#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on September 27, 2021; 14:21 GMT TreeBASE (cc) 1994-2008 Study reference: Dai Y., Wang Z., Binder M., & Hibbett D. 2006. Phylogeny and a new species of Sparassis (Polyporales, Basidiomycota): evidence from mitochondrial atp6, nuclear rDNA and rpb2 genes. Mycologia, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1558] BEGIN TAXA; TITLE 'atp6-phylogeny'; DIMENSIONS NTAX=28; TAXLABELS Climacodon_septentrionalis Fomitopsis_pinicola Grifola_frondosa Laetiporus_porlentosus_Rajch36 Laetiporus_sulphureus Lentinus_tigrinus Oligoporus_rennyi Phaeolus_schweinitzii Phlebia_radiata Piptoporus_betulinus Polyporus_arcularius Polyporus_squamosus Postia_lactea Pycnoporellus_fulgens Sparassis_brevipes_24 Sparassis_crispa Sparassis_crispa_17 Sparassis_crispa_19 Sparassis_crispa_25 Sparassis_crispa_3 Sparassis_crispa_5 Sparassis_crispa_9 Sparassis_cystidiosa Sparassis_radicara_32 Sparassis_radicata_26 Sparassis_radicata_29 Sparassis_spain_1 Sparassis_spathulata_8 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1202] TITLE 'atp6-Sparassis'; LINK TAXA = 'atp6-phylogeny'; DIMENSIONS NCHAR=642; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Climacodon_septentrionalis GCTCCTATTTTAGGTTACTTCAACTTAACTTTAACTAACTTAGCTTTATATTCAGTTTTAGTTATCTTATTTATTATAACTATACATTATATGGCAAATAATAATAATAAATTAGTACCGTCTAAATGGTCACTTTCTTTAGAAAGTCTATTTGCAAGTATAAGTTCTATGGTTAAAGAACAATTAGGA------AAAGAAGTTTATTTACCATTTGTATATTCTTTATTTTGTTTTATTTTAATAGCTAATTTATTTGGTGCTGTTCCTTATAGTTTCACTATTACTACTTCAGCAATAGTAGCTATAGGTTTAAGCTTTACTATTTGGACAGGTGTAACTATTTTAGGTTTAAGTATACATAGATTACACTTCTTCTCATATTTTATACCATCAGGAACACCTTTACCACTAATTCCTTTATTAGTATTAATTGAAGTTATATCTTATGTTGCTAGAGCTGCTAGTCTAGGTCTAAGATTATTTGCTAATATGCTAGGGGGTCATACTCTTATGAAAATTCTTGCTAGTTTTCTATATAAAATGTTCAGTGCATCATTTGTTATTGCTATCTTAACAATAATACCATTCGTTTTATTCTTAGGTATAATGCTTCTAGAAATAGGAGTTGCATTTATCCAA Fomitopsis_pinicola GCGCCTATCTTAGGTTATTTGAATATTAGTTTAACTAATTTAGCATTATATTCTATAATAGTATTAAGTCTAATAATAAGTATTCACTATGTGTCTAATAACGAAAATAAAATAGTACCTTCTAAATGGTCTATTGCTCTTGAAAGTTTATTTGCAAGTATTAATTCAATGGTTAAAGAACAATTAGGT------AAAGAATTATATTTACCTTTTATATATTCTTTATTTTTTTTCATATTAATAGCAAATTTAACAGGTAATGTTCCATATTCTTTCACAATAACAACATCAATAATGGTGTCAATTGGTTTATCTTTCACTATTTTAATTGCTGTTACTATATTAGCTTTATCTATCCATAAATTACATTTCTTCTCATTTTTTGTTCCTTCTGGAACACCATTGGCCTTAGTACCTTTATTAGTTTTAATTGAATTGGTTTCATATTTAGCTAGAGCTTTTTCATTAGGAATAAGATTATTTGCTAATGTGGTAGCAGGTCACACTTTAATGAAAATTTTAGCAACATTCTTATATCAAATGTTTAGTAGTACTTTAATTATAGCTACTATTACTTTAATACCTTTTACAATTTTCTTAGCTATTATTGGTTTAGAATTGGCTGTTTCTATTATTCAA Grifola_frondosa GCACCTATTTTAGGTTATTTAAATATTAGTTTAACTAATTTAGCGTTATACTCATTATTAGTATTATTCTTAATTGTAGCGATACATTATAGTTTTAATAATGATACTAAATTAGTTCCTTCAAAATGGTCTATTTGTCTAGAAAGTTTATTTCAAAGTGTAAATTCAATGGTTAGAGAACAATTAGGA------AAAGAAATTTATTTACCTTTTATATACTCTTTATTTTTTTTCATATTAATAGCTAATTTAACAGGTAATATTCCATATTCTTTCACAATAACTACATCAATTATGGTGTCAATTGGTTTATCTTTCACTATTCTTATTGCTGTAACAATACTAGGACTTTCTATACATAAATTACATTTCTTCTCATATTTTGTACCTTCTGGAACTCCTTTAGCTCTTCTACCTTTATTAGTATTAATTGAAGTTATCTCTTACTCAGCTAGAGCTTTCTCTTTAGGAATCAGATTATTTGCTAATATGCTTGCAGGACACTCTTTAATGAAAATACTTGCAACTTTCTTATATAAAATGTTTAGTAGTTCTATTTTATTTGCTATCTTAACTTTAATTCCATTTGTTTTATTCTTAGCAATTATGACACTTGAATTAGCTGTTTCA--------- Laetiporus_porlentosus_Rajch36 GCTCCTATTTTAGGGTATTTAAATATTAGTTTAACTAATCTAGCTTTATATTCACTATTAGTTTTATTTATAATTGTAGCCTTACACTATATGGCTAATAATGAAACTAAATTAGTACCATCTAAATGGTCTATAGCTCTAGAAAGTTTATTTGCTAGTATAAACTCAATGGTCAGAGAACAATTAGGGGGGCCAGAGGCCCCTTACTTACCATTTATATATAGTCTATTCTTTTTCATATTAATAGCCAACTTAACAGGAAATATTCCATATTCTTTCACTATTACTACAAGTATAATGGTGTCTATTGGTTTATCTTTCACTATTTTAATTGCAGTTACTATTTTAGGATTAGCTATACATAAATTACATTTCTTTTCTTACTTTGTCCCTTCTGGTACACCTTTAGCTTTAGTTCCACTATTAGTATTAATCGAATTAGTTTCTTACTTAGCTAGAGCTTTCTCTTTAGGAATCAGACTATTTGCTAATATGGTAGCAGGGCACACTTTAATGAAAATACTAGCAACATTCTTATATCAAATGTTTAGCGGTAGTTTACTTGTAGCTGTTTTAACTTTAATTCCATTTACACTATTCTTAGCTATAATGGGTCTAGAATTACCAGTATCATTTATACAA Laetiporus_sulphureus GCTCCTATTTTTGGTTATTTCAATTTAAGCTTAACAAATCTAGCTCTTTACTCATTATTAGTATTCTTTTTAATTGTAGCAATACATTATTTTGGTAATAATGAAACTAAATTAGTTCCTTCTAAATGGTCTATAGCACTAGAAAGTTTTTTCGCCAGTATTCAATCAATGGTAAGAGAACAATTAGGT------AGCGAACTGTACTTACCATTTATTTACTCATTATTTGTCTTCATATTAATAGCGAACTTAACTGGAAATGTTCCATATTCTTTCACCATAGCAACCTCAGTAATAGTCTCACTTGGTTTATCTTTCACAATCATTTTAGCAGTAACAATTCTGGGTCTATCTATACATAGATTACACTTTTTCTCATACTTCGTACCCGCTGGATGTCCTGTTGCCTTAACACCACTACTAAGTTTAATTGAATTAGTATCTTATCTTGCAAGAGCCTTTTCTTTAGGTGTTAGACTATTTTCTAACTTACTTGGAGGTCACACTCTTATGAAAATCCTGGCAAGTTTCTTATATAAAATGTTCAGTAGTTCTGTAATTGTAGCTGTTTTAACTGTATTACCTTTTACTTTATTTTTAGGGATTTCTGTATTGGAATTAGCAGTTTCCATGATCCAA Lentinus_tigrinus -------------------------TAACTTTAACTAACTTAGGATTATATTCTATCTTAGTATTATTACTAATAGTTGGAATACACTATGCAGGTAATAATGAAATTAAATTAGTGCCAAGTAAATGGTCTATTGCATTAGAAAGTCTATATGCAAGTATCCACTCTATGGTAAGAGAACAATTAGGT------AAAGAAATTTATTTACCATTTATTTATTCTATATTCTTTTTCATTTTAATAGCTAATTTAACAGGTAATATACCATATTCATTTACAATTACTACTTCTATTATAGTAAGTATTGGTTTATCTTTCACTATTTTAATAGCAGTAACTATTTTAGGTTTAAGTATTCATAAATTACATTTCTTTGCATACTTTGTACCTTCTGGTACACCTTTAGCTTTAGTTCCTTTATTAGTTTTAATTGAATTAACTAGTTATTTAGCTAGAGCTTTCTCTTTAGGTATCAGATTATTTGCTAATGTAGTGGCTGGACACACTTTAATGAAAATTTTAGCTACATTCTTGT-CCAAATGTTTAGTGCTGGTTTAATAGCTGCTTTTATTACTTTAATTCCATTTACTTTATTTTTGGCAATCTGTGGATTAGAACTAGCAGTATCTG-------- Oligoporus_rennyi ---CCTATTTTAGGTTATTTAAATATAAGTATAAGTAACTTATCATTATATTCTTTATTAGTATTATTTATAATTGTGGCAATACATTATATTAGTAATAATGATAATAAATTAGTACCTTCAAAATGGTCTATTTCTCTAGAAAGTTTATTTGCAAGTATAAATTCAATGGTTAAAGAACAATTAGGA------AAAGAAGTTTACTTACCTTTTATATACTCTTTATTCTTTTTCATCTTAATAGCTAACTTAACAGGTAATATACCATATTCTTTCACAATTACTACTTCAATAATGGTGTCAATTGGTTTATCTTTCACAATACTTATAGCTGTAACAATTTTAGGATTGTCTATACATAAATTACACTTCTTTTCATATTTTGTACCTTCTGGTACACCTTTAGCTTTAGTTCCTCTATTAGTATTAATAGAATTGGTTTCATATTTAGCTAGAGCTTTCTCTTTAGGAATTCGATTATTTAGTAACATGGTAGCAGGACACACATTAATGAAAATATTAGCAACTTTCTTATATCAAATGTTTTCTGCTGGAGTTATTATGTTTGTATTAACTTTAATTCCATTTGTTATTTTCTTAGCTATTGTAGGTTTAGAAATCGCAGTTTCAATTATCCAA Phaeolus_schweinitzii GCACCAATATTTGGATATATAAATATAAGTTTAACCAATTTAGCATTATATTCAATAATAGTCTTATTACTAATTGTAGGACTACATTATTGTATTAATAATGACAATAAATTAGTACCATCAAAATGGTCTATATCATTAGAAAGTTTATTTGCAACAATCAATTCAATGGTTCGAGAACAATTAGGT------AAAGAAATATACTTACCATTAATCTACTCATTATTTGTTTTCATCTTAATAGCAAACTTAACTGGTTCAGTACCATACTCATTCACAATTACTACTTCTGCAATTGTTTCAATCGGTTTAAGTTTTACAATATGGGTTGGAGTAACTATATTAGGCTTAAGTATTCATAAATTACATTTCTTTTCTTACTTTGTTCCATCTGGAACGCCATTAGCACTGGTTCCCTTATTAGTAATAATTGAAATGATTTCATATGCTGCAAGAGCAATTAGTCTCGGCTTAAGACTGTTCTCTAATATGGTTGCTGGTCATACATTAATGAAAATATTAAGTACTTTCTTGTTTAAATTGTTCTCTGCCGGAATTTTTATTGCTGTTTTAACTTTAATACCATTTATTATTTTCTTAGCTATTGTGGGTCTTGAACTTGCTGTAGCGGTAATACAA Phlebia_radiata GCACCTATTTTAGGTTATTTTAATTTAACTTTAACTAATTTAGCTTTATATTCAGTATTAGTTATTTTATTCATTATAACTTTACATTATTATTGTAATAATAAAAATAAATTAGTTCCATCTAAATGGCAAATAGCTTTAGAAAGTTTATTTGCAAGTATTAGTTCTATGGTTAGAGAACAATTAGGT------AAAGAAGTTTATTTACCATTTATCTATTCATTATTTTGCTTTATTTTAATAGCTAATTTATTTGGTTCCGTGCCATATAGTTTTACAATCACTACTTCTGCAATAGTTGCTATAGGATTAAGTTTTACAATTTGGACAGCGGTGACAATATTAGGACTAAGTATTCATAAATTACACTTTTTTGCTTATTTTATACCCTCTGGAACACCTTTAGCTTTAATTCCTTTATTAGTGTTAATTGAAGTTATATCATATGTTGCTAGAGCAGCTAGTTTAGGTTTAAGATTATTTGCTAATATGCTTGGGGGTCACACATTAATGAAAATACTTTCTAGTTTTTTATACAAAATGTTTGGTGCTTCATTCATAATTGCTTTTGTTACTCTAATTCCTTTTGTGTTGTTCTTAGGTATAATGTTACTTGAAATAGGTGTAGCTTTTATTCAA Piptoporus_betulinus GCACCTATCTTAGGTTATTTGAATATTAGTTTAACTAATTTAGCTTTATATTCTATAATAGTATTAAGTCTAATAATAAGTATTCACTATGTGTCTAATAACGAAAATAAAATAGTACCATCTAAATGGTCTATTGCTCTTGAAAGTTTATTTGCAAGTATTAATTCAATGGTTAAAGAACAATTAGGT------AAAGAATTATATTTACCTTTTATCTATTCTTTATTTTTTTTCATATTAATAGCAAATTTAACAGGTAATGTTCCATATTCTTTCACAATAACAACATCAATAATGGTGTCAATTGGTTTATCTTTCACTATTTTAATTGCTGTTACAATATTAGCTTTATCTATCCATAAATTACATTTCTTCTCATTTTTTGTTCCTTCTGGAACACCATTGGCCTTAGTACCTTTATTAGTTTTAATTGAATTGGTTTCATATTTAGCTAGAGCTTTTTCATTAGGAATAAGATTATTTGCTAATGTGGTAGCAGGTCACACTTTAATGAAAATTTTAGCAACATTCTTATATCAAATGTTTAGTAGTACTTTAATTATAGCTACTATTACTTTAATACCTTTTACAATTTTCTTAGCTATTATTGGTTTAGAATTGGCTGTTTCTATTATTCAA Polyporus_arcularius --------TTTTGGTTATTTAAATATAACTTTAACTAACTTAGGATTATATTCTATCTTAGTATTATTATTAATAGTTGGAATACACTATGCTGGTAATAATGAAATTAAATTAGTGCCAAGTAAATGGTCTATTGCATTAGAAAGTCTATATGCAAGTATACACTCTATGGTAAGAGAACAATTAGGT------AAAGAAATTTATTTACCATTTATTTATTCTATATTCTTTTTCATTTTAATAGCTAATTTAACAGGTAATATCCCATATTCATTTACAATTACTACTTCTATAATAGTAAGTATTGGTTTCTCTTTCACTATATTAATAGCAGTTACTATTTTAGGTTTAAGTATTCATAAATTACATTTCTTTGCATACTTTGTACCTTCTGGTACACCTTTAGCTTTAGTTCCTTTATTAGTATTAATTGAATTAACTAGTTATTTAGCTAGAGCTTTCTCTTTAGGAATCAGATTATTTGCTAATATGGTAGCTGGACATACTTTAATGAAAATCTTAGCTACATTCTTATATCAAATGTTTAATACTAGTTTAATTGTAGCTGTATTAACTTTAATTCCATTTACTCTATTCTTAGCTATTATGACTTTAGAATTAGCAGTATCTG-------- Polyporus_squamosus GCACCTATTTTAGGATATTTAAATATAACTTTAAGTAATTTAGGGTTATATTCTATGATAATACTATTACTTATAGTAGGAATACATTATGCAGGAAATAATGAAGTTAAATTAGTTCCAAGTAAATGGTCTATAGCCTTAGAAAGTTTATTTGCAAGTATTCATTCTATGGTAAGAGAACAATTAGGA------AAAGAAATATACTTACCATTTATTTATTCTTTATTCTTTTTCATTTTAATAAGTAATTTAACAGGTAATATTCCATATTCATTTACAATTACTACTTCAATTATAGTAAGTATAGGTTTCTCTTTCACAATATTAACTGCAGTAACTATTTTAGGTTTAAGTATTCATAAATTACACTTCTTTTCATATTTTGTTCCATCTGGAACACCTTTAGCATTAGTACCTTTATTAGTATTAATTGAATTAACTAGTTATTTAGCTAGAGCCTTTTCTTTAGGTATAAGATTATTTGCTAATCTAGTAGCGGGACATACTTTAATGAAAATTTTATCAACATTCTTGTATAAAATGTTTAGTGCTGGTTTTATTGTATTTGTATTAACATTAATTCCATTTACTGTTTTCTTAGCAATTTGTGGTCTTGAATTAGCTGTATCTGTAATTCAA Postia_lactea ---CCTATTTTAGGTTACTTAAATATTAGTATTACTAATTTAGCTTTATATTCATTATTAGTATTATTTCTAATAGTATCTATACATTATTTTAGTAATAATGAAAACAAATTAGTACCTTCAAAATGGTCTATTTCACTAGAAAGTTTATTTGCAAGTATAAATTCAATGGTTAAAGAACAATTAGGA------AAAGAAATTTATTTACCATTTATATATTCTTTATTCTTTTTTATATTAATAGCTAACTTAACTGGTAATATTCCTTATTCTTTCACTATTACTACTTCAATTATGGTTTCAATTGGTTTATCTTTTACAATATTAATAGCTGTAACAATATTAGGTTTATCTATACATAAATTACATTTCTTCTCATATTTTGTACCTTCAGGTACTCCATTAGCTTTAGTACCTTTATTAGTATTAATAGAATTAGTATCATATTTAGCTAGAGCTTTCTCTTTAGGAATTCGATTATTTAGTAATATGGTAGCTGGACATACATTAATGAAAATATTAGCTACTTTCTTATATCAAATGTTTTCTGCTGGAGTTATTATGTTTGTATTAACTTTAATTCCATTTACTATATTTTTAGCTATAGTAGGTTTAGAAATTGCAGTTTCAATTATTCAA Pycnoporellus_fulgens ---CCAATTTTAGGTCATTTAAACATTAGTTTAACTAATTTAGGATTGTATTCACTATTAGTTTTAAGTATAATCGTAGGTATTCACTACATGGCTAATAATGAAAATAAATTAGTTCCTTCAAAATGGTCTATAGCTTTAGAAAGTATTTTTGCTAGTATAAATTCAATGGTTAGAGAACAATTAGGT------AAAGAATTATATTTACCTTTTATATATTCTTTATTTTTTTTCATACTAATAGCTAATTTAACTGGTAATGTACCTTATTCATTCACAATAACTACTTCAATTATGGTATCTATTGGTCTATCATTTACTATCTTAATTGCAGTTACAATTTTAGGTCTATCAATTCATAAATTACACTTCTTTTCTTATTTTGTACCTTCTGGTACTCCTTTAGCTTTAGTACCTTTATTAGTTTTAATTGAATTAGTTTCTTATCTAGCTAGAGCTTTCTCTTTAGGTATAAGATTATTTAGTAATATGTTAGGTGGTCATACACTTATGAAAATATTAGCTAGCTTCCTATATAAATTATTCAATAGTTCAATTTTTATAGGGGTATTAACTTTAATACCATTTACTTTATTCTTGGGTGTTGTACTATTAGAGGTTGGTGTTTCTTTCATCCAA Sparassis_brevipes_24 -----------------------------------------------------------------------------------------------TTATAATGAAAATAAATTAGTACCATCAAAATGGTCTATAGCTCTTGAAAGTATTTTTGCTAGTATAAATGCTATGGTTAGAGAACAATTAGGA------AAAGAATTATATTTACCCTTTATTTATTCTTTATTCTTTTTTATATTAATTGCTAATTTAACTGGTAACGTACCCTATTCTTTTGCAATTACTACTTCTATTATGGCCTCTATTGGTTTTTCTTTCACTATTTTAGTAGCAGTAACTATATTAGGTTTGTCAATTCATAAATTACACTTTTTCTCTTATTTTGTTCCTTCGGGAACACCTCTCGGGCTGGTGCCGCTTTTAGTAATTATTGAATTAATTTCCTACCTAGCTAGAGCTTTCTCTCTAGGGGTGCGGCTGTTCGCTAATTTAGTTGCTGGGCATGCACTTATGGCCATTTTATCCACTTTCTTGAATCAGATGTTCTCAGCAGGAGT---------------------------------------------------------------------------------- Sparassis_crispa GCTCCTATTTTAGGTTATTTAAATATTAGTTTAACTAATTTAGCTTTATATTCATTATTAGTATTATTTATAATAGTAGGATTACATTATATGGCTAATAATGATAATAAATTAGTTCCTTCAAAATGGTCTATCGCTCTAGAAAGTATATTTGCTAGTATAAATTCAATGGTTAGAGAACAATTAGGA------AAAGAATTATATTTACCTTTTATATATTCTTTATTCTTTTTCATACTAATAGCTAATTTAACTGGTAATATTCCATATTCTTTCACTATCACTACTTCTATTATGGTATCTATTGGTTTATCTTTTACTATTTTAATTGCTGTGACAATTTTAGGGTTATCTATTCATAAATTACACTTCTTTTCTTATTTTGTACCTTCTGGTACACCTTTAGCGCTTTTACCTTTATTAGTATTAATTGAATTAGTTTCATATCTTGCTAGAGCTTTCTCTTTAGGTATTAGACTATTTGCTAATGTAGTAGCAGGACACACTTTAATGAAAATATTAGCAACTTTCTTATACCAAATGTTTTCAGCTGGAATTATTATATTTGTATTAACTTTAGTTCCATTTGTGCTTTTCTTAGCTATCGTAGGATTAGAATTAGCTGTTTCTTTTATTCAA Sparassis_crispa_17 GCTCCTATTTTAGGTTATTTAAATATTAGTTTAACTAATTTAGCTTTATATTCATTATTAGTATTATTTATAATAGTAGGATTACATTATATGGCTAATAATGATAATAAATTAGTTCCTTCAAAATGGTCTATCGCTCTAGAAAGTATATTTGCTAGTATAAATTCAATGGTTAGAGAACAATTAGGA------AAAGAATTATATTTACCTTTTATATATTCTTTATTCTTTTTCATACTAATAGCTAATTTAACTGGTAATATTCCATATTCTTTCACTATCACTACTTCTATTATGGTATCTATTGGTTTATCTTTTACTATTTTAATTGCTGTGACAATTTTAGGGTTATCTATTCATAAATTACACTTCTTTTCTTATTTTGTACCTTCTGGTACACCTTTAGCGCTTTTACCTTTATTAGTATTAATTGAATTAGTTTCATATCTTGCTAGAGCTTTCTCTTTAGGTATTAGACTATTTGCTAATGTAGTAGCAGGACACACTTTAATGAAAATATTAGCAACTTTCTTATACCAAATGTTTTCAGCTGGAATTATTATATTTGTATTAACTTTAGTTCCATTTGTGCTTTTCTTAGCTATCGTAGGATTAGAATTAGCTGTTTCTTTTATTCAA Sparassis_crispa_19 ---CCTATTTTAGGTTATTTAAATATTAGTTTAACTAATTTAGCTTTATATTCATTATTAGTATTATTTATAATAGTAGGATTACATTATATGGCTAATAATGATAATAAATTAGTTCCTTCAAAATGGTCTATCGCTCTAGAAAGTATATTTGCTAGTATAAATTCAATGGTTAGAGAACAATTAGGA------AAAGAATTATATTTACCTTTTATATATTCTTTATTCTTTTTCATACTAATAGCTAATTTAACTGGTAATATTCCATATTCTTTCACTATCACTACTTCTATTATGGTATCTATTGGTTTATCTTTTACTATTTTAATTGCTGTGACAATTTTAGGGTTATCTATTCATAAATTACACTTCTTTTCTTATTTTGTACCTTCTGGTACACCTTTAGCGCTTTTACCTTTATTAGTATTAATTGAATTAATTTCATATCTTGCTAGAGCTTTCTCTTTAGGTATTAGACTATTTGCTAATGTAGTAGCAGGACACACTTTAATGAAAATATTAGCAACTTTCTTATACCAAATGTTTTCAGCTGGAATTATTATATTTGTATTAACTTTAGTTCCATTTGTGCTTTTCTTAGCTATCGTAGGATTAGAATTAGCTGTTTCTTTTATTCAA Sparassis_crispa_25 ---CCTATTTTAGGTTATTTAAATATTAGTTTAACTAATTTAGCTTTATATTCATTATTAGTATTATTTATAATAGTAGGATTACATTATATGGCTAATAATGATAATAAATTAGTTCCTTCAAAATGGTCTATCGCTCTAGAAAGTATATTTGCTAGTATAAATTCAATGGTTAGAGAACAATTAGGA------AAAGAATTATATTTACCTTTTATATATTCTTTATTCTTTTTCATACTAATAGCTAATTTAACTGGTAATATTCCATATTCTTTCACTATCACTACTTCTATTATGGTATCTATTGGTTTATCTTTTACTATTTTAATTGCTGTGACAATTTTAGGGTTATCTATTCATAAATTACACTTCTTTTCTTATTTTGTACCTTCTGGTACACCTTTAGCGCTTTTACCTTTATTAGTATTAATTGAATTAGTTTCATATCTTGCTAGAGCTTTCTCTTTAGGTATTAGACTATTTGCTAATGTAGTAGCAGGACACACTTTAATGAAAATATTAGCAACTTTCTTATACCAAATGTTTTCAGCTGGAATTATTATATTTGTATTAACTTTAGTTCCATTTGTGCTTTTCTTAGCTATCGTAGGATTAGAATTAGCTGTTTCTTTTATTCAA Sparassis_crispa_3 ---CCTATTTTAGGTTATTTAAATATTAGTTTAACTAATTTAGCTTTATATTCATTATTAGTATTATTTATAATAGTAGGATTACATTATATGGCTAATAATGATAATAAATTAGTTCCTTCAAAATGGTCTATCGCTCTAGAAAGTATATTTGCTAGTATAAATTCAATGGTTAGAGAACAATTAGGA------AAAGAATTATATTTACCTTTTATATATTCTTTATTCTTTTTCATACTAATAGCTAATTTAACTGGTAATATTCCATATTCTTTCACTATCACTACTTCTATTATGGTATCTATTGGTTTATCTTTTACTATTTTAATTGCTGTGACAATTTTAGGGTTATCTATTCATAAATTACACTTCTTTTCTTATTTTGTACCTTCTGGTACACCTTTAGCGCTTTTACCTTTATTAGTATTAATTGAATTAGTTTCATATCTTGCTAGAGCTTTCTCTTTAGGTATTAGACTATTTGCTAATGTAGTAGCAGGACACACTTTAATGAAAATATTAGCAACTTTCTTATACCAAATGTTTTCAGCTGGAATTATTATATTTGTATTAACTTTAGTTCCATTTGTGCTTTTCTTAGCTATCGTAGGATTAGAATTAGCTGTTTCTTTTATTCAA Sparassis_crispa_5 ---CCTATTTTAGGTTATTTAAATATTAGTTTAACTAATTTAGCTTTATATTCATTATTAGTATTATTTATAATAGTAGGATTACATTATATGGCTAATAATGATAATAAATTAGTTCCTTCAAAATGGTCTATCGCTCTAGAAAGTATATTTGCTAGTATAAATTCAATGGTTAGAGAACAATTAGGA------AAAGAATTATATTTACCTTTTATATATTCTTTATTCTTTTTCATACTAATAGCTAATTTAACTGGTAATATTCCATATTCTTTCACTATCACTACTTCTATTATGGTATCTATTGGTTTATCTTTTACTATTTTAATTGCTGTGACAATTTTAGGGTTATCTATTCATAAATTACACTTCTTTTCTTATTTTGTACCTTCTGGTACACCTTTAGCGCTTTTACCTTTATTAGTATTAATTGAATTAGTTTCATATCTTGCTAGAGCTTTCTCTTTAGGTATTAGACTATTTGCTAATGTAGTAGCAGGACACACTTTAATGAAAATATTAGCAACTTTCTTATACCAAATGTTTTCAGCTGGAATTATTATATTTGTATTAACTTTAGTTCCATTTGTGCTTTTCTTAGCTATCGTAGGATTAGAATTAGCTGTTTCTTTTATTCAA Sparassis_crispa_9 ---CCTATTTTAGGTTATTTAAATATTAGTTTAACTAATTTAGCTTTATATTCATTATTAGTATTATTTATAATAGTAGGATTACATTATATGGCTAATAATGATAATAAATTAGTTCCTTCAAAATGGTCTATCGCTCTAGAAAGTATATTTGCTAGTATAAATTCAATGGTTAGAGAACAATTAGGA------AAAGAATTATATTTACCTTTTATATATTCTTTATTCTTTTTCATACTAATAGCTAATTTAACTGGTAATATTCCATATTCTTTCACTATCACTACTTCTATTATGGTATCTATTGGTTTATCTTTTACTATTTTAATTGCTGTGACAATTTTAGGGTTATCTATTCATAAATTACACTTCTTTTCTTATTTTGTACCTTCTGGTACACCTTTAGCGCTTTTACCTTTATTAGTATTAATTGAATTAGTTTCATATCTTGCTAGAGCTTTCTCTTTAGGTATTAGACTATTTGCTAATGTAGTAGCAGGACACACTTTAATGAAAATATTAGCAACTTTCTTATACCAAATGTTTTCAGCTGGAATTATTATATTTGTATTAACTTTAGTTCCATTTGTGCTTTTCTTAGCTATCGTAGGATTAGAATTAGCTGTTTCTTTTATTCAA Sparassis_cystidiosa ------TTTTTAGGATATTTAAATCTTAGTTTAACTAATTTAGCTTTATATTCCCTGTTAGTCTTATTAATAATAATATCTTTACATTTTATGGCCAATAATGAAAATAAATTAGTTCCTTCCAAATGGTCTATAGCTCTAGAAAGTATATTTGCAACTATTCATTCTATGGTTAGAGAACAATTAGGA------AAAGAATTATATTTACCTTTCATATATTCTTTATTCTTTTTCATATTAATTTCTAATTTAACTGGTAATATTCCATATGCTTTTACAATAACTACTTCTATTATAGTATCTATTGGTTTATCATTTACTATTTTAATGGCAGTAACTATTTTAGGACTATCTATTCATAAATTACACTTCTTTTCTTATTTTGTACCTTCTGGTACACCTTTAGCGCTTTTACCTCTATTAGTATTAATTGAATTAGTCTCATATCTAGCTAGAGCTTTCTCTCTAGGTATCCGATTGTTTGCTAATATGTGTGCTGGACATGCTTTAATGAATATATTATCAACTTTCTTATATCAAATGTTCTCAGGAGGAGTTATTATGTTTGTAGTAACTTTACTTCCTTTTGCTATATTCTTAGCAATAGTTGGTCTTGAATTAGGTGTATCAGTCATCCAA Sparassis_radicara_32 ---CCTATTTTAGGTTATTTAAATATTAGTTTAACTAATTTAGCTTTATATTCATTATTAGTATTATTTATAATAGTAGGATTACATTATATGGCTAATAATGATAATAAATTAGTTCCTTCAAAATGGTCTATCGCTCTAGAAAGTATATTTGCTAGTATAAATTCAATGGTTAGAGAACAATTAGGA------AAAGAATTATATTTACCTTTTATATATTCTTTATTCTTTTTCATACTAATAGCTAATTTAACTGGTAATATTCCATATTCTTTCACTATCACTACTTCTATTATGGTATCTATTGGTTTATCTTTTACTATTTTAATTGCTGTGACAATTTTAGGGTTATCTATTCATAAATTACACTTCTTTTCTTATTTTGTACCTTCTGGTACACCTTTAGCGCTTTTACCTTTATTAGTATTAATTGAATTAGTTTCATATCTTGCTAGAGCTTTCTCTTTAGGTATTAGACTATTTGCTAATGTAGTAGCAGGACACACTTTAATGAAAATATTAGCAACTTTCTTATACCAAATGTTTTCAGCTGGAATTATTATATTTGTATTAACTTTAGTTCCATTTGTGCTTTTCTTAGCTATCGTAGGATTAGAATTAGCTGTTTCTTTTATTCAA Sparassis_radicata_26 ----CTATTTTAGGTTATTTAAATATTAGTTTAACTAATTTAGCTTTATATTCATTATTAGTATTATTTATAATAGTAGGATTACATTATATGGCTAATAATGATAATAAATTAGTTCCTTCAAAATGGTCTATCGCTCTAGAAAGTATATTTGCTAGTATAAATTCAATGGTTAGAGAACAATTAGGA------AAAGAATTATATTTACCTTTTATATATTCTTTATTCTTTTTCATACTAATAGCTAATTTAACTGGTAATATTCCATATTCTTTCACTATCACTACTTCTATTATGGTATCTATTGGTTTATCTTTTACTATTTTAATTGCTGTGACAATTTTAGGGTTATCTATTCATAAATTACACTTCTTTTCTTATTTTGTACCTTCTGGTACACCTTTAGCGCTTTTACCTTTATTAGTATTAATTGAATTAGTTTCATATCTTGCTAGAGCTTTCTCTTTAGGTATTAGACTATTTGCTAATGTAGTAGCAGGACACACTTTAATGAAAATATTAGCAACTTTCTTATACCAAATGTTTTCAGCTGGAATTATTATATTTGTATTAACTTTAGTTCCATTTGTGCTTTTCTTAGCTATCGTAGGATTAGAATTAGCTGTTTCTTTTATTC-- Sparassis_radicata_29 ----CTATTTTAGGTTATTTAAATATTAGTTTAACTAATTTAGCTTTATATTCATTATTAGTATTATTTATAATAGTAGGATTACATTATATGGCTAATAATGATAATAAATTAGTTCCTTCAAAATGGTCTATCGCTCTAGAAAGTATATTTGCTAGTATAAATTCAATGGTTAGAGAACAATTAGGA------AAAGAATTATATTTACCTTTTATATATTCTTTATTCTTTTTCATACTAATAGCTAATTTAACTGGTAATATTCCATATTCTTTCACTATCACTACTTCTATTATGGTATCTATTGGTTTATCTTTTACTATTTTAATTGCTGTGACAATTTTAGGGTTATCTATTCATAAATTACACTTCTTTTCTTATTTTGTACCTTCTGGTACACCTTTAGCGCTTTTACCTTTATTAGTATTAATTGAATTAGTTTCATATCTTGCTAGAGCTTTCTCTTTAGGTATTAGACTATTTGCTAATGTAGTAGCAGGACACACTTTAATGAAAATATTAGCAACTTTCTTATACCAAATGTTTTCAGCTGGAATTATTATATTTGTATTAACTTTAGTTCCATTTGTGCTTTTCTTAGCTATCGTAGGATTAGAATTAGCTGTTTCTTTTATTCAA Sparassis_spain_1 ---CCAGTTTTTGGCTATTTTAATATCAGTTTCACAAATTTCGCTTTATATTCACTACTAGTCTTATTTTTAATAGTATCTCTACATTATATGGGTAATAATGAAAATAAATTAGTACCATCAAAATGGTCTATAGCTCTTGAAAGTATATTTGCTAGTATAAATGCTATGGTTAGAGAACAATTAGGA------AAAGAATTATATTTACCCTTTATTTATTCTTTATTCTTTTTTATATTAATAGCTAATTTAACTGGTAATGTACCATATTCTTTTGCAATTACTACTTCTATTATGGCCTCTATTGGTTTTTCTTTCACTATTTTAGTAGCAGTAACTATTTTAGGGTTGTCTATTCATAAATTACACTTTTTCTCTTATTTTGTTCCTTCGGGAACCCCTCTCGGGCTGGTGCCGCTTTTAGTAATTATTGAATTAATTTCCTACCTAGCTAGAGCTTTCTCTCTAGGTGTGCGGCTGTTCGCTAATTTAGTTGCTGGGCATGCACTTATGGCCATTTTATCAACTTTCTTGTATCAGATGTTCTCAGCAGGAGTTATAATGTTTGTAGTAACTTTACTGCCTTTTGCTCTATTTTTAGCAATTATTTCTCTTGAGCTAGCAGTTTCTTTCATCCA- Sparassis_spathulata_8 ------------GGTTATTTTACGACTAGTTTCACTAATTTCGCTTTATATTCACTACTTGTTTTATTTTTAATAGTATCTTTACATTATATGGCTAATAATGAAAATAAATTAGTACCATCAAAATGGTCTATAGCTCTTGAAACGATGTTTGCAAGTATAAATACTATGGTTAGAGAACAATTAGGT------AAAGAATTATATTTACCCTTTATTTATTCTTTATTCTTTTTTATATTAATAGCTAATTTAACAGGTAACGTTCCATATACTTTTGCGATTACTACTTCTCTTATGACTTCTATTGGTTTATCTTTCACTATTTTAGTAGCAGTTACTATTTTAGGTTTGTCAATTCATAAATTACACTTCTTTTCTTATTTTGTTCCTTCCGGTACTCCTTTAGCACTTGTGCCCGCCCTGGTTTTAATAGAATTAGTCTCATACCTGGCTAGAGCTTTCTCTCTAGGAATACGACTTTTCGCTAACCTCAGCGCAGGTCATACGCTTATGGCAATTTTATCACTTTTCTT-TATAAAATGTTCAGTGCCACTATAATT------------------------------------------------------------------------------ ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'atp6-Sparassis') = N: 1-642; CODONPOSSET CodonPositions (CHARACTERS = 'atp6-Sparassis') = N: 1-642; END;