#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on June 20, 2021; 0:00 GMT TreeBASE (cc) 1994-2008 Study reference: Chen J., Cui B., & Dai Y.C. 2016. Global diversity and molecular systematics of Wrightoporia s.l. (Russulales, Basidiomycota). Persoonia, 37: 21-36. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S16109] BEGIN TAXA; TITLE Untitled_Block_of_Taxa; DIMENSIONS NTAX=117; TAXLABELS Albatrellus_ovinus Albatrellus_subrubescens Aleurocystidiellum_disciforme Aleurocystidiellum_subcruentatum Aleurodiscus_amorphus Amylosporus_bracei_1008_77 Amylosporus_campbellii_Gilbertson14806 Amylosporus_campbellii_JV080620J Amylosporus_succulentus_Dai_7802 Amylosporus_succulentus_Dai_7803 Amylostereum_areolatum Amylostereum_laevigatum Auricularia_mesenterica Auriscalpium_vulgare Basidioradulum_radula Boidinia_aculeata Boidinia_granulata Boidinia_propinqua Bondarzewia_podocarpi_Dai_9261 Bondarzewia_sp_AFTOL452 Byssoporia_terrestris Dentipellicula_leptodon Dentipellicula_taiwaniana_Cui8346 Dentipellicula_taiwaniana_dai10867 Dentipellis_coniferarum Dentipellis_coniferarum_Yuan_5623 Dentipellis_fragilis_Dai_12550 Dentipellis_fragilis_Dai9009 Dentipellis_microspora Dentipellis_parmastoi_Cui8513 Dentipellopsis_dacrydicola_Dai_12010 Dentipellopsis_dacrydicola_Dai12004 Dentipratulum_bialoviesense Echinodontium_ryvardenii Echinodontium_tinctorium Exidia_glandulosa Exidia_recisa Gloeocystidiellum_bisporum Gloeocystidiellum_clavuligerum Gloeocystidiellum_compactum Gloeocystidiellum_formosanum Gloeocystidiellum_porosum Gloeocystidiopsis_cryptacanthus Gloeodontia_columbiensis Gloeodontia_discolor Gloeodontia_pyramidata Gloeodontia_subasperispora Gloeopeniophorella_convolvens Gloiodon_nigrescens Gloiodon_strigosus_AF506449 Gloiothele_lactescens Hericium_abietis Hericium_alpestre Hericium_americanum Hericium_cirrhatum Hericium_coralloides Hericium_erinaceus Heterobasidion_annosum_061292 Heterobasidion_parviporum_041213 Lactarius_leonis Larssoniporia_sp_dai13607 Larssoniporia_sp_dai13608 Laurilia_sulcata Laxitextum_bicolor Lentinellus_auricula Lentinellus_cochleatus Lentinellus_omphalodes Lentinellus_ursinus Lentinellus_vulpinus Megalocystidium_luridum Peniophora_pini Polyporoletus_sublividus Pseudowrightoporia_sp_Cui_9073 Pseudowrightoporia_sp_Cui3344 Pseudowrightoporia_sp_Dai_10007 Pseudowrightoporia_sp_Dai_8132 Pseudowrightoporia_sp_Dai_8152 Pseudowrightoporia_sp_Yuan5884 Pseudowrightoporia_sp_Yuan6101 Pseudowrightoporia_sp_Yuan6106 Pseudowrightoporia_sp_Yuan6247 Pseudoxenasma_verrucisporum Russula_violacea Scytinostroma_ochroleucum Scytinostroma_odoratum Scytinostromella_nannfeldtii Sistotrema_brinkmannii Sistotrema_coronilla Sistotrema_muscicola Sistotrema_sernanderi Stereum_hirsutum_NH7960 Trichaptum_abietinum Vararia_ochroleuca Wrightoporia_Wrightoporia_labyrinthina_Yuan1475nthina_TFM_F20724 Wrightoporia_avellanea_LR41710 Wrightoporia_biennies_Cui_8457 Wrightoporia_biennies_Cui_8509 Wrightoporia_casuarinicola_Dai_1614 Wrightoporia_casuarinicola_Dai_6914 Wrightoporia_cylindrospora_PRM915962 Wrightoporia_cylindrospora_Ryvarden46609 Wrightoporia_japonica_KUC20110908 Wrightoporia_labyrinthina_Yuan1475 Wrightoporia_lenta_Dai10462 Wrightoporia_lenta_Dai12850 Wrightoporia_luteola_Dai_12086 Wrightoporia_luteola_Dai_7221 Wrightoporia_pouzarii_Ipulet_F1883 Wrightoporia_rubella_Dai_9233 Wrightoporia_subavellanea_Dai11484 Wrightoporia_subavellanea_Dai11488 Wrightoporia_subavellanea_Dai11492 Wrightoporia_tropicalis_16446 Wrightoporia_tropicalis_18245 Wrightoporiopsis_sp_Yuan_3460 Wrightoporiopsis_sp_Yuan_3467 Wrightoporiopsis_sp_Yuan_3579 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M38998] TITLE Russulales_ITS_and_nLSU; LINK TAXA = Untitled_Block_of_Taxa; DIMENSIONS NCHAR=2132; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Albatrellus_ovinus ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTCTTGGTAT--TCCGAGGGGCACGCCTGTTTGAGTATCGTGAAA--TCATGA{AG}G{CG}G-G-ATCCCTTTTGT-----------------GAAAACGAAGGGAG-AGGGCTTGGACTT-GGAGG-A---TTTGCCGGTCTC------CCCCCTTTGT--------------GTTTGGGATCGGCTCCTCTGGAA-TGCAT--TAGTGGAGCT---TT---------------CGACCGCCC-------TCGGTGT---GATAAT---CGTCT-GCGCCGACGTGTG-GAAAGAGTTA-------------------------------------------------AAGCGTTGCTT-CGAAC-------GGTCTCGTCCCGAGACAAGCTTT----TT-GAACCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCTGGCG-GTCTTT-GGCCGTCCGAGTTGTAGTCTGGAGAAGCGCTTTCCGCGC{CT}-GGACCGTGTACAAGTCCTCTGGAACGGGGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCGG--TGCT-CTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACGTCGTCC-AGGATTCAGCCTT-GAGG-CTTCTCTCGGTGTACTTTCTGGTTCGACGGGCC-AGCATCGATTTCGAT-CGTCGGACAAAGACCGGGGAAACGTGGCACCTT-T--CGGGGTGTG-TTATAGTCCCTT---GTCGTA-TACGATGGTCGGGATCGA-GGAACTCGGCA-CGCCTTTGT---GGTCGGGGCTCAGGCCCACGTC-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTAGGGTGG--AAAACCCTTGCGCGTAATGAAAGTGAAA-GTTGGGACCTTCG-AGAGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTGGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCGAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTCGTTAG-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTCGAAACGACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTCGATCGGACCGCTTGCATGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCCAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCG-A-TGAACTAGCCCTGAAAA-TGGATGGC Albatrellus_subrubescens ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTCTTGGTAT--TCCGAGGGGCACGCCTGTTTGAGTATCGTGAAA--TCATCAACCCTG-ATCCCTCTTGT-----------------GAAAATGAAGGGAGGAGGGCTTGGACTT-GGAGGGA---TTTGCTGGTC---------CCCCTTTGT--------------GTTTGGGATCGGCTCCTCTGGAA-TGCAT--CAGTGGAGCT---TT---------------CGACCGCCC-------TCGGTGT---GATAAT---CGTCT-GCGCCGAAGTGTG-GAAAGAGTTA-------------------------------------------------AAGCGTCGCTT-CGAAC-------GGTCTCGTCCCGAGACAAGCTTT----TT-GAACCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCTGGCG-GTCTTT-GGCCGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGTGC{CT}-GGACCGTGTACAAGTCCTCTGGAACGGGGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCGG--TGCT-TTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCC-AGGATTCAGCCTT-GAGGGCTTCTCTCGGTGTACTTTCTGGTTCGACGGGCC-AGCATCGATTTCGAT-CGTCGGACAAAGGCCGGGGAAACGTGGCACCTT-T--CGGGGTGTG-TTATAGTCCCTT---GTCGTA-TACGATGGTCGGGATCGA-GGAACTCGGCA-CGCCTTTGT---GGTCGGGGCTCAGGCCCACGTC-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTAGGGTGG--AAAACCCTTGCGCGTAATGAAAGTGAAA-GTTGGGACCTTCG-AGAGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTGGAGCGTGTATGTTAGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCGAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTCGTTAG-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTCGAAACGACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTCGATCGGACCGCTTGCATGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCCAGACAGCAGGACGGTGGGCATGGAAGTCGGAACCCACTAAGGAGTGTGTAACAACTCACCTGCCGGA-TGAACTAGCCCTGAAAA-TGGATGGC Aleurocystidiellum_disciforme ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGA?TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT--TCCGAGGGGCACGCCTGTCTGAGTGTCGTTAAA--TTCTCAACCAAGGCTCATCCTTTC-----------------GGGGATG----GGCCTTGGCTTGGATTT-GGAGGCTT--TTGCCGGC----------CTTGACCCCTCGGG--------------GCGGTCGGCTCCTCTTGAA-TGCAT--TAGCG-TGACCCTCT---------------CGCAGGTCGTTCGCCTCTGGCTT---GATAAT---TGTCT-ATGCCGTT--GGCTGTCCGA{ACT}CCGTGAGCCC----------------------------ACGGGGGG---------CCTCGCTT-CTAACCGT--CCCT------CGGGACACTACTC--------TAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCTTCCGGCCGTCCGAGTTGTAGTCTAGAGAAGTGCCTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACCG-CCAG--TGCT-ATGTGATGTGCTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGCC-GGGACTCAGCCTT-GCAA-TCTTGCCTGGTGTACTTTCCGGT-GGACGGGTC-AGCATCAATTTTGAC-CGTCGGACAAGGGCGGGGGAAATGTGGCACCCT-C----GGGTGTG-TTATAGTCCTCC---GCCGCA-TACGTCGGTTGGGATTGA-GGAACTCAGCA-CGCCTTCAC--AGGTCGGGGCTTT-GCCCACGTTATCGTGCTCAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCACGG-TAGCAGAAACTCGT----ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTCGATTGGACCGCTTG-GCGATTGAGAGTTTCTAG{ACT}GGGGCC{ACT}TTTT{CGT}GT{AGT}{ACT}{AGT}CAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTA{GT}ACAGCAGGACGGTGGCCATGGAAGTCGGAATCC{CG}CTAAAGAGTGTGTAAAAACTCACCTGCCGA{AG}-TGAACTAGCCCTGAAAA-TGGATGG{CG} Aleurocystidiellum_subcruentatum ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGA?TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT--TCCGAGGGGCACGCCTGTCTGAGTGTCGTTATA--TTCTCAACCAAGGTC--TCCTTTC-----------------GAGGTTG----GACCTTGGCTTGGACTT-GGAGGCTC--TTGCCGGC----------CTTGACCCTCCGGG--------------GCGGTCGGCTCCTCTTGAA-TGCAT--TAGTG-TGACCCTCT---------------TGT-GGTCGTCCGCCTCTGGCTT---GATAAT---TGTCT-ATGCCGTT--GGTGTGTCGGTCCACGAGCTC----------------------------ATGTGGG----------CCTCGCTT-CTAACCGT--CCTC------TCGGGGACAGCTCCA----TCTAC--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GCCTTTGG--CGTCCGAGTTGTAGTCTAGAGAAGTGCCTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACCG-CCAG--TGCT-ATGTGATGCGCTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCC-GGGACTCAGCCTT-GCAA-CCTTGCCTGGTGTACTTTCCGGT-TGACGGGCC-AGCATCAATTTTGAC-CGTCGGACAAGGGCGGGGGAAATGTGGCACCCT-C----GGGTGTG-TTATAGTCCCCC---GTCGCA-TACGTCGGTTGGGATTGA-GGAACTCAGCA-CGCCTTTAC---GGTCGGGG-TTC-GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGT--AAAACCCATGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-{GT}TCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCGT----ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTG-GCGATTGA{CG}AGTTTCTA{CG}T{ACG}{AG}GG{CGT}??{CT}TT{ACT}GGGAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAA------------------------------------------- Aleurodiscus_amorphus ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTAT--TCCGAAGG-CACACCTGTTTGAGTGTCGTGAAA--TCATCAACTCTT----ACTTTCTT-----------------GATTGAA----AGTCTGAGATTGGACTT-GGAGGCT---TTTGCTGG----------TCCCTAGGA-----------------------TCGGCTCCTCTCAAA-TGCAT--CAGTGCG--GCTCGT---------------TGCCAACGTA---CCTTTGGTGT---GATAAA---TATCT-ACGCTTCT---GGT--CACGTGGCTACTT-------------------------------G---TG--------AGACGTGCTC-CTAACCGT--C------CTT--CAGTTGGACACTT---CATGAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTTTC--GGCTGTCCGAGTTGTAATCTGGAGAAGCGTTTTCCGCGTT-GGACCGTGTACAAGTTTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACC--CCAA--TGCT-TTGTGATACGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCC-GGGACTCAGCCTT-GCTT---CCGCTTGGTGTACTTTCCGGT-TGACGGGCC-AGCATCAATTTTGAC-CGCGGGATAAAGTCCGGAGGAAGGTGGCTCTTC-C---GG-A-GTG-TTATAGCCTCTG---GTCACA-TGCCGCGGTTGGGATTGA-GGAATTCAGCA-CGCCTTTAATTAGGTCGGGG-TTC-GCCCACGT--TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGATCCCTGTCGTGGGGTGCACCGACGCCCGGACCAGAACTTCTGTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Amylosporus_bracei_1008_77 --------------------------------------------GAGGCAT----------GTGCACGCCTGTTCC-ATCTC-TCCAACC-TTTCATATTAAA---CCCCTTGTGAACACATTTGCAT--GTGTGGGAAGAAGGAAACAGAGAAGGTTGGTGAACAAAATCTCATCCTCCTGACAAACCCCATGCCCTTTTCACCACAAACTCCTTTGCATGTAATCTGGAATGT----------CTGATGTGTATAAAAACCA-CATATAATAAAACACACACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCACCGAAATGCGATAA-GTAATGTGAATTGCATAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCCA-TTCCTTGGGGCACACCTGTTTGAGTGTCGGGGAA--CTCTCAACTCTCTCCCTTTCTTTT-------------------GAGTGAAAGGGATTGAGCTTGGACTTTGGAGGGCCC-TTTGCTGGCAG---------CGTTAAATATAA------------TGTATGCCGGCTCCTCTAAAA-TGCAT--TAGCGAGAGAACGCAG---------------GGCCATGCGCGCGCATATGCGTGTGTGTGGTC-TCGTCTCATCTCTCGGTGTGATAAAGCTTTGTC------------------------------------------------TACGCCGTCTGTGGGATGA-----------CCTTGAAGCGCTCGCT----TATAATAGCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG-GTCT-CTGGCCACTCGAGTTGTAGTCTGGAGAAGTGTCTTCTGTGTC-GGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACAA-CCGG--CGCTCT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACGCCCATC--AGAATCAGCCTG----CAACCTGCCTG-TGTATTTCT---GGCGTCGGGCC-AGCATCAAATTGAAC--AACGGATAAAG-TGAGGGAAATGTGGCCACCT----TCGGGTGTGGTTATTAGTTCCCTCCATCGCAATGCCGATGTTGGGATTGAAGGACTCCAGCAACGCCCTTG---TGGGCGGGGGCATTGCCCACGCT--CGTGCTTAGGATGCTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGG--AAAACCCATGCGCGCAATGAAAGTGAAAGTTTGGGACCTCTGTCATGGAGGGCACCGAAGCCCGGCCCTGAAGTTCTCTGACGGTGCTGCGGTGGAGCGTGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAATAAGGGTGGAAGGCCAGAGGAAACTCTTGGTGGAGGGTCTCGTAGCGATTCTGACGGTGCAAATCCGATCCGTTCAAATTTGGGGTAATAGGGCGCGAAGAGACTAATTCGAACCATTCTAGTAGCTGGTTCCTTGCCGAAGTTTCCCTCAGGAATAGCAGAAGCTCAC-CTCATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGGTTGGACCGCTCG-GCGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Amylosporus_campbellii_Gilbertson14806 --------------------------------------------GGGGCATT---------GTGCACACCTGTTCC-ATCTT-TC------TTTCTCATAACA--CTCC-CTGTGAACACATTTGCATA-GTGGAAGGAAGGGGAAACGGGAGGGGTTCTTCCTTCTCTGACCTGCCCTGTGCAAAAAAAACCCCTTTCAATCATGAAACTCCTTTTGCATGTAATTTGGAATGT----------TTGATGC--ATTTTGTAA--CATGTTTAGAAACATACACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCCA-TTCCTTGGGGCACACCTGTTTGAGTGTCATGAAA--TTCTCAAAACTCTGTTTTTCCCCTCTTGAATTTGAATGAATGAATGAAAGAGGGGAGGGATGTGAGCTT-TTGGACTT---TGGAGGGC---------CCCTTTTGCTGGCA------------ACATTGCTGGCTCCTCTGAAA-TGTATATCGGCGAGAGAGGGGT-----------------GTTGTGCATGCATATCGTTGT---GCTGGCT-CTCCCCCTCATCATCTCATCCCTCTCGGTGTGATA---------------------------------------------AAGCTTTGTTT-TG{CT}GCCGT----------TTGAGGGGGGGATGGTCATGTAGTGCTCGCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG-GTCT-CTGGCCACCCGAGTTGTAGTCTGGAGAAGCGTCTTCTGTGCC-GGACCATGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACATGGATGACCTGG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAAAGACC-GATAGGGAACAAGTTCCGTGAAGGGAAAGAATGAAAAGCACTTGGAAAAGAGGAGGTAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACGTCTGCCAGAACTCCAGCCTT--GCAACCTTGCTTGGTGTACTTTCCTGGTGGTCGGGCC-AGCATCAATTT-GAC-CATCGGATAAAGGCAAGGGAAATGTGGCACCTT-----TGGGTGTG-TTATAGTCCCTT---GTCGCA-TGCGATGGTTGGGATTGA-GGAGCTCAGCA-TGCCCTTGT--TGGTCGGGGCTTT-GCCCACGTC--CATGCTTAGGATGCTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGGA-AAAACCCATGCGCGAAATGAAAGTGAAAGTTTGGGACCTCTGTCATGGAGGGCACTGAAGCCCGGCCCTGAAGTGCTCTGACGGTGCTGCGGTGGAGCGTGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTCAC--TCATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCACTTGGTTGGACCGCTCG-GTGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Amylosporus_campbellii_JV080620J --------------------------------------------GGGGCATT---------GTGCACACCTGTTCC-ATCTT-TC------TTTCTCATAACA--CTCC-CTGTGAACACATTTGCATA-GTGGAAGGAAGGGGAAACGGGAGGGGTTCTTCCTTCTCTGACCTGCCCTGTGCAAAAAAAACCCCTTTCAATCATGAAACTCCTTTTGCATGTAATTTGGAATGT----------TTGATGC--ATTTTGTAA--CATGTTTAGAAACATACACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCCA-TTCCTTGGGGCACACCTGTTTGAGTGTCATGAAA--TTCTCAAAACTCTGTTTTTCCCCTCTTGAATTTGAATGAATGAATGAAAGAGGGGAGGGATGTGAGCTT-TTGGACTT---TGGAGGGC---------CCCTTTTGCTGGCA------------ACATTGCTGGCTCCTCTGAAA-TGTATATCGGCGAGAGAGGGGT-----------------GTTGTGCATGCATATCGTTGT---GCTGGCT-CTCCCCCTCATCATCTCATCCCTCTCGGTGTGATA---------------------------------------------AAGCTTTGTTT-TG{CT}GCCGT----------TTGAGGGGGGGATGGTCATGTAGTGCTCGCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG-GTCT-CTGGCCACCCGAGTTGTAGTCTGGAGAAGCGTCTTCTGTGCC-GGACCATGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACATGGATGACCTGG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAAAGACC-GATAGGGAACAAGTTCCGTGAAGGGAAAGAATGAAAAGCACTTGGAAAAGAGGAGGTAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACGTCTGCCAGAACTCCAGCCTT--GCAACCTTGCTTGGTGTACTTTCCTGGTGGTCGGGCC-AGCATCAATTT-GAC-CATCGGATAAAGGCAAGGGAAATGTGGCACCTT-----TGGGTGTG-TTATAGTCCCTT---GTCGCA-TGCGATGGTTGGGATTGA-GGAGCTCAGCA-TGCCCTTGT--TGGTCGGGGCTTT-GCCCACGTC--CATGCTTAGGATGCTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGGA-AAAACCCATGCGCGAAATGAAAGTGAAAGTTTGGGACCTCTGTCATGGAGGGCACTGAAGCCCGGCCCTGAAGTGCTCTGACGGTGCTGCGGTGGAGCGTGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTCAC--TCATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCACTTGGTTGGACCGCTCG-GTGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Amylosporus_succulentus_Dai_7802 ATGAAGCTTTTGGGTGGGCTGTAGCTGGCCCCCCTCCCCTGG--GGGGCATTGT-------GTGCACGCCCGTTCCCATCTTCTCCAACCCTTTCTCATAACAAACCCCCCTTGTGAACACACTTGCATAGTGGAAGGAAGGGGGAAAATGGAGGGA--TCTTCCTCCTCTTCCCTGACCTGCCCTGTGCTCCCTTTTCATCATGTAACTCCCTTT-GCATGTAAATTGGAATGT----------TTGACGC--ATTTTGTAATGCATTGTAAAACATATACACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGACAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCCA-TTCCTTGGGGCACACCTGTTTGAGTGTCATGAAA--TTCTCAACTCTGTTCCCCTTCTTGAAT-------------GAAAGGAGGGGGATGTGAGCTTTGGACTTTGGAGGGCCC-TTTCCTTGC-----------TGGCAAC-------------------ATTGCTGGCTCCTCTGAAA-TGTAT--CAGCGAGAGAGGTGTGCATGGTGCATCCCCCCCCCCCCCTGCCATGTGTGTGTGG-GGTGGTG--CATTGTGTGTGCTGGCTCCATCCATCTCATCTCTTGG-----------------------------------TGTGATAAAGCTTTGTCT-TGCGCCGT----------TTGAAGGGATGGATGGT---CATGTAGTGCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG-GTCT-CTGGCCACCCGAGTTGTAGTCTGGAGAAGCGTCTTCTGTGCTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGATGA-CCAG--TGCTCT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACGTCCACC-GGAACTCAGCCCT--GCAACCTTGCTTGGTGTACTTTCT-GGTGGTCGGGCC-AGCATCAATTTTGAT-CATCAGATAAAGGCAAGGGAAATGTGGCACCTT-----TGGGTGTG-TTATAGTCCCTT---GTCGCA-TGCGATGGTTGGGATTGA-GGAACTCAGCA-TGCCCTTG---TGGCCGGGGGCTTTGCCCCCACGTCCATGCTTAGGATGCTGGCGTAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGGA-AAAACCCATGCGCGCAATGAAAGTGAAAGTTTGGGACCTCTGTCATGGAGGGCACTGAAGCCTGGCCCTGAAGTTCTCTGACGGTGCTGCGGTAGAGCGTGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTCAC--TCATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCACTTGGTTGGACCGCTCG-GTGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Amylosporus_succulentus_Dai_7803 ATGAAGCTTTTGGGTGGGCTGTAGCTGGCCCCCCTCCCCTGG--GGGGCATTGT-------GTGCACGCCCGTTCCCATCTTCTCCAACCCTTTCTCATAACAAACCCCCCTTGTGAACACACTTGCATAGTGGAAGGAAGGGGGAAAATGGAGGGA--TCTTCCTCCTCTTCCCTGACCTGCCCTGTGCTCCCTTTTCATCATGTAACTCCCTTT-GCATGTAAATTGGAATGT----------TTGACGC--ATTTTGTAATGCATTGTAAAACATATACACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCCA-TTCCTTGGGGCACACCTGTTTGAGTGTCATGAAA--TTCTCAACTCTGTTCCCCTTCTTGAAT-------------GAAAGGAGGGGGATGTGAGCTTTGGACTTTGGAGGGCCC-TTTCCTTGC-----------TGGCAAC-------------------ATTGCTGGCTCCTCTGAAA-TGTAT--CAGCGAGAGAGGTGTGCATGGTGCATCCCCCCCCCCCCCTGCCATGTGTGTGTGG-GGTGGTG--CATTGTGTGTGCTGGCTCCATCCATCTCATCTCTTGG-----------------------------------TGTGATAAAGCTTTGTCT-TGCGCCGT----------TTGAAGGGATGGATGGT---CATGTAGTGCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG-GTCT-CTGGCCACCCGAGTTGTAGTCTGGAGAAGCGTCTTCTGTGCTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGATGA-CCAG--TGCTCT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACGTCCACC-GGAACTCAGCCCT--GCAACCTTGCTTGGTGTACTTTCT-GGTGGTCGGGCC-AGCATCAATTTTGAT-CATCAGATAAAGGCAAGGGAAATGTGGCACCTT-----TGGGTGTG-TTATAGTCCCTT---GTCGCA-TGCGATGGTTGGGATTGA-GGAACTCAGCA-TGCCCTTG---TGGCCGGGGGCTTTGCCCCCACGTCCATGCTTAGGATGCTGGCGTAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGGA-AAAACCCATGCGCGCAATGAAAGTGAAAGTTTGGGACCTCTGTCATGGAGGGCACTGAAGCCTGGCCCTGAAGTTCTCTGACGGTGCTGCGGTAGAGCGTGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTCAC--TCATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCACTTGGTTGGACCGCTCG-GTGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Amylostereum_areolatum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TG-GAATTGTAGAATTCTGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT--TCCGAGGGGCACACCTGTTTGAGTGTCGTGAAT--TTCTCAACTCCGTCTCCTT----T-----------------GCGGGAGCG-----CGGGGCTTGGAGTT-GGAGGCT----T-GCGGG----------CGT-------------------------AAGT-CCGCTCCTCTCAAA-TGCAT--TAGTGAAG-CCCAGG---------------TG----------G-CCTCGGCGT---GATAAT---TGTCT-ACGTCCA-AGGTTGTC--TGTAGC-------------------------------------------------GGTTTTCGCTT-CTAACCGT--CCTTC--------GGGACAA-TT-C---ATCGAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG--TCTTC-GGGCGTCCGAGTTGTAGTTTAGAGAAGCGTTTTCCGCGCC-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCGG--TGCT-CTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCTATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAATAAATCGCGTTCGCC-GGGAATCAACCTT-GC---TTCGGCTCGGTGTACTTCCCGGT-GTACGGGCC-AGCATAACTTTTGAT-CGTCGGAAAAGGGCGGGGGAAAGGTGGCACCTT-C----GGGTGTG-TTATAGTCCCTT---GTCGTA-TACGATGGTTGGGAGTGA-GGAACTCAGCA-CGCCTT-AC---GGTCGGGGTTC--GCCCACGTT--CGTGCTTAGGATGCTGCCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGTTCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----GTCAGATTTATGTGGTAAAGC?AATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGATCGAGCCGTCTCTTGATTGGACCGCTCG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Amylostereum_laevigatum -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT--TCCGAGGGGCACACCTGTTTGAGTGTCGTGAAT--TTCTCAACTC{CT}GCCTCCTT----T-----------------GCGGGAGCG-----CGGGGCTTGGAGTT-GGAGGTT----TTGCGGG----------CGC-------------------------AAGT-CCGCTCCTCTCAAA-TGCAT--TAGTGAAG-CCCAGG---------------TG----------G-CCTCGGCGT---GATAAT---TGTCT-ACGTCCA-AGGTTGTC--TATCGC-------------------------------------------------GGTTTTTGCTT-CTAACCGT--CCCTC--------GGGACAA-TT-C---ATCGAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG--TCTTC-GG{CG}CGTCCGAGTTGTAGTTTAGAGAAGCGTTTTCCGCGCC-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCGG--TGCT-CTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTAAGTC{CG}CGTTCGCC-GGGAATCAACCTT-GC---TTCGGCTCGGTGTACTTCCCGGT-GTACGGGCC-AGCATCACTTTTGAT-CGTCGGAAAAGGGCGAGGGAAAGGTGGCACCTT-C----GGGTGTG-TTATAGTCCCTT---GTCGTA-TACGATGGTTGGGAGTGA-GGAACTCAGCA-CGCCTT-AC---GGTCGGGGTT?--GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTATCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGTTCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Auricularia_mesenterica -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAATCTGGCG-GTCTC-AGGCCGTCCGAGTTGTAATCTAGAGAGGTGTTTTCCGTGCC-GGACCGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCC-ATGACACGGACTA-CCGGTG--CTCT-GTGATACACCTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGCA-GGGACTCAGCCTTGCT----TCTGCTTGGGG?ACTTCTC-TGTGGATGGGCC-A{AG}CATCGATTTTG-T-CGCCG{AG}AAAAGGGCGGGAGGAATGTGGCAGCAA--TTTTTGCTGTG-TTATAGCCTCTC---GTCGTA-CACGGTGGTCGGGATCGA-GGACTGCAGCA-CGCCTTTGG-----TCGGGGTTCG--CCCACGCC-ACGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACC{CGT}GTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG--AAAACCCAGGCGCGTAATGAAAGTGAAA-GTTGGGA---CTCTTTAGTGAGGCACCGACGCCCGAACCTGAAGTCTTCTGACGGTTTTGAGGCAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-T-CCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCGCAT----CAGTTTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGATCGGACCGTCACTTGATTGGACCGTCTGG-CGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAA-AAATCACCTGGCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Auriscalpium_vulgare -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT--TCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCTT-CCCCCTTTTAC-----------------GAGGCGGG---CTTGTGGA-TTGGACTT-GGAGGTCT--TTTGCCGG----------CTTTTTACT--------------------AAGTCGGCTCCTCTTAAA-TGTAT--TAGTAGGA-CCTTCA---------------GTTGAAGAAG---CCTC-GGTGT---GATAAT---TATCT-ACGCCGGCTCGTGTGCTATATTCACT---------------------------------GTATGTT--------GAACCTGCTT-CTAACCG---TCTC-----GCAAGGGACAAATTAAATTATCGAA--CCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCTCTGG-CCGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCT-CTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGAAAACACTTGAAGTCAGTCGCGTTCCTC-GAGACTCAGCCTT-GCCT-TCCGGCCTGGTGTACTTCTCGTT-GAACGGGCC-AGCATCAATTTTGAT-CGTCGGATAAAGGCGGGAGGAAGGTGGCACCCC-TCG--GGGTGTG-TTATAGCCTCTC---GTCACA-TACGACGGTTGGGATTGA-GGACCGCAGCA-CGCCTTTA---TGGTCGGGG-TTC-GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGAGGTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Basidioradulum_radula ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTAT--TCCGAGGAGCATGCCTGTTTGAGTGTCATGTTA--ATCTCACTCTC---CTTGACTTTG-----------------TTGTCT-------CGGATAAGTGGACTT-G-AAGGTT-----GCCGGC-----------CCCCCTT---TA------------GGGGGTCAGGCTCCTTTCGAA-TGTAT--TAGCTGGG--CTTTCG---------------CTCGTCC--TT-----TGGTGT---GATA----GTTTTATTCACTATTGGACT----TGTGAT--------------------------------------------TTC----GGT-CTGCTT-CTAATCG----------TCTT--CGGACAC--------ATTCTTGACTTAGTAACTGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCG-GCTTTG---CCGTCCGAGTTGTAATCTGGAGAAGCGTTTTCCGCGTC-GGACCGTGTACAAGTCTCTTGGAACAGAGCTTCATAGAGGGTGAGAATCCCGTCC-ATGACACGGACCG-CCGA--TGCTTT-GTGATACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTAAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCC-GGGACTCAGCCTT----GCTTCTGCTCGGTGTACTTCCCGGTA-GACGGGTC-AACATCGATTTTGGC-CGACGGATAAAGGGGTTGGGAATGTGGCACTC---TTCGGGGTGTG-TTATAGCCCTTC--TTCCGCA-TACGCCGGCCGGGATCGA-GGACCGCAGCG-CGCCTTAA---TGGCCGGGGGCTCGCCCCACGTT-ACGCGCTTAGGATGTTGGCATAATGGCTTTAAGCGACC?GTCTTGAAACACGGACCAAGGAGTCTAACATGCTCGCGAGTGTTAGGGTGG--AAAACCCTTGCGCGTAATGAAAGTGAAA-GTTGGGACTCTCGC-GAGGGAGGCACCGACGCCCGGCCCTGAAGTTCTCTGACGGTGCTGCGGTAGAGCGCGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGCGAA---C-AGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Boidinia_aculeata -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAC-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTCTTGGTAT--TCCGAGAGGCACGCCCGTTTGAGTGTCATGAAA--TTCTCAACCCCTCTTGGTTTTCTT-----------------TTGAAT--ATCAAGATGGGCTTGGACTT--GGAGGCT--CTTGCTGGAGG-------CTT------AATTG---------------CGATCAGCTCCTCTTAAA-TGCAT--TAGCAGGGTCTTCTT---------------TGCC-------GACCTTTGGCGT---GATAAG---TATCT-ACGTCCCATGGTGTGG-CTCTGAT--ATC-GAGGCCTGCTTCGAACCGTC---------TCTT-GAC-----{AG}GAGACAACCTTTGAGTTTCC--CCCCCTCTTCTTTAGAGAGAGGGCCTCATTCTGAAACCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCTT-TGGCTGTCCGAGTTGTAATTTAGAGAAGCGTCTTCCGCGCT-GGACCGTGCACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGGCACGGACCC--CAG--TGCT-CTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAACTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGACC-GAGACTCAGCCTT-GC-C-TTGGC-TTGGTGTACTTCTCGGC-TGACGGGTC-AGCATCAATTTTGCC-CCTTGGATAATGGCGAGGGAAAGGTGGCACCTT-TG----GGTGTG-TTATAGTCCCCC---GTCGCA-TACAAGGGTTGGGATTGA-GGAACTCAGCA-TGCCCCGCGAGGGGTCGGGGCTTCGGCCTACG-T-ACGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCGAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGATGAAACATCC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Boidinia_granulata -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATA--GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT--TCCGAGGGGCACGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCC---TCTCCTTTCTT-----------------GACCG----AAGGACAGGGCTTGGACTT--GGAGGT---CTTGCCGGCGTT------CCCGCCTCG--------------GGCTGGGGTTCGGCTCCTCTCGAA-AGCAT--TAGTGAGACC----C---------------CTTGCGGCC-------TCGGTGT---GATAAT---TGTCT-ACGCCGTGGGCTTAGC?????GCG-------------------------------------------------GGAC-CCGCTT-CGAAC-------CGTCCCTTCGCGGGACACTTTCT----TTATGAAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-G-CTTC-GGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTG-CCAG--TGCT-TTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGACC-GAGACTCAGCCTC-GC---CTTGGCGTGGTGTACTTCTCGGC-CGACGGGCC-AGCATCAATTTTGGT-CCTCGGAAAAGGGCTCGGGAAAGGTGGCACCCT-C----GGGTGTG-TTATAGTCCCGG---GTCGCA-TACGAGGGCTGGGATTGA-GGTACTCGGCG-CGC--------------------------------AAGCGCTTGGGATGCTGGCGTAATGGCTTTAAACGACC?GTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGATCCCTGTCGTGGGGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCGT----GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTCGAAACGACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Boidinia_propinqua ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAC-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCACCTCTTGGTAT--TCCGAGGGGTACACCCGTTTGAGTGTCGTGAAA--TTCTCAACCT-TCTCGGTTTTC-------------------ATTGACCGATTG---AAGGCTTGGACTT-TGGAGGTT--CATGCTGGCCG-------CAA---------------------------GGTCAGCTCCTCTTAAA-TACAT--TAGCTGGGTCCTCTT---------------TGCTT-T----GACCTCTGGCGT---GATAAG---TATCT-ACGTCTTTGGCTCGGGGCTCTGTTCATAT-GGGACTTGCTTCTAATCGTC---------TCTTTGA-------GAGACAA----------------CGTCGAGGGCATAGACTCTCGCAT---CAC---AACCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCTT-TGGCCGTCCGAGTTGTAATTTAGAGAAGCGTCTTCCGCGCT-AGACCGTGCACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGGCACGGACCC--TAG--TGCT-TTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAACTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGACC-GAGACTCAGCCTT-GC-C-TCGGC-TTGGTGTACTTCTC{CG}GC-TGACGGGTC-AGCATCAATTTTGAC-CGTCGGATAATGGCAGAGGAAAGGTGGCACCCT-CG----GGTGTG-TTATAGTCCTCT---GTCGCA-TACGACGGCTGGGATTGA-GGAACTCAGCA-TGCCCCGTGAGGGGTCGGGGCTTCGGCCTACG-T-ACGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACC?GTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCGAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----GTCAGATTTATGTGGTAAAGCGGATGATTAGAAG-CCTTGGGGATGAAACATCC-TTAACCTATTCT-CAAACTTTAAATATGT{AT}AGAACGAGCCGTCGCTTGATTGAACCGCTCC-GCGATTGAGA{AG}TTTCT{AT}ATGGGGCATTTTTGGTAAGCAGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Bondarzewia_podocarpi_Dai_9261 ACGAA-TTTT----GTCCGGGGCCGAT-GCTGGCCTCCT------CAGGCA---------TGTGCTCGCCCTGTTCATA---------TCCTCTCACACCTGTGCACTCTCGCGTGGGCCGG-----C--------------------------------------ATCCCCGCCGGCCTGCGTCTTCTC--------------ACAAACTC-TT-GC--ATGGTCATACGCATGG------------TACCGATGCCGTG---AAAACGCATCTC--ATA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGCAT--TCCGAAGGGCACACCTGTTTGAGTGTCGTGAAA--TTCTCAACCCCCCCTCTTTTTCTT----------------GAAAGAGGGTTGTGG--GGGTTGGACTTT-GGAGGCTG---TTGCCGGT-----------CTGT----------------TG----GTGATCGGCTCCTCTGGAA-AGCAT--TAGCGAGAAGGC-----------------CCCTTGCGGGGCTGCCCCTGGTGT---GATAA---TGGTCT-ACG---------------CCACGGAC-----------------------------------------------GTCCCGCGCAC-TTTCGTG------------------------TGGG---GCCCTTGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TTGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGTC-GGCCCGTGTACAAGTTTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-CTGACACGGACCG-CCGA--TGCTTT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTCGAAGTCAGTCGCGTCCGCC-GGGACTCAGCCTTGCAACCCTT-GCTCGGCGTACTTTCT-GGTGGACGGGCC-AGCATCAATTTTGGC-CGTCGGACAAAGGCTGGAGAAATGTGGCACCT---TC--GGGTGTG-TTATAGTCTCCG---GTCGCA-TGCGGCGGTCGGGATTGA-GGAACTCAGCA-CGCCTTC---ACGGTCGGGG-TTC-GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTGAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGAGCTTCTGTGACGGATCTGCGGTGGAGCGTGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTCGGTTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Bondarzewia_sp_AFTOL452 ACGAA-CGAT----GTCCGGGGTTGAT-GCTGGCCTTTC------GAGGCA---------TGTGCTCGCCCCGTTCACAA----TCATCCCTCTCACACCTGTGCACTCTTGCGTGGGTCGG-----C--------------------------------------GTCTC-GTCGGCCTGCGTTTTCTC--------------ACAAACTC-TT-GC--ATGTTCAAAGAATGA------------TCTTGATGCTTT-------AACGCATTTT--ATA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGCAT--TCCGAAGGGCACACCTGTTTGAGTGTCGTGAAA--TTCTCAACCCCGTCT-TCTTT{CT}TT----------------GAAGA------GCGG--AGGTTGGACTT--GGAGGTCG---TTGCCGGT-----------CCTT----------------TT----GTGATCGGCTCCTCTGGAA-TGCAT--TAGCGAGA---------------------CCCTTGCGGTGGCGCCT-TGGTGT---GATAA---TTGTCT-ACG---------------CCATGGAC-----------------------------------------------GTGCCGCG--A-TTTCAT--------------------------GGG---GCGCTCGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-CTGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGTC-GGACCGTGTACAAGTTTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-CTGACACGGACAG-CCGA--TGCTTT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTCGAAGTCAGTCGCGTCCGCC-GGGACTCAGCCTCGCAATC-TT-GCTTGGTGTATTTTCT-GGTGGACGGGCC-AGCATCAATTTTGGT-CGCCGGACAAAGGTTGGAGAAATGTGGCACCT---TC--GGGTGTG-TTATAGTCTCTG---GCCACA-CGCGGCGGTCGGGATTGA-GGAACTCAGCA-CGCCTTT---ACGGTCGGGGCTTC-GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTGAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGAACTTCTGTGACGGATCTGCGGTAGAGCGTGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTCGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Byssoporia_terrestris ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTCTTGGTAT--TCCGAGGGGCACGCCTGTTTGAGTATCGTGAAA--TCATCAACCC-G-ACTCCTTTTGT-----------------GAAAA---GGGGAGGAGGGCTTGGACTT-TGGAGGT---CTTGCCGGTC----------CGTTCGTC--------------GT----GATCGGCTCCTCTCGAA-TGCAT--TAGTGGGGCTTCATC---------------CACTCTCTCT-GCCTCTCGGTGT---GATAATT--CATCT-GCGCCGACGTGTGAGGGAGGAAAA-------------------------------------------------G--CATCGCTT-CTAACCCTGGTCCGTCTCGCAC-GAGACGACCTTT----TTCGAACCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCTGGCG-GTCTTC-GGCCGTCCGAGTTGTAGTCTGGAGAAGCGCTTTCCGCGCC-GGACCGTGTACAAGTCCTCTGGAACGGGGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCGG--TGCT-CTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCC-AGGATTCAGCCTT-GCGATC-TCGCTCGGTGTAGTTTCTGGTTCGACGGGCC-AGCATCGACTTCGAC-CGTCGGACAAAGGTGGGGGAAACGTGGCATCCT-T--CTGGGTGTG-TTATAGTCCCTC---GTCGTA-TACGACGGTCGGGATCGA-GGAACTCGGCA-CGCCTTCGT---GGTCGGGGCTTCGGCCCACGTC-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTTCG-CGAGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGTTCCGCGGTGGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCGAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTCGTTAG-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTCGAAACGACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTCGATCGGACCGCTTGCGTGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGATCCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Dentipellicula_leptodon ATGAA-TTTGAAAGGGTG---GTTGT--GCTGGCTCGGCCCACAAGCTGAGCAAAAT----GTGCACACCCCCGATCTCA---TCCACT--TTACAC--CTGTGCACCCTCGCGTGAGTTTCTTGTTGG-----------AGGCCTTCATTG----------GTCTCCTCCGAGAGGCTTGCGTA---CTTTAT---------CACAAACTCTTTTGT--ATGTCA-TGGAATGTA---ACAC---ACTTTGCTGTA-------AAAACGCAAA-CTTGTAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTCAGTTC-TACTGTGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTCGAAAGGTTTTCT---------------------GAACTC-----TTCGAGCTTGGACTT-GGAGGTGT---T-GCCGGA----------CTCTCGAAAGAA---------AGG-------TCGGCTCCTCTTGAA-TGCAT--GAGTGGGTTTTTGTCC-------AGCAGGCAAAAAAACTCATCC--TCGGTGT---GATAA---TTGTCT-ACGCTGTGGATGT----GCTTGT-----------------------------------------------TGAGAACACCGCTT-CTAACTGT---CGCCATGTTGTGACAACATCAATC---T-TTCTGAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-CTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCTGCG?T-GGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCAG--TGCTTT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCC-AAGACTCAGCCTT-GCAATCT-TGCTTGGTGTACTTTTT-GGTTGACGGGCC-AGCATCAGTTTTGGT-CGTCGGAGAATGGCCAGAGAAATGTGGCACCT-----TCGGGTGTG-TTATAGTCTCTG---GTCGGA-TACGATGGCTGGGACTGA-GGAATGCAGCA-CGCCCTC--ACGGGTCGGGGTTCG-CCCACGTTA-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCATGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---GTTGTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCACTTGATTGGACCGCTTG-TCGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Dentipellicula_taiwaniana_Cui8346 ATGAA-TTTGAAAGGGGG---GTTGTT-GCTGGCTCTACTGAGCATTTTTG---------TGCACACCCC-CTGATCTCA---TCCACT--TTACAC--CTGTGCACCCTTGCATGAGTTTCTGTGGAAAG---AAAAAAAGGGCCCCATAA--AAAAAGGGGGGGCTGCTTGCTTCTTTTCCAGAACTTGTGT------ATTTTATCACAAACTCTTGTATGTTA-TAGAATGTA---ATCAC--ACTTTGCTGTA-------AAAATGCAAACTTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTCAGTTC-TACTGTGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTCAAAAGTTTTCTGA------------------AAAGAATCCTTTTTTTGAGCTTGGACTT-GGAGGTGT---TGCTGGAC---------TCTCTTTCTAAGA---------GAGGT------CAGCTCCTCTTGAA-TGTAT--GAGTGGGTTTTTCC---------TTTGCAGGTGAAAACTCATCC--TCAGTGT---GATAA---TTGTCT-ACGCTGTGGATGT----GC-TTGTGGGA-------------------------------------------GGAAAAC-TGCTT-CCAACTGT---CACCT---TGTTGTGACAACTTTA---TTTCTTGAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCT-TTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCTGTGCT-GGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCAG--TGCTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCATCATCC-AAGACTCAGCCTT-GCAATCTTTGCTTGGTGTATTTTTT-GGTTGATGGGCC-AGCATCAGTTTTGGC-TGTTGGAAAATGGTCAGAGAAATGTGGCACCT---TTCGGGGTGTG-TTATAGTCTCTG---ATCGGA-TACAATGGCTGGGACTGA-GGAATGCAGCA-TGCCCTTCACGGGGTCGGGGTTCG-CCCACGTTA-TCATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGG--AAAACCCATGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCATGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---ATTGTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCACTTGATTGGACCGCTTG-TCGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAGTTCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATG-AACTAGCCCTGAAAATG-GATGGCGC Dentipellicula_taiwaniana_dai10867 ATGAA-TTTGAAAGGGGG---GTTGTT-GCTGGCTCTACTGAGCATTTTTG---------TGCACACCCC-CTGATCTCA---TCCACT--TTACAC--CTGTGCACCCTTGCATGAGTTTCTGTGGAAAG---AAAAAAAGG{CG}C{CT}{CT}{CT}-T{AT}A--AAAAAGGGGGGGCTGCTTGCTTCTTTTCCAGAACTTGTGT------ATTTTATCACAAACTCTTGTATGTTA-TAGAATGTA---ATCAC--ACTTTGCTGTA-------AAAATGCAAACTTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTCAGTTC-TACTGTGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTCAAAAGTTTTCTGA------------------AAAGAATCCTTTTTTTGAGCTTGGACTT-GGAGGTGT---TGCTGGAC---------TCTCTTTCTAAGA---------GAGGT------CAGCTCCTCTTGAA-TGTAT--GAGTGGGTATTTCC---------TTTGCAGGTGAAAACTCATCC--TCAGTGT---GATAA---TTGTCT-ACGCTGTGGATGT----GC-TTGTGAGA-------------------------------------------GGAAAAC-TGCTT-CCAACTGT---CACCT---TGTTGTGACAACTTTA---TTTCTTGAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCT-TTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCTGTGCT-GGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCAG--TGCTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCATCATCC-AAGACTCAGCCTT-GCAATCTTTGCTTGGTGTATTTTTT-GGTTGATGGGCC-AGCATCAGTTTTGGC-TGTTGGAAAATGGTCAGAGAAATGTGGCACCT---TTCGGGGTGTG-TTATAGTCTCTG---ATCGGA-TACAATGGCTGGGACTGA-GGAATGCAGCA-TGCCCTTCACAGGGTCGGGGTTCG-CCCACGTTA-TCATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGG--AAAACCCATGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCATGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---ATTGTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCACTTGATTGGACCGCTTG-TCGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAGTTCACGCTCA------------------------------------------------------------------------------------------------------------------------------ Dentipellis_coniferarum ATGAA-TTTGAAAGGGG-----TTGTC-GCTGGCCTTCACC------GGCA---------TGTGCACGCC-CTGCTCTCA---TCCGTT--CTACAC--CTGTGCACCTTTGCGTGGGTCTGG-CGGCC--------TTGCGGTCGTT------------GG------GCTTGCGTTCCTTCACACACCC-----------------------TGTATGTATCT-----GAATGTC---TTCA-------TGCTATA-------AA--CGCAT-TTTAATA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT-T-CCGAGGGGCACACCTGTTTGAGTGTCGTGAAA--TTCTCAACCCATGCTTCCTTTTT------------------TGAAAGGA--TG-----GGCTTGGACTT-GGAGGCTT---------GC---------CGGCCTTGTTTG-------------GT------CGGCTCCTCTTGAA-TGCAT--TAGCTGGAGCCTT----------TGTAGGGCT--------GCCT--TCGGTGT---GATAA---TTGTCT-ACGCCGTGGGAGG----GCCTTGCGAGCTTT---------------------------------------TGGGAGCC-AGCTT-CTAACCGT---CCCGT---CA--GGGACACTTCAT-------CGAAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG-GTCT-CCGGCCATCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCT-GGACCGTGTACAAGTTTCCTGGAATGGAACGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCC-AGGACTCAGCCTT-GCA-CTCTTGCATGGTGTACTTTCT-GGTTGACGGGCC-AGCATCAATTTTGAC-CGCTGGACAAAGGCGGGGGAAATGTGGCACC-----TTCGGGTGTG-TTATAGTCCTCC---GTCACA-TACAGCGGTTGGGATTGA-GGAACTCAGCA-TGCCATT---ATGGTCGGGGTTCG-CCCACGTT---CATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---AT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATTCACGCTCA------------------------------------------------------------------------------------------------------------------------------ Dentipellis_coniferarum_Yuan_5623 ATGAA-TTTGAAAGGGG-----TTGTC-GCTGGCCTTCACC------GGCA---------TGTGCACGCC-CTGCTCTCA---TCCGTT--CTACAC--CTGTGCACCTTTGCGTGGGTCTGG-CGGCC--------TTGCGGTCGTT------------GG------GCTTGCGTTCCTTCACACACCC-----------------------TGTATGTATCT-----GAATGTC---TTCA-------TGCTATA-------AA--CGCAT-TTTAATA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT-T-CCGAGGGGCACACCTGTTTGAGTGTCGTGAAA--TTCTCAACCCATGCTTCCTTTTT------------------TGAAAGGA--TG-----GGCTTGGACTT-GGAGGCTT---------GC---------CGGCCTTGTTTG-------------GT------CGGCTCCTCTTGAA-TGCAT--TAGCTGGAGCCTT----------TGTAGGGCT--------GCCT--TCGGTGT---GATAA---TTGTCT-ACGCCGTGGGAGG----GCCTTGCGAGCTTT---------------------------------------TGGGAGCC-AGCTT-CTAACCGT---CCCGT---CA--GGGACACTTCAT-------CGAAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG-GTCT-CCGGCCATCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCT-GGACCGTGTACAAGTTTCCTGGAATGGAACGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCC-AGGACTCAGCCTT-GCA-CTCTTGCATGGTGTACTTTCT-GGTTGACGGGCC-AGCATCAATTTTGAC-CGCTGGACAAAGGCGGGGGAAATGTGGCACC-----TTCGGGTGTG-TTATAGTCCTCC---GTCACA-TACAGCGGTTGGGATTGA-GGAACTCAGCA-TGCCATT---ATGGTCGGGGTTCG-CCCACGTT---CATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---AT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATTCACGCTCA------------------------------------------------------------------------------------------------------------------------------ Dentipellis_fragilis_Dai_12550 CTGAA-TTTGAAAGAGG-----TTGTT-GCTGGCCTTCACC------GGCA---------TGTGCACGCC-TTGATCTCA---TCCATC--TTACAC--CTGTGCACCTTTGCGTGGGTCTGT-TGGCT--------TTGCGGCCTTC------------AG------ACTTGCGTCTTTTCATAAACTC-----------------------TT-ATGTATGTAA-CAGAATGTC----TAA-------TGCTATA-------AAA-CGCAT-CTTA-TA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT-T-CCGAGGGGCACGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTCGATCTTTTTGTTT------------------ACAAAAAGGTTG-----GGCTTGGACTT-GGAGGCTT---------GC---------CGGCTCTGCAAA-----------GACT------CGGCTCCTCTTGAA-TGCAT--GAGTGGGAACCTT----------TGTAGGG--------TGACCT--TTGGTGT---GATAA---TTGTCT-ACGCCGTTGGTCT----GCCTTGCGAAATTA---------------------------------------TGGGTACC-TGCTT-CTAACCGT---CTTTT---CG--GAGACAATTTCT------ATGAAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TCGGCCGTCCGAGTTGTAATCTAGAGAAGTGCTTTCCGTGCT-GGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCC-AGAACTCAGCCTT-GCA---TTTGCTTGGTGTACTTTCT-GGTGAACGGGCC-AGCATCAATTTTGAC-CGCTGGATAATGGCGAGGGGAAGGTGGCACC-----TTCGGGTGTG-TTATAGCCCCTT---GTCGCA-TACAGTGGTTGGGATTGA-GGAATTCAGCA-TGCCTTT---ATGGTCGGGGTTCG-CCCACGTT---CATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG--AAAACCCATGCGCGTAATGAAAGTGAAA-GTTGAGACCTCT-TCACGGAGGGCACCGACGCCCGGACCTGAGCTTCTGCGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATTCACGCTCA------------------------------------------------------------------------------------------------------------------------------ Dentipellis_fragilis_Dai9009 CTGAA-TTTGAAAGAGG-----TTGTT-GCTGGCCTTCACC------GGCA---------TGTGCACGCC-TTGATCTCA---TCCATC--TTACAC--CTGTGCACCTTTGCGTGGGTCTGT-TGGCT--------TTGCGGCCTTC------------AG------ACTTGCGTCTTTTCATAAACTC-----------------------TT-ATGTATGTAA-CAGAATGTC----TAA-------TGCTATA-------AAA-CGCAT-CTTA-TA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT-T-CCGAGGGGCACGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTCGATCTTTTTGTTT------------------ACAAAAAGGTTG-----GGCTTGGACTT-GGAGGCTT---------GC---------CGGCTCTGCAAA-----------GACT------CGGCTCCTCTTGAA-TGCAT--GAGTGGGAACCTT----------TGTAGGG--------TGACCT--TTGGTGT---GATAA---TTGTCT-ACGCCGTTGGTCT----GCCTTGC{AG}AAATTA---------------------------------------TGGGTACC-TGCTT-CTAACCGT---CTTTT---CG--GAGACAATTTCT------ATGAAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TCGGCCGTCCGAGTTGTAATCTAGAGAAGTGCTTTCCGTGCT-GGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCC-AGAACTCAGCCTT-GCA---TTTGCTTGGTGTACTTTCT-GGTGAACGGGCC-AGCATCAATTTTGAC-CGCTGGATAATGGCGAGGGGAAGGTGGCACC-----TTCGGGTGTG-TTATAGCCCCTT---GTCGCA-TACAGTGGTTGGGATTGA-GGAATTCAGCA-TGCCTTT---ATGGTCGGGGTTCG-CCCACGTT---CATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG--AAAACCCATGCGCGTAATGAAAGTGAAA-GTTGAGACCTCT-TCACGGAGGGCACCGACGCCCGGACCTGAGCTTCTGCGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATTCACGCTCA------------------------------------------------------------------------------------------------------------------------------ Dentipellis_microspora ATGAA-TTTGAAAGGGG-----TTGTT-GCTGGCCTTTCTTTACGAGGGCA---------TGTGCACACC-CTGCTCTCA---TCCATC--TTACAC--CTGTGCACCTTTGCGTGAGTTGGT-TTCCGGC---CCATTGCGGGTTAT------------TGGGATCGACTTGCGTCCTTTCACAAACCC-----------------------TTTATGTATGTTATCAGAATGTC---ATTA-------TGCTATA-------AAA-CGCAT-CTTA-TA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGA-TACAGTGAATCATCGAATTTTTGAACGCACCTTGCGCCCTTTGGTAT-T-CCGAGGGGCACACCTGTTTGAGTGTCGTGAAA--TTCTCAACTTCAACTTCTTTCCT------------------TAAGAAGC-TTGA----GGCTTGGACTT-GGAGGCTT---------GC---------TGATTTGTTTGAT---------CAAGT------TGGCTCCTCTTGAA-TGCAT--GAGTGGGGACCTTG---------TAGACAGGTTT---TTAACCT--TTGGTGT---GATAA---TTATCT-ACGCCGCTGGT------GCCTTC-----------------------------------------------TATGTGCC-TGCTT-CTAACCGT---CTCTC---TTATGAGACAACGTCT---T--AC{AG}AAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCGCGTCTGCC-AGAACTCAGCCTT-GCAATCTTTGCTTGGTGTATTTTCT-GGTGGACGGGCC-AGCATCAATTTTGGC-TGCCGGACAATGGCGGGAGAAATGTGGCATCA---TTTATGGTGTG-TTATAGTCTCCC---GTCGCA-TACGGCGGTTGGGATTGA-GGAATGCAGCA-CGCCTTT---ATGGTCGGGGTTCG-CCCACGTTT--CGTGCTTAGGTTGCTGGCGTAATGGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTAAAA-GTTGGGACCTCTGTTGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTG{CT}GGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGGTTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATTCACGCTCA------------------------------------------------------------------------------------------------------------------------------ Dentipellis_parmastoi_Cui8513 ATGAA-TTTGAAAGAGG-----TTGTT-GCTGGCCTTCACG------GGCA---------TGTGCACGCC-TTGATCTCA---TCCATT--CTACAC--CTGTGCACCTTTGCGTGGGTCTGT-CTGTT--------GCAAAACAGAT------------GG------ATCGACGTTTTTTCCACAAACT-----------------------CCCATGTATGTAA-CAGAATGTC----TTA-------TGCTATA-------AA--CGCAT-GTAA-TA--CAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT-T-CCGAGGGGCACACCTGTTTGAGTGTCGTGAAA--TTCTCAACTCATACCTTTTGT-T------------------ATGAAAGGCATG-----AGCTTGGACTT-GGAGGCTT---TT----GC---------TGGCTCTCGTCTG---------AGACT------CGGCTCCTCTTGAA-TGCAT--GAGTGGGGACCTT----------TGCAAAGGA-------GACCT--TTGGTG{CT}---GATAA---TTGTCT-ACGCCGTTGGTGT----GCCTTGCGAATTGA---------------------------------------TAGGTACC-TGCTT-CTAACTGT---CTCTA-------GGGACGACTTCA------TTGAAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCT-TTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGTC-AGAACTCAGCCTT-GCT---TCTGCTTGGTGTACTTTCT-GATGAACGGGCC-AGCATCAATTTTGAC-TGCCGGATAATGGCAGAGGGAATGTGGCACC-----TTCGGGTGTG-TTATAGCCCTTT---GTCGCA-TACGGTGGTTGGGATTGA-GGAATGCAGCA-TGCCTTT---ATGGTCGGGGTTCG-CCCACGTT---CATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGG--AAAACCCATGCGCGTAATGAAAGTGAAA-GTTGGGACCTCT----CTGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATTCACGCTCA------------------------------------------------------------------------------------------------------------------------------ Dentipellopsis_dacrydicola_Dai_12010 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCT-TTGGCTGTCCGAGTTGTAGTTTAGAGAAGCGTTTTCTGCGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTG-CCAG--GGCTAT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCC-GGGACTCAGCCTTTGGCCATCTGGCTAGGTGTACTTCCC-GGTCGACGGGCC-AGCATCACTTTTGGC-CGTCAGAGAAGGGTGGGAGGAAGGTGGCACC-----TTCGGGTGTG-TTATAGCCTCCT---ATCGTA-TGTGACGGCGGGGAGTGA-GGAACTCAGCA-CGCCTCGCAAGGGGTCGGGGTTCG-CCCACGTTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCCCTGTCGTGGGGGGCACCGACGCCCGGACCTGAGCTTCTGCGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAGCAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCA------------------------------------------------------------------------------------------------------------------------------ Dentipellopsis_dacrydicola_Dai12004 TTGAA-ATTCAAAGGCCTCAAGCTGTC-GCTGGTCCACTCGTGGACATGTG---------CACGCTTGCC-GGTCGTCTT---CCATCT--TCATCC--CTGTGCACTCTTGCGTATGGTTCTCGAGGGGG---AGGGAGGGGAAGGAGGC---CTTTTGCCTTTTTCTTTTTCTTTCCTCTTGGAACCCTGCGT------CCTTCATACCCTCCTTTAGTATGTCTCAGAATGTC---TCTT--------GCGATA-------ACA-CGCAA-CTTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT-T-CCGAGGGGCACGTCTGTCTGAGTGTCGTGAAA--TTCTCACCTCGCACCTCTTTTTCTTTCTTTTTGAAAGAAAAGGAAGAGGGGGTTGTCGAGTGTGGACCT-GGAGGTTT---ATTGCTGG---------CCTGCCCGTTGAA---------GGGGTGG---CCGGCTCCTCTCAAA-TGCATT-GAGTGGGTCTGCCT---------GTTGCAGCCTTTGACGTGATA--ATTTTGT---TTACG---TCGTCG-GTAGCACTGTTGA----GGCCTGCTTCGAAC---------------------------------------CGTCTCTG-AAATG-GAGACAGC---CTCCT---TTCATCGGGGCTCTCT---T--TGAAACTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TTGGCCGTCCGAGTTGTAGTTTAGAGAAGCGTTTTCTGCGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTG-CCAG--GGCTAT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCC-GGGACTCAGCCTT-GGCCATCTGGCCAGGTGTACTTCCC-GGTCGACGGGCC-AGCATCACTTTTGGC-CGTCAGAGAAGGGTGGGAGGAAGGTGGCACC-----TTCGGGTGTG-TTATAGCCTCCT---ATCGTA-TGTGACGGCGGGGAGTGA-GGAACTCAGCA-CGCCTCGCAAGGGGTCGGGGTTCG-CCCACGTTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCCCTGTCGTGGGGGGCACCGACGCCCGGACCTGAGCTTCTGCGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAGCAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCA------------------------------------------------------------------------------------------------------------------------------ Dentipratulum_bialoviesense -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAA-GTAATGTGA{AT}TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCCTTGGTAT--TCCGAGGGGTACGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCTCACCCCCTTTTGT-----------------AAGGTTGG---TGTGTGGGCTTGGACTT-GGAGGCTT--TTTGCAGG----------CTCTTTTGG--------------------GAGCCTGCTCCTCTCAAA-GGCAT--TAGCAGGAACCCTTT---------------TCCGTGTGGG---CCTC-GGTGT---GATAAT---TATCTTACGCTG---CTGGTCCCATGGTTACT---------------------------------CT-----------------CTGCTT-CTAATTG---TCTC-----GCAAGGGACAGCTCTA--TA-CGAA--CCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGACA-GCCTCCGG-TTGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTG-CCAG--TGCT-TTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCGCGTTCTTC-GAGACTCAGCCTT-GCCT-TCTGGCCTGGTGTACTTCTCGGT-GAACGGGCC-AGCATCAATTTTGAC-TGTCGGACAAGGGCGAGAGGAAGGTGGCACC---TCC--GGGTGTG-TTATAGCCTCTT---GTCGCA-TGCGGCAGACAGGATTGA-GGACCGCAGCA-CGCCTTTA---TGGTCGGGG-TTC-GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAATGACC?GTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGA--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAAC--AT----GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTG-GCGATTGAGAG{AT}TTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAGGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACC---------------------------------- Echinodontium_ryvardenii -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAAGT{AG}ATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT-T-CCGAGGGGCACACCTGTTTGAGTGTCGTGAAT--TTCTCAATTCCCACCTCCTTTGC------------------GGGGGAGTGCCGG----G{CG}CTTGAA{AT}TT-GAAG{CG}{CT}TT------------------------------------------------------------------------------TGC{CG}GGCGTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCCGTCGGGCGTCCGAGTTGTAGTTTAGAGAAGCGCTTTCCGCGCC-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACCA-CCGG--TGCTTT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCGCC-GGGACTCAGCCTT-GC---TTCGGCTCGGTGTACTTCCC-GGTGGACGGGCC-AGCATCATTTTTGGT-CGTCGGAAAAGGGCGGGGGAAAGGTGGCACC-----TTCGGGTGTG-TTATAGTCCCTC---GCCGTA-TACGGCGGTCGGGAGTGA-GGAACTCAGCA-CGCCTTT---ACGGTCGGGGTTCA-CCCACGTT---CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Echinodontium_tinctorium -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTAT--TCCGAAGGGCACGCCTGTCTGAGTGTCGTGAAA--TTCTCAACTCTA-CTTTCTTTTTT-----------------GAATG--------TTAGAGCTTGGACTT-GGAGGTT---CTTGCTGG----------TCCTTTGTGA----------------------TCGGCTCCTCTTGAA-TGCAT--TAGCAAGA-CCCCAG---------------TG--GTGCTG---CCTCCAGTGT---GATAAT---TGTCT-ACGCTGTGGGTTTG-CTCCGCGACTCGTG----------------------------------GG---------ACCCTCGCTT-CCAACCGT--C----------GAAAGACAA--TTC---ATCGAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCTCC-GGCCGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGTC-GGACCGTGTACAAGTTTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCGA--TGCT-TTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAATAAATCCCGTCTGCC-GGGAATCAACCTT-GCAA-ACCTGCCTGGTGTACTTTCTGGT-GGACGGGCC-AGCATCAATTTTGAC-TGCCGGACAAAGGCTAGGGAAATGTGGCACCTT-C---GGGT-GTG-TTATAGTCCCTG---GTCACA-TACGGTGGTTGGGATTGA-GGAACTCAGCA-TGCCTTA-T---GGTCGGGG-TTC-GCCCACGT--TCATGCTTAGGATGCTGCCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGCGGAGGGCACCGACGCCCGGACCAGAACTTCTGTGACGCATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Exidia_glandulosa ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCGTGGTAT--TCCGCGGAGCATGCCTGTTTGAGTGTCACGTCA--ACCCTCACCCT---TGCGATGTTA-----------------CAATCG-------CACGA-GGTGGATTT-G-GACCGT-----GCCGT---------------------------------------AGTC-GGCTCGTCCTGAA-TGCAT--TAGCTTGCGCTTTTAG---------------AGTGCTGGGCAA----AGGTGT---GATA----ATTATCTGCGCCGACGCTTC----GAGCCT--------------------------------------------CTTCAGCGGCGCTGCTT-ATAGCCG----------TCCCGACGGACAA---TT---TTTTAAAGCTTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTGGCG-GTCTAA-GGCCGTCCGAGTTGTAATCTATAGAGGTGTTTTCCGTGCC-GGACCGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCC-ATGACACGGACTA-CCGAAGTGCTCT-GTGATACACCTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTTCC-AGGACTCAGCCTT----GCTTCTGCTCGGTGTACTTCCTGGCG-GATGGGCC-AGCATCGATTTTGAT-CGCCGGAAAAGGGCGGGAGGAATGTGGCAGC-------TTGCTGTG-TTATAGCCTC-C--CGTCGTA-CACGGTGGTTGGGATCGA-GGACTGCAGCA-CGCCTT-----TGGTCGGGG-TT{CT}GCCC-ACGCC-ACGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGT--CAAACCCAGGCGCGTAATGAAAGTGAAA-GTTGGGACTCTTT---AGTGAGGCACCGACGCCCGATCCTGACGTTTTCTGACGGATTTGAGGCAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAC----ATCAGTTTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGATCGGACCGTCACTTGATTGGACCGTCTG-GCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAA{AC}AACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Exidia_recisa -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCGTGGTAT--TCCGCGGAGCATGCCTGTTTGAGTGTCACGTCA--ACCCTCACCCT---TGCGATGTTA-----------------CAGTCG-------CCCGT-GGTGGATTT-G-GACCGT-----GCCGT---------------------------------------AATC-GG{CGT}TCGTCCTGAAATGCAT--TAGCTTGCGCTTTTAG---------------AGTGCTGGGCAC----CGGTGT---GATA----ATTATCTGCGCCAACGCCTT----AAGCCT--------------------------------------------CTTTAGTGGTGCTGCTT-A{CT}AGTCG----------TCCCGACGGACAA---TT---TTT-AAAGCTTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAATCTGGCG-GTCTAA-GGCCGTCCGAGTTGTAATCTATAGAGGTGTTTTCCGTGC{CT}-GGACCGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCC-ATGACACGGACTA-CCGAAGTGCTCT-GTGATACACCTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGGAGTCAGTCGCGTTTGCC-AGGACTCAGCCTT----GCTTCTGCTCGGTGCACTTCCTGGTG-AATGGGCC-AGCATCTATTTTGGA-CGCCGGAAAAGGGCGGGAGGAATGTGGCAGC-------TTGCTGTG-TTATAGCCTT-C--CGTCGTA-CACGGTGTCTGGGATAGA-GGATTGCAGCA-CGCCTT-----TGGTCGGGG-TTCGCCC-ACGCC-ACGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGT--AAAACTCAGGCGCGTAATGAAAGTGAAAAGTTGGGACTCTTT---AGTGAGGCACCGACGCCCGATCCTGACGTTCTCTGACGGATTTGAGGCAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Gloeocystidiellum_bisporum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATAA-GTAATGTGA{AG}TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCTCTTGGTAT--TCCGAGAGGTACGCCTGTTTGAGTGTCGTGAAA--TTCTCATCCTCTTTTCCTTCTTTT-----------------ATTGGAGGGT--CTTGGGGCTTGGATTT-GGAGGTT----TTGTTGG----------TCCT----------------------TGAGAT-CAACTCCTCTTAAA-AGCAT--TAGTGAGT-CCCCTT---------------TGT---------GGCCTCGGTGT---GATAAT---TGTCT-ACGCCTT-AGCTATGA--TGT--A-------------------------------------------------GGAGCTCGCTT-CTAACTGT--CC-TC--------GGACAAA-CTTT---ATTGAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCTTT-GGCCGTCCGAGTTGTAGTTTAGAGAAGTGTTTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTG-CCAG--TGCT-TTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGTC-AAGACTCAGCCTT-GCC--TTTGGCTTGGTGTATTTCTTGAT-AGACGGGCC-AGCATCACTTTTGAT-CGCCGGAAAAGGGTGGGGGAAAGGTGGCACCTT-C----GGGTGTG-TTATAGTCCCCT---GTCGTA-TACGGTGGTTGGGAGTGA-GGAACTCAGCA-CGCCTTTT----GGTCGGGGCTTCGGCCTACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCAAGTGTTTGGGTGG--AAAACCCATGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGAACTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGTAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCG-GTGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAAGGAT------------------------------------------------- Gloeocystidiellum_clavuligerum -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCTCTTGGTAT--TCCGAGAGGTACGCCTGTTTGAGTGTCGTGAAA--TTCTCATCCCCTTCTCCTTCTTTC-----------------ATTGGAGGGT--CTTGGGGCTTGGATTT-GGAGGTT----TTGTTGG----------TTCT----------------------TGAGAT-CAACTCCTCTTAAA-AGCAT--TAGTGAGT-ACCCTT---------------TGT---------GGCCTCGGTGT---GATAAT---TGTCT-ACGCCTT-AGCTATGA--TGT--A-------------------------------------------------GGAGCTCGCTT-CTAACTGT--CC-TC--------GGACAAA-CTTC---ATCGAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCTTT-GGCCGTCCGAGTTGTAGTTTAGAGAAGTGTTTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAACGGA{CG}CGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTG-CCAG--TGCT-TTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGGACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGTC-AAGACTCAACCTT-GCC--TTTGGCTTGGTGTATTCCTTGAT-AGACGGGCC-AGCATCACTTTTGAT-CGCCGGAAAAGGGTGGGGGAAAGGTGGCACCTT-C----GGGTGTG-TTATAGTCCCTT---GTCGTA-TACGGTGGTTGGGAGTGA-GGAACTCAGAA-CGCCTTTTT---GGTCGGGGCTTCGGCCTACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGG--AAAACCCATGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGAACTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGTAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCG-GTGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAAGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAATGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Gloeocystidiellum_compactum -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTAT--TCCGAAGGGCACACCTGTTTGAGTGTCGTGAAA--TTCTCAACCCTCTTCACTTTTGTGAAT-----------------------------TGGGCTTGGACTT-GGAGGTAT---TTGCCGG----------------GAACTCC-------------------TCGGCTCCTCTCAAA-TGTAT--TAGTACGTCTC--------------------GTTGCGATGTACGCCTCGGTGT---GATAATTATCTAC--GCTG------------TGCGTGTGCTTGCTT-------------------------------------CCTTTGGGATGTGCTCTCAAACCGTCCATCTAGGACAACGATTATATACAT{AG}A-----TCGAAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCTC--GGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGA-TC-CCAGTG--CTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCC-AGGACTCAGCCT------------TATGGTGTACTTCCT-GGTCGACGGGCC-AGCATCAGTTTTGAC-CGCGAGATAAAGGCGTCGGGAATGTGGCTTC-----TTCGGGAGTG-TTATAGCCCTTC---GTCAGA-TGTCGTGGTTGGGACTGA-GGACCGCAG----CTTTTTG--------------------------------CTTAGGATGCTGGCGTAATGGCTTTAAACGACC?GTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGATCCCTGTCGTGGGGTGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCATAT----CAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGG-CGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Gloeocystidiellum_formosanum -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTAT--TCCGAAGGGCACACCTGTTTGAGTGTCGTGAAA--TTCTCAACCCTCTTCACTTTTGTGAAT-----------------------------TGGGCTTGGACTT-GGAGGTAT---TTGCCGG----------------GAACACC-------------------TCGGCTCCTCTCAAA-TGTAT--TAGTACGTCTC--------------------GTTGCGATGTACGCCTCGGTGT---GATAATTATCTAC--GCTG------------TGCGTGTGCTTGCTT-------------------------------------CCTTTGGGATGTGCTCTCAAACCGTCCATCTAGGACAACGATTAT{AG}TA{CT}GTAA-----TCGAAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCTC--GGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGA-TC-CCAGTG--CTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCC-AGGACTCAGCCT------------TATGGTGTACTTCCT-GGTCGACGGGCC-AGCATCAGTTTTGAC-CGCGAGATAAAGGCGTCGGGAATGTGGCTTC-----TTCGGGAGTG-TTATAGCCCTTC---GTCAGA-TGTCGTGGTTGGGACTGA-GGA{CT}CGCAG----CTTTTTG--------------------------------CTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGATCCCTGTCGTGGGGTGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCATAT----CAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGG-CGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Gloeocystidiellum_porosum -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACACACCTTGCGCCCCTTGGTAT--TCCGAGGGGCACGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCC---TTTCCTTTCTT-----------------CACCG---GAAGGACTGGGCTTGGACTT--GGAGGT---CTTGCCGGCATT------CCCATCTCGCCTCAT----GGCGAGGAGGGGTTCGGCTCCTCTCGAA-AGCAT--TAGTGAGACC----C---------------CTTGCGGCC-------TCGGTGT---GATAAT---TGTCT-ACGCCGTGGGCTTAGCTGTAC-CG-------------------------------------------------GGAC-CCGCTT-CGAAC-------CGTCCCTTCACGGGACAATTTCT----TTATGAAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCTTT-GGCCGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGTGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCT-TTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCCCGTCGACC-GAGATTCAGCCTC-GC---CTTGCCGTGGTGTACTTCTCGGC-CGACGGGCC-AGCATCAATTTTGAT-CCTCGGAAAAAGGCTTGGGAAAGGTTGCACCTT-C----GGGTGTG-TTATAGTCCCTC---GTCGCA-TACGGGGGTCGGGATTGA-GGTACTCAGCG-CGC--------------------------------AAGCGCTCGGGATGCTGCCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGATCCCTGTCGTGGGGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCGT----GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTCGAAACGACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC------------------------------------------------------------------------------------------------------------------------------------------------------------ Gloeocystidiopsis_cryptacanthus ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGA{AGT}TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTAT--TCCGAAGG-CACACCTGTTTGAGTGTCGTGAAA--TTCTCAACCCTC-CTCACTTTGCG-----------------GTGT---------TGAGGGATTGGACTT-GGAGGTC---TTTGCCGG----------GTC{ACT}CTTGTG---------------------CTCGGCTCCTCTCAAA-TGCAT--TAGTGCG--TCT{CT}GT---------------TGCGACGTGC---GCCTCGGTGT---GATAAT---TATCT-ACGCTGTGTGCGTG--CTTGCTTC{AT}TTTT-------------------------------T---TG--------GGATGCGCTCTCAAACCGT--C------CGAGTAAGGACAGTCATC---TTTAAG--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCTCC-GGCCGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGTT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACC--CCAG--TGCT-CTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCC-GGGACTCAGCCTT-GCAT---TCGCTTGGTGTACTTTCCGGT-CGACGGGCC-AGCATCAGTTTTGAC-CGCGGGATAAAGGCGAGGGGAATGTGGCTCTTT-C---GGGA-GTG-TTATAGCCCTTT---GTCAGA-TGTCGCGGTTGGGACTGA-GGTACTCAGCA-CGCCTTTAT---GGCCGGGG-TTC-GCCCACGT--ACGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGATCCCTGTCGTGGGGTGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGG{AG}-TAGCAGAAACTCGT----ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACG{AG}GCCGTCGCTTGATTGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Gloeodontia_columbiensis -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTAT--TCTGAAGGGCACGCCTGTTTGAGTGTCGTGAAC--TTCTCAACTCTTTCTTTCTTTTT--------------------TGGAA----GGACTGAGCTTGGATGT-GGAGGCT----TTGCTGG----------TTCCTTTATG-------------------GACTTGGCTCCTCTAGAA-TGCAT--TAGTGGGGACCCT-T---------------GACG--GCCT---C----GGTGT---GATAAT---TGTCT-ACGCCATGGGTTGA--GTCAC-----------------------------------------AGTG--------GGACTTGCTT-CCAACTGT--C-----TCTGTAGGGAGACACTTTA---TTCAA---ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCT-TTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGCGTC-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGGCATGGACTA-CTGA--TGCT-TTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACCCTTGAAGTCAGTCCCGTTGGCC-GAGACTCAGCCTC-GCT----TCACCTGGTGTACTCCCCGGT-GAACGGGCC-AGCATCACTTTCCGC-CGTTGGATAAAGGCAAGGGAAAGGTGGCCCCCT-C---GGGG-GTG-TTATAGTCCCTT---GTCGCA-TACAACGGTTGGGAGTGA-GGAACTCAGCA-CGCCTTTAT---GGTCGGGG-TTC-GCCCACGT--TCGTGCTTAGGATGCTGCCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----GTCAGATTTATGTGG?AAAGCGAATGATTAGAGG-CCTTGGGGTCGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCG-GCGATT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Gloeodontia_discolor -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTAT--TCCGA-AGGCACACCTGTTTGAGTGTCGTGAAA--TTCTCAACTCTACCTCTTC----T-----------------CTTGGAGAGA----CTGAGCTTGGATGT-GGAGGCT----T-GCTGG----------GTCCCTTG----------------ACTGGGGT-CAGCTCCTCTTGAA-TGCAT--TAGTGAGC-CTCTC----------------TGT---------GGCCTCGGTGT---GATAAT---TGTCT-ACGCCGTCGGTTCTGCAGTATTAT-------------------------------------------------AGGACTTGCTT-CTAACCGT--CTCTTC------TGAGACAA-CTTT---ATCGAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG-GTCTTT-GGCCACCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGCT-GGACCGTGCACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGGCACGGATGA-CCAG--TGCT-TTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTC--TT-GAGACTCAGCCTT-GC---TTTTGCTTGGTGTACTTCTCAGT-GAACGGGCC-AGCATCACTTTTGAC-CGTTGGATAAAGGCGAGAGAAAGGTGGCACCCT-C----GGGTGTG-TTATAGTCTCTT---GTCGCA-TACAACGGTTGGGAGTGA-GGAACTCAGCA-CGCCGCAA----GGTCGGGGTTC--GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTAATCT-CAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Gloeodontia_pyramidata ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTAT--TCCGA-AGGCA{CT}GCCTGTTTGAGTGTCGTGAAC--TTCTCAACTCTTTCTTTCT----T-----------------TACGGAAAGA----CTGAGCTTGGATGT-GGAGGCT----T-GCTGG----------TTCCCTTT----------------TTGTGGATGCAGCTCCTCTTGAA-TGCAT--TAGTGAGA-CCCTG----------------GGC---------GGCCTTGGTGT---GATAAT---TGTCT-ACGCCATGGGCTTAGC--TCTTGT-------------------------------------------------GGGACTTGCTT-CCAACTGT--CTTTGT------ATAGAGACACTTT---ATTAAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCTTT-GGCTGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGCG{CT}T-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCT-TTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCGCC-GAGACTCAGCCTT-GC---CTTGGCTTGGTGTATTTCTCGGT-AAACGGGCC-AGCATCACTTTTGAC-CGCTGGAGAAAGGCAGGAGAAAGGTGGCACCCT-T----GGGTGTG-TTATAGTCTCTT---GTTGCA-TACAGCGATGGGGAGTGA-GGTACTCAGCA-CGCCTTTAT---GGTCGGGGTTC--GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATTAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAGCGAGCCGTCGCTTGATTGGACCGCTCG-GTGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATTCACGCTCATC--AGACACCACAAA{AG}GGTGTT{AG}GTTCATCT{AG}GAC{AG}GCAGGACGG{GT}GGCCATGGAAGTCGGAACCCGC{AT}AAGGAG{GT}GTGT{AT}ACAA{CT}TCACCTGCCGAA-T------------------------- Gloeodontia_subasperispora ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTAT--TCCGA-AGGCACGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTCTA--TCTTT----C-----------------TTTTGAAAGA----CTGAGCTTGGATGT-GGAGGCT----T-GCCGG----------TCCC--------------------GCTCGGGT-CGGCTCCTCTCGAA-TGCAT--TAGTGAGA-CCCCT----------------TGC---------GGCCTCGGTGT---GATAAT---TGTCT-ACGCCAT-GGCTTAGC--TATCGT-------------------------------------------------GGGATTCGCTT-CCAACCGT--CTCTTC------GGAGACA--CTTC---ATCGAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG-GTCTTT-GGCCATCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGTC-GGACCGTGCACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGGCACGGACTA-CCGA--TGCT-TTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCC-GGAACTCAGCCTT-GC---CTCGGCTTGGTGTACTTTCCGGT-GAACGGGCC-AGC{AG}TCACTTTCGAC-CGTCGGATAAAGGCAAGGGAAAGGTGGCACCTT-C----GGGTGTG-TTATAGTCCCTT---GTTGCA-TACGACGGTTGGGAGTGA-GGAACTCAGCA-CGCCTTTAT---GGTCGGGGTTC--GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGA{AT}CGAGCCGTCGCTTGATTGGACCGCTCG-GTGATTGAGAGTTTCTAGTGGG{CG}CATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Gloeopeniophorella_convolvens ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAC-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCCTCTTGGTAT--TCCGAGGGGCACACCCGTTTGAGTGTCGTGAAA--TTCTCAAGCT-TATCGGTTGTCCG-----------------AACAACCGATGGTGTAAGGCTTGGACTT--GGAGGTC--GTTGCTGGCCG-------CGTTGCTTT???TG---------------TGGTCGGCTCCTCTTAAA-CGCAT--TAGCGAGGTCCTCAT---------------TGCTTGT----TACCTTTGGCGT---GATAAG---TATCT-ACGTCGCTGGCACCGG-CTATGCT-GTTG-GGACTTTGCTTCGAATCGTC---------TCGGAAAA-----AGAGACAAAACGCGGAT-------CTCCGGATTTTCGGATTTTCGGATTCACAC---AACCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCTTATGGCTGTCCGAGTTGTAATCTAGAGAAGCGTTTTCCGCGCC-GGACCGTGCACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGGCATGGACCC--CAG--TGCT-CTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTGAACTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTAAAGTCAGTCGCGTCGACC-GAGACTCAACCTC-GCTC-TTGGC-TTGGTGTACTTCTCGGC-CGACGGGTC-AGCGTCGATTTTGGC-CTTCGGATAATGGCAAGGGAAAGGTGGCACCTT-CG----GGTGTG-TTATAGTCCCTC---GTCGGA-TATGAGGGTCGGGATCGA-GGAACTCAGCA-CGCCCCGTGAGGGGTCGGGGCTTCGGCCCACGCT-ACGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACC?GTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGTTTAAAACCCGTGCGCGCAACGAAAGTAAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCGAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGG-ATGAAACATCC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCGCTCGATTGGACCGCTCG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Gloiodon_nigrescens ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT--TCCGAGGGGCACGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCTTACCCC--TTTTG----------------CTAGGGCTTCTGGTAACGGGCTTGGACTT-GGAGGC{CGT}----TTGCCGGC-----------CTCT----------------CTTTTGCCAGTCGGCTCCTCTCAAA-GATAT--TAGCAGGACCCCCT------------CCCCCTTCACTGTTTGGGCCTCGGTGT---GATAA---TTATCT-ACGC--------------CGTCGGCT-----------------------------------------------TTGTGTTA--------CAA------------------------CGAG---GGACCCGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GCCT-CTGGC-GTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTG-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCTCC-GAGACTCAGCCTCGCCCTTCCG-GCCTGGTGTACTTCTC-GGTGAACGGGCC-AGCATCAATTTTGAT-CGTCGGACAAGGGCGAGAGGAAGGTGGCACCC---TTCGGGGTGTG-TTATAGCCTCTC---GTCGCA-TACGACGGTCGGGATTGA-GGACCGCAGCA-CGCCTTTT-AATGGTCGGGG-TTC-GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGT{GT}AGTTCATCTAGACAGCAGGACGGTGGC-ATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCGGAA-TGAGATAGCCCTGAAAA-TGGATGGC Gloiodon_strigosus_AF506449 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT--TCCGAGGGGCACGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCTTACCCCCCTTTTA----------------CTAGGG-TTGTGGTA-CGGGCTTGGACTT-GGAGGCT----TTGCCGGC------------TCT----------------CTTTTGCCAGTCGGCTCCTCTCAAA-GATAT--TAGCAGGACCTCC-----------------CTTCACTGTTTGG-CCTCGGTGT---GATAA---TTATCT-ACGC--------------CGTCGGCT-----------------------------------------------TTGTG-----------CAT------------------------ATGA---GGACCCGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GCCT-CTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCT-GGACCGTGTACAAGTCT{CT}CTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCTCC-GAGACTCAGCCTCGCC-TTCCG-GCCCGGTGTACTTCTC-GGCGAACGGGCC-AGCATCAATTTTGAT-CGTCGGACAAGGGCGAGAGGAAGGTGGCACCT---TTCGGGGTGTG-TTATAGCCTCTC---GTCGCA-TACGACGGTCGGGATTGA-GGACCGCAGCA-CGCCTTT---ATGGTCGGGG-TTC-GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCCGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Gloiothele_lactescens -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCTCTCAGTAT--TCTGAAAGGTACACCTGTTTGAGTATCATTAATAACCATCCACTTTAA---CCTTGTTGGTT-----------------------------AAAGCTGGGAAGT-TGGGGGTT---TTGTTGCTAGTCATTTCTGTATCAGATGGA-------------------CTTGCTCCCCTTAAA-TTGAT--TAGTGAAAGAGAACCAAG-CATATAGGGAAACAAGCTTGAAAGGGGTTGATGT---GATAGATAACTTCTAATTGACCTCTGAAGTGTACTCCTGTTGACAT-------------------------------------GCAATAACAAAAGCTTCTCTTCTGCTTTCAAACTGCATTTTTGAATGCTATTT------TTGAACTAGTAACTGCGAGTGAAGCGGGATGAGCTCAAATTTTAAATCTGGCA-GAGTAATGACTGTCCGAATTGTAATTTAGAGAAGTGTTTTCTGTGCC-AGGCCGTGTACAAGTCTCCTGGGATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-TAATGGTGCTCT-GTGATACACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAACTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGCTGAAAGGGAAACACTTGAAGTCAGTCACATTGGCT-AGAACTCAACCTCCCCTTTGTTGGGTTGGTGTACTTTCT-AGTGAATGGGCC-AGCATCACTTTTGGC-TATTGGAAAAGGGTTGAAGGAATGTGGCACTCTGTTTCAGGGTGTG-TTATAGCCTTTG---ATCATA-TACAGTAGCTGGGAGTGA-GGAAAGC-----CTTTATTG----------------------------------TAGGATGCTGGCATAATGGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCGTGCGAGTGTTTGGGTGTTTAAAACCCATGCGCGTAATGAAAGTGAAA-GTTGGGAAGGCTGTCATGGCCTGCACTGATGCCCGGACTTGAGATTTATCGACAGTTCTGCGGTAGAGCATGTATGTTAGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTTGCAT----CAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGA{AT}CGAGTTGTCACTTGGTTGGACTACTCGG-CGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATCTACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Hericium_abietis -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGC?CCCCTTGGTAT--TCCGAGGGGCACGCCTGTTCGAGTGTCGTGAAA--TTCTCAACTCAATCCTCTTGT--TAT--------------GAGAGGGCT--------GGGCTTGGACTT-GGAGGTCT----TGTCGGTTGCT-------CCCTCGGGAA----------GT---------CGGCTCCTCTTGAA-TGCAT--GAGTGGATCCCTTTT------------------GTAGGGTTTGCCCTTGGTGT---GATAA---TTATCT-ACGCCACGGGT-----------AGCCTTGC-----------------------------------------GTTGGTC-TGCTT-CCAACCGT---C?TC---------GGACAAC--TT---TCATCTCAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAATTAAGTCCCGTCCGCC-AGAACTCAGCCTTGCCATCTG--GCCTGGTGTACTTTCT-GGTGGACGGGCC-AGCATCAATTTCGAC-TGCCGGACAAGGGCTGGGGGAATGTGGCACCTT-----CGGGTGTG-TTATAGCCCTCA---GTCGTA-TACGGTGGTTGGGATTGA-GGAATTCAGCA-TGCCTTT---ATGGTCGGGGTTG--GCCCACGT--TCATGCTTAGGATGCTGCCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTTATGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---AT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Hericium_alpestre -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT--TCCGAGGGGCACGCCTGTTCGAGTGTCGTGAAA--TTCTCAACTCAATCCTCTTGT--TAT--------------GAGAGGGCT--------GGGCTTGGACTT-GGAGGTCT----TGCCGGT-GCT-------CCCTCGGGAA----------GT---------CGGCTCCTCTTGAA-TGCAT--GAGTGGATCCCTTTT------------------GTAGGGTTTGCCCTTGGTGT---GATAA---TTATCT-ACGCCGCGGGT-----------AGCCTTGC-----------------------------------------GTTGGTC-TGCTT-CTAACCGT---CCTC---------GGACAAC--TT---TCATCTCAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGCC-AGAACTCAGCC{CT}TGCAATCTT--GCCTGGTGTACTTTCT-GGTGGACGGGCC-AGCATCAATTTCGAC-TGCCGGACAAGGGCTGGGGGAATGTGGCACCTT-----CGGGTGTG-TTATAGCCTCCA---GTCGTA-TACGGTGATTGGGATTGA-GGAATTCAGCA-TGCCTTT---ATGGTCGGGGTTC--GCCCACGT--TCATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACC?GTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGG--AAAACCCATGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTTATGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---AT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hericium_americanum ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTA-TGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT--TCCGAGGGGCACGCCTGTTCGAGTGTCGTGAAA--TTCTCAACTCAATCCTCTTGT--TAT--------------GAGAGGGCT--------GGGCTTGGACTT-GGAGGTCT----TGCCGGT-GCT-------CCCTCGGGAA----------GT---------CGGCTCCTCTTGAA-TGCAT--GAGTGGATCCCTTTT------------------GTAGGGTTTGCCCTTGGTGT---GATAA---TTATCT-ACGCCGCGGGT-----------AGCCTTGC-----------------------------------------GTTGGTC-TGCTT-CTAACCGT---CCTC---------GGACAAC--TT---TCATCTCAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGCC-AGAACTCAGCCTTGCAATCTT--GCCTGGTGTACTTTCT-GGTGGACGGGCC-AGCATCAATTTCGAC-TGCCGGACAAGGGCTGGGGGAATGTGGCACCTT-----CGGGTGTG-TTATAGCCTCCA---GTCGTA-TACGGTGATTGGGATTGA-GGAATTCAGCA-TGCCTTT---ATGGTCGGGGTTC--GCCCACGT--TCATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACC?GTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCATGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTTATGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---AT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCA{AT}GGAAGTCGGAACCCGCTAAGGAGTGTGTAA{AC}AACTCACCTGGCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Hericium_cirrhatum -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AT-AGTATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT--TCCGAGGGGCACGCCTGTTCGAGTGTCGTGAAA--TTCTCAACTCGATCCTCTTGTCATAT--------------GAGAGGGTT--------GGGCTTGGACTT-GGAGGTCT----TGCCGGTTGCTT-----CCCCTCGGGAAT---------GTG-------TCGGCTCCTCTTGAA-TGCAT--GAGTGGATCCCTTTTG-----------------GTAGGGTTTGCCCTTGGCGT---GATAG---TTATCT-ACGCCGTGGGC-----------AGCCTTGCA---------------------------------------TGTTGGTC-TGCTT-CTAACCGT---CCTTT-------GGGACGC---TT---TCATCTCAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCC-AGAACTCAGCCTTGCAATCTT--GCCTGGTGTACTTTCT-GGTGGACGGGCC-AGCATCAATTTTGAC-TGCCGGACAAGGGCTGGGGGAATGTGGCACCTT-T--GCGGGTGTG-TTATAGCCCCTG---GTCGTA-TACGGTGGTTGGGATTGA-GGAATTCAGCA-TGCCTTT---ATGGTCGGGGTTC--GCCCACGTTATCATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACC?GTCTTGAAACACGGACCAAGGAGTCTAACATGCC?GCGAGTGTTCGGGTGG--AAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGACCTCTGTTATGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGGCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAATGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Hericium_coralloides -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT--TCCGAGGGGCACGCCTGTTCGAGTGTCGTGAAA--TTCTCAACTCAATCCTCTTGT--TAT--------------GAGAGGGCT--------GGGCTTGGACTT-GGAGGTCT----TGCCGGTGGTT-------CCTTCGGGACC---------GT---------CGGCTCCTCTTGAA-TGCAT--GAGTGGATCCCTTTTT-----------------GTAGGGTTTGCCCTTGGTGT---GATAA---TTATCT-ACGCCGCGGGT-----------AGCCTTGCG---------------------------------------CGCTGGTC-TGCTT-CTAACCGT---CCTTC-------GGGACATGTATT---TCATCTCAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TCGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCC-AGAACTCAGCCTTGCAATCTT--GCCTGGTGTACTTTCT-GGTGGACGGGCC-AGCATCAATTTTGAC-TGCCGGAGAAGGGCTGGGGGAATGTGGCACCTT-----CGGGTGTG-TTATAGCCCCTG---GTCGCA-TACGGTGGTTGGGATTGA-GGAATTCAGCA-TGCCTTT---ATGGTCGGGGTTC--GCCCACGT--TCATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTTGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAG{CG}AGAAACTC---{AG}T-ATCAGATTTATGTGGTA{AG}AGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTTACAACTCACCTGCCGAA-TGAACTAGCCCTG{AG}AAA-TGGATGGC Hericium_erinaceus -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT--TCCGAGGGGCACGCCTGTTCGAGTGTCGTGAAA--TTCTCAACTCAATCCTCTTGT--TAT--------------GAGAGGGTT--------GGGCTTGGACTT-GGAGGTCT----TGCCGGT-GCT-------CCCTCGGGAA----------GT---------CGGCTCCTCTTGAA-TGCAT--GAGTGGATCCCTTTT------------------GTAGGGTTTGCCCTTGGTGT---GATAA---TTA-CT-ACGCCGCGGGT-----------AGCCTTGC-----------------------------------------GTTGGTC-TGCTT-CCAACCGT---CTTC---------GGACAAC--TT---TCATCTCA-CTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGCC-AGAACTCAGCCTAGCAATCTT--GCCTGGTGTACTTTCT-GGTGGACGGGCC-AGCATCAATTTCGAC-TGCCGGACAAGGGCTGGGGGAATGTGGCACCTT-----CGGGTGTG-TTATAGCCCTCA---GTCGTA-TACGGTGGTTGGGATTGA-GGAATTCAGCA-TGCCTTT---ATGGTCGGGGTTCA-GCCCACGT--TCATGCTTAGGATGCTGCCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTTATGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGC?GAAGTTTCCCTCAGGA-TAGCAGAAACTC---AT-ATCAGATTTATGTGGTAAAGC?AATGATTAGAGG-CCTTGGGGTT?AAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGT???CCATTTTTGGTAA?CAG{AG}ACTGGC{AG}TGC{ACT}GGG{AGT}TGAACCT{AG}ACGCGAGGTTAA?GTGCCGGAATTCACCGTCATC--{AC}{AG}GCACC------------------------------------------------------------------------------------------------------------------- Heterobasidion_annosum_061292 ACGAA-TATC----GTGCAAGGTTGAA-GCTGGCCTCTC------GGGGCA---------TGTGCTCGCCTTGTTCATA--------TCCATCTCACACCTGTGCACACTCGCGTGGGTCGG-----TCGG----------GTTCTTTT--G--------------ACCCCTTCCGAGCCGCGTCTTCTC--------------ACAAACTC-TTCGT--ATGTCTTTAGAATGG------------TATCAATGCTAT-A----AAACGCATCTT--ATA--CAACTTTCAACAATGGATCTCTCGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTAT--TCCGAAGGGCACGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCTGTGCTTTTCTTGT----------------GAAAG-----CGCGT--GGGCTTGGACTT-GGAGGCT----TTGCTGGT-----------CCTC----------------GC----G-GATCGGCTCCTCTCAAA-TGCAT--TAGCGAGA---------------------CCCTTGTGGTGCCGCCCCCGGTGT---GATAA---TTGTCT-ACG---------------CCGTGGTG-----------------------------------------------GTACGCCACGA-TTG----------------------------TGGG---GGACCTGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GCCT-CCGGTCGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGCGTC-GGACCGTGTATAAGTTTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTG-CCGA--TGCTTT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGCGTCCGCC-GGGACTCAGCCTTGCGTTC-TC-GCTCGGTGTACTTTCT-GGTGGACGGGCC-AGCATCAATTTTGAT-CGTCGGAAAAGGATCGGGGAAATGTGGCACCT---TTCGGGGTGTG-TTATAGTCTCCG---GTCGCA-TACGACGGTTGGGATTGA-GGAACTCAGCA-TGCCTTT---ACGGTCGGGG-TTC-GCCCACGTT--CATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGCGGAGGGCACCGACGCCCGGACCAGAACTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---AT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Heterobasidion_parviporum_041213 ACGAA-TATC----GTGCGGGGTTGAA-GCTGGCCTCTC------GGGGCA---------TGTGCTCGCCTTGTTCATA--------TCCATCTCACACCTGTGCACACTCGCGTGGGTCGG-----TCGG----------GCTCTTTTTTG--------------CGCCCTTCCGAGCCGCGTCTTCTC--------------ACAAACTC-TTCGT--ATGTCTTCAGAATGG------------TATCAATGCTAT-A----AAACGCATCTT--ATA--CAACTTTCAACAATGGATCTCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTAT--TCCGAAGGGCACGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCTGCGCTTTTCTTGT----------------GAAAG-----CGCGT--GGGCTTGGACTT-GGAGGCT----TTGCTGGT-----------CCTC----------------GC----G-GATCGGCTCCTCTCAAA-TGCAT--TAGCGAGA---------------------CCCTTGTGGTGCCGCCCCCGGTGT---GATAA---TTGTCT-ACG---------------CCGTG--G-----------------------------------------------GTACACCGCGA-TTG----------------------------TGGG---GGACCTGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GCCT-CCGGTCGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGTC-GGACCGTGTATAAGTTTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACCG-CCGA--TGCTTT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGCGTCCGCC-AGGACTCAGCCTTGCGTTC-TC-GCTCGGTGTACTTTCT-GGTGGACGGGCC-AGCATCAATTTTGAC-CGTCGGAAAAGGATCGGGGAAATGTGGCACCC---TTCGGGGTGTG-TTATAGTCTCCG---GTCGCA-TACGACGGTTGGGATTGA-GGAACTCAGCA-TGCCTTT---ACGGTCGGGG-TTC-GCCCACGTT--CATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGCGGAGGGCACCGACGCCCGGACCAGAACTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---AT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Lactarius_leonis ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAC-GTAATGTGA{AGT}TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT--TCCGAGGGGCACACCCGTTTGAGTGTCGTGAAA--ATCTCAACCT-TCTCGGTTTCTT------------------CTGGAC--ACCGAAGGAGGCTTGGACTT-TGGAGGCC--TTTGCTGGCGT-------CTCT-CTCTTCTGA---------------AACCCAGCTCCTCTTAAA-TGAAT--TAGCGGGGTCCTCTT---------------TGCT-------GATCCTCGACGTGT-GATAAGATGTTTCC-ATGTCTTGGTTTCTGG-CTCTGTTGCTCCTGGGACCCGCTCCTAACCGTCTC-----AACCTTGCAT-----CGAGACAACGTTTGAG-CGTG--TCTCCCTTCTCGGGAAACGCTCTCAACCCCACGAACCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG-GTCTT-TGGCCGTCCGAGTTGTAATTTAGAGAAGCGTCTTCCGCGC{CT}-GGACCGTG{CT}ACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGGCACGGATGC-CTGG--TGCTTCTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAACTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGACC-GAGACTCAGCCTT-GC-C-TCGGC-TTGGTGTACTTCTCGGC-CGACGGGTC-AGCGTCAATTTTGCC-CCTCGGATAATGGCAAGGGAAAGGTGGCACCTT-TAC---GGTGTG-TTATAGTCTCCT---GTCGCA-TGCGAGGGGTGGGATTGA-GGAACTCAGCG-CGCACCTT--GGTGTCGGGGCTTCGGCCCACGTC-ACGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCCAACACGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTGTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGATGAAACATCC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTC{CG}-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACCGTGGCCATGGAAGTCGGAATCCGCTAAG{AG}GGTGTGTAACAACTCACCTGCCGGA-TGAACTAGCCCTGAAAA-TGGATGG{CG} Larssoniporia_sp_dai13607 TCGAT-TTTGAA--GGCTCGGGTTGTA-GCTGGTCTCTCTCTCTCGAGACA---------GGTGCTCGCCCTTGCTCTTT----ACACCCCACATAC-CCTGTGCACTCCTGCGTGAGCCGT--------------------GTCGAACTTC--------------GGTTCGGTGCGCTCGCGAATTTAT--------------A--AACCCCTCAGT--ATGTCT-TAGAATGT------------C-TCTGCGTATC-------TACGCAACCTA-GTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCAACTTGCACCCTTTGGTAT--TCCGAGGGGTACACCTGTTTGAGTGTCGTGAAT--TTCTCAACTCTACCTCCTTTTGCG----------------AGGAG-----TCGTA--GAGCTTGGACTT-GGAGGCT----TTGCGGGC-----------G--------------------TT-TCGCCGTCCGCTCCTCTTAAA-TGTAT--TAGTGACA------------------------TGCCCCGGGTGGCTTGGACGT---GATAA---TTGTCT-ACGT--------------CCGTGGTC-----------------------------------------------GCTCGTCG------------------------------------TCG---GTGGTCGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG--TCT-TTGGGCGTCCGAGTTGTAGTTTAGAGAAGCGTTTTCCGTGCC-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCGG--TGCTAT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCC-GGGACTCAGCCTGGTTTTT----ACCTGGTGTACTTCCC-GGTGAACGGGCCCAGCATCACTTTTGAT-CGTCGGAAAAGAGCGGGAGAAACGTGGCACCT---TT-CGGGTGTG-TTATAGTCTCTC---GTTGTA-TACGGCGGTCGGGAGTGA-GGAACTCAGCA-CGCCTT----ACGGTCGGGGTTC--GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGTGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGCGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCGAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCTTTGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGACTGGACCGCTCG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATTTACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Larssoniporia_sp_dai13608 TCGAT-TTTGA---GGCTCGGGTTGTA-GCTGGTCTCTCTCTCTCGAGACA---------GGTGCTCGCCCTTGCTCTTT----ACACCCCACATAC-CCTGTGCACTCCTGCGTGAGCCGT--------------------GTCGAACTTC--------------GGTTCGGTGCGCTCGCGAATTTAT--------------A--AACCCCTCAGT--ATGTCT-TAGAATGT------------C-TCTGCGTATC-------TACGCAACCTA-GTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCAACTTGCACCCTTTGGTAT--TCCGAGGGGTACACCTGTTTGAGTGTCGTGAAT--TTCTCAACTCTACCTCCTTTTGCG----------------AGGAG-----TCGTA--GAGCTTGGACTT-GGAGGCT----TTGCGGGC-----------G--------------------TT-TCGCCGTCCGCTCCTCTTAAA-TGTAT--TAGTGACA------------------------TGCCCCGGGTGGCTTGGACGT---GATAA---TTGTCT-ACGT--------------CCGTGGTC-----------------------------------------------GCTCGTCG------------------------------------TCG---GTGGTCGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG--TCT-TTGGGCGTCCGAGTTGTAGTTTAGAGAAGCGTTTTCCGTGCC-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCGG--TGCTAT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCC-GGGACTCAGCCTGGTTTTT----ACCTGGTGTACTTCCC-GGTGAACGGGCC-AGCATCACTTTTGAT-CGTCGGAAAAGAGCGGGAGAAACGTGGCACCT---TT-CGGGTGTG-TTATAGTCTCTC---GTTGTA-TACGGCGGTCGGGAGTGA-GGAACTCAGCA-CGCCTT----ACGGTCGGGGTTC--GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGTGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGCGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCGAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCTTTGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGACTGGACCGCTCG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATTTACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Laurilia_sulcata -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTAT--TCCGAAGGGCACGCCTGTCTGAGTGTCGTGAAA--TTCTCAACTCTA-CTTTCTTTTTT-----------------GAATG--------TTAGAGCTTGGACTT-GGAGGTT---CTTGCTGG----------TCCTTTGTGA----------------------TCGGCTCCTCTTGAA-TGCAT--TAGCAAGA-CCCCAG---------------TGTGGTGCTG---CCTCCAGTGT---GATAAT---TGTCT-ACGCTGTGGGTTTGGCTCCGCGACTCGTG----------------------------------GGG--------ACCCTCGCTT-CCAACCGT--C----------GAAAGACAA--TTC---ATCGAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTTGCG-GTCTCC-GGCCGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGTC-GGACCGTGTACAAGT??CCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCGA--TGCT-TTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTC?AAATGGGTGGTGAAT???ATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACGTCTGCC-GGGACTCAGCCTT-GCAA-ACCTGCCTGGTGTACTTCCTGGT-GGACGGGCC-AGCATCAATTTTGAC-TGCCGGACAAAGGCTAGGGAAATGTGGCACCTT-C---GGGT-GTG-TTATAGTC{CT}CTG---GTCACA-TACGGTGGTTGGGATTGA-GGAACTCAGCA-TGCCTT?AT---GGTCGGGG-TTC-GCCAACGT--TCATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGCGGAGGGCACCGACGCCCGGACCAGAACTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----ATCAGATTTATGTGGT??AAG??ATGATTA?AGG-CCTTGGGGTT??GACAACC-TTAAGGTATTCT-?AAACTT??AATATGGT{ACT}?AACAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Laxitextum_bicolor ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGTATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT--TCCGAGGGGCACACCTGTTTGAGTGTCGTGAAA--TTCTCAACTTCAACCT-TTGT----T--------------GGAAGA------------AGCTTGGACTT-GGAGG-CT----TGCTGG------------CTTTTGT?A-----------GT---------CAGCTCCTCTTGAA-TGCAT--GAGTGGAACCTTT--------------------GTAGGG--TGACCTTGGTGT---GATAA---TTGTCT-ACGCCGCTGGTCTTGCCTTGCAAGCTTTATG---------------------------------------GGTTTGCC-TGCTT-CTAACCGT---CTCGC-------AAGAGACA-ACT---TCATGA-AACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCT-TTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCC-AGAACTCAGCCTTA-GCTTCG--GCTTGGTGTACTTTCT-GGTGAACGGGCC-AGCATCAATTTTGAT-CGTCGGATAATGGCAAGGGGAATGTGGCACCTT-----CGGGTGTG-TTATAGCCCCTT---GTCGCA-TACGGCGGTTGGGATTGA-GGAATTCGGCA-TCCCCTC---GTGGTTG--------------------ATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACC?GTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTTGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---AT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Lentinellus_auricula ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCCTTGGTAT--TCCGAGGGGTACGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCCT-GCCCCCCTTTT-----------------G-GGGGT----GCGGGGAGCTTGGACTT-GGAGGTTT--TG{CGT}CGGGGAAAAAAAAAACACACCCCCTTT------GGCGTGTG---CTCTCGGCTCCTCTCAAA-GGCAT--TAGCAAGGACCCTTT---------------TGCCCGGTGGCCCCCTC-GGTGT---GATAGT---TGTCT-A?GCCGCGTCTGGGGCCTCGGCCTCTCTCTTCCTCCTCCTTCCCTCGGGAAAAGGGGGGGTTGGGGAGA{AG}AGAGGGACCTGCTT-CCAACCG---TCCCC---CGCAAGGGACA-CTTTC---ATCGAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGC{CT}CAAATTTGTAATCTGGCG-GTCTTTGG-CCGTCCGAGTTGTAATCTAGAGAAGCGTCTTCCGCGCC-GGACCGCGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACCG-CCGG--TGCT-CTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGCC-GAGACTCAGCCTC-GCCT-CCCGGCCTGGTGTACTTCTCGGT-GGACGGGCC-AGCATCAATTTTGAC-CGTCGGACAAGGGCGGGGGGAAGGTGGCACCTT-C----GGGTGTG-TTATAGCCCCCC---GTCGCA-TGCGGCGGTTGGGATTGA-GGAACTCAGCA-CGCCTTTA---TGGTCGGGG-TTC-GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGAGCTTCTGCGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCGT----GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Lentinellus_cochleatus ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGA{AG}TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCCTTGGTAT--TCCGAGGGGTACGCCTGTCTGAGTGTCGTGAAA--TTCTCAAC{CT}CCG-CCCCCTTTTGC-----------------GAGGGGT----GATTGGGGCTTGGATTT-GGAGGCTT--TGCCGGAACCC----CCCCTCCCCCCGCTAGGAGGAGGAGAGGG--GGGATCGGCTCCTCTCAAA-GGCAT--TAGTG-GGACCCTT----------------TGC--GG------CCTC-GGTGT---GATAAT---TGTCT-ACGCCGTG-----GGCTTAGCTCTC----------------------------------GTGGGGG---------GACCTGCTT-CGAACCG---TCTC-----GCAAGGGACA-CTCTC---ATCGAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGTAATCTGGCG-GCCTTCGG-C-GTCCGAGTTGTAATCTAGAGAAGCGTCTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTG-CCAG--TGCT-CTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGCC-GAGACTCAGCCTC-ACCT-TCTGGTGTGGTGTACTTCTCGGT-GGACGGGCC-AGCATCAATTTTGGT-CGTCGGACAAGGGCGGGGGGAAGGTGGCACCTT-C----GGGTGTG-TTATAGCCCCTC---GTCGCA-TACGGCGGTCGGGATTGA-GGAACTCAGCA-CGCCTTCAA--TGGTCGGGG-TTC-GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGATA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCTGAGCTTCTGCGATGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCGT----GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGG{GT}GTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Lentinellus_omphalodes ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCCTTGGTAT--TCCGAGGGGTACGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCCG-CCCCCTTTTGC-----------------GAGGGGC----GTCGGTGGCTTGGACTT-GGAGGCTT--TGCCGGGGGAAAAAGGGTTTCGACCCCCGC------------------TCTCGGCTCCTCTCGAA-GGCAT--TAGTA-GGACCCTT----------------TGC--GG------CCTC-GGTGT---GATAAT---TGTCT-ACGCCGTG-----GGTTTAGCAT------------------------------------GTCATGG---------GACCCGCTT-CCAACCGG--TCTC-----GCAAGGGACACTTTCA---ATCGAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGTAATCTGGCG-GCCTTCGG-TCGTCCGAGTTGTAATCTAGAGAAGTGCTTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCG?CGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCT-CTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTGAATTCCTTCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGCC-GAGACTCAGCCTT-GCCT-CCTGGCTTGGTGTACTTCTCGGT-GGACGGGCC-AGCATCAATTTTGAC-CGCCGGACAAGGGCGGGGGGAAGGTGGCACTTC------GGGTGTG-TTATAGCCCCTC---GTCGCA-TACGGCGGTCGGGATTGA-GGAACTCAGCA-CGCCTTTA---TGGTCGGGG-TTC-GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCCCTGTCGTGGGGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-TTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGG{AG}-TAGCAGAAACTCGT----GTCAGATTTATGTGGTAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Lentinellus_ursinus ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCCTTGGTAT--TCCGAGGGGTACGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCCG-CCCCCTTTTGC-----------------GAGGGGTTT--GTCGGTGGCTTGGACTT-GGAGGCTT--TTCCCGGGGGAA------TTCATTCC------------------------TCGGCTCCTCTCGAA-GGTAT--TAGCA-GGACCCTT-----------------GC--GG------CCTC-GGTGT---GATAAT---TGTCT-ACGCCGTG-----GGCTTAGCTC------------------------------------CTC-TGG---------GACCTGCTT-ACAACCG---TCTC-----GCAAGGGACACTTTCA----TCGAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGTAATCTGGCG-GCCTTCGG-TCGTCCGAGTTGTAATCTAGAGAAGTGCTTTCCGCGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAG--TGCT-CTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGCC-GAGACTCAGCCTC-GCCT-TCTGGCTTGGTGTACTTCTCGGT-GGACGGGCC-AGCATCAATTTTGAC-CGCCGGACAAGGGCGGGGGGAAGGTGGCACCCT-TTCGGGGGTGTG-TTATAGCCCCTC---GTCGCA-TACGGCGGTTTGGATTGA-GGAACTCAGCA-CGCCTTTA---CGGTCGGGG-TTC-GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAGCGACC?GTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCCCTGTCGTGGGGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Lentinellus_vulpinus ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGA{AG}TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCCTTGGTAT--TCCGAGGGGTACGCCTGTCTGAGTGTCGTGAAA--TTCTCAAC{CGT}CCA-CCCCCTTTTGC-----------------GAGGGGT----G-TCGGGGATTGGACTT-GGAGGCTT--TGCCGGAACCCGGTGTGCCCTCCCCTTCTTGGGGGTGGCGTGTGTCGGGATCGGCTCCTCTCAAA-GGCAT--TAGCA-GGACCCCTC---------------TGC--GG------CCTC-GGTGT---GATAAT---TGTCT-ACGCCGTG-----GGCTTAGC{CT}CTC----------------------------------GTTGGGG---------GACCCGCTT-CCAACCG---TCTC-----GCGAGGGACAACCTTC---ATCGAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGTAATCTGGCG-GTCTTCGG-CCGTCCGAGTTGTAATCTAGAGAAGCGTCTTCCGCGCC-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTG-CCGG--TGCT-CTGCGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGCC-GAGACTCAGCCTC-GCCT-TCCGGCCTGGTGTACTTCTCGGT-GGACGGGCC-AGCATCAATTTCGAT-CGTCGGACAAGGGCGGGGGGAAGGTGGCACCTT-C----GGGTGTG-TTATAGCCCCCC---GTCGCA-TACGGCGGTCGGGATTGA-GGAACTCAGCA-CGCCTTTA---CGGTCGGGG-TTC-GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTCTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGCAATGAAAGTGATA-GTTGGGACCTCCGTCGTGGAGGGCACCGACGCCCGGACCTGAGCTTCTGCGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Megalocystidium_luridum -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTAT--TCCGAAGG-CACACCTGTTTGAGTGTCGTGAAA--TTCTCAACCCTC-CCCACTTTTGC-----------------GAGTGGC----GGTCAGGGCTTGGACTT-GGAGG-C---CTTGCCGG----------ACTTTGTCT-----------------------TCGGCTCCTCTCAAA-TGCAT--TAGTGCG--TCCTGT---------------TGCGATGTTG---CCTTCGGTGT---GATAAT---TATCT-ACGCCGTGTCAGTG--TACGTTGCTTCTC-------------------------------T---AG--------GGACATGCTT-CAAACCGT--C------CGA--AAGGACAA--TTC---ATCGAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTTTC--GGCCGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGTC-GGCCCGTGTACAAGTTTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACC--CCGA--TGCT-TTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCT-TGGACTCAGCCTT-GCAT---CAGCTTGGTGTTCTTCCATGT-CGACGGGCC-AGCATCAGTTTTGAC-CGCGAGACAAAGGCGGAGGGAATGTGGCTCTTT-C---GGGA-GTG-TTATAGCCCTTC---GTCACA-TGTCGCGGTTGGGACTGA-GGTCATCAGCA-CGCCTTTAT---GGCCGGGG-TTC-GCCCACGT--ACGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGATCCCTGTCGTGGGGTGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-T-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Peniophora_pini --------------TATTAGAGGAAGTAAAAGTCGTCACAAGGTTTCCGTAGGTGAACCAGCGGAAGGATCATTAGCGAAGCTCGGAA{CT}GCATGTACGGTGTTGATGCTGCCCAGCAATGGGATGTGCTCGCTCGGATGTGTGTCCCTTCTC--TATTCCACCCCATTGTGAACCAAGTGTGCGAGCCGAAGAG------AGATCGGAGGCTCGCATGCAAACCCTTAACATACCC---CAATGAAGTATCAGAATGTACCTTGCGTTAACTCGCACAAATATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAAT--GCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCAT-----GA-GG----G---GTTTGAGTGTCGTGAA-----CTCCTCCACCCTCT-------------------ACCTTTTACGAAGGG-CATTG--GGCTGGGATTT--GGGAGCA---TGCGGGTCCCTGGCCGATCC--------------------------------GCTCTCCTTGAA-TGCAT--TAGCGAAGCCCTTGCGG--CCTTGGTGTGA----------TAATCA-------------------TCTACGCCTCGGTTTAGCGAACATACGGGAATCGC-----------------------------------------------------------TTACAGCCGTCTCGCAAGAGACAACGA----CTAC------CAACTAGTAACTGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCG-TCTTC-GG--CGTCCGAGTTGTAATTTAGAGAAGTGTTTTCCGCGCC-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACCC-CCGGTG--CTCT-GTGATACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAACTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGCC-GGAGCTCAGCC------------GCAAGGTGTACTCTCT-GGTGGACGGGCC-AGCATCACTTTCGAT-CATCGGAAAAGGGCGAGGGGAATGTGGCACC-----TCCGGGTGTG-TTATAGCCCTTT---GTCGTA-TACGGTGACCGGGAGTGA-GGACCGC-------CTTTTG----------------------------------TAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGAAGGCTGTCGCGGCCTGCACCGACGCCCGGACTTGAGATTTATCGAAGGTTCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTATCCCTCAGGA-TAGCAGAAACTCATGT----CAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGG-CGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC?GGAGGTTAAGGTGCCGGAATCTACGCTCATC--AGACACCAC?AAAGGTGTTAGTACATCTAGACAGCAGGATGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAAC?ACTCACCTGCCGAAATGAACTAGCCCTGAAAAATGGATGGC Polyporoletus_sublividus ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTCTTGGTAT--TCCGAGGGGCACGCCTGTTTGAGTATCGTGAAA--TTCTCAACCC-G-ACTCCTTTTGT-----------------GAAA----GGGGGGGAGGGCTTGGACTT--GGAGGT---CTTGCTGGTC----------CCTTTGTT--------------TTCTGGAACCGGCTCCTCTGGAA-TGCAT--TAGTGGAGCT-CGTC---------------CGCTCTCTC-------TCGGTGT---GATAATT--CATCT-GCGCCGACGTGTGTGACAGGAAAA-------------------------------------------------GAGCGCCGCTT-CGAAC------CGGTCTCGTTC-GAGACAAGCTTC----T--GAACCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCTGGCG-GTCTTT-GGCCGTCCGAGTTGTAGTCTGGAGAAGCGCTTTCCGCGCC-GGACCGTGTACAAGTCCTCTGGAACGGGGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCGG--TGCT-CTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGACC-AGGATTCAGCCTT-GCGACCCTCGCTCGGTGTATTTTCTGGTTCGACGGGCC-AGCATCGATTTCGAC-CGTCGGACAAAGGTGGGGGAAACGTGGCACCCT-TTTCTGGGTGTG-TTATAGTCCCTC---GTCGTA-TACGGTGGTCGGGATCGA-GGAACTCGGCA-CGCCCTCGT---GGTCGGGGCTTCGGCCCACGTC-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTTCG-AGAGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTGGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCGAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTCGTTAG-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTCGAAACGACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTCGATCGGACCGCTTGCATGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTACCAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Pseudowrightoporia_sp_Cui_9073 ATGAA-TTTGAAAGGGGG----TTGTTTGCTGGTCCC-ATACGGACATT------------GTGCACGCCTCTGATCTCA---TCCATC--TCACAC--CTGTGCACTCTTGCGTGAGTCT-TGTGGGA------------GGGCGTTCTT---------GCGTCTTTCTACA-GGGCTTGCGT--CCTTTTAT---------TACAAACTCTTTTGC--ATGTCT-TGGAATGT----------A-TATTGCTGTAT-----AAAAACGCAAT-CTTGTAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCC-CCTGGTTT-CGCTGGGGG-CATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTCGAGCTTTCTTTTCT-----------------TGAGAGTC------TCGGGATTGGACTT-GGAGGTGT---T-GCTGGT------------CTCTGA-----------------------TCAGCTCCTCTTGAA-TGCAT--GAGTGGGGGGCT----------------GATC-----CTCATCCC-TTGGTGT---GATAA---TTGTCT-ACGCCAT-CAG------ATTTGGAACA-------------------------------------------CATGAACC-TGCTT-CTAACTGT---CTCCT---TGTTGAGACAATCACT---TATGAAACTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCT-TTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGCTTTCTGTGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCC-AGGACTCAACCTT-GCATTCA-TGCCTGGTTTATTTTCT-GGTCGACGGGCC-AGCATCAGTTTTGGC-TGCTGGATAATGGCTAGAGAAATGTGGCACCC-----TCGGGTGTG-TTATAGTCTCTA---GTCGGA-TACGGTGGCTGGGACTGA-GGACCGCAGCA-C----------------------------------TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--CAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTTGATTGGACCGCTTG-ACGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Pseudowrightoporia_sp_Cui3344 ATGAA-TTTGAAAGGAGG----TTGTT-GCTGGCCCC-T--CACTTTGGGG--CATC----GTGCACGCCTCTGATCTCA---TCCACCTCTCACACCCCTGTGCACTCTTGCGTGAGCCT--------------------G--CTTCCCT---------------------GCAGGCTTGCGT--CCTTTTAT---------CACAAACCCCTATGC--ATGTCT-CTGAATGT----------T-TGTTGCTTTA----------ACGCAAT-CTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCACCTGGCTT-CGCCGGGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTCGAGCTTTTCTTTTG----------------GAGAGTCTC------TCGGGATTGGACTT-GGAGGTGT---T-GCCGG------------TCTC------C---------TTGCT-GAGATGGGCTCCTCTTGAA-TGCAT--GAGTGGGGGG----------------TTGATC-----CTCGTCCC-TTGGTGT---GATAA---TTGTCT-ACGCCA--GAGG-----ATTTGGAACG-------------------------------------------CATGAACC-TGCTT-CGAACCGT---CTCAT---CGTTGGGACAA--AC---------GGCCTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCTGTGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCAG--TGCTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCC-AGAACTCAACCTT-GCTCTTT-CGCTTGGTTTACTTTCT-GGCCGACGGGCC-AGCATCAGTTTCGGC-CGCCGGACAATGGCCAGGGAAATGTGGCACCC-----TCGGGTGTG-TTATAGTCTCTG---GTCGGA-TACGGTGTCTGGGACTGA-GGACCGCAGCG-C----------------------------------TCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--CAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTTGATTGGACCGCTTG-ACGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Pseudowrightoporia_sp_Dai_10007 ATGAA-TTTGAA-GGGAG----TTGTT-GCTGGTCTG-A--AAATTTCGGA--CAAC----GTGCACGCTCCTGATCT-----TCATCCATTCACAC--CTGTGCACTCTTGCGTGAGCCT--------------------G--CTTCATTT--------------------GCGGGCTTGCGT--TCTTTTAT---------TACAAACTCTTATGT--ATGTCT-AAGAATGT----------TGTATTGCTCTT----------ATGCAAT-CTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCACCTGGCTT-CGCTGGGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCGAGCTTTTTCTATCAT--------------GAGAATGTC------TTGGGCTTGGATTT-GGAGGCCT---TTGCTGGA-----------TCTCACCTAGC---------TTGCTAGGGATCAGCTCCTCTTGAA-TGCAT--GAGTGGGGGTCA-------------ATGTGTC-----CTCATCCC-TTGGTGT---GATAA---TTGTCT-ACGCCAT-GTGG-----ATTTGGATCAATGA---------------------------------------TACGAGCCCTGCTT-CAAACCGT---CTC-C---GATTGTGTGAG--AC---------AGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCTGTGCT-GGACCATGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACATGGACTC-CCAG--TGCTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCAGCC-AGGACTCAACCTTTGCTTTCCATGCACGGTTTACTTTCT-GGTTGACGGGCC-AGCATCAGTTTTGGT-TGCCAGACAATGGCCAGGGAAATGTGGCACCC-----TCGGGTGTG-TTATAGTCTCTG---GTCGGA-TATGGTGGCTGGGACTGA-GGACCGCAGCG-C----------------------------------TCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--CAAACCCGTGCGCGAAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTTGATTGGACCGCTTG-ACGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Pseudowrightoporia_sp_Dai_8132 ATGAA-TTTGAAAGGGAG----TTGTT-GCTGGTCTG-A--AAATTTCGGA--CAAT----GTGCACGCTCCTGATCT-----TCATCCATTCACAC--CTGTGCACTCTTGCGTGAGCCT--------------------G--CTTCATTT--------------------GCGGGCTTGCGT--TCTTTTAT---------TACAAACTCTTATGT--ATGTCT-AAGAATGT----------TGTATTGCTCTT----------ATGCAAT-CTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCACCTGGCTT-CGCTGGGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCGAGCTTTTTCTATCAT--------------GAGAATGTC------TTGGGCTTGGATTT-GGAGGCCT---TTGCTGGA-----------TCTCACCTAGC---------TTGCTAGGGATCAGCTCCTCTTGAA-TGCAT--GAGTGGGGGTCA-------------ATGTGTC-----CTCATCCC-TTGGTGT---GATAA---TTGTCT-ACGCCAT-GTGG-----ATTTGGATCAATGA---------------------------------------TACGAGCCCTGCTT-CAAACCGT---CTC-C---GATTGTGTGAG--AC---------AGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCTGTGCT-GGACCATGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACATGGACTC-CCAG--TGCTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCAGCC-AGGACTCAACCTTTGCTTTCCATGCACGGTTTACTTTCT-GGTTGACGGGCC-AGCATCAGTTTTGGT-TGCCAGACAATGGCCAGGGAAATGTGGCACCC-----TCGGGTGTG-TTATAGTCTCTG---GTCGGA-TATGGTGGCTGGGACTGA-GGACCGCAGCG-C----------------------------------TCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--CAAACCCGTGCGCGAAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTTGATTGGACCGCTTG-ACGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Pseudowrightoporia_sp_Dai_8152 ATGAA-TTTGAA-GGGAG----TTGTT-GCTGGTCTG-A--AAATTTCGGA--CAAT----GTGCACGCTCCTGATCT-----TCATCCATTCACAC--CTGTGCACTCTTGCGTGAGCCT--------------------G--CTTCATTT--------------------GCGGGCTTGCGT--TCTTTTAT---------TACAAACTCTTATGT--ATGTCT-AAGAATGT----------TGTATTGCTCTT----------ATGCAAT-CTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCACCTGGCTT-CGCTGGGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCGAGCTTTTTCTATCAT--------------GAGAATGTC------TTGGGCTTGGATTT-GGAGGCCT---TTGCTGGA-----------TCTCACCTAGC---------TTGCTAGGGATCAGCTCCTCTTGAA-TGCAT--GAGTGGGGGTCA-------------ATGTGTC-----CTCATCCC-TTGGTGT---GATAA---TTGTCT-ACGCCAT-GTGG-----ATTTGGATCAATGA---------------------------------------TACGAGCCCTGCTT-CAAACCGT---CTC-C---GATTGTGTGAG--AC---------AGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCTGTGCT-GGACCATGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACATGGACTC-CCAG--TGCTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCAGCC-AGGACTCAACCTTTGCTTTCCATGCACGGTTTACTTTCT-GGTTGACGGGCC-AGCATCAGTTTTGGT-TGCCAGACAATGGCCAGGGAAATGTGGCACCC-----TCGGGTGTG-TTATAGTCTCTG---GTCGGA-TATGGTGGCTGGGACTGA-GGACCGCAGCG-C----------------------------------TCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--CAAACCCGTGCGCGAAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTTGATTGGACCGCTTG-ACGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Pseudowrightoporia_sp_Yuan5884 ATGAA-TTTGAAAGGGGG----TTGTTTGCTGGTCCC-ATACGGACATT------------GTGCACGCCTCTGATCTCA---TCCATC--TCACAC--CTGTGCACTCTTGCGTGAGTCT-TGTGGGA------------GGGCGTTCTT---------GCGTCTTTCTACA-GGGCTTGCGT--CCTTTTAT---------TACAAACTCTTTTGC--ATGTCT-TGGAATGT----------A-TATTGCTGTAT-----AAAAACGCAAT-CTTGTAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCC-CCTGGTTT-CGCTGGGGG-CATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTCGAGCTTTCTTTTCT-----------------TGAGAGTC------TCGGGATTGGACTT-GGAGGTGT---T-GCTGGT------------CTCTGA-----------------------TCAGCTCCTCTTGAA-TGCAT--GAGTGGGGGGCT----------------GATC-----CTCATCCC-TTGGTGT---GATAA---TTGTCT-ACGCCAT-CAG------ATTTGGAACA-------------------------------------------CATGAACC-TGCTT-CTAACTGT---CTCCT---TGTTGAGACAATCACT---TATGAAACTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCT-TTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGCTTTCTGTGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCC-AGGACTCAACCTT-GCATTCA-TGCCTGGTTTATTTTCT-GGTCGACGGGCC-AGCATCAGTTTTGGC-TGCTGGATAATGGCTAGAGAAATGTGGCACCC-----TCGGGTGTG-TTATAGTCTCTA---GTCGGA-TACGGTGGCTGGGACTGA-GGACCGCAGCA-C----------------------------------TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--CAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTTGATTGGACCGCTTG-ACGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Pseudowrightoporia_sp_Yuan6101 ATGAA-TTTGAAAGGAGG----TTGTT-GCTGGCCCC-T--CACTTTGGGG--CATC----GTGCACGCCTCTGATCTCA---TCCACCTCTCACACCCCTGTGCACTCTTGCGTGAGCCT--------------------G--CTTCCCT---------------------GCAGGCTTGCGT--CCTTTTAT---------CACAAACCCCTATGC--ATGTCT-CTGAATGT----------T-TGTTGCTTTA----------ACGCAAT-CTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCACCTGGCTT-CGCCGGGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTCGAGCTTTTCTTTTG----------------GAGAGTCTC------TCGGGATTGGACTT-GGAGGTGT---T-GCCGG------------TCTC------C---------TTGCT-GAGATGGGCTCCTCTTGAA-TGCAT--GAGTGGGGGG----------------TTGATC-----CTCGTCCC-TTGGTGT---GATAA---TTGTCT-ACGCCA--GAGG-----ATTTGGAACG-------------------------------------------CATGAACC-TGCTT-CGAACCGT---CTCAT---CGTTGGGACAA--AC---------GGCCTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCTGTGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCAG--TGCTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCC-AGAACTCAACCTT-GCTCTTT-CGCTTGGTTTACTTTCT-GGCCGACGGGCC-AGCATCAGTTTCGGC-CGCCGGACAATGGCCAGGGAAATGTGGCACCC-----TCGGGTGTG-TTATAGTCTCTG---GTCGGA-TACGGTGTCTGGGACTGA-GGACCGCAGCG-C----------------------------------TCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--CAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTTGATTGGACCGCTTG-ACGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Pseudowrightoporia_sp_Yuan6106 ATGAA-TTTGAAAGGAGG----TTGTT-GCTGGCCCC-T--CACTTTGGGG--CATC----GTGCACGCCTCTGATCTCA---TCCACCTCTCACACCCCTGTGCACTCTTGCGTGAGCCT--------------------G--CTTCCCT---------------------GCAGGCTTGCGT--CCTTTTAT---------CACAAACCCCTATGC--ATGTCT-CTGAATGT----------T-TGTTGCTTTA----------ACGCAAT-CTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCACCTGGCTT-CGCCGGGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTCGAGCTTTTCTTTTG----------------GAGAGTCTC------TCGGGATTGGACTT-GGAGGTGT---T-GCCGG------------TCTC------C---------TTGCT-GAGATGGGCTCCTCTTGAA-TGCAT--GAGTGGGGGG----------------TTGATC-----CTCGTCCC-TTGGTGT---GATAA---TTGTCT-ACGCCA--GAGG-----ATTTGGAACG-------------------------------------------CATGAACC-TGCTT-CGAACCGT---CTCAT---CGTTGGGACAA--AC---------GGCCTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCTGTGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCAG--TGCTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCC-AGAACTCAACCTT-GCTCTTT-CGCTTGGTTTACTTTCT-GGCCGACGGGCC-AGCATCAGTTTCGGC-CGCCGGACAATGGCCAGGGAAATGTGGCACCC-----TCGGGTGTG-TTATAGTCTCTG---GTCGGA-TACGGTGTCTGGGACTGA-GGACCGCAGCG-C----------------------------------TCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--CAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTTGATTGGACCGCTTG-ACGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Pseudowrightoporia_sp_Yuan6247 ATGAA-TTTGAAAGGGGG----TTGTTTGCTGGTCCC-ATACGGACATT------------GTGCACGCCTCTGATCTCA---TCCATC--TCACAC--CTGTGCACTCTTGCGTGAGTCT-TGTGGGA------------GGGCGTTCTT---------GCGTCTTTCTACA-GGGCTTGCGT--CCTTTTAT---------TACAAACTCTTTTGC--ATGTCT-TGGAATGT----------A-TATTGCTGTAT-----AAAAACGCAAT-CTTGTAA-CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCC-CCTGGTTT-CGCTGGGGG-CATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTCGAGCTTTCTTTTCT-----------------TGAGAGTC------TCGGGATTGGACTT-GGAGGTGT---T-GCTGGT------------CTCTGA-----------------------TCAGCTCCTCTTGAA-TGCAT--GAGTGGGGGGCT----------------GATC-----CTCATCCC-TTGGTGT---GATAA---TTGTCT-ACGCCAT-CAG------ATTTGGAACA-------------------------------------------CATGAACC-TGCTT-CTAACTGT---CTCCT---TGTTGAGACAATCACT---TATGAAACTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCT-TTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGCTTTCTGTGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCAG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCC-AGGACTCAACCTT-GCATTCA-TGCCTGGTTTATTTTCT-GGTCGACGGGCC-AGCATCAGTTTTGGC-TGCTGGATAATGGCTAGAGAAATGTGGCACCC-----TCGGGTGTG-TTATAGTCTCTA---GTCGGA-TACGGTGGCTGGGACTGA-GGACCGCAGCA-C----------------------------------TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--CAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTTGATTGGACCGCTTG-ACGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Pseudoxenasma_verrucisporum ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTA-TGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT--TCCGAGGGGCACGCC?GTTTGAGTGTCGTGAAC--TTCTCAACCCTTCCCTTTCTTCGG-----------------AAAGGGT-------TTGGGCTTGGACTT-GGAGGCCT--TTTGCCGGTCC-------ACCC---CTCGGGG---------------AGGTCGGCTCCTCTTGAA-TGCAT--TAGTGGGA-CCTTAG---------------TGCCG-T----CGCCCTCGGTGT---GATAAT---TGTCT-ACGCCGTGGGTC-AGGCCCGTG----------GACCTGCTTCGAACCGTC----------TTCTGGC-----GAAGACA------------------------------------------CTTTATTGAAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCTA--GGCTGTCCGAGTTGTAATCTAGAGAAGCGTTTTCCGCGCT-GTGCCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTT--CAG--TGCT-TTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCC-GAGACTCAGCCTT-GCCT-TTGGC-CTGGTGTACTTCTCGGT-TGACGGGCC-AGCATCAATTTTGAC-CGCTGGATAATGGCGGAGGAAAGGTGGCACCTT-CG----GGTGTG-TTATAGTCCTCC---GTCGGA-TGCAGTGGTTGGGATTGA-GGAACTCAGCA-TGCCCTTCATTGGGTTCGGGGTTC-GCCCACG-T-TCATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAGACTCAT----GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAGCGAGCCGTCACTTGATTGGACCGCTCG-GCGATTGAGAGTCTCTAGTGGGGCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGGGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGG------------------------------------------------------------------------------------ Russula_violacea -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATGCGATAC-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCAT--TCCGAGGGGCACACCCGTTTGAGTGTCGTGAAA--CCCTCAAAAT-CATTTTTTCTTT------------------TTGAA-------AAAGGATTTTGGACTT-GGAGGTTC--AATGCTCG----------CTCT-CCCTTTCGA---------------AAGCGAGCTCCTCTCAAA-TGAAT--CAGTGGGGTTTGCTT---------------TGCT-------GATCCTTGACGT---GATAAGATGTTTCT-ACGTTTTGGATT-TGG-CACTGTCCCTT---------GCTTCTAACAGTC---------CCTTGGAC-----GACGATGGTGCTCCGGTCGCC--GCCACCTACGCTGGCGGGAGGCTGGACCCACAAAAACCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG-GTCTT-TGGCCATCCGAGTTGTAATTTAGAGAAGCGTCTTCCGCGCT-GGACCGTGCACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGGCACGGACGCACCAG--GGCTTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAACTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTAAGTCCCGTTGACC-GAGACTCAGCCTC-GC-C-TTGGCCTTGGTTCACTTCTCGGT-CGACGGGTC-AGCATCAATTTTGCC-CCTTGGATAATGGCGAGGGAAATGTGACACCTT-TAC---GGTGTG-TTATAGTCTCAC---GTCGCA-TGCGAGGGTCGGGATTGA-GGAACTCAGAA-CGCGCCTTTTGCCGTCGGGCTTT--GCCCACGAT-ACGTGCTTAGGATGTTG-CGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGACCTCCGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGCTCTGCGGTAGAGCGTGTATGTTAGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAG-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----GTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGATGAAACATCC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCTCTTGATTGGACCGCTCG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAAGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Scytinostroma_ochroleucum -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCTCTTGGTAT--TCCGAGAGGTACACCTGTTTGAGTGTCATGAATCTCTATCCACTTTATA--CACTCTTATAT---------------------------AAGAGTCTATATAAG-TTGGGACT---TGGAGG{CGT}TGCAATGGGTCCTA-------------------TTGGTGGCCATTGCTCCTCTTGAA-TGCAT--TAGTGAGGCCCTATTGTA-ATCATGCAGCCTTTGGTGTGATAATCATTAAC-T---GTTAATAACCCTTTGGCTGAAC----ATGAGTAGGGGAAAGGTCAT-------------------------------------ATAACAGGCCCTTCACTTAGAGCCCTTTGAATAGAGAGGGCTCAATACCTTTAA---CATAACACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTATC-TTGCTGTCCGAGTTGTAATCTAGAGAAGTGTTTTCTGTGCT-GGACCGTGTACAAGTCCCCTGGAATGGGGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCAGTG--CTCT-GTGATACACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAACTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCATGTTTGCT-AGGACTCAGCCC--------CTCCCCGGGTGTATTTTCT-AGTAAACAGGCC-AACATCACTTTTGGT-CACTGGAAAAGGGTAGTGGGAATGTGGCACCCT-TTCGGGGGTGTG-TTATAGCCTGCT---ATCATA-TACAGTGACTGGGAGTGA-GGACTGC-----CAT----G----------------------------------TAGGATGTTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGTCAAA-CCCATGCGCGTAATGAAAGTAAAA-GTTGGGAAGGTTGTCAAGGCCTGCACCGATGCCCGGACCTGAGATTTATCGACGGTTCTGCGGTAGAGCATGTATGTTAGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTCAT-TG-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCGAGCCGTCACTTGATTGGACTGCTCGAACGATTGAGAGCTTCTAGTGGGGCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATCTACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Scytinostroma_odoratum -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAAGTAATGTGA{AG}TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCAT--TCCGA-AGGTACGCCTGTTTGAGTGTCGTGATT--TCCTCCACCTATAG-AATTTATTCTA------------------------------AAGGCTGGGTTTT-GGGGGTTT---AAATCTGCAGG--------TTTCTAAT-----------------------CTGCTCCCCTTGAA-TGCAT--TAGTGAAGGC---------TCTTTG------TTACTT--GCAATCGTTAAAGG---CGTGATAGATCTCTAGTAGAAC---------TACGTCTGTTGATTG-------------------------------------TTAA--ACGTAAGAAGAGACTTTGCTTCTAAC---TGTCTTTGGACAAAACAT------TCAAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG-GCTTT---GCCATCCGAGTTGTAATTTAGAGAAGCGTTTTCCGCGTC-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCGGGG--CTAT-GTGATACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAACTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGTC-AGGATTCAGCCC---------TA---TGGTGTATTTTCT-GGTAGACGGGCC-AGCATCATTTTTGGT-AGCCGGAAAATGATGAGGGAAATGTGGCACC-----TCCGGGTGTG-TTATAGTCCCTT---GTCGAA-TACGGTTGCTGGGAGTGA-GGACCGC-----CTTTATTG----------------------------------TAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG---AAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGAAGGTCGTCATGGCCTGCACCGACGCCCGGACCTGAGATTTATCGACGGTTCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCATGT----CAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCTCTTGATTGGACCGCTCGG-CGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATCTACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Scytinostromella_nannfeldtii ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCCTTGGTAT--TCCGAAGGGCACACCTGTTTGAGTGTCGTGAAA--TTCTCAACCCCTCTTCCTT----T-----------------GCGGGAACGG----TGGGGCTTGGACTT-GGAGGCT----T-GCGGG----------CTCCCCTTTGT-------------TGTGGGAT-CCGCTCCTCTTAAA-TGCAT--TAGTGAAG-CCCTGG---------------TG----------GGCCTCGGTGT---GATAAT---TGTCT-ACGCCTT-GGACCGTC--TCT-GT-------------------------------------------------GGCGCTCGCTT-CTAACCGT--CTTTC--------GAGACAG-CGAT---ATAGAA--ACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCTTC-GGCCGTCCGAGTTGTAGTTTAGAGAAGCGTTTTCCGTGCC-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCGG--TGCT-CTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGCC-GGGACTCAGCCTT-GC---TTTTGCTTGGTGTACTTCCTGGT-GGACGGGCC-AGCATCACTTTTGAT-CGCCGGAAAAGGGCGGGGGAAAGGTGGCACCTT-C----GGGTGTG-TTATAGTCCCTC---GTCGAA-TACGGTGGTTGGGAGTGA-GGAACTCAGCA-CGCCTTTAC---GGTCGGGGTTC--GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTCAT----GTCAGATTTATGTGGTAAAGC?AATGATTAGAGG-CCTTGGGGTTGAAACGACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATTTACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCAT------------------------------------------------------------------------- Sistotrema_brinkmannii -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTAT--TCCGAGGAGCACGCCTGTTCGAGTGTCGTGAAA--CTCTCAAGCTA--GAT--GCTTTA-----------------GTGTCA-------TCT--GCTTGGTTAT-TGGACTCT-----GCTGTC-----------TCCTTGT-----------------CTGGAAC-GGCTGGTCTCAAA-TGTAT--TAGCTGGCTCTTGTTGT--------------GGGAATTGGTTCTACTCAGCGT---GATAA---TCTATGACCGCTGAGGACATCTCTCGGGAT------------------------------------GGCCA-AGCCTGCCTTGAACTGCTT-CTAACTCA--------TCATTTCATGATA-----T---TTTTCAAC-TTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCA-GTCTTC-GATTGTCCGAGTTGTAATCTAGAGAAGCGTTTTCCGCGCT-GGACTGTGTACAAGTTTCCTGGAACGGAACATCATAGAGGGTGAGAATCCCGTCC-TTGACACAGACTC-CCAG--TGCTCT-GCGATGCGCTCTCGACGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGAGGTCAATGCCTTCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCCCGTCCGCT-TGGACTCAGCCTT----ACCTCGGTAGGGTGCATTCCCTTGTG-GACGGGCC-A-CGGCCATGTTGTC-CGTCGGAAAAGGT-CCGTGGAATGTGGCTTC----TTCCGGGAGTG-TTATAGCCCA-T--GTTCGTA-TACGGCGAGTGATATGGA-GTGGTACAGCA-TGCTTC--------G-GCGG------------------TGCTTG---TGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTCTGCGAGTGTTTGGGTGG--AAAACCCGAGCGCGCAATGAAAGTGATA-GCTGGGAACCCCTTTACGGGAGGCACCGGCGCCCCGAGCTGACCTTCTGTGACGCATCGGAGGTAGAGCATATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGCGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCGT----ATCAGTTTTATGTGGTAAAGC{CGT}AATGATTAGAGA-CCTTGGGGAT?AAACATCC-TTAATCTATTCT-CAAACTTTAAATATGTAAGCTCAGGATGCTTGCTTAATT?AAGCACCT-GT?AATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCT???AA-TGGATGGC Sistotrema_coronilla -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTAT--TCCGAGGAGCACGCCTGTTCGAGTGTCATGAAG--CTCTCAAGCGA--TAATAACTTTA-----------------TTGTTGTT----GTTTA-GCTTGGATTT-GAGACTTT-----GCTGTG-----------TTACAA------------------------C-GGCTGTCTCTAAA-TGTAT--TAGCCGGCTCT-AATGA--------------AAGACTTGGTTCTACTCGGTGT---GATAA---TTATCTTACGCTGAGGACATTTTCTGTAAAAGGAAGAT----------------------------GGCCAGGACTATTATTAGGCTGCTT-CTAATCG----------TCTCTTCTGACAAAT-TT---TATTCAAA-TTAGTAACGGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTA-GTCTTT-GGCTATCCGAGTTGTAATCTAGAGAAGTATTTTCCGCGCT-GGACCGTGTACAAGTTCCCTGGAACGGAACGTCATAGAGGGTGAGAATCCCGTCC-TTGACATGGACTA-CCAG--TGCTTT-GTGATATACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATCCCTCCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGACCTCTGGAAAGAGAGTTAAACAGTCCGTGAAATTGTTAAAAGGGAAACGCTTGAAGTCAGTCGCATTTGTT-TGGATTCAGCCTT----ACTCCGGTTTGGTGCATCCCTTA-TA-AATGGTCA-GCCGTCAATGTTGCC-CGGTGGAAAAGGT-AGAGGAAATGTGGCT-C----TTCCGG-AGTG-TTATAGTCCT-C--TATCATA-TGCATCGGATGATATTGA-GTGGTACAGCA-TGCTTT--------TAGTGG------------------TGCTTG---TGCTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATATCTGCGAGTGTTTGGGTGG--AAAACCCAAGCGCGTAATGAAAGTGATA-GCTGGGAACCCCGC-AAGGGAGGCACCGGCGCCCCGAGTTGATCTTCTGTGACGCATCGGAGGTAGAGCATATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGCGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCGT----ATCAGTTTTATGTGGTAAAGC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sistotrema_muscicola ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGA{AGT}TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCTCTGGTAT--TCCGGAGAGTACGCCTGTTCGAGTGTCATGTAA--CTCTCAAACAA--AGGTAGCTTTG-----------------TTGCTA-------TCTTTGTTTGGATAT--AGACTCT-----GCTGCG-----------TCAATG------------------------C-GGCTAGT{CGT}TTAAA-TGTAT--TAGCTGGTCCTTAAGG---------------AGGATTTGGTTCTACTCAGCGT---GATAA---TTATCTAACGTTGAGGACAGTTTCAGGACT------------------------------------GGCCAGAGCCATC{ACT}TTGGATTGCTT-CTAATTGA--------TTGTCCTTGGACAATA-AT---TATTCAACGTTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCA-GTCTTCTGGCTGTCCGAGTTGTAATCTAGAGAAGCGTTTTCTGTGCT-GGAC{CT}GTGTACAAGTTTCCTGGAATGGAACATCATAGAGGGTGAGAATCCCGTCC-TTGACACAGACTC-CCAG--TGCTTT-GTGATGCGCTCTCAACGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGAGGTAAATTCCTTCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCGCGTCTACT-TGGACTCAGCCTT----GCCTCGGCTTGGTGCAATTCCTTGTG-GACGGGCC-AGCGTTCATGTTGGT-TATTGGAAAAGGTACTAGGGAATGTGGCT-C----TTTTGGGAGTG-TTATAGCCCT-G--GTTCGTA-TACAGTGACTGATATGGA-GTGATACAGCA-TGCTTC--------G-GCGG------------------TGCTTG---TGCTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTCTGCGAGTATTTGGGTGA--TAAATCCGAGTGCGGAATGAAAGTGATA-GCTGGGAACCCCGT-AAGGGAGGCACCGGCGCCCCGAGTGGATCTTCTGTGATACATCGGAGGTAGAGCATATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----ATCAGTTTTATGTGGTAAAGCGAATGATTAGAGA-CCTTGGGGATGAAACATCC-TTAATCTATTCT-CAAACTTTAAATATGTAAGCTCAGGATGCTTGCTTAATTGAAGCACCT-GTAAATGGGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGTGGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGA{AG}TGTGTAACAACTCACCTGCCGAA-TTGACTA{ACG}CCCTGAAAA-TGGATGGC Sistotrema_sernanderi ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTAT--TCCGGGGAGCACGCCTGTTCGAGCGTCATGAAG--CTCTCAAATAGCCTCTTTTCTTAA-----------------TTGCAAAG----ATGGATGTTTGGATTT-G-GACTCT-----GCTGTG-----------TTACAA------------------------C-AGCTGGTCCGAAA-GATAT--TAGCTGATCCT-A--GC--------------AAGACTTGGTTCTACTCGGCGT---GATAA---TTATCTAACGTTGAGGACAT----CGCAAGATGGCCA-----------------------------AATCGAAACTATA--TGGATTGCTT-CTAATCG----------TCTTCATCGACAACT-TT---TTATCAA--TTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGTG-TCCTTT-GGGCATCCGAGTTGTAGTCTAGAGAAGCATTTTCCGTGTC-GGACCATGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTTC-TTGACATGGACCC-CCGA--TGCTAT-GTGATGTGCTCTCAAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGAGGTAAATTCCTTCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCGCGTCTGCT-TGGACTCAGCCTT----ACTTCGGTTTGGTGCATTTCCTAGTA-GACGGGCC-AGCGTCGATGTTAGC-CGCTGGAAAAGGT-GTAGGGAATGTGGCT-C----TTTCGGGAGTG-TTATAGCCCT-A--TGTCATA-TGCAGTGGCCGGTATCGA-GTGTAACAGCA-CGCTTT--------T-GCGG------------------TGCTTG---TGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTCTGCGAGTGTTTGGGTGG--TAAACCCGAGCGCGGAATGAAAGTGATA-GCTGGGAATCTCGC-AAGAGAGGCACCGGCGCCCCGAGCTGATCTTCTGTGACGCATCGGAGGTAGAGCATATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGCGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCGT----ATCAGTTTTATGTGGTAAAGCGAATGATTAGAGA-CCTTGGGGATGAAACATCC-TTAATCTATTCT-CAAACTTTAAATATGTAAGCTCAGGACGCTTGCTTAATTGAAGCGCCT-GTAAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Stereum_hirsutum_NH7960 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTAT--TCCGAAGG-CACACCTGTTTGAGTGTCGTGAAA--TTCTCAACCCTC-TTCACTTTTGT-----------------GGACG--------TAGTGGATTGGACTT-GGAGG-C---TTTGCCGG----------GGCTTCAC{ACT}G---------------------CTCGGCTCCTCTCAAA-TGCAT--TAGTGCG--TCTTGT---------------TGCGACGTGC---GCCTCGGTGT---GATAAT---TATCT-ACGCTGTG---GTG--TGC-TTGCTTCTG-------------------------------T---GG--------AGACGCGCTTTCTAACCGT--C------CGA--AAGGACAGCTTTC---ATCGAA--CTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCTTCTGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCG{CT}T-GGACCGTGTACAAGT{CT}TCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGATC--CCAA--TGCT-TTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCC-GGGACTCAGCCTT-GCAT---CCGCTTGGTGTACTTTCCGGT-CGACGGGCC-AGCATCAGTTTTGAC-CGCGAGATAAAGGCGGAGGGAATGTGGCTCTCT-C---GGGA-GTG-TTATAGCCCTTC---GTCAGA-TGTCGCGGTTGGGACTGA-GGAACTCAGCA-CGCCTTTAT---GGCCGGGG-CTC-GCCCACGT--ACGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGATCCCTGTCGTGGGGTGCACCGACGCCCGGCCCAGACCTTTTGTGACGGAGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCTCTTGATTGGACCGCTCG-GCGATTGAGAGTTTCTAGTGGG{CG}CATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAA{AGT}GTGCCGGAATACACG---------------------------------------------------------------------------------------------------------------------------------- Trichaptum_abietinum ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTAT--TCCGAGGAGCATGCCTGTTTGAGTGTCATGTTA--ATATCAACCCC---GTCGGTTTG-------------------TAAAT-------CAGACCGTTGGGTGT-T-GGACTT-----GGAGGT-----------TCTTGCTGGCTG------------CAAAGTC-GGCTCCTCTTGAA-TGCAT--TAGCTTGGGCCTGTTG---------------TGCGTAC--TCG----CGGTGT---AATAA---GTTTTATTCATCGTTTGGGT----CGTACA--------------------------------------------CTTATTGGGC-TTGCTT-CTAACTG----------TCTT--CGGACAAGCATA---ACCTTTGACTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTTTCA---CCGTCCGAGTTGTAATCTGGAGAAGCGTTTTCCGTGTC-GGACCGTGCACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTTTTATGGCACGGACAC-CCGA--TACTTT-GTGATACGTTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTTCT-AGGACTCAGCCTT----ACTTCGGTTAGGTGTACTTCCTGGTTTGACGGGTC-AACATCGATTTTGAT-CGACGGATAAAGGAGAAGGGAATGTGGCACC-----TCCGGGTGTG-TTATAGCCCT----CTTCGTA-TACGTCGATTGGGATCGA-GGACTGCAGCA-CGCCCTTG---TGGCCGGGGGTTCGCCCTACGTA-TCGTGCTTAGGATGTTGACATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTCGCGAGTGTTAGGGTGG--AAAACCCTTGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGC-AAGGAGGGCACCGACGCCCGGCCCTGAAGTTCTCTGACGGTGCTGCGGTAGAGCGCGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGCGAA---CCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Vararia_ochroleuca ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAAGTAATG?GAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCACCCCTTGGTAT--TCCTTGGGGTACACCTGTTTGAGTGTTATGAAT--TTCTCCATCTTGAAGACTTTGTTGTCTTT-------------------------AAAGAACTGGGATTT-TGGGGGTT---TGTTTTGCAGAAG----AGTGTTAAATTCT--------------------CTGCTCCCCTTAAA-TACAT--TAGTGAAAG----------CCTCT----------------TAA--GTT---GG------------CTTTGATGT---GATAATTATCTAC--ATCAA-----------TATAGCTACTTAGTT----------------------------GCATTTGCTTATAACTGTCTTTACTTTTTAAAAGACAATGTTAACTTTTGAACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG-GTTTA-TAATCATCCGAGTTGTAATTTAGAGAAGTGTTTTCTGTGCT-GGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCAGGG--CTAT-ATGATACACTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAACTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCATCTATT-AGAATTCAGCCC--------TTGG--TGGTGTACTTTCT-AATGGATGGGCC-AGCATCACTTTTGGT-TGTTGGAAAAGGGTAAAGGAAATGTGGCACCTTTTATTAGG-TGTG-TTATAGTCCTCT---ACTAAA-TACAATGACTAGGAGTGA-GGACTGC-----CATTTATG----------------------------------TAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCAAGTGTTCGGGTGGTTAAA-CCCGTGCGCGTAATGAAAGTGAAA-GTTGGGAAGGCTGTCATGGCCTGCACCGACGCCCGGACTTGAGATTTATCGACGGTTCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCATATT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGG-CGATTGAGAGATTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATCTACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGG{CG}CATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_Wrightoporia_labyrinthina_Yuan1475nthina_TFM_F20724 ATGAA-TTTCT---GATTGGGGTTGTA-GCTGGCCTCTCTT----GAGGCAA--------TGTGCACGCTCCTTTCGCAA----TCATCTATCATACCAGTGTGCACCCTTGCGTAGGTTGGAACAGCAGG----------GGAATA-CTCT--------------GTTTTTC--AACTTGCGTTTATTTTTTT------AATCACAAACTCCTTTGTG-TATGTGTCAGAATGT-----CATTCATGCTG------------TAAAACGCATTTTTTGTA--TAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAATGCACCTTGCGCCCTTTGGTAT--TCCGAAGGGCACGCCTGTCTGAGTGTCGTGAAA--TTCTCAACTCTGTCCTCCTTTTTG----------------AAAAG-GAGTTGATT--GAGCTTGGATTT-GGAGGTTT---TTGCTGAT-----------CCCC----------------TTGGTGGTGGTTGGCTCCTCTAAAA-TGCAT--TAGCAAAAAGAAA----------------ACCACAACCTCTTTCTCTCGATGT---TGATAGC-TTATCT-ACG---------------TCGTTGGT-----------------------------------------------TTGGGGGA------------------------------------AGG---ATTTTTGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-ATGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCTGTGTC-GGACCGTGTACAAGTCTCTTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTG-CCGA--TGCTCT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGGATGCAGGCTCAAATTGGTGGTGA--TTCATCTAAAGGCTAATAT--GCGAGAGACC-GATAGCGAC--AGTAC-GTGA-GG-AAA-GATGAAAAGCACTTTG-AAAGAGAGT-AAACAGTACGTGAAATTGT-GAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCC-AGAACTCAGCCAAGTGATCTC--ACTTGGTGTACTTTCT-GGTTGACGGGCC-AGCATCGATTTTGAC-CGTTGGATAAAGGCTTGAGAAATGTGGCACCC---TC--GGGTGTG-TTATAGTCTCTG---GTCGCA-TACGACGGTTGGGATCGA-GGAACTCAGCA-CGCCTTC---ATGGTCGGGG-TTC-GCCCACGTT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG--AAAACCCATGCGCGTAATGAAAGTGAAA-GTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAGCAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_avellanea_LR41710 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTAT--TCCGAAGGGCACGCCTGTCTGAGTGTTGTGAAC--ATCTCAAGGCCCA{CG}CTTCAAT{AT}AC-----------------CGTTGAG----GTTTTGGCCTTGGATTC-GGAGGC{CT}C--TTTGCAGG----------T{CT}CA{AC}ATTTGAGGT---------------GA{CT}C{GT}GGCTCCTCTCAAA-TG{AT}AG--TAGCAAGGC{CT}CTTGT---------------GATAAAGCCT---CCATTGG{GT}GT---GGTAGT---TCACT-ACGCCATGAGTGGG--TTTGCGCCCTTGTGTCCACCTCGTTTCTT---------GAGGTGTGAAGG--------AGCCGTGCTT-CGAATTGT--CCATAATCTGTTCATGGACAAACTG---TTTCAACCACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCTCTTGGCTGTCCGAGTTGTAGTCTCGAGAAGTGCTTCCCGTGCT-GGACCGTGTACAAGTCTTCTGGAACGAAGCGTCATAGAGGGTGAGAATCCCGTCT-CTGACACGGACCA-CCAG--TGCT-TTGTGAAGTGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCC-AGGACTCAGCCTT-GCTT-ATTTGCTTGGTGTATTCTCTGGT-TGACGGGCC-AGCATCAATTTCGAC-CACTGGATAAAGGTCAGAGAAATGTGGCACTCT-C---GGAGTGTG-TTATAGTCTTGT---GCCGCA-TGCAGTGGTTGGGATTGA-GGAACTCAGCA-CGCCTTCAT---GGTCGGGG-TTC-GCCCACGTC-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGC--AAAACCCAGGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCAT----ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGGTTGGACCGCTTG-GTGATTGAGAGTTCTAGTGGGGCATTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Wrightoporia_biennies_Cui_8457 ATGAA-TTTGAAAGGGGG----TTGTT-GCTGGCTTG-ACACAACG------AGCAC---CGTGCACGCCTCCTATCACA---TCCATC--TCACAC--CTGTGCACCCTTGCGTGAGCCGGATGGGT-------------GGGGA------------------GACCCCCCGCTGGCTTGCGTC--CTTTCGT---------CATAAACTCTACAGCATGTA--T-TGGAATGTGTGT-----CTGCGTTGCTAT--------AAAGCGCAATA-TTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTCAGTA--ATCTGTGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCGAGCTTTTGTTTTGTC--------------GACGAAAGCCT---TCTGGGCTTGGATTT-GGAGGTGC---T-GCCGGA------------CTTGCA-------------AAATGCAAGGTCGGCTCCTCTTGAA-TGCAT--GAGTGGGGGCTCCC------------CGATGGGCGAACTCATCCC-TTGGTGT---GATAA---TTGTCT-GC------------------------------------------------------------------------------GCCT-TTGGATGG---CCC----GTGAAATGGG--------------------TAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-CAGGCCGTCCGAGTTGTAGTCTGGAGAAGCGCTTTCCGCGCC-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCGG--TGCTTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATACTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCC-GGGACTCAGCCTT-GCAATCC-TGCCTGGTGTACTTTCC-GGTTGACGGGCC-AGCATCAGTTTTGGT-CGCCAGACAATGGCCGGGGAAATGTGGCACC----TT-CGGGTGTG-TTATAGTCTCCG---GTCGGA-TATGGTGGCCGGGACTGA-GGAATGCAGCA-TGCCTTTT-GTGGTCGGGGCTCAC-CCCCACGTC-TCATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGGGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGGGTTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---GC-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACCCTTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCACTTGATTGGACCGCTTG-ACGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_biennies_Cui_8509 ATGAA-TTTGAAAGGGGG----TTGTT-GCTGGCTTG-ACACAACG------AGCAC---CGTGCACGCCTCCTATCACA---TCCATC--TCACAC--CTGTGCACCCTTGCGTGAGCCGGATGGGT-------------GGGGA------------------GACCCCCCGCTGGCTTGCGTC--CTTTCGT---------CATAAACTCTACAGCATGTA--T-TGGAATGTGTGT-----CTGCGTTGCTAT--------AAAGCGCAATA-TTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTCAGTA--ATCTGTGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCGAGCTTTTGTTTTGTC--------------GACGAAAGCCT---TCTGGGCTTGGATTT-GGAGGTGC---T-GCCGGA------------CTTGCA-------------AAATGCAAGGTCGGCTCCTCTTGAA-TGCAT--GAGTGGGGGCTCCC------------CGATGGGCGAACTCATCCC-TTGGTGT---GATAA---TTGTCT-GC------------------------------------------------------------------------------GCCT-TTGGATGG---CCC----GTGAAATGGG--------------------TAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-CAGGCCGTCCGAGTTGTAGTCTGGAGAAGCGCTTTCCGCGCC-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCGG--TGCTTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATACTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCCCGGGACTCAGCCTT-GCAATCC-TGCCTGGTGTACTTTCC-GGTTGACGGGCC-AGCATCAGTTTTGGT-CGCCAGACAATGGCCGGGGAAATGTGGCACC----TTTCGGGTGTG-TTATAGTCTCCG---GTCGGA-TATGGTGGCCGGGACTGA-GGAATGCAGCA-TGCCTTTT-GTGGTCGGGGCTCAC-CCCCACGTC-TCATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGGGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---GC-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCACTTGATTGGACCGCTTG-ACGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_casuarinicola_Dai_1614 --------------------------------------------AGGGCATT---------GTGCACGCCTGTTTC-ATCTC-TCCAACCTTTTCATAAAAC--------CTGTGAACACATT-GCAT--GTGTGTGGGGTGGCTTAGAAGGGAGGAATTGAACCTCTTCC-TGACAAAAAAACCCCCATGCCTTTTCCATCACAACCTCCTTTTTTGCATGTAAACTTGAATGT-----------TGATGT--ATAATAA---------AAAAAGACACGCACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCCA-TTCCTTGGGGCACACCTGTTTGAGTGTCGTGAAA--TTCTCAACTCTCTCCCCTTCTT--------------------GAGTGAATGGGGTGTGAGCTTGGACTTTGGAGGGCCCCTTTGCTGGCAA---------TTATATAT---------------------GCTGGCTCCTCTAAAA-TGCAT--TAGCGAGAGAGGTGCC------------ATGCCTCATGGTGTGTGCATGGTGTG--GTCCATCTCATTCTCTCGGTGTGATAAATGCTTTGTCTACGCCGTT-------------------------TGTGGGATGGGTCATGAAGTGCTCGCTC-ATAGTTGTC-CTTCATGCTCTCTGGGACAAATCTTTTGAACCTT???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-----?????????????????????---??????????????????????????????????????????????----?????????????????????????????????????????????????????????????????????????????????????????????????????????????????--???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--????????--????????????????????????--?????????????????????????????????--????????????--????????????????????????????????????????????????????????????????????????????????------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Wrightoporia_casuarinicola_Dai_6914 --------------------------------------------AGGGCATT---------GTGCACGCCTGTTTC-ATCTC-TCCAACCTTTTCATAAAAC--------CTGTGAACACATT-GCAT--GTGTGTGGGGTGGCTTAGAAGGGAGGAATTGAACCTCTTCC-TGACAAAAAAACCCCCATGCCTTTTCCATCACAACCTCCTTTTTTGCATGTAAACTTGAATGT-----------TGATGT--ATAATAA---------AAAAAGACACGCACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCCA-TTCCTTGGGGCACACCTGTTTGAGTGTCGTGAAA--TTCTCAACTCTCTCCCCTTCTT--------------------GAGTGAATGGGGTGTGAGCTTGGACTTTGGAGGGCCCCTTTGCTGGCAA---------TTATATAT---------------------GCTGGCTCCTCTAAAA-TGCAT--TAGCGAGAGAGGTGCC------------ATGCCTCATGGTGTGTGCATGGTGTG--GTCCATCTCATTCTCTCGGTGTGATAAATGCTTTGTCTACGCCGTT-------------------------TGTGGGATGGGTCATGAAGTGCTCGCTC-ATAGTTGTC-CTTCATGCTCTCTGGGACAAATCTTTTGAACCTT???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-----?????????????????????---??????????????????????????????????????????????----?????????????????????????????????????????????????????????????????????????????????????????????????????????????????--???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--????????--????????????????????????--?????????????????????????????????--????????????--????????????????????????????????????????????????????????????????????????????????------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Wrightoporia_cylindrospora_PRM915962 ATGAA-TTTGAA-GGAGG----TTGTT-GCTGGCCCC-CTCCACTTTGGGGGGCATT----GTGCACGCCTCTGATCTCA---TCCACCTCTTACACCCCTGTGCACTCTTGCGTGAGCCT--------------------G--CTCCAAC---------------------GTGGGCTTGCGT--TCTTTTAT---------CATAAACTCTTATGC--ATGTCT-CTGAATGT----------T-TGTTGCTTTG----------ACGCAAT-CTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCACCTGGCTC-CGCCGGGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTCGAGCTTTTCTTTTG----------------GAGAGTCTC------TCGGGATTGGACTT-GGAGGTGT---T-GCCGG------------TCTC------C---------TTGCT-GAGACAGGCTCCTCTTGAA-TGCAT--GAGTGGGGG-----------------TTGATC-----CTTGTCCCCTTGGTGT---GATAA---TTGTCT-ATGCCA--GAGG-----ATTTGGAACG-------------------------------------------CATGAACC-TGCTT-CAAACTGT---CTCAT---TGTTGGGACAACAAT---------GGCCTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCTGTGCT-GGACCGTGTGCAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCAG--TGCTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGTGTTGGCCCAGGACTCAACCTT-GCTCTTT-TGCTTGGTTTACTTTCT-GGCTGACGGGCC-AGCATCAGTTTCGGC-CGCCGGACAATGGCCAGGGAAATGTGGCACCC-----TCGGGTGTG-TTATAGTCTCTG---GTCGGA-TACGGTGTCTGGGACTGA-GGACCGCAGCG-C----------------------------------TCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--CAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTTGATTGGACCGCTTG-ACGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_cylindrospora_Ryvarden46609 ATGAA-TTTGAAAGGAGG----TTGTT-GCTGGCCCC-CTCCACTTTGGGGGGCATT----GTGCACGCCTCTGATCTCA---TCCACCTCTTACACCCCTGTGCACTCTTGCGTGAGCCT--------------------G--CTCCAAC---------------------GTGGGCTTGCGT--TCTTTTAT---------CATAAACTCTTATGC--ATGTCT-CTGAATGT----------T-TGTTGCTTTG----------ACGCAAT-CTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCACCTGGCTC-CGCCGGGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTCGAGCTTTTCTTTTG----------------GAGAGTCTC------TCGGGATTGGACTT-GGAGGTGT---T-GCCGG------------TCTC------C---------TTGCT-GAGACAGGCTCCTCTTGAA-TGCAT--GAGTGGGGG-----------------TTGATC-----CTTGTCCCCTTGGTGT---GATAA---TTGTCT-ATGCCA--GAGG-----ATTTGGAACG-------------------------------------------CATGAACC-TGCTT-CAAACTGT---CTCAT---TGTTGGGACAACAAT---------GGCCTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-TTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCTGTGCT-GGACCGTGTGCAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCAG--TGCTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGTGTTGGCCCAGGACTCAACCTT-GCTCTTT-TGCTTGGTTTACTTTCT-GGCTGACGGGCC-AGCATCAGTTTCGGC-CGCCGGACAATGGCCAGGGAAATGTGGCACCC-----TCGGGTGTG-TTATAGTCTCTG---GTCGGA-TACGGTGTCTGGGACTGA-GGACCGCAGCG-C----------------------------------TCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGG--CAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTTGATTGGACCGCTTG-ACGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_japonica_KUC20110908 ATGAACTTTGAAAGGAGG----TTGTT-GCTGGCCTT-GTCAGGCAAATAA--AAAA----GTGCACGCCTCTGATCTCA---TCCACC--TCACAC--CTGTGCACCCTTGCGTGGGTCTGTGAGAGGAGGGGAAGAGAGGGGCTTTCCTTCTCA----CCCCCCCCTTTCATGGGCTCGCGTT-CCTTTCAT---------CATAAACCCCTTTGTGTATGTGC-ATGAATGT----------TCTTTTGCTGTA------ATAAACGCAAA-CTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCACCCGGTTC-CGCCGGGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCAAGACTTCTTTT---------------------GAAGTC------TTGGGATTGGACTT-GGAGGTGT---T-GCCGGTGGCCCACCCC-TTTCTAAGGGG---------TTGGT-GGTGTTGGCTCCTCTTGAA-TGCAT--GAGTAGGGTGTCTCCTCAATTCGTTGGGGATCGAGCTCTCGTCCG-TTGGTGT---GATAA---TTGTCT-ACGCCAC-GAGGACACGACTCGAATGA-------------------------------------------TGCAAACC-TGCTT-CCAACTGT---CTCCCT-CTGATGAGACAAGCCTT---TCCTGAACTCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCT-TTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCTGTGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCAG--TGCTGT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCC-AGGACTCGGCCTT-GCACCCA-CGCTTGGTTTACTTCCT-GCTCGACGGGCC-AGCATCAGTTTTGGC-TGCCGGACAATGGCCAGAGAAATGTGGCACCC-----TCGGGTGTG-TTATAGTCTCTG---GTCGGA-TACGGTGGCTGGGACTGA-GGACCGCGGCG-C----------------------------------TCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGA--AAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGACCTC-GTCG-AGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Wrightoporia_labyrinthina_Yuan1475 ATGAA-TTTCT---GATTGGGGTTGTA-GCTGGCCTCTCTT----GAGGCAA--------TGTGCACGCTCCTTTCGCAA----TCATCTATCATACCAGTGTGCACCCTTGCGTAGGTTGGAACAGCAGG----------GGAATA-CTCT--------------GTTTTTC--AACTTGCGTTTATTTTTTT------AATTACAAACTCCTTTGTG-TATGTGTTAGAATGT------------CATTCATGCTGTAA-----AACGCATTTTTTGTA--TAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAATGCACCTTGCGCCCTTTGGTAT--TCCGAAGGGCACGCCTGTCTGAGTGTCGTGAAA--TTCTCAACTCTGTCCTCCTTTTTG----------------AAAAG-GAGTTGATT--GAGCTTGGATTT-GGAGGCTT---TTGCTGAT-----------CCCC----------------TTGGTGGTGGTTGGCTCCTCTAAAA-TGCAT--TAGCAAAAAGAAA----------------ACCACAACCTCTTTCTCTCGATGT---TGATAGC-TTATCT-ACG---------------TCGTTGGT-----------------------------------------------TTGGGGGA------------------------------------AGG---AGTTTTGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-ATGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCTGTGTC-GGACCGTGTACAAGTCTCTTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTG-CCGA--TGCTCT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGGATGCAGGCTCAAATTGGTGGTGA--TTCATCTAAAGGCTAATAT--GCGAGAGACC-GATAGCGAC--AGTAC-GTGA-GG-AAA-GATGAAAAGCACTTTG-AAAGAGAGT-AAACAGTACGTGAAATTGT-GAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCC-AGAACTCAGCCAAGTGATCTC--ACTTGGTGTACTTTCT-GGTTGACGGGCC-AGCATCGATTTTGAC-CGTTGGATAAAGGCTTGAGAAATGTGGCACCC---TC--GGGTGTG-TTATAGTCTCTG---GTCGCA-TACGACGGTTGGGATCGA-GGAACTCAGCA-CGCCTTC---ATGGTCGGGG-TTC-GCCCACGTT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG--AAAACCCATGCGCGTAATGAAAGTGAAA-GTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAGCAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_lenta_Dai10462 ATAAA-AAGCTG-GGCGGTGGCTGTT-GCTGGCCTTCCT-----GAGGCAT----------GTGCACGCTCCGTTCAACC----TTTTCCACCTCACACCTGTGCACCTTTGCGCTTGCTGGC-------------------AATGTCTATG--------------ACATTCGCCGGCTCGCGTACATTTTTCA---------CACAAA-CCATT-GCA-TGTATCGTAGAATGT------------TTATG----ATG------TTATAAAAA----AAA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCCCTTTGGTAT--TCCGAAGGGCACGCCTGTTTGAGTGTCGTGAAA--CCCCCTCAAG--------GACCTT----------------GAC---ATTTTGTCATGGCCTTTGGATTT-GGAGGAC---ATTGCGGGC-----------TTTCACC-------------GTCGGTG-AGTCTGCTCCTCTTCAA-TGCAG--CAGTGGG----GCT------------CTTGTGATGG-CTTCCCCTGGTGTTGT---AGTTACA-CTTTAC-GCCATGG----------GCGGTCGTCGC------------------------------------------CGTGTTTGTCTCCT-CCTTTCCA---TTCATGGTTAGGGGAGAGAGAGGG---AGCCAGGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GCCT-TTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGTCTTCCGCGCT-GGACCGTGTACAAGTCTTCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-CTGACACGGATC--CCAG--TGCTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCATCAGCC-AGGACTCAGCCTTGC-CTTTC--GCTTGGTGTACTTTCT-GGTTGATGGGCC-AGCATCAATTTTGAC-CGCTGGATAAAGGTCAGGGAAATGTGGCACCC---TTCGGGGTGTG-TTATAGTCTCTGTTTGCCGCA-TACAGTGGTTGGGATTGA-GGAACTCAGCA-CGCCTTC---ATGGTCGGGG-TTC-GCCCACGTC--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGC--AAAACCCAGGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_lenta_Dai12850 ATAAA-AAGCTG-GGCGGTGGCTGTT-GCTGGCCTTCCT-----GAGGCAT----------GTGCACGCTCCGTTCAACC----TTTTCCACCTCACACCTGTGCACCTTTGCGCTTGCTGGC-------------------AATGTCTATG--------------ACATTCGCCGGCTCGCGTACATTTTTCA---------CACAAA-CCATT-GCA-TGTATCGTAGAATGT------------TTATG----ATG------TTATAAAAA----AAA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCCCTTTGGTAT--TCCGAAGGGCACGCCTGTTTGAGTGTCGTGAAA--CCCCCTCAAG--------GACCTT----------------GAC---ATTTTGTCATGGCCTTTGGATTT-GGAGGAC---ATTGCGGGC-----------TTTCACC-------------GTCGGTG-AGTCTGCTCCTCTTCAA-TGCAG--CAGTGGG----GCT------------CTTGTGATGG-CTTCCCCTGGTGTTGT---AGTTACA-CTTTAC-GCCATGG----------GCGGTCGTCGC------------------------------------------CGTGTTTGTCTCCT-CCTTTCCA---TTCATGGTTAGGGGAGAGAGAGGG---AGCCAGGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GCCT-TTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGTCTTCCGCGCT-GGACCGTGTACAAGTCTTCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-CTGACACGGATC--CCAG--TGCTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCATCAGCC-AGGACTCAGCCTTGC-CTTTC--GCTTGGTGTACTTTCT-GGTTGATGGGCC-AGCATCAATTTTGAC-CGCTGGATAAAGGTCAGGGAAATGTGGCACCC---TTCGGGGTGTG-TTATAGTCTCTGTTTGCCGCA-TACAGTGGTTGGGATTGA-GGAACTCAGCA-CGCCTTC---ATGGTCGGGG-TTC-GCCCACGTC--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGC--AAAACCCAGGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_luteola_Dai_12086 ATGAACTTTGAAAGGAGG----TTGTT-GCTGGCCTT-GTCAGGCAAATAA--AAAA----GTGCACGCCTCTGATCTCA---TCCACC--TCACAC--CTGTGCACCCTTGCGTGGGTCTGTGAGAGGAGGGGAAGAGAGGGGCTTTCCTTCTCA----ACCCCCCCTTTCATGGGCTCGCGTT-CCTTTCAT---------CATAAACCCCTTTGTGTATGTGC-ATGAATGT----------TCTTTTGCTGAA------ATAAACGCAAA-CTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCACCCGGTTC-CGCCGGGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCAAGACTTCTTTT---------------------GAAGTC------TTGGGATTGGACTT-GGAGGTGT---T-GCCGGTGGCCCCCCCCCTTTTTAAGGGG---------TTGGT-GGTGTTGGCTCCTCTTGAA-TGCAT--GAGTAGGGTGTCTCCTCAATTCGTTGGGGATCGAGCTCTCTTCCG-TTGGTGT---GATAA---TTGTCT-ACGCCAC-GAGGACACGACTCGAATGA-------------------------------------------CGCAAACC-TGCTT-CCAACTGT---CTCCCT-CTGATGAGACAAGCCTT---TCCTGAACTCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCT-TTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCTGTGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCAG--TGCTGT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCC-AGGACTCGGCCTT-GCACCCA-CGCTTGGTTTACTTCCT-GCTCGACGGGCC-AGCATCAGTTTTGGC-TGCCGGACAATGGCCAGAGAAATGTGGCACCC-----TCGGGTGTG-TTATAGTCTCTG---GTCGGA-TACGGTGGCTGGGACTGA-GGACCGCGGCG-C----------------------------------TCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGA--AAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGACCTC-GTCG-AGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTTGATTGGACCGCTTG-ACGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAGTTCACGCTCCATCAGAACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_luteola_Dai_7221 ATGAACTTTGAAAGGAGG----TTGTT-GCTGGCCTT-GTCAGGCAAATAA--AAAA----GTGCACGCCTCTGATCTCA---TCCACC--TCACAC--CTGTGCACCCTTGCGTGGGTCTGTGAGAGGAGGGGAAGAGAGGGGCTTTCCTTCTCA----ACCCCCCCTTTCATGGGCTCGCGTT-CCTTTCAT---------CATAAACCCCTTTGTGTATGTGC-ATGAATGT----------TCTTTTGCTGAA------ATAAACGCAAA-CTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCACCCGGTTC-CGCCGGGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACCCAAGACTTCTTTT---------------------GAAGTC------TTGGGATTGGACTT-GGAGGTGT---T-GCCGGTGGCCCACCCC-TTTCTAAGGGG---------TTGGT-GGTGTTGGCTCCTCTTGAA-TGCAT--GAGTAGGGTGTCTCCTCAATTCGTTGGGGATCGAGCTCTCGTCCG-TTGGTGT---GATAA---TTGTCT-ACGCCAC-GAGGACACGACTCGAATGA-------------------------------------------TGCAAACC-TGCTT-CCAACTGT---CTCCCT-CTGATGAGACAAGCCTT---TCCTGAACTCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCT-TTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCTGTGCT-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTC-CCAG--TGCTGT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCCGATAGCGAACAAGTACCGTGA-GGGAAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCC-AGGACTCGGCCTT-GCACCCA-CGCTTGGTTTACTTCCT-GCTCGACGGGCC-AGCATCAGTTTTGGC-TGCCGGACAATGGCCAGAGAAATGTGGCACCC-----TCGGGTGTG-TTATAGTCTCTG---GTCGGA-TACGGTGGCTGGGACTGA-GGACCGCGGCG-C----------------------------------TCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGA--AAAACCCGTGCGCGCAATGAAAGTGAAA-GTTGGGACCTC-GTCG-AGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGACCAAGCCGTCGCTTGATTGGACCGCTTG-ACGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAGTTCACGCTCCATCAGAACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_pouzarii_Ipulet_F1883 ATGAA-TTTCT---GATCGGGGTTGTA-GCTGGCCTCTC------GGGGCAA--------CGTGCACGCTCCTTTCGCAAATCCTCATCCCTCACACCTGTGTGCACCCTCGCGTGGGCTAGAAAAACTGG----------GACACGGTTCC--------------GTTTTTTTGAGCTTGCGTTCTTTTTTAT------AA---CAAACTCTTTTGTGGTATGTGTTAGAATGT-----CTTCATGCTATTA----------TTAAATGCATCTTT-GTA--TAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTAT--TCCGAAGGGCACGCCTGTCTGAGTGTCGTGAAA--TTCTCAACTCTGTCCTCCTTTTTT----------------CGAGG-AGTTTGACT--GAGCTTGGATTT-GGAGGCTT---T-GCCGGT-----------TCTT----------------TT--TTGGGATCGGCTCCTCTAGAA-TGCAT--TAGCGAAAGGA----------------------CTCTCTCTTTCTCTTGATGT---GATAAGT-TTATCT-ACG---------------TCATGGGT-----------------------------------------------ATTGAAGG------------------------------------GGG---AGGTTCGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCT-ATGGCCGTCCGAATTGTAGTCTGGAGAAGCGTTTTCTGTGTC-GGACCGTGTACAAGTCTCTTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACTG-CCGA--TGCTCT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCC-AGAACTCAGCCAAGCAATCTCTTGCTCGGTGTATTTTCT-GGTTGACGGGCC-AGCATCGATTTTGAC-CGTCGGATAAAGGCTTGAGAAATGTGGCACCC---TT--GGGTGTG-TTATAGTCTCAG---GTCGCA-TACGACGGCTGGGATCGA-GGAACTCAGCA-CGCCTTT---ATGGTCGGGG-TTC-GCCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGG--AAAACCCATGCGCGTAATGAAAGTGAAA-GTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-CTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAA-CTC---GT-ATCAGATTTATGTG-TAAAGCGAATGATTAGAGGGCCTTGGGGTTGAAACAACCCTTAACCTATTCT-CAAACTTTAAATATGTAAGAGCAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_rubella_Dai_9233 --------------------------------------------GGAGAGTGCAT------GTGCACGCCTGTTCC-ATCTT-TCCAACCCTTTCATAACACC-------CTGTGAACACATT-GCAT--GTGGAAGGAGGGAGGAGGAAGTTGGAGGGTTTGTGGCCCTTTGATCATCATCCTCCTGATGTCCCATGCCTTTTACCAAACCCTCTTGCATGTAACCTAGAATGT----------TTGATGC--ATTTTTATA--CATATA---TGAAACACACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCCTTGGCCA-TTCCTTGGGGTACACCTGTTTGAGTGTTATGAAA--TTCTCAACTCTCTCCCCTTCCTTG-------------------AGTGAAAGGGATGTGAGCTTGGACTTTGGAGGTGTC-TTTGCTGGCGA----------------------------------TGGTGCTGGCTCCTCTAAAA-TGGAT--TAGCGAGAGAGGTGC-------------------ATCGCGTATGCATGCATGT--TGATCCATCTCGTCTCTCGGTGTGATA--------------------------------------------------------------AAGCTTTGTCT--GCGCCGT----------TTGAAGGGATGGTCATT------GAAGTACTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG-GTCT-CTGGCCACCCGAGTTGTAGTCTGGAGAAGCGTCTTCTGTGCC-GGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACGGACAA-TCGG--TGCTCT-GTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGTGTCTGCC-GGAATTCAGCCTT--GCAGCCTTGCTTGGTGCATTTTCT-GGTGGTCGGGCC-AGCATCAATTTTGAT-CATCGGATAAAGGCAAGGGAAATGTGGCACCTT-----TGGGTGTG-TTATAGTCTCTT---GTTGCA-TGCGATGGTTGGGATTGA-GGAACTCAGCA-TGCCCTTG---TGGCCGGGGCTTT-GCCCACGTC--CATGCTTAGGATGCTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGG--AAAACCCATGCGCGCAATGAAAGTGAAAGTTTGGGACCTCTGTCGTGGAGGGCACTGAAGCCCGGCCCTGAAGTTCTCTGACGGTGCTGCGGTGGAGCGTGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTCAC--TCGTCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCG-GTGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_subavellanea_Dai11484 GAAAA-TCGCTG-GGCGGCG-CTGCT-GCTGGCTCCATC-----GGGGCAT---------CGTGCACGCGACGTTCAACC----TTTTCCACCTCACACCTGTGCACCCTCGCGCTCGTCAGT-------------------GAT---CGTC--------------AAGTTCGCTGGCGCGCGTCCTTTTACAT---------CACAAAACCCTT-GCA-TGTATTTT-GAATGT------------TTTTGATATATG------TTATAAATATTA-AAA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCCCTTTGGTAT--TCCGAAGGGCACGCCTGTTTGAGTGTCGTGAAA--TTCCTCAAGGCCCATCTCAATCAT----------------GATTG-ATTGAGGCATGTGTCTTGGATTT-GGAGGATTG-TTTGCAGGT-----------CATGGGG-------------GTTTCTGTGATCTGCTCCTCTTCAA-TATCG--CAGCAAA---GGCT------------CTCGCGACGGGCCTTTCCCCTTGGTGT-----TTGTA-GTTTTC-ACCCTAC----------GCCGTGGGT----------------------------------------------TGTCCGTCGCCC-CTTGTCC-----TCCTCGTTCTTGAGGTGTGAGAG---GGCCTGGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GCCT-TTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGCGCT-GGACCGTGTACAAGTCTTCTGGAACGAAGCGTCGTAGAGGGTGAGAATCCCGTCT-CTGACACGGACCA-CCAG--TGCTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCATCTGCC-AGGACTCAGCCTTGCTCTTTT--GCTTGGTGTACTTTCT-GGTTGATGGGCC-AGCATCAATTTTGAC-CGCCGGATAAAGGTCAGAGAAATGTGGCACCC---TTCGGGGTGTG-TTATAGTCTCTG---GCCGCA-TACGGTGGTTGGGATTGA-GGAACTCAGCA-CGCCTTC---ATGGTCGGGG-TTC-GCCCACGTC-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGC--AAAACCCAGGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_subavellanea_Dai11488 GAAAA-TCGCTG-GGCGGCG-CTGCT-GCTGGCTCCATC-----GGGGCAT---------CGTGCACGCGACGTTCAACC----TTTTCCACCTCACACCTGTGCACCCTCGCGCTCGTCAGT-------------------GAT---CGTC--------------AAGTTCGCTGGCGCGCGTCCTTTTACAT---------CACAAAACCCTT-GCA-TGTATTTT-GAATGT------------TTTTGATATATG------TTATAAATATTA-AAA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCCCTTTGGTAT--TCCGAAGGGCACGCCTGTTTGAGTGTCGTGAAA--TTCCTCAAGGCCCATCTCAATCAT----------------GATTG-ATTGAGGCATGTGTCTTGGATTT-GGAGGATTG-TTTGCAGGT-----------CATGGGG-------------GTTTCTGTGATCTGCTCCTCTTCAA-TATCG--CAGCAAAA--GGCT------------CTCGCGACGGGCCTTTCCCCTTGGTGT-----TTGTA-GTTTTC-ACCCTAC----------GCCGTGGGT----------------------------------------------TGTCCGTCGCCC-CTTGTCC-----TCCTCGTTCTTGAGGTGTGAGAG---GGCCTGGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GCCT-TTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGCGCT-GGACCGTGTACAAGTCTTCTGGAACGAAGCGTCGTAGAGGGTGAGAATCCCGTCT-CTGACACGGACCA-CCAG--TGCTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCATCTGCC-AGGACTCAGCCTTGCTCTTTT--GCTTGGTGTACTTTCT-GGTTGATGGGCC-AGCATCAATTTTGAC-CGCCGGATAAAGGTCAGAGAAATGTGGCACCC---TTCGGGGTGTG-TTATAGTCTCTG---GCCGCA-TACGGTGGTTGGGATTGA-GGAACTCAGCA-CGCCTTC---ATGGTCGGGG-TTC-GCCCACGTC-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGC--AAAACCCAGGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_subavellanea_Dai11492 GACAA-TCGCTGTGGCGGCG-CTGCT-GCTGGCTCCATC-----GGGGCAT---------CGTGCACGCGACGTTCAACC----TTTTCCACCTCACACCTGTGCACCCTCGCGCTCGTCAGT-------------------GAT---CGTC--------------AAGTTCGCTGGCGCGCGTCCTTTTACAT---------CACAAAACCCTT-GCA-TGTATTTT-GAATGT------------TTTTGATATATG------TTATAAATATTA-AAA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCCCTTTGGTAT--TCCGAAGGGCACGCCTGTTTGAGTGTCGTGAAA--TTCCTCAAGGCCCATCTCAATCAT----------------GATTG-ATTGAGGCATGTGTCTTGGATTT-GGAGGATTG-TTTGCAGGT-----------CATGGGG-------------GTTTCTGTGATCTGCTCCTCTTCAA-TATCG--CAGCAAA---GGCT------------CTCGCGACGGGCCTTTCCCCTTGGTGT-----TTGTA-GTTTTC-ACCCTAC----------GCCGTGGGT----------------------------------------------TGTCCGTCGCCC-CTTGTCC-----TCCTCGTTCTTGAGGTGTGAGAG---GGCCTGGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GCCT-TTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGCGCT-GGACCGTGTACAAGTCTTCTGGAACGAAGCGTCGTAGAGGGTGAGAATCCCGTCT-CTGACACGGACCA-CCAG--TGCTTT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCATCTGCC-AGGACTCAGCCTTGCTCTTTT--GCTTGGTGTACTTTCT-GGTTGATGGGCC-AGCATCAATTTTGAC-CGCCGGATAAAGGTCAGAGAAATGTGGCACCC---TTCGGGGTGTG-TTATAGTCTCTG---GCCGCA-TACGGTGGTTGGGATTGA-GGAACTCAGCA-CGCCTTC---ATGGTCGGGG-TTC-GCCCACGTC-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGC--AAAACCCAGGCGCGTAATGAAAGTGAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTC---GT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACAAGCCGTCGCTTGATTGGACCGCTTG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_tropicalis_16446 TCGAA-TTTGAAGGGGCTCGGGTTGTA-GCTGGTCTCTC------GGGACA---------GGTGCTCGCCCTTGCTCTCT----TACACCCACACAC-CCTGTGCACTCTTGCGTGGGTCGC--------------------GTCGACTTT----------------GTTCGGCGCGCTCGCGACTTTAT--------------ACAAACCCCCCTGTA---TGTTTTAGAATGT-----------C-TCTGCGTACC--------CACGCAACCTA-GTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCAACTTGCACCCCTTGGTAT--TCCGAGGGGTACACCTGTTTGAGTGTCGTGAAT--TTCTCAACTCTACCTCCTTTTTCG----------------AGGAG-----TTGTA--GGGCTTGGACTT-GGAGGCT----TTGCAGGC-----------GGTG----------------TTC-TCTCCGTCCGCTCCTCTTAAA-TGCAT--TAGTGACG------------------------TGCCCCGGGTGGCTTGGACGT---GATAA---TTGTCT-ACGT--------------TCGTGGTT-----------------------------------------------GCTCGTCG------------------------------------TTG---GCGGTTGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG--TCT-TCGGGCGTCCGAGTTGTAGTTTAGAGAAGCGTTTTCCGCGCC-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCGG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGCC-GGGACTCAGCCTGGTTTTT----ACCTGGTGTACTTCCC-GGTGAACGGGCC-AGCATCACTTTTGGT-TGCCGGAAAAGAGCGGGAGAAAAGTGGCACCT---T--CGGGTGTG-TTACAGTCTCTC---GTTGTA-TACGGTGGTCGGGAGTGA-GGAACTCAGCA-CGCCTT----ACGGTCGGGGTTTT-ACCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGTGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTAAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGCGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCGAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCTTTGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGACTGGACCGCTCG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporia_tropicalis_18245 TCGAA-TTTGAAGGGGCTCGGGTTGTA-GCTGGTCTCTC------GGGACA---------GGTGCTCGCCCTTGCTCTCT----TACACCCACACAC-CCTGTGCACTCTTGCGTGGGTCGC--------------------GTCGACTTT----------------GTTCGGCGCGCTCGCGACTTTAT--------------ACAAACCCCCCTGTA---TGTTTTAGAATGT------------C-TCTGCGTACC-------CACGCAACCTA-GTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCAACTTGCACCCCTTGGTAT--TCCGAGGGGTACACCTGTTTGAGTGTCGTGAAT--TTCTCAACTCTACCTCCTTTTTCG----------------AGGAG-----TTGTA--GGGCTTGGACTT-GGAGGCT----TTGCAGGC-----------GGTG----------------TTC-TCTCCGTCCGCTCCTCTTAAA-TGCAT--TAGTGACG------------------------TGCCCCGGGTGGCTTGGACGT---GATAA---TTGTCT-ACGT--------------TCGTGGTT-----------------------------------------------GCTCGTCG------------------------------------TTG---GCGGTTGCTTTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG--TCT-TCGGGCGTCCGAGTTGTAGTTTAGAGAAGCGTTTTCCGCGCC-GGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCT-TTGACACGGACTA-CCGG--TGCTCT-GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGCC-GGGACTCAGCCTGGTTTTT----ACCTGGTGTACTTCCC-GGTGAACGGGCC-AGCATCACTTTTGGT-TGCCGGAAAAGAGCGGGAGAAAAGTGGCACCT---T--CGGGTGTG-TTACAGTCTCTC---GTTGTA-TACGGTGGTCGGGAGTGA-GGAACTCAGCA-CGCCTT----ACGGTCGGGGTTTT-ACCCACGTT--CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGTGCCCGCGAGTGTTCGGGTGG--AAAACCCGTGCGCGTAATGAAAGTAAAA-GTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGCGAA--GCCAGAGGAAACTCT-GGTGGAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCGAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAACTCTTTGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCT-CAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGACTGGACCGCTCG-GCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporiopsis_sp_Yuan_3460 ATGAA-TTTGAA-GGAGA----TTGTT-GCTGGCTTTTATACAATGTATAGGAGCATTTTTGTGCACATCTCCAATCTCA---TCCACT--TTACAC--CTGTGCACTCTTGCATGAGCTTGATTACT-------------GGACACTTGTT------------GTCTGGCAATGGGCCCATGTTTATCTTTAT---------TATAAACACCTTTGTATGTTCTT-TAGAATGT---ATTCTATTTCTTTGCTATTTTTGAAAAAAATGCAAAACTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTCAGTTCCCTCTGTGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTTGATTTCTTTTTTTTTA--------------AAAAAAAAAAAAAACTCAGGCTTGGACTT-GGAGGTGT---T-GCTGGA------------CTTGCT-------------CTGTTCAAGCTCAGCTCCTCTTGAA-TGCAT--GAGTAGT--TTTGC------------TAAGTGGCAAACTCATCC--TTGGTGT---GATAA---TTGTCT-ACACTATAGATGTGTCCATTCTATTTA--------------------------------------------GTGAGCT--GCTT-CTAGCTGT---CCCTCTTGTGTAGGGACAA--AT---------CACTTTAGTAGCTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCT-CTGGCTGTCCGAATTGTAGTCTGGAGAAGTGCTTTCCGTGCT-GGACTGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACAGACCC-CCAG--TGCTTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACATTGGCC-AAGACTCAGCCTT-GCAATCT-TGCTTGGTGTATTTTTTTGGTTGATGGGCC-AGCATCAGTTTTGTT-CATTGGATAAGGGTCAGAGAAATGTGGCACCCT-TTTTTGGGTGTG-TTATAGTCTCTG---GTCGTA-TACAATGGCTGGGACTGA-GGAATGCAGCA-TGCCTTT--ATGGTTGGGGTTTAC-CCACAT----TCATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGGCCAAGGAGTCTAACATGCTCGCGAGTATTTGGGTGG--AAAACCCATGTGCGCAATGAAAGTGAAA-GTTGGGACCTCTGTTATGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGAAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---AT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCTTCAAACTTTAAATATGTAAGACCAAGCCGTCACTTGATTGGACCGCTTG-ATGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGGGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporiopsis_sp_Yuan_3467 ATGAA-TTTGAA-GGAGA----TTGTT-GCTGGCTTTTATACAATGTATAGGAGCATTTTTGTGCACATCTCCAATCTCA---TCCACT--TTACAC--CTGTGCACTCTTGCATGAGCTTGATTACT-------------GGACACTTGTT------------GTCTGGCAATGGGCCCATGTTTATCTTTAT---------TATAAACACCTTTGTATGTTCTT-TAGAATGT---ATTCTATTTCTTTGCTATTTTTGAAAAAAATGCAAAACTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTCAGTTCCCTCTGTGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTTGATTTCTTTTTTTTTA--------------AAAAAAAAAAAAAACTCAGGCTTGGACTT-GGAGGTGT---T-GCTGGA------------CTTGCT-------------CTGTTCAAGCTCAGCTCCTCTTGAA-TGCAT--GAGTAGT--TTTGC------------TAAGTGGCAAACTCATCC--TTGGTGT---GATAA---TTGTCT-ACACTATAGATGTGTCCATTCTATTTA--------------------------------------------GTGAGCT--GCTT-CTAGCTGT---CCCTCTTGTGTAGGGACAA--AT---------CACTTTAGTAGCTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCT-CTGGCTGTCCGAATTGTAGTCTGGAGAAGTGCTTTCCGTGCT-GGACTGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACAGACCC-CCAG--TGCTTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACATTGGCC-AAGACTCAGCCTT-GCAATCT-TGCTTGGTGTATTTTTTTGGTTGATGGGCC-AGCATCAGTTTTGTT-CATTGGATAAGGGTCAGAGAAATGTGGCACCCT-TTTTTGGGTGTG-TTATAGTCTCTG---GTCGTA-TACAATGGCTGGGACTGA-GGAATGCAGCA-TGCCTTT--ATGGTTGGGGTTTAC-CCACAT----TCATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGGCCAAGGAGTCTAACATGCTCGCGAGTATTTGGGTGG--AAAACCCATGTGCGCAATGAAAGTGAAA-GTTGGGACCTCTGTTATGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGAAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---AT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCTTCAAACTTTAAATATGTAAGACCAAGCCGTCACTTGATTGGACCGCTTG-ATGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGGGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC Wrightoporiopsis_sp_Yuan_3579 ATGAA-TTTGAA-GGAGA----TTGTT-GCTGGCTTTTATACAATGTATAGGAGCATTTTTGTGCACATCTCCAATCTCA---TCCACT--TTACAC--CTGTGCACTCTTGCATGAGCTTGATTACT-------------GGACACTTGTT------------GTCTGGCAATGGGCCCATGTTTATCTTTAT---------TATAAACACCTTTGTATGTTCTT-TAGAATGT---ATTCTATTTCTTTGCTATTTTTGAAAAAAATGCAAAACTTGTA--CAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA-GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTCAGTTCCCTCTGTGGGGCATGCCTGTTTGAGTGTCGTGAAA--TTCTCAACTTGATTTCTTTTTTTTTA--------------AAAAAAAAAAAAAACTCAGGCTTGGACTT-GGAGGTGT---T-GCTGGA------------CTTGCT-------------CTGTTCAAGCTCAGCTCCTCTTGAA-TGCAT--GAGTAGT--TTTGC------------TAAGTGGCAAACTCATCC--TTGGTGT---GATAA---TTGTCT-ACACTATAGATGTGTCCATTCTATTTA--------------------------------------------GTGAGCT--GCTT-CTAGCTGT---CCCTCTTGTGTAGGGACAA--AT---------CACTTTAGTAGCTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA-GTCT-CTGGCTGTCCGAATTGTAGTCTGGAGAAGTGCTTTCCGTGCT-GGACTGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCT-TTGACACAGACCC-CCAG--TGCTTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACC-GATAGCGAACAAGTACCGTGA-GGGAAA-GATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACATTGGCC-AAGACTCAGCCTT-GCAATCT-TGCTTGGTGTATTTTTTTGGTTGATGGGCC-AGCATCAGTTTTGTT-CATTGGATAAGGGTCAGAGAAATGTGGCACCCT-TTTTTGGGTGTG-TTATAGTCTCTG---GTCGTA-TACAATGGCTGGGACTGA-GGAATGCAGCA-TGCCTTT--ATGGTTGGGGTTTAC-CCACAT----TCATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGGCCAAGGAGTCTAACATGCTCGCGAGTATTTGGGTGG--AAAACCCATGTGCGCAATGAAAGTGAAA-GTTGGGACCTCTGTTATGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT--AGGGTGAA--GCCAGAGGAAACTCT-GGTGAAGG--CTCGTAGCGATTCTGACG-TGCAAATC-GATCG--TCAAATTTGGGT--ATAGGG-GCGAA-AGACTAAT-CGAACCAT-CTAGTAGCTGG-TTCCTGCCGAAGTTTCCCTCAGGA-TAGCAGAAGCTC---AT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGG-CCTTGGGGTTGAAACAACC-TTAACCTATTCTTCAAACTTTAAATATGTAAGACCAAGCCGTCACTTGATTGGACCGCTTG-ATGATTGAGAGCTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGGGGTTAAGGTGCCGGAGTTCACGCTCATC--AGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA-TGAACTAGCCCTGAAAA-TGGATGGC ; END;