#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on February 06, 2023; 5:27 GMT TreeBASE (cc) 1994-2008 Study reference: Couch B., & Kohn L. 2002. A multilocus gene genealogy concordant with host preference indicates segregation of a new species, Magnaporthe oryzae, from M. grisea. Mycologia, 94(4): 683-693. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S833] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=27; TAXLABELS 'Magnaporthe grisea frm Digitaria horizontalis Py-D' Magnaporthe_grisea_frm_Digitaria_smutsii_JP34 Magnaporthe_grisea_frm_Digitaria_sp._81T4 Magnaporthe_grisea_frm_Digitaria_sp._91T16 Magnaporthe_grisea_frm_Eleusine_coracana_1122 Magnaporthe_grisea_frm_Eleusine_coracana_RW12 Magnaporthe_grisea_frm_Eleusine_indica_C10 Magnaporthe_grisea_frm_Eleusine_indica_T28 'Magnaporthe grisea frm Eragrostis curvula K76-79' Magnaporthe_grisea_frm_Eragrostis_curvula_NI909 Magnaporthe_grisea_frm_Lolium_perenne_330 Magnaporthe_grisea_frm_Lolium_perenne_365 'Magnaporthe grisea frm Oryza sativa BK-19' Magnaporthe_grisea_frm_Oryza_sativa_A119 Magnaporthe_grisea_frm_Oryza_sativa_A264 Magnaporthe_grisea_frm_Oryza_sativa_A347 Magnaporthe_grisea_frm_Oryza_sativa_A598 'Magnaporthe grisea frm Oryza sativa BK-6' Magnaporthe_grisea_frm_Oryza_sativa_Guy11 'Magnaporthe grisea frm Oryza sativa ML-56' 'Magnaporthe grisea frm Oryza sativa ML-91' 'Magnaporthe grisea frm Oryza sativa R694-2b' 'Magnaporthe grisea frm Oryza sativa R707-1E' Magnaporthe_grisea_frm_Setaria_sp._1152 Magnaporthe_grisea_frm_Setaria_sp._G48 Magnaporthe_grisea_frm_lab_strain_FGSC_8465 Magnaporthe_grisea_frm_lab_strain_FGSC_8470 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=31; TAXLABELS 'Magnaporthe grisea frm Digitaria horizontalis Py-D' Magnaporthe_grisea_frm_Digitaria_smutsii_JP34 Magnaporthe_grisea_frm_Digitaria_sp._81T4 Magnaporthe_grisea_frm_Digitaria_sp._91T16 Magnaporthe_grisea_frm_Eleusine_coracana_1122 Magnaporthe_grisea_frm_Eleusine_coracana_RW12 Magnaporthe_grisea_frm_Eleusine_indica_C10 Magnaporthe_grisea_frm_Eleusine_indica_T28 'Magnaporthe grisea frm Eragrostis curvula K76-79' Magnaporthe_grisea_frm_Eragrostis_curvula_NI909 Magnaporthe_grisea_frm_Lolium_perenne_330 Magnaporthe_grisea_frm_Lolium_perenne_365 'Magnaporthe grisea frm Oryza sativa BK-19' Magnaporthe_grisea_frm_Oryza_sativa_A119 Magnaporthe_grisea_frm_Oryza_sativa_A264 Magnaporthe_grisea_frm_Oryza_sativa_A347 Magnaporthe_grisea_frm_Oryza_sativa_A598 'Magnaporthe grisea frm Oryza sativa BK-6' Magnaporthe_grisea_frm_Oryza_sativa_Guy11 'Magnaporthe grisea frm Oryza sativa ML-56' 'Magnaporthe grisea frm Oryza sativa ML-91' 'Magnaporthe grisea frm Oryza sativa R694-2b' 'Magnaporthe grisea frm Oryza sativa R707-1E' Magnaporthe_grisea_frm_Setaria_sp._1152 Magnaporthe_grisea_frm_Setaria_sp._G48 Magnaporthe_grisea_frm_lab_strain_FGSC_8465 Magnaporthe_grisea_frm_lab_strain_FGSC_8470 Magnaporthe_poae Magnaporthe_rhizophila_58114 Magnaporthe_rhizophila_96043 'Magnaporthe salvinii frm Oryza sativa MS-1' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M269] TITLE Figs._3_and_4; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1580; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] 'Magnaporthe grisea frm Digitaria horizontalis Py-D' CGGTGATGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT-------CCCAAAAATGC---CAATC--------GTCAGCT---TCCGGTCTGTCGACA------------------------------------GATGTCC------TCTGTCGCATTCCGCGATACTTGGTTAG--AATGAGTGACT-GAT----------------AACTTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATTATCCTAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAGTCCCCTGGATGAT--GATATCCATGGCTT----CGGC-ACAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGCTTTGCTCCGTTGACCAGCCGTGGCGCCCACTCTTTCCGCGCCGTCACTGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAACGGTCGCTACCTGACCTGCTCTGCCATCTTGTAAGTGACCATGACCACATC---------CACA---TGACCCA-AGAGTTTGAACGTCAACTGATAA-------CGAT-ACCA--CCACAGCCGTGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCGCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACTGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCATGGCCTTACTTCT----CTCTGTCTACTATTCGATTGGC--TAGACATCGACTGCATGCACG--------------------------------------------------CTGTCAAGATACTGATGAAGGATCTCC---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCAGCCCATAACACTGCAGTATACCG-ATTGCGCGCT-ATCGGCGACCGCC-CTCTCCGAGAATCAGAGGTTTGCGATCGCTACGACGTCGCTTGAATTCCTGCCTTGCGGAATGCAGAAACTAAAATAAT--CGTATTCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCGCTCGGCCAGAACCCTTCTGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGAAAATAGCCCACGCGAAC-CCGAGACT---GGATTAAGACTCGAGCAGTTG------GGACTT--GCTGACAGCT-------TCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Digitaria_smutsii_JP34 CGGTGATGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT-------CCCAAAAATGC---CAATC--------GTCAGCT---TCCGGTCTGTCGACA------------------------------------GATGTCC------TCTGTCGCATTCCGCGATACTTGGTTAG--AATGAGTGACT-GAT----------------AACTTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATTATCCTAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAGTCCCCTGGATGAT--GATATCCATGGCTT----CGGC-ACAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTTGCTCCGTTGACCAGCCGTGGCGCCCACTCTTTCCGCGCCGTCACTGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAACGGTCGCTACCTGACCTGCTCTGCCATCTTGTAAGTGACCATGACCACATC---------CACA---TGACCCA-AGAGTTTGAACGTCAACTGATAA-------CGAT-ACCA--CCACAGCCGTGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCGCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACTGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCATGGCCTTACTTCT----CTCTGTCTACTATTCGATTGGC--TAGACATCGACTGCATGCACG--------------------------------------------------CTGTCAAGATACTGATGAAGGATCTCC---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCAGCCCATAACACTGCAGTATACCG-ATTGCGCGCT-ATCGGCGACCGCC-CTCTCCGAGAACCAGAGGTTTGCGATCGCTACGACGTCGCTTGAATTCCTGCCTTGCGGAATGCAGAAACTAAAATAAT--CGTATTCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCGCTCGGCCAGAACCCTTCTGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGAAAATAGCCCACGCGAAC-CCGAGACT---GGATTAAGACTCGAGCAGTTG------GGACTT--GCTGACAGCT-------TCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Digitaria_sp._81T4 CGGTGATGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT-------CCCAAAAATGC---CAATC--------GTCAGCT---TCCGGTCTGTCGACA------------------------------------GATGTCC------TCTGTCGCATTCCGCGATACTTGGTTAG--AATGAGTGACT-GAT----------------AACTTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATTATCCTAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAGTCCCCTGGATGAT--GATATCCATGGCTT----CGGC-ACAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTTGCTCCGTTGACCAGCCGTGGCGCCCACTCTTTCCGCGCCGTCACTGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAACGGTCGCTACCTGACCTGCTCTGCCATCTTGTAAGTGACCATGACCACATC---------CACA---TGACCCA-AGAGTTTGAACGTCAACTGATAA-------CGAT-ACCA--CCACAGCCGTGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCGCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACTGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCATGGCCTTACTTCT----CTCTGTCTACTATTCGATTGGC--TAGACATCGACTGCATGCACG--------------------------------------------------CTGTCAAGATACTGATGAAGGATCTCC---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCAGCCCATAACACTGCAGTATACCG-ATTGCGCGCT-ATCGGCGACCGCC-CTCTCCGAGAATCAGAGGTTTGCGATCGCTACGACGTCGCTTGAATTCCTGCCTTGCGGAATGCAGAAACTAAAATAAT--CGTATTCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCGCTCGGCCAGAACCCTTCTGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGAAAATAGCCCACGCGAAC-CCGAGACT---GGATTAAGACTCGAGCAGTTG------GGACTT--GCTGACAGCT-------TCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Digitaria_sp._91T16 CGGTGATGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT-------CCCAAAAATGC---CAATC--------GTCAGCT---TCCGGTCTGTCGACA------------------------------------GATGTCC------TCTGTCGCATTCCGCGATACTTGGTTAG--AATGAGTGACT-GAT----------------AACTTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATTATCCTAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAGTCCCCTGGATGAT--GATATCCATGGCTT----CGGC-ACAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTTGCTCCGTTGACCAGCCGTGGCGCCCACTCTTTCCGCGCCGTCACTGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAACGGTCGCTACCTGACCTGCTCTGCCATCTTGTAAGTGACCATGACCACATC---------CACA---TGACCCA-AGAGTTTGAACGTCAACTGATAA-------CGAT-ACCA--CCACAGCCGTGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCGCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACTGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCATGGCCTTACTTCT----CTCTGTCTACTATTCGATTGGC--TAGACATCGACTGCATGCACG--------------------------------------------------CTGTCAAGATACTGATGAAGGATCTCC---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCAGCCCATAACACTGCAGTATACCG-ATTGCGCGCT-ATCGGCGACCGCC-CTCTCCGAGAATCAGAGGTTTGCGATCGCTACGACGTCGCTTGAATTCCTGCCTTGCGGAATGCAGAAACTAAAATAAT--CGTATTCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCGCTCGGCCAGAACCCTTCTGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGAAAATAGCCCACGCGAAC-CCGAGACT---GGATTAAGACTCGAGCAGTTG------GGACTT--GCTGACAGCT-------TCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Eleusine_coracana_1122 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTTACTTGT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Eleusine_coracana_RW12 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGA--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTTACTTGT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Eleusine_indica_C10 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGA--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGC?CC-TAGCCTTACTTGT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Eleusine_indica_T28 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGT?CACTGA?GCCCC-TAGCCTTACTTGT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC 'Magnaporthe grisea frm Eragrostis curvula K76-79' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCTATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTTACTTGT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Eragrostis_curvula_NI909 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTTACTTGT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Lolium_perenne_330 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TA?CCTTACTTG?----TTATG?G-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Lolium_perenne_365 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TA?CCTTACTTG?----TTATG?G-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC 'Magnaporthe grisea frm Oryza sativa BK-19' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTT----GT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Oryza_sativa_A119 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAACGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTT----GT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Oryza_sativa_A264 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTT----GT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Oryza_sativa_A347 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTT----GT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Oryza_sativa_A598 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTT----GT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC 'Magnaporthe grisea frm Oryza sativa BK-6' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTT----GT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Oryza_sativa_Guy11 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTT----GT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC 'Magnaporthe grisea frm Oryza sativa ML-56' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTA?GTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTT----GT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC 'Magnaporthe grisea frm Oryza sativa ML-91' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTT----GT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC 'Magnaporthe grisea frm Oryza sativa R694-2b' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTT----GT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC 'Magnaporthe grisea frm Oryza sativa R707-1E' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTT----GT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Setaria_sp._1152 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTTACTTGT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC Magnaporthe_grisea_frm_Setaria_sp._G48 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTTACTTGT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC Magnaporthe_grisea_frm_lab_strain_FGSC_8465 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTTACTTGT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC Magnaporthe_grisea_frm_lab_strain_FGSC_8470 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTT---------CCAATATGA---CAACC--------GTCAGCTC---CCGGTTTGTCGACA------------------------------------GATGTGC------TCTGTCGCAT-CCGCGATACTTGGTCAG--AATGAGAGACT-GAT-----------------AATTTTGCGATT------------------------------AGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTA------CTCCATT-TCCCAGGG--CCCACATTGGCCAATCC----TGCCAAGGCCCTAG-CCCCTGGATGAT--GATATCCATCGCGT----CGGC-AGAGATCTGACA------------------------------------------------GTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACC---------CTCA---TGGTTCG-AGGATTTGAACGTCAACTGACAA-------TAATCACCA--TAATAGCCGTGGAAAGGTTTCTATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-TAGCCTTACTTGT----TTATGTG-ACTGTCGAATTGAGT----GCATCGACTCCATGCTTT--------------------------------------------------CTACCAGGTTACTGATAGAGGACCTTG---------------------------ATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCG-ATTGCGCATT-CTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACC-CCGATAC----GGATTAAGCCTTGAGCTGGTG------GGGCTTT-GCTGACAGCT-------CCCAACAGAGTTCCTC Magnaporthe_poae CGGTGATGATGCTCCCCGTGCCGTCTTCCGTAAGTGCCCCGCATTTTACCTCTGCCCTCGGTTGCGCGCCATTCCTT-GCCGCCACCTCCATCCCGCCAGCAGCCACAAACTCTGCAGCGAACGGCTCCGGCCGT-------GACGGCC------GATGTTGTGGGCTGCGTGGAGGGGAAAGTAAAAAAGAGGAG-GAA----AAGGAAAATAGGAACCGTGGCGATAAAGTCTAACCACTACC-GCGG----TCCACAGCGTCCATTGTTGGTCGTCCCCGCCACCATGGGTGAGTAAACA--CACACCTCGACTTGATTTCCCCTTTTTGCGGCACA----TCCGCCTCCACAAAACACCTGGCTGGATCGAGTCCCGAGGTTTACCTCGTCGAGAGGTC-GACTTCTAGCCTCGCGCCTCAAGCCGTGCAGACCGCAGTGCTGACAACCC-AATCATGGCAGTATCATGATCGGCTTCGCTCCCCTGACCAGCCGCGGCGCCCACTCGTTCCGCGCCGTCACGGTGCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCCTCGGACTTCCGTAACGGTCGCTACCTGACCTGCTCTGCCATCTTGTAAGTGCTCACAGCCACGAAACTTTGCTTCTCTTGCTGGCAAA-ACCAAGCAATCTGTGACTAATCATCCGTCGTTTGCGCCAACCAATAGCCGCGGTAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCCCTCTGCTCCATCCCTCCTCGGGGCCTGAAGATGTCGTCGACCTTCATCGGCAACTCGACGGCCATCCAGGAGCTCTTCAAGCGTGTTGGCGAGCAGTTCACCGCCATGTTCAGGCGCAAGGCTTTCCTCCACTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACCGAGGCCCC-TGCCCTACCCCGCCGCCCGCAA-ACCCAGCGGCATTGTTCTAGCGTCACCACCACAACCACCACCACCACCACCACCACCACCATCACCACCGCCACCGCAGCCAAACCTTCGAGGCACGGCACCAGTTAAGGGACACGGTGCTGACGAGGCAAACTTTGCGTGCA---ATAACAGGACAAGGACGGCGATGGTTAGTCGATACAGCTTTTCCCGCAACCAT-GCACGCCG-ATGAAGAATT-CGCATCGC-----TGCCCCCGACACTGA-ACG---CCCTTGTCTG-GGCGGCGAGCCACGGACGAAGTACCCGGAAACATGAGCTAACAC------CTTC--GCCCAGGACAAATCACCACCAAGGAGCTCGGGACCGTCATGCGGTCGCTCGGCCAGAACCCTTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAACAATGGCACCATCGACTTCCCGGGTACGGCCACAGCCCAATACCCGACCCATACCTGACCGAATTTCTTGGTCCATGTTCATTCTCGCCTTGCGCTA-CATCA---CGCCCGCCATAGAATT?CTG Magnaporthe_rhizophila_58114 CGGTGATGATGCTCCCCGTGCCGTCTTCCGTAAGTGCCCCGCATTTTACCTCTGCCCTCGGTTGCGCACCATCCCTT-GCTGCCACCTCCATCCCGCCAGCAGCCACAAACTCTGCAGCGAACGGCTCCGGCCGT-------GATGGCC------GATGTTGTGGGCTGCGTGGAGGGGAAAGTAAAAAAGAGAAG-GAAGCGAAAGGAAAATAGGAACTGTGGCGATAAAGTCTAACCACTACCCGCGG----TCCACAGCGTCCATTGTTGGTCGTCCCCGCCACCATGGGTGAGTAAACA--CACACCTCGCCTTGACTTCCCCTTTTTGCGGCACA----TTCGCCTCGGCAAAACACCTGGCTGGACCGAGTCCCGAGGTTTACCTTGTTGAAAGGTC-GACTTCTAGCCTCGCGCCTCAAGCCGTGCAGACCGCAGTGCTGACAAACC-CGTCATGGCAGTATCATGATCGGTTTCGCTCCCCTGACCAGCCGCGGCGCCCACTCGTTCCGCGCCGTCACGGTGCCGGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCCTCGGATTTCCGCAACGGTCGCTACCTGACCTGCTCTGCCATCTTGTAAGTGCTCACAGCCACGAAACCTTGCTTCTCTTGCTGGCAAA-ACCAAGCAATCTGTGACTAACCATCCGTCGTTTGCGCCAACCAATAGCCGCGGTAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATTCAGACCGCCCTCTGCTCCATCCCTCCTCGGGGCCTGAAGATGTCGTCGACCTTCATCGGCAACTCGACGGCCATCCAGGAGCTCTTCAAGCGTGTTGGCGAGCAGTTCACCGGCATGTTCAGGCGCAAGGCTTTCCTTCACTGGTACACTGGTGAGGGCATGGACGAGATGGAGTTCACCGAGG--CC-TGCCCTACCCCGCCGCCCGCAA-ACCCAGCGGCATTGTTCTAGCGTCACCACCACAACCACCACCACCA---------------TCACCACCGCCACCGCAGCCAAACCTTCGAGGCACGGAACCAGTTAAGGGACACGATGCTGACGAGGCAAACTTTGCGTGCA---ACAACAGGACAAGGACGGCGATGGTTAGTCGATACAGCTTTTCCCGCAACCAT-GCACGCCG-ATGAAGAATT-CGCATCGC-----TACCCCCGACACTGA-ACG---CCCTTATCTG-GGCGGCGAGCCACGGATGAAGTGCCCAGAAACATGAGCTAACAC------CTTC--GCCCAGGACAAATCACCACCAAGGAGCTCGGGACCGTCATGCGGTCGCTCGGCCAGAACCCTTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAACAACGGCACTATCGACTTCCCGGGTACGGCCACAGCCCAATACCCGACCCATACCTGACCGAATTTCTTGGTCCATGTTCATTCTCGCCTTGCGCTAACATCA---CGCCCGCCATAGAATTCCTG Magnaporthe_rhizophila_96043 CGGTGATGATGCTCCCCGTGCCGTCTTCCGTAAGTGCCCCGCATTTTATCTCTGCCCTCGGTTGCGCGCCATCCCTT-GCCGCCATCTCCATCCCACCGGCAGCCACAAACTCTGCAGCGAACGGCTCCGGCCGT-------GATGGCC------GATGTTGTGGGCTGCGTGGAGGGGAAAGTAAAAAAGAGAAG-GAAGCGAAAGGAAAATAGGAACCGTGGCGATAAAGTCTAACCACTACC-GCGG----TCCACAGCGTCCATTGTTGGTCGTCCCCGCCACCATGGGTGAGTAAACA--CACACCTCGCCTTGATTTCCCCTTTTTGCGGCACA----TACACCTCCCCAAAACACCTGGCTGGACCGAGTCCCGAGGTTTACCTCGTTGAGAGGTC-GACTTCTAGCCTCGCGCCTCAAGCCGTGCAGGCCGCAGTGCTGACAAACC-CGTCATGGCAGTATCATGATCGGCTTCGCTCCCCTGACCAGCCGCGGCGCCCACTCGTTCCGCGCCGTCACGGTGCCTGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCCTCGGACTTCCGCAACGGTCGCTACCTGACCTGCTCTGCCATCTTGTAAGTGCTCACAGTCATGAA-CTTTGCTTATCCTGTTGGCAAA-ACCAAGCGATCTGTGACTAACAATCCGTCGTTTGCGCCAACCAATAGCCGCGGTAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCCCTCTGCTCCATCCCTCCTCGGGGCCTGAAGATGTCGTCGACCTTCATCGGCAACTCGACGGCCATCCAGGAGCTCTTCAAGCGTGTTGGCGAGCAGTTCACCGCCATGTTCAGGCGCAAGGCTTTCCTCCACTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACCGAGGCCCC-TGCCCTACCCCGCCGCCCGCAA-ACCCAGCGGCATTGTTCTAGCGTCACCACCACAACCACCACCACCA---------------TCACCACCGCCACCGCAGCCAAGCCTTCGAGGCACGGAACCAGTTAAGGGACACGATGCTGACGAGGCAAACTTTGCGTGCA---ATAACAGGACAAGGACGGCGATGGTTAGTCGATACAGCTTTTCCCGCAACCAT-GCACGCCG-ATGAAGAATT-CGCATCGC-----TACCCCCGATACTGA-ACG---CCCTTGTCTG-GGCGGCGAGCCACGGATGAAGTACCCAGAAGCATGAGCTAACAC------CTT--TGCCCAGGACAAATCACCACCAAGGAGCTCGGGACCGTCATGCGGTCGCTCGGCCAGAACCCTTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAACAATGGCACCATCGACTTCCCGGGTACGGCCACAGCCCAATACCCGACCCATACCTGACCGAATTTCTTGGTCCATGTTCATTCTCGCCTTGCGCTAACATCA---CGCCCGCCATAGAATTCCTG 'Magnaporthe salvinii frm Oryza sativa MS-1' CGGTGATGATGCTCCCCGTGCTGTCTTCCGTAAGTGCCCCGCATTTTACTTTTGGCCTCCG-TGCACGCCATCCCGCCGCTATTAGCTCCCTCCCGCCAGCAGCCCGCAACCCTGCTGCTGCTGCTGCAAAAAAAAAAAAAAGAAGCAAAGAAAAGATTTTGGCCATGGATTTACATGCCTGGCCAAATGGAGGAGAGAGTGAGAAGAAGACCTGGCACAAAGCACAAAAGTCTAACCACCGCCGCGGTTCATTTCTACAGCGTCCATTGTTGGTCGCCCCCGCCACCATGGGTGAGTAGCCTGCGCCCCCTCATGTTGATTTCCCTTCCTTGCGGCAAAGAAATTCGTAGCCACAAGTCATCTGGTCGCGCTG-GACCCAAAGTCTAGCTCATTGAGACGGT-GGTTGCGAGCCTCAAGCCTCGCGCACTGCAGACAGCGATGCTGACAACGCTCAATATGACAGTATC---------TTCGCCCCCCTGACCAGCCGCGGCGCCCACTCGTTCCGCGCTGTCACCGTGCCGGAGCTCACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCGTCGGACTTCCGCAACGGCCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGACAACA-CCGCGCC----TGATTCTAT--CTGCCTCAGATTATGCGGGGTTTGACTAACCA-CCACATGCTGCACCAAACAACAGCCGTGGCAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCCATTCCTCCCCGCGGCCTGAAGATGTCGTCGACCTTCATCGGAAACTCGACGGCCATCCAGGAGCTGTTCAAGCGTGTCGGCGAGCAGTTCACCGCCATGTTCAGGCGCAAGGCCTTCCTTCACTGGTACACTGGCGAGGGTATGGACGAGATGGAGTTCACCGAGGCCCC-TG?TCTACCCCGCCGCCCGCAAGACCCAGC?GCATCGCTCTAGTGTCACCACCAC-------A--------------------------------------GCCTGACCTACGAGGCTCGCGGCCGACCAAGCGACACGGTGCTAACAATGCCATGTTTGCGTGCA---ATAACAGGACAAGGATGGTGATGGTTCGTGGACTCGATTTCTCCCACATCCCT-TTTCCTCGGATGATGAATTACTCGCCCCCTT--TTTTCCCGCCACCGA-ACG---CCCTTCCCTG-GCCGGCGAACAAGTCGCCAGGAGCCCATAAATATGAGCTGACACT-----CTTCCTCCCCAGGACAAATCACCACCAAGGAGCTGGGCACCGTCATGCGCTCGCTCGGCCAGAACCCGTCCGAGTCTGAGCTGCAGGATATGATCAACGAGGTTGACGCCGACAACAACGGCACCATCGACTTCCCTGGTACGACCCTAGCCCAATGCGTTGCCAAAACCCTTCGGCCCAGCCTCC-CCC------T-CTCGGCTTGCGCTAACTGCTACCCGTCCGCCACAGAATTCCTG ; END; BEGIN SETS; CHARSET calExclude (CHARACTERS = Figs._3_and_4) = 998-1171 1194-1349 1478-1572 1577; CHARSET Bt1 (CHARACTERS = Figs._3_and_4) = 480-997; CHARSET actExclude (CHARACTERS = Figs._3_and_4) = 48-259 300-456 471-479; CHARSET ACT (CHARACTERS = Figs._3_and_4) = 1-479; CHARSET Cal (CHARACTERS = Figs._3_and_4) = 998-1580; CHARSET bt1Exclude (CHARACTERS = Figs._3_and_4) = 626-711 996-997; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Figs._3_and_4) = N: 1-1580; CODONPOSSET CodonPositions (CHARACTERS = Figs._3_and_4) = N: 1-1580; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M270] TITLE Figs._1_and_2; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1275; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Magnaporthe grisea frm Digitaria horizontalis Py-D' CGGTGATGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCCCAAAAATGCCAATCGTCAGCTTCCGGTCTGTCGACAGATGTCCTCTGTCGCATTCCGCGATACTTGGTTAGAATGAGTGACTGATAACTTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATTATCCTAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAGTCCCCTGGATGATGATATCCATGGCTTCGGCACAGATCTGACAGTTTGCATAGTATCATGATTGGCTTTGCTCCGTTGACCAGCCGTGGCGCCCACTCTTTCCGCGCCGTCACTGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAACGGTCGCTACCTGACCTGCTCTGCCATCTTGTAAGTGACCATGACCACATCCACATGACCCAAGAGTTTGAACGTCAACTGATAACGAT-ACCACCACAGCCGTGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCGCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACTGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-ATGGCCTTACTTCTCTCTGTCTACTATTCGATTGGCTAGACATCGACTGCATGCACGCTGTCAAGATACTGATGAAGGATCTCCATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCAGCCCATAACACTGCAGTATACCGATTGCGCGCTATCGGCGACCGCC-CTCTCCGAGAATCAGAGGTTTGCGATCGCTACGACGTCGCTTGAATTCCTGCCTTGCGGAATGCAGAAACTAAAATAAT--CGTATTCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCGCTCGGCCAGAACCCTTCTGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGAAAATAGCCCACGCGAACCCGAGACTGGATTAAGACTCGAGCAGTTGGGACTT-GCTGACAGCTTCCAACAGAGTTCC Magnaporthe_grisea_frm_Digitaria_smutsii_JP34 CGGTGATGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCCCAAAAATGCCAATCGTCAGCTTCCGGTCTGTCGACAGATGTCCTCTGTCGCATTCCGCGATACTTGGTTAGAATGAGTGACTGATAACTTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATTATCCTAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAGTCCCCTGGATGATGATATCCATGGCTTCGGCACAGATCTGACAGTTTGCATAGTATCATGATTGGTTTTGCTCCGTTGACCAGCCGTGGCGCCCACTCTTTCCGCGCCGTCACTGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAACGGTCGCTACCTGACCTGCTCTGCCATCTTGTAAGTGACCATGACCACATCCACATGACCCAAGAGTTTGAACGTCAACTGATAACGAT-ACCACCACAGCCGTGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCGCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACTGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-ATGGCCTTACTTCTCTCTGTCTACTATTCGATTGGCTAGACATCGACTGCATGCACGCTGTCAAGATACTGATGAAGGATCTCCATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCAGCCCATAACACTGCAGTATACCGATTGCGCGCTATCGGCGACCGCC-CTCTCCGAGAACCAGAGGTTTGCGATCGCTACGACGTCGCTTGAATTCCTGCCTTGCGGAATGCAGAAACTAAAATAAT--CGTATTCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCGCTCGGCCAGAACCCTTCTGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGAAAATAGCCCACGCGAACCCGAGACTGGATTAAGACTCGAGCAGTTGGGACTT-GCTGACAGCTTCCAACAGAGTTCC Magnaporthe_grisea_frm_Digitaria_sp._81T4 CGGTGATGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCCCAAAAATGCCAATCGTCAGCTTCCGGTCTGTCGACAGATGTCCTCTGTCGCATTCCGCGATACTTGGTTAGAATGAGTGACTGATAACTTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATTATCCTAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAGTCCCCTGGATGATGATATCCATGGCTTCGGCACAGATCTGACAGTTTGCATAGTATCATGATTGGTTTTGCTCCGTTGACCAGCCGTGGCGCCCACTCTTTCCGCGCCGTCACTGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAACGGTCGCTACCTGACCTGCTCTGCCATCTTGTAAGTGACCATGACCACATCCACATGACCCAAGAGTTTGAACGTCAACTGATAACGAT-ACCACCACAGCCGTGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCGCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACTGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-ATGGCCTTACTTCTCTCTGTCTACTATTCGATTGGCTAGACATCGACTGCATGCACGCTGTCAAGATACTGATGAAGGATCTCCATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCAGCCCATAACACTGCAGTATACCGATTGCGCGCTATCGGCGACCGCC-CTCTCCGAGAATCAGAGGTTTGCGATCGCTACGACGTCGCTTGAATTCCTGCCTTGCGGAATGCAGAAACTAAAATAAT--CGTATTCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCGCTCGGCCAGAACCCTTCTGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGAAAATAGCCCACGCGAACCCGAGACTGGATTAAGACTCGAGCAGTTGGGACTT-GCTGACAGCTTCCAACAGAGTTCC Magnaporthe_grisea_frm_Digitaria_sp._91T16 CGGTGATGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCCCAAAAATGCCAATCGTCAGCTTCCGGTCTGTCGACAGATGTCCTCTGTCGCATTCCGCGATACTTGGTTAGAATGAGTGACTGATAACTTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATTATCCTAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAGTCCCCTGGATGATGATATCCATGGCTTCGGCACAGATCTGACAGTTTGCATAGTATCATGATTGGTTTTGCTCCGTTGACCAGCCGTGGCGCCCACTCTTTCCGCGCCGTCACTGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAACGGTCGCTACCTGACCTGCTCTGCCATCTTGTAAGTGACCATGACCACATCCACATGACCCAAGAGTTTGAACGTCAACTGATAACGAT-ACCACCACAGCCGTGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCGCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACTGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCC-ATGGCCTTACTTCTCTCTGTCTACTATTCGATTGGCTAGACATCGACTGCATGCACGCTGTCAAGATACTGATGAAGGATCTCCATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCAGCCCATAACACTGCAGTATACCGATTGCGCGCTATCGGCGACCGCC-CTCTCCGAGAATCAGAGGTTTGCGATCGCTACGACGTCGCTTGAATTCCTGCCTTGCGGAATGCAGAAACTAAAATAAT--CGTATTCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCGCTCGGCCAGAACCCTTCTGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGAAAATAGCCCACGCGAACCCGAGACTGGATTAAGACTCGAGCAGTTGGGACTT-GCTGACAGCTTCCAACAGAGTTCC Magnaporthe_grisea_frm_Eleusine_coracana_1122 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Eleusine_coracana_RW12 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGACCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Eleusine_indica_C10 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGACCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGC?CCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Eleusine_indica_T28 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGT?CACTGA?GCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC 'Magnaporthe grisea frm Eragrostis curvula K76-79' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCTATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Eragrostis_curvula_NI909 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Lolium_perenne_330 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGT?TACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Lolium_perenne_365 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGAGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC 'Magnaporthe grisea frm Oryza sativa BK-19' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Oryza_sativa_A119 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAACGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Oryza_sativa_A264 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Oryza_sativa_A347 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Oryza_sativa_A598 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC 'Magnaporthe grisea frm Oryza sativa BK-6' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Oryza_sativa_Guy11 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC 'Magnaporthe grisea frm Oryza sativa ML-56' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC 'Magnaporthe grisea frm Oryza sativa ML-91' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC 'Magnaporthe grisea frm Oryza sativa R694-2b' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC 'Magnaporthe grisea frm Oryza sativa R707-1E' CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTT----GTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Setaria_sp._1152 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_Setaria_sp._G48 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_lab_strain_FGSC_8465 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC Magnaporthe_grisea_frm_lab_strain_FGSC_8470 CGGTGACGATGCTCCCCGCGCCGTCTTCCGTAAGTGCCCCGCAATTTCC--AATATGACAACCGTCAGCTCCCGGTTTGTCGACAGATGTGCTCTGTCGCAT-CCGCGATACTTGGTCAGAATGAGAGACTGATAA-TTTTGCGATTAGCGTCCATTGTCGGTCGCCCTCGTCACCATGGGTTAGTACTCCATT-TCCCAGGGCCCACATTGGCCAATCCTGCCAAGGCCCTAG-CCCCTGGATGATGATATCCATCGCGTCGGCAGAGATCTGACAGTTTGCATAGTATCATGATTGGTTTCGCTCCTTTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTGTCACCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCAGGAATGGTCGTTACCTGACCTGCTCTGCCATCTTGTGAGTGTTTATAACCGGACCCTCATGGTTCGAGGATTTGAACGTCAACTGACAATAATCACCATAATAGCCGTGGAAAGGTTTCTATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCCAGACCGCTCTCTGCTCTATCCCGCCCCGCGGCCTCAAGATGTCGTCGACTTTCATCGGAAACTCGACCGCCATCCAGGAGCTGTTCAAGCGTGTCGGTGAGCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGTTCACTGAGGCCCCTAG--CCTTACTTGTTTATGTG-ACTGTCGAATTGAGTG--CATCGACTCCATGCTTTCTACCAGGTTACTGATAGAGGACCTTGATATCAACAGGACAAGGACGGCGATGGTTAGTCTACACCCCTGCCCATACCACTACAGCACACCGATTGCGCATTCTCAGCGACGTCCTCACCGCGAGAACTAGACGTTTGCGATCGCTACGACGTCGCATGAGTTCCCGCCTCACGGAATGCAGAAACTAAAACAATACCCTTATCGATCAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTTCCCGGTAGGCAAACAGCCCACAAAACCCCGATAC-GGATTAAGCCTTGAGCTGGTGGGGCTTTGCTGACAGCTCCCAACAGAGTTCC ; END; BEGIN SETS; CHARSET bt1 (CHARACTERS = Figs._1_and_2) = 301-796; CHARSET cal (CHARACTERS = Figs._1_and_2) = 797-1275; CHARSET idel (CHARACTERS = Figs._1_and_2) = 50 802 809-811 838 1052; CHARSET act (CHARACTERS = Figs._1_and_2) = 1-300; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Figs._1_and_2) = N: 1-1275; CODONPOSSET CodonPositions (CHARACTERS = Figs._1_and_2) = N: 1-1275; END; BEGIN TREES; TITLE Tb6144; LINK TAXA = Taxa2; TRANSLATE 1 Magnaporthe_rhizophila_96043, 2 Magnaporthe_poae, 3 Magnaporthe_rhizophila_58114, 4 'Magnaporthe salvinii frm Oryza sativa MS-1', 5 Magnaporthe_grisea_frm_Digitaria_smutsii_JP34, 6 Magnaporthe_grisea_frm_Digitaria_sp._91T16, 7 'Magnaporthe grisea frm Digitaria horizontalis Py-D', 8 Magnaporthe_grisea_frm_Digitaria_sp._81T4, 9 Magnaporthe_grisea_frm_lab_strain_FGSC_8465, 10 Magnaporthe_grisea_frm_lab_strain_FGSC_8470, 11 Magnaporthe_grisea_frm_Setaria_sp._1152, 12 Magnaporthe_grisea_frm_Oryza_sativa_A119, 13 Magnaporthe_grisea_frm_Oryza_sativa_A598, 14 'Magnaporthe grisea frm Eragrostis curvula K76-79', 15 Magnaporthe_grisea_frm_Oryza_sativa_Guy11, 16 'Magnaporthe grisea frm Oryza sativa R694-2b', 17 'Magnaporthe grisea frm Oryza sativa ML-91', 18 Magnaporthe_grisea_frm_Eragrostis_curvula_NI909, 19 'Magnaporthe grisea frm Oryza sativa BK-6', 20 Magnaporthe_grisea_frm_Oryza_sativa_A347, 21 Magnaporthe_grisea_frm_Lolium_perenne_365, 22 Magnaporthe_grisea_frm_Eleusine_indica_C10, 23 Magnaporthe_grisea_frm_Eleusine_coracana_RW12, 24 'Magnaporthe grisea frm Oryza sativa R707-1E', 25 'Magnaporthe grisea frm Oryza sativa ML-56', 26 Magnaporthe_grisea_frm_Setaria_sp._G48, 27 'Magnaporthe grisea frm Oryza sativa BK-19', 28 Magnaporthe_grisea_frm_Oryza_sativa_A264, 29 Magnaporthe_grisea_frm_Lolium_perenne_330, 30 Magnaporthe_grisea_frm_Eleusine_indica_T28, 31 Magnaporthe_grisea_frm_Eleusine_coracana_1122; TREE Fig._3B = [&R] (4,((3,(2,1)),((31,30,29,28,27,26,25,24,23,22,21,20,19,18,17,16,15,14,13,12,11,10,9),(8,7,6,5)))); END; BEGIN TREES; TITLE Tb6140; LINK TAXA = Taxa1; TRANSLATE 1 Magnaporthe_grisea_frm_Digitaria_smutsii_JP34, 2 Magnaporthe_grisea_frm_Digitaria_sp._91T16, 3 'Magnaporthe grisea frm Digitaria horizontalis Py-D', 4 Magnaporthe_grisea_frm_Digitaria_sp._81T4, 5 Magnaporthe_grisea_frm_lab_strain_FGSC_8465, 6 Magnaporthe_grisea_frm_lab_strain_FGSC_8470, 7 Magnaporthe_grisea_frm_Setaria_sp._1152, 8 Magnaporthe_grisea_frm_Oryza_sativa_A119, 9 Magnaporthe_grisea_frm_Oryza_sativa_A598, 10 'Magnaporthe grisea frm Eragrostis curvula K76-79', 11 Magnaporthe_grisea_frm_Oryza_sativa_Guy11, 12 'Magnaporthe grisea frm Oryza sativa R694-2b', 13 'Magnaporthe grisea frm Oryza sativa ML-91', 14 Magnaporthe_grisea_frm_Eragrostis_curvula_NI909, 15 'Magnaporthe grisea frm Oryza sativa BK-6', 16 Magnaporthe_grisea_frm_Oryza_sativa_A347, 17 Magnaporthe_grisea_frm_Lolium_perenne_365, 18 Magnaporthe_grisea_frm_Eleusine_indica_C10, 19 Magnaporthe_grisea_frm_Eleusine_coracana_RW12, 20 'Magnaporthe grisea frm Oryza sativa R707-1E', 21 'Magnaporthe grisea frm Oryza sativa ML-56', 22 Magnaporthe_grisea_frm_Setaria_sp._G48, 23 'Magnaporthe grisea frm Oryza sativa BK-19', 24 Magnaporthe_grisea_frm_Oryza_sativa_A264, 25 Magnaporthe_grisea_frm_Lolium_perenne_330, 26 Magnaporthe_grisea_frm_Eleusine_indica_T28, 27 Magnaporthe_grisea_frm_Eleusine_coracana_1122; TREE Fig._1B = [&R] (27,(26,25,(24,23,22,21,20,16,15,13,12,11,(10,6),9,(8,(4,3,2,1)),7,5),19,18,17,14)); END; BEGIN TREES; TITLE Tb6139; LINK TAXA = Taxa1; TRANSLATE 1 Magnaporthe_grisea_frm_Digitaria_smutsii_JP34, 2 Magnaporthe_grisea_frm_Digitaria_sp._91T16, 3 'Magnaporthe grisea frm Digitaria horizontalis Py-D', 4 Magnaporthe_grisea_frm_Digitaria_sp._81T4, 5 Magnaporthe_grisea_frm_lab_strain_FGSC_8465, 6 Magnaporthe_grisea_frm_lab_strain_FGSC_8470, 7 Magnaporthe_grisea_frm_Setaria_sp._1152, 8 Magnaporthe_grisea_frm_Oryza_sativa_A119, 9 Magnaporthe_grisea_frm_Oryza_sativa_A598, 10 'Magnaporthe grisea frm Eragrostis curvula K76-79', 11 Magnaporthe_grisea_frm_Oryza_sativa_Guy11, 12 'Magnaporthe grisea frm Oryza sativa R694-2b', 13 'Magnaporthe grisea frm Oryza sativa ML-91', 14 Magnaporthe_grisea_frm_Eragrostis_curvula_NI909, 15 'Magnaporthe grisea frm Oryza sativa BK-6', 16 Magnaporthe_grisea_frm_Oryza_sativa_A347, 17 Magnaporthe_grisea_frm_Lolium_perenne_365, 18 Magnaporthe_grisea_frm_Eleusine_indica_C10, 19 Magnaporthe_grisea_frm_Eleusine_coracana_RW12, 20 'Magnaporthe grisea frm Oryza sativa R707-1E', 21 'Magnaporthe grisea frm Oryza sativa ML-56', 22 Magnaporthe_grisea_frm_Setaria_sp._G48, 23 'Magnaporthe grisea frm Oryza sativa BK-19', 24 Magnaporthe_grisea_frm_Oryza_sativa_A264, 25 Magnaporthe_grisea_frm_Lolium_perenne_330, 26 Magnaporthe_grisea_frm_Eleusine_indica_T28, 27 Magnaporthe_grisea_frm_Eleusine_coracana_1122; TREE Fig._1A = [&R] (27,(26,25,24,23,22,21,20,(19,18),17,16,15,14,13,12,11,10,9,8,7,6,5,(4,3,2,1))); END; BEGIN TREES; TITLE Tb6141; LINK TAXA = Taxa1; TRANSLATE 1 Magnaporthe_grisea_frm_Digitaria_smutsii_JP34, 2 Magnaporthe_grisea_frm_Digitaria_sp._91T16, 3 'Magnaporthe grisea frm Digitaria horizontalis Py-D', 4 Magnaporthe_grisea_frm_Digitaria_sp._81T4, 5 Magnaporthe_grisea_frm_lab_strain_FGSC_8465, 6 Magnaporthe_grisea_frm_lab_strain_FGSC_8470, 7 Magnaporthe_grisea_frm_Setaria_sp._1152, 8 Magnaporthe_grisea_frm_Oryza_sativa_A119, 9 Magnaporthe_grisea_frm_Oryza_sativa_A598, 10 'Magnaporthe grisea frm Eragrostis curvula K76-79', 11 Magnaporthe_grisea_frm_Oryza_sativa_Guy11, 12 'Magnaporthe grisea frm Oryza sativa R694-2b', 13 'Magnaporthe grisea frm Oryza sativa ML-91', 14 Magnaporthe_grisea_frm_Eragrostis_curvula_NI909, 15 'Magnaporthe grisea frm Oryza sativa BK-6', 16 Magnaporthe_grisea_frm_Oryza_sativa_A347, 17 Magnaporthe_grisea_frm_Lolium_perenne_365, 18 Magnaporthe_grisea_frm_Eleusine_indica_C10, 19 Magnaporthe_grisea_frm_Eleusine_coracana_RW12, 20 'Magnaporthe grisea frm Oryza sativa R707-1E', 21 'Magnaporthe grisea frm Oryza sativa ML-56', 22 Magnaporthe_grisea_frm_Setaria_sp._G48, 23 'Magnaporthe grisea frm Oryza sativa BK-19', 24 Magnaporthe_grisea_frm_Oryza_sativa_A264, 25 Magnaporthe_grisea_frm_Lolium_perenne_330, 26 Magnaporthe_grisea_frm_Eleusine_indica_T28, 27 Magnaporthe_grisea_frm_Eleusine_coracana_1122; TREE Fig._1C = [&R] (27,(26,25,(24,23,21,20,16,15,13,12,11,9,8),22,19,18,17,14,10,7,6,5,((4,3,2),1))); END; BEGIN TREES; TITLE Tb6145; LINK TAXA = Taxa2; TRANSLATE 1 Magnaporthe_rhizophila_96043, 2 Magnaporthe_poae, 3 Magnaporthe_rhizophila_58114, 4 'Magnaporthe salvinii frm Oryza sativa MS-1', 5 Magnaporthe_grisea_frm_Digitaria_smutsii_JP34, 6 Magnaporthe_grisea_frm_Digitaria_sp._91T16, 7 'Magnaporthe grisea frm Digitaria horizontalis Py-D', 8 Magnaporthe_grisea_frm_Digitaria_sp._81T4, 9 Magnaporthe_grisea_frm_lab_strain_FGSC_8465, 10 Magnaporthe_grisea_frm_lab_strain_FGSC_8470, 11 Magnaporthe_grisea_frm_Setaria_sp._1152, 12 Magnaporthe_grisea_frm_Oryza_sativa_A119, 13 Magnaporthe_grisea_frm_Oryza_sativa_A598, 14 'Magnaporthe grisea frm Eragrostis curvula K76-79', 15 Magnaporthe_grisea_frm_Oryza_sativa_Guy11, 16 'Magnaporthe grisea frm Oryza sativa R694-2b', 17 'Magnaporthe grisea frm Oryza sativa ML-91', 18 Magnaporthe_grisea_frm_Eragrostis_curvula_NI909, 19 'Magnaporthe grisea frm Oryza sativa BK-6', 20 Magnaporthe_grisea_frm_Oryza_sativa_A347, 21 Magnaporthe_grisea_frm_Lolium_perenne_365, 22 Magnaporthe_grisea_frm_Eleusine_indica_C10, 23 Magnaporthe_grisea_frm_Eleusine_coracana_RW12, 24 'Magnaporthe grisea frm Oryza sativa R707-1E', 25 'Magnaporthe grisea frm Oryza sativa ML-56', 26 Magnaporthe_grisea_frm_Setaria_sp._G48, 27 'Magnaporthe grisea frm Oryza sativa BK-19', 28 Magnaporthe_grisea_frm_Oryza_sativa_A264, 29 Magnaporthe_grisea_frm_Lolium_perenne_330, 30 Magnaporthe_grisea_frm_Eleusine_indica_T28, 31 Magnaporthe_grisea_frm_Eleusine_coracana_1122; TREE Fig._4 = [&R] (4,((3,(2,1)),((((31,30,29,23,22,21,18),28,27,26,25,24,20,19,17,16,15,(14,10),13,11,9),12),(8,7,6,5)))); END; BEGIN TREES; TITLE Tb6142; LINK TAXA = Taxa1; TRANSLATE 1 Magnaporthe_grisea_frm_Digitaria_smutsii_JP34, 2 Magnaporthe_grisea_frm_Digitaria_sp._91T16, 3 'Magnaporthe grisea frm Digitaria horizontalis Py-D', 4 Magnaporthe_grisea_frm_Digitaria_sp._81T4, 5 Magnaporthe_grisea_frm_lab_strain_FGSC_8465, 6 Magnaporthe_grisea_frm_lab_strain_FGSC_8470, 7 Magnaporthe_grisea_frm_Setaria_sp._1152, 8 Magnaporthe_grisea_frm_Oryza_sativa_A119, 9 Magnaporthe_grisea_frm_Oryza_sativa_A598, 10 'Magnaporthe grisea frm Eragrostis curvula K76-79', 11 Magnaporthe_grisea_frm_Oryza_sativa_Guy11, 12 'Magnaporthe grisea frm Oryza sativa R694-2b', 13 'Magnaporthe grisea frm Oryza sativa ML-91', 14 Magnaporthe_grisea_frm_Eragrostis_curvula_NI909, 15 'Magnaporthe grisea frm Oryza sativa BK-6', 16 Magnaporthe_grisea_frm_Oryza_sativa_A347, 17 Magnaporthe_grisea_frm_Lolium_perenne_365, 18 Magnaporthe_grisea_frm_Eleusine_indica_C10, 19 Magnaporthe_grisea_frm_Eleusine_coracana_RW12, 20 'Magnaporthe grisea frm Oryza sativa R707-1E', 21 'Magnaporthe grisea frm Oryza sativa ML-56', 22 Magnaporthe_grisea_frm_Setaria_sp._G48, 23 'Magnaporthe grisea frm Oryza sativa BK-19', 24 Magnaporthe_grisea_frm_Oryza_sativa_A264, 25 Magnaporthe_grisea_frm_Lolium_perenne_330, 26 Magnaporthe_grisea_frm_Eleusine_indica_T28, 27 Magnaporthe_grisea_frm_Eleusine_coracana_1122; TREE PAUP_8 = [&R] (27,(26,25,(((24,23,21,20,16,15,13,12,11,9),(8,((4,3,2),1))),22,(10,6),7,5),(19,18),17,14)); TREE PAUP_7 = [&R] (27,(26,25,((24,23,21,20,16,15,13,12,11,9,(8,((4,3,2),1))),22,(10,6),7,5),(19,18),17,14)); TREE PAUP_6 = [&R] (27,(26,25,((24,23,21,20,16,15,13,12,11,9),22,(10,6),(8,((4,3,2),1)),7,5),(19,18),17,14)); TREE PAUP_5 = [&R] (27,(26,25,((((24,23,21,20,16,15,13,12,11,9),8),((4,3,2),1)),22,(10,6),7,5),(19,18),17,14)); TREE Fig._2 = [&R] (27,(26,25,((24,23,21,20,16,15,13,12,11,9,8),22,(10,6),7,5,((4,3,2),1)),(19,18),17,14)); END; BEGIN TREES; TITLE Tb6143; LINK TAXA = Taxa2; TRANSLATE 1 Magnaporthe_rhizophila_96043, 2 Magnaporthe_poae, 3 Magnaporthe_rhizophila_58114, 4 'Magnaporthe salvinii frm Oryza sativa MS-1', 5 Magnaporthe_grisea_frm_Digitaria_smutsii_JP34, 6 Magnaporthe_grisea_frm_Digitaria_sp._91T16, 7 'Magnaporthe grisea frm Digitaria horizontalis Py-D', 8 Magnaporthe_grisea_frm_Digitaria_sp._81T4, 9 Magnaporthe_grisea_frm_lab_strain_FGSC_8465, 10 Magnaporthe_grisea_frm_lab_strain_FGSC_8470, 11 Magnaporthe_grisea_frm_Setaria_sp._1152, 12 Magnaporthe_grisea_frm_Oryza_sativa_A119, 13 Magnaporthe_grisea_frm_Oryza_sativa_A598, 14 'Magnaporthe grisea frm Eragrostis curvula K76-79', 15 Magnaporthe_grisea_frm_Oryza_sativa_Guy11, 16 'Magnaporthe grisea frm Oryza sativa R694-2b', 17 'Magnaporthe grisea frm Oryza sativa ML-91', 18 Magnaporthe_grisea_frm_Eragrostis_curvula_NI909, 19 'Magnaporthe grisea frm Oryza sativa BK-6', 20 Magnaporthe_grisea_frm_Oryza_sativa_A347, 21 Magnaporthe_grisea_frm_Lolium_perenne_365, 22 Magnaporthe_grisea_frm_Eleusine_indica_C10, 23 Magnaporthe_grisea_frm_Eleusine_coracana_RW12, 24 'Magnaporthe grisea frm Oryza sativa R707-1E', 25 'Magnaporthe grisea frm Oryza sativa ML-56', 26 Magnaporthe_grisea_frm_Setaria_sp._G48, 27 'Magnaporthe grisea frm Oryza sativa BK-19', 28 Magnaporthe_grisea_frm_Oryza_sativa_A264, 29 Magnaporthe_grisea_frm_Lolium_perenne_330, 30 Magnaporthe_grisea_frm_Eleusine_indica_T28, 31 Magnaporthe_grisea_frm_Eleusine_coracana_1122; TREE Fig._3A = [&R] (4,((3,(2,1)),((((31,30,29,23,22,21,18),28,27,26,25,24,20,19,17,16,15,(14,10),13,11,9),12),(8,7,6,5)))); END;