTERS = combined) = N: 1-1892; END;