#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on June 02, 2023; 17:44 GMT TreeBASE (cc) 1994-2008 Study reference: Pitakpong A., Kraichak E., Papong K.B., Muangsan N., Suwanwaree P., Lumbsch H.T., & L├╝cking R. 2015. New species and records of the lichens genus Graphis (Graphidaceae, Ascomycota) from Thailand, with a key to currently known species. Lichenologist, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S17170] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=48; TAXLABELS Diorygma_antillarum_Luecking33019 Diorygma_minisporum_Lumbsch19543v Graphis_albissima_Rivas1004D Graphis_anfractuosa_Hernandez1340 Graphis_angustata_Luecking28102 Graphis_caesiella_Berger17247 Graphis_caesiella_LUmbsch_20530a Graphis_caesiella_Lumbsch20540i Graphis_chrysocarpa_Luecking0035 Graphis_cinerea_Kalb26950 Graphis_dichotoma_RivasPlata2088 Graphis_furcata_Rivas_pLata1172Q Graphis_gracilescens_Luecking33942B Graphis_handelii_GreenGR4BH Graphis_illinata_Lumbsch19639 Graphis_implicata_Luecking16103a Graphis_implicata_Luecking16103b Graphis_implicata_Luecking28039 Graphis_implicata_Luecking28104 Graphis_implicata_Luecking28527 Graphis_implicata_RivasPlata0103A Graphis_leptoclada_Lumbsch20535 Graphis_librata_Luecking28001 Graphis_librata_Luecking28001b Graphis_librata_Lueckinh28007 Graphis_pavoniana_Luecking16100c Graphis_proserpens_RivasPlata2065 Graphis_pseudocinerea_Luecking26531 Graphis_pseudocinerea_Luecking26532a Graphis_pseudocinerea_Luecking26537 Graphis_pseudoserpens_Luecking28003 Graphis_pseudoserpens_Luecking28048 Graphis_rhizocola_Luecking28502 Graphis_rhizocola_Luecking28512 Graphis_rhizocola_Luecking28548 Graphis_rimulosa_RivasPlta1021H Graphis_scripta_Nelsen499 Graphis_scripta_Neuwirth11834 Graphis_scripta_Tonsberg42518 Graphis_sp.A_Pitakpong311 Graphis_sp.A_PitakpongA04 Graphis_sp.A_PitakpongD205 Graphis_sp.A_PitakpongE108 Graphis_streblocarpa_RivasPlata1015E Graphis_tenella_RivasPlata1007G Graphis_tsunodae_Luecking26096 Graphis_vestitoides_RivasPlata2078 Graphis_xanthospora_Luecking26535 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M31801] TITLE Graphis_mtSSU_and_nuLSU; LINK TAXA = Taxa1; DIMENSIONS NCHAR=956; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Diorygma_antillarum_Luecking33019 GAACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTC--GTATTAAGAACAGGATTAGAGACCCTAGTACTGTGGGCAGACAATGATGAGTGTCATATGCAAGAAATTTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACACGGAAACTGAAATCATTAGACCGTTTCTGAAACTCGTAGTGAAGTATGTTGTTTAATTTGATGATCCACAAATAACCTTACCACAATTTGTATGACTA-TGATTTT------------GC---TATT-------------------------AGTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTTGTGAAACTTTGGTTAGATCCATTAAATTGACGTAAACCCTTGCTTTATTTATTATAGAGCAGTTCGCCGCTATATAGGTAGTGATAGGTGCTTCGGGTGCGACCGCGGTCCAAGTCCCATGGAACTGGGCGTCACAGAGGGTGAGAATCCCGTACGTGGCCGAGGGTCTATCCCGTGCGAAGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAACTTCATCTAAAGCTAAATATCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCGCGCGG-GGTTCAGCCGTCCCTCGGGGTGGTGCACTCCCC-GTGCGCGGGCCAGCATCAGCTTGGGCGGTCGGATAAAGGTTCGGGGAACGTAGCTCCCTCCGGGGAGTGTTATAGCCCCGGGCATCATGCGGCCAGCCCGGGCTGAGGATCGCGCT-CCGCTAGGATGC-------------------------------------------- Diorygma_minisporum_Lumbsch19543v GAACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTC--GAATAAAGATTAGGATTAGAGACCCTAGTATTGTGGGCAGACAATGATGAGTGTCATATGCAAGAAATTTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACGCGGAAACTGAAATCATTAGACCGTTTCTGAAACTCGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAATAACCTTACCGCAATTTGTATGACTAGTAATATTAACAA-----AAGCA--TATTTTGTTTTAATATGTTTTAACT----AGTTACAAGCGTTGCATGGCTGTCTTCAGTTAATGTTGTGAAACTTTGGTTAGATCCATTTAATTGACGTAAACCCTTGCTTTATTTATAATAAAGCAGTTCACCGTTATATTGGAAATGATAGGTGCTTCGGGAACGACCGCGGCCCAAGTCCCATGGAACTGGGCGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGACGGTCCGACCCGCGTGAAGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAGGCTAAATATCTGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAAGGAAGCGCTTGCAACCAGACTCGTTGGCAG-GGTTCAGCCGCGCTTCGGTGTGGTGTACTCC-CTGCGATCGGGCCAGCATCGGTTTCGGCGGCCGGACAAAGGCCCCGGGAATGTAGCTCCCTTCGGGGAGTGTTAGAGCCCGGGGTACAATGCGGCCTGCCGGGACCGAGGACCGCGCT-CTGCTAGGATGCTGGCGTAATGGTTGCCAGCGACCCGTCTTGAAACACGGATCAAG Graphis_albissima_Rivas1004D GGACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTCAAGGAGAAAAAAGAGGATTAGATACCCTCGTATAGTGGGCAGACAATGATGAGTGTCATATGTAAGATATTTTTATGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACCCGTAGTGAAGTATGTTGTTTAATTTGTTGGCCCTCAAATAACCTTACCACAATTTGTATAGCTTGTAATTTTAAAAACTTGTATGCTATTATTTATAA---ACATAGTAGAACTTACAAGCTACAAGCGTTGCACGGCTGTTTTTAGTCAATGTTGTGAAACTTTGGTTAGGTCCATTAAATTGATGTAAGCCCTTGCTTTATTTAATAAAAAGTAGTTCGCCACTGTATAGGTAGCGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Graphis_anfractuosa_Hernandez1340 GGACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTCAAGGAGAAAAAAGAGGATTAGATACCCTCGTATAGTGGGCAGACAATGATGAGTGCCATATGTAAGATATTTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACTCGTAGTGAAGTATGTTGTTTAATTTGATAGTCCTCAAATAACCTTACCACAATTTGTATAGCTTGTAATTTTAATAACTTGTATATTATTATTTACATATAATATAGTAGACCTTGCAAGCTACAAGCGTTGCACGGCTGTTTTTAGTCAATGTTGTGAAACTTTGGTTAGATCCATTAAATTGACGTAAGCCCTTGCTTTATTTACTATAGAGTAGTTCGCCGCTATATTGGTAGTGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Graphis_angustata_Luecking28102 GAACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTCGA-AATAAGTAACAGGATTAGATACCCTAGTATTGTGGGCAGACAATGATGAGTGTCATATGCAAGAAATTTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAACCATTAGACCGTTTCTGAAACTCGTAGTGAAGTATGTTGTTTAATTTGATAGTCCTCAAAGAACCTTACCACAATTTGTATAACTTGAACATA------------------GATTTATATATTATCTGGT-------ACAAGTAACAAGCGTTGCACGGCTGTCTTCAGTTAATGTTGTGAAACTTTGGTTAGATCCATTTAATTGACGTAAACCCTTACTTTATTTATTATAAAGTAGTTCGCCGCTATATTGGTAGTGATAGGTGCCTCGGGAGCGACGACGGTGCAAGTTTCCTGGAACGGAGCGTCGAAGAGGGTGAGAATCCCGTCTGTCGCCGAACGTCAAACCCGCGTGAGGCCCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGACGGTGGTAAGTTCCATCTAAAGCTAAATATCCGCCAGAAACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGTCCGCGCGTGCTCAGCCGCCCCTCGGTGCGGTGTACTCTCGTGCGGACGGGCCAGCATCGGTTTCGGCGGCCGGACAAAGGCCCTGGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCCGGGGTGTAATGCGGCCAGCCGGGACCGAGGATCGCGCTCTCGCTAGGATGCTGGCGTAATGGTTGCCAGCGACCCGTCTTGAAACACGGACCA-- Graphis_caesiella_Berger17247 GGACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTCAAGGAGAAAAAAGAGGATTAGATACCCTTGTATAGTGGGCAGACAATGATGAGTGTTATATGTAAGATATTCTTGTGTATAAATTAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACCCGTAGTGAAGTATGTTGTTTAATTTGTTAGCCCTCAAATAACCTTACCACAATTTGTATAGCTTGTAATTTTAAAAACATGTATGCTAT----TGTATATAATATAGTAGAACTTACAAGCTACAAGCGTTGCACGGCTGTTTTTAGTCAATGTTGTGAAACTATGGTTAGGTCCATTAAATTGATGTAAACCCTTGCTTTATTTTATAAAAAGTAGTTCGCTACTATATAGGTAGCGATAGGTGTTTCGGAAGAGATGATGGTCCAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTACGTGGCTAATCATCGATTCCATGTGAAACCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTCGTTTGCAGATGCTCAGCCTTCCTTCGGGATGGTGTATTCATCTGTTGACGGGCCAGCATCAGTTTCAGCGGCTGGATAAAGGTTCTGAGAACGTAGCACTCTTCGGGGTGTGTTA-AGCTCAGAGCGTAATGCAGCCAGTTGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCTAGCGACCCGTCTTGAAACACGGACCA-- Graphis_caesiella_LUmbsch_20530a GGACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTCAAGGAGAAAAAAGAGGATTAGATACCCTTGTATAGTGGGCAGACAATGATGAGTGTTATATGTAAGATATTCTTGTGTATAAATTAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACCCGTAGTGAAGTATGTTGTTTAATTTGTTAGCCCTCAAATAACCTTACCACAATTTGTATAGCTTGTAATTTTAAAAACATGTATGCTAT----TGTATATAATATAGTAGAACTTACAAGCTACAAGCGTTGCACGGCTGTTTTTAGTCAATGTTGTGAAACTATGGTTAGGTCCATTAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Graphis_caesiella_Lumbsch20540i GGACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTCAAGGAGAAAAAAGAGGATTAGATACCCTTGTATAGTGGGCAGACAATGATGAGTGTTATATGTAAGATATTCTTGTGTATAAATTAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACCCGTAGTGAAGTATGTTGTTTAATTTGTTAGCCCTCAAATAACCTTACCACAATTTGTATAGCTTGTAATTTTAAAAACATGTATGCTAT----TGTATATAATATAGTAGAACTTACAAGCTACAAGCGTTGCACGGCTGTTTTTAGTCAATGTTGTGAAACTATGGTTAGGTCCATTAAATTGATG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Graphis_chrysocarpa_Luecking0035 GAACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTCGA-ATTAAGTAACAGGATTAGATACCCTAGTATTGTGGGCAGACAATGATGAGTGTCATATGCAAGACATTTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGACCGTTTCTGAAACTCGTAGTGAAGTATGTTGTTTAATTTGTTAATCCTCAAAGAACCTTACCACAATTTGTATAACTTGAACATATAAGCACTTATATAAATATATTTATATATTATCTAGT-------ACAAGTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTTGTGAAACTTTGGTTAGATCCATTTAATTGACGTAAACCCTTACTTTATTTATTATAAAGTAGTTCGCCGCTATATTGGTAGTGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Graphis_cinerea_Kalb26950 GAACTGGTAAAGGCGAAGGCAACCTTT?ATGTAAAA-CTGACGT{AT}A--GGACGAAGGCTCGA--AAAAGTAACAGGATTAGATACCCTAGTATTGTGGGCAGACA?TGATGAGTGTCATATGCAAGAATATTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGACCGTTTCTGAAACTCGTAGTGAAGTATGTTGTTTAATTTGATTGCCCTCAAAGAACCTTACCACAATTTGTATAACTTGAA----TAAGAGATATTATCTCAT-------------------------TATAAGTAACAGGCGTTGCACGGCTGTCTTCAGTTAATGTTGTGAAATTTTGGTTAGATCCATTTAATTGACGTAAACCCTTGCTTTATTTATTATAAAGCAGTTCGCCGCTATATTGGTAGTGATAGGTGCCTCGGGGGCGACGACGGCGCAAGTCTCCTGGAACGGAGCGTCGCAGAGGGTGAGAATCCCGTTTGCCGCCGAACGTCAAACCCGTGTGAGGCCCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCCAAGCGGGTGGTAAGTTCCATCTAAAGCTAAATATCCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCCCGCGCGTGTTCAGCCGTGCTTCGGTGCGGTGCACTCTCGCGCGGGCGGGCCAGCATCGGTTTCGGCGGCCGGACAAAGGCCCTGGGAACGTAACTCCCCTCGGGGAGTGTTATAGCCCGGGGTGCAATGCGGCCAGCCGGGACCGAGGATCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCCAGCGACCCGTCTTGAAACACGGACCA-- Graphis_dichotoma_RivasPlata2088 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGCTTCGGAAGAGATGACGGTCCAAGTACCTTGGAACAGGTCGTCACAGAGGGTGAGAATCCCGTATGTGATCAATCATCGATTCCATGTGAAGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCAATCAGACTCGTTTGCAGAAGCTCAGCTTTCCTTCGGGATGGTGTATTCTTCTGTCAACGGGCCAGCATCAGTTTCGGCGGTTGGATAAAGACTTTGGGAACGTAGCTCTCCTCGGAGAGTGTTATAGCCCGGAGTGTAATGCAGCCAGCTGAGACTGAGGTCCACGCTTTTGCTAGGATGCTGGCATAATGGTTGCTAGCGACCCGTCTTGAAACACGGACCA-- Graphis_furcata_Rivas_pLata1172Q GGACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTCATGGAGAAAAAAGAGGATTAGATACCCTCGTATAGTGGGCAGACAATGATGAGTGTCATATGTAAGATATTTTTATGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACCCGTAGTGAAGTATGTTGTTTAATTTGTAGGTACGCAAATAACCTTACCACAATTTGTATAGCTTGTAATTTTAAAAACTAGTATGCTATTATTTATATATAATATAGTAGAACTTACAAGCTACAAGCGTTGCACGGCTGTTTTTAGTCAATGTTGTGAAACTTTGGTTAGGTCCATTAAATTGATGTAAGCCCTTGCTTTATTTAATAAAAAGCAGTTCGCCACTGTATAGGTTGCGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Graphis_gracilescens_Luecking33942B GGACTGGTAAAGGCGAAGGCAACCTTTTATCTAAAAACTGACGTTGAGGGACGAAGGCTCAAGGAGAAAAAAGAGGATTAGATACCCTTGTATAGTGGGCAGACAATGATGAGTGTCATATGTAAGATATTTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACCCGTAGTGAAGTATGTTGTTTAATTTGATATTCCGCAAATAACCTTACCACAATTTGTATAGCTTGTAATTTTAAAAACTAGTATGCTATTATTTATATATCATATAGTAGAACTTACAAGCTACAAGCGTTGCACGGCTGTTTTTAGTCAATGTTGTGAAACTTTGGTTAGGTCCATTAAATTGATGTAAGCCCTTGCTTTATTTATTAAAAAGCAGTTCGCCGCTGTATGGGTAGCGATAGGTGCTTCGGAAGAGATGATGGTCCAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTACGTGACCAATTGTCGATTCCATGTGAAGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTCGCAATCAGACTCGTTTGCAGAAGCTCAGCCTCTCCACGGAGTGGTGTATTCTTCTGTCAACGGGCCAGCATCAGTTTCGGCGGTTGGATAAAGACTTTGGGAACGTAGCTCTCCTCGGAGAGTGTTATAGCCTGGAGTGCAATGCAGCCAGCTGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCTAGCGACCCGTCTTGAAACACGGACCA-- Graphis_handelii_GreenGR4BH GAACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTCGT-ATTAAGTAATAGGATTAGAGACCCTAGTATTGTGGGCAGACAATGATGAGTGTCATATGCAAGAAAATTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGACCGTTTCTGAAACTCGTAGTGAAGTATGTTGTTTAATTTGATAATCCGCAAATAACCTTACCACAATTTGAATTACTGGTAAAATTAAA----------------------------------------ACTAGTAACAAGCGTTGCACGGCTGTCTTCAGTCAATGTTGTGAAACTTTGGTTAGATCCATTAAATTGACGTAAACCCTTGCTTTATTTGTTATAAAGCAGTTCGCCGCTATATTGGTAGTGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Graphis_illinata_Lumbsch19639 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGCCTCGGGAGCGACGACGGTGCAAGTTTCCTGGAACGGAACGTCGAAGAGGGTGAGAATCCCGTCCGTCGCCGATCGTCAAACCCGCGTGAGGCCCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGACGGTGGTAAGTTCCATCTAAAGCTAAATATCCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGTCCGCGCGTGCTCAGCCGTTCTCCGGAGCGGTGCATTCTCGTGCGGACGGGCCAGCATCGGTTTCGGTGGCCGGACAAAGGTCCTGGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCCGGGGCGCAATGCGGCCTGCCGGGACCGAGGACCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCCAG-------------------------- Graphis_implicata_Luecking16103a GGACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTCAAGGAGAAAAAAGAGGATTAGATACCCTTGTATAGTGGGCAGACAATGATGAGTGTCATATGCAAG----TTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACCCGTAGTGAAGTATGTTGTTTAATTTGTAGTTACGCAAATAACCTTACCACAATTTGTATAGCTTG--------------------------------------------------------TACAAGCGTTGCACGGCTGTTTTTAGTCAATGTTGTGAAACTTTGGTTAGGTCCATTAAATTGATGTAAGCCCTTGCTTTATTTAATAAAAAGTAGTTCGCCACTGTATTGGTAGCGATAGGTGCTTCGGGAGAGATGATGGTCCAAGTCCCTTGGAATAGGGCGTCACAGAGGGTGAGAATCCCGTATGTGGCC?GTCATCGATTCCATGTGAGGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCAATCAGACTCGTTTGCAGAGGCTCAGCTTTCCTTCGGGATTGTGTATTCTTCTGTCAACGGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGTTCTGGGAACGTAGCTCTCTTCGGAGAGTGTTATAGCCCGGAGCGTAATGCGG-CAGCCGAGACTGAGGTCCGCGCTCTTGCTAGGATGCTGGCATAATGGTTGTA---------------------------- Graphis_implicata_Luecking16103b GGACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTCAAGGAGAAAAAAGAGGATTAGATACCCTTGTATAGTGGGCAGACAATGATGAGTGTCATATGCAAGATATTTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACCCGTAGTGAAGTATGTTGTTTAATTTGTAGTTACGCAAATAACCTTACCACAATTTGTATAGCTTGTAATTTTAAAAACTTGTATACTATTATTTATATATAATATAGTAGAACTTACAAGCTACAAGCGTTGCACGGCTGTTTTTAGTCAATGTTGTGAAACTTTGGTTAGGTCCATTAAATTGATGTAAGCCCTTGCTTTATTTAATAAAAAGTAGTTCGCCACTGTATTGGTAGCGATAGGTGCTTCGGGAGAGATGATGGTCCAAGTCCCTTGGAATAGGGCGTCACAGAGGGTGAGAATCCCGTATGTGGCCAGTCATCGATTCCATGTGAGGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCAATCAGACTCGTTTGCAGAGGCTCAGCTTTCCTTCGGGATTGTGTATTCTTCTGTCAACGGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGTTCTGGGAACGTAGCTCTCTTCGGAGAGTGTTATAGCCCGGAGCGTAATGCGGCCAGCCGAGACTGAGGTCCGCGCTCTTGCTAGGATGCTGGCATAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCA-- Graphis_implicata_Luecking28039 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGCTTCGGGAGAGATGATGGTCCAAGTCCCTTGGAATAGGGCGTCACAGAGGGTGAGAATCCCGTATGTGGCCAGTCATCGATTCCATGTGAGGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCAATCAGACTCGTTTGCAGAGGCTCAGCTTTCCTTCGGGATTGTGTATTCTTCTGTCAACGGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGTTCTGGGAATGTAGCTCTCTTCGGAGAGTGTTATAGCCCGGAGCGTAATGCGGCCAGCCGAGACTGAGGTCCGCGCTCTTGCTAGGATGCTGGCATAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCA-- Graphis_implicata_Luecking28104 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGCTTCGGGAGAGATGATGGTCCAAGTCCCTTGGAATAGGGCGTCCCAAAGGGTGAGAATCCCGTATGTGGCCAGTCATCGATTCCATGTGAGGCCCTTTCGACAAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAAAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCAATCAGACTCGTTTGCAGAGGCTCAAGTTTCCTTCGGGATTGTGTATTCTTCTGTCAACGGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGTTCTGGGAATGTAGCTCTCTTCGGAGAGTGTTATAGCCCGGAGCGTAATGCGGCCAGCCGAGACTGAGGTCCGCGCTCTTGCTAGGATGCTGGCATAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCA-- Graphis_implicata_Luecking28527 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGCTTCGGAAGAGATGATGGTCCAAGTCCCTTGGAATAGGGCGTCACAGAGGGTGAGAATCCCGTATGTGACCGATCTTCAATTCCATGTGAAGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCAATCAGACTCGTTTGCAGAAGCTCAGCCTTCCCTCGGGATGGTGTATTCTTCTGTCAACGGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGTTTTGGGAATGTAGCTCTCTTCGGAGAGTGTTATAGCCCGGAGCGTAATGCGACCAGCCGAGACTGAGGTCCGCGTTTTTACTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCA-- Graphis_implicata_RivasPlata0103A GGACTGGTAAAGGCGAAGGCAACCTTTTATG-AAAAACTGACGTTAAGGGACGAAGGCTCAAGGAGAAAAAAGAGGATTAGATACCCTTGTATAGTGGGCAGACAATGATGAGTGTCATATGCAAGATGTTTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACCCGTAGTGAAGTATGTTGTTTAATTTGTAAGTACGCAAATAACCTTACCACAATTTGTATAGCTTGTAATTTTAATAACTTGTATACTATTATTTATATATAATATAGTAGAACTTACAAGCTACAAGCGTTGCACGGCTGTTTTTATTTAAGGTTGTGAAACTTTGGTTAGGTCCATTAAATTGATGTAAAACAGTACTTTATTTAATAAAAAGTAGTTCGCCACTGTATTAGTAGCGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Graphis_leptoclada_Lumbsch20535 GGACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTGAGGGACGAAGGCTCAAGGAGAAAAAAGAGGATTAGATACCCTTGTATAGTGGGCAGACAATGATGAGTGTCATATGTAAGATTTTTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACCCGTAGTGAAGTATGTTGTTTAATTTGTAGGTACGCAAATAACCTTACCACAATTTGTATAGCTTGTAATTTAAAAAACTAGTATGCTATTATTTATATATAATATAGTAGAACTTACAAGCTACAAGCGTTGCACGGCTGTTTTTAGTCAATGTTGTGAAACTTTGGTTAGGTCCATTAAATTGATGTAAGCCCTTGCTTTATTTATTATAAAGCAGTTCGCCGCTGTATGG---------GGTGCTTCGGAAGAGATGATGGTCTAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTACGTGACTAATTATCGATTCCATGTGAAGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTCGCAATCAGACTCGTTTGCAGAAGCTCAGCCTTCCTACGGGATGGTGTATTCTTCTGTCAACGGGCCAGCATCAGTTTCGGCGGTTGGATAAAGACTCTGGGAACGTAGCTCTTCTCGGAGAGTGTTATAGCCCGGAGTGTAATGCAGCCAGCTGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCTAGCGACCCGTCTTGAAACACGGACCA-- Graphis_librata_Luecking28001 GGACTGGTAAAGGCGCAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTCAAGGAGAAAAAAGAGGATTAGATACCCTCGTATAGTGGGCAGACAATGATGAGTGTCATACGTAAG----TTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACCCGTAGTGAAGTATGTTGTTTAATTTGTAGGTACGCAAATAACCTTACCACAATTTGTATAGCTTG--------------------------------------------------------TACAAGCGTTGCATGGCTGTTTTTAGTCAATGTTGTGAAACTTTGGTTAGGTCCATTAAATTGATGTAAGCCCTTGCTTTATTTAATAAAAAGCAGTTCGCCACTGTACTGGTAGCGATAGGTGCTTCGGAAGAGATAAAGGTCCAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTACGCGACC?ATTATCGATTCCATGTGAAGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTATATGTCATCTCAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTCGTTTGCAGAAGCTCAGCCTTCCTCCGGGACGGTGTATTCTTCTGTCAACGGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGTTCTGGGAACGTAGCTCCCTTAGGAGAGTGTTATAGCCCGGAGCGCAATGCGG-CAGCCGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCT---------------------------- Graphis_librata_Luecking28001b GGACTGGTAAAGGCGCAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTCAAGGAGAAAAAAGAGGATTAGATACCCTCGTATAGTGGGCAGACAATGATGAGTGTCATACGTAAGATATTTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACCCGTAGTGAAGTATGTTGTTTAATTTGTAGGTACGCAAATAACCTTACCACAATTTGTATAGCTTGTAATTTTAAAAACTTGTATGCTATTGTTTATA----ATATAGTAGAACTTACAAGCTACAAGCGTTGCATGGCTGTTTTTAGTCAATGTTGTGAAACTTTGGTTAGGTCCATTAAATTGATGTAAGCCCTTGCTTTATTTAATAAAAAGCAGTTCGCCACTGTACTGGTAGCGATAGGTGCTTCGGAAGAGATAAAGGTCCAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTACGCGACCGATTATCGATTCCATGTGAAGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTATATGTCATCTCAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTCGTTTGCAGAAGCTCAGCCTTCCTCCGGGACGGTGTATTCTTCTGTCAACGGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGTTCTGGGAACGTAGCTCCCTTAGGAGAGTGTTATAGCCCGGAGCGCAATGCGGCCAGCCGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCTAGCGACCCGTCTTGAAACACGGACCA-- Graphis_librata_Lueckinh28007 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGCTTCGGAAGAGATAAAGGTCCAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTACGCGACCGATTATCGATTCCATGTGAAGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTATATGTCATCTTAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTCGTTTGCAGAAGCTCAGCCTTCCTCCGGGACGGTGTATTCTTCTGTCAACGGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGTTCTGGGAACGTAGCTCCCTTCGGAGAGTGTTATAGCCCGGAGCGCAATGCGGCCAGCCGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCTAGCGACCCGTCTTGAAACACGGACCA-- Graphis_pavoniana_Luecking16100c GAACTGGTAAAGGCGAAGGCAACCTTCTATGTAAAAACTGACGTTAAGGGACGAAGGCTTGA-ATTAAGTAATAGGATTAGATACCCTAGTATTGTGAGCAGACAATGATGAGTGTCATATGCAAGATAATTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACATGGCAACATGGGAACTGAAATCATTAGACCGTTTCTGAAACTCGTAGTGAAGTATGTTGTTTAATTTGATAATCCGCAAAGAACCTTACCACAATTTGTATTACTTGAGCATA-------TAATATTATAT----TATATTTTATAAAATACAAAACACAAGTAACAAGCGTTGCACGGCTGTCTTCAGTTAATGTTGTGAAACTTTGGTTAGATCCATTTAATTGACGTAAACCCTTGCTTTATTTGTTATAAAGCAGTTCGCCGCTATATTGGTAGTGATAGGTGCTTTGGGAGCGACGACGGTGCAAGTTTCCTGGAACGGAGCGTCACAGAGGGTGAGAATCCCGTACGCCACCGATTGTCAATCCCGCGTAAAGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCGCGTGCTCAGCCTTCCTTTGGGATGGTGCACTCTCGTGCGGACAGGCCAGCATCGGTTCCGGCGGCCGGATAAAGGCCTTGGGCATGTAGCTCCCTTCGGGGTGTGTTATAGCCCGAGGTGAAATGCGGCCTGCTGGGACCGAGGACCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCG-- Graphis_proserpens_RivasPlata2065 GGACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTCAAGGAGAAAAAAGAGGATTAGATACCCTCGTATAGTGGGCAGACAATGATGAGTGTCATATGCAAGATAATTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACCCGTAGTGAAGTATGTTGTTTAATTTGTAGGTACGCAAATAACCTTACCACAATTTGTATAGCTTGTAATTTTAAAAACTTGTATGCTATTATTTATATATTATATAGTAGAACTTACAAGCTACAAGCGTTGCACGGCTGTTTTTAGTCAATGTTGTGAAACTTTGGTTAGGTCCATTAAATTGATGTAAGCCCTTACTTTATTTATTAAAAAGTAGTTCGCTGCTGTATGGGTGGCGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Graphis_pseudocinerea_Luecking26531 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGCCTCGGGAGCGACGACGGTGCAAGTTTCCTGGAACGGGGCGTCGAAGAGGGTGAGAATCCCGTCTGTCGCCGAACGTCAAACCCGCGTGAGGCCCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGACGGTGGTAAGTTCCATCTAAAGCTAAATATCCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGTCCGCGCGTGCTCAGCTGTTCTTCGGTGCAGTGCATTCTCGTGCGGACGGGCCAGCATCGGTTTCGGCGGCCGGACAAAGGCCCTGGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCCGGGGTGCAATGCGGCCTGCCGGGACCGAGGATCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCCAGCGACCCGTCTTGAAACACGGACCA-- Graphis_pseudocinerea_Luecking26532a --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGCCTCGGGAGCGACGACGGTGCAAGTTTCCTGGAACGGGGCGTCGAAGAGGGTGAGAATCCCGTCTGTCGCCGAACGTCAAACCCGCGTGAGGCCCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGACGGTGGTAAGTTCCATCTAAAGCTAAATATCCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGTCCGCGCGTGCTCAGCTGTTCTTCGGTGCAGTGCATTCTCGTGCGGACGGGCCAGCATCGGTTTCGGCGGCCGGACAAAGGCCCTGGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCCGGGGTGCAATGCGGCCTGCCGGGACCGAGGATCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCCAGCGACCCGTCTTGAAACACGGACCA-- Graphis_pseudocinerea_Luecking26537 GAACTGGTAAAGGCGAAGGCAACCTTCTATGTAAAAACTGACGTTAAGGGACGAAGGCTCGA-ATTAAGTAACAGGATTAGATACCCTAGTATTGTGGGCAGACAATGATGAGTGTCATATGCAAGAAATTTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAACCATTAGACCGTTTCTGAAACTCGTAGTGAAGTATGTTGTTTAATTTGTTAGTCCTCAAAGAACCTTACCACAATTTGTATAACTTGAACATA------------------GATTTATATATTATCTGGT-------ACAAGTAACAAGCGTTGCACGGCTGTCTTCAGTTAATGTTGTGAAACTTTGGTTAGATCCATTTAATTGACGTAAACCCTTACTTTATTTATTATAAAGTAGTTCGCCGCTATATTGGTAGTGATAGGTGCCTCGGGAGCGACGACGGTGCAAGTTTCCTGGAACGGGGCGTCGAAGAGGGTGAGAATCCCGTCTGTCGCCGAACGTCAAACCCGCGTGAGGCCCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGACGGTGGTAAGTTCCATCTAAAGCTAAATATCCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGTCCGCGCGTGCTCAGCTGTTCTTCGGTGCAGTGCATTCTCGTGCGGACGGGCCAGCATCGGTTTCGGCGGCCGGACAAAGGCCCTGGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCCGGGGTGCAATGCGGCCTGCCGGGACCGAGGATCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCCAGCGACCCGTCTTGAAACACGGACCA-- Graphis_pseudoserpens_Luecking28003 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGTTTCGGAAGGGATGATGGTCCAAGTCCCTTGGAACAGGGCGTCGCAGAGGGTGAGAATCCCGTACGTGGCCAATCATCGATTCCGTGTGAAACCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTCGTTTGCAGAAGCTCAGCCT{CT}CCTCCGGGGTGGTGTATTCTTCTGCCAACGGGCCAGCATCAGTTTCGGCGGCTGGATAAAGACCCTGGGAACGTAGCTCTCCTCGGAGAGTGTTATAGCCCGGAGTGCAATGTAGCCAGCTGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCTAGCGACCCGTCTTGAAACACGGACCA-- Graphis_pseudoserpens_Luecking28048 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGTTTCGGAAGGGATGATGGTCCAAGTCCCTTGGAACAGGGCGTCGCAGAGGGTGAGAATCCCGTACGTGGCCAATCATCGATTCCGTGTGAAACCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTCGTTTGCAGAAGCTCAGCCTTCCTCCGGGGTGGTGTATTCTTCTGCCAACGGGCCAGCATCAGTTTCGGCGGCTGGATAAAGACCCTGGGAATGTAGCTCTCCTCGGAGAGTGTTATAGCCCGGAGTGCAATGTAGCCAGCTGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCTAGCGACCCGTCTTGAAACACGGACCA-- Graphis_rhizocola_Luecking28502 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGTCTCGGGAGCGATGACGGTGCAAGTCCCCTGGAATGGGGCGTCTCAGAGGGTGAGAATCCCGTACGCCACCGATCGTCAACCCCGCGTGAGACCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATCCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGGCCGCGCGTGCTCAGCCTCTCCTCGGAGTGGTGCACTCTCGCGCGGTCGGGCCAGCATCGGTTTCGGCGGTCGGACAAAGGCTCTGGGAACGTGGCTCCTCTCGGGGAGTGTTATAGCCCGGAGTGCAATGCGGCCTGCTGGGACCGAGGAACGCGCTCTTGCTAGGATGCTGGCGTAATGGTTGCCAGCGACCCGTCTTGAAACACGGACCA-- Graphis_rhizocola_Luecking28512 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGTCTCGGGAGCGACGACGGTGCAAGTCCCCTGGAATGGGGCGTCTCAGAGGGTGAGAATCCCGTACGCCACCGATCGTTAACCCCGCGTGAGACCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATCCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGGCCGCGCGTGCTCAGCCTCTCCTCGGAGCGGTGCACTCTCGCGCGGTCGGGCCAGCATCGGTTTCGGCGGTCGGACAAAGGCTTTGGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCCGGAGTGCAATGCGGCCTGCTGGGACCGAGGAACGCGCTCTCGCTAGGATGCTGGCGTAATGGTTGCCAGCGACCCGTCTTGAAACACGGACCA-- Graphis_rhizocola_Luecking28548 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGTCTCGGGAGCGATGACGGTGCAAGTCCCCTGGAATGGGGCGTCTCAGAGGGTGAGAATCCCGTACGCCACCGATCGTCAACCCCGCGTGAGACCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATCCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGGCCGCGCGTGCTCAGCCTCTCCTCGGAGTGGTGCACTCTCGCGCGGTCGGGCCAGCATCGGTTTCGGCGGTCGGACAAAGGCTCTGGGAACGTGGCTCCTCTCGGGGAGTGTTATAGCCCGGAGTGCAATGCGGCCTGCTGGGACCGAGGAACGCGCTCTTGCTAGGATGCTGGCGTAATGGTTGCCAGCGACCCGTCTTGAAACACGGACCA-- Graphis_rimulosa_RivasPlta1021H GAACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTCGA-ATTAAGTAACAGGATTAGATACCCTAGTATTGTGGGCAGACAATGATGAGTGTCATATGCAAGAATATTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGACCGTTTCTGAAACTCGTAGTGAAGTATGTTGTTTAATTTGATGGTCCACAAAGAACCTTACCACAATTTGTATAACTTGAACATA----------------------TATAGATTTTAAACT--ATAATTCAAGTAACAAGCGTTGCACGGCTGTCTTCAGTTAATGTTGTGAAACTTTGGTTAGATCCATTTAATTGACGTAAACCCTTGCTTTATTTATTATAAAGCAGTTCGCCGCTATATTGGTAGTGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Graphis_scripta_Nelsen499 GGACTGGTAAAGGCGAAGGCAACCTTTTATGTAGAAACTGACGTTAAGGGACGAAGGCTCAAGGAGAAAAAAGAGGATTAGATACCCTCGTATAGTGGGCAGACAATGATGAGTGTCATATGTAAGA----TTTATGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACTCGTAGTGAAGTATGTTGTTTAATTTGTAGGTACGCAAATAACCTTACCACAATTTGAATAGCTTG--------------------------------------------------------TACAAGCGTTGCACGGCTGTTTTTAGTCAATGTTGTGAAACTTTGGTTAGGTCCATTAAATTGATGTAAGCCCTTACTTTATTTAATAAAAAGTAGTTCGCCGCTGTATGGGTAGCGATAGGTGTTTCGGGAGAGATGATGGTCCAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTATGTGACCATTCATCGATTCCATGTGAAACCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCACTTGCAATCAGACTCGTTTGCAGAAGCTCAGCCTTCCTTCGGGATGGTGTATTCTTCTGTTAACGGGCCAGCATCAGTTTCGGCGGCTGGATAAAGACTTCGAGAACGTAGCTCTCCTCGGAGAGTATTATAGCTCGGAGTGTAATGCAG-CAGTTGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTACT---------------------------- Graphis_scripta_Neuwirth11834 GGACTGGTAAAGGCGAAGGCAACCTTTTATGTAAAAACTGACGTTAAGGGACGAAGGCTCAAGGAGAAAAAAGAGGATTAGATACCCTCGTATAGTGGGCAGACAATGATGAGTGTCATATGTAAG----TTTTATGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACCCGTAGTGAAGTATGTTGTTTAATTTGTAGGTACGCAAATAACCTTACCACAATTTGTATAGCTTG--------------A-----------------------A-------------------CAAGCGTTGCACGGCTGTTGGTTGTCAATGTTGTGGAACTTT---------------------------------------------------------------------------AGGTGTTTCGGAAGAGATGATGGTCCAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTACGTGACC?ATTATCGATTCCATGCGAAACCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTCGTTTGCAGAAGCTCAGCCTTCCTTCGGGATGGTGTATTCTTCTGTCAACGGGCCAGCATCAGTTTCGGCGGCTGGATAAAGACTTTGAGAACGTAGCTCTTTTCGGAGAGTGTTATAGCTCGGAGTGTAATGCAG-CAGCTGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCT---------------------------- Graphis_scripta_Tonsberg42518 --------AAAGGCGAAGGCAACCTGTTATGTAAAAACTGTCGTTAAGGGACGAAGGCTCAAGGAGAAAAAAGAGGATTAGATACCCTCGTATAGTGGGCAGACAATGATGAGTGTCATATGTAAGA----TTTATGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGGCCGTTTCTGAAACTCGTAGTGAAGTATGTTGTTTAATTTGTAGGTACGCAAATAACCTTACCACAATTTGAATAGCTTG--------------------------------------------------A-------CAAGCGTTGCACGGCTGTTTTTAGTTAATGTTGTGAAACTTTGGTTAGGTCCATTAAATTGATGTAAGCCCTTACTTTATTTAATATAAAGTAGTTCGCCGCTGTATGGGTAGCGAT-----------------------------------------------------------------------------------------------------------------------------------------------GGTAAATTTCATGTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGGGGTTGCAATCAGACTCGTTTGCAGAAGTTCAGCCTTCTTTCGAGATGGTGTATTCTTCTGTCAACGGGCCAGCATCAGTTTCGGCGGTTGGATAAAGACTTTGAGAACGTATCTCTCCTCGGAGAGTGTTATAGCTCGGAGTGTAATGCAGC-AGCTGAGACTGAG------------------------------------------------------------------ Graphis_sp.A_Pitakpong311 -----------------------------------------CGTTAAGGGACGAAGGCTCGT-ATTAAATAATAGGATTAGAGACCCTTGTATCGTGGGCAGACAATGATGAGTGTCATATGCAAGAAAATTTTTTGTATAAATGAAAGTGTAAGCGCTCCCCCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGACCGTTTCTGAAACTCGTAGTGAAGTATGTTGTTTAATTTGATAATCCACAAATAACCTTACCACAACTTGAATTACTAGTGCTTTTATAAGCTTCCTAGTTATTTTCTATAAATGTATGAGT--AATATATTAGTAACAAGCGTTGCACGGCTGTCTTCAGTTAATGTTGTGAACCTTTGGTTAGATCCATTAAATTGACGTAAACCCTTGCTTTATTTGTTTA------------------------------AGGTGCTTCGGAAAAGATGATGGTCCAAGTCCCTT?GAACAGGGCGTCACAGAGGGTGAGAATCCCGTATGTGACCAATCATCGATTCCATGTGAAGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAATTGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTCGTTTGCAGATGCTCAGCCTTCCTTCGGGACGGTGTATTCATCTGTAGACGGGCCAGCATCAGTTTCGACGGCTGGATAAAGGTTCTGGGAACGTAGCTCTCTTCGGAGAGTGTTATAGCCCGGAGCGTAATGCGGCCAGTCGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCTA--------------------------- Graphis_sp.A_PitakpongA04 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGCTTCGGAAGAGATGATGGTCCAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTATGTGACCAATCATCGATTCCATGTGAAGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTCGTTTGCAGATGCTCAGCCTTCCTTCGGGACGGTGTATTCATCTGTAGACGGGCCAGCATCAGTTTCGACGGCTGGATAAAGGTTCTGGGAACGTAGCTCTCTTCGGAGAGTGTTATAGCCCGGAGCGTAATGCGGCCAGTCGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCTAGCGACCCGTCTTGAAACACGG------ Graphis_sp.A_PitakpongD205 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGCTTCGGAAGAGATGATGGTCCAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTATGTGACCAATCATCGATTCCATGTGAAGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTCGTTTGCAGATGCTCAGCCTTCCTTCGGGACGGTGTATTCATCTGTAGACGGGCCAGCATCAGTTTCGACGGCTGGATAAAGGTTCTGGGAACGTAGCTCTCTCCGGAGAGTGTTATAGCCCGGAGCGTAATGCGGCCAGTCGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCTAGCGACCCGTCTGAAAAA---------- Graphis_sp.A_PitakpongE108 GAACTGGTAAAGGCGAAGGCATCCTTTTATGTAAAACCTGACGTTAAGGGACGAAGGCTCGT-ATTAAATAATAGGATTAGAGACCCTAGTATCGTGGGCAGCCAATGATGAGTGTCATATGCAAGAAAATTTTGTGTATAAATGAAAGTGTAAGCACTCCACCTCAAGAGTAACGTGGCAACATGGGAACTGAAATCATTAGACCGTTTCTGAAACTCGTAGTGAAGTATGTTGTTTAATTTGATAATCCACAAATAACCTTACCACAAC{CT}TGAATTA{AC}TAGTGCTTTTATAAGCTTCCTAGTTATTTTCTATAAATGTATGAGT--AATATATTAGTAACAAGCGTTGCACGGCTGTCTTCAGTTAATGTTGTGAAACTTTGGTTAGATCCATTAAATTGACGTAAA{AC}CCTTGCTTTATTTGTTATAAAGCAGTTCGCCGCTATATTGGTAGTGATAGGTGCTTCGGAAAAGATGATGGTCTAAGTCCTTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTATGTGACCAATCATCGATTCCATGTGAAGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTCGTTTGCAGATGCTCAGCCTTCCTTCGGGACGGTGTATTCATCTGTAGACGGGCCAGCATCAGTTTCGACGGCTGGATAAAGGTTCTGGGAACGTAGCTCTCTTCGGAGAGTGTTATAGCCCGGAGCGTAATGCGGCCAGTCGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCTAGCGACCCGTCTTGAAA----------- Graphis_streblocarpa_RivasPlata1015E --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGCTTCGGAAGAGATGATGGTCCAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGACCGATTATCGCTTCCATGTGAAGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTCGTTTGCAGAAGCTCAGCCTTCCTTCGGGATGGTGTATTCTTCTGTCAACGGGCCAGCATCAGTTTTGACGGCTGGATAAAGACTCTGGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGGAATGTAATGCAGCCAGTTGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCTAGCGACCCGTCTTGAAACACGGACCA-- Graphis_tenella_RivasPlata1007G --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGATGCTTCGGAAGAGATGATGGTTCAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAGTCCCGTATGTGACCAATCGTCGATTCCATGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTAGCAATCAGACTCGTTTGCAGAAGCTCAGCTCTCCTTCGGGATAGTGTATTCTTCTGTCAACGGGCCAGCATCAGTTTCGGCGGTTGGATAAAAACTTTGGGAACATAGCTCTCCTCGGAGAGTGTTATAGCCCGGAGTACAATGCTGCCAGCTGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGTTAGCGACCCGTCTTGAAACACGGACCA-- Graphis_tsunodae_Luecking26096 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGCTTCGGAAGAGATGATGGTCCAAGTACCTTGGAACAGGTCGTCGCAGAGGGTGAGAATCCCGTATGTGACCAATCATCGATTCCATGTGAAGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCAATCAGACTCGTTTGCAGAAGCTCAGCCCTCTTTCGGGATGGTGTATTCTTCTGTCAATGGGCCAGCATCAGTTTCGGCGGTTGGATAAAGACTTTGGGAACGTAGCTCTCTTCGGAGAGTGTTATAGCCCGGAGTGTAATGCAGCTAGCTGAGACTGAGGTCCGCGCTTTTGCTAGGATGCTGGCGTAATGGTTGCTAGCGACCCGTCTTGAAACACGGACCA-- Graphis_vestitoides_RivasPlata2078 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGCCTCGGGAGCGACGACGGTGCAAGTTTCCTGGAACGGAGCGTCGAAGAGGGTGAGAATCCCGTCCGTCGCCGAACGTCAAACCCGCGTGAGGCCCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGACGGTGGTAAGTTCCATCTAAAGCTAAATATCCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGTCCGCGCGTGCTCAACCGTCCTTCGGGGCGGCTCATTCTCGCGCGGACGGGCCAGCATCGGTTTCGGCGGCCGGACAAAGGCCCTGGGAACGTAGCTCCCTCCGGGGAGTGTTATAGCCCGGGGTGCAATGCGGCCCGCCGGGACCGAGGATCGCGCTCTCGCTAGGATGCTGGCGTAATGGTTGCCAGCGACCCGTCTTGAAACACGGACCA-- Graphis_xanthospora_Luecking26535 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGCCTCGGGGGAGATGTAGGTGCAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTACGCCACCGGAGGTCGACCCCGCGTGAGGCCCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAGGCTAAATATCCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCCCGCGCGTGCTCAGCCGTCCTCCGGGGCGGTGCACTCTCGCGCGGGCGGGCCAGCATCGGTTTCGGCGGCCGGACAAAGGCTCTGGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTGGGGTGCAATGCGGCCCGCCGGGACCGAGGATCGCGCTCTTGCTAGGATGCTGGCGTAATGGTTGCCAGCGACCCGTCTTGAAACACGGACCA-- ; END; BEGIN TREES; TITLE Graphis_mtSSU_and_nuLSU_RAxML_bipartitions; LINK TAXA = Taxa1; TRANSLATE 1 Diorygma_antillarum_Luecking33019, 2 Diorygma_minisporum_Lumbsch19543v, 3 Graphis_albissima_Rivas1004D, 4 Graphis_anfractuosa_Hernandez1340, 5 Graphis_angustata_Luecking28102, 6 Graphis_caesiella_Berger17247, 7 Graphis_caesiella_LUmbsch_20530a, 8 Graphis_caesiella_Lumbsch20540i, 9 Graphis_chrysocarpa_Luecking0035, 10 Graphis_cinerea_Kalb26950, 11 Graphis_dichotoma_RivasPlata2088, 12 Graphis_furcata_Rivas_pLata1172Q, 13 Graphis_gracilescens_Luecking33942B, 14 Graphis_handelii_GreenGR4BH, 15 Graphis_illinata_Lumbsch19639, 16 Graphis_implicata_Luecking16103a, 17 Graphis_implicata_Luecking16103b, 18 Graphis_implicata_Luecking28039, 19 Graphis_implicata_Luecking28104, 20 Graphis_implicata_Luecking28527, 21 Graphis_implicata_RivasPlata0103A, 22 Graphis_leptoclada_Lumbsch20535, 23 Graphis_librata_Luecking28001, 24 Graphis_librata_Luecking28001b, 25 Graphis_librata_Lueckinh28007, 26 Graphis_pavoniana_Luecking16100c, 27 Graphis_proserpens_RivasPlata2065, 28 Graphis_pseudocinerea_Luecking26531, 29 Graphis_pseudocinerea_Luecking26532a, 30 Graphis_pseudocinerea_Luecking26537, 31 Graphis_pseudoserpens_Luecking28003, 32 Graphis_pseudoserpens_Luecking28048, 33 Graphis_rhizocola_Luecking28502, 34 Graphis_rhizocola_Luecking28512, 35 Graphis_rhizocola_Luecking28548, 36 Graphis_rimulosa_RivasPlta1021H, 37 Graphis_scripta_Nelsen499, 38 Graphis_scripta_Neuwirth11834, 39 Graphis_scripta_Tonsberg42518, 40 Graphis_sp.A_Pitakpong311, 41 Graphis_sp.A_PitakpongA04, 42 Graphis_sp.A_PitakpongD205, 43 Graphis_sp.A_PitakpongE108, 44 Graphis_streblocarpa_RivasPlata1015E, 45 Graphis_tenella_RivasPlata1007G, 46 Graphis_tsunodae_Luecking26096, 47 Graphis_vestitoides_RivasPlata2078, 48 Graphis_xanthospora_Luecking26535; TREE tree_1 = [&R] ((1:0.056998,2:0.065723):0.021302,((26:0.048535,((34:0.00634,(33:2.0E-6,35:2.0E-6):0.005003):0.039977,(48:0.032804,((10:0.026229,36:0.016025):0.009093,(9:0.016588,((47:0.016122,5:0.011691):0.002535,(15:0.022465,(28:2.0E-6,(29:2.0E-6,30:2.0E-6):2.0E-6):0.005182):0.001142):0.006347):0.017276):0.018431):0.004509):0.006158):0.042887,((14:0.012503,((43:0.009415,42:0.003514):0.003902,(40:2.0E-6,41:0.007495):2.0E-6):0.02552):0.018781,(4:0.030865,(((25:2.0E-6,(24:2.0E-6,23:2.0E-6):0.003098):0.023016,(20:0.01922,(21:0.032428,((16:2.0E-6,17:2.0E-6):7.08E-4,(18:2.0E-6,19:0.011238):0.00269):0.004672):0.009308):0.005069):0.002119,(27:0.014754,(44:0.018906,(((13:0.01761,22:0.007131):0.005925,(45:0.030854,(46:0.013247,11:0.00911):0.004236):0.006203):0.003764,((31:2.0E-6,32:0.001828):0.020955,((37:0.010861,38:0.021985):0.006352,(39:0.011083,(12:0.007537,(3:0.00488,(6:2.0E-6,(8:2.0E-6,7:2.0E-6):2.0E-6):0.028601):0.011299):0.003872):2.03E-4):0.003711):0.003456):0.002755):0.004126):0.004451):0.014021):0.036353):0.03876):0.021302); END;