#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on February 06, 2023; 6:10 GMT TreeBASE (cc) 1994-2008 Study reference: Crous P.W., Groenewald J.Z., Risede J., Simoneau P., & Hyde K.D. 2006. Calonectria species and their Cylindrocladium anamorphs: species with clavate vesicles. Studies in Mycology, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1563] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=123; TAXLABELS Calonectria_leguminum Calonectria_reteaudii_CBS_112143 Calonectria_reteaudii_CBS_112144 Calonectria_reteaudii_CBS_112146 Calonectria_reteaudii_CBS_112147 Calonectria_reteaudii_CBS_112149 Calonectria_reteaudii_CBS_112151 Calonectria_reteaudii_CBS_112153 Calonectria_reteaudii_CBS_112155 Calonectria_reteaudii_CBS_112634 Calonectria_reteaudii_CBS_112955 Calonectria_reteaudii_CBS_113582 Calonectria_reteaudii_CBS_113583 Calonectria_reteaudii_CBS_113925 Calonectria_reteaudii_CBS_582.50 Calonectria_reteaudii_CPC_3217 Cylindrocladiella_lageniformis Cylindrocladiella_peruviana Cylindrocladium_acicola_CBS_114812 Cylindrocladium_acicola_CBS_114813 Cylindrocladium_acicola_CPC_10898 Cylindrocladium_angustatum_CBS_112133 Cylindrocladium_angustatum_CBS_114544 Cylindrocladium_angustatum_CBS_114766 Cylindrocladium_angustatum_CBS_114767 Cylindrocladium_australiense Cylindrocladium_avesiculatum Cylindrocladium_clavatum Cylindrocladium_colhounii_CBS_111205 Cylindrocladium_colhounii_CBS_111367 Cylindrocladium_colhounii_CBS_112739 Cylindrocladium_colhounii_CBS_112948 Cylindrocladium_colhounii_CBS_112951 Cylindrocladium_colhounii_CBS_114036 Cylindrocladium_colhounii_CBS_114660 Cylindrocladium_colhounii_CBS_114695 Cylindrocladium_colhounii_CBS_114704 Cylindrocladium_colhounii_CBS_293.79 Cylindrocladium_colhounii_CPC_1237 Cylindrocladium_colhounii_CPC_681 Cylindrocladium_colhounii_CPC_705 Cylindrocladium_curvisporum_CPC_763 Cylindrocladium_curvisporum_CPC_765 Cylindrocladium_ecuadoriae_CBS_111383 Cylindrocladium_ecuadoriae_CBS_111393 Cylindrocladium_ecuadoriae_CBS_111394 Cylindrocladium_ecuadoriae_CBS_111406 Cylindrocladium_ecuadoriae_CBS_111412 Cylindrocladium_ecuadoriae_CBS_111425 Cylindrocladium_flexuosum_CBS_112675 Cylindrocladium_flexuosum_CBS_112676 Cylindrocladium_flexuosum_CBS_114557 Cylindrocladium_flexuosum_CBS_114666 Cylindrocladium_flexuosum_CPC_11347 Cylindrocladium_flexuosum_CPC_11348 Cylindrocladium_flexuosum_CPC_11349 Cylindrocladium_flexuosum_CPC_11350 Cylindrocladium_flexuosum_CPC_11351 Cylindrocladium_flexuosum_CPC_11352 Cylindrocladium_gordoniae Cylindrocladium_gracile_CBS_110676 Cylindrocladium_gracile_CBS_111129 Cylindrocladium_gracile_CBS_111382 Cylindrocladium_gracile_CBS_111390 Cylindrocladium_gracile_CBS_111456 Cylindrocladium_gracile_CBS_111458 Cylindrocladium_gracile_CBS_111465 Cylindrocladium_gracile_CBS_111468 Cylindrocladium_gracile_CBS_111474 Cylindrocladium_gracile_CBS_111475 Cylindrocladium_gracile_CBS_111476 Cylindrocladium_gracile_CBS_111478 Cylindrocladium_gracile_CBS_111869 Cylindrocladium_gracile_CBS_112673 Cylindrocladium_gracile_CBS_112694 Cylindrocladium_gracile_CBS_114167 Cylindrocladium_gracile_CBS_114171 Cylindrocladium_gracile_CBS_115680 Cylindrocladium_gracile_CBS_115769 Cylindrocladium_graciloideum_CBS_111040 Cylindrocladium_graciloideum_CBS_111141 Cylindrocladium_graciloideum_CBS_115674 Cylindrocladium_hawksworthii Cylindrocladium_hurae_CBS_114182 Cylindrocladium_hurae_CBS_114551 Cylindrocladium_hurae_FTCC_1002 Cylindrocladium_hurae_FTCC_1003 Cylindrocladium_macroconidiale_CBS_114880 Cylindrocladium_macroconidiale_CPC_413 Cylindrocladium_madagascariense_CBS_114539 Cylindrocladium_madagascariense_CBS_114571 Cylindrocladium_madagascariense_CBS_114572 Cylindrocladium_madagascariense_CPC_2322 Cylindrocladium_multiseptatum_CBS_112682 Cylindrocladium_multiseptatum_CPC_1602 Cylindrocladium_penicilloides Cylindrocladium_pseudogracile_AR2677 Cylindrocladium_pseudogracile_CBS_111284 Cylindrocladium_pseudogracile_CBS_114454 Cylindrocladium_pteridis_CBS_111778 Cylindrocladium_pteridis_CBS_111793 Cylindrocladium_pteridis_CBS_111867 Cylindrocladium_pteridis_CBS_111871 Cylindrocladium_pteridis_CPC_11284 Cylindrocladium_pteridis_CPC_11285 Cylindrocladium_pteridis_CPC_11286 Cylindrocladium_pteridis_CPC_11435 Cylindrocladium_pteridis_CPC_11569 Cylindrocladium_pteridis_CPC_11618 Cylindrocladium_pteridis_CPC_11619 Cylindrocladium_pteridis_CPC_12072 Cylindrocladium_pteridis_CPC_12114 Cylindrocladium_pteridis_CPC_2190 Cylindrocladium_pteridis_CPC_2869 Cylindrocladium_rumohrae_CBS_111431 Cylindrocladium_rumohrae_CBS_114529 Cylindrocladium_rumohrae_UFV_215 Cylindrocladium_sp. Cylindrocladium_theae_ATCC_48895 Cylindrocladium_theae_CBS_111399 Cylindrocladium_theae_CBS_111705 Cylindrocladium_theae_CBS_114175 Cylindrocladium_theae_CBS_114684 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1209] TITLE Combined; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1181; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Calonectria_leguminum ------------TCT--TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGTCCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--CCCTTTTTGAACAT--GACGAGA-TA-TCAAA-ACAAGATT-GCTGACCATATGCTTCTTTCTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCAACAAAAA--TTCTTCACGGCGAGATTCGCTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---TCAATCATCAA-GATGTG-CTCCC--TTGA--GTGCAA-GGTGCAA-GTAAA-CTCACAC--CATGT--AGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ATC------------------------------------AC---ACCA-ACACATC---TGGCATCATACTG---------------------------ATATC--AATACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGA---CTCTCACAT--GAACC---ATCAAGT-AA--CAGTTGCTAACCA-------ACAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCCCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCTCTCTTTGAGGATACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Calonectria_reteaudii_CBS_112143 -----------GCTTC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--ACATC-ATGAACAA--GACGAGA-TA-TCGGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGATT-CCAAATATG----TTCTCATGATAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAACCATGC---CTGCG-CTCGC-TTTGT---CGAAAAAGCACAA-GCAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCTAAGGCTGGTAAGTGAATT--CT-ACC------------------------------------TC---AAGA--ATAGCC----GACCA-CAACTG---------------------------ACACA--TCTGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGTCAATAT-------CAACGCAG-ATCACATCACA-G-CC---AGACGCTAACGC-------ATTGCAGGTTCGTGAGATTGCTCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGCGCTCTTCAGGAGTCCGTTGAATCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Calonectria_reteaudii_CBS_112144 ------------TCTG-AGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--ACATC-ATGAACAA--GACGAGA-TA-TCCGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTGGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTTGATT-GCAAATATG----TTCTCATGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAACCATGC---CTGCG-CTCGC-TTTGT---CGAAAAAGCACAA-GCAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTGGCGCTGTCCTCGTCGATCTTGAGCCCCGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCTAAGGCTGGTAAGTGAATT--CT-ACC------------------------------------TC---AAGA--ATAGCC----GACCA-CAACTG---------------------------ACACA--TCTGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGTCAATAT-------CAACGCAG-ATCACATCACA-G-CC---AGACGCTAACGC-------ATTGCAGGTTCGTGAGATTGCTCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGCGCTCTTCAGGAGTCCGTTGAATCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Calonectria_reteaudii_CBS_112146 ------------TCTG-AGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--ACATC-ATGAACAA--GACGAGA-TA-TCGGA-ACACGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTTGACT-CCGAAAATG----TTCTCATGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAACCATGC---CTGCG-CTCGC-TTTGT---CGAAAAAGCACAA-GCAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTGCTCGCGCTGTCCTCGGCTATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCCAAGGCTGGTAAGTAAATT--CT-ACCA-----------------------------------CAACAACAG---CCGGCCA--------CAACTG---------------------------ACACA--TGTGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTTAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGCCAATCT-------CAACGCAG-ATCACACCTCA-GTCTC--AGACGCTAACAC-------ATTACAGGTTCGTGAGATTGCTCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGCGCTCTTCAGGAGTCCGTTGAATCCTACCTCGTCTCTCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Calonectria_reteaudii_CBS_112147 ------------TCT---GAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--ACATC-ATGAACAA--GACGAGA-TA-TCGGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGATT-CCAAATATG----TTCTCATGATAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAACCATGC---CTGCG-CTCGC-TTTGT---CGAAAAAGCACAA-GCAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTGGCGCTGTCCTCGTCGATCTTGAGCCCCGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCTAAGGCTGGTAAGTGAATT--CT-ACC------------------------------------TC---AAGA--ATAGCC----GACCA-CAACTG---------------------------ACACA--TCTGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGTCAATAT-------CAACGCAG-ATCACATCACA-G-CC---AGACGCTAACGC-------ATTGCAGGTTCGTGAGATTGCTCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGCGCTCTTCAGGAGTCCGTTGAATCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Calonectria_reteaudii_CBS_112149 ------------TCTG-AGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--ACATC-ATGAACAA--GACGAGA-TA-TCGGA-ACACGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTTGACT-CCGAAAATG----TTCTCATGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAACCATGC---CTGCG-CTCGC-TTTGT---CGAAAAAGCACAA-GCAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTGCTCGCGCTGTCCTCGGCTATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCCAAGGCTGGTAAGTAAATT--CT-ACCA-----------------------------------CAACAACAG---CCGGCCA--------CAACTG---------------------------ACACA--TGTGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTTAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGCCAATCT-------CAACGCAG-ATCACACCTCA-GTCTC--AGACGCTAACAC-------ATTACAGGTTCGTGAGATTGCTCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGCGCTCTTCAGGAGTCCGTTGAATCCTACCTCGTCTCTCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Calonectria_reteaudii_CBS_112151 -----------GCTTC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--ACCTC-ACGAACAA--GACGAGA-TA-TCGGA-ACAGGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTTGACT-CCGAAAATG----TTCTCATGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAACCATGC---CTGCG-CTCGC-TTTGT---CGAAAAAGCACAA-TCAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????--------------------------------GGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCTAAGGCTGGTAAGTAAATT--CT-ACCA-----------------------------------CAACAACAG---CCGGCCA--------CAACTG---------------------------ACACA--TGTGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTTAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGCCAATCT-------CAACGCAG-ATCACACCTCA-GTCTC--AGACGCTAACAC-------ATTACAGGTTCGTGAGATTGCTCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGCGCTCTTCAGGAGTCCGTTGAATCCTACCTCGTCTCTCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Calonectria_reteaudii_CBS_112153 ------------TCT---GAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--ACATC-ATGAACAA--GACGAGA-TA-TCGGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGATT-CCAAATATG----TTCTCATGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAACCATGC---CTGCG-CTCGC-TTTGT---CGAAAAAGCACAA-GCAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTGGCGCTGTCCTCGTCGATCTTGAGCCCCGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCTAAGGCTGGTAAGTGAATT--CT-ACC------------------------------------TC---AAGA--ATAGCC----GACCA-CAACTG---------------------------ACACA--TCTGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGTCAATAT-------CAACGCAG-ATCACATCACA-G-CC---AGACGCTAACGC-------ATTGCAGGTTCGTGAGATTGCTCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGCGCTCTTCAGGAGTCCGTTGAATCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Calonectria_reteaudii_CBS_112155 ------------TCTC-AGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--ACATC-ATGAACAA--GACGAGA-TA-TCGGA-ACACGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTTGACT-CCGAAAATG----TTCTCATGACAGGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAACCATGC---CTGCG-CTCGC-TTTGT---CGAAAAAGCACAA-GCAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTGCTCGCGCTGTCCTCGGCTATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCCAAGGCTGGTAAGTAAATT--CT-ACCA-----------------------------------CAACAACAG---CCGGCCA--------CAACTG---------------------------ACACA--TGTGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTTAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGCCAATCT-------CAACGCAG-ATCACACCTCA-GTCTC--AGACGCTAACAC-------ATTACAGGTTCGTGAGATTGCTCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGCGCTCTTCAGGAGTCCGTTGAATCCTACCTCGTCTCTCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Calonectria_reteaudii_CBS_112634 -----------GCTTC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--ACCTC-ACGAACAA--GACGAGA-TA-TCGGA-ACAGGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTTGACT-CCGAAAATG----TTCTCATGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAACCATGC---CTGCG-CTCGC-TTTGT---CGAAAAAGCACAA-TCAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCCAAGGCTGGTAAGTAAATT--CT-ACCA-----------------------------------CAACAACAG---CCGGCCA--------CAACTG---------------------------ACACA--TGTGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTTAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGCCAATCT-------CAACGCAG-ATCACACCTCA-GTCTC--AGACGCTAACAC-------ATTACAGGTTCGTGAGATTGCTCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGCGCTCTTCAGGAGTCCGTTGAATCCTACCTCGTCTCTCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Calonectria_reteaudii_CBS_112955 -----------GCTTC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCATC-ACGAACAT--GACGAGA-TA-TCGGA-ACAAGATT-GCTAACAATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCGATT-CCAAAAATG----TTCTCATGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCGAAAAAAAACATGC---GTGCG-CTCGC-TTTGA---CGAGAAA-CACGA-GCAAA-CTGACACCATATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCCAAGGCTGGTAAGTGATTCC-CC-ACGA-----------------------------------CAACAACACT---TGGCTA--------CGACTG---------------------------ACCCA--TGTGCAGCCCGCAAGAGCGCCCCTTCTACCGGAGGCGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCTTTCCAGCGTCTCGTAAGAAAATAC-------CCACACCG-ATCACACCTCA-GCCTC--AGACGCTAACAC-------ATCACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGCGCTCTTCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Calonectria_reteaudii_CBS_113582 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--ACATC-ATGAACAA--GACGAGA-TA-TCGGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGATT-CCAAATATG----TTCTCATGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTTTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAACCATGC---CTGCG-CTCGC-TTTGT---CGAAAAAGCACAA-GCAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????--------------------------------GGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCTAAGGCTGGTAAGTGAATT--CT-ACC------------------------------------TC---AAGA--ATAGCC----GACCA-CAACTG---------------------------ACACA--TCTGCAGCCCGCAAGAGCGCACCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGTCAATAT-------CAACGCAG-ATCACATCACA-G-CC---AGACGCTAACGC-------ATTGCAGGTTCGTGAGATTGCTCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGCGCTCTTCAGGAGTCCGTTGAATCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Calonectria_reteaudii_CBS_113583 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--ACATC-ATGAACAA--GACGAGA-TA-TCGGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGATT-CCAAATATG----TTCTCATGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAACCATGC---CTGCG-CTCGC-TTTGT---CGAAAAAGCACAA-GCAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTTCGTGCCGGTCCTTTCTGGTAGCTCTTTCGC???????????----?????--------------------------------GGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCTAAGGCTGGTAAGTGAATT--CT-ACC------------------------------------TC---AAGA--ATAGCC----GACCA-CAACTG---------------------------ACACA--TCTGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGTCAATAT-------CAACGCAG-ATCACATCACA-G-CC---AGACGCTAACGC-------ATTGCAGGTTCGTGAGATTGCTCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGCGCTCTTCAGGAGTCCGTTGAATCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGTGTCACCATCCAGTCCA-------------------- Calonectria_reteaudii_CBS_113925 -----------------------G--CGTGCC-TTGGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--ACCTC-GTGAACAT--GACGAGA-TA-TCGGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCG---CT-CCGAAAATG----TTCTCATGACAACGTTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACGCTGGTACTTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATC----AAAAAACATGC---GTGCG-CTCAC-TTTGA---CGAGAAA-TACAG-GCAAA-CTGACACACCATGTGTAGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????-------------------------------TGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCCAAGGCTGGTAAGTGAATT--CT-ACC------------------------------------AC---AACA--ACAGTC----GGCCA-CAACTG---------------------------ACACC--TGTGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGCGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTTGTAAGTCAACAC-------CAACGCAG-ATCACACACCG-GCCT--CGGACGCTAACGC-------ATTACAGGTTCGTGAGATTGCTCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGCGCTCTTCAGGAGTCCGTTGAATCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCTAAGCGTGTCACTATCCAGTCCA-------------------- Calonectria_reteaudii_CBS_582.50 ------------TCT---GAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--ACATC-ATGAACAA--GACGAGA-TA-TCGGA-ACAAGATT-GCTAACCATGTGCTTCTTTTTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGATT-CCAAATATG----TTCTCATGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAACCATGC---CTGCG-CTCGC-TTTGT---CGAAAAAGCACAA-GCAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????-------------------------------TGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCTAAGGCTGGTAAGTGAATT--CT-ACC------------------------------------TC---AAGA--ATAGCC----GACCA-CAACTG---------------------------ACACA--TCTGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGTCAATAT-------CAACGCAG-ATCACATCACA-G-CC---AGACGCTAACGC-------ATTGCAGGTTCGTGAGATTGCTCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGCGCTCTTCAGGAGTCCGTTGAATCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGTGTCACCATCCAGTC---------------------- Calonectria_reteaudii_CPC_3217 ------------TCT---GAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--ACATC-ATGAACAA--GACGAGA-TA-TCGGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGATT-CCAAATATG----TTCTCATGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAACCATGC---CTGCG-CTCGC-TTTGT---CGAAAAAGCACAA-GCAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTAGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCCTCTAAGGCTGGTAAGTGAATT--CT-ACC------------------------------------TC---AAGA--ATAGCC----GACCA-CAACTG---------------------------ACACA--TCTGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGTCAATAC-------CAACGCAG-ATCACATCACA-G-CC---AGACGCTAACGC-------ATTGCAGGTTCGTGAGATTGCTCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGCGCTCTTCAGGAGTCCGTTGAATCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTCTGCGCCATTCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladiella_lageniformis -------CAGCTTCCACTCGATACAACGCG----TTGTTG-----CT-GCCCCTGATTCTACCCCGCCGAATCGTTTCCCACCGCCTCGACAACAACAAAGCTCGCGATGCCCA-CCCACACCATGATATCT-GAACATAA-TGGCTAAT---TTTGCGTGTTT-----CTGCGAATATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCATTCCTCACCT--CGACAAGC------CTCGTCAACGGCTGCTAACGGTGTCTTGA-TAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTTTACAACGGCAGCTCTGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGAC-CAGAGCACTC--TCAT--TTGC-----------TGTGAA--CGATA-ATGTA-CTCACGC--TTCAT--AGGCTTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTTTTCCGCCCCGACAACTT----?????-----------------------------------------------------------GCTTCCAAGGCTGGTGAGTTCTAC--CC-TCTTTGTTTATGATCTTGGTCACCATCGCCATCATCGGACGGTGGCCACCGACATCATCGACGATCAACCCCATCACCATCAAACATCACCACTAACTTCCATC-TTCTCTAGCCCGCAAGTCTGCCCCTTCTACCGGAGGTGTCAAGAAGCCTCACCGTTATAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACTGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTCA-CAC---CGCGATTCAATCAACGC-G-TCCCAACACA-CACTAACGCGATC-------AACACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGT----------------------- Cylindrocladiella_peruviana -------CAGCTCCCACTCGAGCCAGCGCG---TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGAACCATTTTCCACCGCCTCGACAACAACAAAGCTCGCGAT-AATG-CCCACGTCGTGATATCTTGAATCAGA-TTGCTAAT---C--ATGTGTTT-----CTG-AACTATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTTTACACCTCGCCT--TCACGAGT------CTCTGCGGCGTTTGCTCACGAT-ACATAA-CAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGCAGCTCTGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGACTAATGAT-CT----AAT--CTGT-----CAC---AGAGAA--CCACA-GTG-A-CTTACGC--ACAAT--AGGCTTCTGGCAACAAGTATGTCCCTCGCGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCTGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????-----------------------------------------------------------GCTTCCAAGGCTGGTGAGTACTAT--CC-TCTCTATTGTCTGATGCCATCGGCCTCGATCATATCG-ATCATGGTC---GCCGACATCGAC-ATCATCATC--AACCATCAT-CACCAATACTGACTTCTATC-TT---CAGCCCGCAAGTCCGCCCCTTCTACCGGAGGTGTCAAGAAGCCTCACCGTTATAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACTGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTCACCAC--AACAGAACCACTCAACGC-GCTTTCAACATC-AACTAACGCATCA-------AACACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAG--------------------------------------- Cylindrocladium_acicola_CBS_114812 ------TCGTGGCTTC-TGAGACG--AGTGCC-TTTGTTGCTTTGCT-GCCCCTGATTCTACCCCGCGGCCCCGGTTTCCACCGCTCCGACGAAAACAAACA-CGCA--ACCTC-ACGAATAT--GACGAGA-TA-TCGGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGACT-CCAACGATA----TTCTTGTGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAACGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAATCACGA---GTGCG-CTCGC-TTTGT---GGAGAAG----AA--CAAA-CTGACACACCATGTGTAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCTGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCC-------------?????-------------------------------TGGTGGCAAGGCTCCTCGCAAGCAGCTTGCCTCCAAGGCTGGTAAGTAAACT--CC-AAC------------------------------------AC---TGTT---GCCCA----GACAC--GACTA---------------------------ACACAAATGTACAGCCCGCAAAAGCGCGCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCCACCGAGCTTCTCATTCGAAAGCTCCCTTTCCAGCGTCTCGTAAGTGAAAAT-----GCACATGCAA-ATCGCGCCGCA-GCCC--CAGCCGCTAATGC-------ACCACAGGTCCGTGAGATTGCTCAGGATTTCAAGAGCGACCTCCGCTTCCAGTCATCTGCCATCGGTGCTCTTCAGGAGTCCGTTGAGTCTTATCTCGTCTCTCTCTTCGAGGACACTAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGAC--------------- Cylindrocladium_acicola_CBS_114813 ------TCGTGGCTTC-TGAGACG--AGTGCC-TTTGTTGCTTTGCT-GCCCCTGATTCTACCCCGCGGCCCCGGTTTCCACCGCTCCGACGAAAACAAACA-CGCA--ACCTC-ACGAATAT--GACGAGA-TA-TCGGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGACT-CCAACGATA----TTCTTGTGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAACGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAATCACGA---GTGCG-CTCGC-TTTGT---GGAGAAG----AA--CAAA-CTGACACACCATGTGTAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCTGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCC-------------?????-------------------------------TGGTGGCAAGGCTCCTCGCAAGCAGCTTGCCTCCAAGGCTGGTAAGTAAACT--CC-AAC------------------------------------AC---TGTT---GCCCA----GACAC--GACTA---------------------------ACACAAATGTACAGCCCGCAAAAGCGCGCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCCACCGAGCTTCTCATTCGAAAGCTCCCTTTCCAGCGTCTCGTAAGTGAAAAT-----GCACATGCAA-ATCGCGCCGCA-GCCC--CAGCCGCTAATGC-------ACCACAGGTCCGTGAGATTGCTCAGGATTTCAAGAGCGACCTCCGCTTCCAGTCATCTGCCATCGGTGCTCTTCAGGAGTCCGTTGAGTCTTATCTCGTCTCTCTCTTCGAGGACACTAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGAC--------------- Cylindrocladium_acicola_CPC_10898 ------TCGTGGCTTC-TGAGACG--AGTGCC-TTTGTTGCTTTGCT-GCCCCTGATTCTACCCCGCGGCCCCGGTTTCCACCGCTCCGACGAAAACAAACA-CGCA--ACCTC-ACGAATAT--GACGAGA-TA-TCGGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGACT-CCAACGATA----TTCTTGTGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAACGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAATCACGA---GTGCG-CTCGC-TTTGT---GGAGAAG----AA--CAAA-CTGACACACCATGTGTAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCTGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGA??????----?????-----------------------AGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTTGCCTCCAAGGCTGGTAAGTAAACT--CC-AAC------------------------------------AC---TGTT---GCCCA----GACAC--GACTA---------------------------ACACAAATGTACAGCCCGCAAAAGCGCGCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCCACCGAGCTTCTCATTCGAAAGCTCCCTTTCCAGCGTCTCGTAAGTGAAAAT-----GCACATGCAA-ATCGCGCCGCA-GCCC--CAGCCGCTAATGC-------ACCACAGGTCCGTGAGATTGCTCAGGATTTCAAGAGCGACCTCCGCTTCCAGTCATCTGCCATCGGTGCTCTTCAGGAGTCCGTTGAGTCTTATCTCGTCTCTCTCTTCGAGGACACTAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCTCGCCCGC Cylindrocladium_angustatum_CBS_112133 CTCCTGCTT--------TGCAACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGATCCGGTTTCCACCGCTTCGACGACAGCGAAAC-CGCG--CTCTC-ATGAACAT--GACGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTGCTTCCTTCTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCCCAACT-CGAACAAAA----TTCTCGCGGCGAGATTTACTGACATTTGTCGACAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCTGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTT---GCAACCGCAC--GGCGTA-TTCCC--TTCA---GCCAACCGTGCAA-GGAAA-CTCACAT--CATGT--AGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTAAGTGAACT--CC-ATC------------------------------------AC---ACCG-ACGCATC-------ATCATACTG---------------------------ACATC--GATACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGCGTTCAC---TTCACCCATC-TCGCCC--ATTGGGT-CA--CAGTTACTAACCA-------ACATCAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTAGAGTCTTACCTCGTCTCTCTCTTCGAGGATACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_angustatum_CBS_114544 -----------------------G--CGTGCC-TTTGTTG-----TT-GCCCCTGATTCTACCCCGCCGATCCGGTTTCCACCG?TTCGACGACAGCGAAAC-CGCG--TTCTC-ATGAACAT--GACGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTGCTTCCTTCTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCCCAACT-CGAACAAAA----TTCTCGCGGCGAGATTTACTGACATTTGTCGACAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCTGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTT---GCAACCGCAC--GGCGTA-TTCCC--TTCA---GCCAACCGTGCAA-GGAAA-CTCA-----CATGT--AGGCTTCTGGCAACAAGTTCGTCCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCG?CAAC??----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTAAGTGAACT--CC-ATC------------------------------------AC---ACCG-ACGCATC-------ATCATACTG---------------------------ACATC--GATACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGCGTTCAC---TTCACCCATC-TCGCCC--ATTGGGT-CA--CAGTTACTAACCA-------ACATCAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTAGAGTCTTACCTCGTCTCTCTCTTCGAGGATACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_angustatum_CBS_114766 CCAGAGCTCCTGCTT--TGCAACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGATCCGGTTTCCACCGCTTCGACGACAGCGAAAC-CGCG--CTCTC-ATGAACAT--GACGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTGCTTCCTTCTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCCCAACT-CGAACAAAA----TTCTCGCGGCGAGATTTACTGACATTTGTCGACAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCTGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTT---GCAACCGCAC--GGCGTA-TTCCC--TTCA---GCCAACCGTGCAA-GGAAA-CTCACAT--CATGT--AGGCTTCTGGCAACAAGTTCGTCCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTAAGTGAACT--CC-ATC------------------------------------AC---ACCG-ACGCATC-------ATCATACTG---------------------------ACATC--GATACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGCGTTCAC---TTCACCCATC-TCGCCC--ATTGGGT-CA--CAGTTACTAACCA-------ACATCAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTAGAGTCTTACCTCGTCTCTCTCTTCGAGGATACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_angustatum_CBS_114767 CCAGAGCTCCTGCTT--TGCAACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGATCCGGTTTCCACCGCTTCGACGACAGCGAAAC-CGCG--CTCTC-ATGAACAT--GACGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTGCTTCCTTCTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCCCAACT-CGAACAAAA----TTCTCGCGGCGAGATTTACTGACATTTGTCGACAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCTGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTT---GCAACCGCAC--GGCGTA-TTCCC--TTCA---GCCAACCGTGCAA-GGAAA-CTCACAT--CATGT--AGGCTTCTGGCAACAAGTTCGTCCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTAAGTGAACT--CC-ATC------------------------------------AC---ACCG-ACGCATC-------ATCATACTG---------------------------ACATC--GATACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCTGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCTTTCCAGCGTCTTGTAAGCGTTCAC---TTCACCCATC-TCGCCC--ATTGGGT-CA--CAGTTACTAACCA-------ACATCAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTAGAGTCTTACCTCGTCTCTCTCTTCGAGGATACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_australiense -----------GATTT-CGAGACG--CGAGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GGCGAGA-TA-TCGGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTACTCTCAACT-CCGACAAGA----TTCTCACGACAAGATTTACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCT----AAACACTAT-----GC--GCAGG-CTTCG---CCAAGAATCACAA-GCAAA-CTGACACACTATGT--AGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCTCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTAA-----TC-TCC------------------------------------AT---CGCA-TCG-TACC---TGAACACCACTA---------------------------ATAGA--TACACAGCACGCAAGAGCGCCCCCTCTACTGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATCCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTTGTAAGTACATCGTCTTT--CGCAGA---ACA----TCATAGCCAC--AGCCACTAACAG-------ACATAAGGTTCGTGAGATTGCCCAGGATTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCTGTCGAGTCCTACCTCGTCTCTCTCTTCGAAGACACCAACCTCTGCGCTATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_avesiculatum -----------------------G--CGTGCC-TTTGTTG-----CC-GCCCCTGATTCTACCCCGCCGTCCCGGTTTCCACCGCTTCAACGACAACAAAGC-CGCA--GCCTCGAGGAACAT--GGCGAGA-TA-TCAAG-ATGCAATG-GCTAACCGTGTGTTTCTTTCTCAATTATAGGTTCACCTTCAGACCGGTCAGTGCGTAAGTGCTCTCATCAACC-CCGAAAAAAAACTTTCTCGAGGCCATATTCACTGACAGGAGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTTAACGAGGTGTGTA---AAAACCGCGC-CGA-GAA-CTTTC-TGTGT---CGAGG---CATAAACCCAA-CTCACACGTCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTTGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGCGCTGGTCCCTTCGGTCAGCTCTTCCGTCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCTCCTCGTAAGCAGCTTGCCTCCAAGGCTG---------------------------------------------------------------------------------------------------------------------------------CCCGCAAGTCTGCTCCTTCCACCGGAGGAGTCAAGAAGCCTCACCGCTATAAGCCTGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCCACTGAGCTCCTGATCCGCAAGCTCCCCTTCCAGCGTCTGGTAAGCATCATCGCCAC--AGTATC---ATA---CATCAATACAA--GTTGCTAACAAT----TATTCAACAGGTTCGTGAGATTGCACAGGACTTCAAGAGCGACCTCCGCTTCCAGTCTTCTGCCATTGGCGCCCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACTTGTGCGCCATCCACGCCAAGCGTGTCACTATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_clavatum -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTC?????????????????----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACT------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_colhounii_CBS_111205 -----------GCTTC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GACGAGA-TA-TCGAA-ACAAGATTTGCTGACCATGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTGTCAACT-CCAACAATA----TTATCAC---GAGATTTACTGACATATGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----AAAGC-TGCTTGGTGTA--CCCC-TATGT---CGAGA-GACGCAA-GCAAA-CTGACGC--CATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cylindrocladium_colhounii_CBS_111367 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GACGAGA-TA-TCGAA-ACAAGATTTGCTGACCATGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAATGCGTAAGTGCTCTTGTCAACT-CCAACAATA----TTATCAC---GAGATTTACTGACACATGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----AAAGC-TGCTTGGTGTA--CCCC-TATGT---CGAGA-GACGCAA-GCAAA-CTGACGC--CATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGT?GATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????-------------------------------TGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAACTC-GA-TCCA-----------------------------------AT-------CACCACGACT--GATCA-CGACTA---------------------------ACATA--CACACAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGACTTGTAAGCATACACTCATT--CAACCTG--CCTATAAATA--G-CT-------GCTCACAC-------TCAACAGGTTCGTGAGATTGCTCAGGATTTTAAGAGCGACCTTCGCTTCCAGTCCTCCGCCATCGGTGCCCTTCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGATACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_colhounii_CBS_112739 -------CATGGCTTC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GACGAGA-TA-TCGAA-ACAAGATTTGCTGACCATGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTGTCAACT-CCAACAATA----TTATCAC---GAGATTTACTGACATATGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----AAAGC-TGCTTGGTGTA--CCCC-TATGT---CGAGA-GACGGAA-CTAAA-CTGACAC--CATGT--AGGCCTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAACTC-GA-TCCA-----------------------------------AT-------CACCACGACT--GATCA-CGACTA---------------------------ACATA--CACACAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGACTTGTAAGCATACACTCATT--CAACCTG--CCTATAAATA--G-CT-------GCTCACAC-------ACAACAGGTTCGTGAGATTGCCCAGGATTTTAAGAGCGACCTTCGCTTCCAGTCCTCCGCCATCGGTGCCCTCCAGGAGTCCGTCGAGTCTTACCTAGTCTCTCTCTTCGAGGATACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_colhounii_CBS_112948 -----------------------A--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GACGAGA-TA-TCGAA-ACAAGATTTGCTGACCATGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTGTCAACT-CCAACAATA----TTATCAC---GAGATTTACTGACATATGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----AAAGC-TGCTTGGTGTA--CCCC-TATGT---CGAGA-GACGCAA-GCAAA-CTGACGC--CATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAACTC-GA-TCCA-----------------------------------AT-------CACCACGACT--GATCA-CGACTA---------------------------ACATA--CACACAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGACTTGTAAGCATACACTCATT--CAACCTG--CCTATAAATA--G-CT-------GCTCACAC-------TCAACAGGTTCGTGAGATTGCTCAGGATTTTAAGAGCGACCTTCGCTTCCAGTCCTCCGCCATCGGTGCCCTTCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGATACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_colhounii_CBS_112951 ---------TGGCTTC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GACGAGA-TA-TCGAA-ACAAGATTTGCTGACCATGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTGTCAACT-CCAACAATA----TTATCAC---GAGATTTACTGACATATGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----AAAGC-TGCTTGGTGTA--CCCC-TATGT---CGAGA-GACGCAA-GCAAA-CTGACGC--CATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????------------------AGGTTAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAACTC-GA-TCCA-----------------------------------AT-------CACCACGACT--GATCA-CGACTA---------------------------ACATA--CACACAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGACTTGTAAGCATACACTCATT--CAACCTG--CCTATAAATA--G-CT-------GCTCACAC-------ACAACAGGTTCGTGAGATTGCTCAGGATTTTAAGAGCGACCTTCGCTTCCAGTCCTCCGCCATCGGTGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGATACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_colhounii_CBS_114036 ------TCATGGCTTC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GACGAGA-TA-TCGAA-ACAAGATTTGCTGACCATGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTGTCAACT-CCAACAATA----TTATCAC---GAGATTTACTGACATATGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----AAAGC-TGCTTGGTGTA--CCCC-TATGT---CGAGA-GACGGAA-CTAAA-CTGACAC--CATGT--AGGCCTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACT?----?????-------------------------------TGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAACTC-GA-TCCA-----------------------------------AT-------CACCACGACT--GATCA-CGACTA---------------------------ACATA--CACACAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGACTTGTAAGCATACACTCATT--CAACCTG--CCTATAAATA--G-CT-------GCTCACAC-------ACAACAGGTTCGTGAGATTGCCCAGGATTTTAAGAGCGACCTTCGCTTCCAGTCCTCCGCCATCGGTGCCCTCCAGGAGTCCGTCGAGTCTTACCTAGTCTCTCTCTTCGAGGATACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGAC--------------- Cylindrocladium_colhounii_CBS_114660 ----------GGCTTC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GATGAGA-TA-TCGAA-ACAAGATTTGCTGACCATGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTATCAACT-CCAAGAATA----TTATCACGACGAGATTTACTGACAGATGCCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTATGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----AAAGC-TGCTTAGTGTA--CCCC-TATGT---CGAGA-GACGCAA-GTGAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAACTC-GA-TCCA-----------------------------------AT-------CACCACGACT--GATCA-CGACTA---------------------------ACATA--CACACAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGACTTGTAAGCATACACTCATT--CAATCTG--CCTATAAATA--G-CT-------GCTCACAC-------ACAACAGGTTCGTGAGATTGCTCAGGATTTTAAGAGCGACCTTCGCTTCCAGTCCTCCGCCATCGGTGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGATACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_colhounii_CBS_114695 -------CATGGCTTC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GATGAGA-TA-TCGAA-ACAAGATTTGCTGACCATGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTATCAACT-CCAAGAATA----TTATCACGACGAGATTTACTGACAGATGCCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTATGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----AAAGC-TGCTTAGTGTA--CCCC-TATGT---CGAGA-GACGCAA-GTGAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAACTC-GA-TCCA-----------------------------------AT-------CACCACGACT--GATCA-CGACTA---------------------------ACATA--CACACAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGACTTGTAAGCATACACTCATT--CAATCTG--CCTATAAATA--G-CT-------GCTCACAC-------ACAACAGGTTCGTGAGATTGCTCAGGATTTTAAGAGCGACCTTCGCTTCCAGTCCTCCGCCATCGGTGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGATACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_colhounii_CBS_114704 -----------GCTTC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GATGAGA-TA-TCGAA-ACAAGATTTGCTGACCATGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTATCAACT-CCAAGAATA----TTATCACGACGAGATTTACTGACAGATGCCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTATGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----AAAGC-TGCTTAGTGTA--CCCC-TATGT---CGAGA-GACGCAA-GTGAA-CTGACAC--CATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAACTC-GA-TCCA-----------------------------------AT-------CACCACGACT--GATCA-CGACTA---------------------------ACATA--CACACAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGACTTGTAAGCATACACTCATT--CAATCTG--CCTATAAATA--G-CT-------GCTCACAC-------ACAACAGGTTCGTGAGATTGCTCAGGATTTTAAGAGCGACCTTCGCTTCCAGTCCTCCGCCATCGGTGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGATACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_colhounii_CBS_293.79 ------TCATGGCTTC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GACGAGA-TA-TCGAA-ACAAGATTTGCTGACCATGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTGTCAACT-CCAACAATA----TTATCAC---GAGATTTACTGACATATGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----AAAGC-TGCTTGGTGTA--CCCC-TATGT---CGAGA-GACGCAA-CTAAA-CTGACAC--CATGT--AGGCCTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----TACTAAGCAGACCGCCCGCAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAACTC-GA-TCCA-----------------------------------AT-------CACCACGACT--GATCA-CGACTA---------------------------ACATA--CACACAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGACTTGTAAGCATACACTCATT--CAACCTG--CCTATAAATA--G-CT-------GCTCACAC-------ACAACAGGTTCGTGAGATTGCTCAGGATTTTAAGAGCGACCTTCGCTTCCAGTCCTCCGCCATCGGTGCCCTCCAGGAGTCTGTTGAGTCTTACCTCGTCTCTCTCTTCGAGGATACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCTCGCCCGC Cylindrocladium_colhounii_CPC_1237 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GACGAGA-TA-TCGAA-ACAAGATTTGCTGACCATGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTCTTGTCAACT-CCAACAATA----TTATCAC---GAGATTTACTGACATATGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----AAAGC-TGCTTGGTGT---CCCC-TATGT---CGAGA-GACGCAA-CTAAA-CTGACAC--CATGT--AGGCCTTCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCTGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAACTC-GA-TCCA-----------------------------------AT-------CACCACGACT--GATCA-CGACTA---------------------------ACATA--CACACAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGACTTGTAAGCATACACTCATT--CAACCTG--CCTATAAATA--G-CT-------GCTCACAC-------ACAACAGGTTCGTGAGATTGCCCAGGATTTTAAGAGCGACCTTCGCTTCCAGTCCTCCGCCATCGGTGCCCTCCAGGAGTCCGTCGAGTCTTACCTAGTCTCTCTCTTCGAGGATACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_colhounii_CPC_681 -----------------------G--CGTGCC-TTTGTTG-----CT-GACCCTGATTCTACCCCGACGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GACGAGA-TA-TCGAA-ACAAGATTTGGTGACCATGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTGTTAACT-CCAACAATA----TTATCAC---GAGATTTACTGACATATGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----AAAGC-TGCTTGGTGTA--CCCT-TATGT---CGAGA-GACGCAA-GTAAA-CTGACAC--CATGT--AGGCCTTCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTTCATCTTGAGCCCCGTACCATGGATGCCGTCCGTGCCGGTCCTTTTTGTTAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAACTC-GA-TCCA-----------------------------------AT-------CACCACGACT--GATCA-CGACTA---------------------------ACATA--CACACAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGACTTGTAAGCACACACTCATT--CAACCTG--CCTATAAATA--G-CT-------GCTCACAC-------ACAACAGGTTCGTGAGATTGCTCAGGATTTTAAGAGCGACCTTCGCTTCCAGTCCTCCGCCATCGGTGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGATACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_colhounii_CPC_705 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GACGAGA-TA-TCGAA-ACAAGATTTGCTGACCATGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTCTTGTCAACT-CCAACAATA----TTATCAC---GAGATTTACTGACATATGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----AAAGC-TGCTTGGTGTA--CCCC-TATGT---CGAGA-GACGCAA-CTAAA-CTGACAC--CATGT--AGGCCTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAACTC-GA-TCCA-----------------------------------AT-------CACCACGACT--GATCA-CGACTA---------------------------ACATA--CACACAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGACTTGTAAGCATACACTCATT--CAACCTG--CCTATAAATA--G-CT-------GCTCACAC-------ACAACAGGTTCGTGAGATTGCCCAGGATTTTAAGAGCGACCTTCGCTTCCAGTCCTCCGCCATCGGTGCCCTCCAGGAGTCCGTCGAGTCTTACCTAGTCTCTCTCTTCGAGGATACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_curvisporum_CPC_763 -----------------------G--CGTGCC-TTTGTT------CT-GCCCCTGATTCTACCCCCCCGCCCCGGTTTCGACCGCTTCGACAACAACAAAGC-TCGA--CGACC-CCAAGCAC--GATGTGA-TATCGGAGGACAAGGTT-GCTGACTATAT--TTCTTTCTCAATTCTAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTGATCATTCCAGCTTCCAAAAA--------CTGCCCTGAGGATTCACTAACATTCGCGATCAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGACCTCCAGTTGGAGCGCATGAACGTCTACTTCAACGAGGTATGTG---GTTAAAATA--AAACGC--TCGCC--TGGTCGAAAAACTTGTGC---ACAAA-CTCACAC--GATAC--AGGCTTCCGGCAACAAGTATGTCCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGA----------?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTACACT--CA-CAGA-----------------------------------ATACTGGCG-ACACATG-------CTGACATCA---------------------------AT-----CCAATAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACTGAGCTGCTTATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCACACCC---CAAACATC----------ACCATA-A-CAT-CAGGCGCTAATCA-------GAAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTTCGCTTCCAGTCATCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGTCCTACCTCGTCTCTCTTTTCGAGGACACCAACCTCTGCGCTATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_curvisporum_CPC_765 -----------------------G--CGTGCC-TTTGTT------CT-GCCCCTGAGCGTACCCCCCCGCCCCGGTTTCGACCGCTTCGACAACAACAAAGC-TCGA--CGACC-CCAAGCAC--GATGTGA-TATCGGAGGACAAGGTT-GCTGACTATAT--TTCTTTCTCAATTCTAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTGATCATTCCAGCTTCCAAAAA--------CTGCCCTGAGGATTCACTAACATTCGCGATCAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGACCTCCAGTTGGAGCGCATGAACGTCTACTTCAACGAGGTATGTG---GTTAAAATA--AAACGC--TCGCC--TGGTCGAAAAACTTGTGC---ACAAA-CTCACAC--GATAC--AGGCTTCCGGCAACAAGTATGTCCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGA----------?????-------------------------------TGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTACACT--CA-CAGA-----------------------------------ATACTGGCG-ACACATG-------CTGACATCA---------------------------AT-----CCAATAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACTGAGCTGCTTATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCACACCC---CAAACATC----------ACCATA-A-CAT-CAGGCGCTAATCA-------GAAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTTCGCTTCCAGTCATCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGTCCTACCTCGTCTCTCTTTTCGAGGACACCAACCTCTGCGCTATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGAC--------------- Cylindrocladium_ecuadoriae_CBS_111383 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GGCGAGA-TA-TCAGA-CCAAGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTAT---CAACT-CCAACAAGA----TTCTCACGACGAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGTA-GTCCC-CTGAC---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACT------------------------------------AC---TTCA-TCGCATTC---GACATCCAACTA---------------------------ACAAC--ACTGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCTCTCAT-------CAACTC---AACGCGATCAG-C-CA--CAGCCACTAACAA-------GTAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCTAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_ecuadoriae_CBS_111393 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTAT---CAACT-CCAACAAGA----TTATCACGACAAGATTCACTGACAGTTATCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGTA-TTCCC-CTGAC---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACT------------------------------------AC---TTCA-TCGCATTT---GACATTCCACTA---------------------------ACAAC--ACTGTAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCTCTCAT-------CAACTC---ACCGCGATCAG-C-CA--CAGCCACTAACAA-------GCAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCTCTTCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_ecuadoriae_CBS_111394 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTAT---CAACT-CCAACAAGA----TTATCACGACAAGATTCACTGACAGTTATCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGTA-TTCCC-CTGAC---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACT------------------------------------AC---TTCA-TCGCATTT---GACATTCCACTA---------------------------ACAAC--ACTGTAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCTCTCAT-------CAACTC---ACCGCGATCAG-C-CA--CAGCCACTAACAA-------GCAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCTCTTCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_ecuadoriae_CBS_111406 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTAT---CAACT-CCAACAAGA----TTCTCACGACAAGATTCACTGACAGTTATCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGTA-TTCCC-CTGAC---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACT------------------------------------AC---TTCA-TCGCATTT---GGCATTCCACTA---------------------------ACAAC--ACTGTAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCTCTCAT-------CAACTC---ACCGCGATCAG-C-CA--CAGCCACTAACAA-------GCAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCTCTTCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_ecuadoriae_CBS_111412 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTAT---CAACT-CCAACAAGA----TTCTCACGACAAGATTCACTGACAGTTATCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGTA-TTCCC-CTGAC---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACT------------------------------------AC---TTCA-TCGCATTT---GGCATTCCACTA---------------------------ACAAC--ACTGTAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCTCTCAT-------CAACTC---ACCGCGATCAG-C-CA--CAGCCACTAACAA-------GCAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCTCTTCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_ecuadoriae_CBS_111425 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTAT---CAACT-CCAACAAGA----TTCTCACGACAAGATTCACTGACAGTTATCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGTA-TTCCC-CTGAC---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACT------------------------------------AC---TTCA-TCGCATTT---GACATTCCACTA---------------------------ACAAC--ACTGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCTCTCAT-------TAACTC---ACCGCGATCAA-C-CA--CAGCCACTAACAA-------GCAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCTCTTCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_flexuosum_CBS_112675 -----------------------?--??????-TTTGTTG-----CT-GCCCCTGAATCTACCCCGCCGCCC-GGTTTCCACCGCTCCGACGACAACAAAGC-CGTA--GCCTC-ACGAATAT--GGCGAGA-TA-CCAGA-ACAAGATT-GCTAACCATGTGCTTATTTCTCGGTTATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTACTCTTCTCAACT-CCAACAAAA----TTCTCATGACGAGATTTACTGACGGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAA-CATAA-ACAAA-CTCACAC--CATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----TACTAAGCAGACCGCCCGCAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CA-ACT------------------------------------AC--TTACA--CACAATC---GACATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTTATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATCTCTG--CCA-CATTAT-CCACCACACACCG-C-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCCGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTTACCATTCAGTCCAAGGACATCCAGCTCGCCCGC Cylindrocladium_flexuosum_CBS_112676 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCC-GGTTTCCACCGCTCCGACGACAACAAAGC-CGTA--GCCTC-ACGAATAT--GGCGAGA-TA-CCAGA-ACAAGATT-GCTAACCATGTGCTTATTTCTCGGTTATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTACTCTTCTCAACT-CCAACAAAA----TTCTCATGACGAGATTTACTGACGGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAA-CATAA-ACAAA-CTCACAC--CATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----TACTAAGCAGACCGCCCGCAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CA-ACT------------------------------------AC--TTACA--CACAATC---GACATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTTATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATCTCTG--CCA-CATTAT-CCACCACACACCG-C-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCCGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTTACCATTCAGTCCAAGGACATCCAGCTCGCCCGC Cylindrocladium_flexuosum_CBS_114557 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGTA--GCCTC-ACGAATAT--GGCGAGA-TA-CCAGA-ACAAGATT-GCTAACCATGTGCTTATTTCTCGATTATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTACTCTTCTCAACT-CCAACAAAA----TTCTCATGACGAGATTTACTGACGGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAA-CATAA-ACAAA-CTCACAC--CATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CA-ACT------------------------------------AC--TTACA--CACAATC---GACATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTTATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATCTCCG--CCA-CATTAT-CCACCACACACCG-C-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCCGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTTACCATTCAGTCCAAGGACATCCAGCT------- Cylindrocladium_flexuosum_CBS_114666 ------TCAGAGCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCC-GGTTTCCACCGCTCCGACGACAACAAAGC-CGTA--GCCTC-ACGAATAT--GGCGAGA-TA-CCAGA-ACAAGATT-GCTAACCATGTGCTTATTTCTCGATTATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTACTCTTCTCAACT-CCAACAAAA----TTCTCATGACGAGATTTACTGACGGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAA-CATAA-ACAAA-CTCACAC--CATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCG-----------?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CA-ACT------------------------------------AC--TTACA--CACAATC---GACATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTTATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATCTCCG--CCA-CATTAT-CCACCACACACCG-C-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCCGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTTACCATTCAGTCCAAGGACATCCAGCT------- Cylindrocladium_flexuosum_CPC_11347 ------TCAGAGCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCC-GGTTTCCACCGCTCCGACGACAACAAAGC-CGTA--GCCTC-ACGAATAT--GGCGAGA-TA-CCAGA-ACAAGATT-GCTAACCATGTGCTTATTTCTCGGTTATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTACTCTTCTCAACT-CCAACAAAA----TTCTCATGACGAGATTTACTGACGGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAA-CATAA-ACAAA-CTCACAC--CATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGA----------?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CA-ACT------------------------------------AC--TTACA--CACAATC---GACATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTTATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATCTCTG--CCA-CATTAT-CCACCACACACCG-C-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCCGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTTACCATTCAGTCCAAGGACATCCAGCT------- Cylindrocladium_flexuosum_CPC_11348 ------TCAGAGCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCC-GGTTTCCACCGCTCCGACGACAACAAAGC-CGTA--GCCTC-ACGAATAT--GGCGAGA-TA-CCAGA-ACAAGATT-GCTAACCATGTGCTTATTTCTCGGTTATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTACTCTTCTCAACT-CCAACAAAA----TTCTCATGACGAGATTTACTGACGGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAA-CATAA-ACAAA-CTCACAC--CATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGA----------?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CA-ACT------------------------------------AC--TTACA--CACAATC---GACATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTTATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATCTCTG--CCA-CATTAT-CCACCACACACCG-C-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCCGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTTACCATTCAGTCCAAGGACATCCAGCT------- Cylindrocladium_flexuosum_CPC_11349 ------TCAGAGCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCC-GGTTTCCACCGCTCCGACGACAACAAAGC-CGTA--GCCTC-ACGAATAT--GGCGAGA-TA-CCAGA-ACAAGATT-GCTAACCATGTGCTTATTTCTCGGTTATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTACTCTTCTCAACT-CCAACAAAA----TTCTCATGACGAGATTTACTGACGGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAA-CATAA-ACAAA-CTCACAC--CATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCG-----------?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CA-ACT------------------------------------AC--TTACA--CACAATC---GACATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTTATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATCTCTG--CCA-CATTAT-CCACCACACACCG-C-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCCGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTTACCATTCAGTCCAAGGACATCCAGCT------- Cylindrocladium_flexuosum_CPC_11350 ------TCAGAGCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCC-GGTTTCCACCGCTCCGACGACAACAAAGC-CGTA--GCCTC-ACGAATAT--GGCGAGA-TA-CCAGA-ACAAGATT-GCTAACCATGTGCTTATTTCTCGGTTATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTACTCTTCTCAACT-CCAACAAAA----TTCTCATGACGAGATTTACTGACGGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAA-CATAA-ACAAA-CTCACAC--CATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCG-----------?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CA-ACT------------------------------------AC--TTACA--CACAATC---GACATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTTATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATCTCTG--CCA-CATTAT-CCACCACACACCG-C-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCCGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTTACCATTCAGTCCAAGGACATCCAGCT------- Cylindrocladium_flexuosum_CPC_11351 ------TCAGAGCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCC-GGTTTCCACCGCTCCGACGACAACAAAGC-CGTA--GCCTC-ACGAATAT--GGCGAGA-TA-CCAGA-ACAAGATT-GCTAACCATGTGCTTATTTCTCGGTTATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTACTCTTCTCAACT-CCAACAAAA----TTCTCATGACGAGATTTACTGACGGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAA-CATAA-ACAAA-CTCACAC--CATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCG-----------?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CA-ACT------------------------------------AC--TTACA--CACAATC---GACATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTTATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATCTCTG--CCA-CATTAT-CCACCACACACCG-C-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCCGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTTACCATTCAGTCCAAGGACATCC----------- Cylindrocladium_flexuosum_CPC_11352 ------TCAGAGCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCC-GGTTTCCACCGCTCCGACGACAACAAAGC-CGTA--GCCTC-ACGAATAT--GGCGAGA-TA-CCAGA-ACAAGATT-GCTAACCATGTGCTTATTTCTCGGTTATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTACTCTTCTCAACT-CCAACAAAA----TTCTCATGACGAGATTTACTGACGGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAA-CATAA-ACAAA-CTCACAC--CATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGA----------?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CA-ACT------------------------------------AC--TTACA--CACAATC---GACATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTTATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATCTCTG--CCA-CATTAT-CCACCACACACCG-C-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCCGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTTACCATTCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gordoniae -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGTCCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCAGG-ACGAGATT-GCTAACCGTGTGCTTCTTTCTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCAACT-CCAACAAAA----TTATCACGACGAGATTCGCTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAATGTCTACTTCAACGAGGTATGTG---AAAACCACGT--GGTGCAACCCCC-TTGGC---CGAGAAG-CACAA-GCAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGCCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTCAACA--CT-ACT------------------------------------C----TAACATCATCCCC---ATCATCACACTG---------------------------ACATC--AAC-CAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACACTT---CATCATGCACATCAC-----TTCCAACAA--CAGTCGCTAATAC-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCTCTCCAGGAGTCCGTAGAGTCCTACCTCGTCTCTCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_110676 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGATGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTT----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_111129 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_111382 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTT----?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cylindrocladium_gracile_CBS_111390 ----------AGCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-------------------------------TGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_111456 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_111458 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-ATCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_111465 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-ATCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_111468 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_111474 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_111475 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCACGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCGCAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_111476 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_111478 -----------GCTTC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-ATCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_111869 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CACA--GCCTC-ACGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGATGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAAC??----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_112673 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CACA--GCCTC-ACGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGATGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----TACTAAGCAGACCGCCCGCAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCTCGCCCGC Cylindrocladium_gracile_CBS_112694 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCACGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_114167 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-ATCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_114171 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_115680 ---------------C-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCC?????????----?????---------------------------CCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_gracile_CBS_115769 ---------------C-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTCCGACGACAACAAAGC-CGCA--GCCTC-ACGAGCAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTAACCATGTCCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATATTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTGAT---CGAGAAG-CACAA-GCAAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCA?????????????????????----?????---------------------------CCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACC------------------------------------AC--TTCCA--TCTAATC---GACATCACACTG---------------------------ACATC--AACGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTTGCT--CCA-TCACGC---ATCGCCCACAG-T-CA--CAGTCACTAACCA-------ACAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_graciloideum_CBS_111040 -----------GCTACCTGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGAAAACAAGGC-CGCA--GCCTC-AAGAACAT--GACGAGA-TA-TCAGA-ACAAGATT-GCTGACCATGTGCTTCTTTCTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCAACAAAA----TTCTCGCGGCCAGATTCGCTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACAG--AGTACT-TCG---TTTGT---CGGGAAG-ATCAA-GCGAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTGGCTTCCAAGGCTGGTGAGTGA-CT--CC-ATC-------------------------------------G---CTTC-CAA-CATCC--AACATCACACTG---------------------------ACATT--CAGACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTCCC--CCCGTTCATCA---TCGC--ATCGAATCACA-GAC--ACTAACAG-------ATCACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCCTACCTCGTCTCTCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_graciloideum_CBS_111141 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGAAAACAAGGC-CGCA--GCCTC-AAGAACAT--GACGAGA-TA-TCAGA-ACAAGATT-GCTGACCATGTGCTTCTTTCTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCAACAAAA----TTCTCGCGGCCAGATTCGCTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACAG--AGTACT-TCG---TTTGT---CGGGAAG-ATCAA-GCGAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTGGCTTCCAAGGCTGGTGAGTGA-CT--CC-ATC-------------------------------------G---CTTC-CAA-CATCC--AACATCACACTG---------------------------ACATT--CAGACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTCCC--CCCGTTCATCA---TCGC--ATCGAATCACA-GAC--ACTAACAG-------ATCACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCCTACCTCGTCTCTCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_graciloideum_CBS_115674 -----------------------A--CGTGCC-TTGGTTG-----CT-GCCCCTGATTCTACCCCGCCGTCCCGGTTTCCACCGCTTCGACGAAAACAAGGC-CGCA--GCCTC-AAGAACAT--GACGAGA-TA-TCAGA-ACAAGATT-GCTGACCATGTGCTTCTTTCTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCAACAAAA----TTCTCGCGGCCAGATTCGCTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACAG--AGTACT-TCG---TTTGT---CGGGAAG-ATCAA-GCGAA-CTCACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTT----?????---------------------------CCACTGGTGGCAAGGCCCCCCGCAAGCAGCTGGCTTCCAAGGCTGGTGAGTGA-CT--CC-ATC-------------------------------------G---CTTC-CAA-CATCC--AACATCACACTG---------------------------ACATT--CAGACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATTCCC--CCCGTTCATCA---TCGC--ATCGAATCACA-GAC--ACTAACAG-------ATCACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCCTACCTCGTCTCTCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAATGACATCCAGCT------- Cylindrocladium_hawksworthii -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCACCTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GATGTGA-TA-TCAGA-ACAAGATT-GCTAACCGTGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTT--CAACT-CCAACAAAA----TTCTCACGACCAGATTCACTGACAGTTATCGACAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGTGTA-CTCAC----GC---CGAGAGG-CACAA-GCAAA-CTGACAC--TATGT--AGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ACT------------------------------------A----CTTCATCACAATC---GACATCACACTG---------------------------ACATC--GATACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCACACAT---CCACTGTAACACATC-----AAGCGACAT--C---TGCTAATGC-------ATCACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGCGCCCTCCAGGAGTCTGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTCTGCGCTATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_hurae_CBS_114182 -----------GCTCTATGAGACGAGCGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAGCAAAGC-CGCG--TCCTC-ATGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTGACTATGTGCTTCTTTCTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCAACAAAA----TTCTCCCGGCGAGATTTACTGACATGTTTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTTCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTT---CAAACCACAC--GACCTA-CTCCC--TCAT---ACCAGCAGTATGA-GAAAA-CTCACAT--CATGT--AGGCCTCTGGCAACAAGTTCGTCCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTC-TCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTAAACC--AC-ATC------------------------------------AC---ATCA-ACACACCCAGTATCAGCATACTG---------------------------ACAAT--GGCATAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTTATCCGCAAGCTCCCCTTCCAGCGCCTCGTAAGCACTCACCTCACTCACATC--ACCT-----GTCGATGCA--CAGCCACTAACCA-------ATAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCCCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGATACCAACCTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_hurae_CBS_114551 -----------------------?--???GCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCG?TTTGACGACAGCAAA{AG}C-CGCG--TCCTC-ATGAACAT--GGCGAGA-TA-TCAGA-ACAAGAT?-GCTGACTATGTGCTTCTTTCTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCAACAAAA----TTCTCCCGGCGAGATTTACTGACATGTTTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTTTACGCCGGTACCTCCGAGCTTCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTT---CAAACCACAC--GACCTA-CTCCC--TCAT---ACCAGCAGTATGA-GAAAA-CTCA-----CATGT--AGGCCTCTGGCAACAAGTTCGTCCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCG???????----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTAAACC--AC-ATC------------------------------------AC---ATCA-ACACACCCAGTATCAGCATACTG---------------------------ACAAT--GGCATAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTTATCCGCAAGCTCCCCTTCCAGCGCCTCGTAAGCACTCACCTCACTCACATC--ACCT-----GTCGATGCA--CAGCCACTAACCA-------ATAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCCCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGATACCAACCTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_hurae_FTCC_1002 -----------------------G--CGGGC?-TTTGTTG-----TT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAGCAAAGC-CGCG--TCCTC-ATGAACAT--GGCGAGA-TA-TCAGA-ACAAGATT-GCTGACTATGTGCTTCTTTCTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCAACAAAA----TTCTCCCGGCGAGATTTACTGACATGTTTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGT?TACGCCGGTACCTCCGAGCTTCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTT---CAAACCACAC--GACCTA-CTCCC--TCAT---ACCAGCAGTATGA-GAAAA-CTCA-----CATGT--AGGCCTCTGGCAACAAGTTCGTCCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGCATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTAAACC--AC-ATC------------------------------------AC---ATCA-ACACACCCAGTATCAGCATACTG---------------------------ACAAT--GGCATAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTTATCCGCAAGCTCCCCTTCCAGCGCCTCGTAAGCACTCACCTCACTCACGTC--ACCT-----GTCGATGCA--CAGCCACTAACCA-------ATAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCCCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGATACCAACCTGTGCGCCATCCACGCCAAGCGTGTCACCATC--------------------------- Cylindrocladium_hurae_FTCC_1003 -----------------------G--CGTGCC-TTTGCTG-----CT-GCCCCTGATACTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAGCAAAGC-CGCG--TCCTC-ATGAACGT--GGCGAGA-TA-TCACA-ACAAGATT-GCTGACTATGTGCTTCTTTCTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-ACAACAAAA----TTCTCGCGGCAAGATTTACTGACATGTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCAACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTTCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTTTGTA---AAAACCACAC--GAACTA-CTTCC--TTAT---ACCAGCAGTATGA-GAAAA-CTCA-----C-TGT--GGGCCTCTGGCAACAAGTTCGTCCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTAAACC--AC-ATC------------------------------------AC---ATCA-ACACACCCAGTATCAGCATACTG---------------------------ACAAT--GGCATAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTTATCCGCAAGCTCCCCTTCCAGCGCCTCGTAAGCACTCACCTCACTCACGTC--ACCT-----GTCGATGCA--CAGCCACTAACCA-------ATAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCCCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGATACCAACCTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_macroconidiale_CBS_114880 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--TCCTC-ACGAACAT--GGCGAGA-TA-TCGGA-ACAAGATTTGCTGACCATGTGCTTCTTTCTCAACTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCGACAATA----TTATCACGGCGAGGTTTACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----AAACCCATCTGATCTGA--CCCC-TTCGT---CGATA-GGCACAAAGTAAA-CTGACACGCTATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCTAAGGCTGGTGAGTGAACTC-CA-GCAA-----------------------------------CAT------CACACCCT----GATTGCCACTGA---------------------------CACTC---GCGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTTCAGCGTCTCGTAAGCATAGCTCCACC--CGATCAA--CGCACGCATC--GACA----GTTGCTAATAA-------ATCACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCTTCTGCCATCGGTGCCCTTCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTTTTCGAGGATACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACTATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_macroconidiale_CPC_413 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--TCCTC-ACGAACAT--GGCGAGA-TA-TCGGA-ACAAGATTTGCTGACCATGTGCTTCTTTCTCAACTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCGACAATA----TTATCACGGCGAGGTTTACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----AAACCCATCTGATCTGA--CCCC-TTCGT---CGATA-GGCACAA-GTAAA-CTGACACGCTATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCTAAGGCTGGTGAGTGAACTC-CA-GCAA-----------------------------------CAT------CACACCCT----GATTGCCACTGA---------------------------CACTC---GCGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTTCAGCGTCTCGTAAGCATAGCTCCACC--CGATCAA--CGCACGCATC--GACA----GTTGCTAATAA-------ATCACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGATCTCCGCTTCCAGTCTTCTGCCATCGGTGCCCTTCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTTTTCGAGGATACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACTATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_madagascariense_CBS_114539 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCGGA-ACAAGATT-GCTGACCATGTGCTTCTTTCTCAACTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCAAGA-------TTCTCACCACGGGATTTACTGACAGCTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGT?TGAACGT?TACTTCAACGAGGTATGTG----GAGGC-TACCTGGTGCA-CCCCC-TTTGC---CGAGA-GGCACAA-ACAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAG{AC}TCTTCCG?CCCGACAACTT----?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cylindrocladium_madagascariense_CBS_114571 ----------GACTTC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCGGA-ACAAGATTTGCTGACCATGTGCTTCTTTCTCAACTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCAAGA-------TTCTCACCACGGGATTTACTGACAGCTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----GAGGC-TACCTGGTGCA-CCCCC-TTTGC---CGAGA-GGCACAA-ACAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGT-----TC-ATC------------------------------------AT---CGCA-AC--ATCC---CGTCAACCACTA---------------------------ACACA--TACATAGCCCGCAAGAGCGCCCCTTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATCCGACGATACCAGAAGTCGACTGAGCTTCTCATCCGCAAGCTCCCATTCCAGCGTCTCGTAAGCACACCCCCAAT--TAAA-----CGG----GCACATGAAC--AGTTACTAACGC-------ACCGCAGGTTCGTGAGATTGCCCAGGATTTCAAGAGCGATCTCCGCTTCCAGTCCTCCGCCATCGGCGCCCTGCAGGAGTCTGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCACTATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_madagascariense_CBS_114572 ----------GACTTC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCGGA-ACAAGATTTGCTGACCATGTGCTTCTTTCTCAACTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCAAGA-------TTCTCACCACGGGATTTACTGACAGCTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----GAGGC-TACCTGGTGCA-CCCCC-TTTGC---CGAGA-GGCACAA-ACAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGT-----TC-ATC------------------------------------AT---CGCA-AC--ATCC---CGTCAACCACTA---------------------------ACACA--TACATAGCCCGCAAGAGCGCCCCTTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATCCGACGATACCAGAAGTCGACTGAGCTTCTCATCCGCAAGCTCCCATTCCAGCGTCTCGTAAGCACACCCCCAAT--TAAA-----CGG----GCACGTGAAC--AGTTACTAACGC-------ACCGCAGGTTCGTGAGATTGCCCAGGATTTCAAGAGCGATCTCCGCTTCCAGTCCTCCGCCATCGGCGCCCTGCAGGAGTCTGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCACTATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_madagascariense_CPC_2322 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGACCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACGT--GACGAGA-TA-TCGGA-ACAAGATT-GCTGACCATGTGCTTCTTTCTCAACTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-TCGATA-------TTCTCACGACGAGATTTACTGACAGCTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGCCTAGACAGCAATGGTGTCTACGCTGGTACCTCTGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG----GAAAC-TGCCTGGTGCA-TCCCC-TTGGC---CGAGA-GGCACAA-ACAAA-CTGACACACCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGT?GATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTC?G?CCCGACAACTT----?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cylindrocladium_multiseptatum_CBS_112682 ------TCGTGGCTTC-TGAGACG--AGTGCC-TTTGTTGCTTTGCT-GCCCCTGATTCTACCCCGCGGCCCCGGTTTCCACCGCTCCGACGAAAACAAAGC-CGCA--ACCTC-ACGAATGT--GACGAGA-TA-TCAGA-ACAAGATT-GCTAACCTTGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTCCTCTCGACT-CCAACGATA----TTCTTATGACAAGATTCACTGACAGTTTTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAATCATGA---GTGCG-CTCGC-TTTGT---GGAGAAA-CATAG-TCAAA-CTGACACACCATGTGTAGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTTGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCC?????????----?????----------------------TAGGTCCACTGGTGGCAAGGCTCCTCGCAAGCAGCTTGCCTCCAAGGCTGGTAAGTAACCT--CC-AAC------------------------------------AC---TGTT---GCCCA----GACAC--GACTA---------------------------ACACAAATGTACAGCCCGCAAGAGTGCACCCTCCACGGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCCACCGAGCTTCTCATTCGCAAGCTCCCTTTCCAGCGTCTCGTAAGTGAAAAT-----GCACATGCAA-ATCGCGCCGCA-GCCC--CAGCCGCTAATGC-------ACCACAGGTCCGTGAGATTGCTCAGGATTTCAAGAGCGACCTCCGCTTCCAGTCATCTGCCATCGGTGCTCTTCAGGAGTCCGTTGAGTCTTATCTCGTCTCTCTCTTCGAGGACACTAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_multiseptatum_CPC_1602 -----------------------G--AGTGCC-TTTGTTGCTTTGCT-GCCCCTGATTCTACCCCGCGGCCCCGGTTTCCACCGCTCCGACGAAAACAAAGC-CGCA--ACCTC-ACGAATGT--GACGAGA-TA-TCAGA-ACAAGATT-GCTAACCTTGTGCTTCTTTCTCGATTATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTCCTCTCGACT-CCAACGATA----TTCTTATGACAAGATTCACTGACAGTTTTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGCG--AAAAATCATGA---GTGCG-CTCGC-TTTGT---GGAGAAA-CATAG-TCAAA-CTGACACACCATGTGTAGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTTGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cylindrocladium_penicilloides -----------------------G--CGTGCCTTTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCGACCGCC-CGACGACAGAACAGC-TCGG--CGGCT-TCAGGCAT--GATGTGA-TGGACGAGGACAAGATT-GCTGACCAAGT--TTCTT-CTCAATTCTAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTCTTCAC--CAACGCCCAA-TT------CTCTCCCAAGGAGATTCGCTCACAATCACAAACAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGATCTCCAGCTGGAGCGCATGAGCGTCTACTTCAACGAGGTATGTA--GAGAAGCCCCA-TTGGGAA-AAC-----TGAT---GA--AATCTCA--CACACGCT--------ACTC--AGGCTTCCGGCAACAAGTATGTCCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCCTTCGGTCAGCTCTTCCGTCCCGACAACTT----?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cylindrocladium_pseudogracile_AR2677 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACAACAACAAAGC-CGCT--GCCTC-ACGAACAT--GGCAAGA-TA-TCAGA-ACAAGATT-GCTAACCGTTTGCTTCTTTTTCGATCATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATCTTCTCAACT-CCAACAAAA----TTCTCACGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAACTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTACGTG---AAAACCACAC--GGAGTA-CTCCCGTTGC----CCAGAAG-CACAA-GCAAA-CTCACACATCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATC--CG-ACT------------------------------------TC---ATCA-TCA-CTTC---CACATCCCACTG---------------------------ACATC--ATCATAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACTGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCACTTGC---CTTTACCTATTCCACC-----TCCACCCA--CAGCCACTAACAA-------TTACCAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTTCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pseudogracile_CBS_111284 -----------GCTCT-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACAACAACAAAGC-CGCT--GCCTC-ACGAACAT--GGCAAGA-TA-TCAGA-ACAAGATT-GCTAACCGTTTGCTTCTTTTTCGATCATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATCTTCTCAACT-CCAACAAAA----TTCTCACGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAACTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTACGTG---AAAACCACAC--GGAGTA-CTCCCGTTGC----CCAGAAG-CACAA-GCAAA-CTCACACATCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATC--CG-ACT------------------------------------TC---ATCA-TCA-CTTC---CACATCCCACTG---------------------------ACATC--ATCATAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACTGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCACTTGC---CTTTACCTATTCCACC-----TCCACCCA--CAGCCACTAACAA-------TTACCAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTTCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pseudogracile_CBS_114454 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACAACAACAAAGC-CGCT--GCCTC-ACGAACAT--GGCAAGA-TA-TCAGA-ACAAGATT-GCTAACCGTTTGCTTCTTTTTCGATCATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGATCTTCTCAACT-CCAACAAAA----TTCTCACGACAAGATTCACTGACAGTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAACTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTACGTG---AAAACCACAC--GGAGTA-CTCCCGTTGC----CCAGAAG-CACAA-GCAAA-CTCACACATCATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATC--CG-ACT------------------------------------TC---ATCA-TCA-CTTC---CACATCCCACTG---------------------------ACATC--ATCATAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACTGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCACTTGC---CTTTACCTATTCCACC-----TCCACCCA--CAGCCACTAACAA-------TTACCAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTTCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pteridis_CBS_111778 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCAGA-ACGAGATC-GCTAACCGTGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGACT-CCAGCAAGA----TTTTCACGACGAGATTCGCTGACAGTTGTCAATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTTAC---CGGGAAG-CACAA-GCAAA-CTGACAC--GCCGTGCAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTCAACA--CC-ACA------------------------------------C----TGACAACATTTCC---ATCATCACACTG---------------------------ACATC--AACATAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACACAG---CATCACGAAAAGTGC-----CTCCGAGAA--CAACCACTAACAC-------ATAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pteridis_CBS_111793 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCAGA-ACGAGATC-GCTAACCGTGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGACT-CCAACAAGA----TTTTCACGACCAGATTCGCTGACAGTTGTCAATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTTAC---CGGGAAG-CACAA-GCAAA-CTGACAC--GCCGTGCAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTCAACA--CC-ACA------------------------------------C----TGACAACATTTCC---ATCATCACACTG---------------------------ACGTC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACACAT---CATCACGAAAAGTGC-----CTCCGAGAA--CAACCACTAACAC-------ATAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pteridis_CBS_111867 -----------GCTCC-CGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCAGA-ACGAGATC-GCTAACCGTGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGACT-CCAGCAAGA----TTTTCACGACGAGATTCGCTGACAGTTGTCAATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTTAC---CGGGAAG-CACAA-GCAAA-CTGACAC--GCCGTGCAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTTCTTTCGGTCAGCTCTTCCGTCCCGA----------?????-------------------------------TGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTCAACA--CC-ACA------------------------------------C----TGACAACATTTCC---ATCATCACACTG---------------------------ACATC--AACATAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACACAG---CATCACGAAAAGTGC-----CTCCGAGAA--CAACCACTAACAC-------ATAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pteridis_CBS_111871 -----------GCTCC-CGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCAGA-ACGAGATC-GCTAACCGTGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGACT-CCAGCAAGA----TTTTCACGACGAGATTCGCTGACAGTTGTCAATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTTAC---CGGGAAG-CACAA-GCAAA-CTGACAC--GCCGTGCAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTCAACA--CC-ACA------------------------------------C----TGACAACATTTCC---ATCATCACACTG---------------------------ACATC--AACATAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACACAG---CATCACGAAAAGTGC-----CTCCGAGAA--CAACCACTAACAC-------ATAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pteridis_CPC_11284 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCAGA-ACGAGATC-GCTAACCGTGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGACT-CCAGCAAGA----TTTTCACGACGAGATTCGCTGACAGTTGTCAATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTTAC---CGGGAAG-CACAA-GCAAA-CTGACAC--GCCGTGCAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTCAACA--CC-ACA------------------------------------C----TGACAACATTTCC---ATCATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACACAT---CATCACGAAAAGTGC-----CTCCGAGAA--CAACCACTAACAC-------ATAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCCTCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pteridis_CPC_11285 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCAGA-ACGAGATC-GCTAACCGTGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGACT-CCAGCAAGA----TTTTCACGACGAGATTCGCTGACAGTTGTCAATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTTAC---CGGGAAG-CACAA-GCAAA-CTGACAC--GCCGTGCAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTCAACA--CC-ACA------------------------------------C----TGACAACATTTCC---ATCATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACACAT---CATCACGAAAAGTGC-----CTCCGAGAA--CAACCACTAACAC-------ATAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pteridis_CPC_11286 ------TCAGAGCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCAGA-ACGAGATC-GCTAACCGTGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGACT-CCAGCAAGA----TTTTCACGACGAGATTCGCTGACAGTTGTCAATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTTAC---CGGGAAG-CACAA-GCAAA-CTGACAC--GCCGTGCAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------------CACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTCAACA--CC-ACA------------------------------------C----TGACAACATTTCC---ATCATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACACAT---CATCACGAAAAGTGC-----CTCCGAGAA--CAACCACTAACAC-------ATAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pteridis_CPC_11435 ------TCAGAGCTCC-CGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCAGA-ACGAGATC-GCTAACCGTGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTTCTCTCGACT-CCAGCAAGA----TTTTCACGACGAGATTCGCTGACAGTTGTCAATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--CGAGCA-CTCCC-TTTAC---CGGGAAG-CACAA-GCAAA-CTGACAC--GCCGTGCAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGG????????????????????????----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTTAACA--CC-ACA------------------------------------C----TGACAACATTTCC---ATCATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACACAG---CATCACGAAAAGTGC-----CTCCGAGAA--CAACCACTAACAC-------ATAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pteridis_CPC_11569 -----------GCTCC-CGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCAGA-ACGAGATC-GCTAACCGTGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTTCTCTCGACT-CCAGCAAGA----TTTTCACGACGAGATTCGCTGACAGTTGTCAATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--CGAGCA-CTCCC-TTTAC---CGGGAAG-CACAA-GCAAA-CTGACAC--GCCGTGCAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTTAACA--CC-ACA------------------------------------C----TGACAACATTTCC---ATCATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACACAG---CATCACGAAAAGTGC-----CTCCGAGAA--CAACCACTAACAC-------ATAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pteridis_CPC_11618 ------------CTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAACAAAGG-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCAGA-ACGAGATC-GCTAACCGTGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGACT-CCAACAAGA----TTTTCACGACGAGATTCGCTGACAGTTGTCAATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTTAC---CGGGAAG-CACAA-GCAAA-CTGACAC--GTCGTGCAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTCAACA--CC-ACA------------------------------------C----TGACAACATTTCC---ATCATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACACAG---CATCACGAAAAGTGC-----CTCCGAGAA--CAACCACTAACAC-------ATAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGTTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pteridis_CPC_11619 ------TCAGAGCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAACAAAGG-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCAGA-ACGAGATC-GCTAACCGTGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGACT-CCAACAAGA----TTTTCACGACGAGATTCGCTGACAGTTGTCAATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTTAC---CGGGAAG-CACAA-GCAAA-CTGACAC--GTCGTGCAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCG??????????????????????????????????----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTCAACA--CC-ACA------------------------------------C----TGACAACATTTCC---ATCATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACACAG---CATCACGAAAAGTGC-----CTCCGAGAA--CAACCACTAACAC-------ATAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGTTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pteridis_CPC_12072 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAACAAAGG-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCAGA-ACGAGATC-GCTAACCGTGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGACT-CCAACAAGA----TTTTCACGACGAGATTCGCTGACAGTTGTCAATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTTAC---CGGGAAG-CACAA-GCAAA-CTGACAC--GTCGTGCAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGG????????????????????????----?????--------------------------------TGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTCAACA--CC-ACA------------------------------------C----TGACAACATTTCC---ATCATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACACAG---CATCACGAAAAGTGC-----CTCCGAGAA--CAACCACTAACAC-------ATAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGTTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pteridis_CPC_12114 ------TCAGAGCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAACAAAGG-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCAGA-ACGAGATC-GCTAACCGTGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGACT-CCAACAAGA----TTTTCACGACGAGATTCGCTGACAGTTGTCAATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTTAC---CGGGAAG-CACAA-GCAAA-CTGACAC--GTCGTGCAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTCAACA--CC-ACA------------------------------------C----TGACAACATTTCC---ATCATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACACAG---CATCACGAAAAGTGC-----CTCCGAGAA--CAACCACTAACAC-------ATAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGTTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pteridis_CPC_2190 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCAGA-ACGAGATC-GCTAACCGTGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGACT-CCAGCAAGA----TTTTCACGACGAGATTCGCTGACAGTTGTCAATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAG{AC}G{AT}ATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTTAC---CGGGAAG-CACAA-GCAAA-CTGACAC--GCCGTGCAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTTAACA--CC-ACA------------------------------------C----TGACAACATTTCC---ATCATCACACTG---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACACAG---CATCACGAAAAGTGC-----CTCCGAGAA--CAACCACTAACAC-------ATAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCTGCCATCGGTGCTCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_pteridis_CPC_2869 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCAGA-ACGAGATC-GCTAACCGTGTGCTTCTTTTTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCCTCTCGACT-CCAGCAAGA----TTTTCACGACGAGATTCGCTGACAGTTGTCAATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG---AAAACCACGC--GGAGCA-CTCCC-TTTAC---CGGGAAG-CACAA-GCAAA-CTGACAC--GCCGTGCAGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCGGACAACTT----?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cylindrocladium_rumohrae_CBS_111431 -----------------------G--CGTGCCCTTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACAACAGCAAAGC-CGCA--CCCTC-TTGAACAT--GACGATA-TA-TTGGA-ATCAAATT-GCTGACCATGTGCTTCTTTCTCAATTATAGGTCTACCTCCAGACCGGTCAGTGCGTAAGTACATTTCTCAACT-CCAACAAAA----TTCTCGCAGCGAGATAAACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTT---GCAACCGCGC--GGCGTA-TCGCC--TTTA---ACCGGCAGTGCAA-GAAAA-CTCA-----CATGT--AGGCCTCTGGCAACAAGTTCGTCCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGGCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCACCCCGCAAGCAGCTTGCTTCCAAGGCTGGTGAGTGAACGCAATCACAC-----------------------------------AAA--TCCA-CCC-AGCA----TCACCACATTA---------------------------ACATT--ACGGTAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTTATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATCCAAC--TCCACATAT---CACCC--ATCTGTT-CA--CAGTCGTTAACCA-------ATATCAGGTTCGTGAGATTGCTCAGGACTTCAAGAGCGACCTTCGCTTCCAGTCCTCAGCCATCGGCGCCCTTCAGGAGTCAGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_rumohrae_CBS_114529 -----------------------?--????CC-TTTGTTG-----CTTGCCCCTAATTCAACCCCGCCGCCCCGGTTTCCACCGCTTCGACAACAGCAAAGT-CGCA--CCCTC-TTGAACAT--GATGATA-TA-TTGGA-ATCAGATT-GCTGACCGTGTGCTTCTTTCTCAATAATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTACTTTTCTCAACT-CCAGCAAAA----TTCTCGCAGCGAGATGAACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTT---ACAACCGCGC--GGCGTA-TCGCC--TTTA---ACCAGCAGTGCAA-GAAAA-CTCA-----CATGT--AGGCCTCTGGCAACAAGTTCGTCCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????-----------------------AGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTTGCCTCCAAGGCTGGTGAGTGAACA--CC-ACA------------------------------------AA---TCCA-CCC-AGCA----TCATCACATTG---------------------------ACATT--ACCGCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGGCGATACCAGAAGTCGACTGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCACCTAGC---CCCCACAT---CACCC--ATCGGTT-CA--CAGTCGCTAACCA-------ATAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTTCGCTTCCAGTCCTCCGCCATCGGCGCCCTCCAGGAGTCAGTCGAGTCTTACCTCGTCTCTCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_rumohrae_UFV_215 -----------------------G--CGTGCCCTTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTT{CT}GACAACAGCAAAGC-CGCA--CCCTC-TTGAACAT--GACGATA-TA-TTGGA-ATCAAATT-GCTGACCATGTGCTTCTTTCTCAATTATAGGTCTACCTCCAGACCGGTCAGTGCGTAAGTACATTTCTCAACT-CCAACAAAA----TTCTCGCAGCGAGATAAACTGACATTTGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTT---GCAACCGCGC--GGCGTA-TCGCC--TTTA---ACCGGCAGTGCAA-GAAAA-CTCA-----CATGT--AGGCCTCTGGCAACAAGTTCGTCCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCACCCCGCAAGCAGCTTGCTTCCAAGGCTGGTGAGTGAACGCAATCACAC-----------------------------------AAA--TCCA-CCC-AGCA----TCACCACATTA---------------------------ACATT--ACGGTAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTTATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCATCCAAC--TCCACATAT---CACCC--ATCTGTT-CA--CAGTCGTTAACCA-------ATATCAGGTTCGTGAGATTGCTCAGGACTTCAAGAGCGACCTTCGCTTCCAGTCCTCAGCCATCGGCGCCCTTCAGGAGTCAGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_sp. -----------GCTTC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCCTCGACGACAACAAAGC-CGCA--GCCTC-ACGAACAT--GACGAGA-TA-TCCGA-ACAAGATC-GCTAACCATGTGCTTCTTTCTCAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTATCCTCAACT-CCAACGATA----TTCTCACGACAAGATTTACTGACAGTCGTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCCGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTACGTA--AAAAATCATGC--TTGGACTCTAT--CGGGA---AGCACTGTCAGA--------CTCACAC--CATGT--AGGCTTCCGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTTAATT--CC-GCC------------------------------------AC-----AA-TCA-AGCT---CGATCACCACTA---------------------------ACAAT--CGCGCAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTTGCTCTCCGTGAGATTCGACGATACCAGAAATCGACCGAGCTTCTCATCCGCAAGCTCCCATTCCAGCGCCTCGTAAGCACATAA--TCGCACACAGTG-------ATCCGA-C-CA--CGGTCGCTAACAC-------TCAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTTCGCTTCCAGTCCTCTGCTATCGGTGCTCTCCAGGAGTCCGTTGAGTCCTACCTCGTCTCCCTCTTTGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_theae_ATCC_48895 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTCCCACCGCCTCGATGGCAGCGAAGC-CGCA--TCCTC-ATGAACAAAAGACGAGG-CA-TCAGA-ACCAGATT-GCTGACCATGTCCTTTTCTCTGAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCAACAAAA----TTCTCACGACGGGATTCGCTGACACTCGCGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACTTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG-AAAAAAGCACGC--ACAGTT-GTG-----AA----CGCGAAG-GACA--GCCAA-CTCACAC--CATGT--AGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTTTTCCGTCCCGACAACTT----?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cylindrocladium_theae_CBS_111399 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCCTCGATGGCAGCGAAGC-CGCA-----TC-GTGAACAAAAGACGAGG-CA-TTAGA-ACCAGATT-GCTGACCATGTCCTTTTCTCTGAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCGCTGACACTCGCGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGTAATGGTGTCTACGCTGGTACCTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG-AAAAAAGCACGC--ACAGTT-GTG----TGA----CGCGAAG-GATA--GCCAA-CTCACAC--CATGT--AGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTTTTCCGCCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ATC------------------------------------AC------A-ACGCGTC----GGCAACCTACTA---------------------------ACATC--ACCATAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACTGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCACGCCC-ATTCACACAGC-AA-CG--------CAGCAA--CAGCCGCTAACAT-------GTAACAGGTTCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCCCTCCAGGAGTCCGTCGAGTCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_theae_CBS_111705 -----------GCTCC-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTCCCACCGCCTCGATGGCAGCGAAGC-CGCA--TCCTC-ATGAACAA--GACGAGG-CA-TCAGA-ACCAGATT-GCTGACCATGTCCTTTTCTCTGAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCAACAAAA----TTCTCACGACGAGATTCGCTGACACTCGCGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACTTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG-AAAAAAGCACGC--ACAGTT-GTG----TAA----CGCGAAG-GACA--GCCAA-CTCACAC--CATGT--AGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTTTTCCGTCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ATC------------------------------------AC---CTCA-ACGCGTT----GACAACCTACTA---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCACAGCC-ATCCACACAGCGCA-TG--------CAACAG--CAGCCGCTAACAT-------GTAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCCCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_theae_CBS_114175 -----------GCTTA-TGAGACG--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTTCCACCGCTTCGACGACAGCAAAGC-CGCA--TCCTC-ATGAACAAAAGACGAGG-CA-TCAGA-ACCAGATT-GCTGACCATGTCCTTTTCTCTGAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCAACAAAA----TTCTCACGACGGGATTCGCTGACACTCGCGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACTTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG-AAAAAAGCACGC--ACAGTT-GTG----TAA----CGCGAAG-GACA--GCCAA-CTCACAC--CATGT--AGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACT-----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ATC------------------------------------AC---CTCA-ACGCGTT----GACAACCTACTA---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCACAGCC-ATCCACACAGCGCA-TG--------CAACAG--CAGCCGCTAACAT-------GTAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCCCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- Cylindrocladium_theae_CBS_114684 -----------------------G--CGTGCC-TTTGTTG-----CT-GCCCCTGATTCTACCCCGCCGCCCCGGTTCCCACCGCCTCGATGGCAGCGAAGC-CGCA--TCCTC-ATGAACAAAAGACGAGG-CA-TCAGA-ACCAGATT-GCTGACCATGTCCTTTTCTCTGAATTATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTGCTCTTCTCAACT-CCAACAAAA----TTCTCACGACGGGATTCGCTGACACTCGCGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACGCTGGTACTTCCGAGCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTATGTG-AAAAAAGCACGC--ACAGTT-GTG-----AA----CGCGAAG-GACA--GCCAA-CTCACAC--CATGT--AGGCTTCTGGCAACAAGTTCGTTCCTCGCGCTGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTTTTCCGTCCCGACAACTT----?????----------------------TAGGTCCACTGGTGGCAAGGCCCCCCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTGAATT--CC-ATC------------------------------------AC---CTCA-ACGCGTT----GACAACCTACTA---------------------------ACATC--AACACAGCCCGCAAGAGCGCCCCCTCTACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATACCAGAAGTCGACCGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGCACAGCC-ATCCACACAGCGCA-TG--------CAACAG--CAGCCGCTAACAT-------GTAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCCCTCCAGGAGTCCGTCGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT------- ; END; BEGIN SETS; CHARSET his (CHARACTERS = Combined) = 784-1142 656-688 724-756; CHARSET tub (CHARACTERS = Combined) = 31-563; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Combined) = N: 1-1181; CODONPOSSET CodonPositions (CHARACTERS = Combined) = N: 1-1181; END; BEGIN TREES; TITLE Tb7816; LINK TAXA = Taxa1; TRANSLATE 1 Cylindrocladium_sp., 2 Cylindrocladium_australiense, 3 Cylindrocladium_avesiculatum, 4 Cylindrocladium_madagascariense_CPC_2322, 5 Cylindrocladium_madagascariense_CBS_114571, 6 Cylindrocladium_madagascariense_CBS_114539, 7 Cylindrocladium_madagascariense_CBS_114572, 8 Cylindrocladium_macroconidiale_CPC_413, 9 Cylindrocladium_macroconidiale_CBS_114880, 10 Cylindrocladium_colhounii_CBS_114704, 11 Cylindrocladium_colhounii_CBS_114695, 12 Cylindrocladium_colhounii_CBS_114660, 13 Cylindrocladium_colhounii_CPC_705, 14 Cylindrocladium_colhounii_CPC_1237, 15 Cylindrocladium_colhounii_CPC_681, 16 Cylindrocladium_colhounii_CBS_112739, 17 Cylindrocladium_colhounii_CBS_114036, 18 Cylindrocladium_colhounii_CBS_293.79, 19 Cylindrocladium_colhounii_CBS_111367, 20 Cylindrocladium_colhounii_CBS_112951, 21 Cylindrocladium_colhounii_CBS_111205, 22 Cylindrocladium_colhounii_CBS_112948, 23 Calonectria_reteaudii_CBS_112955, 24 Calonectria_reteaudii_CBS_112149, 25 Calonectria_reteaudii_CBS_112146, 26 Calonectria_reteaudii_CBS_112155, 27 Calonectria_reteaudii_CBS_112151, 28 Calonectria_reteaudii_CBS_112634, 29 Calonectria_reteaudii_CPC_3217, 30 Calonectria_reteaudii_CBS_113582, 31 Calonectria_reteaudii_CBS_113583, 32 Calonectria_reteaudii_CBS_112143, 33 Calonectria_reteaudii_CBS_112147, 34 Calonectria_reteaudii_CBS_112153, 35 Calonectria_reteaudii_CBS_112144, 36 Calonectria_reteaudii_CBS_582.50, 37 Calonectria_reteaudii_CBS_113925, 38 Cylindrocladium_acicola_CPC_10898, 39 Cylindrocladium_acicola_CBS_114813, 40 Cylindrocladium_acicola_CBS_114812, 41 Cylindrocladium_multiseptatum_CPC_1602, 42 Cylindrocladium_multiseptatum_CBS_112682, 43 Cylindrocladium_ecuadoriae_CBS_111383, 44 Cylindrocladium_ecuadoriae_CBS_111394, 45 Cylindrocladium_ecuadoriae_CBS_111393, 46 Cylindrocladium_ecuadoriae_CBS_111406, 47 Cylindrocladium_ecuadoriae_CBS_111412, 48 Cylindrocladium_ecuadoriae_CBS_111425, 49 Cylindrocladium_gracile_CBS_111478, 50 Cylindrocladium_gracile_CBS_111458, 51 Cylindrocladium_gracile_CBS_111382, 52 Cylindrocladium_gracile_CBS_111465, 53 Cylindrocladium_gracile_CBS_114167, 54 Cylindrocladium_gracile_CBS_111456, 55 Cylindrocladium_gracile_CBS_111468, 56 Cylindrocladium_gracile_CBS_115680, 57 Cylindrocladium_gracile_CBS_111129, 58 Cylindrocladium_gracile_CBS_111474, 59 Cylindrocladium_clavatum, 60 Cylindrocladium_gracile_CBS_111476, 61 Cylindrocladium_gracile_CBS_111390, 62 Cylindrocladium_gracile_CBS_114171, 63 Cylindrocladium_gracile_CBS_115769, 64 Cylindrocladium_gracile_CBS_110676, 65 Cylindrocladium_gracile_CBS_112673, 66 Cylindrocladium_gracile_CBS_111869, 67 Cylindrocladium_gracile_CBS_111475, 68 Cylindrocladium_gracile_CBS_112694, 69 Cylindrocladium_flexuosum_CBS_114666, 70 Cylindrocladium_flexuosum_CPC_11352, 71 Cylindrocladium_flexuosum_CPC_11350, 72 Cylindrocladium_flexuosum_CBS_112676, 73 Cylindrocladium_flexuosum_CBS_112675, 74 Cylindrocladium_flexuosum_CPC_11349, 75 Cylindrocladium_flexuosum_CPC_11351, 76 Cylindrocladium_flexuosum_CPC_11348, 77 Cylindrocladium_flexuosum_CPC_11347, 78 Cylindrocladium_flexuosum_CBS_114557, 79 Cylindrocladium_pseudogracile_CBS_111284, 80 Cylindrocladium_pseudogracile_AR2677, 81 Cylindrocladium_pseudogracile_CBS_114454, 82 Cylindrocladium_hawksworthii, 83 Cylindrocladium_pteridis_CPC_12072, 84 Cylindrocladium_pteridis_CPC_11619, 85 Cylindrocladium_pteridis_CPC_11618, 86 Cylindrocladium_pteridis_CBS_111793, 87 Cylindrocladium_pteridis_CPC_12114, 88 Cylindrocladium_pteridis_CPC_11569, 89 Cylindrocladium_pteridis_CPC_11435, 90 Cylindrocladium_pteridis_CPC_11284, 91 Cylindrocladium_pteridis_CBS_111867, 92 Cylindrocladium_pteridis_CBS_111871, 93 Cylindrocladium_pteridis_CBS_111778, 94 Cylindrocladium_curvisporum_CPC_763, 95 Cylindrocladium_curvisporum_CPC_765, 96 Cylindrocladium_penicilloides, 97 Cylindrocladium_pteridis_CPC_2869, 98 Cylindrocladium_pteridis_CPC_2190, 99 Cylindrocladium_pteridis_CPC_11285, 100 Cylindrocladium_pteridis_CPC_11286, 101 Cylindrocladium_gordoniae, 102 Calonectria_leguminum, 103 Cylindrocladium_rumohrae_CBS_111431, 104 Cylindrocladium_rumohrae_UFV_215, 105 Cylindrocladium_rumohrae_CBS_114529, 106 Cylindrocladium_angustatum_CBS_112133, 107 Cylindrocladium_angustatum_CBS_114767, 108 Cylindrocladium_angustatum_CBS_114766, 109 Cylindrocladium_angustatum_CBS_114544, 110 Cylindrocladium_hurae_FTCC_1003, 111 Cylindrocladium_hurae_CBS_114182, 112 Cylindrocladium_hurae_FTCC_1002, 113 Cylindrocladium_hurae_CBS_114551, 114 Cylindrocladium_theae_CBS_111399, 115 Cylindrocladium_theae_ATCC_48895, 116 Cylindrocladium_theae_CBS_114684, 117 Cylindrocladium_theae_CBS_114175, 118 Cylindrocladium_theae_CBS_111705, 119 Cylindrocladium_graciloideum_CBS_111141, 120 Cylindrocladium_graciloideum_CBS_111040, 121 Cylindrocladium_graciloideum_CBS_115674, 122 Cylindrocladiella_lageniformis, 123 Cylindrocladiella_peruviana; TREE Fig._2 = [&R] ((123,122)Cylindrocladiella,(((((((121,120,119)Cylindrocladium_graciloideum,82),(101,((100,99,((98,89,88),(93,92,91),(87,85,84,83)),90),86)Cylindrocladium_pteridis)),(((((118,117,116),114)Cylindrocladium_theae,(((((((42,(40,39,38)Cylindrocladium_acicola),(((37,((36,35,34,33,32,31,30),29)),(28,27,26,25,24)),23)Calonectria_reteaudii),1),2),(7,5)Cylindrocladium_madagascariense),(((22,19),20,18,15,(12,11,10)),(17,16,14,13))Cylindrocladium_colhounii),((9,8)Cylindrocladium_macroconidiale,(95,94)Cylindrocladium_curvisporum))),((81,80,79)Cylindrocladium_pseudogracile,((78,(77,76,75,74,73,72,71,70),69)Cylindrocladium_flexuosum,(((68,64),67,66,65,63,62,61,60,58,57,56,55,54,53,52,50,49),59)Cylindrocladium_gracile))),((48,((47,46),45,44)),43)Cylindrocladium_ecuadoriae)),((113,(112,110),111)Cylindrocladium_hurae,((109,108,107,106)Cylindrocladium_angustatum,102))),(105,(104,103))Cylindrocladium_rumohrae),3)); END; BEGIN TREES; TITLE Tb7815; LINK TAXA = Taxa1; TRANSLATE 1 Cylindrocladium_sp., 2 Cylindrocladium_australiense, 3 Cylindrocladium_avesiculatum, 4 Cylindrocladium_madagascariense_CPC_2322, 5 Cylindrocladium_madagascariense_CBS_114571, 6 Cylindrocladium_madagascariense_CBS_114539, 7 Cylindrocladium_madagascariense_CBS_114572, 8 Cylindrocladium_macroconidiale_CPC_413, 9 Cylindrocladium_macroconidiale_CBS_114880, 10 Cylindrocladium_colhounii_CBS_114704, 11 Cylindrocladium_colhounii_CBS_114695, 12 Cylindrocladium_colhounii_CBS_114660, 13 Cylindrocladium_colhounii_CPC_705, 14 Cylindrocladium_colhounii_CPC_1237, 15 Cylindrocladium_colhounii_CPC_681, 16 Cylindrocladium_colhounii_CBS_112739, 17 Cylindrocladium_colhounii_CBS_114036, 18 Cylindrocladium_colhounii_CBS_293.79, 19 Cylindrocladium_colhounii_CBS_111367, 20 Cylindrocladium_colhounii_CBS_112951, 21 Cylindrocladium_colhounii_CBS_111205, 22 Cylindrocladium_colhounii_CBS_112948, 23 Calonectria_reteaudii_CBS_112955, 24 Calonectria_reteaudii_CBS_112149, 25 Calonectria_reteaudii_CBS_112146, 26 Calonectria_reteaudii_CBS_112155, 27 Calonectria_reteaudii_CBS_112151, 28 Calonectria_reteaudii_CBS_112634, 29 Calonectria_reteaudii_CPC_3217, 30 Calonectria_reteaudii_CBS_113582, 31 Calonectria_reteaudii_CBS_113583, 32 Calonectria_reteaudii_CBS_112143, 33 Calonectria_reteaudii_CBS_112147, 34 Calonectria_reteaudii_CBS_112153, 35 Calonectria_reteaudii_CBS_112144, 36 Calonectria_reteaudii_CBS_582.50, 37 Calonectria_reteaudii_CBS_113925, 38 Cylindrocladium_acicola_CPC_10898, 39 Cylindrocladium_acicola_CBS_114813, 40 Cylindrocladium_acicola_CBS_114812, 41 Cylindrocladium_multiseptatum_CPC_1602, 42 Cylindrocladium_multiseptatum_CBS_112682, 43 Cylindrocladium_ecuadoriae_CBS_111383, 44 Cylindrocladium_ecuadoriae_CBS_111394, 45 Cylindrocladium_ecuadoriae_CBS_111393, 46 Cylindrocladium_ecuadoriae_CBS_111406, 47 Cylindrocladium_ecuadoriae_CBS_111412, 48 Cylindrocladium_ecuadoriae_CBS_111425, 49 Cylindrocladium_gracile_CBS_111478, 50 Cylindrocladium_gracile_CBS_111458, 51 Cylindrocladium_gracile_CBS_111382, 52 Cylindrocladium_gracile_CBS_111465, 53 Cylindrocladium_gracile_CBS_114167, 54 Cylindrocladium_gracile_CBS_111456, 55 Cylindrocladium_gracile_CBS_111468, 56 Cylindrocladium_gracile_CBS_115680, 57 Cylindrocladium_gracile_CBS_111129, 58 Cylindrocladium_gracile_CBS_111474, 59 Cylindrocladium_clavatum, 60 Cylindrocladium_gracile_CBS_111476, 61 Cylindrocladium_gracile_CBS_111390, 62 Cylindrocladium_gracile_CBS_114171, 63 Cylindrocladium_gracile_CBS_115769, 64 Cylindrocladium_gracile_CBS_110676, 65 Cylindrocladium_gracile_CBS_112673, 66 Cylindrocladium_gracile_CBS_111869, 67 Cylindrocladium_gracile_CBS_111475, 68 Cylindrocladium_gracile_CBS_112694, 69 Cylindrocladium_flexuosum_CBS_114666, 70 Cylindrocladium_flexuosum_CPC_11352, 71 Cylindrocladium_flexuosum_CPC_11350, 72 Cylindrocladium_flexuosum_CBS_112676, 73 Cylindrocladium_flexuosum_CBS_112675, 74 Cylindrocladium_flexuosum_CPC_11349, 75 Cylindrocladium_flexuosum_CPC_11351, 76 Cylindrocladium_flexuosum_CPC_11348, 77 Cylindrocladium_flexuosum_CPC_11347, 78 Cylindrocladium_flexuosum_CBS_114557, 79 Cylindrocladium_pseudogracile_CBS_111284, 80 Cylindrocladium_pseudogracile_AR2677, 81 Cylindrocladium_pseudogracile_CBS_114454, 82 Cylindrocladium_hawksworthii, 83 Cylindrocladium_pteridis_CPC_12072, 84 Cylindrocladium_pteridis_CPC_11619, 85 Cylindrocladium_pteridis_CPC_11618, 86 Cylindrocladium_pteridis_CBS_111793, 87 Cylindrocladium_pteridis_CPC_12114, 88 Cylindrocladium_pteridis_CPC_11569, 89 Cylindrocladium_pteridis_CPC_11435, 90 Cylindrocladium_pteridis_CPC_11284, 91 Cylindrocladium_pteridis_CBS_111867, 92 Cylindrocladium_pteridis_CBS_111871, 93 Cylindrocladium_pteridis_CBS_111778, 94 Cylindrocladium_curvisporum_CPC_763, 95 Cylindrocladium_curvisporum_CPC_765, 96 Cylindrocladium_penicilloides, 97 Cylindrocladium_pteridis_CPC_2869, 98 Cylindrocladium_pteridis_CPC_2190, 99 Cylindrocladium_pteridis_CPC_11285, 100 Cylindrocladium_pteridis_CPC_11286, 101 Cylindrocladium_gordoniae, 102 Calonectria_leguminum, 103 Cylindrocladium_rumohrae_CBS_111431, 104 Cylindrocladium_rumohrae_UFV_215, 105 Cylindrocladium_rumohrae_CBS_114529, 106 Cylindrocladium_angustatum_CBS_112133, 107 Cylindrocladium_angustatum_CBS_114767, 108 Cylindrocladium_angustatum_CBS_114766, 109 Cylindrocladium_angustatum_CBS_114544, 110 Cylindrocladium_hurae_FTCC_1003, 111 Cylindrocladium_hurae_CBS_114182, 112 Cylindrocladium_hurae_FTCC_1002, 113 Cylindrocladium_hurae_CBS_114551, 114 Cylindrocladium_theae_CBS_111399, 115 Cylindrocladium_theae_ATCC_48895, 116 Cylindrocladium_theae_CBS_114684, 117 Cylindrocladium_theae_CBS_114175, 118 Cylindrocladium_theae_CBS_111705, 119 Cylindrocladium_graciloideum_CBS_111141, 120 Cylindrocladium_graciloideum_CBS_111040, 121 Cylindrocladium_graciloideum_CBS_115674, 122 Cylindrocladiella_lageniformis, 123 Cylindrocladiella_peruviana; TREE Fig._1 = [&R] ((123,122)Cylindrocladiella,((((((121,120,119)Cylindrocladium_graciloideum,(((118,(116,115)),114),117)Cylindrocladium_theae),(((((101,((100,99,98,97,93,92,91,90,(89,88)),(87,85,84,83),86)Cylindrocladium_pteridis),(((((42,41)Cylindrocladium_multiseptatum,(40,39,38)Cylindrocladium_acicola),((37,23),((((36,32,31,30,29),(35,(34,33))),(26,25,24)),(28,27)))Calonectria_reteaudii),(2,1)),(((((22,21,20,19),(18,(17,16),(15,14),13)),(12,11,10))Cylindrocladium_colhounii,(9,8)Cylindrocladium_macroconidiale),((7,6,5),4)Cylindrocladium_madagascariense))),82),((81,80,79)Cylindrocladium_pseudogracile,(((78,(77,76,75,74,73,72,71,70),69)Cylindrocladium_flexuosum,((68,67),((66,65),64),(63,62,61,60,59,58,57,56,55,54),(53,52,50,49),51)Cylindrocladium_gracile),((48,47,46,(45,44)),43)Cylindrocladium_ecuadoriae))),3)),102),(((113,112,111),110)Cylindrocladium_hurae,((109,108,107,106)Cylindrocladium_angustatum,(105,(104,103))Cylindrocladium_rumohrae))),(96,(95,94)Cylindrocladium_curvisporum))Cylindrocladium); END;