#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on September 17, 2021; 7:58 GMT TreeBASE (cc) 1994-2008 Study reference: Couch B., & Kohn L. 2002. A multilocus gene genealogy concordant with host preference indicates segregation of a new species, Magnaporthe oryzae, from M. grisea. Mycologia, 94(4): 683-693. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S833] BEGIN TAXA; TITLE combined; DIMENSIONS NTAX=27; TAXLABELS 'Magnaporthe grisea frm Digitaria horizontalis Py-D' Magnaporthe_grisea_frm_Digitaria_smutsii_JP34 Magnaporthe_grisea_frm_Digitaria_sp._81T4 Magnaporthe_grisea_frm_Digitaria_sp._91T16 Magnaporthe_grisea_frm_Eleusine_coracana_1122 Magnaporthe_grisea_frm_Eleusine_coracana_RW12 Magnaporthe_grisea_frm_Eleusine_indica_C10 Magnaporthe_grisea_frm_Eleusine_indica_T28 'Magnaporthe grisea frm Eragrostis curvula K76-79' Magnaporthe_grisea_frm_Eragrostis_curvula_NI909 Magnaporthe_grisea_frm_Lolium_perenne_330 Magnaporthe_grisea_frm_Lolium_perenne_365 'Magnaporthe grisea frm Oryza sativa BK-19' Magnaporthe_grisea_frm_Oryza_sativa_A119 Magnaporthe_grisea_frm_Oryza_sativa_A264 Magnaporthe_grisea_frm_Oryza_sativa_A347 Magnaporthe_grisea_frm_Oryza_sativa_A598 'Magnaporthe grisea frm Oryza sativa BK-6' Magnaporthe_grisea_frm_Oryza_sativa_Guy11 'Magnaporthe grisea frm Oryza sativa ML-56' 'Magnaporthe grisea frm Oryza sativa ML-91' 'Magnaporthe grisea frm Oryza sativa R694-2b' 'Magnaporthe grisea frm Oryza sativa R707-1E' Magnaporthe_grisea_frm_Setaria_sp._1152 Magnaporthe_grisea_frm_Setaria_sp._G48 Magnaporthe_grisea_frm_lab_strain_FGSC_8465 Magnaporthe_grisea_frm_lab_strain_FGSC_8470 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M270] TITLE Figs._1_and_2; LINK TAXA = combined; DIMENSIONS NCHAR=1275; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Magnaporthe grisea frm Digitaria horizontalis Py-D' CGGTGATGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCCCAAAAATGCCAATCGTCAGCTTCCGGTCTGTCGACAGATGTCCTCTGTCGCATTCCGCGATACTTGGTTAGAATGAGTGACTGATAACTTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATTATCCTAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAGTCCCCTGGATGATGATATCCATGGCTTCGGCACAGATCTGACAGTTTGCATAGTATCATGATTGGCTTTGCTCCGTTGACCAGCCGTGGCGCCCACTCTTTCCGCGCCGTCACTGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAACGGTCGCTACCTGACCTGCTCTGCCATCTTGTAAGTGACCATGACCACATCCACATGACCCAAGAGTTTGAACGTCAACTGATAACGAT-ACCACCACAGCCGTGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCGCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACTGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-ATGGCCTTACTTCTCTCTGTCTACTATTCGATTGGCTAGACATCGACTGCATGCACGCTGTCAAGATACTGATGAAGGATCTCCATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCAGCCCATAACACTGCAGTATACCGATTGCGCGCTATCGGCGACCGCC-CTCTCCGAGAATCAGAGGTTTGCGATCGCTACGACGTCGCTTGAATTCCTGCCTTGCGGAATGCAGAAACTAAAATAAT--CGTATTCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCGCTCGGCCAGAACCCTTCTGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGAAAATAGCCCACGCGAACCCGAGACTGGATTAAGACTCGAGCAGTTGGGACTT-GCTGACAGCTTCCAACAGAGTTCC Magnaporthe_grisea_frm_Digitaria_smutsii_JP34 CGGTGATGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCCCAAAAATGCCAATCGTCAGCTTCCGGTCTGTCGACAGATGTCCTCTGTCGCATTCCGCGATACTTGGTTAGAATGAGTGACTGATAACTTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATTATCCTAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAGTCCCCTGGATGATGATATCCATGGCTTCGGCACAGATCTGACAGTTTGCATAGTATCATGATTGGTTTTGCTCCGTTGACCAGCCGTGGCGCCCACTCTTTCCGCGCCGTCACTGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAACGGTCGCTACCTGACCTGCTCTGCCATCTTGTAAGTGACCATGACCACATCCACATGACCCAAGAGTTTGAACGTCAACTGATAACGAT-ACCACCACAGCCGTGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCGCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACTGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-ATGGCCTTACTTCTCTCTGTCTACTATTCGATTGGCTAGACATCGACTGCATGCACGCTGTCAAGATACTGATGAAGGATCTCCATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCAGCCCATAACACTGCAGTATACCGATTGCGCGCTATCGGCGACCGCC-CTCTCCGAGAACCAGAGGTTTGCGATCGCTACGACGTCGCTTGAATTCCTGCCTTGCGGAATGCAGAAACTAAAATAAT--CGTATTCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCGCTCGGCCAGAACCCTTCTGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGAAAATAGCCCACGCGAACCCGAGACTGGATTAAGACTCGAGCAGTTGGGACTT-GCTGACAGCTTCCAACAGAGTTCC Magnaporthe_grisea_frm_Digitaria_sp._81T4 CGGTGATGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCCCAAAAATGCCAATCGTCAGCTTCCGGTCTGTCGACAGATGTCCTCTGTCGCATTCCGCGATACTTGGTTAGAATGAGTGACTGATAACTTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATTATCCTAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAGTCCCCTGGATGATGATATCCATGGCTTCGGCACAGATCTGACAGTTTGCATAGTATCATGATTGGTTTTGCTCCGTTGACCAGCCGTGGCGCCCACTCTTTCCGCGCCGTCACTGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAACGGTCGCTACCTGACCTGCTCTGCCATCTTGTAAGTGACCATGACCACATCCACATGACCCAAGAGTTTGAACGTCAACTGATAACGAT-ACCACCACAGCCGTGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCGCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACTGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-ATGGCCTTACTTCTCTCTGTCTACTATTCGATTGGCTAGACATCGACTGCATGCACGCTGTCAAGATACTGATGAAGGATCTCCATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCAGCCCATAACACTGCAGTATACCGATTGCGCGCTATCGGCGACCGCC-CTCTCCGAGAATCAGAGGTTTGCGATCGCTACGACGTCGCTTGAATTCCTGCCTTGCGGAATGCAGAAACTAAAATAAT--CGTATTCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCGCTCGGCCAGAACCCTTCTGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGAAAATAGCCCACGCGAACCCGAGACTGGATTAAGACTCGAGCAGTTGGGACTT-GCTGACAGCTTCCAACAGAGTTCC Magnaporthe_grisea_frm_Digitaria_sp._91T16 CGGTGATGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCCCAAAAATGCCAATCGTCAGCTTCCGGTCTGTCGACAGATGTCCTCTGTCGCATTCCGCGATACTTGGTTAGAATGAGTGACTGATAACTTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATTATCCTAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAGTCCCCTGGATGATGATATCCATGGCTTCGGCACAGATCTGACAGTTTGCATAGTATCATGATTGGTTTTGCTCCGTTGACCAGCCGTGGCGCCCACTCTTTCCGCGCCGTCACTGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAACGGTCGCTACCTGACCTGCTCTGCCATCTTGTAAGTGACCATGACCACATCCACATGACCCAAGAGTTTGAACGTCAACTGATAACGAT-ACCACCACAGCCGTGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCGCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACTGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-ATGGCCTTACTTCTCTCTGTCTACTATTCGATTGGCTAGACATCGACTGCATGCACGCTGTCAAGATACTGATGAAGGATCTCCATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCAGCCCATAACACTGCAGTATACCGATTGCGCGCTATCGGCGACCGCC-CTCTCCGAGAATCAGAGGTTTGCGATCGCTACGACGTCGCTTGAATTCCTGCCTTGCGGAATGCAGAAACTAAAATAAT--CGTATTCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCGCTCGGCCAGAACCCTTCTGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGAAAATAGCCCACGCGAACCCGAGACTGGATTAAGACTCGAGCAGTTGGGACTT-GCTGACAGCTTCCAACAGAGTTCC Magnaporthe_grisea_frm_Eleusine_coracana_1122 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Eleusine_coracana_RW12 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGACCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Eleusine_indica_C10 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGACCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGC?CCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Eleusine_indica_T28 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGT?CACTGA?GCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC 'Magnaporthe grisea frm Eragrostis curvula K76-79' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCTATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Eragrostis_curvula_NI909 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Lolium_perenne_330 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGT?TACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Lolium_perenne_365 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC 'Magnaporthe grisea frm Oryza sativa BK-19' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Oryza_sativa_A119 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAACGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Oryza_sativa_A264 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Oryza_sativa_A347 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Oryza_sativa_A598 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC 'Magnaporthe grisea frm Oryza sativa BK-6' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Oryza_sativa_Guy11 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC 'Magnaporthe grisea frm Oryza sativa ML-56' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC 'Magnaporthe grisea frm Oryza sativa ML-91' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC 'Magnaporthe grisea frm Oryza sativa R694-2b' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC 'Magnaporthe grisea frm Oryza sativa R707-1E' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Setaria_sp._1152 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Setaria_sp._G48 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_lab_strain_FGSC_8465 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_lab_strain_FGSC_8470 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCTATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC ; END; BEGIN SETS; CHARSET cal (CHARACTERS = Figs._1_and_2) = 797-1275; CHARSET act (CHARACTERS = Figs._1_and_2) = 1-300; CHARSET bt1 (CHARACTERS = Figs._1_and_2) = 301-796; CHARSET idel (CHARACTERS = Figs._1_and_2) = 50 802 809-811 838 1052; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Figs._1_and_2) = N: 1-1275; CODONPOSSET CodonPositions (CHARACTERS = Figs._1_and_2) = N: 1-1275; END;