#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on January 25, 2022; 5:07 GMT TreeBASE (cc) 1994-2008 Study reference: Perez-moreno J.L., Balazs G., Wilkins B., Herczeg G., & Bracken-grissom H.D. 2017. The role of isolation on contrasting phylogeographic patterns in two cave crustaceans. BMC Evolutionary Biology, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21599] BEGIN TAXA; TITLE Taxa; DIMENSIONS NTAX=56; TAXLABELS 'Niphargus forroi HBG3990_outgroup' 'Niphargus hrabei 1CR19_Movila_Banului' 'Niphargus hrabei 1RS9H_Sabac' 'Niphargus hrabei 2AU1H_Freudenau' 'Niphargus hrabei 2RS5H_Lugovo' 'Niphargus hrabei 2RS9H_Sabac' 'Niphargus hrabei 4NH2_Dunaalmas' 'Niphargus hrabei HBG2901_Soroksar' 'Niphargus hrabei HBG2903_Soroksar' 'Niphargus hrabei HBG2904_Soroksar' 'Niphargus hrabei HBG2905_Soroksar' 'Niphargus hrabei HBG2906_Soroksar' 'Niphargus hrabei HBG2908_Soroksar' 'Niphargus hrabei HBG2909_Soroksar' 'Niphargus hrabei HBG2910_Soroksar' 'Niphargus hrabei HBG2912_Soroksar' 'Niphargus hrabei HBG2913_Soroksar' 'Niphargus hrabei HBG2914_Soroksar' 'Niphargus hrabei HBG2916_Soroksar' 'Niphargus hrabei HBG2917_Soroksar' 'Niphargus hrabei HBG2939_Molnar_Janos_Cave' 'Niphargus hrabei HBG2941_Molnar_Janos_Cave' 'Niphargus hrabei HBG2942_Molnar_Janos_Cave' 'Niphargus hrabei HBG2944_Molnar_Janos_Cave' 'Niphargus hrabei HBG2945_Molnar_Janos_Cave' 'Niphargus hrabei HBG2946_Molnar_Janos_Cave' 'Niphargus hrabei HBG2949_Molnar_Janos_Cave' 'Niphargus hrabei HBG2950_Molnar_Janos_Cave' 'Niphargus hrabei HBG2951_Molnar_Janos_Cave' 'Niphargus hrabei HBG2952_Molnar_Janos_Cave' 'Niphargus hrabei HBG2953_Molnar_Janos_Cave' 'Niphargus hrabei HBG2955_Molnar_Janos_Cave' 'Niphargus hrabei HBG2956_Molnar_Janos_Cave' 'Niphargus hrabei HBG2957_Molnar_Janos_Cave' 'Niphargus hrabei HBG2958_Molnar_Janos_Cave' 'Niphargus hrabei HBG2979_Malom_Lake' 'Niphargus hrabei HBG2980_Malom_Lake' 'Niphargus hrabei HBG2981_Malom_Lake' 'Niphargus hrabei HBG2982_Malom_Lake' 'Niphargus hrabei HBG2983_Malom_Lake' 'Niphargus hrabei HBG2984_Malom_Lake' 'Niphargus hrabei HBG2985_Malom_Lake' 'Niphargus hrabei HBG2986_Malom_Lake' 'Niphargus hrabei HBG2987_Malom_Lake' 'Niphargus hrabei HBG2988_Malom_Lake' 'Niphargus hrabei HBG2989_Malom_Lake' 'Niphargus hrabei HBG2990_Malom_Lake' 'Niphargus hrabei HBG2991_Malom_Lake' 'Niphargus hrabei HBG2992_Malom_Lake' 'Niphargus hrabei HBG2993_Malom_Lake' 'Niphargus hrabei HBG2994_Malom_Lake' 'Niphargus hrabei HBG2996_Malom_Lake' 'Niphargus hrabei HBG2997_Malom_Lake' 'Niphargus hrabei HBG2998_Malom_Lake' Niphargus_sp.1_HBG2943_outgroup Niphargus_sp.1_HBG2947_outgroup ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M44588] TITLE 'Niphargus hrabei - ITS Alignment'; LINK TAXA = Taxa; DIMENSIONS NCHAR=1317; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Niphargus forroi HBG3990_outgroup' TAAGTGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGCGGCCGGCTAAACAACCTGCAGACAAAAGCCTGTGGTTTGGAACAAAGGCAATTGTGTGGCCTCCGAGCAACGGCGGGGGAGCCAGGAGCACATGCGCGTGCGTTCCAGCCACTCGTAAGTAGTCAGGCTGGACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCATCTCTCTATCTCC----------CTTTGGGAGGGAGGG--CTTGAGTTTCTTTGTTGCT-GGTGGCTATTTGGGTCGACATCAGTCGTGCCCGCAAACATCTGCCTTGGCTCGTGCCTCTGCGCGT----TTTACCTATCACAGGTGCGTGCATCGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCAC--------------CACCTCGGTGGTGCGCACCGGTCCAAAAGGAT---GATGATACGAGTGTCGGGTCTCACTAACTCTGGTCCGCCTGCGGGTCGTGAG-----------------TGTGGCTATCGGCGTTACGCTTTTCTGGTAAAGGTTCGTCTC--------TCGTAGTATTCGGGAATGACACACCTTATCTTCTTC----------------------ACACGGTAAGCACACGTT---CGAGTGATGGATAGGAACCCCTGAGAGCTCGGGAGGGCAGTCA---------TGTTGTGTGTGAAATTATTTTCACATGGTAAGCACATGTTCGAGTGATTTAAAGAAACTCCCAGCAAGCTCAGGAAGCGGGCATGTGTGTGTGACATTGTCACATGGTAAGCTCATGTTCGAGTGATGGA-----------------AAGAAACCCCTGAGAGCTCGGGAGGGCA------GTCATGTTGTGTGTGA-------AATTATTTTCACATGGTAAGCAC-ATGTTCGAGTGATTTAAAGAAACTCCCAG---------------------CGAGCTCAGGAAGCGGGCATGTGTGTGTGACATTGTCAC--------------------ATGGTAAGCTCATGTTCGAGTG----------------------------ATGGAAAGAAACCCCTGAGAGCTCGGGAGGGCAGTCATGTTGTGTGTGAAATTATTTTCACATGGTAAGCACATGTTCGAGTGATTTAAAGAAACTCCCAGCGAGCTCAGGAAGCGGGCATGTGTGTGTGACATTGTCACATGGTAAGCTCATG?TTCGAGTGATGGAGGATAA 'Niphargus hrabei 1CR19_Movila_Banului' TAAGTGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTTACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTAGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGGCTAT 'Niphargus hrabei 1RS9H_Sabac' TAAGTGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTTACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTAGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGGCTAT 'Niphargus hrabei 2AU1H_Freudenau' TAAGTGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTTACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTAGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGGCTAT 'Niphargus hrabei 2RS5H_Lugovo' TAAGTGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTTACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTAGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGGCTAT 'Niphargus hrabei 2RS9H_Sabac' TAAGTGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTTACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTAGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGGCTAT 'Niphargus hrabei 4NH2_Dunaalmas' TAAGTGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTT{CT}ACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGT{AG}GAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGGCTAT 'Niphargus hrabei HBG2901_Soroksar' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAG????????????????????????????????????????????????? 'Niphargus hrabei HBG2903_Soroksar' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2904_Soroksar' ???GTGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTTACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTAGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGGCTAT 'Niphargus hrabei HBG2905_Soroksar' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTTACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTAGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGA???????????????????????????????????????????????? 'Niphargus hrabei HBG2906_Soroksar' ?????GTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTTACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTAGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAG????????????????????????????????????????????????? 'Niphargus hrabei HBG2908_Soroksar' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTTACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTAGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTG????? 'Niphargus hrabei HBG2909_Soroksar' ??AGTGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTG{AG}AGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAA????????????????????????????????????????????????????? 'Niphargus hrabei HBG2910_Soroksar' ?????GTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTTACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTAGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCT??????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2912_Soroksar' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTTACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTAGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACT????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2913_Soroksar' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTT{CT}ACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGT{AG}GAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAAC??????????????????????????????????????????????????? 'Niphargus hrabei HBG2914_Soroksar' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTT{CT}ACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGT{AG}GAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAG????????????????????????????????????????????????? 'Niphargus hrabei HBG2916_Soroksar' ?????GTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTT{CT}ACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGT{AG}GAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAAC??????????????????????????????????????????????????? 'Niphargus hrabei HBG2917_Soroksar' ?????GTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTTACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTAGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATC???????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2939_Molnar_Janos_Cave' ???????GAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTC???????????????????????????????????????????????????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2941_Molnar_Janos_Cave' ???GTGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATC?????????????????????????????????????????????? 'Niphargus hrabei HBG2942_Molnar_Janos_Cave' ???GTGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGG???????????????????????????????????? 'Niphargus hrabei HBG2944_Molnar_Janos_Cave' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGA?????????? 'Niphargus hrabei HBG2945_Molnar_Janos_Cave' ????????AGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTC???????????????????????????????????????????????????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2946_Molnar_Janos_Cave' ?????GTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACT??????????????????????? 'Niphargus hrabei HBG2949_Molnar_Janos_Cave' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTT??????????????????????????????????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2950_Molnar_Janos_Cave' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTT?????????????????????? 'Niphargus hrabei HBG2951_Molnar_Janos_Cave' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACA?????????????????????????????????????????????????? 'Niphargus hrabei HBG2952_Molnar_Janos_Cave' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTG??????????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2953_Molnar_Janos_Cave' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAA?????????????????????????????????????????????????????? 'Niphargus hrabei HBG2955_Molnar_Janos_Cave' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTG?????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2956_Molnar_Janos_Cave' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCG?????????????????????????????? 'Niphargus hrabei HBG2957_Molnar_Janos_Cave' ?????GTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTC???????????????????????????????????????????????????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2958_Molnar_Janos_Cave' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGGCT?? 'Niphargus hrabei HBG2979_Malom_Lake' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCG??????????????????? 'Niphargus hrabei HBG2980_Malom_Lake' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTG???????????????????????????????????????? 'Niphargus hrabei HBG2981_Malom_Lake' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCG??????????????????? 'Niphargus hrabei HBG2982_Malom_Lake' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2983_Malom_Lake' ?????GTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2984_Malom_Lake' ?????GTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2985_Malom_Lake' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCAAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT??????????????????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2986_Malom_Lake' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAGG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACA?????????????????????????????????????????????????? 'Niphargus hrabei HBG2987_Malom_Lake' ?AAGTGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTG????? 'Niphargus hrabei HBG2988_Malom_Lake' ?????GTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAG????????????????????????????????????????????????? 'Niphargus hrabei HBG2989_Malom_Lake' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGA?????????? 'Niphargus hrabei HBG2990_Malom_Lake' ???????????ATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTG?????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2991_Malom_Lake' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTG?????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2992_Malom_Lake' ?????GTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCA????????????????????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2993_Malom_Lake' ?????GTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTG??????????? 'Niphargus hrabei HBG2994_Malom_Lake' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Niphargus hrabei HBG2996_Malom_Lake' ?????GTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGGCTA? 'Niphargus hrabei HBG2997_Malom_Lake' ???GTGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTG???????????????????????????????????????? 'Niphargus hrabei HBG2998_Malom_Lake' ????TGTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCACATTGCGCCCCACCCAGTGGTCGGCTAAACAACCTGCAGACAAAAGCCTGTTAGTTGGAACAAAGGCGAGTGTGTGGCCCTCGAGCCTCGGCGGGGGAGCCAGGAGCACATGAGCGTGCGGACCTTCTTCTCGTGAGTAGTCAGGCTG-ACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCAT---CTCATTCGCGCGTTTGCGTCTGAGC------------TTGAGTTTCTTTGTTG--CTGGTGGCATTTGGGTCGACATCAGTCGTGCCCGTAAAAACCTGCCTTGGCTCGTGCCTCTGCACGTTGGATTACCTTTATGAAGGTGCGTGCATTGAAAGGCCATAGCTGGCGATCACTCTTGCGGCCAGGGCA--------------GTACCTCGGTACTGCGCAAAGGTCCAAAAGGATATGGAATACGAGAGTCG--GGTCTTTTATAGTCCGCTCCGGTTACAAACAGGGAGT-------GGGTGATGTTGGTGATATCCACTAAACGTCAATCTGTTAAAGGTTTGTCTC--------TCGTAGTATTCGAGAATGACACGGCCTTACTCCTTTCGTTCACACAGAGGCATGGCAGACAAAG-----AAACTCCTGACGAGATCAGGACCGGATTTTCTAACACAGTGTGAAGAAAGAGACAGAGAGGCTTGTGGGGACCGCATCACTTCACGATGAACTGTTTGTGGTCGATGGGATGAAG------------ACTTTGACGATCGGGACATGCGAGAGTGGAGTCCTTTGATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACT-AAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCACTTGCGTTGAACTGATGGTGACTATGGGAGAAAGGCTTTG-CGAGATCCGAGTCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGGGTGGTGTTAACGGAAATATCCACTAAACGTTGGTCTGGTAAAACAGATCAGCTTGTGGGCGACCGCACCATCTACGTTGAACTGAAGGTGACTATGGGAGAAAGACTTCGCGGTCGTGGCATGGGAGAGTAAAGTCCTTTTATACTCCGTTTAGGTTGCACTCAGGGAGTGAGTGGTGTTAACGGAAATATCCACTAAACGTTGATCTGGTAAAACAGATCAGCTTGTGGGC??????????????????????????????????? Niphargus_sp.1_HBG2943_outgroup ?????GTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCATATTGCGCCCCACCCAGCGGTCGGCT-AACAACCTGCAGACAAAAGCCTGCGCGTTGGAACAAAGGCAATTGTGTGGCCCTCGAGCAACGGCGGGGGAGCCAGGAGCACATGCGCGTGCGTTTCAGCCGCTCGTGAGTAGTCAGGCTGAACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCATGAGCCTCTCTCCGAGCTAGCGGCGTCGCGAGGGAGGATTTCTGAGTTTCTCTGTTGCTCTGTGGCAATTTCGGTCGACATCAGTCGTGCCGGTAAACACCTGCCTTGGCTCGTGCCTCTGTACGATA---CCCTTAGGTAAGGGTGCGTGCATTG-AAGGTTATAGCTGGCGATCTCTCATGCGACCAGGGCACGGCGCCACCTTGTGTGTGTGCGCGGTGCGCAGCGGTCCAAAAGGATAAAGACGAATCGAGTGGCTGGTATCTGATAATCTGTCTCGCGCTAAAAGAGATGGCTATAATGGAGGCTGGTTAGAGGCGTGCTCTCGGTGT-ACTCTGGAAAGAGCCCCTCTCCACGGTTTTCGCAGCTCAATGGTCTGACACACACTCTCTCTCTCTCTCACTGGATTGGACGGACGGACGCGGTACTCTAAAGCCTGACGAGATCAGGTGGTGGT----AAAGAAAGCGCGCTGTTAGGGCCTGGTGGTCCGGTG-------------TTGGTGTTGCTGCGACTCTGCTCGTGGTGATGCTG------------AT-------GTCGCGAGCTGCCCTCGTGCTGCCTCT-----ATGCGCGTGTCTGGCACGAGCAACTCGGTCGCTGTTAGGGCCAAGTGCCAGTCCGGCGTTGGTGTTGCTAGGACTCTGCTCTTAGTGATGCTGGTGTCGCGTGC------TGGTAGGCCTCTATGCGCCGTGTGGGACGAAGAGCCTCTATCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Niphargus_sp.1_HBG2947_outgroup ?????GTGAGAATGGCAGCGAGCCGTCGCTATATGCGCTGTCCTCTTCTTATCACATGTCGAATGCATATTGCGCCCCACCCAGCGGTCGGCT-AACAACCTGCAGACAAAAGCCTGCGCGTTGGAACAAAGGCAATTGTGTGGCCCTCGAGCAACGGCGGGGGAGCCAGGAGCACATGCGCGTGCGTTTCAGCCGCTCGTGAGTAGTCAGGCTGAACCCTATGGTGGGGCACTCCTAGTCGAGTGTGGTGGATCGGACTCATGAGCCTCTCTCCGAGCTAGCGGCGTCGCGAGGGAGGATTTCTGAGTTTCTCTGTTGCTCTGTGGCAATTTCGGTCGACATCAGTCGTGCCGGTAAACACCTGCCTTGGCTCGTGCCTCTGTACGATA---CCCTTAGGTAAGGGTGCGTGCATTG-AAGGTTATAGCTGGCGATCTCTCATGCGACCAGGGCACGGCGCCACCTTGTGTGTGTGCGCGGTGCGCAGCGGTCCAAAAGGATAAAGACGAATCGAGTGGCTGGTATCTGATAATCTGTCTCGCGCTAAAAGAGATGGCTATAATGGAGGCTGGTTAGAGGCGTGCTCTCGGTGT-ACTCTGGAAAGAGCCCCTCTCCACGGTTTTCGCAGCTCAATGGTCTGACACACACTCTCTCTCTCTCTCACTGGATTGGACGGACGGACGCGGTACTCTAAAGCCTGACGAGATCAGGTGGTGGT----AAAGAAAGCGCGCTGTTAGGGCCTGGTGGTCCGGTG-------------TTGGTGTTGCTGCGACTCTGCTCGTGGTGATGCTG------------AT-------GTCGCGAGCTGCCCTCGTGCTGCCTCT-----ATGCGCGTGTCTGGCACGAGCAACTCGGTCGCTGTTAGGGCCAAGTGCCAGTCCGGCGTTGGTGTTGCTAGGACTCTGCTCTTAGTGATGCTGGTGTCGCGTGC------TGGTAGGCCTCTATGCGCCGTGTGGGACGAAGAGCCTCTATCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ; END;