#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on January 25, 2022; 5:17 GMT TreeBASE (cc) 1994-2008 Study reference: Perez-moreno J.L., Balazs G., Wilkins B., Herczeg G., & Bracken-grissom H.D. 2017. The role of isolation on contrasting phylogeographic patterns in two cave crustaceans. BMC Evolutionary Biology, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21599] BEGIN TAXA; TITLE Taxa; DIMENSIONS NTAX=82; TAXLABELS 'Asellus aquaticus HBG2880_Soroksar' 'Asellus aquaticus HBG2881_Soroksar' 'Asellus aquaticus HBG2882_Soroksar' 'Asellus aquaticus HBG2883_Soroksar' 'Asellus aquaticus HBG2884_Soroksar' 'Asellus aquaticus HBG2885_Soroksar' 'Asellus aquaticus HBG2886_Soroksar' 'Asellus aquaticus HBG2887_Soroksar' 'Asellus aquaticus HBG2888_Soroksar' 'Asellus aquaticus HBG2889_Soroksar' 'Asellus aquaticus HBG2890_Soroksar' 'Asellus aquaticus HBG2891_Soroksar' 'Asellus aquaticus HBG2892_Soroksar' 'Asellus aquaticus HBG2893_Soroksar' 'Asellus aquaticus HBG2894_Soroksar' 'Asellus aquaticus HBG2895_Soroksar' 'Asellus aquaticus HBG2896_Soroksar' 'Asellus aquaticus HBG2897_Soroksar' 'Asellus aquaticus HBG2898_Soroksar' 'Asellus aquaticus HBG2919_Molnar_Janos_Cave' 'Asellus aquaticus HBG2920_Molnar_Janos_Cave' 'Asellus aquaticus HBG2921_Molnar_Janos_Cave' 'Asellus aquaticus HBG2922_Molnar_Janos_Cave' 'Asellus aquaticus HBG2923_Molnar_Janos_Cave' 'Asellus aquaticus HBG2924_Molnar_Janos_Cave' 'Asellus aquaticus HBG2925_Molnar_Janos_Cave' 'Asellus aquaticus HBG2926_Molnar_Janos_Cave' 'Asellus aquaticus HBG2927_Molnar_Janos_Cave' 'Asellus aquaticus HBG2928_Molnar_Janos_Cave' 'Asellus aquaticus HBG2929_Molnar_Janos_Cave' 'Asellus aquaticus HBG2930_Molnar_Janos_Cave' 'Asellus aquaticus HBG2931_Molnar_Janos_Cave' 'Asellus aquaticus HBG2932_Molnar_Janos_Cave' 'Asellus aquaticus HBG2934_Molnar_Janos_Cave' 'Asellus aquaticus HBG2935_Molnar_Janos_Cave' 'Asellus aquaticus HBG2936_Molnar_Janos_Cave' 'Asellus aquaticus HBG2937_Molnar_Janos_Cave' 'Asellus aquaticus HBG2938_Molnar_Janos_Cave' 'Asellus aquaticus HBG2959_Malom_Lake' 'Asellus aquaticus HBG2960_Malom_Lake' 'Asellus aquaticus HBG2961_Malom_Lake' 'Asellus aquaticus HBG2962_Malom_Lake' 'Asellus aquaticus HBG2963_Malom_Lake' 'Asellus aquaticus HBG2964_Malom_Lake' 'Asellus aquaticus HBG2965_Malom_Lake' 'Asellus aquaticus HBG2966_Malom_Lake' 'Asellus aquaticus HBG2967_Malom_Lake' 'Asellus aquaticus HBG2968_Malom_Lake' 'Asellus aquaticus HBG2969_Malom_Lake' 'Asellus aquaticus HBG2970_Malom_Lake' 'Asellus aquaticus HBG2971_Malom_Lake' 'Asellus aquaticus HBG2972_Malom_Lake' 'Asellus aquaticus HBG2973_Malom_Lake' 'Asellus aquaticus HBG2974_Malom_Lake' 'Asellus aquaticus HBG2975_Malom_Lake' 'Asellus aquaticus HBG2976_Malom_Lake' 'Asellus aquaticus HBG2977_Malom_Lake' 'Asellus aquaticus HBG2978_Malom_Lake' 'Asellus aquaticus HBG3991_Lipot' 'Asellus aquaticus HBG3992_Lipot' 'Asellus aquaticus HBG3993_Lipot' 'Asellus aquaticus HBG3994_Lipot' 'Asellus aquaticus HBG3995_Polgar' 'Asellus aquaticus HBG3996_Polgar' 'Asellus aquaticus HBG3997_Polgar' 'Asellus aquaticus HBG3998_Polgar' 'Asellus aquaticus HBG3999_Polgar' 'Asellus aquaticus HBG4000_Polgar' 'Asellus aquaticus HBG4001_Balatonfenyves' 'Asellus aquaticus HBG4002_Balatonfenyves' 'Asellus aquaticus HBG4003_Balatonfenyves' 'Asellus aquaticus HBG4004_Balatonfenyves' 'Asellus aquaticus HBG4005_Balatonfenyves' 'Asellus aquaticus HBG4007_Cserdi' 'Asellus aquaticus HBG4008_Cserdi' 'Asellus aquaticus HBG4009_Cserdi' 'Asellus aquaticus HBG4010_Cserdi' 'Asellus aquaticus HBG4012_Cserdi' 'Asellus aquaticus HBG4013_Cserdi' 'Asellus aquaticus HBG4015_Cserdi' 'Asellus aquaticus HBG4016_Cserdi' Caecidotea_sp._Genbank_outgroup ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M44592] TITLE 'Asellus aquaticus - 12S Alignment'; LINK TAXA = Taxa; DIMENSIONS NCHAR=359; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Asellus aquaticus HBG2880_Soroksar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATCTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTCTATAGAAAAGCCATTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2881_Soroksar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAN--------NNNN 'Asellus aquaticus HBG2882_Soroksar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2883_Soroksar' CCCTATAGTGAAATATTAAACCCCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2884_Soroksar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATCTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTCTATAGAAAAGCCATTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2885_Soroksar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2886_Soroksar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATCTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTCTATAGAAAAGCCATTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2887_Soroksar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAAACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAATTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2888_Soroksar' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2889_Soroksar' CCCTATAGTGAAATATTAAACCCCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2890_Soroksar' CCCTATAGTGAAATATTAAACCCCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2891_Soroksar' CTCTATAGTGAAATATTAAACCTCCGGTGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2892_Soroksar' CCCTATAGTGAAATATTAAACCCCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAAT{CT}TGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2893_Soroksar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATCTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTCTATAGAAAAGCCATTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2894_Soroksar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATCTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTCTATAGAAAAGCCATTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2895_Soroksar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2896_Soroksar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATCTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTCTATAGAAAAGCCATTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2897_Soroksar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2898_Soroksar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2919_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2920_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2921_Molnar_Janos_Cave' CTCTATAATGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2922_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2923_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2924_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2925_Molnar_Janos_Cave' CTCTATAATGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2926_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAANNNNNNNNNNNNNNN--------NNNN 'Asellus aquaticus HBG2927_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2928_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAANNNNNNNNNNNNNNN--------NNNN 'Asellus aquaticus HBG2929_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2930_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2931_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2932_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2934_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2935_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2936_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2937_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2938_Molnar_Janos_Cave' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2959_Malom_Lake' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2960_Malom_Lake' CTCTATAGTGAAATACTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2961_Malom_Lake' CTCTATAGTGAAATACTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2962_Malom_Lake' CTCTATAGTGAAATACTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2963_Malom_Lake' CTCTATAGTGAAATACTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2964_Malom_Lake' CTCTATAGTGAAATACTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2965_Malom_Lake' CTCTATAGTGAAATACTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2966_Malom_Lake' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2967_Malom_Lake' CTCTATAGTGAAATACTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2968_Malom_Lake' CTCTATAGTGAAATACTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2969_Malom_Lake' CTCTATAGTGAAATACTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2970_Malom_Lake' CTCTATAGTGAAATACTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2971_Malom_Lake' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2972_Malom_Lake' CTCTATAGTGAAATACTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAANNNNNNNNN--------NNNN 'Asellus aquaticus HBG2973_Malom_Lake' CTCTATAGTGAAATACTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2974_Malom_Lake' CTCTATAGTGAAATACTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2975_Malom_Lake' CTCTATAGTGAAATACTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2976_Malom_Lake' CTCTATAGTGAAATACTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2977_Malom_Lake' CTCTATAGTGAAATACTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG2978_Malom_Lake' NNNNNNNNNNNNNNNNNNNNNNNNNGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG3991_Lipot' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG3992_Lipot' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG3993_Lipot' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG3994_Lipot' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG3995_Polgar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGCATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG3996_Polgar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGCATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG3997_Polgar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGCATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG3998_Polgar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCGGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTCATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG3999_Polgar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG4000_Polgar' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGCATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG4001_Balatonfenyves' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGAGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG4002_Balatonfenyves' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGATATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATTTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATAACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG4003_Balatonfenyves' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG4004_Balatonfenyves' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG4005_Balatonfenyves' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 'Asellus aquaticus HBG4007_Cserdi' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAACCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG4008_Cserdi' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAAACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAATTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG4009_Cserdi' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAAACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAATTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG4010_Cserdi' CTCTATAGTGAAATATTAAACCTCCGGGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAAACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAATTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG4012_Cserdi' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAAACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAATTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG4013_Cserdi' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAACCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG4015_Cserdi' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAAACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGCGAAATTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT 'Asellus aquaticus HBG4016_Cserdi' CTCTATAGTGAAATATTAAACCTCCGAGGTAGTAATAGTTATATGCTTCAAACCTAAAGAATTTGGCGGCAGCTAACCTTATCAGAGAGACCTGTTAGTTAATCTGACAATCCACATTCTATCTTACTTTTCTTATATTTGTATACCGTCATCTAAATTTTATTT------------TTAAAATAATAATTCTAAAGGAGACAAATATGTTAGATCAACGCGCAGTTTATAGAAAAGCCCTTTATGGGTCTCAATTTATATTAAGTAGAAAAAATAGTGAAACTAT-TTTTAAAAGAGGATTTGAATGTAATCTAGTTTTAATATGACAAAATGAAAAAGCCATTAG--------CCGT Caecidotea_sp._Genbank_outgroup TATTATTCGCNTAT-TAAAATATTTAAGG{GT}AGTAGTTGATACAAGCTTGAAACCTAAAGATTTTGGCGGTACTTAATCTTATCAGAGGAACCTGCCTATTAA-ACGATAACCCGCGATAAATCTTACCGTCTCGCTGTTTGTACACCGTCGTCTAAGCAACCTTTA{AT}A{CG}AGGTTGGCTTAAAATATTTTTACTAAATA------------CAGATCTAGGCGCAGCC--TGGGCCGGATAAAGGTTGGTTACAATTGCCCTGTCATTGGAAAAATATTTTATTAGTATTATGAAATTGGATTTGAAAGTAATAGTAGTTTAACACGCTGCTATAAATACTCCTTTAAGTATGTACATAT ; END;