#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 19:21 GMT TreeBASE (cc) 1994-2008 Study reference: Tank D., & Olmstead R. 2009. The evolutionary origin of a second radiation of annual Castilleja (Orobanchaceae) species in South America: the role of long distance dispersal and allopolyploidy. American Journal of Botany, 96: 1907-1921. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10016] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=92; TAXLABELS Castilleja_alpicola_33 Castilleja_alpicola_37 Castilleja_alpicola_42 Castilleja_alpicola_48 Castilleja_ambigua_02 Castilleja_ambigua_08 Castilleja_arvensis_2_01 Castilleja_arvensis_2_10 Castilleja_attenuata_58 Castilleja_attenuata_72 Castilleja_auriculata_48 Castilleja_auriculata_50 Castilleja_auriculata_53 Castilleja_auriculata_61 Castilleja_campestris_01 Castilleja_campestris_07 Castilleja_campestris_09 Castilleja_campestris_11 Castilleja_cerroana_11 Castilleja_cerroana_17_2 Castilleja_cerroana_25_2 Castilleja_cerroana_3 Castilleja_cerroana_6_2 Castilleja_cerroana_85_2 Castilleja_cusickii_59 Castilleja_cusickii_64 Castilleja_densiflora_08 Castilleja_densiflora_10 Castilleja_elmeri_18 Castilleja_elmeri_26 Castilleja_elmeri_28 Castilleja_elmeri_8 Castilleja_exserta_03 Castilleja_exserta_04 Castilleja_exserta_05 Castilleja_exserta_15 Castilleja_lacera_01 Castilleja_lacera_03 Castilleja_lacera_07 Castilleja_lacera_08 Castilleja_lacera_15 Castilleja_lasiorhyncha_04 Castilleja_lasiorhyncha_05 Castilleja_lasiorhyncha_06 Castilleja_linariifolia_85 Castilleja_linariifolia_93 Castilleja_lineariloba_17 Castilleja_lineariloba_20 Castilleja_miniata_53 Castilleja_miniata_55 Castilleja_miniata_56 Castilleja_miniata_58 Castilleja_miniata_61 Castilleja_nubigena_3_50 Castilleja_occidentalis_17 Castilleja_occidentalis_18 Castilleja_occidentalis_26 Castilleja_occidentalis_33 Castilleja_ophiocephala_01 Castilleja_ophiocephala_10 Castilleja_parviflora_82 Castilleja_parviflora_90 Castilleja_peirsonii_10 Castilleja_peirsonii_2 Castilleja_peruviana_4_30 Castilleja_peruviana_4_62_2 Castilleja_peruviana_4_70_2 Castilleja_peruviana_4_83 Castilleja_pilosa_33 Castilleja_pilosa_36 Castilleja_pilosa_41 Castilleja_pilosa_44 Castilleja_pumila_2_75 Castilleja_pumila_94 Castilleja_rubicundula_03 Castilleja_rubicundula_05 Castilleja_tenuiflora_75 Castilleja_tenuiflora_78 Castilleja_tenuiflora_79 Castilleja_tenuiflora_81 Castilleja_tenuis_25 Castilleja_tenuis_26 Castilleja_vadosa_3_54 Castilleja_vadosa_3_56 Castilleja_vadosa_3_60 Castilleja_virgata_2_26 Castilleja_virgata_2_33 Triphysaria_eriantha_54 Triphysaria_eriantha_57 Triphysaria_pusilla_62 Triphysaria_versicolor_11 Triphysaria_versicolor_12 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=34; TAXLABELS Castilleja_alpicola Castilleja_ambigua_ssp_ambigua Castilleja_arvensis Castilleja_attenuata Castilleja_attenuata_CHILE Castilleja_auriculata_ssp_auriculata Castilleja_campestris_ssp_campestris Castilleja_cerroana Castilleja_cusickii Castilleja_densiflora_ssp_densiflora Castilleja_elmeri Castilleja_exserta_ssp_exserta Castilleja_lacera Castilleja_laciniata Castilleja_lasiorhyncha Castilleja_linariifolia Castilleja_lineariloba Castilleja_miniata_ssp_miniata Castilleja_nubigena Castilleja_occidentalis Castilleja_ophiocephala Castilleja_parviflora_ssp_parviflora Castilleja_peirsonii Castilleja_peruviana Castilleja_pilosa_ssp_pilosa Castilleja_pumila Castilleja_rubicundula_ssp_rubicundula Castilleja_tenuiflora_ssp_tenuiflora Castilleja_tenuis Castilleja_vadosa Castilleja_virgata Triphysaria_eriantha_ssp_gratiosa Triphysaria_pusilla Triphysaria_versicolor_ssp_versicolor ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4480] TITLE 'combined nrDNA (ITS+ETS) and cpDNA (trnL/F+rps16 intron)'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=3018; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Castilleja_alpicola TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAAAGCAGACCGCGCACACGTTAAACCAAATCAGGCACGTTGCCAGGGGCAACCCGGGCTATCGTCCCCCTCCCGCAGCGCGCGCGCC-CTGGCATGCGTGGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACTAATGGGCGCGCTTG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGCTGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCC-ATCCCGTCCGCTCCGCAAGGGCGATCGGCTGGTGTGGG-CGGACATTGGCCCCCCGTGCGCTGTGCTGCGCGGTCGGCCTAAATGCGAGCCCGTGGCATCTCACGTCACGACAAGTGGTGGTTGAACGCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATCGGGCACGTGGTAGACCCAACGGC-ACAATCTGATTG-GCCTTCGACACGCGACCCCAGGTCAGGCGGGATTACCCGCTGAGTTTAAATTGGCTTCTGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAAGCCTCTTCAGTTGTTGGCTCTAGCA---TGTCTCGTCCGTTGTCGGTTTCTTGTGTTGAATACCTACTTGAAAGGCATTATTCGGTTGGTTGCAAATGATTCGACTCCGCCTTGCGCTGCGTGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCTATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCGGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGCGGGTGTTGTGATCGGGTCCTCGTGGCCTTGGTCATGCGCCTACGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAA----GGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCCCTGATAGAGGAATGAAACTTCAGATCAGAAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCC--AAAAAA--GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATTAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAAGAGAAAGGATCCAACTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATTACGCGGGAATTAACTGTCCATAGGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTCAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGATAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_ambigua_ssp_ambigua TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAAAGCAGACCGCGCACACGTTAAACCAAATCAGGCACGTGGCCCGGGGCAACCCTGGCCATCGTTCCCCTCCCGCAGCGCGCGCGCC-CCGGCGTGCGTGGTGCGGGCCAACGAACCCCGGCGCGGATTGCGCCAAGGAAAACTAATAGGAGCGCTTG-CCGCCCGTCGCCCCGTTCGCGGTGCGCGCTGGGTG--GAGCGGGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCCCGTCCGCTCCGCAAGGGCGATCGGATGGTG-GGGGCGGACATTGGCCCCCCGTGCGCTTTGACGCGCGGCCGGCCTAAATGCGAGCCCGTGGCATCTCGCGTCACGACAAGTGGTGGTTGAA-CCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATCGGGCATGTGGTAGACCCAACGGC-ACAATCTGATTG-GCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATTACCCGCTGAGTTTAAACTGGCTTTTGTTGGCTCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAAGCCTCTTCAGATGATGGCTCTAGCAGCATGTCTCGGCCGTTGTCGGTTTCTTGTGTTGAATACCTATT-GAAAGGCATTCTTCGGTTG----CAAAAGATAAGATTCCGCCTTGCGCTGCGTGCCCCTTGGGTATGCGGTGTCGGGTGGACCTCGAAGCACGCGATGTGTCCCAAGTCTCTCGCACAA-CCTTGTGCCCGATTCGTTGGCCCACGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGGGCGGGCACGAGGTCCTCAACCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGTGGGCGTTCTGATCGGGTCCTCGTGGCCTTGCTCTTGCGCCTGCGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAA-CCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAAA---GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTTATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAAA--GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACCTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACCCATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGATAAAACTTCGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTTAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTT-GTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAAGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAA-------GTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCTCTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAGTAAGGGGGTAAAGACGACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATCGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_arvensis TTTCC-TAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAACCAGGCACGTGGCCCGGGGCAACCCTGGCTCTCGTGCCTCTCCCGCAGCGAGCGCGTC-TCGGCGCGCGCGGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTAATGGGAGCGCCCG-CCGCCCGTCGCCCTGTTCGCG-------ATTGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCTCGTCCGATCCGCAAGGGCGTTCGGGTGGTG-GGG-CGGACATTGGCCCCCCGTGCGCTGTGTCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGTATCCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATAGGGCACGTGGTAGACCCAACGGCC-CAATCTGATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAAATTGGCTTATGTTGGCGCGTTGGATCCCTGTTCAGGCAGCGACAACGTGCTACACAAGCCTTTTCAGTTGTCGGCTCTAGCA---TGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTTGAGAGGCATTCATCGGTTG----CAAATGATAAGATTCCGCCCTGTGCTGCGCGCCCCTTGGGGATGCGGTGTCGGGTGGACCTTGAAGCACGCAATGCGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCTCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCTGCGGGCGTTGTGATCGGGTCCTCGTGGCCTCGATCATGCGCCTGCGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGATCAGAAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAAA--GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTAGT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAACTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCGTTGCTAGAAAGAAATCAAAAAAGGGCCTGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTCAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGCAAGAAAAAAAGACTGAAATAGAAATTATAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_attenuata TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAAATCAGACCGCGCACACGTTAAACCAAATCAGGCACGTGGCCCGGGGCAACCCTGGCTATCGTTCCCCTCCCGCAGCGCGCGCGCC-CCGGCGTGCGTGGTGCGGGCTAACGAACCCCGGCGCGGACTGCGCCAAGGAAAACTAATGGGAGCGCTTG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGCTGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCCCGTGCGCTCCGCAAGGGCGATCGGATGGTG-GGGGCGGACATTGGCCCCCCGTGCGCTGTGCCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCATCTCACGTCACGACAAGTGGTGGTTGAACTCTCAACTCTCGTTCTGTCGTGGCGATTCGAGTCGCACATCGGGCACTTTGTAGACCCAACGGC-ACAATCTGATTG-GCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATTACCCGCTGAGTTTAAATTGGCTTTTGTTGGCTCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACCCAAGCCTCTTCAGTTGTTGGCTCTAGCAGCATGTCTCGGCCATTGTTGGTTTCTTGTGTTGAATACCTACTCGAAAGGCATTCTTCGGTTG----CAAAAGATAAGATTCCGCCTTGTGCTGCGTGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCGATGTGTCCCAAGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCACGTTGCCGTGCGCGGTCTCTTGGATAAGGAACATTGTGCGGGCAAGAGGTCCTCAGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGTGGGCGTTGTGATCGGGTCCTCGTGGCCTTGCTCATGCGCCTGCGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAAA--GCCTATTTGACTCCTAAAATATTTATCCTATTCCCC------CTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTTGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACGTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGGCATCTAATAAAATGAGCTATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTAAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAAAAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_attenuata_CHILE ???????????????????????????CATTGTCGAATCCTGCAAAATCAGACCGCGCACACGTTAAACCAAATCAGGCACGTGGCCCGGGGCAACCCTGGCTATCGTTCCCCTCCCGCAGCGCGCGCGCC-CCGGCGTGCGTGGTGCGGGCTAACGAACCCCGGCGCGGACTGCGCCAAGGAAAACTAATGGGAGCGCTTG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGCTGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCCCGTGCGCTCCGCAAGGGCGATCGGATGGTG-GGGGCGGACATTGGCCCCCCGTGCGCTGTGCCGCTCGGCCGGCCTAAATGCGAGCCCGTGGCATCTCACGTCACGACAAGTGGTGGTTGAACTCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATCGGGCACTTTGTAGACCCAACGGC-ACAATCTGATTG-GCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATTACCCGCTGAGTTTAAATTGGCTTTTGTTGGCTCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACCCAAGCCTCTTCAGTTGTTGGCTCTAGCAGCATGTCTCGGCCATTGTTGGTTTCTTGTGTTGAATACCTACTCGAAAGGCATTCTTCGGTTG----CAAAAGATAAGATTCCGCCTTGTGCTGCGTGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCGATGTGTCCCAAGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCACGTTGCCGTGCGCGGTCTCTTGGATAAGGAACATTGTGCGGGCAAGAGGTCCTCAGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGTGGGCGTTGTGATCGGGTCCTCGTGGCCTTGCTCATGCGCCTGCGGTGTCCGTTGGGAA??????????????????????????????????????????????????CAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAA-----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAAAA-GCCTATTTGACTCCTAAAATATTTATCCTATTCCCC------CTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTTGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACGTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGGCATCTAATAAAATGAGCTATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTAAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAAAAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_auriculata_ssp_auriculata TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAACCAGGCACGTGGCCCGGGGCAACCCTGGCTCTCGTGCCTCTCCCGCAGCGAGCGCGTC-TCGGCGCGCGCGGTGCGGGCTAACGAACCCCGGCGCAGAACGCGCCAAGGAAAACCAATGGGAGCGCCCG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGATGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCTCGTCCGATCCGCAAGGGCGTTCGGGTGGTG-GGG-CGGACATTGGCCCCCCGTGCGCTGCGTCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACACAGGGCACGTGGTAGACCCAACGGCC-CAATCTGATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAAATTGGCTTGTGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCTACACAATCCTTTTCAGTTGTCGGCTCTAGCA---TGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTTGAGAGGCATTCATCGGTTG----CAAATGATAAGATTCCGCCCTGTGCTGCGCGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCAATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCTGCGGGCGTTGTGATCGGGTCCTCGTGGCCTTGCTCATGCGCCTGCGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGATCAGAAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTCTAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCC--AAAAAA--GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAACTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTCAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGGGTATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_campestris_ssp_campestris TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAATCAGGCACGCGGCCCGGGGCAACCTTGGCTCTCGTGCCCCTCCCGCAGCTCGCGCGTC-TCGGCGTGCGCGGTGCGGGCTAACGAACCCCGGCGCGGAATGCGTCAAGGAAAACTAATGGGAGCCCCCT-CCGCCAGTCGCCCCGTTCGCGGTGTGCGATGGGTG--GAGCGAGCGCCTCTACGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTTCCTGGGCGTCACGCATCGCGTCGTCCCCCCGCCCGTCCGCTCCGCAAGGGCGTTCGGATGGTG-GGG-CGGACAATGGCCCCCCGTGCGCAGCGTCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTCGTTTCGATTCGAGTCGCACATCGGGCACGTGGTAGACCCAACGGCC-AAATCTGATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAAATTGGCTTGTGTTGGCGAATTGGATCCCTGCTCAGGCAGTGACAACGTGCGACACAACCCTTTTCAGTTGTCGGCTCCAGCA---TGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTTGAGAGGCATTCTTCGGTTG----CAAAAGATAGGATTCCGCCCTGTGCTGCGCGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGTACGCTATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCATGTTGCTGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGCGGGCGTTGTGATCGGGTCCTCGTGGCCTTGCTCATGCGCCTACGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAA-TTCAGAGAAACCCTGGAATTAATAAAAA--GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCC--AAAAAAAAGCCTATTTGACTCCTAAAATATTTATTCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTTGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACGTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTAAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAAAAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_cerroana TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAAAGCAGACCGCGCACACGTTAAACCAAATCAGGCACGTTGCCAGGGGCAACCCGGGCTATCGTCCCCCTCCCGCAGCGCGCGCGCC-CTGGCATGCGTGGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACTAATGGGCGCGCTTG-CCGCCCGTCGACCCGTTCGCGGTGTGCGCTGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCC-ATCCCGTCCGCTCCGCAAGGGCGATCGGCTGGTGTGGG-CGGACATTGGCCCCCCGTGCGCTGTGCTGCGCGGTCGGCCTAAATGCGAGCCCGTGGCATCTCACGTCACGACAAGTGGTGGTTGAACGCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATCGGGCACGTGGTAGACCCAACGGC-ACAATCTGATTG-GCCTTCGA?????????????????????????????????????????ATTGGCTTCTGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAAGCCTCTTCAGTTGTTGGCTCTAGCA---TGTCTCGTCCGTTGTCGGTTTCTTGTGTTGAATACCTACTTGAAAGGCATTATTCGGTTGGTTGCAAATGATTCGACTCCGCCTTGTGCTGCGTGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCTATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCGGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGCGGGTGTTGTGATCGGGTCCTCGTGGCCTTGGTCATGCGCCTACGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAAAA--GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCCCTGATAGAGGAATGAAACTTCAGATCAGAAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAAA--GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATTAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAAGAGAAAGGATCCAACTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATTACGCGGGAATTAACTGTCCATAGGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTCAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGATAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_cusickii TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAACAAGGCACGTGGCCCGGGGCAACCCTGGCTCTCGTGCCCCTCCCGCAGCGAGCGCGTC-TCGGCGCGCGCGGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTAATGGGAGCGCCCGTCCCCCCGTCGCCCCGTTCGCGGTGTGCGATTGGTG--GAGCGAGCGCCTCTTCGAAGTCATAA???????????????????????????????????????????????????????????????????????????????????????????CATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCCCGTCCGCTCCGCAAGGGCGTTCGGGTGGTG-GGG-CGGACATTGGCCCCCCGTGCGCTGCGTCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATAGGGCACGTGGTAGACCCAACGGCC-CAATCTCATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAA???????????TTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAAGTCTTTTCAGTTGTCGGCTCTAGCA---TGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTTGAGAGGCATTCTTCGGTTG----CAAATGATGAGATTCCGCCCTGTGCTGCGCGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCTATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCCAAATT-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGCGGGCGTTGTGATCGGGTCCTCGTGGCCTTGCTCATGCGCCCACGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATAATATATCAAATGATTTATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATACATAGTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCC--AAAAAAA-GCCTATTTGACTCCGAAAATATTGATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAATGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACCCATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTCGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAAT???????ACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCTCTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_densiflora_ssp_densiflora TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAAAGCAGACCGCGCACACGTTAAACCAAATCAGGCACGTGGCCCGGGGCAACCCTGGCTATCGTTCCCCTCCCGCAGCGCGCGCGCC-CCGGCGTGCGTGGTGCGGGCTAACGAACCCCGGCGCGGACTGCGCCAAGGAAAACTAATGGGAGCGCTTG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGCAGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCCCGTGCGCTCCGCAAGGGCGATCGGATGGTG-GGGGCGGACATTGGCCCCCCGTGCGCTGTGCCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCATCTCACGTCACGACAAGTGGTGGTTGAACTCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATCGGGCACTTTGTAGACCCAATGGC-ACAATCTGATTG-GCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATTACCCGCTGAGTTTAAATTGGCTTTTGTTGGCTCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAAGCCTCTTCAGTTGTTGGCTCTAGCAGCATGTCTCGGCCATTGTTGGTTTCTTGTGTTGAATACCTACTCGAAAGGCATTCTTCGGTTG----CAAAAGATAAGATTCCGCCTTGTGCTGCGTGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCGATGTGTCCCAAGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCACGTTGCCGTGCGCGGTCTCTTGGATAAGGAACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGTGGGCGTTGTGATCGGGTCCTCGTGGCCTTGCTCATGCGCCTGCGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAA-CCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAAA--GCCTATTTGACTCCTAAAATATTTATCCTATTCCCC------CTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTTGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACGTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGGCATCTAATAAAATGAGCTATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAAGTAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTAAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAAAAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_elmeri TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAACAAGGCACTTGGCCCGGGGCAACCCTGGCTCTCGTGCCCCTCCCGCAGCGAGCGCGTC-TCGGCGCGCGCGGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTAATGGGAGCGCCCG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGAAGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCCCGTCCGCTCCACAAGGGCGTTCGGGTGGTG-GGG-CGGACATTGGCCCCCCGTGCGCTGCGTCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATCGGGCACGTGGTAGACCCAACGGCC-CAATCTGATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAA?????????TGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAAGCCTTTTCAGTTGTCGGCTCTAGCA---TGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTTGAGAGGCATTCTTCGGTTG----CAAATGAT{AG}{AG}GATTCCGCCCTGTGCTGCGCGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCTATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCCAAATT-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGCGGGCGTTGTGATCTGGTCCTCGTGGCCT??????????????????????????????GACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAA-----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTTATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATACATAGTCTGATAGATCCTTTTTTAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAA---GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATTTGACTCCGAAAATATTTATCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAATGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACCCATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTCGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCTCTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAACCTTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_exserta_ssp_exserta TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAAAGCAGACCGCGCACACGTTAAACCAAATCGGGCACGTGGCCCGGGGCGACCCTGGCTCTCGTGCCCCTCCCGCTGCCCGCGCGTC-TCGGCGTGCGTGGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTAATGGGAGCGCCCA-CCCCCCGTCGCCCCGTTCGCGGTGTGCGCTGGGTGTGGTGCGAGCGCCTCCTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCCGCCCGTTCCCCTCGCAAGGGCGTTCGGATGGTG-GGG-CGGACATTGGCCCCCCGTGCGCTGCGTCGCGTGGCCGGCCTAAATGCGAGCCCGTGGCGACCCGCGTCACGACAAGTGGTGGTTGAATGCTCAACTCTCGTACTGTCGTGGCGATTCGAGTCGCACATCGGGCACGTGGTAGACCCAACGGCG-CAATCTGATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAA???????????TCGGCGCGTTGGTTCCCTGCTCAGGCAGCGACAACGTGCGACACAAGCCTCTTCAGTTGTTGGCTCTAGCAGCATGTCTCGGTCATTGTCGGTTTCTTGTGTTGAATACCTACTCGAAAGGCATTCTTCGGTTG----CAAGCGATAAGATTCCGCCTTGTGCTGCGTGCCCCTTGGGGATGCGGTGTCGGGTGGACCTTGAAGCACGCTATGTGTCCCAAGTCTCTTGCACAAACCTTGTGCTCGATTCGT-GGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCGAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGCCGTCGTTGTGATCGGGTCCTCGTGGCCTTGGTCATGCGACTGCGGTGTCCGTTGGGAA????????TGA--TGAGC-TTAGTATGGAA-CCTACTAAGTGATAACTTTCAGATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTATATCTGTATTTTT-----GAATACGAAACGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAAA--GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGTATAAATGCCCTTTTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCGAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTTCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACTAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACAAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_lacera TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAATCAGGCACGCGGCCCGGGGCGACCCTGGCTCTCGTGCCCCTCCCGCAGCGCGCGCGTC-TCGGCGTGCGCGGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACTAATGGGAGCGCCCG-CCGCCCGTCACCCCGTTCGCGGTGTGCGATGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCCGCCCGTCCGCTC-GCAAGGGCGTTCGGATGGTG-GTG-CGGACATTGGCCCCCCGTGCGCTGCGTCGCGCGGCCGGCCCAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTTGTTTCGATTCGAGTCGCACATCGGGCACGTGGTAGACCCAACGGCC-CAATCTGATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAAATTGGCTTTTGTTGGCTCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAAGCCTCTTCAGTTGTTGGCTCTAGCAGCATGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTCGAAAGGCATTCTTCGGTTG----CAAAAGTTAAGATTCCGCCCTGTGCTGCGTGCCCCTTGGGGATGCGGTGTCGGGTGGGCCTCGAAGCACGCTATGTGTCCCATGTCTCTCGCACAA-CCCTGTGCCCGATTCGTTGGCCCATGTAGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCTTCAGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGTGGGCGTTCTGATCGGGTCCTCGTGGCCTTGGTCATGCGCCTGCGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACC-TGGAATTAATAAAAA--GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAAA---GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTTATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAAAA-GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTAGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATCCCCTTCTTCTCTTATCACATGTGATATAGAATACCCATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCTAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCTCTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTTCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_laciniata TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAATAGCAGACCGCGCACACGTTTAACCAAATCCGGCACGTGGCTCGGGGCAACTCGGGCTATCGTGCCCCTCCCGCAGCGCGCGCGCC-CCGGCGTGCGTGGTGCGGACTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACTAATGGGCGCGCTTG-CCGCCCGTCGCCCCGTACGCGGTGTGCGCTGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCC-ATCCCGTCCGCTCCGCAAGGGCGATCGGCTGGTGTGGG-CGGACATTGGCCCCCCGTGCGCTGTGCTGCGCGGTCGGCCTAAATGCGAGCCCGTGGCATCTCACGTCACGACAAGTGGTGGTTGATCGCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATCGGGCACGTGGTAGACCCAACGGC-ACAATCTGATTG-GCCTTCGACACGCGACCCCAGGTCAGGCGGGATTACCCGCTGAGTTTAAATTGGCTTCTGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAAGCCTCTTCAGTTGTTGGCTCTAGCA---TGTCTCGTCCGTTGTCGGTTTCTTGTGTTGAATACCTTCTTGAAAGGCATTACTCGGTTG----CAAATGATAAGACTCCGCCTTGTGCTGCGTGCCCCTCGGGTATGCGGTGTCGGGTGGACCTCGAAGCACGCTACGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCTTTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCGGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGCGGGCGTTGTGATCGGGTCCTCGTGGCCTTGGTCATGCG?????????????????????????????????????????????????????TACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGATCAGAAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAAAA-GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAAGAGAAAGGATCCAACTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTCAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAA?????????????????? Castilleja_lasiorhyncha TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAATCAGGCACGCGGCCCGGGGCAACCTTGGCTCTCGTGCCCCTCCCGCAGCTCGCGCGTC-TCGGCGTGCGCGGTGCGGGCTAACGAACCCCGGCGCGGAATGCGTCAAGGAAAACTAATGGGAGCCCCCT-CCGCCAGTCGCCCCGTTCGCGGTGTGCGATGGGTG--GAGCGAGCGCCTCTACGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTTCCTGGGCGTCACGCATCGCGTCGTCCCCCCGCCCGTCCGCTCCGCAAGGGCGTTCGGATGGTG-GGG-CGGACAATGGCCCCCCGTGCGCAGCGTCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTCGTTTCGATTCGAGTCGCACATCGGGCACGTGGTAGACCCAACGGCC-AAATCTGATTGTGCCTTCGAA-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAA?????????????????????????????????????????ACAACGTGCGACACAAGCCTCTTCAGTTGTTGGCTCTAGCAGCATGTCTCGGCCATTTTCGGTTTCTTGTGTTGAATACCTGCTCGAAAGGCATTCTTCGGTTG----CAAAAGATAAGATTCCGCCTTGTGCTGCGTCCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCTATGTGTCCCAAGTCTCTCGCACAA-CCTTGTGCCCGATTCTTTGGCCCACGTTGCCGTGCGCGGACTCTTGGATATGGTACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGCGG????????????????????????????????????????????????????????GACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCC--AAAAAAAAGCCTATTTGACTCCTAAAATATTTATTCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTTGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACGTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTAAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAAAAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_linariifolia TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAACAGACCGCGCACAAGTTAAACCAAACAAGGCACGTGGCCCGGGGCAACCCTGGCCCTCGTGCCCCTCCCGCAGCGAGCGCGTC-TCGGCGCGCGCGATGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTAATGGGTGCGCCCG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGAAGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCCCTTCCGCACCGCAAGGGCGTTCGGGTGGTG-GGG-CGGACATTGGCCCCCCGTGCGCTGCGTCGCGCGGCCGACCTAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTCTTGGCGATTCGAGTCGCATATCGGGCACGTGGTAGACCCAACGGCC-CAATCTGATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAAATTGGCTTGTGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAAGCCTTTTCAGTTGTCGGCTCTAGCA---TGTCTCGGCC{AG}TTGTCGGTTTCTTGTGTTGAATACCTACTTGAGAGGCATTATTC{GT}GTTG----CAAATGATA{AG}GATTCCGCCCTGTGCTGCGCGCCCCTTGGGGATGCGGTGTCGGGTGGACCT{CT}GAAGCACGCTATGTGTACCATGTCTCTTGCACAT-CCTTGTGCTCGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCCAAAT{AT}-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGCGGGCG{CT}TGTGATCGGGTCCTCGTGGCCTTGCTCATGCGCCTACGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAAAA-GGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGATCAGAAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATGGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAA---GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGA--------CCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTTCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAACTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAGGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGAATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTCAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_lineariloba ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATTGGCTTTTGTTGGCGCGTTGGATCCTTGCTCAGGCAGCGACAACGTGCGACACAAGCCTCTTCAGTTGTTGGCTCTAGCAGCATGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTCGAAAGGCATTCTTCGGTTG----CAAGGGATAAGATTCCGCCTTGTGTTGCGTGCCCCTTGGGGATGCGGCGTCGGGTGGACCTCGAAGCACGCTATGTGTCCCAAGTCTCTTGCACAA-CCTTGTGCTTGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTCGGATATGGAACATTGTGCGGGCACGAGGTCCTCGACCTCTATCTTGCCCCAATG-CAAGCGTTCTTCGCTTCGTGCGAACGACTTCCGCGGGCGTTGTGATCGGGTCCTCGTGGCCTTGCTCATGCGCCTGCGTTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAA-CCTACTAAGTGATAACTTTCTAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTTATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCCAAAAAA--GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTATTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACCCATCCAAATTAAGCAAGGAATTCCTAGAATTCCTATGTGAATGATTCACAATCAATAACTTTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTCGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAA-TGAG????????????????????????????????????????????????????????????????????????????????????????????????????????CCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTT-GTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAA-------GTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCTCTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCC???????????????????? Castilleja_miniata_ssp_miniata TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAACAAGGCACTTGGCCCGGGGCAACCCTGGCTCTCGTGCCCCTCCCGCAGCGAGCGCGTC-TCGGCGCGCGCGGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTAATGGGAGCGCCCG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGAAGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCCCGTCCGCTCCGCAAGGGCGTTCGGGTGGTG-GGG-CGGACATTGGCCCCCCGTGCGCTGCGTCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATCGGGCACGTGGTAGACCCAACGGCC-CAATCTGATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAAATTGGCTTGTGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAAGCCTTTTCAGTTGTCGGCTCCAGCA---TGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTTGAGAGGCATTCTTCGGTTG----CAAAAGATAGGATTCCGCCCTGTGCTGCGCGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGTACGCTATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCATGTTGCTGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGCGGGCGTTGTGATCAGGTCCTCGTGGCCTTGCTCATGCGCCTACGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAAA---GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGATCAGAAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAAA--GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAACTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTCAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAACTGGACTCCCAATTTTTTTCCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAAT? Castilleja_nubigena TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACAAGTTAAACCAAACAAGGCACGTGGCCCGGGGCAACCCTGGCTCTCGTGCCCCTCCCGCAGCGAGCGCGTCCTCGGCGCGCGCGGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTAATGGGAGCGCCCG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGATGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCCCGTCCGCTCGGCAAGGGCGTTCGGGTGTTG-GGG-CGGACATTGGCCCCCCGTGCGCTGCGCCGCACGGCCGGCCTAAATGCGAGCCCGTGGCGACTTACGTCACGTCAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATAGGGCACGTGGTAGACCCAACGGCC-CAATCTGATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAAATTGGCTTCTGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAATCCTTTTCAGTTGTCGGCTCTAGCA---TGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTTGAGAGGCATTCTTCGGTTG----CAAATGATAGGATTCCGCCCTGTGCTGCGCGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCTATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCATTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCTTCAGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGTGGGCGTTTTGATCGGGTCCTCGTGGCCCTGCTCATGCGCCTGCGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGATCAGAAAAGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAAA--GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGGTGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAACTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAAATTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTCAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_occidentalis TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAACAAGGCACTTGGCCCGGGGCAACCCTGGCTCTCGTGTCCCTCCCGCAGCGAGCGCGTC-TCGGCGCGCGCGGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTAATGGGAGCGCCCG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGAAGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGAATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCCCGTCCGCTCCGCAAGGGCGTTCGGGTGGTG-GGG-CGGACATTGGCCCCCCGTGCGCTGCGTCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTCGTGGCGATTCGATTCGCACATCGGGCACTTGGTAGACCCAACGGCC-CAATCTGATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAAATTGGCTTCTGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAAGCCTTTTCAGTTGTCGGCTCAAGCA---TGTCTTGGACATTGTCGGTTTCTTGTGTTGAATACCTACTTGAGAGGCATTCTTCGGTTG----CAAATGATAAGATTCCGCCCTGTGCTGCGCGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCTATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCCAAATT-CAAGCGTTCTACGCT{AT}CGTGCGAACGACTTCCG{CT}GGGCGTTGTGATCGGGTCCTCGTGGCCTTGCTCATGCGCCCACGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAAA---GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGATCAGAAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCCAAAAA---GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAACTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTCAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAACTGGACTCCCAATTTTTTTCCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_ophiocephala TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAACCAGGCACGTGGCCTGGGGCAACCCTGGCTCTCGTGCCCCTCCCGCAGCGAGCGCGTC-TCGGCGCGCGCGGT{CG}CGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTAATGGGAGCGCACG-CCGCCCGTCGCCCCGTTCGCGGTGT{CG}CGATGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTC???????????????????????????????????????????????????????????????????????????????????CATCGAGTCTTTGAACGCAAGTTG{CG}GCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCCCGTCCGCTCCGCAAGGGCGTTCGGATGGTG-GGG-CGGACATTGGCCCCCCGTGCGCTGCGTCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGAATCCTCAGCTCTCGTGCTGTCTTGGCGATTCGAGTCGCACATCGGGCACGTGGTAGACCCAACGGCC-CAATCTGATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAA????????????TGGCGCG-TGGATCCCTGCTCAGGCATCGACAACGTGCGACACAAGCCTTTTCAGTTGTCGGCTCTAGCA---TGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTTGAGAGGCATTGTTCGGTTG----CAAATGATAGGATTCCGCCCTGCGCTGCGCGCCCCTCGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCTATGTGTACCATGTCTCTTGCACAT-CCCTGTGCTCGATTCTTTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAATATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCCAAATA-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGCGGGCGTTGTGATCGGGTCCTCGTGGCCTTGCTCATGCGCCTACGGTGTCCGTTGGGAA?????AATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAAAAAAAAAGGGCAATCCTGAGCCAAATCCGGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAA------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACTGGCAACAATGAAATTTATAGTAAAAGGAAAATCC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTCGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACTAAGTTTGCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAA-GGGTATGTTGCTGCCATTTTGAAAGAATTTAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAAGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCTAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTTGTCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_parviflora_ssp_parviflora TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACAGCGCACACGTTAAACCAAACAAGGCACGTGGCCCGGGGCAACCCTGGCTCTCGTGCCCCTCCCGCAGCGAGCGCGTC-TCGGCGTGCGCGGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTAATGGGAGCGCCCG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGAAGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCCCGTCCGCTCCGCAAGGGCGTTCGGGTGGTG-GGG-CGGACATTGGCCCCCCGTGCGCTGCATCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTCATGGCGATTCGAGTCGCACATCGGGCACGTGGTAGACCCAACGGCC-CAATCTGATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAAATTGGCTTCTGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAAGCCTTTTCAGTTGTCGGCTCATGCA---TGTCTTGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTTGAGAGGCATTCTTCGGTTG----CAAATGATAAGATTCCGCCCTGTGCTGCGCGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCTATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTACTCAGCCTCTATCTTGCCCAAATA-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGCGGGCGTTATGATCGGGTCCTCGTGGCCTTGCTCATGCGCCCACGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTTATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATACATAGTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAA---GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAATGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACCCATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTCGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATTCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCTCTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_peirsonii TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAACAAGGCACGTGGCCCGGGGCAACCCTGGCTCTCGTGCCCCTCCCGCAGCGAGCGCGTC-TCGGCGCGCGCGGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTAATGGGAGCGCCCGTCCCCCCGTCGCCCCGTTCGCGGTGTGCGATGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCCTGTCCGCTCCGCAAGGGCGTTCGGGTGGTG-GGG-CGGACATTGGCCCCCCGTGCGCTGCGTCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATAGGGCACGTGGTAGACCCAACGGCC-CAATCTGATTGTGCCTTCGAA-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAAATTGGCTTGTGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACTTGCGACACAAGACTTTTCAGTTGTTGGCTCTAGCA---TGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTTGAGAGGCATTCTTCGGTTG----CAAATGATGAGATTCCGCCCTGTGCTGCGCGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGC{AG}CGCTATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCCAAATT-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGCGGGCGTTGTGATCGGGTCCTCGTGGCCTTGCTCATGCGCCCACGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTTATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCCAAAAAAAAGCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACCCATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTAAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCTCTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATCGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_peruviana TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAAAGCAGACCGCGCACACGTTAAACCAAATCAGGCACGTTGCCAGGGGCAACCCGGGCTATCGTCCCCCTCCCGCAGCGCGCGCGCC-CTGGCATGCGTGGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACTAATGGGCGCGCTTG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGCTGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCC-ATCCCGTCCGCTCCGCAAGGGCGATCGGCTGGTGTGGG-CGGACATTGGCCCCCCGTGCGCTGTGCTGCGCGGTCGGCCTAAATGCGAGCCCGTGGCATCTCACGTCACGACAAGTGGTGGTTGAACGCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATCGGGCACGTGGTAGACCCAACGGC-ACAATCTGATTG-GCCTTCGACACGCGACCCCAGGTCAGGCGGGATTACCCGCTGAGTTTAAATTGGCTTCTGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAAGCCTCTTCAGTTGTTGGCTCTAGCA---TGTCTCGTCCGTTGTCGGTTTCTTGTGTTGAATACCTACTTGAAAGGCATTATTCGGTTGGTTGGAAATGATACGACTCCGCCTTGTGCTGCGTGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCTATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCGGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGCGGGTGTTGTGATCGGGTCCTCGTGGCCTTGGTCATGCGCCTACGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAA---GGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCCCTGATAGAGGAATGAAACTTCAGATCAGAAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCC--AAAAAAA-GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATTAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAAGAGAAAGGATCCAACTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATTACGCGGGAATTAACTGTCCATAGGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTCAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGATAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_pilosa_ssp_pilosa TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAACAAGGCACGTGGCCCGGGGCAACCCTGGCTCTCGTGCCCCTCCCGCAGCGAGCGCGTC-TCGGCGCGCGCGGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTAATGGGAGCGCCCGTCCCCCCGTCGCCCCGTTCGCGGTGTGCGATGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCCCGTCCGCTCCGCAAGGGCGTTCGGGTGGTG-GGG-CGGACATTGGCCCCCCGTGCGCTGTGTCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATAGGGCACGTGGTAGACCCAACGGCC-CAATCTCATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAAATTGGCTTGTGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAAGACTTTTCAGTTGTTGGCTCTAGCA---TGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTTGAGAGGCATTCTTCGGTTG----CAAATGATGAGATTCCGCCCTGTGCTGCGCGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCTATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCCAAATT-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGCGGGCGTTGTGATCGGGTCCTCGTGGCCTTGCTCATGCGCCCACGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAAAA--GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTTATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATACATAGTCTGATAGATCCTTTTTTAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCC--AAAAAA--GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAATGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACCCATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTCAAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCTCTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Castilleja_pumila ???????????????????GGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAACCAGGCACGTGGCCCGGGGCAACCCTGGCTCTCGTGCCCCTCCCGCAGCGAGCGCGTC-TCGGCGCGCGCGGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACCAATGGGAGCGCCCG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGTAGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTTCCTGGGCGTCACGCATCGCGTCGTCCCCCATCTCGTCCGATCCGCAAGGGCGTTCGGGTGGTG-GGG-CGGACATTGGCCCCCCGTGCGCTGCGTCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATAGGGCACGTGGTAGACCCAACGGCC-CAATCTGATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAA??????????????????????????????????????????????????????????CCTTTTCAGTTGTCGGCTCTAGCA---TGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTTGAGAGGCATTCTTCGGTTG----CAAATGATAGGATTCCGCCCTGTGCTGCGCGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCTATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCATTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGTGGGCGTTTTGATCGGGTCCTCGTGGCCCTGCTCATG??????????????????????GACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAAA---GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGATCAGAAAGGATGAAGTAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAAAA-GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAACTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAAGTGTCTCGAGAGTCTCACTAGTTGGATCAGACTCAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTTGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_rubicundula_ssp_rubicundula TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAAAGCAGACCGCGCACACGTTAAACCAAATCAGGCACGTGGCACGGGGCAACCCTGGCCATCGTTCCCCTCCCGCAGCGCGTGCGCC-CCGGCGTGCGTGGTGCGGGCTAACGAACCCCGGCGCGGATTGCGCCAAGGAAAACTAATGGGAGCGCTTG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGCTGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCCCGTCCGCTCCGCAAGGGCGATCGGCTGGTG-GGGGCGGACATTGGCCCCCCGTGCGCTGTGCCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCATCTCGCGTCACGACAAGTGGTGGTTGAA-CCTCAACTCTCGTGCTGTCGTGGCGATTTGAGTTGCACATCGGGCACGTGGTAGACCCAACGGC-ACAATCTGATTG-GCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATTACCCGCTGAGTTTAAATTGGCTTTTGTTGGCGCGTTGGATCCTTGCTCAGGCAGCGACAACGTGCGACACAAGCCTCTTCAGTTGTTGGCTCTAGCAGCATGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTCGAAAGGCATTCTTCGGTTG----CAAGGGATAAGATTCCGCCTTGTGTTGCGTTCCCCTTGGGGATGCGGCGTCGGGTGGACCTCGAAGCACGCTATGTGTCCCAAGTCTCTTGCACAA-CCTTGTGCTTGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTCGGATATGGAACATTGTGCGGGCACGAGGTCCTCGACCTCTATCTTGCCCCAATG-CAAGCGTTCTTCGCTTCGTGCGAACGACTTCCGCGGGCGTTGTGATCGGGTCCTCGTGGCCTTGCTCATGCGCCTGCGTTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAA--GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAAA---GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTTATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAAA--GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTC-AAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACCCATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTATCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAAATGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTAAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCTCTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_tenuiflora_ssp_tenuiflora ????????????????????????GATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAACCAGGCACGTGGCCCGGGGCAACCCTGGCTCTCGTGCCTCTCCCGCAGCGAGCGCGTC-TCGGCGCGCGCGGTGCGGGCTAACGAACCCCGGCGCAGAACGCGCCAAGGAAAACCAATGGGAGCGCCCG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGATGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCTCGTCCGATCCGCAAGGGCGTTCGGGTGGTG-GGG-CGGACATTGGCCCCCCGTGCGCTGCGTCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACACAGGGCACGTGGTAGACCCAACGGCC-CAATCTGATTGTGC???????????????????????????????????????????????ATTGGCTTGTGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCTACACAATCCTTTTCAGTTGTCGGCTCTAGCA---TGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTTGAGAGGCATTCATCGGTTG----CAAATGATAAGATTCCGCCCTGTGCTGCGCGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCAATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCTGCGGGCGTTGTGATCGGGTCCTCGTGGCCTTGCTCATGCGCCTGCGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAAA---GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGATCAGAAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTCTAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCC--AAAAAA--GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAACTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTCAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGGGTATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_tenuis TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAATCAGGCACGCGGCCCGGGGCAACCCTGTCTCTCGTGCCTCTCCCGCAGCGCGCGCGTC-TCGGCGTGCGCGGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACTAATGGGAGCGCCCG-CCGCCCGTCACCCCGTTCGCGGTGTGCGATGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGTTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCGCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCCGCCCGTCCGCTCCGCAAGGGCGTTCGGATGGTG-GTG-CGGACATTGGCCCCCCGTGCGCTGCGTCGCGCGGCCGGCCCAAATGCGAGCCCGTGGCGACTCACGTCACGACAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTCGTTTCGATTCGAGTCGCACATCGGGCACGTGGTAGACCCAACGGCT-CAATCTGATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAAATTGGCTTTTGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAAGCCTCTTCAGTTGTTGGCTCTAGCAGCATGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTCGAAAGGCATTCTTCGGTTG----CAAGTGATAAGATTTCGCCTTGTGTTGCGTGCCCCTTGGGGATGCGGCGTCGGGTGGACCTCGAAGCACGCTATGTGTCCCAAGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTCGGATATGGAACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCCCAATG-CAAGCGTTCTTCGCTTCGTGCGAACGACTTCCGTGGGCGTTGTGATTGGGTCCTCGTGGCCTTGCTCATGCGCCTGCGTTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAA-CCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAA--GGGCAATCCTGAGCCCAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTTATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAA-TCCGTCGAC-TTTA???????????????????????????????????????????????????????????????????????????????????????TTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATCCCCTTCTTCTCTTATCACATGTGATATAGAATACCCATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCTAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCTCTAGTTGGATCAGACTAAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAATTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTTCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_vadosa TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAAAGCAGACCGCGCACACGTTAAACCAAATCAGGCACGTTGCCAGGGGCAACCCGGGCTATCGTCCCCCTCCCGCAGCGCGCGCGCC-CTGGCATGCGTGGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACTAATGGGCGCGCTTG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGCTGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCC-ATCCCGTCCGCTCCGCAAGGGCGATCGGCTGGTGTGGG-CGGACATTGGCCCCCCGTGCGCTGTGCTGCGCGGTCGGCCTAAATGCGAGCCCGTGGCATCTCACGTCACGACAAGTGGTGGTTGAACGCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATCGGGCACGTGGTAGACCCAACGGC-ACAATCTGATTG-GCCTTCGACACGCGACCCCAGGTCAGGCGGGATTACCCGCTGAGTTTAAATTGGCTTCTGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAAGCCTCTTCAGTTGTTGGCTCTAGCA---TGTATCGTCCGTTGTCGGTTTCTTGTGTTGAATACCTACTTGAAAGGCATTATTCGGTTGGTTGCAAATGATTCGACTCCGCCTTGTGCTGCGTGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCTATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCGTTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCGGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGCGGGTGTTGTGATCGGGTCCTCGTGGCCTTGGTCATGCGC???????????????????GACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAA-----GGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCCCTGATAGAGGAATGAAACTTCAGATCAGAAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAAA--GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATTAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAAGAGAAAGGATCCAACTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATTACGCGGGAATTAACTGTCCATAGGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTCAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGATAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Castilleja_virgata TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACAAGTTAAACCAAACAAGGCACGTGGCCCGGGGCAACCCTGGCTCTCGTGCCCCTCCCGCAGCGAGCGCGTCCTCGGCGCGCGCGGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTAATGGGAGCGCCCG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGATGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCATCCCGTCCGCTCGGCAAGGGCGTTCGGGTGTTG-GGG-CGGACATTGGCCCCCCGTGCGCTGCGCCGCACGGCCGGCCTAAATGCGAGCCCGTGGCGACTTACGTCACGTCAAGTGGTGGTTGAATCCTCAACTCTCGTGCTGTCGTGGCGATTCGAGTCGCACATAGGGCACGTGGTAGACCCAACGGCC-CAATCTGATTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAAATTGGCTTGTGTTGGCGCGTTGGATCCCTGCTCAGGCAGCGACAACGTGCGACACAATCCTTTTCAGTTGTCGGCTCTAGCA---TGTCTCGGCCATTGTCGGTTTCTTGTGTTGAATACCTACTTGAGAGGCATTCTTCGGTTG----CAAATGATAGGATTCCGCCCTGTGCTGCGCGCCCCTTGGGGATGCGGTGTCGGGTGGACCTCGAAGCACGCTATGTGTACCATGTCTCTTGCACAA-CCTTGTGCTCGATTCATTGGCCCATGTTGCCGTGCGCGGTCTCTTGGATATGGAACATTGTGCGGGCACGAGGTCCTCAGCCTCTATCTTGCCCAAATG-CAAGCGTTCTACGCTTCGTGCGAACGACTTCCGTGGGCGTTTTGATCGGGTCCTCGTGGCCCTGCTCATGCGCCTGCGGTGTCCGTTGGGAAGACTTAATTGAATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGATCAGAAAAGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCC-AAAAAA--GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-ATAGGATGCTACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGGTGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAACTCGACCAAGTTTCCAATTCAAAAGCAAAACGTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAAATTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTCAAGAATCCAAATACAATTTTAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTCCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACTTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCCATCTATCGAATC Triphysaria_eriantha_ssp_gratiosa TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAAAGCAGACCGCGCACACGTTAAACCAAATCAGGCACGTGGCCTGGGGCAACCCTGGCCATTGTTCCAACCCTGCAGCGCGCTCGTC-TCGGCGTGCGTGGTGCGGGCTAACGAACCCCGGCGCGGATTGCGCCAAGGAAAACTAATGGGAGTGCCCG-CCGCCCGTCGCCCCGTTCGCGGTGTGCGCTGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCCTCGCATCCCCTCTACAAGGGAGGATGCCCGATG-GGGACGGATATTGGCCCCCCGTGCGCTTCTCCGCGCGGCCGGCCTAAATGCGAGCCCGTGGCGACTCACGTCACGACTAGTGGTGGTTGAATTCTCAACTCTCGTGCAGTCTTGGCGATTCGAGTCGCATATCGGGCATGTGGTAGACCCAATGGCCACAACCTCGTTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATTACCCGCTGAGTTTAAATTGGCTTGTGTTGATTCGTTGGATCCCTGCCCAGGCAGAGACACCATCCCACACAAGCCTCTTCAGTTGTTGGCTCAAGCA---TGGCTTGGCCATTGTCGGTTTCTTGTGCTGAATACCTACTTGAAAGGCATTCATCGGTTG----CAAATTAGAAGATTCCGCCTCGTGCCGT--GCCCTATAGGGATGCGGTGTAGGGTGGACTTCGAAGCACGCTGCGTGTTCCACGGAACTTGCACAA-CCTTGTGCTTGTTTTGTTGGCCCATGTTTCCGTGCGCGGTCTCTCGGATATAGAACATTGTGCGGGCATGAGGTCCTGGGCCTCTATCTTGCCCAAACTACAAGCGTTCTACGCTTTGTGCGAACGACTTCCACAGGTGTTTTGATCGG????????????????????????????????????????????????????????TGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAAA---GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATCGCCCAAATCTGTATCTGTATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCC--AAAAGAA-GCCCATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCAAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATTATTCACAATCAATAACATTACTCCTACTGAAA-CTTTGAAAGGCGTCTTTTTGAAGATCCACGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTTATCTAATAAAATGAGC-AGAGGATGCCACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAAGATATCTTCTATCTATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCGAATTCAAAAGCAAAACTTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATATGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATAAAAGGATCTACGAACAAGGAAACACCATTTGAATGGTCTCGAGAGTCTCACTAGTTGGATCAGACTAAAGAATCCAAATACAATTTAAAATGAGACAAAAAA-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTTCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACGTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCAATGAGCC???????????? Triphysaria_pusilla TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAAAGCAGACCGCGCACACGTTAAACCAAATCAGGCACGTGGCCTGGGGCAACCCTGGCCATTGTTCCAACCCTGCAGCGCGCACGTC-TCGGCGTGCGTGGTGCGGGCTAACGAACCCCGGCGCGGATTGCGCCAAGGAAAACTAATGGGAGTGCCCG-CCGCCCGTCGCCCCGTTTGCGGTGTGCGCTGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCCTCCCTTCCGCTCTACAAGGGCGGATGCCCGGTG-GGGACGGACATTGGCCCCCCGTGCGCTTCTCCGCGCGGCCGGCCTAAATGCAAGCCTGTGGCGACTCGCGTCATGGCCAGTGGTGGTTGAATCCTCAACTCTCGTGAAGTCGTGGCGATTCGAGTCGCATATCGGGCACGTGTTAGACCTAATGGCCACAACCTAGTTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATTACCCGCTGAGTTTAA??????????????????????????????????????????????????????????????????????????????AGCA---ATGCTTGGCCATTGTCGGTTTTTTGTGCTGAATACCTACTTGAAAGGCATTCTTCGGTTG----CAAA{AT}TA{AG}AAGATTCCGCCTTGTGCCGC--GCCCTTTGGGGATGCGGTGTAGGGTGGACCTCGAAGCACGCTGCGTGTCCCACGGAACTTGCACAA-CCTTGTGCTTGTTTTGTTGGCTCATGTGGCCGTGCGCGGTCTCTCGGATATAGAACATTGTGCGGGCATGAGGTC-TCGGCCTCTATCTTGCCC{AC}AACGACAAGCGTTCTACGCTTTGTGCGAACGACTTCC???????????????????????????????????????????????????????????????????????????????????????????????????????TAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCC{AC}AATCCTGTTTTCTCAAAACAAAGGTTCAG{AG}AAACGAAAAAAAAAAA--GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTAT{CT}TATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGT------ATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCC--AAAAGAA-GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCAAAATTCCTTATTCTGATTCTTTTTAACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTAAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-AGAGGATGTCACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAACCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGACAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAAGCAAAACTTGTTGGAATTTATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTAAAGAATCCAAATACAATTTAAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAACAAAAAAAAAGGACTTCCAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCAGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACGTGTCATTTAATTTATTATAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCT??????????????????????????????? Triphysaria_versicolor_ssp_versicolor TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAAAGCAGACCGTGCACACGTTAAACCAAATCAGGCACGTGGCCTGGGGCAACCCTGGCCATTGTTCCAACCCTGCAGCGCGTTCGTC-TCGGCGTGCGTGGTGCGGGCTAACGAACCCCGGCGCGGATTGCGCCAAGGAAAACTAATGGGAGTGCCCG-CCGCCCGTCGCCCCGTTTGCGGTGTGCGCTGGGTG--GAGCGAGCGCCTCTTCGAAGTCATAACGACTCTCGGCAA-CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCCCTCCCTTCCGCTCTACAAGGGCGGATGCCCGGTG-GGGACGGACATTGGCCCCCCGTGCGCTTCTCCGCGCGGCCGGCCTAAATGCAAGCCTGTGGCGACTCGCGTCATGGCCAGTGGTGGTTGAATCCTCAACTCTCGTGAAGTCGTGGCGATTTGAGTCGCATATCGGGCACGTGTTAGACCCAATGGCCACAACCTAGTTGTGCCTTCGAC-CGCGACCCCAGGTCAGGCGGGATTACCCGCTGAGTTTAA????????????????????????????TGCCTAGGCGGAGACAGCATCTCACACAGGTCTCTTCAGTTGTTGGCTCAAGCA---CGGCTTGGCCATTGTCGGTTTTTTGTGCTGAATACCTACTTGAAAGGCATTCTTCGGTTG----CAAATTA{AG}AAGATTCCGCCTTGTGCCGC--GCCCTTTGGGGATGCGGTGTAGGGTGGACCTCGAAGCACGCTGCGTGTCCCACGGAACTTGCACAA-CCTTGTGCTTGTTTTGTTGGCCCATGTGGCCGTGCGTG{GT}TCTCTCGGATATAGAACATTGTGCGGGCATGAGGTC-TCGGTCTCTATCTTGCCCAAACGACAAGCGTTCTACGCTTTGTGCGAACGACTTCCACAAGCGTTTTGATCGG?????????????????????????????????????????????????????????????????????GGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAAA-GGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAAAA---GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAG-----AAAGGATGAAGGAGAAACGTATCTATTGAATACTATATCAAATGATTGATTAATGATGGCCCAAATCTGT------ATTTTT-----GAATACGAAAAGTGGAAGAATTGGTGTGAATTCCATATTGACGAAAGAATATTCATTCATCAAATCATTCACTCCATA----GTCTGATAGATCCTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCC--AAAAGAA-GCCTATTTGACTCCGAAAATATTTATCCTATTCCCC------TTTTTCGTTATT-----------------------------------------CGTTAGCGGTTCAAAATTCCTTATTCTGATTCTTTTTAACAAACGTATTGCGGCATAAATGCCCTTCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCT---------ATGTGAATGATTCACAATCAATAACATTACTCCTACTGAAA-CTTCGAAAGGCGTCTTTTTGAAGATCCAAGAAATTACAGGATTTGGAGAAAACTTTGAAATTTCCCCTTGTCCTTTTAATTGACATAGACCCC-AGTCATCTAATAAAATGAGC-AGAGGATGCCACATTGGGAATGGTCGGGATAGCTCAGC-TGGTAGAGCAGAGGACTGAAAATGAAGGACACGGTCCGTTGTGGATTAAAAATCCACCATTTTCCATTTGTCTAGGAATGGCGGTGCTCTTGGCTCGACATTGTTTGTTCTGTTACACTTGAATCCTTCTTTTTTTGTTGGGTTGTAAATAGTCTACGATGGAGCTCGAGTAGAAAGGATTAATTCATTTCTGGGGGGCAAGGATCTAGGGTTAATGCCAATCAATTGGAACAACTTCGTAAATATATCTTCTATATATAGAAATAGAAAGGATCCAATTCGACCAAGTTTCCAATTCAAAAGCAAAACTTGTTGGAATTGATCAAACTTTTTCGATTCAAGGTGTATCACGCGGGAATTAACTGTCCATACGATTCTTTGCTAGAAAGAAATCAAAAAAGGGTATGTTGCTGCCATTTTGAAAGAATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAA-TTAAGGATTAAAGGATCTACGAACAAGGAAACACCATTTGAATTGTCTCGAGAGTCTCACTAGTTGGATCAGACTAAAGAATCCAAATACAATTTAAAATGAGACAAACAG-AAGGGGGTAAAGACTACTCAATAAATAAAATGGACTTCTAATTTTT--CCTTTGAACTATTTGAAGAGTTATCCAACTTGAGTTATGAGTACGAATGGTTTCTTTTTCCTTT-TCCGGAAGAAAAAAAGACTGAAATAGAAATTCTAGTCTAATTGATTGGCCCACGTGTCATTTAATTTATTAGAATTGCATACATAGACAAAAC-TTCGAATCAAATCATTTTTTCTCGAGCCGTACGAGGAGAAAACCTCCTATACGGTTCTAGGGGGGG-TATTGTTCATCTACATCTATCCCACTGAG?????????????? ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4307] TITLE 'GBSSI (waxy)'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2294; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Castilleja_alpicola_33 ?????CTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCGTTCGATTTCATCGATGGGTATGAAAAAGA----TTACCTGTTTAGCTCTAA---AGAAGAGTATTATAATAATAA---------TAATATTTTTTT--CTTGTGTCAATGTGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCTGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACTGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACAGTAAGATTCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACGGATATATTAATCGAGAA------------------------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAAGAGCGTACCTGTTATCGGGTTTATCGGTAGACTCGAAGAACAGAAAGGCTCGGATATTTTGGTCGCCGCTATTTCTAAATTTATTGGGATGAAGGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTAAGCAGGAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTCCCCTT--CGCATTATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTT--------------CTTT----CTATTTTTGCCTTTTT-----------AAAAAAAAC--TGTGCTTGGTAT----TGATCTAATT----TTCGAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGTGTTATTAGGA---TTGAG-----------------------------CTATCCGGATGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TTGTCCGATT-------GTAACAACTTATTCTTTCTGGACCGTTAGATCGTTTTTATTT-----------AAAT-TTACGACAAC---GGTTGTTATAGCAATCGTTATTGTAA-------CTATAGACATTTTTAACGATTCTAA---CCAACTCTAACAAATTTGCTAACCATGATTCA-CAGCCCGGAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTTTATGGGATGCCTGAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGAAGCTTACGGTACTGATGCCTTCTGATGCCTTCGACAAAATGATCCAAAACTGCATGTCACAAGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGACAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGATCGGCAAAGGAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_alpicola_37 ??CTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCGTTCGATTTCATCGATGGGTATGAAAAAGA----TTACCTGTTTAGCTCTAA---AGAAGAGTATTATAATAATAA---------TAATATTTTTTT--CTTGTGTCAATGTGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCTGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCCAAGCCTTTGTTGAAGGAGGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATAGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGCTCAGATAATCATTCTTGTAAGTTTTACTCA----TCAACTTGT----CATTCTT--CGTCTT-----GGTGTTATGTTGATATTGATTTTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGGACGGTGAGAGCCTTTTTTTT---------------CCTT----CTATTTTTGCCTTTTTTT--------------ATAAAATGTGCTTGATTT----TGATCTAATT----CTCGAAACTG----GTTGGATCAGATACCCATCTGTACTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGGAGTTTTAATGTTGAGGTA----CGATAA---CATCGATATTTGAATCATAATC-------TTATGCATTATTAGGA---TTGAGTTAA---TAGTTACAAAGAGCTGCTCAACTCTTCCGGCTGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTACTCTTTCCGGACTGTTAGATCGTTTTTTTT------------AAAC-ATACGAGAAC---GGTTGTTATAACAATCGTTATTGAAA-------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAA---------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCCACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGCAGCTTATGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTGC-TCA-----TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTCAATTAT---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-TGGG----CTTT-ATA----TTGGCAT--------CTCCTAAAGTCATAAACAACACTCTTAAAAGCGCCCATA--------CATAGAACCAACGACGCGTATTCATCTCTTCTACAGTGTCGATATATACCCAAAGTAAAAGTTGTTGGCCCACGCTCAA-TAT----GAACACTTTTTTACAGGGACCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGACGATGAAATTGGTCCGCTCTCC Castilleja_alpicola_42 ?ACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCGTTCGATTTCATTGGTGGGTATGAATTTTTT---TTACCTATTTAGTTCTAA---AGAAGAGTATAATAATAATAATAATAATAATAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCCAAGCCTTTGTTGAAGGAGGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATAGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TCAACTTGT----CATTCTT--CGTCTT-----GGTGTTATGTTGATATTGATTTTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGACTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGGACGGTGAGAGCCCTTTTTTT---------------CTTT----CTATTTTTGCCTTTTTTT--------------ATAAAATGTGCTTGATTT----TGATCTAATT----CTCGAAACTG----GTTGGATCAGATACCCATCTGTACTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TTATGCATTATTAGGA---TTGAGTTAA---TAGTTACAAAGAGCTGCTCAACTTTTCCGGCTGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCCGGACTGTTAGATCGTTTTTTTT------------AAAC-ATACGAGAAC---GGTTGTTATAACAATCGTTATTGAAA-------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAA---------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCCACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGCAGCTTATGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTGC-TCA-----TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTCAATTAT---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-TGGG----CTTT-ATA----TTGGCAT--------CTCCTAAAGTCATAAACAACACTCTTAAAAGGGCCCATA--------CATAGAACCAACGACGCGTATTCATCTCTTCTACAGTGTCGATATATACCCAAAGTAAAAGTTGTTGGCCCACGCTCAA-TAT----GAACACTTTTTTACAGGGACCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTCGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_alpicola_48 ?ACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCGTTCGATTTCATCGATGGGTATGAAAAAGA----TTACCTGTTTAGCTCTAA---AGAAGAGTATTATAATAATAA---------TAATATTTTTTT--CTTGTGTCAATGTGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTAGATGAAGGCTGGGATCTTAGAATCTGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACTGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTGCTGATAAATACATTGATTGCAACTACGATATCACCACAGTAAGATTCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACGGATATATTAATCGAGAA------------------------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGCTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAAGAGCGTACCTGTTATCGGGTTTATCGGTAGACTCGAAGAACAGAAAGGCTCGGATATTTTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTAAGCAGGAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTCCCCTT--CGCATTATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTT--------------CTTT----CTATTTTTGCCTTTTT-----------AAAAAAAAC--TGTGCTTGATTT----TGATCTAATT----TTCGAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGTGTTATTAGGA---TTGAG-----------------------------CTATCCGGATGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TTGTCCGATT-------GTAACAACTTATTCTTTCTGGACCGTTAGATCGTTTTTATTT-----------AAAT-TTACGACAAC---GGTTGTTATAACAATCGTTATTGTAA-------CTATAGACATTTTTAACGATTCTAA---CCAACTCTAACAAATTTGCTAACCATGATTCA-CAGCCCGGAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTTTATGGGATGCCTGAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGAAGCTTACGGTACTGATGCCTTCTGATGCCTTCGACAAAATGATCCAAAACTGCATGTCACAAGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGACAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGATCGGCAAAGGAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_ambigua_02 ??????????????????????????????????????????TTCGATTTCATCGATGGGTATGAAAAAAAAT--TTACCTGTTTAGTTCTAA---AGAAGAGTATAATAA---------------TAATATTTTTTC--CATGTGTCAATGAGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGATGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACTGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGACTACTGACAAATACATTGATTGCAACTATGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACT-AATGAGTACGGATAAATTAATCGAGAATGTGTACATA--------------------CGTACTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTACCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCACCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGGTATAT-----TTGTAT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCTTTTTTTT----------------CTTCTT--CTATTTTTGGCTTTTTTT--------------AA-C--TATTGTTT---T------------------TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGGTATTTGAATCATAATC-------TAATGTG-----------------------------------AGCTACTTGACCTTTCCGGCTGTTTCAAGTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TCGTCCGAAC-------GTAACAACTTATTCTTTTTGGACCGTTAGATTTTTTTTTTTT-----------AAAC-ATACAAGAAC---AGTTGATATAACAATTGTTATTGAAA-------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAA---------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCGACACTATTGACCCTAGGGATGTGCAAAAGATAGTCAAAGCCGTTGGCAGAGCTCTAGCAGCTTATGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAAGATCACTCTTGGAAGGTAAATTG-----TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTCATTTAT---CTTAGAT-AT--GAAGTA--------------------------------------------------------------------------------------------GT-AAAAA--------------ATA----TTTGCAT--------CTCGTAAAGTCAT-AAAAGTACTCTTAAAAGCGCCCGTA--------CATAGAACCAACGACGCGTATTCATCTCTTTTATGGTGTCGAGAT-----------------------------CTCAA-TAT----GATCATTTTTTTAAAGGGGCCGGCAAAGAAATGGGAAGCAATGCTGCTAAACTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_ambigua_08 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAAAT--TTACCTGTTTAGTTCTAA---AGAAGAGTATAATAA---------------TAATATTTTTTC--CATGTGTCAATGAGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGGAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACTGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGACTACTGACAAATACATTGATTGCAACTATGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACT-AATGAGTACGGATAAATTAGTCGAGAATGTGTACATA--------------------CGTACTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCACCGCTATTCCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGGTATAT-----TTGTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGACAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATCACATGCCATGCGATATGGAACGGTGAGAGC-TTTTTTTT---------------CTTCTT--CTATTTTTGGCTTTTTTT--------------AA-C--TATTGTTT---T------------------TTCAGAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGGTATTTGAATCATAATC-------TAATGTG-----------------------------------AGCTACTTGACCTTTCCGGCTGTTTCAAGTAGCCGTTGGACAG-----GTTT-AAGTCCTAG----TCGTCCGAAC-------GTAACAACTTATCCTTTTTGGACCGTTAGATTTTTTTTTTTT-----------AAAC-ATACAAGAAC---AGTTGATATAACAATTGTTATTGAAA-------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAA---------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCGACACTATTGACCCTAGGGATGTGCAAAAGATAGTCAAAGCCGTTGGCAGAGCTCTAGCAGCTTATGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAAGATCACTCTTGGAAGGTAGATTA-----TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTCATTTAT---CTTAGAT-AT--GAAGTA--------------------------------------------------------------------------------------------GT-AAAAA--------------ATA----TTTGCAT--------CTCGTAAAGTCAT-AAAAGTACTCTTAAAAGCGCCCGTA--------CATAGAACCAACGACGCGTATTCATCTCTTTTATGGTGTCGAGAT-----------------------------CTCAA-TAT----GATCATTTTTTTAAAGGGGCCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_arvensis_2_01 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGATATGAAAAAAA----TTACCTGTTTAGTTCTAAATTAGAAGCGTATAATAATAA------------TAATACTTTTT---CTTGTGTCGATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGTATCTTAGAATCGGATAGGGTTCTGACAGTGAGCCCTTATTATGCTCAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGTTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACT-AATGAGTACGGACAAATTAATCGAGAAAGTGTACGTACGTG----------------CGTATTTCCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAATGTACCTGTTATCGGGTTTATTGGTAGACTAGAAGAACAGAAAGGCTCCGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAAATAATCGTTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATAATGATGATATTGATATTTTTT--TTTTCT----TTC----------------------AGGGAACTGGCAAGAAGAAGTTTGAGCAGCAGACCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCTAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCACAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCCTATTCAATTACATGCCATGCGATATGGAACGGTGAGAGCTTTTTTTTT---------------CTTTTT--CTATTTTTGCCTTTTCTTTTT-----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGAT----------------GAATCATAATC-------TAATGCGTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCTTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCTGGACCGCTAGATCGTTTTTTTTT-----------AAACTATACGAGAACAACGGTTGTTATAACAA-------------------CTGTCGGCAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGCTCATGATATAT--GCATATTT----ATGTTTCATTATAGAATGCCTAAAAGTTGCTATATTATTGTTT-GCAGTGCGACACTATTGACCCTACGGACGTGCTAAAGATAGCAAAAGCCGTTGGTAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTTTT-CTATTATTTCGTTTGATTTAA---CTTTAGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTAAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_arvensis_2_10 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAAATTAGAAGCGTATAATAATAA------------TAATACTTTTT---CTTGTGTCGATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGTATCTTAGAATCGGATAGGGTTCTGACAGTGAGCCCTTATTATGCTCAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGTATTGGACAACACCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGG-TACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACT-AATGAGTACGGACAAATTAATCGAGAAAGTGTACGTACGTG----------------CGTATTTCCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAATGTACCTGTTATCGGGTTTATTGGTAGACTAGAAGAACAGAAAGGCTCCGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAAATAATCGTTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATAATGATGATATTGATAATTTTTT-TTTTCT----TTC----------------------AGGGAACTGGCAAGAAGAAGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCTAGAGGGGTGGCAAAATTCAACGTGCCCTTGGCACAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATCTGAACCCTGTGGTCTTATTCAATTACATGCCATGCGATATGGTACGGTGAGAGCTTTTTTTTT---------------CTTTTT--CTATTTTTGCCTTTTCTTTTT-----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGGAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGAT----------------GAATCATAATC-------TAATGCGTTATTAGGA---TTGAGTCAA---TAGTTGCAAAGAGCTGCTCGACCTTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCTGGACCGCTAGATCGTTTTTTTTT-----------AAACTATACGAGAACAACGGTTGTTATAACAA-------------------CTGTCGGCAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCCAACCATGATTCAACAGCCCGTAAGCTTCATCCACAACATGCGCTCATGATATAT--GCATATTT----ATGTTTCATTATAGAATGCCTAAAAGTTGCTATATTATTGTTT-GCAGTGCGACACTATTGACCCTACGGACGTGCTAAAGATAGCAAAAGCCGTTGGTAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTTTT-CTATTATTTCGTTTGATTTAA---CTTTAGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTAAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGAGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_attenuata_58 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGCAAGAAA----TTACCTGTTTAGTTCTAA---GGAAGCGTATAATAATTA------------TAATACTTTTT---CTTGTGTCAATGGGTAAGAAT--GGAATGTATGTTACTGT--------TGTAGTTACAAGAAGCCTGTGAAAGGAAGGAAAATCTACTGGATGGAGGCCGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTAGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTGC----TTTCTTATATCACT-AATGAGCAAGGATAAATTAATCGAGAATGTGTACATACGTATGTA------------CGTACTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTAGTCGCCGCTATTTCTAAATTCATTGGAATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TTAAATCGT----CATTCTT--TGTCTT-----GGCATTACGTTGATAATGATACTTT----TTTTTT----CTCTTTCCTATATATCTGATCTATCAGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGTTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCATTTTTTTTT--------------CTTT----CTATTTTTGGCTTTTTTT-----------CTAATCC--AGTGATCTATTT------------------TTCAAAACTG----GTTTGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTTGCTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGGTA------------TTTGAATCATAATC-------TAATGTGTTATTAGGA---TTG----------------------------------------------AACTAGCCGTTGAACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCTGGACCGCTAGCTCGTTTGTTTTT-----------AAAC-ATACTAGAAC---AGTTGTTATAATAGTCGTTATTGAAA-------CTATCGACAGTTTCAACGATTCTAA---CCAACTCTAACAAATT-TCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT--------------ATAGAATGCCTAAAAGTTGCTACATTATTGTTT-GCAGTGTGACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TTA-----TTCATACATTTACGGGCTTTT-GTATAACTTCGTTTGATTTAA---CTTAGATTATATGAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGGCCGGTTTTCATA----TTGGCAT--------CTCGTAAAGTCATAAATAACAATCTTGAAAGCGCCCATA--------CATAGAACCAACGACGCGCATTCATCTCTTC-------------------------------------------------TATAT--GAACACTTTTTCACAGGGACCGGCTAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_attenuata_72 ??CTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGCAAGAAA----TTACCTGTTTAGTTCTAA---GGAAGCGTATAATAATTA------------TAATACTTTTT---CTTGTGTCAATGGGTAAGAAT--GGAATGTATGTTACTGT--------TGTAGTTACGAGAAGCCTGTGAAAGGAAGGAAAATCAACTGGATGAAGGCCGGGATCTTAGAATCTGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTAGACAACATCCTTCGCAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTGC----TTTCTTATATCACT-AATGAGCAAGGATAAATTAATCGAGAATGTGTACATACGTATGTA------------CGTACTTTCAGGTTACCGATGCTTAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCCCGGATATTCTAGTCGCCGCTATTTCTAAATTCATTGGAATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TTAAATTGT----CATTCTT--CGTCTT-----GGCATTACGTTGATAATGATATTTTT---TTTTTT----CTCTTTCCTATATATCTGATCTATCAGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGTTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGCCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCATTTTTTTTT--------------CTTT----CTATTTTTGGCTTTTTTT-----------CTAATCC--AGTGATCTATTT------------------TTCAAAACTG----GTTTGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTTGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGGTA------------TTTGAATCATAATC-------TAATGTGTTATTAGGA---TTG----------------------------------------------AACTAGCCGTTGAACAG-----CTTT-AAGTCCTAG----CCGTCCGATC-------GTAACAACTTATTCTTTCTGGACCGTTAGCTCGTTTGTTTTT-----------AAAC-ATACTAGAAC---AGTTGTTATAATAGTCGTTATTGAAA-------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-TCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT--------------ATAGAATGCCTAAAAGTTGCTACATTATTGTTT-GCAGTGTGACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTTTT-GTATAACTTCGTTTGATTTAA---CTTAGATTATATGAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGGCCGGTTT-CATA----TTGGCAT--------CTCGTAAAGTCATAAACAACAATCTTGAAAGCGCCCATA--------CATAGAACCAACGACGCGCATTCATCTCTTC-------------------------------------------------TATAT--GAACACTTTTTCACAGGGACCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_auriculata_48 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TAATACTCTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGCTCTGACAGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGTGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACT-AATGAGAACAGATTAATCAATCGAGAATGTGCACGTACGAA----------------CGTACCTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTCATCGGGTTTATTGGTGGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTCT-TTGATATTGATATTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCAGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCACAT-ATGATAACTGCTGCTGCTGATTTTATGCTGGTTCCAAGTAGATTTGAACCCTGTGGTCTTATTCAGTTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTT--------------GTTCTT--CTATTTTAGCTTCTCTTTTTTTTT--------AAAT--TGTGCTT-----------------TT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGACATTTGAATCATAATC-------TAATGTGTTATTAGGA---TTGAGTCAA---TAGTTACGAAGAGCAGCTCGACCTTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTG-TCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAA--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACCATTGACCCTAAGGACGTTCTAAAGATAGCAAAAGCCGTTGGTAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAACAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGCCGATGAAATTGGTCCGCTCTCC Castilleja_auriculata_50 ????????????????ATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAATAA------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACAGTGAGCCCTTACTATGCTCAGGAACTCATTTCGGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC---TACCGTCCTACGTAC----TTTCTTA--TCACT-AATGAGAACAGATAAATTAATCGAGAATGTGCACGTACGAA----------------CGTACTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTCATCGGGTTTATTGGTGGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTCT-TTGATATTGATATTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCAGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCACAT-ATGATAACTGCTGCTGCTGATTTTATGCTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATTCAGTTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTT--------------GTTCTT--CTATTTTAGCTTCTTTTTTTTTTT--------TAAT--TGTGCTT-----------------TT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGACATTTGAATCATAATC-------TAATGTGTTATTAGGA---TTGAGTCAA---TAGTTACGAAGAGCAGCTCGACCTTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTGGATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTTCTAAAGATAGCAAAAGCCGTTGGTAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTTGTAAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAACAGTGCTGCTAAGATTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGCCGATGAAATTGGTCCGCTCTCC Castilleja_auriculata_53 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACAGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACT-AATGAGAACAGATTAATTAATCGAGAATGTGCACGTACGAA----------------CGTACCTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTCATCGGGTTTATTGGTGGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTCT-TTGATATTGATATTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCAGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCACAT-ATGATAACTGCTGCTGCTGATTTTATGCTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATTCAGTTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTT--------------GTTCTT--CTATTTTAGCTTCTTTTTTTTTTTTT------AAAT--TGTGCTT-----------------TT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGACATTTGAATCATAATC-------TAATGTGTTATTAGGA---TTGAGTCAA---TAGTTACGAAGAGCAGCTCGACCTTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-ACAGTGCGACACTATTGACCCTAAGGACGTTCTAAAGATAGCAAAAGCCGTTGGTAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGGGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTCAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAACAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGCCGATGAGATTGGTCCGCTCTCC Castilleja_auriculata_61 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAATAA------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------CGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACAGTGAGCCCTTACTATGCTCGGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CG---ATCTGTCGTACGTAC----TTTCTTA--TCACT-AATGAGAACAGATAAATTAATCGAGAATGTGCACGTACGAA----------------CGTACTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTCATCGGGTTTATTGGTGGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTCT-TTGATATTGATATTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCAGATAAAGCCAGAGGAGTGGAAAAATTCAACGTGCCCTTGGCACAT-ATGATAACTGCTGCTGCTGATTTTATGCTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATTCAGTTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTT--------------GTTCTT--CTATTTTGGCTTCTTTTTTTTTTTTTT-----AAAT--TGTGCTT-----------------TT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TGTCGACATTTGAATCATAATC-------TAATGTGTTATTAGGA---TTGAGTCAA---TAGTTACGAAGAGCAGCTCGACCTTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTTCTAAAGATAGCAAAAGCCGTTGGTAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGGATGGGAAACAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGCCGATGAAATTGGTCCGCTCTCC Castilleja_campestris_01 ??CTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGCAAGAAA----TTACCTGTTTAGTTCTAA---AGAAGAGTATAATAATAGTAA---------TAATACTTTTT---CTTGTGTCAATGTGTAAGAAT-------GTATGTTACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCCTA--TCACTTAATGAGTACGGTTAAATTAATCGAGAATGTGTA------------------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGGTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTGTTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGCCTT-----GGCATTATGTTGATATTGATATT------TTTTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAACAGCAGATCAAAGAACTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCGTGTGGTCTTATCCAACTACACGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTT--------------CTTTTACCCTATTTTTGGCTTTTT-CT-------------AAAC---------TATTT---------------------------------TTGGATCAGATACCTATATGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CAATAA---TATCGACATTTGAATCATAATC-------TAATGCTTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCTTACCGGCTGTTCCAACTAGCCGTTGGGCAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------GAAACAACTTATTCTTTCTGGACCGTTAGATCGTTTTTTTTTT----------AAACTATACGAGAACAACGGTTGTTATAACAATCGTTATTGAAA-------CTATAGGCAGTTTAAATGATTCTAA---CCAACTCTAACAAATT-GCTAATCATGATTCAACAGCCAGGAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATGTTTCATTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACAATTGACCCTACGGACGTGCAAAAGATAGTCAAAGCCGTTGGCAGAGCTGTTGCAGCTTACGGTACTGATGCCTTC----------AACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTTACACATTTACGAGCTTTT-ATATAATTTCGTTTGATTTAA---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGGTCGGCTTTCATA----TTGGTAT--------CTCGCAAAGTCAT-AACAACACTCTTAATAGCGCCCGTA--------CATAGAATCAACGACACGTATTCATCTTT--------------------------------TTTTTGGCCCACGCTCAA-TATATATGATCACTCTTTTACAGGGACCAGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_campestris_07 ???????????????????????????????????????????????????????????????????????????????????????TTCTAA---AGAAGAGTATAATAATAGTAA---------TAATACTTTTT---CTTGTGTCAATGTGTAAGAAT-------GTATGTTACTGT--------TATAATTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCCTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATTGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCCTA--TCACTTAATGAGTACGGTTAAATTAATCGAGAATGTGTA------------------------CGTATTTTCGGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGGATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATT------TTTTTT----CTC----------------------AGGGAACTGGTAAGAAAAGGTTTGAACAGCAGATCAAAGAACTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCGTGTGGTCTTATCCAACTACACGCCATGCGATATGGAACGGTGAGAGCCTTCTTTTTTCTTTTT--------CTTTTACCCTATTTTTGGCTTTTTTCT-------------AAAC---------TATTT---------------------------------TTGGATCAGATACCTATATGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGACATTTGAATCATAATC-------TAATGCTTTATTAGGA---TTGAGTCAA---TAGTTACAAAGGTCTGCTCGACCTTTCCGGCTGTTCCAACTAGCCGTTGGGCAGGACAGCTTT-AAGTCCTAA----TCGTCCGATC-------GAAACAACTTATTCTTTCTGGACCGTTAGATCGTTTTTTTT------------AAACTATACGAGAACAACGGTTGTTATAACAATCGTTATTGAAA-------CTATAGGCAGTTTAAACGATTCTAA---CCAACTCTAACAAATT-GCTAATCATGATTCAACAGCCAGGAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATGCTTCATTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACAATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTGTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTTACACATTTACGAGCTTTT-ATATAATTTCGTTTGATTTAA---CTTAGAT-AT--GAGATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGGTCGGCTTTCATA----TTGGTAT--------CTCGTAAAGTCAT-AACAACACTCTTAATAGCGCCCGTA--------CATAGAACCAACGACACGTATTCATCTTT--------------------------------TTTTTGGCCCACGCTCAA-TATATAAGATCACTCTTTTACAGGGACCAGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_campestris_09 ?????CTTTCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGCAAGAAA----TTACCTGTTTAGTTCTAA---AGAAGAGTATAATAATAGTAA---------TAATACTTTTT---CTTGTGTCAATGTGTAAGAAT-------GTATGTTACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCCTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGGGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCCTA--TCACTTAATGAGTACGGTTAAATTAATCGAGAATGTGTA------------------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATT------TTTTTT----CTC----------------------AGGGAACTGGTAAGAAAAGGTTTGAACAGCAGATCAAAGAACTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCGTGTGGTCTTATCCAACTACACGCCATGCGATATGGAACGGTGAGAGCCTT-TTTTTTCTTTTT--------CTTTTACCCTATTTTTGGCTTTTTTCT-------------AAAC---------TATTT---------------------------------TTGGATCAGATACCTATATGTGCTCCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGACATTTGAATCATAATC-------TAATGCTTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCTTTCCGGCTGTTCCAACTAGCCGTTGGGCAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------GAAACAACTTATTCTTTCTGGACCGTTAGATCGGTTTTTTTTT----------AAACTATACGAGAACAACGGTTGTTATAACAATCGTTATTGAAA-------CTATAGGCAGTTTAAACGATTCTAA---CCAACTCTAACAAATT-GCTAATCATGATTCAACAGCCAGGAAGTTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATGTTTCATTATAGAGTGCCTAAAAGTTGCTATATAATCGTTT-GCAGTGCGACACAATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTGTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTTACACATTTACGAGCTTTT-ATATAATTTCGTTTGATTTAA---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGGTCGGCTTTCATA----TTGGTAT--------CTCGTAAAGTCAT-AACAACACCCTTAATAGCGCCCGTA--------CATAGAACCAACGACGCGTATTCATCTTT--------------------------------TTTTTGGCCCACGCTCAA-TATATATGATCACTCTTTTACAGGGACCAGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_campestris_11 ??CTTCTATCTCCTCAATCTCCCTGATCAGTACAAAAGTTCATTCGATTTCATCGATGGGTATGCAAGAAA----TTACCTGTTTAGTTCTAA---AGAAGAGTATAATAATAGTAA---------TAATACTTTTT---CTTGTGTCAAGGTGTAAGAAT-------GTATGTTACTGT--------GGTATTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCCTA--TCACTTAATGAGTACGGTTAAATTAATCGAGAATGTGTA------------------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGGTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATT------TTTTTT----CTC----------------------AGGGAACTGGTAAGAAAAGGTTTGAACAGCAGATCAAAGAACTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCGTGTGGTCTTATCCAACTACACGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTCTTTTT--------CCTTTACCCTATTTTTGGCTTTTTTCT-------------AAAC---------TATTT---------------------------------TTGGATCAGATACCTATATGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAGAGAAGGATACACTGGGTTCCACATGGAAAGTTTTAATGTTGAGGTA----CAATAA---TATCGACATTTGAATCATAACC-------TAATGCTTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCTTTCCGGCTGTTCCAACTAGCCGTTGGGCAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------GAAACAACTTATTCTTTCTGGACCGTTAGATCGTTTTTTTTTT----------AAACTATACGAGAACAACGGTTGTTATAACAATCGTTATTGAAA-------CTATAGGCAGTTTAAACGATTCTAA---CCAACTCTAACAAATT-GCTAATCATGATTCAACAGCCAGGAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATGTTTCATTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACAATTGACCCTACGGACGTGCTAAAGATAGCCAAAGCCGTTGGCAGAGCTGTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTTACACATTTACGAGCTTTT-ATATAATTTCGTTTGATTTAA---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAGAA-CGGGTCGGCTTTCATA----TTGGTAT--------CTCGTAAAGTCAT-AACAACACTCTTAATAGCGCCCGTA--------CATAGAACCAGCGACACGTATTCATCTTT--------------------------------TTTTTGGCCCACGCTCAA-TATATATGATCACTCTTTTACAGGGACCAGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_cerroana_11 ???????????????????????????CAATATAAAAGTTCGTTCGATTTCATTGATGGGTATGATTTTTTT---TTACCTATTTAGTTCTAA---AGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGAACTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATACCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAGGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATAGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TCAACTTGT----CATTCTT--CGTCTT-----GGTGTTATGTTGATATTGATTTTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCTGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATGACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGGACGGTGAGAGCCTTTTTTTT---------------CTTT----CTATTTTCGCCTTTTTTT--------------ATAAAATGTGCTTGATTT----TGATTTAATT----CTCGAAACTG----GTTGGATCAGATACCCATCTGTACTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAACGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TTATGCATTATTAGGA---TTGAGTTAA---TAGTTACAAAGAGCTGCTCAACTTTTCCGGCGGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTCG----TCGTCCGATC-----------GAACTTATTCTTTCCGGACTGTTAGATCGTTTTTTTT------------AAAC-ATACGAGAAC---GGTTGTTATAACAATCGTTATTGAAA-------CTATCGACAGTTTTAACGACTCTAA---CCAACTCTAACAAA---------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCCACACTATTGACCCTACGGACGTGCTAAAGATAGTGAAAGCCGTTGGCAGAGCTCTTGCAGCTTATGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTGC-TCA-----TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTCAATTAT---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-TGGG----CTTT-ATA----TTGGCAT--------CTCCTAAAGTCATAAACAACACTCTTAAAAGCGCCCATA--------CATAGAACCAACGACGCGTACTCATCTCTTCTACAGTGTCGATATATACCCAAAGTAAAAGTTGTTGGCCCACGCTCAA-TAT----GAACACTTTTTTACAGGGACCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_cerroana_17_2 ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GAAGGAAAATCACCTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTAAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTTGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCATAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAACGTGTACGTACGTACGTA------------CGTATTTTCAGGTTACTGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCACCGGTTGGGTTGCCTGTG??????????????????????????????????????????????????????????????????????????????????AATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATAT-----TTGTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAAATCAAAGAGCTGGAGGTGTTGTATCCCGATAACGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCAGATTTTATGTTGATTCCAAGTAGATTTGAACCATGTGGTCTTATCCAATTACATGCCATGCGATACGGAACGGTGAGAGCCTTTTTTTTTTTTTTTTTTTTTT---------CTATTTTTGCCTTATTTTTTTT----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTGCATGCTTGGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACTTGGGAAGCTTTAATGTTGAGGTA----CGATAC---TATCGATATTTGAATCATAATC-------TAATGCGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTTCGGCTGTTCCAACTAGCCGTTAGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCCTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATGCGAGAAC---GGTTGTAA-------------------------CTATCGACGGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---GTATAT--GCATATTT----ATGTTTCTTTATAGAATGCCTAAAAGTTGCTATATTATTGTTT-GCAGTGCGACACTATTGACCCTACAGACGTGCTAAAGATAGCAAAAGCCGTTAGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GATGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTTTT-CTATTATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTAAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGTGATGAAATTGGTCCGCTCTCT Castilleja_cerroana_25_2 ?????????????????TCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAT----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TACTACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTAAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTTGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGCAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACCTAATGAGTACAGATAAATTAATCGAGAATGTGTACGTACGTACGTA------------CGTATTTTCAGGTTACAGATGATAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGG?????????????????????????????????????????????????????????????????????????CTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATAT-----TTGTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAAATCAAAGAGCTGGAGGTGTTGTATCCCGATAACGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCAGATTTTATGTTGATTCCAAGTAGATTTGAACCATGTGGTCTTATCCAATTACATGCCATGCGATACGGAACGGTGAGAGCCTTTTTTTTTTTTTTTTTTTT-----------CTATTTTTGCCTTATTTTTTTT----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTGCATGCTTGGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACTTGGGAAGCTTTAATGTTGAGGTA----CGATAC---TATCGATATTTGAATCATAATC-------TAATGCGTTATTCGGA---TTGAGTCAA---TAGTTTCAAAGAGCTGCTCGACCATTTCGGCTGTTCCTACTAGCCGTTAGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTTATCCATAACATGCGGTC---GTATAC--GCATATTT----ATGTTTCTTTATAGAATGCCTAAAAGTTGCTATATTATTGTTT-GCAGTGCGACACTATTGACCCTACAGACGTGCTAAAGATAGCAAAAGCCGTTAGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GATGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTTTT-CTATTATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTAAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGTGATGAAATTGGTCCGCTCTCT Castilleja_cerroana_3 ???????????????????????????CAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAT----TTACCTGTTTAGTTCTAA---GGAGGAGCATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------AGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTAAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTTGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATCGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACAGATAAATTAATCGAGAATGTGTACGTACGTACGTA------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATAT-----TTGTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAAATCAAAGAGCTGGAGGTGTTGTATCCCGATAACGCCCGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATACGGAACGGTGAGAGCCTTTTTT-----------------CTTT----CTATTT-CGCCTTTTTTTT-------------ATAC--TGTGCTTGATTTCCCGTGATCTAATT----TTCGAAACTGCATGCTTGGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTCGACACGGTGAAAGAAGGATACACTGGGTTCCACTTGGGAAGCTTTAATGTTGAGGTA----CGATAC---TATCGATATTTGAATCATAATC-------TAATGCGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTTCGGCTGTTCCAACTAGCCGTTAGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-----------AAACTTGGTCTTTCTGGACCGTTAGATCGTTCTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---GTATAT--GCATATTT----ATGTTTCTTTGTAGAATGCCTAAAAGTTGCTATATTATTGTTT-GCAGTGCGACACTATTGACCCTACAGACGTGCTAAAGATAGCAAAAGCCGTTAGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GATGAGATGATTCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTCTT-CTATTATTTCGTTTGATTCAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTAAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGTGATGAAATTGGTCCGCTCTCT Castilleja_cerroana_6_2 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAGGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATAGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TCAACTTGT----CATTCTT--CGTCTT-----GGTGTTATGTTGATATTGATTTTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGGGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGGACGGTGAGAGCCTTTTTTTT---------------CTTT----CTATTTTCGCCTTTTTTT--------------ATAAAATGTGCTTGATTT----TGATCTAATT----CTCGAAACTG----GTTGGATCAGATACCCATCTGTACTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TTATGCATTATTAGGA---TTGAGTTAA---TAGTTACAAAGAGCTGCTCAACTTTTCCGGCTGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCCGGACTGTTAGATCGTTTTTTTT------------AAAC-ATACGAGAAC---GGTTGTTATAACAATCGTTATTGAAA-------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAA---------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCCACACTATTGACCCTACGGACGTGCTAAAGATAGTGAAAGCCGTTGGCAGAGCTCTTGCAGCTTATGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTGC-ACA-----TTCACACATTTACGAGCTTTC-GTATAATTTCGTTTCAATTAT---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-TGGG----CTTT-ATA----TTGGCAT--------CTCCTAAAGTCATAAACAACACTCTTAAAAGCGCCCATA--------CATAGAACCAACGACGCGTATTCATCTCTTCTACAGTGTCGATATATACCCAAAGTAAAAGTTGTTGGCCCACGCTCAA-TAT----GAACACTTTTTTACAGGGACCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_cerroana_85_2 ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAGGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATAGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TCAACTTGT----CATTCTT--CGTCTT-----GGTGTTATGTTGATATTGATTTTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACACGCCATGCGATATGGGACGGTGAGAGCCTTTTTTTT---------------CTTT----CTATTTTCGCCTTTTTTT--------------ATAAAATGTGCTTGATTT----TGATCTAATT----CTCGAAACTG----GTTGGATCAGATACCCATCTGTACTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TTATGCATTATTAGGA---TTGAGTTAA---TAGTTACAAAGAGCTGCTCAACTTTTCCGGCTGTTCCAACTAGCCGTTGGACAG-----CTTT-GAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCCGGACTGTTAGATCGTTTTTTTT------------AAAC-ATACGAGAAC---GGTTGTTATAACAATCGTTATTGAAA-------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAA---------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCCACACTATTGACCCTACGGACGTGCTAAAGATAGTGAAAGCCGTTGGCAGAGCTCTTGCAGCTTATGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCTCAGGATCACTCTTGGAAGGTGC-TCA-----TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTCAATTAT---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-TGGG----CTTT-ATA----TTGGCAT--------CTCCTAAAGTCATAAACAACACTCTTAAAAGCGCCCATA--------CATAGAACCAACGACGCGTATTCATCTCTTCTACAGTGTCGATATATACCCAAAGTAAAAGTTGTTGGCCCACGCTCAA-TAT----GAACACTTTTTTACAGGGACCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_cusickii_59 GACTTCTATCTCCTTAATCTCCCTGATCAATACAAAAGTTCATTTGATTTCATGGATGGGTATGAAAATAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGACACCGGTGAAAGGAGGGAAAATCAACAGGATGAAGGCTGGGATCTCAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAAGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTAGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGTCTACTGATACATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACGGATAAATTAATCAAGAACGTGTACGTACATACACGTGTATGTACGTACGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAAA????????????????????????????????????????????????????????????GCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTTTTTTCGTCTT-----GGCATTCTGTTGATATTGATATTTTTT--CTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGAAGATCATGGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCATCGTGCCGTTGGCACAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAAACCTGTGGTCTTATTCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTCTTTTTTTTTTTT---------CTTT----CTATTTTTGCCTTTTCTTTTT-----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGAATGGTGGACCAGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTC----CGATAA---TATCGATATTTGAATCATAATC-------TAACGCGTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCTTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCCAG----TCGTCCGATC-------GTAACAACTTATTCTTTCTGGACTGTTAGATCGTTTTTTTAG----------AAAACTATACGGGACCAACAGTTGTTATGACAATCGTTATTGAAA-------CTATCTGCAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCATGAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAATTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTGTAGCAGCTTACGGTACTGATGCCTTG----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTTTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTGAA--------------------------------------------------------------------------------------------------------------CTGATCAA-TAT----GATCACTCTTTTATAGGGACCGGCCAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCTCTCTCC Castilleja_cusickii_64 GACTTCTATCTCCTTAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAATAATAA---TAACACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGCGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTTGACAAAGGAGTCGAATTAGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACGGATAAATTAATCAAGAACGTGTACGTACGTACACGTGTATGTACGTACGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTGAATGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAAATTACCTGTTATCGGGTTTATTGGTAGACTTGAAGAACAGAAAGGCTCGGATATTCTGTTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTCTGTTGATATTGATATTTTTTT-CTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGAAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCGTTGGCACAT-ATGATAACAGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATTCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTTTTT----------CTTT----CTATTTTTGCCTTTTCTTTTT-----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAACGCGTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCCTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCTGGACTGTTAGATCGTTTTTTTAG----------AAAACTATACGGGACTAACGGTTGTTATGACAATCGTTATTGAAA-------CTATCTGCAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATATATGCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTGTAGCAGCTTACGGTACTGATGCCTTC----------AACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTGAA--------------------------------------------------------------------------------------------------------------CTGATCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCTCTCTCC Castilleja_densiflora_08 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGCAAGAAA----TTACCTGTTTAGTTCTAA---GGAAGCGTATAATAATTA------------TAATACTTTTT---CTTGTGTCAATGGGTAAGAAT--GGAATGTATGTTACTGT--------TGTAGTTACGAGAAGCCTGGGAAAGGAAGGAAAACCAACTGGATGGAGGCCGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTAGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTGC----TTTCTTATATCACT-AATGAGCAAGGATAAATTAATCGAGAATGTGTACATACGTATGTA------------CGTACTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTAGTCGCCGCTATTTCTAAATTCATTGGAATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TTAAATTGT----CATTCTT--CGTCTT-----GGCATTACGTTGATAATGATATTT-----TTTTTT----CTCTTTCCTATATATCTGATCTATCAGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGTTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCATTTTTTTT---------------CTTT----CTATTTTTGGCTTTTTTT-----------CTAATCC--AGTGATCTATTT------------------TTCAAAACTG----GTTTGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTTGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACAGGGGAAGTTTTAATGTTGAGGTA----CGGTA------------TTTGAATCATAATC-------TAATGTGTTATTAGGA---TTG----------------------------------------------AACTAGCCGTTGAACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCTGGACCGTTAGCTCGTTTGTTTTT-----------AAAC-ATACTAGAAC---AGTTGTTATAATAGTCGTTATTGAAA-------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-TCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT--------------ATAGAATGCCTAAAAGTTGCTACATTATTGTTT-GCAGTGTGACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGTATGTCACAGGATCACTCTTGGAAGGCAC-TTA-----TTCACACATTTACGAGCTTTT-GTATAACTTCGTTTGATTTAA---CTTAGATTAT---AAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGGCCGGTTTTCATA----TTGGCAT--------CTCGTAAAGTCATAAATAACAATCTTGAAAGCGCCCATA--------CATAGAACCAACGAC-----------------------------------------------------------------TATAT--GAACACTTTTTCACAGGGACCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_densiflora_10 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGCAAGAAA----TTACCTGTTTAGTTCTAA---GGAAGCGTATAATAATTA------------TAATACTTTTT---CTTGTGTCAATGGGTAAGAAT--GGAATGTATGTTACTGT--------TGTAGTTACGAGAAGCCTGTGAAAGGAAGGAAAATCAACTGGATGAAGGCCGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTAGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTGC----TTTCTTATATCACT-AATGAGCAAGGATAAATTAATCGAGAATGTGTACATACGTATGTA------------CGTACTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTAGTCGCCGCTATTTCTAAATTCATTGGAATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TTAAATTGT----CATTCTT--CGTCTT-----GGCATTACGTTGATAATGATATT------TTTTTT----CTCTTTCCTATATATCTGATCTATCAGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGTTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCATTTTTTTT---------------CTTT----CTATTTTTGGCTTTTTTT-----------CTAATCC--AGTGATCTATTT------------------TTCAAAACTG----GTTTGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTTGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGGTA------------TCTGAATCATAATC-------TAATGTGTTATTAGGA---TTG----------------------------------------------AACTAGCCGTTGAACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCTGGACCGTTAGCTCGTTTGTTTTT-----------AAAC-ATACTAGAAC---AGTTGTTATAATAGTCGTTATTGAAA-------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-TCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT--------------ATAGAATGCCTAAAAGTTGCCACATTATTGTTT-GCAGTGTGACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGTATGTCACAGGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTTTT-GTATAACTTCGTTTGATTTAA---CTTAGATTAT---AAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGGCCGGTTTTCATA----TTGGCAT--------CCCGTAAAGTCATAAATAACAATCTTGAAAGCGCCCATA--------CATAGAACCAACGAC-----------------------------------------------------------------TATAT--GAACACTTCTTCACAGGGACCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_elmeri_18 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCTATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------CAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTTCGAGAAGCCGGTGAAAGGAAGGAAAATCAATTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCCCAGCCTTTGTTGAAGGAAGCTCTCCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--AGTCTTAG---TGCATTATGTTGATGTTGATATTTT----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAAGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGAGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTTTTTTTTT------C-------CTATTTTTGCCTCTTTTTTTTT----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGAGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTCCGGCTGTTCCAACTAGCCGTTAGACAG-----CTTT-AAGTCTTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTTATATATATTTCTCTATAGAATGCTTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGAAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CGCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_elmeri_26 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------CAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTTCGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTAGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTTAGCCTTTGTTGAAGGAAGCTCTCCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGCTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTTAG---TGCATTATGTTGATGTTGATATTTT----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAAGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGCGAGAGCCTTTTTTTTTTTTTT-----------------CTATTTTTGCCTTCTTTTTTTT----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGAGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTCCGGCTGTTCCAACTAGCCGTTAGACAG-----CTTT-AAGTCTTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACTGTTGGATCGTTTTTT------------AAAAAC-ATACGAGAAC---GGTTGTAG-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGCAAAAGCCGTCGGTAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTT-ATATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATATA--TTGGCAT--------CTCGTGAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_elmeri_28 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------CAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTTCGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTTAGCCTTTGTTGAAGGAAGCTCTCCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--AGTCTTAG---TGCATTATGTTGATGTTGATATTTT----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAAGTTTGAGCAGCAGATCAAAGTGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCACGCGATATGGAACGGTGAGAGCCTTTTTTTTTTTTTT-----------------CTATTTTTGCCTTCTTTTTTTT----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGAGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTCCGGCTGTTCCAACTAGCCGTTAGACAG-----CTTT-AAGTCTTAG----TCGTCCGATC-------GTAACAACTTGGTCTTTCTGGACTGTTGGATCGTTTTTT------------AAAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCGTGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGCAAAAGCCGTTGGTAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTT-ATATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATATATATTGGCAT--------CCCGTGAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_elmeri_8 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------CAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTTCGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTTAGCCTTTGTTGAAGGAAGCTCTCCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--AGTCTTAG---TGCATTATGTTGATGTTGATATTTT----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAAGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTTTTTTT--------C-------CCTTTTTTGCCTTTTTTTTTTTT---------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCAAAAATG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGAGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTCCGGCTGTTCCAACTAGCCGTTAGACAG-----CTTT-AAGTCTTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTTATATATATTTCTCTATAGAATGCTTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGAAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAGACTGCATGTCGCGGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_exserta_03 GACTTCTATCTCCTTAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGATTTTATTTTTTTACCTATTTAGTTCTAA---AGAAGAGTATAATAATAATAA---------AAATACTTTTT---CTTGT-------------------------ATGTAACTGT--------TGTAGTTATGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCGGATAGGGTTGTGACAGTGAGCCCTTACTATGCTCAAGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTA-GACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATACT-CCTAAG-------CACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTCAGCGATGCTAAGCCTTTGTTGAAGGAGGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAAAGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTTTGGTTGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCACTCATCAACTTGT----TATTCTT--TGTCTTAGAGCTGCATTATGTTGGTGTGGATATAT-----TTTTCTACTTCTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGGAGCAGATCAAAGAGCTGGAGGTGTTGTATCCTGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAGTTACATGCCATGCGATATGGAACCGTGAGAGCCTTTTTTTTTTTTT----------CCTT----CTATTTTTGCCTTTTTTCT-------------AAAC---------TATTT----T----------------------------TTGGATTAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAGCTTTTAATGTTGAGGTATATATGGTAA---TATCGATATTTGAATCATAATC-------TAAGCCGTTGT--------TTGAATCA----TA-----------------------------------AACAAGCCGTTGGACAG-----CTTT-AAGACCTAG----TCTTCTGATC-------GTAACAACTTATTCTTT-TGGACCGTTAGATCGTTGTTTTTTT----------AAAC-ATACGAGAAC---GGTTGTTATAACAATCGTTATTGAAA-------CTATCAAC-------------------------------------------------------------------------------------------------------------------------------CTAAAAGTTGCTATATTGTTGTTT-GAAGTGCGACACTATTGACCCTACGGACGTGCTAAAGATAGTCGAAGCCGTTAGCAGAGCTCTTGCAGCTTACGGTACTGATGCCCTC----------GACGAAATGATCCGAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCACTCA-TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTGATTTAA---CTTGGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAAGAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGACGAAATTGGTCCGCTCTCC Castilleja_exserta_04 GACTTCTATCTCCTTAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGATTTTATTTTTTTACCTATTTAGTTCTAA---AGAAGAGTATAATAATAATAA---------AAATACTTTTT---CTTGT-------------------------ATGTAACTGT--------TGTAGTTATGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCGGATAGGGTTGTGACAGTGAGCCCTTACTATGCTCAAGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATACT-CCTAAG-------CACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAGGCCCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAAAGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAGCAGAAAGGCTCGGATATTTTGGTTGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCACTCATCAACTTGT----TATTCTT--TGTCTTAGAGCTGCATTATGTTGGTGTGGATATAT-----TTTTCTACTTCTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGGAGCAGATCAAAGAGCTGGAGGTGTTGTATCCTGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATCTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAGCTACATGCCATGCGATATGGAACCGTGAGAGCCTTTTTTTTTTTTTT---------CCTT----CTATTTTTGCCTTTTTTCT-------------AAAC---------TATTT----T----------------------------TTGGATTAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTCCCACATGGGAGCTTTTAATGTTGAGGTATATATGGTAA---TATCGATATTTGAATCATAATC-------TAAGCCGTTGT--------TTGAATCA----TA-----------------------------------AACAAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TCTTCTGATC-------GTAACAACTTATTCTTT-TGGACCGTTAGATCGTTGTTTTTTT----------AAAC-ATACGAGAAC---GGTTGTTATAACAATCGTTATTGAAA-------CTATCAAC-------------------------------------------------------------------------------------------------------------------------------CTAAAAGTTGCTATATTGTTGTTT-GAAGTGCGACACTATTGACCCTACGGACGTGCTAGAGATAGTCGAAGCCGTTAGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCGAAACTGCACGTCACAGGATCACTCTTGGAAGGTAC-TCACTCA-TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTGATTTAA---CTTGGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAAGAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_exserta_05 GACTTCTATCTCCTTAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGATTTTATTTATTTACCTATTTAGTTCTAA---AGAAGAGTATAATAATAATAA---------AAATACTTTTT---CTTGT-------------------------ATGTAACTGT--------TGTAGTTATGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATACTAGAATCGGATAGGGTTCTGACAGTGAGCCCTTACTATACACAGGAACTCATTTCAGGAGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATACT-CCTAAG-------CACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAGGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAAAGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTTTGGTTGCGGCTATTTCTAAATTTATTGGGGTGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCACCCATCAACTTGT----TATTCTT--TGTCTTAGAGCTGCATTATGTTGGTGTGGATATAT-----TTTTCTACTTCTC----------------------AGGGGACTGGTAAGAAGAGGTTTGAGGAGCAGATCAAAGAGCTGGAGGTGTTGTATCCTGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTCATGTTGATTCCAAGTAGATTTGAGCCCTGTGGTCTTATCCAGTTACATGCCATGCGATATGGAACCGTGAGAGCCTTTTTTTTTTTTT------------------CTATTTTTGGCTTTTTTCT-------------AAAC---------TATTT----T----------------------------TTGGATTAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAGCTTTTAATGTTGAGGTA----TGGTAA---TATCGATATTTGAATCATAATC-------TAAGCCGTTGT--------TTGAATCA----TA-----------------------------------AACAAGCCGTTGGACAG-----CTTT-AAGTCATAG----TCTTCTGATC-------GTAGCAACATATTACTTCTGGACCGTTAGATCGTCTTAT------------AAAAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATTGATT-GCAGTGCGACACTATTGACCCTACGGACGTGCTAAAGATAGTCGAAGCCGTTAGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCGAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCACTCA-TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTGATTTAA---CTTGGAT-AT--GAGATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAATGCTGCTAAACTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_exserta_15 GACTTCTATCTCCTTAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGATTTTATTTATTTACCTATTTAGTTCTAA---AGAAGAGTATAATAATAATAA---------AAATACTTTTT---CTTGT-------------------------ATGTAACTGT--------TGTAGTTATGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATACTAGAATCGGATAGGGTTCTGACAGTGAGCCCTTACTATGCACAGGAACTCATTTCAGGAGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATACT-CCTAAG-------CACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGGTGCTAAGCCTTTGTTGAAGGAGGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAAAGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTTTGGTTGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCACTCATCAACTTGT----TATTCTT--CGTCTTAGAGCTGCATTATGTTGGTGTGGATATAT-----TTTTCTACTTCTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGGAGCAGATCAAAGAGCTGGAGGTGTTGTATCCTGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAGTTACATGCCATGCGATATGGAACCGTGAGAGCCTTTTTTTTTTTTTT-----------------CCATTTTTGGCTTTTTTCT-------------AAAC---------TATTT----T----------------------------TTGGATTAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAGCTTTTAATGTTGAGGTA----TGGTAA---TATCGATATTTGAATCATAATC-------TAAGCCGTTGT--------TTGAATCA----TA-----------------------------------AACAAGCCGTTGGACAG-----CTTT-AAGTCATAG----TCTTCTGATC-------GTAGCAACATATTATTTCTGGACCGTTAGATCGTCTTAT------------AAAAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATTGATT-GCAGTGCGACACTATTGACCCTACGGACGTGCTAAAGATAGTCGAAGCCGTTAGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCGAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCACTCA-TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTGATTTAA---CTTGGAT-AT--GAGATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAATGCTGCTAAACTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_lacera_01 GAGTTCTATCTCCTTAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGCAAGAAA----CTACCTGTTTAGTTCTAA---AGAAGAGTATAATAATAATAATAA------TAATAATTTTTTTTCATGTGTCAATGAGTATGAAT-------TTATGTAACTGT--------TGGAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATCTTCAGGTTACCGATGCTAAGCCTTTGTTAAAGGAAGCTCTTCAAGCATCGGTTGGGTTACCTGTGGACAGGAACATACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAAAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----TTCATTATGTTGATATTGATATAT-----TTGTTT----CTC----------------------AGGGAACGGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCGTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTT----------------CTTT----CTATTTTTGCCTTTTTTTT-------------AAAC--TGTGCTTGATTT----TGATCTAATT----TTCGAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGCCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGTGTTATTAGGA---TTGAGCTAATAGTAGTTACAAAGAGCTGCTCGACCTTTCCGGCTGTTCCAACTAGCCGTTTGACAG-----CTTTTAAGTCCTAGCTAGTCGTCCGATC-------GTAACAACTTATTCTTTCTGGACCGTTAGATTGTTTTTTATT----------AAAAC-ATACGAGAAC---GGTTGTTATAACAGTCGTTATTGAAA-------CTATCGACAGTTTTAACGATTCTAA---CTGACTCTAACAAATT-GCTAACCATGATTCAA-----------------------------------------------------------------------TGACTGAAGGTTGCTATATTATTGTTT-GCAGTGCGACACAATTGACCCTACGGACGTGCTAAAGATAGCCAAAACCGTTGGCAGAGCTCTCGCAGCCTACGAAACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----CTCATATATTTACGAGCTTTT-GTATAACTTCGTTTGATTTAA---CTGAGAT-AT--GAAATACTACATCCGTTTCAAAAAGATTGTCCACTTTGCTATGTAAATT-ACATA--------GCAAAGTGGACAATCTTTTTGAAACGGAGGGAGTAGT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAA----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATCGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_lacera_03 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGCAAGAAA----CTACCTGTTTAGTTCTAA---AGAAGAGTATAATAATAATAA---------TAACAATTTTTTTTCATGTGTCAATGAGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAACGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAGCTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CA-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTAAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAAAAAGGCTCGGATATTCTAGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATAT-----TTGTTT----CTC----------------------AGGGAACGGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCTCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTG-TCTTATCCAATTACATGCCATGCGATATGGAACGGTTAGAGCCTTTTTTTT---------------CCTT----CTATTTTTGGCTTTTTTTTTT-----------AA-C--TATGCTTTT---------------------TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATTCGTTTTTAGGAATATTGATCTAA---TAGCTACAAAGAGCAGCTCGACCTTTCCGGCTGTTCCAACTAGCCGTTTGACAG-----CTTT-AAGTAATAG----TCGTCCTATCTTAACAAGTAACAACTTATTCTTTCTGGACCGTTAGATCGTTGGTTTT-----------AAAAC-GTGGGA-AAC---GG----TATAACAATCATTATTGAAA-------CTATCGAC-------------------------------------------------------------------------------------------------------------------------------CTAAAAGTTGCTATATTGTTGTTT-GCAGTGCGACACTATTGACCCTATGGACGTGCTAAAGATCGTCAAAGGCGTTGGCAGAGCTCTTGCAGCTTACGAAACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGGCACAGGATCACTCTTGGAAGGTAC-TCA-----CTCACATATTTACGAGCTTTT-GTATAACTTCGTCTGATTTAA---CTGAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGTCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAAATAA----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATCGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_lacera_07 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGCAAGAAA----CTACCTGTTTAGTTCTAA---AGAAGAGTATAATAATAATAA---------TAATAATTTTTTTTCATGTGTCAATGAGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAGCTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CA-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTAAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAAAAAGGCTCGGATATTCTAGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATAT-----TTGTTT----CTC----------------------AGGGAACGGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCTCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTTAGAGCCTTTTTTTT---------------CCTT----CTATTTTTGGCTTTTTTTTTT-----------AA-C--TATGCTTTT---------------------TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATTCGTTTTTAGGAATATTGATCTAA---TAGCTACAAAGAGCAGCTCGACCTTTCCGGCTGTTCCAACTAGCCGTTTGACAG-----CTTT-AAGTAGTAG----TCGTCCTATCTTAACAAGTAACAACTTATTCTTTCTGGACCGTTAGATCGTTGGTTTT-----------AAAAC-ATGGGA-AAC---GG----TATAACAATCATTATTGAAA-------CTATCGAC-------------------------------------------------------------------------------------------------------------------------------CTAAAAGTTGCTATATTGTTGTTT-GCAGTGCGACTCTATTGACCCTATGGACGTGCTAAAGATCGTCAAAGGCGTTGGCAGAGCTCTTGCAGCTTACGAAACTGATGCCTTC----------GACGAAATGATCCAAAACTGCGTGTCACAGGATCACTCCTGGAAGGTAC-TCA-----CTCACATATTTACGAGCTTTTTGTATAACTTCGTCTGATTTAA---CTGAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGTCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAAATAA----GATCACTCTTTTATAGGGACCGGCAAAGAAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATCGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_lacera_08 GAGTTCTATCTCCTTAATCTCCCTGACCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGCAAGAAA----CTACCTGTTTAGTTCTAA---AGAAGAGTATAATAATAATAATAA------TAATAATTTTTTTTCATGTGTCAATGAGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTAAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAAAAAGGCTCGGATATTCTAGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATAT-----TTGTTT----CTC----------------------AGGGAACGGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCTCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCT-ATCCAATTACATGCCATGCGATATGGAACGGTTAGAGCCTTTTTTTT---------------CCTT----CTATTTTTGGCTTTTTTTTT------------AA-C--TATGCTTTT---------------------TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATTCGTTTTGAGGAATATTGATCTAA---TAGCTACAAAGAGCAGCTCGACCTTTCCGGCTGTTCCAACTAGCCGTTTGACAG-----CTTT-AAGTAATAG----TCGTCCTATCTTAACAAGTAACAACTTATTCTTTCTGGACCGTTAGATCGTTGGTTTT-----------AAAAC-ATGGGA-AAC---GG----TATAACAATCATTATTGAAA-------CTATCGAC-------------------------------------------------------------------------------------------------------------------------------CTAAAAGTTGCTATATTGTTGTTT-GCGGTGCGACACTATTGACCCTATGGACGTGCTAAAGATCGTCAAAGGCGTTGGCAGAGCTCTTGCAGCTTACGAAACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----CTCACATATTTACGAGCTTTT-GTATAACTTCGTCTGATTTAA---CTGAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGTCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAAATAA----GATCACTCTTTTATAGGGACCGGCAAAGGAAAGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATCGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_lacera_15 GAGTTCTATCTCCTTAATCTCCCTGATCAGTACAAAAGTTCATTCGATTTCATCGATGGGTATGCAAGAAA----CTACCTGTTTAGTTCTAA---AGAAGAGTATAATAATAATAATAA------TAATAATTTTTTTTCATGTGTCAATGAGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACCGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGCTAAAGGAAGCTCTTCAAGCATCGGTTGGGTTACCTGTGGACAGGAACATACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAAAAAGGCTCGGATATTCTGGTCGCGTCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----TTCATTATGTTGATATTGATATAT-----TTGCTT----CTC----------------------AGGGAACGGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCGTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTT----------------CTTT----CTATTTTTGCCTTTTTTTTT------------AAAC--TGTGCTTGATTT----TGATCTAATT----TTCGAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGTGTTATTAGGA---TTGAGCTAATAGTAGTTACAAAGAGCTGCTCGACCTTTCCGGCTGTTCCAACTAGCCGTTTGACAG-----CTTTTAAGTCCTAGCTAGTCGTCCGATC-------GTAACAACTTATTCTTTCTGGACCGTTAGATTGTTTTTTATT----------AAAAC-ATACGAGAAC---GGTTGTTATAACAGTCGTTATTGAAA-------CTATCGACAGTTTTAACGATTCTAA---CTGACTCTAACAAATT-GCTAACCATGATTCAA-----------------------------------------------------------------------TGACTGAAGGTTGCTATATTATTGTTT-GCAGTGCGACACGATTGACCCTACGGACGTGCTAAAGATAGCCAAAACCGTTGGCAGAGCTCTCGCAGCTTACGAAACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----CTCACATATTTACGAGCTTTT-GTATAACTTCGTTTGATTTAA---CTGAGAT-AT--GAAATACTACATCCGTTTCAAAAAGATTGTCCACTTTGCTATGTAAATT-ACATA--------GCAAAGTGGACAATCTTTTTGAAACGGAGGGAGTAGT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAA----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATCGAAGGCGATGAAATTGATCCGCTCTCC Castilleja_lasiorhyncha_04 ????????????????????????????????????????????CGATTTCATCGATGGGTATGCAAGAAA----TTACCTGTTTAGTTCTAA---AGAAGAGTATAATAATAGTAA---------TAATACTTTTT---CTTGTGTCAATGTGTAAGAAT-------GTATGTTACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCCTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTACAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCCTA--TCACTTAATGAGTACGGTTAAATTAATCGAGAATGTGTA------------------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCCTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATT------TTTTTT----CTC----------------------AGGGAACTGGTAAGAAAAGGTTTGAACAGCAGATCAAAGAACTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCGTGTGGTCTTATCCAACTACGCGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTCTTTTT--------CTTTTACCCTATTTTTGGCTTTTTTCT-------------AAAC---------TATTT---------------------------------TTGGATCAGATACCTATATGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGACATTTGAATCATAATC-------TAATGCTTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCTTTCCGGCTGTTCCAACTAGCCGTTGGGCAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------GAAACAACTTATTCTTTCTGGACCGTTAGATCGTTTTTTTTT-----------AAACTATACGAGAACAACGGTTGTTATAACAATCGTTATTGAAA-------CTATAGGCAGTTTAAACGATTCTAA---CCAACTCTAACAAATT-GCTAATCATGATTCAACAGCCAGGAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATGTTTCATTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACAATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTGTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTTACACATTTACGAGCTTTT-ATATAATTTCGTTTGATTCAA---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGGTCGGCTTTCATA----TTGGTAT--------CTCGTAAAGCCAT-AACAACACTCTTAATAGCGCCCGTA--------CATAGAACCAACGACACGTATTCATCTTT--------------------------------TTTTTGGCCCACGCTCAA-TATATATGATCACTCTTTTACAGGGACCAGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_lasiorhyncha_05 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGCAAGAAA----TTACCTGTTTAGTTCTAA---AGAAGAGTATAATAATAGTAA---------TAATACTTTTT---CTTGTGTCAATGTGTAAGAAT-------GTATGTTACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATAACACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCCTA--TCACTTAATGAGTACGGTTAAATTAATCGAGAATGTGTA------------------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATACTT--CGTCTT-----GGCATTATGTTGATATTGATATT------TTTTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAACAGCAGATCAAAGAACTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTACGTTGATTCCAAGTAGATTTGAACCGTGTGGTCTTATCCAACTACACGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTT--------------CTTTTACCCTATTTTTGGCTTTTTTCT-------------AAAC---------TATTT---------------------------------TTGGATCAGATACCTATATGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CAATAA---TATCGACATTTGAATCATAATC-------TAATGCTTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCTTTCCGGCTGTTCCAACTAGCCGTTGGGCAGGGCAGCTTT-AAGTCCTAG----TCGTCCGATC-------GAAACAACTTATTCTTTCTGGACCGTTAGATCGTTTTTTTTTTTT--------AGACTATACGAGAACAACGGTTGTTATAACAATCGTTATTGAAA-------CTATAGGCAGTTTAAATGATTCTAA---CCAACTCTAACAAATT-GCTAATCATGATTCAACAGCCAGGAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATGTTTCATTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACAATTGACCCTACGGACGTGCAAAAGATAGTCAAAGCCGTTGGCAGAGCTGTTGCAGCTTACGGTACTGATGCCTTC----------AACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTTACACATTTACGAGCTTTT-ATATAATTTCGTTTGATTTAA---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGGTCGGCTTTCATA----TTGGTAT--------CTCGTAAAGTCAT-AACAACACTCTTAATAGCGCCCGTA--------CATAGAATCAACGACACGTATTCATCTTT--------------------------------TTTTTGGCCCACGCTCAA-TATATATGATCACTCTTTTACAGGGACCAGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_lasiorhyncha_06 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGCAAGAAA----TTACCTGTTTAGTTCTAA---AGAAGAGTATAATAATAGTAA---------TAATACTTTTT---CTTGTGTCAATGTGTAAGAAT-------GTATGTTACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCCTA--TCACTTAATGAGTACGGTTAAATTAATCGAGAATGTGTA------------------------CGTATTTTCAGGTTACCGATGCCAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAGGGCTCGGACATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATT------TTTTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAACAGCAGATCAAAGAACTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCGTGTGGTCTTATCCAACTACACGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTT--------------CTTTTACCCTATTTTTGGCTTTTTTCT-------------AAAC---------TATTT---------------------------------TTGGATCAGATACCTATATGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CAATAA---TATCGACATTTGAATCATAATC-------TAATGCTTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCTTTCCGGCTGTTCCAACTAGCCGTTGGGCAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------GAAACAACTTATTCTTTCTGGACCGTTAGATCGTTTTTTTGTTT---------AAACTATACGAGAACAACGGTTGTTATAACAATCGTTATTGAAA-------CTATAGGCAGTTTAAATGATTCTAA---CCAACTCTAACAAATT-GCTAATCATGATTCAACAGCCAGGAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATGTTTCATTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACAATTGACCCTACGGACGTGCAAAAGATAGTCAAAGCCGTTGGCAGAGCTGTTGCAGCTTACGGTACTGATGCCTTC----------AACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTTACACATTTACGAGCTTTT-ATATAATTTCGTTTGATTTAA---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGGTCGGCTTTCATA----TTGGTAT--------CTCGTAAAGTCAT-AACAACACTCTTAATAGCGCCCGTT--------CATAGAATCAACGACACGTATTCATCTTT--------------------------------TTTTTGGCCCACGCTCAG-TATATATGATCACCCTTTTACAGGGACCAGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCCGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_linariifolia_85 GACTTCTATCTCCTCAATCTACCTGATCAATACAAAAGTTCGTTCGATTTCATCGATGGGTATGAAAAAAA----TGACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAACAATAA------TAATACTTTTT---CTTGTGTCAATGTGTAT-----------------AACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTAGACAACGTCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAGGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--CCACTTAATGCGTACTGAATAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTTAG---TGCATTATGTTGATGTTGATATTTTT---CTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAAGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCGTTGGCACAT-AAGATAACTGCTGCTGCTGGTTTTATGCTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATTCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTCTATTT----------CTCT----CTATTTTTGCCTTTTCTTTTT-----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCAAAACTG----GTTGGATCAGATACCCATTTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGAGTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCTTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCTGGACTGTTAGATCGTTTGTTTAG----------AAAACTATACGGGATCAACGGTTGTTATAACAATCGTTATTGAAA-------CTATCAGCAGTTTTAACGGTTCTAA---CCAACTCTAACGAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGAAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACAGATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CACAG-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAACAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGCCGATGAAATTGGTCCGCTCTCC Castilleja_linariifolia_93 GACTTCTATCTCCTCAATCTACCTGATCAATACAAAAGTTCGTTCGATTTCATCGATGGGTATGAAAAAAA----TGACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAACAATAA------TAATACTTTTT---CTTGTGTCAATGTGTAT-----------------AACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACGAAGGAGTCGAATTAGACAACATCCTTCGTGAGACTTGTGTAACCGGTATCGTAAATGGCGTGGATACTCAGGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGCGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTTAG---TGCATTATGTTGATGCTGATATTTTT---CTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAAATTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCGTTGGCACAT-AAGATAACTGCTGCTGCTGATTTTATGCTGATTCCAAGTAGATTTGAGCCCTGTGGTCTTATTCAATTACATGCCATGCGATATGGAACGGTGAGGGCCTTTTTTTCTTTTT----------CTTT----CTATTTTTGCCTTTTCTTTTT-----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGTTACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGCGTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCTTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCTAG----TCGTCCGGTT-------GTAACAACTTATTCTTTCTGGACTGTTAGATCGTTTTTTTTTTTT--------AAACTATACGAGAACAACGGTTGTTATAACAATCGTTATTGAAA-------CTATCGGCAGTTATAACGATTATAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---GTATAT--GCATATTT----ATGTTTCTTTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTGTAGCAGCTTACGGTACTGATGCCTTG----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTT-ATATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATATATATTGGCAT--------CTCGTGAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_lineariloba_17 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATTGATGGGTATGAAAAAAAA---TTA-------------------GAAA-------------------------AAATATTTTT----TTTGTGTCAATGTGTATGAAT-------GTATGTTTCTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAAGAACTCATTTCAGGGGTTGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTTACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATTAATACATTGACTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGCAC----TTTCTTA--TTACTTAATGAGTACGAATTAATTAATCGAGAATGTGTACGTACGTACGTA------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGCTGAAGGAATCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAAAAAGGCTCGGATATTCTAGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CACTCTT--CGTCTT-----GGCATTATGTTGATATTGATATAT-----TTGTTTAATTCTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGCCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTT------------------CTTT----CTATTTTTGGCTTCTTTTTTTTT---------AA-C--TGTGCTTAA---------------------TTCAAAACTG----GTTGAATCAGATACCCATCTGTGCTTCGACCGGTGGCCTAGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TAATGATATTTGAATCATAATC-------TAATGTGTTGATAGGG---TCGAGCTAA---TAGTTACAAAGAGCTGCTCGACCTTTCCGGCTGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TATTCCGATC-------GTAACAACTTATTCTTTCTGGACTGTTAGATCGTTTTTTTATT---------AAAAC-ATACGAGAAT---GTTTGTTATAACAGTCGTTATTGAAAGTTGAAACTATCGACAGTTTTAACCATTCTAA---CCAACTCTAACCAATT-TCT----------------------------------------------------------------------------TTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGCAGCTTACGAAACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----CTCACATATTTACGAGCTTTT-GTATAACTTCGTTTGATTTAA---CTGAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-ATACA-CGGG----CTTGTATA----TTGGCAT--------GTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCCGGTATTGAAGGCGATGAAATTGGTCCGCTCTCA Castilleja_lineariloba_20 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATTGATGGGTATGAAAAAAAA---TTA-------------------GAAAA------------------------AAATATTTTT----TTTGTGTCAATGTGTATGAAT-------GTATGTCTCTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAAGAACTCATTTCAGGGGTTGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGCATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGACTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGCAC----TTTCTTA--TTACTTAATGAGTACGAATTAATTAATCGAGAATGTGTACGTACGTACGTA------------CGTATCTTCAGGTTACCGATGCTAAGCCTTTGCTGAAGGAATCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAAAAAGGCTCGGATATTCTAGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CACTCTT--CGTCTT-----GGCATTATGTTGATATTGATATAT-----TTGTTTAATTCTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGCCTTATCCGATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTT------------------CTTT----CTATTTTTGGCTTCTTTTTTTTTT--------AA-C--TGTGCTTGA---------------------TTCAAAACTG----GTTGAATCAGATACCCATCTGTGCTTCGACCGGTGGCCTAGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TAATGATATTTGAATCATAATC-------TAATGTGTTGATAGGG---TCGAGCTAA---TAGTTACAAAGAGCTGCTCGACCTTTCCGGCTGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TATTCCGATC-------GTAACAACTTATTCTTTCTGGACTGTTAGATCGTTTTTTTATT---------AAAAC-ATACGAGAAT---GTTTGTTATAACAGTCGTTATTGAAAGTTGAGACTATCGACAGTTTTAACCATTCTAA---CCAACTCTAACCAATT-TCT----------------------------------------------------------------------------TTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGCAGCTTACGGTACTGATGCATTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTGATTCAA---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-ATAAA-CGGG----CTTGCATA----TTGGCAT--------GTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAAGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_miniata_53 GACTTCTATCTCCTCAATCTCCCTAATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAG----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCGATGTGTATGAAT-------GCGTGTAACTGT--------TGTAGTTTCGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCCGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTTAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTGTTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--TGTCTTAG---TGCATTATGTTGATGTTGATATTTT----TTTTCT----TTT----------------------AGGGAACTGGTAAGAAGAAGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAGCCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTT-------------C-------CTATTTTTGCCTTTTTTTTTT-----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCAAAACCG----GTTGGATCAGATACCCATCTGTTCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CAATGA---TATCGATATTTGAATCATAATC-------TAATGAGTTATTCGGA---TTGAGTCAA---TAGCTACAAAGAGCTGCTCGACCATTCCGGCTGTTCCAACTAGCCGTTAGACAG-----CTTT-AAGTCTTAG----TCGTCCGATC-------GTAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTTTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGCAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCTTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGAAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_miniata_55 ???TTCTATCTCCTCAATCTCCCTAATCAATACAAAAGCTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACAGT--------TGTAGTTTCGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTTACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACAT{CT}GATTGCAAGTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCGGGTAAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTGTTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGAAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTTAG---TGCATTATGTTGATGTTGATATTTT----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAAGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCGATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTTTTTTTTTTTTTTT--------CC-TTTTTGCCTTTTTTTTTTTTTTT------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCAAAACCG----GTTGGATCAGATACCCATCTGTTCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CAATGA---TATCGATATTTGAATCATAATC-------TAATGCGTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCTTTTCGACTGTTCCAACTAGCCGTTGGACAAGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTTT------------AAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGCAAAAGCCGTTGGTAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCATAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_miniata_56 ?????CTATCTCCTCAATCTCCCTAATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAA-----CTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTTCGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTTAG---TGCATTATGTTGATGTTGATATTTT----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAAGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATCCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTTTTTTTT---------------CT-TTTTTGCCTTTTTTTTTTTTTTTT-----ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCTTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGAAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTT-ATATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTGAA-----------------------------------------------------------------------------------------------------------------CATAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAACAGTGCTGCTAAGCTTGGGTGCTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_miniata_58 ?????CTATCTCCTCAATCTCCCTAATCAATACAAAAGTTCATTCGATTTCATTGATGGGTATGAAAAAAA----TTACTTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAATAATAATAATAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTAGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCTAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTATGATCCT-CC-----------TACCTAC----TTTCTTA--TCACTTAATGAGTACGGATTAATTAATCAAGAACGTGTTCGTACGTCCACGTGTATGTACGTACGTATTTTCAGGTTACCGATGCTTAGCCTTTGTTGAAAGAAGCTCTTCAAGCATCCGTTGGGTTGCCTGTGGACAGGAAAGTACCTGTTATCGGGTTTATTGGTAGACTGGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATATTCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTCTGTTGATATTGATATTTT----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAAGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTTTTTTT----------------CTATTTTTGCCTTTTTTTTTTTTT--------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCAAAACCG----GTTGGATCAGATACCCATCTGTTCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CAATGA---TATCGATATTTGAATCATAATC-------TAATGAGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTCCGGCTGTTCCAACTAGCCGTTAGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTCGGTCTTTCTGGACCGTTAGATCGTTTTTTTT------------AAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGCAAAAGCCGTTGGTAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_miniata_61 ?????CTATCTCCTCAATCTCCCTAATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTTCGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTAATAAATACATTGATTGCAACTACGATATTACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTTAG---TGCATTATGTTGATGTTGATATTTT----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAAGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTTTTTTTT---------------CTTTTTTTGCCTTTTTTTTTTTTTTTT-----ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCTTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGATCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGAAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTT-ATATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTGAA-----------------------------------------------------------------------------------------------------------------CATAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAACAGTGCTGCTAAGCTTGGGTGCTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_nubigena_3_50 ?ACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAA----TTTACCTGTTTAGTTCTAA---GGATGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTAAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTTGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCGACTACGATATCACAACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACT-AATGAGTACAGATAAATTAATCGAGAATGTGTACGTACGTACGTA------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGACAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATAT-----TTGTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAAATCAAAGAGCTGGAGGTGTTGTATCCCGATAACGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCAGATTTTATGTTGATTCCAAGTAGATTTGAACCATGTGGTCTTATCCAATTACATGCCATGCGATACGGAACGGTGAGAGCCTTTTTTTTTTTTTTTTTTTT-----------CTATTTTTGCCCTATTTTTTTT----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTGCATGCTTGGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGCTTTAATGTTGAGGTA----CGATAC---TATCGATATTTGAATCATAATC-------TAATGCGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTTCGGCTGTTCCAACTAGCCGTTAGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---GTATAT--GCATATTT----ATGTTTCTTTATAGAATGCCTAAAAGTTGCTATATTATTGTTT-GCAGTGCGACACTATTGACCCTACAGACGTGCTAAAGATAGCAAAAGCCGTTAGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GATGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTCTT-CTATTATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTAAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGTGATGAAATTGGTCCGCTCTCT Castilleja_occidentalis_17 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGGAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTAAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCATTTAATGAGTACTGATTAATTAATCAAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTGGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTTAG---TGCATTATGTTGATGTTGATATTTTT---TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAAGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGCTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCCCTTTTTTTTTTTT------------------CTATTTTTGCCTTCTTTTTTT-----------ATAC--TGTGCTTGATTTCCTGTGATCTAATTAATTTTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGAGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTCCGGCTGTTCCAACTAGCCGTTAGACAG-----CCTT-AAGTCTTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTT-----------AAAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATC--------------TTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCTTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGAAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGGAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAGATTGGTCCGCTCTCT Castilleja_occidentalis_18 ??????TATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTAAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCAAGAA------------------------------CGTATCTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTGGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTTAG---TGCATTATGTTGATGTTGATATTTTT---TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAAGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTT-------------CTTT----CTATTTTTGCCTTTTTTATTTTTT--------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACAGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCGTAGTC-------TAATGCGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTCCGGCTGTTCCAACTAGCCGTTAGATAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTCTT------------AAAAC-ATACGAGAAC---GGTTGTAT-------------------------CTATCGACAGTTTTAACGATTCTAG---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---GTATGT--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGCAAAAGCCGTTGGTAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTT-ATATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATATATATTGCCATATTGGCATCTCGTGAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_occidentalis_26 ?ACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAATAA------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTAAGCCCTTACTAAGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATAGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCAAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTGGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTTAG---TGCATTATGTTGATGTTGATATTTT----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAAGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATGACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGACTTTTTTTTTTTTTTTTT--------------CTATTTTTGCCTTTTTTTTTT-----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTCGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGGGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTCCGGCTGTTCCAACTAGCCGTTAGACAG-----CTTT-AAGTCTTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCTTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGCTGGCAGAGCTCTTGAAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATACATATTGGCAT--------CTCGTGAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_occidentalis_33 ???TTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAATAA------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTAAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACATAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTGGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTTAG---TGCATTATGTTGATGTTGATATTTTT---TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAAGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTAGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTTTTTTTTTTTTTTT--------CTATTTTTGCCTTTTTTTTT------------ATAC--TGTGCTTGATTTCTTGTGATCTAATT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTTATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATCTATAATCTAATGAGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTCCGGCTGTTCCAACTAGCCGTTAGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGCTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGCAAAAGCCGTTGGTAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTT-ATATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATATATATTGGCAT--------CTCGTGAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_ophiocephala_01 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CTTGTGTCAAGGTGTAAGAAT-------GTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTTGAATCGGATAGGGTTCTGACAGTGAGCCCTTACTATGCTCAGGAACTCGTTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACAATATCACCACCGTAAGATCCT-CC-----------TACGTACCTTCTTTCTTA--TCACT-AACGAGTACGGATAAATTAACCGAGAAAGTGTATGTACGTACGTA------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAAAGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGTTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGCCTT-----GGCATTATGTTGATATTGATATTTTTT--TATTCT----TTC----------------------AGGGAACGGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTGGAGGCGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGACTTTATGTTGATTCCAAGTAGATTTGAACCATGTGGTCTTATACAATTACATGCCATGCGATACGGAACGGTAAGAGCATTTTGTTT---------------CTTT----CTATTTTTGCCTT-CTTT--------------AAAC--TGTGATTGATTT----TGATCTAATT----TTCGAAACTG----GTTTGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGGAGTTTCAATGTTGAGGTA----CGATAA---TATCGACATTTGAATCATAATC-------TAATGCGTTATTAGGA---TTGAGTCAA---TAGTTACAGAGAGTAGCTCGACCTTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCCAG----TCGTCCGATC-------GTAACAACTTATTCTTTCTGGACCGTTAGATCTTTTTTTTTTTT-------GAAAATTATATGAGAACAACGGTTGTTATAACTATCGTTATTGAAA-------CTATCGACAGTTATGACGATTCTAA---CCAACTCTAACAAATT-GCTAA--------------------------------------AAGTC---ATATAT--GCAGATTT----ATATTTCTTTCGAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTGTTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTAGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTTTT-GTATTATTTCGTTTGATTTAA---CTTGGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-TGGG----CTTTTATA----TTGGCAT--------CTCGTAGAGTCATAAAGAACACTCTTAAAAGCGCCCGTATGGCCGTACATAGAACCAACGATGCGTATTCATCTCTTCTATAGTGTCGATATCTATCCAAAGTAAAAGCTATTGGTCCACGCTCAA-TGT----GATCACTTTTTTACAGGGACCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGTAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_ophiocephala_10 ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TCTTGTGTCAATGTGTAAGAAT-------GTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACAGTGAGCCCTTACTATGCTCAGGAACTCGTTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACAATATCACCACCGTAAGATCCT-CC-----------TACGTACCTACTTTCTTA--TCACT-AACGAGTACGGATAAATTAACCGAGAAAGTGTATGTACGTACGTA------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAAAGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTACTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGCCTT-----GGCATTATGTTGATATTGATATTTTTT--TATTCT----TTC----------------------AGGGAACGGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCATGTGGTCTTATACAATTACATGCCATGCGATACGGAACGGTAAGAGCATTTTGTTT---------------CTTT----CTATTTTTGCCTTTTTT---------------AAAC--TGTGATTGATTT----TGATCTAATT----TTCGAAACTG----GTTTGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGGAGTTTTAATGTTGAGGTA----CGATAA---TATCGACATTTGAATCATAATC-------TAGTGCGTTATTAGGA---TTGAGTCAA---TAGTTACAGAGAGTAGCTCGACCTTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCCAG----TCGTCCGATC-------GTAACAACTTATTCTTTCTGGACCGTTAGATCTTTTTTTTTTT--------GAAAATTATATGAGAACAACGGTTGTTATAACTATCGTTATTGAAA-------CTATCGACAGTTATGACGATTCTAA---CCAACTCTAACAAATT-GCTAA--------------------------------------AAGTC---ATATAT--GCAGATTT----ATATTTCTTTCGAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTAGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTTTT-GTATTATTTCGTTTGATTTAA---CTTGGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-TGGG----CTTTTATA----TTGGCAT--------CTCGTAAAGTCATAAAGAACACTCTTAAAAGCGCCCGTATGGCCGTACATAGAACCAACGATGCGTATTCATCTCTTCTATAGTGTCGATATCTATCCAAAGTAAAAGCTATTGGTCCACGCTCAA-TGT----GATCACTTTTTTACAGGGACCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGTAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_parviflora_82 ?????CTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCGTTCGATTTCATCGATGGGTATGATTTTTTT---TTACCTGTTTAGTTCTAA---AGAGGAGTATAATAATAT------------TAATACTTTTT---CTTGTGTCAATGTGTATGAACTATGAATGTATGTAACTGT--------TGTAGTTATGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACAGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATCTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCTTGTGGACAGGAAAATACCTGTTATCGGGTTTATTGGTAGACTTGAAGAACACAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTTAG---TGCATTATGTTGATGTTGATATT------TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAACAGAAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCGTTGGCGCAT-ATGATAACTGCTGCTACTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTTT------------C-------CTATCCTTGCCTTTTTTTTTTT----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGAGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTCCGGCTGTTACAACTAGCCGTTAGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAAATCGTTTTTTT------------AAAAC-ATACGGGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCATAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCTTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGAAGCTTACGGTACTGATGCCTTG----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CAGG----CTTTTATA----TTGGCAT--------CTCGTGAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_parviflora_90 ?????CTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCGTTCGATTTCATCGATGGGTATGATTTTTTT---TTACCCGTTTAGTTCTAA---AGAGGAGTATAATAATAT------------TAATACTTTTT---CTTGTGTCAATGTGTATGAACTATGAATGTACGTAACTGT--------TGTAGTTATGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATCTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATTGGTAGACTTGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTTAG---TGCATTATGTTGATGTTGATATT------TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAAGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATCCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGAATTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGAAAGCCTTTTTTTTTTTT-----------C-------CTATTTTTGCCTTTTTTTTTT-----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGAGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTCCGGCTGTTCCAACTAGCCGTTAGACAG-----CTTC-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAAATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGACTCAACAGCCCATAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCTTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGAAGCTTACGGTACTGATGCCTTG----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CAGG----CTTTTATA----TTGGCAT--------CTCGTGAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_peirsonii_10 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAATAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAGGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCTACTACG--------TACGTAC----TTTCTTA--TTACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAAAGTACCTGTTATCGGGTTTATTGGTAGACTTGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAGGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTCTGTTGATATCGATATTTTTT--TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGAAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCGTTGGCACAT-ATGATAACTGCTGCTGCTGATTTTATGCTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATTCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTTTTTTT--------CTTT----CTATTTTTGCCTTTGTCTTTTT----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTG----GTTGGATCAGATACCCATCTGTTCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGAGTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCTTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTCCTGGACCGTTAGATCGTTTTTTTTTT----------AAACTATACGAGAACAACGGTTGTTATAACAATCGTTATTGAAA-------CTATCGGCAGCTTTAACGATTCTAA---CCAACTCTAACAAACT-GCTAACCATGATTCAACAGCCCGTACGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGTTATTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTGTAGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAGATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCCTTTATAGGGACCGGCAAAGGAATGGGAAACAGTGCTGCTAAGCTTGGGTGTTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_peirsonii_2 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAATAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAATAATAA---TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTATGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAAGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATGAATACATTGATCGCAACTACGATATCACCACCGTAAGATCCTACCACG--------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAAAGTACCTGTTATCGGGTTTATTGGTAGACTTGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTCCGTTGATATTGATATTTTTT--TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGAAGATCAAAGAGCTGGAGGTGTGGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCGTTGGCACAT-ATGATAACTGCTGCTGCTGATTTTATGCTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATTCAATTACATGGCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTTT------------CTTT----CTATTTTTGCCTTTGTCTTTTA----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTG----GCTGGATCAGATACCCATCTGTTCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGAGTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCTTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCTGGACCGTTAGATCGTTTTTTTTTTTT--------AAACTATACGAGAACAACGGTTGTTATAACAATCGTTATTGAAA-------CTATCGGCAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCCGTAGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA----TTTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATTAATCTTTTATAGGGACCGGCAAAGGAATGGGAAACAGTGCTGCTAAGCTTGGGTGCTTCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCTCTCTCC Castilleja_peruviana_4_30 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCGTTCGATCTCATTGATGGGTATGAAAAAATT---TTACCTATTTAGTTCTAA---AGAAGAGTATAATAATAATAATAA------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGAGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAGGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATAGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TCAACTTGT----CATTCTT--CGTCTT-----GGTGTTATGTTGATATTGATTTTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGGACGGTGAGAGCCTTTTTTTT---------------CTTT----CTATTTTTGCCTTTTTTT--------------ATAAAATGTGCTTGATTT----TGATCTAACT----CTCGAAACTG----GTTGGATCAGATACCCATCTGTACTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGAAATTTGAATCATAATC-------TTATGCATTATTAGGA---TTGAGTTAA---TAGTTAAAAAGAGCTGCTCAACTTTTCCGGCTGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCCGGACTGTTAGATCGATTTTTTT------------AAAC-ATACGAGAAC---GGTTGTTATAACAATCGTTATTGAAA-------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAA---------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCCACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAGGCCGTTGGCAGAGCTCTTGCAGCTTATGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGAATCACTCTTGGAAGGTGC-TCA-----TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTCAATTAT---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-TGGG----CTTT-ATA----TTGGCAT--------CTCCTAAAGTCATAAACAACACTCTTAAAAGCGCCCATA--------CATAGAACCAACGACGCGTATTCATCTCTTCTACAGT--CGATATATACCCAAAGTAAAAGTTGTTGGCCCACGCTCAA-TAT----GAACACTTTTTTACAGGGACCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_peruviana_4_62_2 ????????????CTCAATCTCCCTGATCAATACAAAAGTTCGTTCGATTTCATTGATGGGTATGAAAAAAT----TTACCTATTTAGTTCTAA---AGAAGAGTATAATAATAATAATAA------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAACTGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAGGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATAGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TCAACTTGT----CATTCTT--CGTCTT-----GGTGTTATGTTGATATTGATTTTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCACGCGATATGGGACGGTGAGAGCCTTTTTTTT---------------CTTT----CTATTTTTGCCTTTTTTT--------------ATAAAATGTGCTTGATTT----TGATCTAATT----CTCGAAACTG----GTTGGATCAGATACCCATCTGTACTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGAAATTTGAATCATAATC-------TTATGCATTATTAGGA---TTGAGTTAA---TAGTTAAAAAGAGCTGCTCAACATTTCCGGCTGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCCGGACTGTTAGATCGATTTTTTT------------AAAC-ATACGAGAAC---GGTTGTTATAACAATCGTTATTGAAA-------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAA---------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCCACACTATTGACCTTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGCAGCTTATGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGAATCACTCTTGGAAGGTGC-TCA-----TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTCAATTAT---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-TGGG----CTTT-ATA----TTGGCAT--------CTCCTAAAGTCATAAACAACACTCTTAAAAGCGCCCATA--------CGTAGTACCAACGACGCGTATTCATCTCTTCTACAGT--CGATATATACCCAAAGTAAAAGTTGTTGGCCCACGCTCAA-TAT----GAACACTTTTTTACAGGGACCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGTTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_peruviana_4_70_2 ?????????CTCCTCAATCTCCCTGATCAATACAAAAGTTCGTTCGATTTCATTGATGGGTATGAAAAAAT----TTACCTATTTAGTACTAA---AGAAGAGTATAATACTAATAATAA------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAACTGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAGGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATAGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TCAACTTGT----CATTCTT--CGTCTT-----GGTGTTATGTTGATATTGATTTTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGGACGGTGAGAGCCTTTTTTTT---------------CTTT----CTATTTTTGCCTTTTTTT--------------ATAAAATGTGCTTGATTT----TGATCTAATT----CTCGAAACTG----GTTGGATCAGATACCCATCTGTACTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGAAATTTGAATCATAATC-------TTATGCATTATTAGGA---TTAAGTTAA---TAGTTAAAAAGAGCTGCTCAACTTTTCCGGCTGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTACTCTTTCCGGACTGTTAGATCGATTTTTTT------------AAAC-ATACGAGAAC---GGTTGTTATAACAATCGTTATTGAAG-------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAA---------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCCACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGCAGCTTATGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGAATCACTCTTGGAAGGTGC-TCA-----TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTCAGTTAT---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-TGGG----CTTT-ATA----TTGGCAT--------CTCCTAAAGTCATAAACAACACTCTTAAAAGCGCCCATA--------CATAGAACCAACGACGCGTATTCATCTCTTCTACAGT--CGATATATACCCAAAGTAAAAGTTGTTGGCCCACGCTCAA-TAT----GAACACTTTTTTACAGGGACCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_peruviana_4_83 ???TTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCGTTCGATTTCATTGATGGGTATGAAAAAATT---TTACCTATTTAGTTCTAA---AGAAGAGTATAATAATAATAATAA------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CG-----------TACGTAC----TTTCTTA--TCACTTAATGAATACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAGGCTCTTCAAGCAT????????????????????????????????????????????????????????????????????????????????????????????????CTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATAT-----TTGTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAAATCAAAGAGCTGGAGGTGTTGTATCCCGATAACGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCAGATTTTATGTTGATTCCAAGTAGATTTGAACCATGTGGTCTTATCCAATTACATGCCATGCGATATGGGACGGTGAGAGCCTTTTTTTT---------------CTTT----CTATTTTTGCCTTTCTTT--------------ATAAAATGTGCTTGATTT----TGATCTAATT----CTCGAAACTG----GATGGATCAGATACCCATCTGTACTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTCTAATGTTGAGGTA----CGATAA---TATCGAAATTTGAATCATAATC-------TTATGCATTATTAGGA---TTGAGTTAA---TAGTTAAAAAGAGCTGCTCAACTTTTCCGGCTGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCCGGACTGTTAGATCGATTTTTTT------------AAAC-ATACGAGAAC---GGTTGTTATAACAATCGTTATTGAAA-------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAA---------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCCACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGAATCACTCTTGGAAGGTGC-TCA-----TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTCAATTAT---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-TGGG----CTTT-ATA----TTGGCAT--------CTCCTAAAGTCATAAACAACACTCTTAAAAGCGCCCATA--------CATAGAACCAACGACGCGTATTCATCTCTTCTACAGT--CGATATATACCCAAAGTAAAAGTTGTTGGCCCACGCTCAA-CAT----GAACACTTTTTTACAGGGACCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_pilosa_33 GACTTCTATCTCCTCAATCTACCTGATCAATACAAAAGTTCATTTGATTTCATCGATGGGTATGAATTTTT----TTACCTGTTTAGTTCTAA---AGAAGAGTATAATAATAA------------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTTTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCAAGAACGTGTACTTACGTA----------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACGGGAAATTACCTGTTATCGGGTTTATTGGTAGACTTGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGTCTGTCATTCTT--CGTCTT-----GGCATCCTGTTGATATTGATATTTTTT--TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGAAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGCTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATTCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTTTTTT-----------------CTATTTTTGCCTTTTCTTTTT-----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTC------------AGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGACATTTGGATCATAATC-------TAATGCGTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCAGCTCGACCTTTCCGACTGTTCCAACAAGCCGTTGGACAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCTGGACCGTTAGATCGTTTTTTTTTTTTTTTT-GAAAAACTATACGAGAACAACGGTTGTTATAACAATCGTTATTGAAA-------CTATCGGCAGTTTTAACGATTCTAAGTACCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGGAAGCTTCATCCATAACATGCGATC---ATATAT--GCAGATTT----ATATTTCTGTATAGAATGCCTAAAAGTTGCTATACTGTTCTTTTGCAGTGTGACACTATTGACCCTTTGGACGTGCTAAAGATAGTGAAAGCCGTTGGGAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAT-TCA-----TTCACGCATTTACGAGCTT--------ATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GTTAAAAAATGGG----CTTTTCTA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCCGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_pilosa_36 GACTTCTATCTCCTCAATCTACCTGATCAATACAAAAGTTCATTTGATTTCATCGATGGGTATGAATTTTTT---TTACCTGTTTAGTTCTAA---AGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTTTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCAAGAACGTGTACTTACGTA----------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACGGGAAATTACCTGTTATCGGGTTTATTGGTAGACTTGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGTCTGTCATTCTT--CGTCTT-----GGCATTCTGTTGATATTGATATTTTTT--TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGAAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGCTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATTCAATTACATGCCTTGCGATATGGAACGGTGAGAGCCTTTTTTTTTTTTTT-----------------CTATTTTTGCCTTTTCTTTTT-----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTC------------AGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGACATTTGAATCATAATC-------TAATGCGTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCAGCTCGACCTTTCCGACTGTTCCAACAAGCCGTTGGACAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCTGGACCGTTAGATCGTTTTTTTTTTTTTTTTTGAAAAACTATACGAGAACAACGGTTGTTATAACAATCGTTATTGAAA-------CTATCGGCAGTTTTAACGATTCTAAGTACCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGGAAGCTTCATCCATAACATGCGATC---ATATAT--GCAGATTT----ATATTTCTGTATAGAATGCCTAAAAGTTGCTGTATTGTTCTTTTGCAGTGTGACACTATTGACCCTTTGGACGTGCTAAAGATAGTGAAAGCCGTTGGGAGAGCTCTTGCAGCTTACGGTACTGATGCCTCC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAT-TCA-----TTCACGCATTTACGAGCTT--------ATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GTTAAAAAATGGG----CTTTTCTA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_pilosa_41 GACTTCTATCTCCTCAATCTACCTGATCAATACAAAAGTTCATTTGATTTCATCGATGGGTATGAATTTTTT---TTACCTGTTTAGTTCTAA---AGAGGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTTTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCGCTTAATGAGTACTGATTAATTAATCAAGAACGTGTACTTACGTA----------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACGGGAAATTACCTGTTATCGGGTTTATTGGTAGACTTGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGTCTGTCATTCTT--CGTCTT-----GGCATTCTGTTGATATTGATATTTT----TTTTCC----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGAAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGCTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATTCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTTTTTTTT---------------CTACTTTTGCCTTTTCTTTTT-----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTC------------AGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGACATTTGAATCATAATC-------TAATGCGTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCAGCTCGACCTTTCCGACTGTTCCAACAAGCCGTTGGACAGGACGGCTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCTGGACCGTTAGATCGTTTTTTTTTTTTTTTTTGAAAAACTATACGAGAACGACGGTTGTTATAACAATCGTTATTGAAA-------CTATCGGCAGTTTTAACGATTCTAAGTACCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGGAAGCTTCATCCATAACATGCGATC---ATATAT--GCAGATTT----ATATTTCCGTATAGAATGCCTAAAAGTTGCTGTATTGTTCTTTTGCAGTGTGACACTATTGACCCTTTGGACGTGCTAAAGATAGTGAAAGCCGTTGGGAGAGCTCTTGCAGTTTACGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAT-TCA-----TTCACACATTTACGAGCTT--------ATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GTTAAAAAATGGG----CTTTTCTA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGAGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCCCTCTCT Castilleja_pilosa_44 ?????CTATCTCCTCAATCTACCTGATCAATACAAAAGTTCATTTGATTTCATCGATGGGTATGAATTTTTT---TTACCTGTTTAGTTCTAA---AGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTTTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCAAGAACGTGTACTTACGTA----------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACGGGAAATTACCTGTTATCGGGTTTATTGGTAGACTTGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGTCTGTCATTCTT--CGTCTC-----GGCATTCTGTTGATATTGATATTTTT---TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGAAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGCTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATTCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTTTTTTT-----------------CTATTTTTGCCTTTTCTTTTT-----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTC------------AGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAACGTTGAGGTA----CGATAA---TATCGACATTTGAATCATAATC-------TAATGCGTTATTAGGA---TTGAGTCAA---TAGTTACAAAGAGCAGCTCGACCTTTCCGGCTGTTCCAACAAGCCGTTGGACAGAACAGCTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCTGGACCGTTAGATCGTTTTTTTTTTTTTTTT-GAAAAACTATACGAGAACAACGGTTGTTATAACAATCGTTATTGAAA-------CTATCGGCAGTTTTAACGATTCTAAGTACCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGGAAGCTTCATCCATAACATGCGATC---ATATAT--GCAGATTT----ATATTTCTGTATAGAATGCCTAAAAGTTGCTGTATTGTTCCTTTGCAGTGTGACACTATTGACCCTTTGGACGTGCTAAAGATAGTGAAAGCCGTTGGGAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAT-TCA-----TTCACACATTTACGAGCTT--------ATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GTTAAAAAATGGG----CTTTTCTA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAGGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_pumila_2_75 GACTTCTATCTCCTCAATCTCCCTGATAAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTACTTCTAA---GGAAGAGTATAATAATAA------------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACAGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGATAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATAATGTTGATATTGATATTTT----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTACCCTTGGCGCAT-ATGATAACTGCTGCTGCAGATTTTATGTTGATTCCAAGTAGATTTGAACCATGTGGTCTTATCCAATTACATGCCATGCGATACGGAACGGTGAGAGCCCTTTTTTTTTTTTTTTTT-------------CTATTTTTGCCTTCTTTTTTTT----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTGCATGGTTGGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGCTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGCGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTCCGGCTGTTCCAACTAGCCGTTAGACAG-----CTTT-GAGTCCTAG----TCGTCCAATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---GTATAT--GCATATTT----GTGTTTCCTTATAGAATGCCTAAAAGTTGCTATATTATTGTTT-GCAGTGCGACACTATTGACCCTACGGACGTGCTAAAGATAGCCAAAGCCGTTAGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTTTT-CTATTATTTCGTTTGATT------CTCAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTAGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGCTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCT Castilleja_pumila_94 ??CTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAA----TTTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTAAGCCCTTACTATGCTCAGGAATTCATTTCAGGTGTTGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCT-A--TCACT-AATGAGTACAGATAAATTAATCGAGAATGTGTACGTACGTACGTA------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTCCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATAATGTTGATATTGATATTTT----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTACCCTTGGCGCAT-ATGATAACTGCTGCTGCAGATTTTATGTTGATTCCAAGTAGATTTGAACCATGTGGTCTTATCCAATTACATGCCATGCGATACGGAACGGCGAGCGCCCTTTTTTTTTTTTTTTTT-------------CTATTTTTGCCTTATTTTTTTT----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTGCATGCTTGGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGCTTTAATGTTGAGGTA----CAATAC---TATCGATATTTGAATCATAATC-------TAATGCGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTTCGGCTGTTCCAACTAGCCGTTAGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---GTATAT--GCATATTT----ATGTTTCTTTATAGAATGCCTAAAAGTTGCTATATTATTGTTT-GCAGTGCGACACTATTGACCCTACAGACGTGCTAAAGATAGCAAAAGCCGTTAGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GATGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTCTT-CTATTATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTAAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGTGATGAAATTGGTCCGCTCTCT Castilleja_rubicundula_03 ??????????????????????????????????????????????????????GACGGGTATGCGAGAAA----TTACTTGTTTAGTTCTAA---GGAAGAGTATAATAATAA------------TAATATTTTTTT--CATGTGTCAATGAGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCGGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTCGAAAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACATAA----TTTCTTA--TCACT-AATGAGTACGGATAAATTAACCGATAATGTG-----------------------------ATTTTCAGGTTACGGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCCGTGGACAGGAAGGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGATCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGGATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATAT-----TTTTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCACCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACAGTGAGAGCTTTTTTTTTT--------------CCTT----CTATTTTTGGCTTTTTTTTTTTT------AT-AAAC--TGTGCTTGAT--------------------TTC----CTG-------TGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCAGTATTTGAATCATAATC-------TAATGTCTTATTAGGA---TTGAGCTAATAGTAGTTACAAAGAGCTGCTTGACCTTTCCGGCTGTTCCAACTAGCCGTTGTACAG-----CTTT-AAGTCCTAG----TCGACCAATC-------GTAAGAACTTATTCTTTCTGGACCGTTAGATCATTTTTTTT-----------AAAAC-ATACGAGAAC---AGTTGTTATAACAGTCATTATTGAAA-------CTATAGACAGTTTTAACGATGCTAA---CCAACTCTAACAAA---------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCGACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAAACCATTGGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATTCAAAACTGCATGTCGCAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTT-GTATAACTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAG-CGGG----CTTTCATA----TTGGGA---------CTCGTAAAGTTAT-GACAACACTCTTAAAAGTGCCCGTA--------TAAAT----------GCGTATTCATCTCTTTTATGGTGTCGATAT-----------------------------CTCAA-TAT----GATCATTTTTTTACAGGGACCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTATTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_rubicundula_05 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGACGGGTATGCAAGAAA----TTACTTGTTTAGTTCTAA---AGAAGAGTATAATAATAA------------TAATATTTTTTTT-CATGTGTCAATGAGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCGGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTCGAAAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACATAA----TTTCTTA--TCACT-AATGAGTACGGATAAATTAACCGATAATGTG-----------------------------ATGTTCAGGTTACGGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAAGGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGATCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATAT-----TTTTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACAGTGAGAGCTTTTTTTTT---------------CCTT----CTATTTTTGGCTTTTTTTTTTTT------AT-AAAC--TGTGCTTGAT--------------------TTC----CTG-------TGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCAGTATTTGAATCATAATC-------TAATGTCTTATTAGGA---TTGAGCTAATAGTAGTTACAAAGAGCTGCTTGACCTTTCCGGCTGTTCCAACTAGCCGTTGTACAG-----CTTT-AAGTCCTAG----TCGACCAATC-------GTAAGAACTTATTCTTTCTGGACCGTTAGATCATTTTTTTT-----------AAAAC-ATACGAGAAC---AGTTGTTATAACAGTCATTATTGAAA-------CTATAGACAGTTTTAACGATGCTAA---CCAACTCTAACAAA---------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCGACAATATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGCTGGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATTCAAAACTGCATGTCGCAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTT-GTATAACTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAG-CGGG----CTTTCATA----TTGGGA---------CTCGTAAAGTTAT-GACAACACTCTTAAAAGTGCCCGTA--------TAAAT----------GCGTATTCATCTCTTTTATGGTGTCGATAT-----------------------------CTCAA-TAT----GATCATTTTTTTACAGGGATCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_tenuiflora_75 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACAGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACT-AATGAGAACAGATAAATTAATCGAGAATGTGCACGTACGAA----------------CGTACTTTCAGGTTACCGATGCTAGGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTCT-TTGATATTGATATTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGACCAAAGAGCTGGAGGTGTTGTATCCAGATAAAGCCTGAGGAGTGGCAAAATTCAACGTGCCCTTGGCACGT-ATGATAACTGCTGCTGCTGATTTTATGCTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATTCAGTTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTT---------------GTTCTT--CTATTTTAGCTTCTTTTTTTTTTTT-------AAAT--TGTGCTT-----------------TT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGACATTTGAATCATAATC-------TAATGTGTTATTAGGA---TTGAGTCAA---TAGTTACGAAGAGCAGCTCGACCTTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATGCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCTTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTTCTAGAGATAGCAAAAGCCGTTGGTAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAACAGTGCTGCTAAGCTTGGGTGTTGCAGGAAGTGAACCTGGTATTGAAGCCGATGAAATTGGTCCGCTCTCC Castilleja_tenuiflora_78 ?ACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAA------------TAATACCTTTT---TTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACAGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCTCCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACT-AATGAGAACAGATAAATTAATCGAGAATGTGCACGTACGAA----------------CGTACTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTCT-TTGATATTGATATTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCAGATAAAGCCAGAGGAGTGGCAGAATTCAACGTGCCCTTGGCACAT-ATGATAACTGCTGCTGCTGATTTTATGCTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATTCAGTTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTT--------------GTTCTT--CTATTTTAGCTTCTTTTTTTTTTT--------AAAT--TGTGCTT-----------------TT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGACATTTGAATCATAATC-------TAATGTGTTATTAGGA---TTGAGTCAA---TAGTTACGAAGAGCAGCTCGACCTTTCCGACAGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGCTTTTTT------------AAAAC-ATACGAGAAT---GGTTGTAG-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGTGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTTCTAAAGATAGCAAAAGCCGTTGGTAGAGCCCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAACAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGCCGATGAAATTGGGCCGCTCTCC Castilleja_tenuiflora_79 GACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACAGTGAGCCTTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTATCTCACT-AATGAGAACAGATAAATTAATCGAGAATGTGCACGTACGAA----------------CGTACTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACCTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGCCTT-----GGCATTCT-TTGATATTGATATTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCAGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCACAT-ATGATAACTGCTGCTGCTGATTTTATGCTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATTCAGTTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTT--------------GTTCTT--CTATTTTAGCTTCTTTTTTTTTTTTT------AAAT--TGTGCTT-----------------TT----TTCAAAACTG----GTTGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGACATTTGAATCATAATC-------TAATGTGTTATTAGGA---TTGAGTCAA---TAGTTACGAAGAGCAGCTCGACCTTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCAATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTTCTAAAGATAGCAAAAGCCGTTGGTAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTCACGAGCTCTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAACAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGCCGATGAAATTGGTCCGCTCTCC Castilleja_tenuiflora_81 GACTTCTGTCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAAA----TTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TAATACCTTTT---TTTGTGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACAGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACT-AATGAGAACAGATAAATTAATCGAGAATGTGCACGTACGAA----------------CGTACTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTCT-TTGATATTGATATTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTGGAGGTGTTGTATCCAGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCACAT-ATGATAACTGCTGCTGCTGATTTTATGCTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATTCAGTTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTT--------------GTTCTT--CTATTTTAGCTTCTTTTTTTTTTT--------AAAT--TGTGCTT-----------------TT----TTCAAAACTG----GTCGGATCAGATACCCATCTGTGCTTCGACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGACATTTGAATCATAATC-------TAATGTGTTATTAGGA---TTGAGTCAA---TAGTTACGAAGAGCAGCTCGACCTTTCCGACTGTTCCAACTAGCCGTTGGACAGGACAGCCTT-AAGCCCTAG----TCGTCCGATC-------ATAACAACATGGTCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAC---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAACT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTCTATAGAATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTTCTAAAGATAGCAAAAGCCGTTGGTAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----TTCACACATTTACGAGCTTTG-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CACAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAACAGTGCTGCTAAGCTTGAGTGTTGCTGGAAGTGAACCTGGTATTGAAGCCGATGAAATTGGTCCGCTCTCC Castilleja_tenuis_25 ?????CTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGCAAGAAA----CTAAATGTTTAGTTCTAA---AGAAGAGTATAATAATAA------------TAATATTTTTTT--CATGTGTCAATGAGTATGAAT-------TTATGTAACTGTGTAACTGTTGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCC-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTAAAGGAAGCTCTTCAAGCATCGGTTGGGTTACCTGTGGACAGGAACATACCTGTTATTGGGTTTATAGGTAGACTCGAAGAACAAAAAGGCTCGGATATTCTGGTCGCAGCTATTTCTAAATTTATTGGAATGAATGTTCAGATAATCATTCTTGTAAGTTCTACACA----TCAACTTGT----CATTGTT--TGTCTT-----GGCATTATGTTGATATTGATATA------TTTTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGCGAGCCTTTTT------------------CTCT----CTATTTTTGGCTTCTTCTTTTTTTTTTTTT--TAAC--TGTGCTTGA---------------------TTCAAAACTG----GTTGAATCAGATACCCATCTGTGCTTCGACCGGTGGCCTAGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGATA----CGATAA---TATCTGTATTTGAATCATAATC-------TAATGTGTTGATAGGG---TCGAGCTAA---TAGTTACAAAGAGCTGCTCGACCTTTC-GGCTGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TATTCCGATC-------GTAACAACTTATTCTTTCTAGACTGTTAGATCGTTTTTTATT----------AAAAC-ATACGAGAAC---GTTTGTTATAACAGTCGTTATTGAAA-------CTATGGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAA-----------------------------------------------------------------------TGCCTAAAGATTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGCAGCTTACGAAACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-ACA-----CTCACATATTTACGAGCTTTT-GTATAACTTCGTTTGATTCAA---CTGAGAT-AT--GAAATACTACCTCCGTTTCAAAAAGATTGTCCACTTTGCTATGTAAATTTACATAGTATTATAGCAAAGTGGACAATCTTTTTGAAACGGGGGGAGTAGT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAA----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAGCCTGGTATCGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_tenuis_26 ?????CTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGCAAGAAA----CTAAATGTTTAGTTCTAA---AGAAGAGTATAATAATAA------------TAATATTTTTTT--CATGTGTCAATGAGTATGAAT-------TTATGTAACTGTGTAACTGTTGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCGAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCC-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTAAAGGAAGCTCTTCAAGCATCGGTTGGGTTACCTGTGGACAGGAACATACCTGTTATTGGGTTTATAGGTAGACTCGAAGAACAAAAAGGCTCGGATATTCTGGTCGCAGCTATTTCTAAATTTATTGGAATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTGTT--TGTCTT-----GGCATTATGTTGATATTGATATA------TTTTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATCCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACGGTGCGAGCCTTTTT------------------CTTT----CTATTTTTGGCTTCTTCTTTTTTTTTTTTTT-TAAC--TGTGCTTGA---------------------TTCAAAACCG----GTTGAATCAGATACCCATCTGTGCTTCGACCGGTGGCCTAGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCTGTATTTGAATCATAATC-------TAATGTGTTGATAGGA---TCGAGCTAA---TAGTTACAAAGAGCTGCTCGACCTTTC-GGCTGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TATTCCGATC-------GTAACAACTTATTCTTTCTGGACTGTTAGATCGTTTTTTATT----------AAAAC-ATACGAGAAC---GTTTGTTATAACAGTCGTTATTGAAA-------CTATGGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAA-----------------------------------------------------------------------TGCCTAAAGATTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGCAGCTTACGAAACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TCA-----CTCACATATTTACGAGCTTTT-GTATAACTTCGTTTGATTTAA---CTGAGAT-AT--GAAATACTACCTCCGTTTCAAAAAGATTGTCCACTTTGCTATGTAAATTTACATAGTATTATAGCAAAGTGGACAATCTTTTTGAAACGGAGGGAGTAGT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAA----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAGCCTGGTATCGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_vadosa_3_54 ??CTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCGTTCGATTTCATTGATGGGTATGAAAAAAAT---TTACCTATTTAGTTCTAA---AGAAGAGTATAATAATAATAATAA------TAATACTTCTT---CTTGTGTCAATGTGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAGCTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAGGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATAGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TCAACTTGT----CATTCTT--CGTCTT-----GGTGTTATGTTGATATTGATTTTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCTATTACATGCCATGCGATATGGGACGGTGAGAGCCTTTTTTTTT--------------CTTT----CTATTTTTGCCTTTTTTT--------------ATAAAATGTGCTTGATTT----TGATCTAATT----CTCGAAACTG----GTTGGATCAGATACCCATCTGTACTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TTATGCATTATTAGGA---TTGAGTTAA---TAGTTACAAAGAGCTGCTCAACTTTTCCGGCTGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCCGGACTGTTAGATCATTTTTTTT------------AAAC-ATACGAGAAC---GGTTGTTATAACAATCGTTATTGAAA-------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAA---------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCCACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCGGTTGGAAGAGCTCTTGAAGCTTACGGTACTGATGCCTTC----------GACAAAATGATCCAAAACTGCATGTCACAAGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGATCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCAGGAAGTGAACTTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_vadosa_3_56 ?ACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCGTTCGATTTCATTGATGGGTATGAAAAAAAT---TTACCTATTTAGTTCTAA---AGAAGAGTATAATAATAATAATAA------TAATACTTTTT---CTTGTGTCAATGTGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGGGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCAGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACTGATTAATTAATCGAGAA------------------------------CGTATTTTCAGGTTAGCGATGCTAAGCCTTTGTTGAAGGAGGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTTATCGGGTTTATAGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACTCA----TCAACTTGT----CATTCTT--CGTCTT-----GGTGTTATGCTGATATTGATTTTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCAAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGGACGGTGAGAGCCTTTTTTTTT--------------CTTT----CTATTTTTGCCTTTTTTT--------------ATAAAATGTGCTTGATTT----TGATCTAATT----CTCGAAACTG----GTTGGATCAGATACCCATCTGTACTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TTATGCATTATTAGGA---TTGAGTTAA---TAGTTACAAAGAGCTGCTCAACTTTTCCGGCTGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------GTAACAACTTATTCTTTCCGGACTGTTAGATCATTTTTTTT------------AAAC-ATACGAGAAC---GGTTGTTATAACAATCGTTATTGAAA-------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAA---------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCCACACTATTGACCCTACGGACGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCTCTTGCAGCTTATGGTACTGATGCCTTC----------GACGAAATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTGC-TCA-----TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTCAATTAT---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-TGGG----CTTT-ATA----TTGGCAT--------CTCCTAAAGTCATAAACAACACTCTTAAAAGCGCCCATA--------CATAGAACCAACGACGCGTATTCATCTCTTCTACAGTGTCGATATATACCCAAAGTAAAAGTTGTTGGCCCACGCTCAA-TAT----GAACACTTTTTTACAGGGACCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_vadosa_3_60 ??CTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCGTTCGTTTTCATCGATGGGTATGAAAAAGA----TTACCTGTTTAGTTCTAA---AGAAGAGTATTATAATAATAA---------TAATATTTTTTT--CTTGTGTCAATGTGTATGAAT-------TTATGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCTGATAGGGTTCTGACTGTGAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTCGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACTGGTATCGTATATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACTATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACTTAATGAGTACGGATATATTAATCGAGAA------------------------------CGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAAGAGCGTACCTGTTATCGGGTTTATCGGTAGACTCGAAGAACAGAAAGGCTCGGATATTTTGGTCGCCGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATTT-----TTTTCT----TTC----------------------AGGGAACTGGTAAGAAGAGGTTTAAGCAGGAGATCAAAGAGCTGGAGGTGTTGTATCCCGACAAAGCCAGAGGAGTGGCAAAATTCAACGTCCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGATCTTTTCCAATTACATGCCATGCGATATGGAACGGTGAGAGCCTTTTTTTTT--------------CTTT----CTATTTTTGCCTTTTT----------AAAAAAAAAC--TG--CTTGATTT----TGACCTAATT----TTCGAAACTG----GTTGGATCAGATACCCATCTGTGCTTTGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGTTTTAATGTTGAGGTA----CGATAA---TATCGATATTTGAATCATAATC-------TAATGTGTTATTAGGA---TTGAG-----------------------------CTATCCGGATGTTCCAACTAGCCGTTGGACAG-----CTTT-AAGTCCTAG----TTGTCCGATT-------GTAACAACTTATTCTTTCTGGACCGTTAGATCGTTTTTATTT-----------AAAT-TTACGACAAC---GGTTGTTATAACAATCGTTATTGTAA-------CTATAGACATTTTTAACGATTCTAA---CCAACTCTAACAAATTTGCTAACTATGATTCA-CAGTCCGGAAGCTTCATCCATAACATGCGGTC---ATATAT--GCAGATTT----ATATTTCTTTATGGGATGCCTAAAAGTTGCTATATAATTGTTT-GCAGTGCGACACTATTGACCCTAAGGACGTGCTAAAGATAGTCAAAGCCGTTGGAAGAGTTCTTGAAGCTTACGGTACTGATGCCTTC----------GACAAAATGATCCAAAACTGCATGTCACAAGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTTTT-GTATAATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTCAA-TAT----GATCACTCTTTTATAGGGATCGGCAAAGAAATGGGAAGCAATGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACTTGGTATTGAAGGCGATGAAATTGGTCCGCTCTCC Castilleja_virgata_2_26 ??CTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAA----TTTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGAGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTAAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTTGACAAAGGAGTCGAATTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACTGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACT-AATGAGTACAGATAAATTAATCGAGAATGTATACGTACGTACGTACGTACGTACGTACGTATTTTCAGGTTACCGATGCTAAGCCTTTGTCGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATAT-----TTGTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAAATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCAGATTTTATGTTGATTCCAAGTAGATTTGAACCATGTGGTCTTATCCAATTACATGCCATGCGATACGGAACGGTGAGAGCCTTTTTTTTTTT--------------------CTATTTTTGCCTTATTTTTTTT----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTGCATGCTTGGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGCTTTAGTGTTGAGGTA----CAATAC---TATCGATATTTGAATCATAATC-------TAATGCGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTTCGGCTGTTCCAACTAGCCGTTAGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAT---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---GTATAT--GCATATTT----ATGTTTCTTTATAGAATGCCTAAAAGTTGCTATATTA---TTT-GCAGTGCGACACTATTGACCCTACAGACGTGCTAAAGATAGCAAAAGCCGTTAGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GATGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGAAGGTAC-TTA-----TTCACACATTTACGAGCTTTT-CTATTATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTAAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGTGATGAAATTGGTCCGCTCTCT Castilleja_virgata_2_33 ?ACTTCTATCTCCTCAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGAAAAAA----TTTACCTGTTTAGTTCTAA---GGAAGAGTATAATAATAATAA---------TAATACTTTTT---CTTGAGTCAATGTGTATGAAT-------GTGTGTAACTGT--------TGTAGTTACGAGAAGCCGGTGAAAGGAAGGAAAATCAACTGGATGAAGGCTGGGATCTTAGAATCGGATAGGGTTCTGACTGTAAGCCCTTACTATGCTCAGGAACTCATTTCAGGTGTTGACAAAGGAGTCGAGTTGGACAACATCCTTCGTAAGACTTGTGTAACCGGTATCGTAAATGGCATGGATACTCAAGAGTGGGACCCGGCTACCGATAAATACATTGATTGCAACTACGATATCACCACCGTAAGATCCT-CC-----------TACGTAC----TTTCTTA--TCACT-AATGAGTACAGATAAATTAATCGAGAATGTGTACGTACGTACGTACGTACGTACGTACGTATTTTCAGGTTACCGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACGTACCTGTTATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGCGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTTTTACACA----TCAACTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATAT-----TTGTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAAATCAAAGAGCTGGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGGCAAAATTCAACGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCAGATTTTATGTTGATTCCAAGTAGATTTGAACCATGTGGTCTTATCCAATTACATGCCATGCGATACGGAACGGTGAGAGCCTTTTTTTTTTTTTT-----------------CTATTTTTGCCTTATTTTTTTT----------ATAC--TGTGCTTGATTTCCTGTGATCTAATT----TTCGAAACTGCATGCTTGGATCAGATACCCATCTGTGCTTCGACCGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGGTTCCACATGGGAAGCTTTAATGTTGAGGTA----CGATAC---TATCGATATTTGAATCATAATC-------TAATGCGTTATTCGGA---TTGAGTCAA---TAGTTACAAAGAGCTGCTCGACCATTTCGGCTGTTCCAACTAGCCGTTAGACAG-----CTTT-AAGTCCTAG----TCGTCCGATC-------ATAACAACTTGGTCTTTCTGGACCGTTAGATCGTTTTTTT------------AAAAC-ATACGAGAAT---GGTTGTAA-------------------------CTATCGACAGTTTTAACGATTCTAA---CCAACTCTAACAAATT-GCTAACCATGATTCAACAGCCCGTAAGCTTCATCCATAACATGCGGTC---GTATAT--GCATATTT----ATGTTTCTTTATAGAATGCCTAAAAGTTGCTATATTATTGTTT-GCAGTGCGACACTATTGACCCTACAGACGTGCTAAAGATAGCAAAAGCCGTTAGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GATGAGATGATCCAAAACTGCATGTCACAGGATCACTCTTGGATGGTAC-TTA-----TTCACACATTTACGAGCTTTT-CTATTATTTCGTTTGATTTAA---CTTAGGT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAAA-CGGG----CTTTTATA----TTGGCAT--------CTCGTAAA-----------------------------------------------------------------------------------------------------------------CTAAA-TAT----GATCACTCTTTTATAGGGACCGGCAAAGGAATGGGAAGCAGTGCTGCTAAGCTTGGGTGTTGCTGGAAGTGAACCTGGTATTGAAGGTGATGAAATTGGTCCGCTCTCT Triphysaria_eriantha_54 ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CCGTAAGA-CCT-CG-----------TACATAC----TTTAATA--TCGCT-AGTGAGTACTGATAAATTAATCGAGAATGTGTACGTACGTACGTA------------CGTACTTTCAGGTTACGGATGCTAAGCCTTTGTTAAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGCGGACAGGAACGTACCTGTAATCGGGTTTATTGGTAGACTCGAAGAACAAAAAGGCTCGGATATTCTGGTTGAGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAG-------------TCA-CTTGT----CATTCTT--CATCTT-----GCCATTATGTTGATATTGATATTTTTTTTCTGTTA----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCGAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGCCAAAATTCAGCGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGACTTTATGTTGATTCCAAGTAGAATCGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACCGTGAGAGCCTTTTTT-CTTCTTCTTCTT----AATTTT--CTATTTTTGGCATTTCT---------------AAAC--TGTG--------------------------CTCAAAACTG----GTTGGATTAGATACCCATCTGTGCTTCTACGGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGCTTCCACATGGGAGCTTTTAATGTTGAGGTA----TGATAATAATATTGATATTC-------------------------------------------------------------------------------------------------------------TTTTAAGTCCTAG----TCGTCCGATC---------------------------------CTAGTCGT-GTGTTT-----------AAGAC-ATACGAGAAC---GGTTGTTATAACAATCGTTATTGAAA-------CTATCGACAGTTGTAAC------AA---CCAACTCTGACATCTT-GCTAACC--------------------------------------------ATATAT--GCAGATTTGTAGTAT-ATCTGTCGAGAATGCCTCAAAGTTGGTATATTGTTGTTT-GCAGTGCGACACTATTGTCCCTACCGATGTGCTAAAGATAGTCAAAGCCGTTGGCAGAGCCCTTGCAGCATATGGTACTGATGCCTTT----------GACGGAATGATCCAGAACTGCATGTCACAGGATCACTCCTGGAAGGTAG-TTT----ATCGACACAATTACAAGCTTTT-GAATTATTTCGTTTGATTTAATAACTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AGAA---GGG--------------------------------------------------------------------------------------------------------------------------------------------------------ATTT--TAT----GATCACATTTTTACAGGGACCGGCAAAGAAATGGGAAACAATGTTGCTAAGCTTGGGTGTTGCTGGGAGTGAACCTGGTATTGAAGGTGAAGAAATTGGTTCACTCTCC Triphysaria_eriantha_57 ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GAATGTGTACGTACGTACGTA------------CGTACTTTCAGGTTACGGATGCTAAGCCTTTGTTAAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGCGGACAGGAACGTACCTGTAATCGGGTTTATTGGTAGACTCGAAGAACAAAAAGGCTCGGATATTCTGGTTGAGGCTACTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAG-------------TCA-CTTGT----CATTCTT--CATCTT-----GCCATTATGTTGATATTGATATTTTTTTTCTGTTA----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCGAAGAGCTAGAGGTGTTGTATCCCGATAAAGCCAGAGGAGTGCCAAAATTCAGCGTGCCCTTGGCGCAT-ATGATAACTGCTGCTGCTGACTTTATGTTGATTCCAAGTAGATTCGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACCGTGAGAGCCTTTTTT-CTTCTTCTTCTT----AATTTT--CTATTTTTGGCATTTCT---------------AAAC--TGTG--------------------------CTCAAAACTG----GTTGGATTAGATACCCATCTGTGCTTCTACGGGTGGCCTCGTTGACACGGTGAAAGAAGGATACACTGGCTTCCACATGGGAGCTTTTAATGTTGAGGTA----TGATAATAATATTGATATTC-------------------------------------------------------------------------------------------------------------TTTTAAGTCCTAG----TCGTCCGATC---------------------------------CTAGTCGT-GTGTTT-----------AAGAC-ATACGAGAAC---GGTTGTTATAACAATCGTTATTGAAA-------CTATCGACAGTTGTAAC------AA---CCAACTCTGACAACTT-GCTAACC--------------------------------------------ATATAT--GCAGATTTGTAGTAT-ATCTGTCGAGAATGCCTCAGAGTTGGTATATTGTTGTTT-GCAGTGCGACACTATTGACCCTTCAGATATGCTAAAGATAGTCAAAGCCGTTGGCAGAGCCCTTGCAGCATATGGTACTGATGCCTTT----------GACGGAATGATCCAGAACTGCATGTCACAGGATCACTCCTGGAAGGTAG-TTT----ATCGACACAATTACAAGCTTTT-GGATTATTTCGTTTGATTTAATAACTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------GT-AAAA---GGG--------------------------------------------------------------------------------------------------------------------------------------------------------ATTT--TAT----GATCACATTTTTACAGGGACCGGCAAAGAAATGGGAAACAATGTTGCTAAGCTTGGGTGTTGCTGGGAGTGAACCTGGTATTGAAGGTGAAGAAATTGGTTCACTCTCC Triphysaria_pusilla_62 ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AACGAGTACCGATAAATTAATCGAGAATGTGTAAGTA---------------------GACCTTTCAGGTTACGGATGCTAAGCCTTTGTTAAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTAATCGGGTTTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGAGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTCTTACTCA----TCGGCTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATTTTTCTTCTGTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCGAAGAGCTAGAGGTGTTGTACCCCAATAAAGCCAGAGGAGTGCCAAAATTCAACGTGACCTTGGCCCAT-ATGATAACCGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACCGTGAGGGCCTTTTTTGTTTTTGTTTTTT----AGTTTT--CTATTT-TGGCTTTTCT---------------AAAC--TGTG--------------------------CTCAAAACTG----GTTGGATCAGATACCCATCTGTACTTCTACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATATACTGGCTTCCACATGGGAGCTTTTAATGTTGAGGTA----CGATAATAATATCGATA--C-------------------------------------------------------------------------------------------------------------TTTTAAGTCCTAG----TCGTCCGATC-------ATAACAACTTATTCTTTCTGTACCGTAAGATCGTTTCTTTTTT-----------AAC-ATACGAGAAC---GGTTGTTATATCAACCATTAATG-------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCGACACTATTGACCCTACGGACGTGCTAAAGATAGTAAAAGCCGTTGGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAGAACTGCATGTCACAAGATCACTCCTGGAAGGTAC-TTT----ATCGACACAATTACAAGCTTTT-GAATTATTTCGTTTGATTTCAA--CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------AT-TAAA---GGG--------------------------------------------------------------------------------------------------------------------------------------------------------CTTT--TAT----GATCACATATTTACAGGGACCGGCAAAAAAATGGGAAACAATGCTGCAAAGCTTGGGTGTTGCTGGGAGTGAACCTGGTATTGAAGGCGATGAAATCGGTCCACTCTCC Triphysaria_versicolor_11 ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTCTTACTCA----TCAGCTTGT----CATTCTT--CGTCT------GGCATTATGTTGATATTGATATTTTTCTTCTGTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCGAAGAGCTAGAGGTGTTGTACCCCAATAAAGCCAGAGGAGTGCCAAAATTCAACGTGCCCTTGGCCCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACCGTGAGGGCCTTTTTTTTTTTTTTTT-------AGTTTT--CTATTT-TGGCTTTTCT---------------AAAC--TGTG--------------------------CTCAAAACTG----GTTGGATCAGATACCCATCTGTACTTCTACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATATACTGGCTTCCACATGGGAGCTGTTAATGCTGAGGTA----CGATCATAATATCGATA--C-------------------------------------------------------------------------------------------------------------TTTTAAGTCCTAG----TCGTCCGATC-------ATAACAACTTATTCTTTCTGTACCGTAAGATCGTTTCATTTTT-----------AAC-ATACGAGAAC---GGTTGTAATAACAACCATTAATG-------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCGACACTATTGACCCTACAGACGTGCTAAAGATAGTAAAAGCCGTTGGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAGAACTGCATGTCACAAGATCACTCCTGGAAGGTAC-TTT----ATCGACACAATTACAAGCTTTT-GAATTATTTCGTTTGATTTAA---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------AT-TAAA---GGG--------------------------------------------------------------------------------------------------------------------------------------------------------CTTT--TAT----GATCACATATTTACAGGGACCGGCAAAAAAATGGGAAACAATGCTGCTAAGCTTGGGTGTTGCTGGGAGTGAACCTGGTACTGAAGGCGATGAAATCGGTCCACTCTCC Triphysaria_versicolor_12 ?????CTATCTCCTTAATCTCCCTGATCAATACAAAAGTTCATTCGATTTCATCGATGGGTATGATTTTTTTT--TTACCTTTGTAGTCCTAA---TGAAGAGTATAATAATAATAA---------TAATATTTTTTG--------------------------------------CTGT--------TGTAGTTACGAGAAGCCGGTTTAAGGAAGGAAAATAAACTGGATGAAGGCTGGGATCTTAGAGTCGGATAGGGTTGTGACTGTAAGCCCTTACTATGCTGAGGAACTCATTTCAGGGGTCGACAAAGGAGTCGAATAGGACGACATCCTTCGCGAGACTAGTGTCGCCGGTATCATCAATGGCATGGATACTCGAGAGTGGGACCCGACTACTGATAGATACCTTGATTGCAACTACAATATCGCCACCGTAAGATCCA-CG-----------TACCTAC----TTTCTTA--TCGCT-AACGAGTACAGATAAATTAATCGAGAATGTGTAAGTA---------------------GACCTTTCAGGTTACGGATGCTAAGCCTTTGTTGAAGGAAGCTCTTCAAGCATCGGTTGGGTTGCCTGTGGACAGGAACATACCTGTAATCGGGTCTATTGGTAGACTCGAAGAACAGAAAGGCTCGGATATTCTGGTCGAGGCTATTTCTAAATTTATTGGGATGAATGTTCAGATAATCATTCTTGTAAGTCTTACTCA----TCAGCTTGT----CATTCTT--CGTCTT-----GGCATTATGTTGATATTGATATTTTTCTTCTGTTT----CTC----------------------AGGGAACTGGTAAGAAGAGGTTTGAGCAGCAGATCGAAGAGCTAGAGGTGTTGTACCCCAATAAAGCCAGAGGAGTGCCAAAATTCAACGTGCCCTTGGCCCAT-ATGATAACTGCTGCTGCTGATTTTATGTTGATTCCAAGTAGATTTGAACCCTGTGGTCTTATCCAATTACATGCCATGCGATATGGAACCGTGAGGGCCTTTTTTGTTTTTGTTTTTT----AGTTTT--CTATTT-TGGCTTTTCT---------------AAAC--TGTG--------------------------CTCAAAACTG----GTTGGATCAGATACCCATCTGTACTTCTACTGGTGGCCTCGTTGACACGGTGAAAGAAGGATATACTGGCTTCCACATGGGAGCTGTTAATGCTGAGGTA----CGATAATAATATCGATA--C-------------------------------------------------------------------------------------------------------------TTTTAAGTCCTAG----TCGTCCGATC-------ATAACAACTTATTCTTTCTGTACCGTAAGATCGTTTCATTTTT-----------AAC-ATACGAGAAC---GGTTGTAATAACAACCATTAATG-------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTT-GCAGTGCGACACTATTGACCTTACAGACGTGCTAAAGATAGTAAAAGCCGTTGGCAGAGCTCTTGCAGCTTACGGTACTGATGCCTTC----------GACGAAATGATCCAGAACTGCATGTCACAAGATCACTCCTGGAAGGTAC-TTT----ATCGACACAATTACAAGCTTTT-GAATTATTTCGTTTGATTTAA---CTTAGAT-AT--GAAATA--------------------------------------------------------------------------------------------AT-TAAA---GGG--------------------------------------------------------------------------------------------------------------------------------------------------------CTTT--TAT----GATCACATATTTACAGGGACCGGCAAAAAAATGGGAAACAATGCTGCTAAGCTTGGGTGTTGCTGGGAGTGAACCTGGTATTGAAGGCGATGAAATCGGTCCACTCTCC ; END; BEGIN TREES; TITLE Tb10464; LINK TAXA = Taxa1; TRANSLATE 1 Castilleja_lacera_08, 2 Castilleja_lacera_03, 3 Castilleja_lacera_07, 4 Castilleja_lineariloba_17, 5 Castilleja_lineariloba_20, 6 Castilleja_rubicundula_03, 7 Castilleja_rubicundula_05, 8 Castilleja_attenuata_58, 9 Castilleja_attenuata_72, 10 Castilleja_densiflora_08, 11 Castilleja_densiflora_10, 12 Castilleja_ambigua_08, 13 Castilleja_ambigua_02, 14 Triphysaria_versicolor_12, 15 Triphysaria_versicolor_11, 16 Triphysaria_pusilla_62, 17 Triphysaria_eriantha_54, 18 Triphysaria_eriantha_57, 19 Castilleja_nubigena_3_50, 20 Castilleja_virgata_2_26, 21 Castilleja_virgata_2_33, 22 Castilleja_pumila_2_75, 23 Castilleja_pumila_94, 24 Castilleja_auriculata_48, 25 Castilleja_auriculata_50, 26 Castilleja_auriculata_53, 27 Castilleja_auriculata_61, 28 Castilleja_tenuiflora_75, 29 Castilleja_tenuiflora_79, 30 Castilleja_tenuiflora_78, 31 Castilleja_tenuiflora_81, 32 Castilleja_arvensis_2_10, 33 Castilleja_arvensis_2_01, 34 Castilleja_linariifolia_85, 35 Castilleja_linariifolia_93, 36 Castilleja_occidentalis_17, 37 Castilleja_occidentalis_26, 38 Castilleja_occidentalis_33, 39 Castilleja_occidentalis_18, 40 Castilleja_parviflora_82, 41 Castilleja_parviflora_90, 42 Castilleja_miniata_53, 43 Castilleja_miniata_58, 44 Castilleja_miniata_55, 45 Castilleja_miniata_56, 46 Castilleja_miniata_61, 47 Castilleja_elmeri_8, 48 Castilleja_elmeri_18, 49 Castilleja_elmeri_26, 50 Castilleja_elmeri_28, 51 Castilleja_cusickii_59, 52 Castilleja_cusickii_64, 53 Castilleja_peirsonii_2, 54 Castilleja_peirsonii_10, 55 Castilleja_pilosa_33, 56 Castilleja_pilosa_41, 57 Castilleja_pilosa_44, 58 Castilleja_pilosa_36, 59 Castilleja_ophiocephala_10, 60 Castilleja_ophiocephala_01, 61 Castilleja_peruviana_4_83, 62 Castilleja_peruviana_4_62_2, 63 Castilleja_peruviana_4_70_2, 64 Castilleja_peruviana_4_30, 65 Castilleja_cerroana_85_2, 66 Castilleja_cerroana_6_2, 67 Castilleja_cerroana_25_2, 68 Castilleja_cerroana_17_2, 69 Castilleja_cerroana_3, 70 Castilleja_cerroana_11, 71 Castilleja_alpicola_48, 72 Castilleja_alpicola_33, 73 Castilleja_alpicola_37, 74 Castilleja_alpicola_42, 75 Castilleja_vadosa_3_60, 76 Castilleja_vadosa_3_54, 77 Castilleja_vadosa_3_56, 78 Castilleja_exserta_03, 79 Castilleja_exserta_04, 80 Castilleja_exserta_05, 81 Castilleja_exserta_15, 82 Castilleja_lasiorhyncha_05, 83 Castilleja_lasiorhyncha_06, 84 Castilleja_lasiorhyncha_04, 85 Castilleja_campestris_01, 86 Castilleja_campestris_07, 87 Castilleja_campestris_09, 88 Castilleja_campestris_11, 89 Castilleja_tenuis_25, 90 Castilleja_tenuis_26, 91 Castilleja_lacera_01, 92 Castilleja_lacera_15; TREE Fig._4 = [&R] (18,17,((16,(14,15)),(((6,7),(12,13)),((9,(8,(10,11))),((((1,(2,3)),(91,92)),((4,5),(89,90))),(((83,(82,85)),(88,(87,(84,86)))),((75,(71,72)),((59,60),((((32,33),(22,(23,((20,21),(19,(69,(67,68))))))),(((34,35),((53,54),(((55,58),(56,57)),(51,52)))),(((30,31),((27,(25,(24,26))),(28,29))),(44,(43,(((49,50),(38,39)),((40,41),((36,37),((45,46),(42,(47,48))))))))))),((76,(77,((73,74),((64,(61,(62,63))),(70,(65,66)))))),((80,81),(78,79)))))))))))); END; BEGIN TREES; TITLE Tb10463; LINK TAXA = Taxa2; TRANSLATE 1 Castilleja_campestris_ssp_campestris, 2 Castilleja_lineariloba, 3 Castilleja_tenuis, 4 Castilleja_lacera, 5 Castilleja_lasiorhyncha, 6 Castilleja_rubicundula_ssp_rubicundula, 7 Castilleja_ambigua_ssp_ambigua, 8 Castilleja_attenuata, 9 Castilleja_attenuata_CHILE, 10 Castilleja_exserta_ssp_exserta, 11 Castilleja_densiflora_ssp_densiflora, 12 Castilleja_pilosa_ssp_pilosa, 13 Castilleja_cusickii, 14 Castilleja_parviflora_ssp_parviflora, 15 Castilleja_peirsonii, 16 Castilleja_elmeri, 17 Castilleja_occidentalis, 18 Castilleja_miniata_ssp_miniata, 19 Castilleja_tenuiflora_ssp_tenuiflora, 20 Castilleja_auriculata_ssp_auriculata, 21 Castilleja_linariifolia, 22 Castilleja_ophiocephala, 23 Castilleja_arvensis, 24 Castilleja_nubigena, 25 Castilleja_virgata, 26 Castilleja_pumila, 27 Castilleja_alpicola, 28 Castilleja_vadosa, 29 Castilleja_peruviana, 30 Castilleja_cerroana, 31 Castilleja_laciniata, 32 Triphysaria_eriantha_ssp_gratiosa, 33 Triphysaria_pusilla, 34 Triphysaria_versicolor_ssp_versicolor; TREE Fig._3 = [&R] (32,(33,34),(((31,(29,(28,(27,30)))),((11,(8,9)),(7,(2,6)))),(10,((22,(((23,(19,20)),(26,(24,25))),((17,18),(21,(16,(14,(15,(12,13)))))))),((1,5),(3,4)))))); END;