#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 14:46 GMT TreeBASE (cc) 1994-2008 Study reference: Ogawa Y., Sugiyama M., Hirose D., Kusama-eguchi K., & Tokumasu S. 2010. Polyphyly of intraspecific groups of Umbelopsis ramanniana and their genetic and morphological variation. Mycoscience, 52(2): 91-98. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10027] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=30; TAXLABELS Mucor_circinelloides_f_lusitanicus_ATCC1216 Mucor_hiemalis_NRRL3624 Umbelopsis_angularis_CBS603_68 Umbelopsis_autotrophica_CBS212_72 Umbelopsis_fusiformis_CBS385_85 Umbelopsis_gibberispora_CBS101745 Umbelopsis_gibberispora_CBS109328 Umbelopsis_isabellina_NRRL1757 Umbelopsis_ramanniana_CBS112_08 Umbelopsis_ramanniana_CBS219_47 Umbelopsis_ramanniana_CBS243_58 Umbelopsis_ramanniana_CBS478_63 Umbelopsis_ramanniana_NRRL5844 Umbelopsis_ramanniana_YODK004 Umbelopsis_ramanniana_YODK028 Umbelopsis_ramanniana_YODK036 Umbelopsis_ramanniana_YODK101 Umbelopsis_ramanniana_YODK106 Umbelopsis_ramanniana_YODK119 Umbelopsis_ramanniana_YODK120 Umbelopsis_ramanniana_YODK122 Umbelopsis_ramanniana_YODK126 Umbelopsis_ramanniana_YODK129 Umbelopsis_ramanniana_YODK130 Umbelopsis_ramanniana_YODK170 Umbelopsis_roseonana_CBS473_74 Umbelopsis_swartii_CBS868_85 Umbelopsis_vinacea_CBS222_29 Umbelopsis_vinacea_CBS561_63 Umbelopsis_westeae_CBS870_85 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4527] TITLE '28S rDNA D1- D2 domain'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=664; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Mucor_circinelloides_f_lusitanicus_ATCC1216 TA-CAATGATTTCCCTAGTA--CGGCGAGTGAAGAGGAAAGAGCTCAAAGTTGGAAACTGTTTGGCTTACTAAACCGTA-TTGTAAACTGTAGAAACATTTTCCTGGCACACCGATTAATAAGTCCTTTGGAACAAGGCATCATGGAGGGTGAGAATCCCGTCTTTGATCT-GAGTAGTTTCTTTTGTGATATGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAATTGGGTGGTAAATCTCACCTAAAGCTAAATATTTGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTATGTGAAATTGTTAAAAGGGAACC-GTTTGGAGCCAGACTGGTTTGCTTGTAATCAACCTAGAATTCGTTTTGGGTGCACTTGCAG-CTATACCTGCCAACAACAGTTTGATTTGGAGGAAAAAATTAGTAGGAATGTAGCCTCTAGGTGTTATACCTACTTC-AA---CTCTGG-ATTGGACTGAGGAACGCAGTAGGCAAGATTGCTGGGTGCTTTCGCTAATAAATGAGAATTTCTGCTTCGGGTGGTGCTAATGTTTAAAGGAGGAACCATCAG--TATTTTTTTATT--CTAGTG-TGG---------------------- Mucor_hiemalis_NRRL3624 TA-CAATGATTTCCCTAGTA--CGGCGAGTGAAGAGGAAAGAGCTCAAAGTTGGAACCTATTTGGCTTACTAAATCGGA-TTGTAAACTGTAGAAGTGTTTTCCAGACACGCCGGTAAAAAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCATTGGCCA-GAGCTGTTTCTTTTGTGATACATTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAATTGGGTGGTAAATCTCACCTAAAGCTAAATATTTGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTATGTGAAATTGTTAAAAGGGAACC-GTTTGGAGCCAGACTGGCTTAATCGTAATCAATTTAGGCTTTGGCCTGGATGCACTTGCGG-TTATGCCGGCCAACGACAGTTTTGTTTGGGAGAAAAAATTACATTGAATGTGGCCCCTGGGTGTTATACTTTGT-A-AAA--TCCTGG-ACTGGACTGAGGAACGCAGTAGGCAAGATTGCTGGGTGCTTTCGCTAATACATGAGAATTTCTGCTTCGGGTGGTGCTAGTGTTTAAAGGAGGAACCGCCGG--TATTTTTTTATT--CTAGTG-TGG---------------------- Umbelopsis_angularis_CBS603_68 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTGCTTGC-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAATTTTTGCCTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAAGGGAAATGTGGCCTTCGGGTGTTATAGTCCCTTATAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAACGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTCGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_autotrophica_CBS212_72 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTACTTGT-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAATTTTTGCTTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAGGGGAAATGTGGCCTTCGGGTGTTATAGTCCCTTATAAAATATCGTGTCCTGGACTGAGGATCGCAGTGAAAATGTGGGCAGGTGGATTTCTGTGGTGACTGTCGGTTAGGACAACTTGTTGACCTAGCCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_fusiformis_CBS385_85 TACCAAGGATTCCCTCAGTA-CCGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCTTGCTTGC-AAGTCCGAGTTGTAGTCTGAAGAAGCGTTTTCCATAAGCACTGAGGCACAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTCGCTTATTTTGTGATACGCTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAGTTTGTACCTCGGTATGAATGCACTCTTGGGTATGGTAGGCCAACGACAGTTTGGAGTGCGAGAAAAAAACTTGGGAAATGTGGCCTTCGGGTGTTATAGTCCCTTGTAAAATATCGTGTTCCGGACTGAGGATCGCAGTAAAAATGTGGGCAGGTAGATTTCTGTGGCGAATGTTTATTAGGACAACTTGTTGACCTAGTTTGCACGAACTTCACTGGTTGCCTCGCTTCTAATTTGCTTA-G-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_gibberispora_CBS101745 TA-CAAGGATTCCCTCAGTAACCGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTGCTTGC-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGACAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAATTTTTGCTTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAGAGGAAATGTGGCCTTCGGGTGTTATAGTCCTTTATAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAACGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_gibberispora_CBS109328 TA-CAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTGCTTGC-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGACAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAATTTTTGCTTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAGAGGAAATGTGGCCTTCGGGTGTTATAGTCCTTTATAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAACGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG-CGGT-GGCATAATGGCTTTAAATGA Umbelopsis_isabellina_NRRL1757 TAACAAGGATTCCCCTAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCTTGCTTGC-AAGTCCGAGTTGTAGTCTGAAGAAGCGTTTTCCATGAAAGCTGAGGCACAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCATGCATTTCATTTTGTGATACGTTTTCTAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-AAAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTGCTTACTTGTGATCAATCTTAGCTTCGGCTTGGATGCACTCTCAAGTTATGCAGGTCAACGTCAGTTTGAGAGGTGGGAAAAAAGTTTGAGGAATGTGGCCTTCGGGTGTTATAGCCTCTTACTAAATACCATCTCCTGGACTGAGGCTCGCAGCAAAAATGTGGGCTGGTTTGCTCCTGAGGTGAATCATTATTAAGACAGCTTGCTGACTTAGTTTTGTGGATCTTCACGGTA-GGCTAGCTTCTAATTTGCTTAGG-TCGTTGACATAATGGCTTTAAATGA Umbelopsis_ramanniana_CBS112_08 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTGCTTGC-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTC--TTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTCGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-AAAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAATTTTTGCTTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAGGGGAAATGTGGCCTTCGGGTGTTATAGTCCCTTATAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTCGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_ramanniana_CBS219_47 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTGCTTGC-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAATTTTTGCTTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAGAGGAAATGTGGCCTTCGGGTGTTATAGTCCTTTGTAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_ramanniana_CBS243_58 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTGCTTGC-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACA-GGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGGTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAATTTTTGCTTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAGAGGAAATGTGGCCTTCGGGTGTTATAGTCCTTTGTAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAACGTGGGCAGGTGGATTTCTGTGGTAACTGTCGATTAGGACAACTCGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_ramanniana_CBS478_63 TACCAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTTTGCTTGC-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCTTTGGAACAAGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAATTTTTGCTTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAAAGGAAATGTGGCCTTCGGGTGTTATAGTCCTTTATAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTAACTGTCGATTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_ramanniana_NRRL5844 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTACTTGT-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAACACAGTACGTGAAATTGTTGAAAGGGAACCCGTTTGAAGCCAGTCTTACTTGCTCGTGATCAATTTTTGGCTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTAGAATGCGAGAAAAAAATAGGGGAAATGTGGCCTTCGGGTGTTATAGTCCCTTATAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_ramanniana_YODK004 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTACTTGT-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCTCGTGATCAATTTTTGCCTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTAGAATGCGAGAAAAAAATAGGGGAAATGTGGCCTTCGGGTGTTATAGTCCCTTATAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_ramanniana_YODK028 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTGCTTGC-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTCGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-AAAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAATTTTTGC{CT}TCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAGGGGAAATGTGGCCTTCGGGTGTTATAGTCCCTTATAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTCGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_ramanniana_YODK036 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTGCTTGC-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGGTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAATTTTTGCTTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAGAGGAAATGTGGCCTTCGGGTGTTATAGTCCTTTGTAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_ramanniana_YODK101 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTGCTTGC-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGGTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAATTTTTGCTTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAGAGGAAATGTGGCCTTCGGGTGTTATAGTCCTTTGTAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_ramanniana_YODK106 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTGCTTGC-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGGTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAATTTTTGCTTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAGAGGAAATGTGGCCTTCGGGTGTTATAGTCCTTTGTAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_ramanniana_YODK119 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTGCTTGC-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGGTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAATTTTTGCTTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAGAGGAAATGTGGCCTTCGGGTGTTATAGTCCTTTGTAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_ramanniana_YODK120 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTGCTCGC-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTCGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-AAAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAATTTTTGCCTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAGGGGAAATGTGGCCTTCGGGTGTTATAGTCCCTTATAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTCGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAGTGA Umbelopsis_ramanniana_YODK122 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTGCTTGC-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-AAAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAATTTTTGCCTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAGGGGAAATGTGGCCTTCGGGTGTTATAGTCCCTTATAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTCGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_ramanniana_YODK126 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTACTTGT-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCTCGTGATCAATTTTTGCCTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTAGAATGCGAGAAAAAAATTTGAGAAATGTGGCCTTCGGGTGTTATAGTCTCTTGTAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_ramanniana_YODK129 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTACTTGT-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCTCGTGATCAATTTTTGCCTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTAGAATGCGAGAAAAAAATTTGAGAAATGTGGCCTTCGGGTGTTATAGTCTCTTGTAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_ramanniana_YODK130 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTACTTGT-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCTCGTGATCAATTTTTGCCTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTAGAATGCGAGAAAAAAATTTGAGAAATGTGGCCTTCGGGTGTTATAGTCTCTTGTAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_ramanniana_YODK170 TAACAAGGATTCCCTCAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTGCTTGC-AAGCCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCCTGTGATCAATTTTTGCTTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAGAGGAAATGTGGCCTTCGGGTGTTATAGTCCTTTGTAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTAACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG-TCGTTGGCATAATGGCTTTAAATGA Umbelopsis_roseonana_CBS473_74 TA-CAAGGATTCCCCTAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTGCTTGC-AAATCCGAGTTGTAGTCTGAAGAAACGTTTTCCATGAAAGCTGAGGCACAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGCCTTTCATTTTGTGATACGTTTTCTAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-AAAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTGCTTGCTTGTGATCAGTCTTTGCTTCGGCTTGGATGCACTCTCAGGTTATGCAGGTCAACGTCAGTTTGAGAGGTGGGAAAAAAGCTTGAGGAATGTGGCCTTCGGGTGTTATAGCCTCTTGCTAAATACCATCTTTTGGACTGAGGCTCGCAGCAAAAATGTGGGCAGGTTTGCGTTTGAGGTGATACATTATTAAGACAGCTTGCTGACTTAGTTTTGTCTATCTTCACTGCAAGCTTCGCTTCTAATTTGCTTAGG-TCGT-GACATAATGGCTTTAAATGA Umbelopsis_swartii_CBS868_85 T-CCAAGGATTCCCTCAGTA--CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTACTTGT-AAATCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCTCGTGATCAATTTTTGCTTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTGGAATGCGAGAAAAAAATAGGGGAAATGTGGCCTTCGGGTGTTATAGTTCTCTATAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGATGGATTTCTGTGGTGACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTATCTTGCTTCTAATT-GCTTAGG--CGGTGGCATAATGGCTTTAAATGA Umbelopsis_vinacea_CBS222_29 TA-CAAGGATTCCCCTAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTAGTTTGCTTGC-AAACTCGAGTTGTAGTCTGAAGAAACGTTTTCCATGAAAGCTGAGGCACAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTCTTTCATTTTGTGATACGTTTTCTAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-AAAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTGTTTTTTTGTGATCAGTCTCAGCTTTGGCTGGGATGCACTCTCAA-TTTTACAGGTCAACGTCAGTTTGAGAAGTGGGAAAAAAATTTGAGGAATGTGGCCTTCGGGTGTTATAGCCTCTTATTAAATACCATTTCCTGGACTGAGGCTCGCAGCAAAAATCTTGGCAGACTTGCTTCTGAGGTGAACCATTATTAAGACAGCTTGCTGACTTAGTTTTGTCTAACTTCACAGTAAGTTTCGCTTCTAATTTGCTTAGG-TCGTTGACATAATGGCTTTAAATGA Umbelopsis_vinacea_CBS561_63 TACCAAGGATTCCCCTAGTAA-CGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTAGTTTGCTTGC-AAACTCGAGTTGTAGTCTGAAGAAACGTTTTCCATGAAAGCTGAGGCACAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTCTTTCATTTTGTGATACGTTTTCTAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-AAAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTGTTTTTTTGTGATCAGTCTCAGCTTTGGCTGGGATGCACTCTCAA-TTTTACAGGTCAACGTCAGTTTGAGAAGTGGGAAAAAAATTTGAGGAATGTGGCCTTCGGGTGTTATAGCCTCTTATTAAATACCATTTCCTGGACTGAGGCTCGCAGCAAAAATCTTGGCAGACTTGCTTCTGAGGTGAACCATTATTAAGACAGCTTGCTGACTTAGTTTTGTCTAGCTTCACAGTAGGTTTCGCTTCTAATTTGCTTAGG-TCGTTGACATAATGGCTTTAAATGA Umbelopsis_westeae_CBS870_85 TA-CAAGGATTCCCTCAGTAACCGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTTTACTTGT-AAATCCGAGTTGTAGTCTGAAGAAACGTTTTCCATAAGCACTGAGGCAAAAGTCCCTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCCATGGTCTCAAGTTGTTTATTTTGTGATACGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA-ACAGTACGTGAAATTGTTGAAAGGGAACC-GTTTGAAGCCAGTCTTACTTGCTCGTGATCAATTTTTGCTTCGGCATGAATGCACTCTCGGGTATGGTAGGCCAACGACAGTTTAGAATGCGAGAAAAAAATTTGGGAAATGTGGCCTTCGGGTGTTATAGTCCCTTATAAAATATCGTGTTCTGGACTGAGGATCGCAGCAAAAATGTGGGCAGGTGGATTTCTGTGGTGACTGTCGGTTAGGACAACTTGTTGACCTAGTCTTCCTTAGCCTCACTATTTACCTTGCTTCTAATTTGCTTAGG--CGGTGGCATAAGGGCTTTAAATGA ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = '28S rDNA D1- D2 domain') = N: 1-664; CODONPOSSET * CodonPositions (CHARACTERS = '28S rDNA D1- D2 domain') = N: 1-664; END; BEGIN TREES; TITLE Tb10492; LINK TAXA = Taxa1; TRANSLATE 1 Umbelopsis_gibberispora_CBS101745, 2 Umbelopsis_gibberispora_CBS109328, 3 Umbelopsis_isabellina_NRRL1757, 4 Umbelopsis_roseonana_CBS473_74, 5 Umbelopsis_vinacea_CBS222_29, 6 Umbelopsis_vinacea_CBS561_63, 7 Umbelopsis_fusiformis_CBS385_85, 8 Umbelopsis_ramanniana_CBS478_63, 9 Mucor_hiemalis_NRRL3624, 10 Mucor_circinelloides_f_lusitanicus_ATCC1216, 11 Umbelopsis_westeae_CBS870_85, 12 Umbelopsis_swartii_CBS868_85, 13 Umbelopsis_ramanniana_YODK126, 14 Umbelopsis_ramanniana_YODK129, 15 Umbelopsis_ramanniana_YODK130, 16 Umbelopsis_ramanniana_YODK004, 17 Umbelopsis_ramanniana_NRRL5844, 18 Umbelopsis_ramanniana_YODK028, 19 Umbelopsis_ramanniana_YODK120, 20 Umbelopsis_ramanniana_YODK122, 21 Umbelopsis_ramanniana_CBS112_08, 22 Umbelopsis_ramanniana_YODK036, 23 Umbelopsis_ramanniana_YODK101, 24 Umbelopsis_ramanniana_YODK106, 25 Umbelopsis_ramanniana_YODK119, 26 Umbelopsis_ramanniana_YODK170, 27 Umbelopsis_ramanniana_CBS219_47, 28 Umbelopsis_ramanniana_CBS243_58, 29 Umbelopsis_angularis_CBS603_68, 30 Umbelopsis_autotrophica_CBS212_72; TREE Fig._3 = [&R] (9,(10,(((((((((11,12),((13,14,15),16,17)),30),(((22,23,24,25,28),26,27),(1,2),8)),29),20),18,19,21),7),((3,(5,6)),4)))); END; BEGIN TREES; TITLE Tb10491; LINK TAXA = Taxa1; TRANSLATE 1 Umbelopsis_gibberispora_CBS101745, 2 Umbelopsis_gibberispora_CBS109328, 3 Umbelopsis_isabellina_NRRL1757, 4 Umbelopsis_roseonana_CBS473_74, 5 Umbelopsis_vinacea_CBS222_29, 6 Umbelopsis_vinacea_CBS561_63, 7 Umbelopsis_fusiformis_CBS385_85, 8 Umbelopsis_ramanniana_CBS478_63, 9 Mucor_hiemalis_NRRL3624, 10 Mucor_circinelloides_f_lusitanicus_ATCC1216, 11 Umbelopsis_westeae_CBS870_85, 12 Umbelopsis_swartii_CBS868_85, 13 Umbelopsis_ramanniana_YODK126, 14 Umbelopsis_ramanniana_YODK129, 15 Umbelopsis_ramanniana_YODK130, 16 Umbelopsis_ramanniana_YODK004, 17 Umbelopsis_ramanniana_NRRL5844, 18 Umbelopsis_ramanniana_YODK028, 19 Umbelopsis_ramanniana_YODK120, 20 Umbelopsis_ramanniana_YODK122, 21 Umbelopsis_ramanniana_CBS112_08, 22 Umbelopsis_ramanniana_YODK036, 23 Umbelopsis_ramanniana_YODK101, 24 Umbelopsis_ramanniana_YODK106, 25 Umbelopsis_ramanniana_YODK119, 26 Umbelopsis_ramanniana_YODK170, 27 Umbelopsis_ramanniana_CBS219_47, 28 Umbelopsis_ramanniana_CBS243_58, 29 Umbelopsis_angularis_CBS603_68, 30 Umbelopsis_autotrophica_CBS212_72; TREE Fig._2 = [&R] (9,(10,((((((((11,12),((13,14,15),16,17)),30),(((22,23,24,25,28),26,27),(1,2),8)),29),(((18,21),19),20)),7),((3,(5,6)),4)))); END; BEGIN TREES; TITLE Tb10490; LINK TAXA = Taxa1; TRANSLATE 1 Umbelopsis_gibberispora_CBS101745, 2 Umbelopsis_gibberispora_CBS109328, 3 Umbelopsis_isabellina_NRRL1757, 4 Umbelopsis_roseonana_CBS473_74, 5 Umbelopsis_vinacea_CBS222_29, 6 Umbelopsis_vinacea_CBS561_63, 7 Umbelopsis_fusiformis_CBS385_85, 8 Umbelopsis_ramanniana_CBS478_63, 9 Mucor_hiemalis_NRRL3624, 10 Mucor_circinelloides_f_lusitanicus_ATCC1216, 11 Umbelopsis_westeae_CBS870_85, 12 Umbelopsis_swartii_CBS868_85, 13 Umbelopsis_ramanniana_YODK126, 14 Umbelopsis_ramanniana_YODK129, 15 Umbelopsis_ramanniana_YODK130, 16 Umbelopsis_ramanniana_YODK004, 17 Umbelopsis_ramanniana_NRRL5844, 18 Umbelopsis_ramanniana_YODK028, 19 Umbelopsis_ramanniana_YODK120, 20 Umbelopsis_ramanniana_YODK122, 21 Umbelopsis_ramanniana_CBS112_08, 22 Umbelopsis_ramanniana_YODK036, 23 Umbelopsis_ramanniana_YODK101, 24 Umbelopsis_ramanniana_YODK106, 25 Umbelopsis_ramanniana_YODK119, 26 Umbelopsis_ramanniana_YODK170, 27 Umbelopsis_ramanniana_CBS219_47, 28 Umbelopsis_ramanniana_CBS243_58, 29 Umbelopsis_angularis_CBS603_68, 30 Umbelopsis_autotrophica_CBS212_72; TREE Fig._1 = [&R] (9,(10,((((((11,12),(((13,14),15),(16,17))),30),(((((18,19),21),20),29),(((((22,(23,(24,25))),28),(26,27)),(1,2)),8))),7),((3,4),(5,6))))); END;