#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 10:30 GMT TreeBASE (cc) 1994-2008 Study reference: Shiroya Y., & Takamatsu S. 2009. Erysiphe corylopsidis sp. nov., a new powdery mildew fungus found on Corylopsis spicata and C. pauciflora. Mycoscience, 50(6): 409-414. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10042] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=82; TAXLABELS Arthrocladiella_mougeotii_ex_Lycium_AB022379 Arthrocladiella_mougeotii_ex_Lycium_AB329690 Blumeria_graminis_ex_Bromus_AB022362 Blumeria_graminis_ex_Hordeum_AB022399 Blumeria_graminis_ex_Triticum_AB022376 Brasiliomyces_trina_ex_Quercus_AB022350 Byssoascus_striatisporus_U17912 Caespitotheca_forestalis_ex_Schinopsis_AB193467 Cystotheca_lanestris_ex_Quercus_AB022353 Cystotheca_wrightii_ex_Quercus_AB022355 Erysiphe_abbreviata_ex_Quercus_AB271785 Erysiphe_adunca_ex_Salix_AB022374 Erysiphe_alphitoides_ex_Quercus_AB237811 Erysiphe_alphitoides_ex_Quercus_AB257431 Erysiphe_aquilegiae_ex_Cimicifuga_AB022405 Erysiphe_arcuata_ex_Carpinus_AB252459 Erysiphe_arcuata_ex_Carpinus_AB252460 Erysiphe_arcuata_ex_Carpinus_AB252473 Erysiphe_australiana_ex_Lagerstroemia_AB022407 Erysiphe_corylopsidis_ex_corylopsis_MUMH_4104 Erysiphe_corylopsidis_ex_corylopsis_MUMH_4174 Erysiphe_corylopsidis_ex_corylopsis_MUMH_4315 Erysiphe_corylopsidis_ex_corylopsis_MUMH_4404 Erysiphe_epigena_ex_Quercus_AB292720 Erysiphe_epigena_ex_Quercus_AB292722 Erysiphe_friesii_ex_Rhamnus_AB022382 Erysiphe_glycines_ex_Desmodium_AB022397 Erysiphe_gracilis_ex_Quercus_AB022357 Erysiphe_heraclei_ex_Daucus_AB022391 Erysiphe_hypophylla_ex_Quercus_AB292715 Erysiphe_hypophylla_ex_Quercus_AB292716 Erysiphe_mori_ex_Morus_AB022418 Erysiphe_paeoniae_ex_Paeonia_AB257438 Erysiphe_pisi_AB102942 Erysiphe_pulchra_ex_Swida_AB022389 Erysiphe_quercicola_ex_Quercus_AB197135 Erysiphe_quercicola_ex_Quercus_AB292691 Erysiphe_quercicola_ex_Quercus_AB292694 Erysiphe_simulans_ex_Rosa_AB022395 Golovinomyces_adenophorae_ex_Adenophora_AB077632 Golovinomyces_cichoracearum_ex_Aster_AB077641 Golovinomyces_cichoracearum_ex_Dahlia_AB077628 Golovinomyces_cichoracearum_ex_Eupatorium_AB022387 Golovinomyces_cichoracearum_ex_Solidago_AB077650 Golovinomyces_orontii_ex_Nicotiana_AB022412 Golovinomyces_orontii_ex_Physalis_AB077646 Golovinomyces_orontii_ex_Rubia_AB077634 Golovinomyces_orontii_ex_Veronica_AB077651 Golovinomyces_sordidus_ex_Plantago_AB077657 Leveillula_saxaouli_ex_Haloxylon_AB080469 Leveillula_sp_ex_Chondrilla_AB080478 Leveillula_taurica_ex_Artemisia_AB080470 Neoerysiphe_cumminsiana_ex_Cacalia_AB329669 Neoerysiphe_galeopsidis_ex_Acanthus_AB329670 Neoerysiphe_galeopsidis_ex_Chelonopsis_AB022369 Neoerysiphe_galeopsidis_ex_Lamium_AB329674 Neoerysiphe_galii_ex_Galium_AB329681 Neoerysiphe_galii_ex_Galium_AB329682 Oidium_aloysiae_ex_Aloysia_AB329683 Oidium_baccharidis_ex_Baccharis_AB329684 Oidium_maquii_ex_Aristotelia_AB329686 Oidium_phyllanthi_ex_Phyllanthus_AB120754 Oidium_phyllanthi_ex_Phyllanthus_AB120755 Oidium_phyllanthi_ex_Phyllanthus_AB120758 Parauncinula_septata__ex_Quercus_AB183533 Parauncinula_septata_ex_Quercus_AB022420 Phyllactinia_fraxini_ex_Fraxinus_AB080451 Phyllactinia_fraxini_ex_Syringa_AB080436 Phyllactinia_guttata_ex_Alnus_AB080452 Phyllactinia_guttata_ex_Diospyros_AB022372 Phyllactinia_guttata_ex_Euptelea_AB080388 Phyllactinia_guttata_ex_Hamamelis_AB080410 Phyllactinia_guttata_ex_Morus_AB080372 Pleochaeta_shiraiana_ex_Celtis_AB022403 Podosphaera_filipendulae_ex_Filipendula_AB022384 Podosphaera_longiseta_ex_Prunus_AB022423 Podosphaera_pannosa_ex_Rosa_AB022347 Podosphaera_tridactyla_ex_Prunus_AB022393 Podosphaera_xanthii_ex_Melothria_AB022410 Sawadaea_polyfida_ex_Acer_AB022364 Sawadaea_tulasnei_ex_Acer_AB022366 Typhulochaeta_japonica_ex_Quercus_AB022415 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=70; TAXLABELS Erysiphe_abbreviata_AB271785 Erysiphe_alphitoides_AB237783 Erysiphe_alphitoides_AB257431 Erysiphe_aquilegiae_AB000944 Erysiphe_aquilegiae_AB015929 Erysiphe_aquilegiae_AF154322 Erysiphe_baeumleri_AB015919 Erysiphe_baeumleri_AB015933 Erysiphe_betae_AF011290 Erysiphe_blasti_AB015918 Erysiphe_castaneigena_AF298545 Erysiphe_convolvuli_AF011298 Erysiphe_convolvuli_AF154327 Erysiphe_corylopsidis_MUMH_4104 Erysiphe_corylopsidis_MUMH_4174 Erysiphe_corylopsidis_MUMH_4315 Erysiphe_corylopsidis_MUMH_4404 Erysiphe_cruciferarum_AF031283 Erysiphe_epigena_AB292717 Erysiphe_epigena_AB292720 Erysiphe_euonymijaponici_AB250229 Erysiphe_friesii_AB000939 Erysiphe_glycines_AB015927 Erysiphe_glycines_AB015934 Erysiphe_hedwigii_AF298539 Erysiphe_helwingiae_AB015916 Erysiphe_heraclei_AB000942 Erysiphe_howeana_AF011301 Erysiphe_huayinensis_AB015914 Erysiphe_hypogena_AB292724 Erysiphe_hypogena_AB292725 Erysiphe_hypophylla_AB292715 Erysiphe_japonica_AB000941 Erysiphe_japonica_AB015924 Erysiphe_juglandis_AB015928 Erysiphe_katumotoi_AB015917 Erysiphe_lespedezae_AB015921 Erysiphe_lespedezae_AB015923 Erysiphe_liriodendri_AF011302 Erysiphe_macleayae_AB016048 Erysiphe_magnifica_AF011312 Erysiphe_paeoniae_AB257436 Erysiphe_paeoniae_AB257437 Erysiphe_paeoniae_AB257438 Erysiphe_pisi_AF011306 Erysiphe_pisi_AF073348 Erysiphe_polygoni_AF011307 Erysiphe_polygoni_AF011308 Erysiphe_pseudolonicerae_AB015915 Erysiphe_pulchra__AB015935 Erysiphe_quercicola_AB292691 Erysiphe_quercicola_AB292694 Erysiphe_sp_ex_Quercus_AB292713 Erysiphe_staphyleae_AB015922 Erysiphe_syringae_AB015920 Erysiphe_trifolii_AB015913 Erysiphe_vanbruntiana_AB015925 Erysiphe_viburni_AF298541 Erysiphe_wallrothii_AB015930 Erysiphe_weigelae_AB015931 Erysiphe_weigelae_AB015932 Oidium_anacardii_AB237786 Oidium_bixae_AB237788 Oidium_citri_AB237791 Oidium_heveae_AB193587 Oidium_mangiferae_AB237795 Oidium_mangiferae_AB237796 Oidium_mangiferae_AB237802 Oidium_sp_ex_Convolvulus_AF154328 Oidium_sp_ex_Glycine_AB078800 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4682] TITLE ITS; LINK TAXA = Taxa2; DIMENSIONS NCHAR=586; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Erysiphe_abbreviata_AB271785 CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGCT--GCTGT-GCGCAAGG--ACATGC---GGTGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-ATTTTTTGTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTGGT--GTCGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGTCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGTTCCAGTCA-CATGGAA-TCAAAGG Erysiphe_alphitoides_AB237783 CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_alphitoides_AB257431 CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_aquilegiae_AB000944 CAGAGCGTGAGGCTCAGT-CGT-GGCGTCA-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTAC-GTCGTC--GCTGC-CCGTACGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGTCCGCCAAA-GACCT-AACCAAAA----CTCATGTT-GTCTTT-GTCGTCT-CAG-GTTTATTA----TAGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCCCGTCGCGTT--GCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-AGTGGCTTGCCGTTCCAGTCA-CATGGA--TCACAGG Erysiphe_aquilegiae_AB015929 CAGAGCGTGAGGCTCAGT-CGT-GGCGTCA-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTAC-GTCGTC--GCTGC-CCGTACGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGTCCGCCAAA-GACCT-AACCAAAA----CTCATGTT-GTCTTT-GTCGTCT-CAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCCCGTCGCGTT--GCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-AGTGGCTTGCCGTTCCAGTCA-CATGGA--TCACAGG Erysiphe_aquilegiae_AF154322 CAGAGCGTGAGGCTCAGT-CGT-GGCGTCA-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTAC-GTCGTC--GCTGC-CCGTACGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGTCCGCCAAA-GACCT-AACCAAAA----CTCATGTT-GTCTTT-GTCGTCT-CAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCCCGTCGCGTT--GCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-AGTGGCTTGCCGTTCCAGTCA-CATGGA--TCACAGG Erysiphe_baeumleri_AB015919 CAGAGTGCGAGGCTCAGT-CGC-GGCGTCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGT-TCGCAAGG--ACCTGC---GTCGGCC-GCCC--ACCGGTC--TTGAACTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTCTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_baeumleri_AB015933 CAGAGTGCGAGGCTCAGT-CGC-GGCGTCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGT-TCGCAAGG--ACCTGC---GTCGGCC-GCCC--ACCGGTC--TTGAACTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTCTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_betae_AF011290 ---------AGGCTCAGT-CGT-GGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGCCGTCGTC--GCTGT-CCGCCTGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAAA---CTCATGTT-GTCTGT-GTCGTCT-TAG-CTTTATAAA--TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAAT-GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCCGGTCCAGTCA-CATGGA--TCACATG Erysiphe_blasti_AB015918 CAGAGCGTGAGGCTCAGT-CGT-GGCGTCT-GCTACGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTAC-GTGGAC--GCTGC-CCGTAAGG--ATATGC---GTCGGCT-GCCC--ACCGGTT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCC-AATCAAAAA---CTCATGTT-GTCTTT-GCAGTCT-CAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGCA--GCGGCGGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGGGTGACGAC-AGTGGCCTGCCGTTCCAGTCA-TATGGA--TCACAGG Erysiphe_castaneigena_AF298545 CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCATCGTC--GCTGC-CCGCAAGG--ACCAGC---GTCGGCC-GCCC--ACCGGTC--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGTTCCAGTCA-CATGGA--TCACAGG Erysiphe_convolvuli_AF011298 --GAGTGCGAGGCTC-GT-CGT-GGCATCA-GCTGCGTGACTGGGCCGACCCTCCCACCCGTGTCGATTTTGTATCTTGTTGCTTTGGCGAGCCGGGCCGTTGTCGTC--GCTGC-CCGCATGG--GCATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGTGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CAACCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGCGTTGGGGCTCGTCGCGCT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACACGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCGTTCCAGTCA-CATGGA--TCATAGG Erysiphe_convolvuli_AF154327 CAGAGTGCGAGGCTCCGT-CGT-GGCATCA-GCTGCGTA-CTGGGCCGACCCTCCCACCCGTGTCGATTTTGTATCTTGTTGCTTTGGCGAGCCGGGCCGTTGTCGTC--GCTGC-CCGCATGG--GCATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGTGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CAACCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGCGTTGGGGCTCGTCGCGCT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCGTTCCAGTCA-CATGGA--TCATAGG Erysiphe_corylopsidis_MUMH_4104 CAGAGCGTGAGGCTCAGT-CGT-GGCTTCT-ACCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTGC-GTCGTC--GCTGC-CTTCAAGG--ACAGGT---GACGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCC-AAACAAAA----CTCATGTT-GTCTTT-GCAGTCT-AAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CAACCCCC-TCCAGCTGCCTCTGT--GTGGTTGCGGTGTTGGGGCACGTCGCGAT--GCGGCGGCTCTTAAAGACAGTGGCGGTCCCGGCGTGAGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCGTTCCAGTCA-CATGGA--TCATAGG Erysiphe_corylopsidis_MUMH_4174 CAGAGCGTGAGGCTCAGT-CGT-GGCTTCT-ACCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTGC-GTCGTC--GCTGC-CTTCAAGG--ACAGGT---GACGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCC-AAACAAAA----CTCATGTT-GTCTTT-GCAGTCT-AAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CAACCCCC-TCCAGCTGCCTCTGT--GTGGTTGCGGTGTTGGGGCACGTCGCGAT--GCGGCGGCTCTTAAAGACAGTGGCGGTCCCGGCGTGAGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCGTTCCAGTCA-CATGGA--TCATAGG Erysiphe_corylopsidis_MUMH_4315 CAGAGCGTGAGGCTCAGT-CGT-GGCTTCT-ACCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTGC-GTCGTC--GCTGC-CTTCAAGG--ACAGGT---GACGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCC-AAACAAAA----CTCATGTT-GTCTTT-GCAGTCT-AAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CAACCCCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------- Erysiphe_corylopsidis_MUMH_4404 CAGAGCGTGAGGCTCAGT-CGT-GGCTTCT-ACCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTGC-GTCGTC--GCTGC-CTTCAAGG--ACAGGT---GACGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCC-AAACAAAA----CTCATGTT-GTCTTT-GCAGTCT-AAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CAACCCCC-TCCAGCTGCCTCTGT--GTGGTTGCGGTGTTGGGGCACGTCGCGAT--GCGGCGGCTCTTAAAGACAGTGGCGGTCCCGGCGTGAGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCGTTCCAGTCA-CATGGA--TCATAGG Erysiphe_cruciferarum_AF031283 CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGC-CCGCATGGG-ACATGC---GTCGGCC-GCCC--ACCGGTTTCACGA-CTGGAGCAGGTCCGCCAAA-GACCC-AACCAAAAA---CTCATGTT-GTCTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGGATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAAACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_epigena_AB292717 CAGAGTGTGAGGTTCAGT-CGT-GGCATCT-GCTGCGTA-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGCC--GCTGC-CCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGTT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GATGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_epigena_AB292720 CAGAGTGTGAGGCACAGT-CGT-GGCATCT-GCTGCGTA-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGC-CCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGTT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_euonymijaponici_AB250229 CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCCAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_friesii_AB000939 CCGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGT-CCGCATGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAAA---CTCATGTT-GTTTGT-GTCGTCT-TAG-TTTGATAA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAC--GCGGCGGCCCTTAAAGACAGTGCCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_glycines_AB015927 CAGAGCGTGAGGCTCAGT-CGCTGGCATCT-GCCACGTG-CTGGGCCGACCCTCCCACCCGTGTCGATTTTATAGATTGTTGCTTTGGCGGGCCGGGAC-C-GTCCAC--GTCGT-TCACAGTG--ACGCGT---GCGAGCT-GCCC--ACCGGCT--TTGG-CTGGAGCGTGTCCGCCAAA-GACCC-AACCCAAAACT-CTTATATTTGTCATG-GTAGTCT-AAG-TAAAAGTA----TATAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCGAGCTACCGTTGT--GTGGCTGTGGTGTTGGGGCTCGCCGCGTCTCGCGGTGGCTCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GATTCTCGCGACAGAGTGACGAC-GATGATCAGCCAAGTCCGGTCATACGGATTTTACAGG Erysiphe_glycines_AB015934 CAGAGCGTGAGGCTCAGT-CGC-GGCGTCT-GCCATGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTATTGATTGTTGCTTTGGCGGGCCGGGAC-C-GTCCAC--GTCGC-TCGCAGTG--ACGTGT---GCGAACT-GCCC--ACCGGCT--TTGG-CTGGAGCGTGCCCGCCAAA-GACCC-ATCCCCAAA---CTCATATT-GTCCT--GCAGTCT-AAG-TGATATTA----TATAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCGAGCTACAATTGT--GTGGCTGTGGTGTTGGGGCTCGCCGCGCCTCGCGGTGGCTCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTACTTTTGATTCTCGCGACAGAGTGACGAC-GAAGATCAGCCAAGTCCGGTAAATACGGATTTACAGG Erysiphe_hedwigii_AF298539 CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCCGCGCG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGCTGT-GTCGAC--GCTGC-CCGCAAGG--ACATGC---GACGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTCTTT-GCAGTCTTAAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCA-TCCAGCTACCTTTGC--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGACGGTCGGCCTGCCGTTCCAGTCA-CATGGA--TCATAGG Erysiphe_helwingiae_AB015916 CAGAGCGTGAGGCTCAGT-CGC-GGCATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGT-GTCGATGTGCTGG-CCGCGAGG--ACATGC---ATCGGCC-GCCC--ACCGGCC--TCGG-CTGGAGCGCGCCCGCCAGA-GATCT-AACCAAAA----CTCATGTT-GTCTTTTGCAGTCT-AAG-CTTAATTT---ATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CAACCCCCGTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAAACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGTTCCAGTCA-CATGGAA-TCACAGG Erysiphe_heraclei_AB000942 CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGCG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGCCGTCGTC--GCTGT-CCGCCTGG--ACACGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAAAA--CTCATGTT-GTCTGT-GTCGTCT-TAG-CTTTATAA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGGATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCCGGTCCAGTCA-CATGGA--TCACAGG Erysiphe_howeana_AF011301 -AGA-TGCGAGGCTCAGT-CGT-GGCATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGCCGCTGTC--GCTGT-CCGCATGG--ACATGC---GTTGGCC-GCCC--ACCGGTT--TTCAACTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGATAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_huayinensis_AB015914 CAGAGCGCGAGGCTCAGT-CGT-AGCATGT-GCTGCGCG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGCTGC-GTCGAC--CCTGC-CCGTACGG--ACAAGC---GTCGGCCCGCCC--ACTGTCTATTCGG-CTGGAGCGCGTTCGCCAAA-GACCC-AACCACAAA---CTCATGTT-GTCTTTTGTCGTCT-AAG-GTATATATCTAATTGAATTGACAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAAACA-CCCCCCTCGAGCTACCTTTGTTGGTGGCTGTGGTGTTGGGGCACGTCGCGGA--GCGGCGGCCCTTAAAGACAGTGGCGGTCTCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGCT-GGTGGCTTGCCGTTCCAGTCA-CATGGGA-TCACAGG Erysiphe_hypogena_AB292724 CAGAGTGTGAGGCCCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGC-CCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-ATTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCCCGTCGCGTT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_hypogena_AB292725 CAGAGTGTGAGGCCCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGC-CCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-ATTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCCCGTCGCGTT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_hypophylla_AB292715 CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCTCCGCAAGG--ATATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GTTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_japonica_AB000941 CAGAGCGTGAGGCTCAGT-CGT-GGCATTT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGCTGC-GCCGAC--GCTGT-CCGCAAGGAAAGATGC---GTCGGTC-GCCCCCGCCGGCT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCC-AACCAAAAAAAACTCATGTT-ATCATT-GCAGTCT-AAGTCTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAACA-CCCCC-TCCAGCTGCCTTTGC--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGACGGCCCTGAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGACGGTTGGCTTGCCGTTCCAGTCA-CATGGA--TCACAGG Erysiphe_japonica_AB015924 CAGAGCGTGAGGCTCAGT-CGT-GGCATTT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGCTGC-GCCGAC--GCTGT-CCGCAAGGAAAGATGC---GTCGGTC-GCCCCCGCCGGCT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCC-AACCAAAAAAAACTCATGTT-ATCATT-GCAGTCT-AAGTCTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAACA-CCCCC-TCCAGCTGCCTTTGC--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGACGGCCCTGAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGACGGTTGGCTTGCCGTTCCAGTCA-CATGGA--TCACAGG Erysiphe_juglandis_AB015928 CAGAGCGTGAGGTTCAGT-CGT-GGCATCT-GCCGTGTC-CTGAGCCGACCCTCCCACCCGTGTCGACTTTATATCATGTTGCTTTGGCGGGCCGGGTTAT-GTCCAG--GTCGC-CCGTAAGG--GTGCGT---ATGGGCA-GCCC--ACCGGCT--TCGG-CTGGAGCGTGTCCGCCAGA-GACCT-ATCCAAA-----CTCATGTT-GTCTTT-GCAGTCT-AAG-GTTTATTA----TGTAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAACA-CCCCC-TCGAGCCATC-TAGT--GTGGTTACGGTGTTGGGGCTCGTCGGGTTTC-CGGCGGCCCTTAAAGACAGTGGCGGTCCTGACGTGGGCTCTACGCGCAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCG-TCCAGTCT-TCTGGA--TCATAGG Erysiphe_katumotoi_AB015917 CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGTTGC-GTCGTC--GCTGC-CCGCAAGG--ACATGC---GTCGCCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCC-AACCAAAAA---CTCATGTT-GTCTTT-GCAGTCT-AAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGTGGTCCCGACGTGGACTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_lespedezae_AB015921 CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGCCGTC--GCTGT-CCGCACGG--ATATGC---ATCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CCCAAGTT-GTTAAT-GTCGTCT-TAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCGCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCCTGCCGTCCCAGTCA-CATGGGATTCATAGG Erysiphe_lespedezae_AB015923 CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGCCGTC--GCTGT-CCGCACGG--ATATGC---ATCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCAAGTT-GTTTTT-GTCGTCT-TAG-CATTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCGCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGTCCCAGTCA-CATGGGATTCATAGG Erysiphe_liriodendri_AF011302 CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TGTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGCC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT-TTCGG-CTGGAGCGTGCCCGCCAAA-GACCCCAATCAAAA----CTCATGTT-GTTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCCCTCCAGCTACCTTTGT--GTGGCTGCGGCGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCGTTCCAGTCA-CATGGA--TCACAGG Erysiphe_macleayae_AB016048 CAGAGCGTGAGGCTCAGT-CGT-GGCGTCA-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTAC-GTCGTC--GCTGC-CCGTACGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGTCCGCCAAA-GACCT-AACCAAAA----CGCATGTT-GTCTTT-GTCGTCT-CAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCCCGTCGCGTT--GCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-AGTGGCTTGCCGTTCCAGTCA-CATGGA--TCACAGG Erysiphe_magnifica_AF011312 ------------------------CCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTCGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGC-CCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAACGCGTCCGCCAAA-GACCT-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-AGCGGCTTGCCGTTCCAGTCA-CATGGA--TCACAGG Erysiphe_paeoniae_AB257436 CAGAGCGTGAGGTCCAGT-CGT-GGCGTCT-GCCGCGTG-CTGGGCCAACCCTCCCACCCGTGTCGA-TATGTATCTTGTTGCTTTGGCGGGCCGGGTCGT-GTCGTC--GCTGC-CCGCAAGG--ACATGC---GTCGCCT-GCCC--ACCGGTT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCT-AATCAAAA----CTCATGTT-GTCTAT-GTAGTCT-CAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCACGTCGCAGT--GCGGCGGCTCTTAAAAATAGTGGCGGTCTCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGTTCCAGTCA-CATGGA--TCACAGG Erysiphe_paeoniae_AB257437 CAGAGCGTGAGGTCCAGT-CGT-GGCGTCT-GCCGCGTG-CTGGGCCAACCCTCCCACCCGTGTCGA-TATGTATCTTGTTGCTTTGGCGGGCCGGGTCGT-GTCGTC--GCTGC-CCGCAAGG--ACATGC---GTCGCCT-GCCC--ACCGGTT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCT-AATCAAAA----CTCATGTT-GTCTAT-GTAGTCT-CAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCACGTCGCAGT--GCGGCGGCTCTTAAAAATAGTGGCGGTCTCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGTTCCAGTCA-CATGGA--TCACAGG Erysiphe_paeoniae_AB257438 CAGAGCGTGAGGTCCAGT-CGT-GGCGTCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TATGTATCTTGTTGCTTTGGCGGGCCGGGCTGT-GTCGTC--GCTGC-CCGCAAGG--ACATGC---GTCGTCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCT-AATCAAAA----CTCATGTT-GTCTAT-GTAGTCT-CAG-CTTTATTA----TTAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCACGTCGCAGT--GCGGCGGCTCTTAAAAATAGTGGCGGTCTCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGTTCCAGTCA-CATGGA--TCACAGG Erysiphe_pisi_AF011306 CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGCTGTC--GCTGT-CCGCATGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TTCAACTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAA--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_pisi_AF073348 CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGCTGTC--GCTGT-CCGCATGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TTCAACTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAA--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_polygoni_AF011307 CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTACCGTCGTC--GCTGT-CCGCAGGG--ACACGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTCTGT-GTCGTCT-TAG-CTTTATAA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAA--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGACGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAATGACGCCTGGTGGCTTGCCGGTCCAGTCA-CATGGA--TCACAGG Erysiphe_polygoni_AF011308 CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTACCGTCGTC--GCTGT-CCGCAGGG--ACACGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCGCGCCAAA-GACCC-AACCAAAA----CTCATGTA-GTCTGT-GTCGTCT-TAG-CTTTATAA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTACCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAC--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGACGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCCGGTCCAGTCA-CATGGA--TCACAGG Erysiphe_pseudolonicerae_AB015915 CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCATGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_pulchra__AB015935 CAGAGCGTGAGGTTCAGT-CGT-GGCATCTTGCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGC-TCCATC--GCTGC-CCGCAAGG--ACATGC---G{GT}TGAGC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAGA-GACCC-AACCAAAA----CTCATGTT-GTCTTT-GCAGTCT-AAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCTC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGTTCCAGTCA-CATGGA--TCATAGG Erysiphe_quercicola_AB292691 CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_quercicola_AB292694 CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_sp_ex_Quercus_AB292713 CAGAGTGTGAGGCTCAGT-CGT-GGCAACT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCTCCGCAAGG--ATATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTG------------------------------------------- Erysiphe_staphyleae_AB015922 CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GTCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGC-GTCGTC--GCGAT-CCGCAAGG--ACTGGC---GTCGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCT-AACCAAAA----CTCATGTT-GTCTAT-GCAGTCT-AAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTACCTTTGT--GTGGTTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGTTCCAGTCA-CATGGA--TCACAGG Erysiphe_syringae_AB015920 CAGAGTGCGAGGCTCAGT-CGT-AGCATCT-GCTGCGTG-CTGGGCCAACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGC-CCACACGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGTCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-TTTTTTCGTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGGATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGGGTGACGAC-GGCGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_trifolii_AB015913 CAGAGTGCGAGGCTCAGT-CGC-GGCGTCG-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGT-TCGCAAGG--ACGTGC---GTCGGCC-GCCC--ACCGGTT--TAGAACTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_vanbruntiana_AB015925 CAGAGCGTGAGGCTCAGC-CAC-GACATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTGC-GTCGAT--GCTGG-CCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAGA-GACCG-AACCAAAA----CTCATGTT-ATCTTG-GCAGTCT-AAG-CTTTATTT---ATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CACCCCCCCTCCAGCTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGGGTGACGAC-GGCGGCTTGCCGTTCCAGTCA-TATGGAT-CCACAGG Erysiphe_viburni_AF298541 CAGAGCGTGAGGCTCAGT-TGT-GGCATCT-GCCGCGCG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGCTGT-GTCGAC--GCTGC-CCGCAAGG--ACATGC---GACGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTCTTT-GCAGTCTTAAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCA-TCCAGCTACCTTTGC--GTGGCTGCGGT?TTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTCGGCCTGCGTTCCAGTCA-CATGGA--TCATAGG Erysiphe_wallrothii_AB015930 CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Erysiphe_weigelae_AB015931 CAGAGTGTGAGGCTCAGGGCGT-AGCATCT-GCTGCGTG-CTGGGCCAATCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTAC-GCCGTC--GCTGG-CCGCAAGG--ACATGCGTAGGCTGCC-GCCC--ACTGGCT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCT-AACCAAAA----CTCATGTT-GTCTTT-GTAGTCT-CAG-TTATATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGGATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTACCTTTGA--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCTCTAAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGCAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGTTCCAGTCA-CATGGA--TCACAGG Erysiphe_weigelae_AB015932 CAGAGCGTGAGGCTCAGGGCGT-AGCATCT-GCTGCGTG-CTGGGCCAATCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTAC-GCCGTC--GCTGG-CCGCAAGG--ACATGCGTAGGCTGCC-GCCC--ACTGGCT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCT-AACCAAAA----CTCATGTT-GTCTTT-GTAGTCT-CAG-TTATATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTAC-TTTGA--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCTCTAAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGCAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGTTCCAGTCA-CATGGA--TCACAGG Oidium_anacardii_AB237786 CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Oidium_bixae_AB237788 CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAAAGACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCACGACAGAGTGACGAC-GGCGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Oidium_citri_AB237791 CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTGTTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Oidium_heveae_AB193587 CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCGCTCCAGTCAACATGGA--TCACAGG Oidium_mangiferae_AB237795 CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Oidium_mangiferae_AB237796 CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGA---------------------------------------------- Oidium_mangiferae_AB237802 CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG Oidium_sp_ex_Convolvulus_AF154328 CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGCCGTCGTC--GCTGT-CCGCCTGG--ACACGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAAAA--CTCATGTT-GTCTGT-GTCGTCT-TAG-CTTTATAA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAGTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCCGGTCCAGTCA-CATGGA--TCACAGG Oidium_sp_ex_Glycine_AB078800 CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGCTGTT--GCAGT-CCGCATGG--ACATGC---GTCGGCC-GCCCC-CCCGGTG--TTCCACTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTGT-ATCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCATTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTTCCGACGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCGCTCCAGTCA-CATGGA--TCACAGG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS) = N: 1-586; CODONPOSSET CodonPositions (CHARACTERS = ITS) = N: 1-586; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4383] TITLE 28S_rDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=825; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arthrocladiella_mougeotii_ex_Lycium_AB022379 AAGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGCGGCCGCGGCC-TACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGACCCTAGGAACGTAGCTCCCTTC----GGGGCGTG--TTATAGCCTAGGGTGCAATGCAGCCTACCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTACGTGAGAACCCGTAA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTACCAGCAT----------- Arthrocladiella_mougeotii_ex_Lycium_AB329690 AAGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGCGGCCGCGGCC-TACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGACCCTAGGAACGTAGCTCCCTTC----GGGGCGTG--TTATAGCCTAGGGTGCAATGCAGCCTACCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Blumeria_graminis_ex_Bromus_AB022362 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGATCCATTA--GGAGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGCG-ACGAGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGCGGCCGGGTGCTCGATGCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACCTGTGGAATGTAGCTCCTTTC----GGGGAGTG--TTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCATA------AGGGGGCATCATCGACCGATCCGGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Blumeria_graminis_ex_Hordeum_AB022399 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACC-CAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCCGGTTA-C-GGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGTA-GTGAGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGCGGCCGAGTACTCAGTGCC--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACTTGTGGAATGTAGCTCCTTTC----GGGGAGTG--TTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACC----------------------------------------------------------------------------------------------------------------------------------------------------------- Blumeria_graminis_ex_Triticum_AB022376 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCCGTTTA-C-GGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGTG-GCGAGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGCGGCCGGGTGCTCGATGCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACTTGTGGAATGTAGCTCCTTTC----GGGGAGTG--TTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCATA------AGGGGGCATCATCGACCGATCCGGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Brasiliomyces_trina_ex_Quercus_AB022350 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTGACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGAATCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGTT-TGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGG-CC--AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCTACCAGACTTGGGCGCTGCCGATCATCCCGAG-TTCTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCCTTC--GGGGCAGTG--TTATAGCCTCTGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGTTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTTACATCAATGCGAGTGTTTGGGCGTGAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTGTAAAGGGGGTGCATCATCGACCGATCCTGATGT?TTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Byssoascus_striatisporus_U17912 ----------------------------------------------------------AAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCT---TTGGGGTCCGAGTTGTAATTTGGAGAAGATGCTTCGGGT-ACGGTCCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGGTGGC-CGTGCCC--GTGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCCATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCGGTCGATCATCCTGGG-TTCGCCCGGGTGCACTCGGCCGCGCTCAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTCGGGAACGTGGCTCCCCTC----GGGGAGTG--TTATAGCCCGAGGTGCAATGCAGCCTACCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Caespitotheca_forestalis_ex_Schinopsis_AB193467 TTGACCTCGGATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCTGTC--GTCAGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGC-GCGGGCCCGGCCTAAGTTCCTTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCTGGTGCTCGT-GCCC--GGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTACCGATCACCCAGAGTTCTGCTCTGGTGCACTCGGTAGCGTACAGGCCAGCATCGGTTCGGGCGGTCGGACAAGGGCCGTAGGAATGTATCTCTCCCTCA--CGGAAGAGTATTATAGCCTACGGCGCCATACGGCCTGCCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTGAAACCCATACGCGAAATGAAAGTGAACGTAGGTGAGAACCCCGTCAAAC--GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAGGAGCATAGCTGTTGGGA Cystotheca_lanestris_ex_Quercus_AB022353 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGAGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGT-ATGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTGCC-CTTGTCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCTGGGG-TTCTCCCCGGGGTACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCGAGAGGAATGTAGCTGTCTCTC--GGGGCAGTG--TTATAGCCTCTCGCGTCATGCAGCCTACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAACCCGTT------AGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Cystotheca_wrightii_ex_Quercus_AB022355 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---CGGGGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGC-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTGCC-CTTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGTCGGGG-TTCTCCCCGGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGTGAGGGGAATGTAGCTGTCTCTC--GGGGCAGTG--TTATAGCCCCTCGCGTCATGCAGCCTACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTT------AGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_abbreviata_ex_Quercus_AB271785 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGCTGCCGATCACCCGGAG-TTCTCTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGCAGGTG------------------------------------------------------------------------------------- Erysiphe_adunca_ex_Salix_AB022374 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGCAGCTTTGGGTTGTGGGACCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-TGCACCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACACCACTGATCCGCGAGGG-TTCTCTCTCGGGCACTCGGTGGGGTACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCCGAAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTTCGGTGCAATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTAAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTC-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_alphitoides_ex_Quercus_AB237811 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACG------------------------------------------------------------------------------------------- Erysiphe_alphitoides_ex_Quercus_AB257431 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT------------------------------------------------------------------------------------------------------------------------ Erysiphe_aquilegiae_ex_Cimicifuga_AB022405 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCATGGCC-CGCGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAG-TTCTCTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTC----GGGGAGTG--TTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_arcuata_ex_Carpinus_AB252459 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-TGCGCCT--GTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGCTGATCATCCAGAG-TTCTCTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCATTT----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_arcuata_ex_Carpinus_AB252460 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-TGCGCCT--GTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGCTGATCATCCAGAG-TTCTCTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCATTT----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGG-- Erysiphe_arcuata_ex_Carpinus_AB252473 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-TGCGCCT--GTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGCTGATCATCCAGAG-TTCTCTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACG{CT}AGGTG------------------------------------------------------------------------------------- Erysiphe_australiana_ex_Lagerstroemia_AB022407 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTGGTAACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGGCT-TGCGCCT--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACTAGACTTGGGCATCGCTGATCATCCGGGG-GTATCTCCGGTGCACTCGACGATGCACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCTGTGGGAACGTGGCTCCTTTC----GAGGAGTG--TTATAGCCCACGGTGCAATGCAGCCCATCCGGACCGAGGACCGCGCCCTTCGGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTT-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_corylopsidis_ex_corylopsis_MUMH_4104 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAG--------------------------------------------------------------AAATCTGGCTCCGT--CTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCAGCC-TGCGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCGTGAG-TTCTCTCTCGTGCACTCGTCAGCGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC----GGAGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCTTCATT--GGA-GGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_corylopsidis_ex_corylopsis_MUMH_4174 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT--CTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCAGCC-TGCGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCGTGAG-TTCTCTCTCGTGCACTCGTCAGCGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC----GGAGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCTTCATT--GGA-GGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_corylopsidis_ex_corylopsis_MUMH_4315 --------------------------------------------------------------------------------------ACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT--CTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCAGCC-TGCGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCGTGAG-TTCTCTCTCGTGCACTCGTCAGCGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC----GGAGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCTTCATT--GGA-GGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_corylopsidis_ex_corylopsis_MUMH_4404 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG--------------------------------------------------------------AATCTGGCTCCGT--CTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCAGCC-TGCGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCGTGAG-TTCTCTCTCGTGCACTCGTCAGCGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC----GGAGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCTTCATT--GGA-GGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_epigena_ex_Quercus_AB292720 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAG-TTCTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_epigena_ex_Quercus_AB292722 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAG-TTCTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_friesii_ex_Rhamnus_AB022382 TTGACCTCGAATCAGGTAGGAATACCCGCTGAAC------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-TACGCCC--GGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCC--AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAGTTCTTCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_glycines_ex_Desmodium_AB022397 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGATTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGTT-TGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTTGATCATCTAGAG-TTTTCTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTT----GGGGAGTG--TTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAA-CCCATACGCGGAATGAAAGTGAACGCAGGTGAGAACCCCTTT-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_gracilis_ex_Quercus_AB022357 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-TGCGCTC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGCTGATCATCCAGAGGTTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTC--GGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATC-ACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_heraclei_ex_Daucus_AB022391 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---TGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTTT---GGGGGCGCATCATCGACCGATCCTGA-------------------------------------------- Erysiphe_hypophylla_ex_Quercus_AB292715 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTGGGAACGTGGCTCCCCTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGT------------------------------------------------------------------------------------------ Erysiphe_hypophylla_ex_Quercus_AB292716 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTGGGAACGTGGCTCCCCTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT------------------------------------------------------------------------------------------------------------------------ Erysiphe_mori_ex_Morus_AB022418 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-TGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGACCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCTGATCATCCAGAG-TTCTCTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGATGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTCTC--GGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGCAGGTG------------------------------------------------------------------------------------- Erysiphe_paeoniae_ex_Paeonia_AB257438 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-TGCGCCT--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCAACCAGACTTGGGCACTGCCGATCACCCTGAG-TTCTCTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTA----------------------------------------------------------------------------------------------------------------------- Erysiphe_pisi_AB102942 ------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCATGGCC-CGCGCCT--CTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAG-TTCTCTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGGCCGGAGGAATGTAGCTCCCCTC----GGGGAGTG--TTATAGCCTACGGCGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCGTTC--GGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTT----------------------- Erysiphe_pulchra_ex_Swida_AB022389 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACCCAGAG-TTTTCTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAATGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_quercicola_ex_Quercus_AB197135 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCC----------------------------------------------- Erysiphe_quercicola_ex_Quercus_AB292691 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_quercicola_ex_Quercus_AB292694 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_simulans_ex_Rosa_AB022395 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCA-CCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGCTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCTGAGGCC-CGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACGCTGCCGATCATTCCGAG-TTCTCTCTGATGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGCAGAAAGACCGGAGGAACGTAGCTCCCCCCTCGGGAGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAC-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTC------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_adenophorae_ex_Adenophora_AB077632 TTGACCTCGAATCAGGTAGGGATACCCG------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGAGGTCGGCGCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCC-GACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGGGCGTCATGCAGCCCATCCGGACCGAGGACCGCGCC-TTT-GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------TGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_cichoracearum_ex_Aster_AB077641 TTGACCTCGAATCAGGTAGGGATACCCGCTGAA-------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCC-TACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTCGATCATCCGGGG-TTCTCCTCGGTGCACTCGACGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCCCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGAGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCC-TTT--GGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_cichoracearum_ex_Dahlia_AB077628 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCC-TACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTCGATCATCCGGGG-TTCTCCTCGGTGCACTCGACGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCCCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGAGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCC-TTT--GGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_cichoracearum_ex_Eupatorium_AB022387 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCA-CCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCC-TACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTCGATCATCCGGGG-TTCTCCTCGGTGCACTCGACGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCCCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGAGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCC-TTT--GGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTACGAGCATAGCTGTTGGGA Golovinomyces_cichoracearum_ex_Solidago_AB077650 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCC-TACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGG-TTCTCCTCGGTGCACTCGACGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCGAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTCGGGCGCAATGCAACCCATCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGACGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_orontii_ex_Nicotiana_AB022412 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTGAGCTCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGCCCGTGGCC-TATGCCC--GTGTAAGGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGGGCGTAATGCAGCCTATCTGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTA------TGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTACGAGCATACCTGTTGGGA Golovinomyces_orontii_ex_Physalis_AB077646 ----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATTTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGCGGCC-TACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCGATGCACAGGCCAGCATCGGTTTGGATGGCTGGAGAAAGGCGCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGGGCGTAATGCAGCCCATCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTT------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_orontii_ex_Rubia_AB077634 TTGACCTCGAATCAGGTAGGGATACCCG------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGCTCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCC-TACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGGGCGTAATGCAGCCCATCTGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------TGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_orontii_ex_Veronica_AB077651 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGGAGGCTCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCC-TCCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGGGCGTAATGCAGCCCATCGGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCATC------TGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_sordidus_ex_Plantago_AB077657 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGGAGGCTCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGTC-TCCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCGCTTC----GGGGAGTG--TTATAGCCTAGGGCGGAATGCAGCCCATCTGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------TGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGG- Leveillula_saxaouli_ex_Haloxylon_AB080469 TTGACCTCGAATC-----------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGCG-CCTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-TTTTCTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC----GGGGAGTG--TTATAGCCTGCGACGCAATACCGCCTACTCCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCAAAA-CCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGGGCATCAT--------------------------------------------------------- Leveillula_sp_ex_Chondrilla_AB080478 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGCG-CCTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-TTTTCTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGACGTGGGAACGTAGCTCCTTTC----GGGGAGTG--TTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCAAAA-CCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGGGCATCATCGACCGATCCTGATGTCTT-------------------------------------- Leveillula_taurica_ex_Artemisia_AB080470 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGCGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGCG-CCTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-TTTCCTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC----GGGGAGTG--TTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCAAAA-CCCATACGCGCAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGGGCATCATCGACCGATCCTGAT------------------------------------------- Neoerysiphe_cumminsiana_ex_Cacalia_AB329669 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGTTCGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGACC-TGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCATGGATCATCCGAGG-TTCTCCTCGGTGCACTCGATGACGCGCAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGA----GGGGAGTG--TTATAGTCTAGGGCGCAATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGACCGATCCTGAAGTCTTCGGA--GA----TTTGAGT------------------- Neoerysiphe_galeopsidis_ex_Acanthus_AB329670 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTCGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCGGCCGTGACC-TGTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGACGACGCACAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGTAATGCAGCCCATCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Neoerysiphe_galeopsidis_ex_Chelonopsis_AB022369 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTCGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCGGCCGTGACC-TGTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGACGACGCACAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCTTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGTAATGCAGCCCATCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Neoerysiphe_galeopsidis_ex_Lamium_AB329674 TTGACCTCGAATCAGGTAGG--------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTCGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCGGCCGTGACC-TGTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGACGACGCACAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGTAATGCAGCCCATCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGA----TTTGAGTA------------------ Neoerysiphe_galii_ex_Galium_AB329681 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTTGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGACC-TGTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTCGGATGGCTGGAAAAAGGTCCTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGCAATGCAGCCCAACTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGACCGATCCTGAA------------------------------------------- Neoerysiphe_galii_ex_Galium_AB329682 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTTGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGACC-TGTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTCGGATGGCTGGAAAAAGGTCCTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGCAATGCAGCCCAACTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACG------------------------------------------------------------------------------------------- Oidium_aloysiae_ex_Aloysia_AB329683 -------------------------------------------------------------------------------------AACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGTTCGGTCTAAGTTCCCTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGACC-TGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCATGGATCACCCGAGG-TTCTCCTCGGTGCACTCGATGACGCGCAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGTAATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Oidium_baccharidis_ex_Baccharis_AB329684 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG-------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGTTCGGTCTAAGTTCCTTGGGACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGATC-TATGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCATGGATCATCCGAGG-TTTTCCTCGGTGCACTCGATGATGCGCAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGCAATGCAGCCCATCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Oidium_maquii_ex_Aristotelia_AB329686 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGA----------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGTTCGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGACC-TGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCATGGATCACCCGAGG-TTCTCCTCGGTGCACTCGATGACGCGCAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGCAATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCACCCGTATGGGGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Oidium_phyllanthi_ex_Phyllanthus_AB120754 ----------------------------------------------------------------------------------------------------------AGCTCAAATTTGAAATCTGGCTCCTT---TGGAGCCCGAGTTGTAATTTGTAGAAGACGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGTCGAGACCCTACGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTTGTTGATCATCCGAGGTTCTGCCTCGGTGCACTCGACAATGTGCAGGCCAGCATCGGTTTGACTGGCTGGACAAAGGTCCTAGGAACGTAACTCCTCGC----GGGGAGTG--TTATAGCCTAGGGCGTCATGCAGCCCAGTCGGACCGAGGACCGCGCCTTTT-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTTA-----GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Oidium_phyllanthi_ex_Phyllanthus_AB120755 ----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCTT---TGGAGCCCGAGTTGTAATTTGTAGAAGACGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGTCGAGACCCTACGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTTGTTGATCATCCGAGGTTCTGCCTCGGTGCACTCGACAATGTGCAGGCCAGCATCGGTTTGACTGGCTGGACAAAGGTCCTAGGAACGTAACTCCTCGC----GGGGAGTG--TTATAGCCTAGGGCGTCATGCAGCCCAGTCGGACCGAGGACCGCGCCTTTT-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTTA-----GGGTGCATCATCGACCGATCCTGATGTCTTCGGAT--------------------------------- Oidium_phyllanthi_ex_Phyllanthus_AB120758 ----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTTCCT---CGGAGCCCGAGTTGTAATTTGTAGAAGACGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGCGGCCGAGACCCTACACCTATATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCATCGTTGATCATCCGAGGCTTTGCCTCGGTGCACTCAACAATGCACAGGCCAGCATCGGTTTGACTGGCTGGAAAAAGGCCCTAGGAATGTAGCTCCTTTC----GGGGAGTG--TTATAGCCTAGGGCGTCATGCAGCCCAGTTAGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTTA-----GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAGGAGCATAGCTGTTGGGA Parauncinula_septata__ex_Quercus_AB183533 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTACAAGCTCAAATTTGAAATCTGGCGCCCT---CGGCGTCCGAGTTGTAATTTGTAGACGATGCTTTGGGC-TGGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCC--GTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGGGGCCGTGGATCATCCGGGCTTCGGGCCCGGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTAGAGCGCCATGCAGCCTACCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGTTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGAA------GGGTGCATCATCGACCGATTCTGATGTCT--------------------------------------- Parauncinula_septata_ex_Quercus_AB022420 TTGACCTCGGATCA--------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTACTAGCTCAAATTTGAAATCTGGCGCCCT---CGGCGTCCGAATTGTAATTTGTAGACGATGCTTTGGGT-AGGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCC--GTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGGGGCCGTGGATCATCCAGGCTTCGGGCC-TGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTCGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTAGGGCGCCATGCAGCCTACCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGAA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----T------------------------- Phyllactinia_fraxini_ex_Fraxinus_AB080451 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTG-GGTGCTC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-TTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTC----GGGGAGTG--TTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGGGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAACATAGCTGTTGGGA Phyllactinia_fraxini_ex_Syringa_AB080436 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTG-GGTGCTC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-TTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTC----GGGGAGTG--TTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGGGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTATGAGCATAGCTGTTGGGA Phyllactinia_guttata_ex_Alnus_AB080452 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA??????????????????????TAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTGTC-GGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGACTCTCTTTGGTGCACTCAACGACGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC----GGAGAGTG--TTATAACCGGCGACGCAATACCGCCTACTCCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTATGAGCATAGCTGTTGGGA Phyllactinia_guttata_ex_Diospyros_AB022372 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTC-GACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCATCGCTGATCATCCAAAG-TTCTCTTTGGTGCACTCGACGATGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC----GGAGAGTG--TTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCGTT-----AAGGGGGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGG- Phyllactinia_guttata_ex_Euptelea_AB080388 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTGTC-GGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGACTCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC----GGAGAGTG--TTATAGCCGGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTATGAGCATAGCTGTTGGGA Phyllactinia_guttata_ex_Hamamelis_AB080410 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTC-GACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-TTCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC----GGAGAGTG--TTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTT-----AAGGGGGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Phyllactinia_guttata_ex_Morus_AB080372 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCAGTGTC-GGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG---CTCTTTGGTGCACTTGACGACGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC----GGAGAGTG--TTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAA-CCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGGGCATCATCGACCGATCCTG--------------------------------------------- Pleochaeta_shiraiana_ex_Celtis_AB022403 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTCAC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTAGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGGTGCC-TGTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTTGGTGATCATCCGGAG-TTTTCTCTGGTGCACTCGGCAATGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTAGGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCCTGGGCGCAATGCAGCCTACCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------AGGGTGCATCATCGACCGATC------------------------------------------------ Podosphaera_filipendulae_ex_Filipendula_AB022384 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCC-CGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGG-TTCTCCCTGGGGTACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCTTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCA------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_longiseta_ex_Prunus_AB022423 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCC-CGTGCCC--GTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGG-TTCTCCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTG------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_pannosa_ex_Rosa_AB022347 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCC-CGCGCCC--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGG-TTCTCCCTGGGGTACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCTTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCA------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_tridactyla_ex_Prunus_AB022393 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCC-CGTGCCC--GTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGGAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGG-TTCTCCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTG------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_xanthii_ex_Melothria_AB022410 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT----CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCC-CGTGCCC--GTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGG-TTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTCTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCA------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Sawadaea_polyfida_ex_Acer_AB022364 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTGCC-CTCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCCACCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTC------AGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Sawadaea_tulasnei_ex_Acer_AB022366 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACC---------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCT----CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTGCC-CTCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTC------AGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Typhulochaeta_japonica_ex_Quercus_AB022415 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA--------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCT-TGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCATCCAGAG-TTCTCTCTGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCAGAGGAACGTAGCTACCTTTC--GGGGGAGTGTTTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 28S_rDNA) = N: 1-825; CODONPOSSET CodonPositions (CHARACTERS = 28S_rDNA) = N: 1-825; END; BEGIN TREES; TITLE Tb10530; LINK TAXA = Taxa1; TRANSLATE 1 Erysiphe_paeoniae_ex_Paeonia_AB257438, 2 Erysiphe_abbreviata_ex_Quercus_AB271785, 3 Erysiphe_epigena_ex_Quercus_AB292722, 4 Erysiphe_epigena_ex_Quercus_AB292720, 5 Erysiphe_hypophylla_ex_Quercus_AB292716, 6 Erysiphe_hypophylla_ex_Quercus_AB292715, 7 Erysiphe_quercicola_ex_Quercus_AB292694, 8 Erysiphe_quercicola_ex_Quercus_AB292691, 9 Erysiphe_quercicola_ex_Quercus_AB197135, 10 Erysiphe_alphitoides_ex_Quercus_AB257431, 11 Erysiphe_alphitoides_ex_Quercus_AB237811, 12 Oidium_phyllanthi_ex_Phyllanthus_AB120754, 13 Oidium_phyllanthi_ex_Phyllanthus_AB120755, 14 Oidium_phyllanthi_ex_Phyllanthus_AB120758, 15 Arthrocladiella_mougeotii_ex_Lycium_AB022379, 16 Arthrocladiella_mougeotii_ex_Lycium_AB329690, 17 Neoerysiphe_cumminsiana_ex_Cacalia_AB329669, 18 Neoerysiphe_galii_ex_Galium_AB329682, 19 Neoerysiphe_galii_ex_Galium_AB329681, 20 Neoerysiphe_galeopsidis_ex_Acanthus_AB329670, 21 Neoerysiphe_galeopsidis_ex_Chelonopsis_AB022369, 22 Neoerysiphe_galeopsidis_ex_Lamium_AB329674, 23 Oidium_aloysiae_ex_Aloysia_AB329683, 24 Oidium_maquii_ex_Aristotelia_AB329686, 25 Oidium_baccharidis_ex_Baccharis_AB329684, 26 Golovinomyces_orontii_ex_Nicotiana_AB022412, 27 Golovinomyces_cichoracearum_ex_Eupatorium_AB022387, 28 Golovinomyces_cichoracearum_ex_Solidago_AB077650, 29 Golovinomyces_cichoracearum_ex_Aster_AB077641, 30 Golovinomyces_cichoracearum_ex_Dahlia_AB077628, 31 Golovinomyces_orontii_ex_Physalis_AB077646, 32 Golovinomyces_adenophorae_ex_Adenophora_AB077632, 33 Golovinomyces_orontii_ex_Rubia_AB077634, 34 Golovinomyces_sordidus_ex_Plantago_AB077657, 35 Golovinomyces_orontii_ex_Veronica_AB077651, 36 Pleochaeta_shiraiana_ex_Celtis_AB022403, 37 Leveillula_saxaouli_ex_Haloxylon_AB080469, 38 Leveillula_sp_ex_Chondrilla_AB080478, 39 Leveillula_taurica_ex_Artemisia_AB080470, 40 Phyllactinia_fraxini_ex_Syringa_AB080436, 41 Phyllactinia_fraxini_ex_Fraxinus_AB080451, 42 Phyllactinia_guttata_ex_Morus_AB080372, 43 Phyllactinia_guttata_ex_Euptelea_AB080388, 44 Phyllactinia_guttata_ex_Alnus_AB080452, 45 Phyllactinia_guttata_ex_Hamamelis_AB080410, 46 Phyllactinia_guttata_ex_Diospyros_AB022372, 47 Byssoascus_striatisporus_U17912, 48 Caespitotheca_forestalis_ex_Schinopsis_AB193467, 49 Parauncinula_septata__ex_Quercus_AB183533, 50 Parauncinula_septata_ex_Quercus_AB022420, 51 Blumeria_graminis_ex_Bromus_AB022362, 52 Blumeria_graminis_ex_Triticum_AB022376, 53 Blumeria_graminis_ex_Hordeum_AB022399, 54 Cystotheca_lanestris_ex_Quercus_AB022353, 55 Cystotheca_wrightii_ex_Quercus_AB022355, 56 Podosphaera_filipendulae_ex_Filipendula_AB022384, 57 Podosphaera_pannosa_ex_Rosa_AB022347, 58 Podosphaera_tridactyla_ex_Prunus_AB022393, 59 Podosphaera_longiseta_ex_Prunus_AB022423, 60 Podosphaera_xanthii_ex_Melothria_AB022410, 61 Sawadaea_tulasnei_ex_Acer_AB022366, 62 Sawadaea_polyfida_ex_Acer_AB022364, 63 Erysiphe_australiana_ex_Lagerstroemia_AB022407, 64 Erysiphe_adunca_ex_Salix_AB022374, 65 Typhulochaeta_japonica_ex_Quercus_AB022415, 66 Erysiphe_simulans_ex_Rosa_AB022395, 67 Erysiphe_mori_ex_Morus_AB022418, 68 Brasiliomyces_trina_ex_Quercus_AB022350, 69 Erysiphe_gracilis_ex_Quercus_AB022357, 70 Erysiphe_friesii_ex_Rhamnus_AB022382, 71 Erysiphe_pulchra_ex_Swida_AB022389, 72 Erysiphe_corylopsidis_ex_corylopsis_MUMH_4104, 73 Erysiphe_corylopsidis_ex_corylopsis_MUMH_4174, 74 Erysiphe_corylopsidis_ex_corylopsis_MUMH_4315, 75 Erysiphe_corylopsidis_ex_corylopsis_MUMH_4404, 76 Erysiphe_glycines_ex_Desmodium_AB022397, 77 Erysiphe_arcuata_ex_Carpinus_AB252459, 78 Erysiphe_arcuata_ex_Carpinus_AB252473, 79 Erysiphe_arcuata_ex_Carpinus_AB252460, 80 Erysiphe_heraclei_ex_Daucus_AB022391, 81 Erysiphe_pisi_AB102942, 82 Erysiphe_aquilegiae_ex_Cimicifuga_AB022405; TREE Fig._1 = [&R] ((((((((((((1,((((2,((5,6),(((7,8,9),(70,80)),(10,11)))),(3,4)),((72,73,74,75),(81,82))),71)),(77,78,79)),(((65,67),((66,68),69)),76)),64),63)Erysiphe,((((12,13),14)Oidium_phyllanthi,(((17,(23,24)),25),((18,19),(20,21,22)))Neoerysiphe),((15,16)Arthrocladiella,((((26,33,(34,35)),32),31),((27,29,30),28))Golovinomyces))),((37,(38,39))Leveillula,((40,41),((42,(43,44)),(45,46)))Phyllactinia)),36),48),((51,(52,53))Blumeria,(((54,55)Cystotheca,(61,62)Sawadaea),((56,57),((58,59),60))Podosphaera))),(49,50)Parauncinula),47); END; BEGIN TREES; TITLE Tb10531; LINK TAXA = Taxa2; TRANSLATE 1 Erysiphe_glycines_AB015934, 2 Erysiphe_glycines_AB015927, 3 Erysiphe_paeoniae_AB257437, 4 Erysiphe_paeoniae_AB257436, 5 Erysiphe_paeoniae_AB257438, 6 Erysiphe_juglandis_AB015928, 7 Erysiphe_corylopsidis_MUMH_4104, 8 Erysiphe_corylopsidis_MUMH_4404, 9 Erysiphe_corylopsidis_MUMH_4174, 10 Erysiphe_corylopsidis_MUMH_4315, 11 Erysiphe_macleayae_AB016048, 12 Erysiphe_aquilegiae_AB000944, 13 Erysiphe_aquilegiae_AF154322, 14 Erysiphe_aquilegiae_AB015929, 15 Erysiphe_huayinensis_AB015914, 16 Erysiphe_hypophylla_AB292715, 17 Erysiphe_hypogena_AB292724, 18 Erysiphe_hypogena_AB292725, 19 Erysiphe_epigena_AB292720, 20 Erysiphe_epigena_AB292717, 21 Erysiphe_alphitoides_AB237783, 22 Erysiphe_alphitoides_AB257431, 23 Erysiphe_quercicola_AB292694, 24 Erysiphe_quercicola_AB292691, 25 Oidium_citri_AB237791, 26 Oidium_bixae_AB237788, 27 Oidium_mangiferae_AB237795, 28 Oidium_mangiferae_AB237802, 29 Oidium_mangiferae_AB237796, 30 Oidium_anacardii_AB237786, 31 Oidium_heveae_AB193587, 32 Erysiphe_hedwigii_AF298539, 33 Erysiphe_viburni_AF298541, 34 Erysiphe_pulchra__AB015935, 35 Erysiphe_staphyleae_AB015922, 36 Erysiphe_katumotoi_AB015917, 37 Erysiphe_vanbruntiana_AB015925, 38 Erysiphe_helwingiae_AB015916, 39 Erysiphe_japonica_AB015924, 40 Erysiphe_japonica_AB000941, 41 Erysiphe_blasti_AB015918, 42 Erysiphe_weigelae_AB015932, 43 Erysiphe_weigelae_AB015931, 44 Erysiphe_magnifica_AF011312, 45 Erysiphe_liriodendri_AF011302, 46 Erysiphe_syringae_AB015920, 47 Erysiphe_lespedezae_AB015923, 48 Erysiphe_lespedezae_AB015921, 49 Erysiphe_convolvuli_AF154327, 50 Erysiphe_convolvuli_AF011298, 51 Erysiphe_cruciferarum_AF031283, 52 Erysiphe_trifolii_AB015913, 53 Erysiphe_baeumleri_AB015919, 54 Erysiphe_baeumleri_AB015933, 55 Oidium_sp_ex_Glycine_AB078800, 56 Erysiphe_howeana_AF011301, 57 Erysiphe_pisi_AF073348, 58 Erysiphe_pisi_AF011306, 59 Erysiphe_friesii_AB000939, 60 Erysiphe_polygoni_AF011307, 61 Erysiphe_polygoni_AF011308, 62 Erysiphe_betae_AF011290, 63 Erysiphe_heraclei_AB000942, 64 Oidium_sp_ex_Convolvulus_AF154328, 65 Erysiphe_castaneigena_AF298545, 66 Erysiphe_wallrothii_AB015930, 67 Erysiphe_pseudolonicerae_AB015915, 68 Erysiphe_euonymijaponici_AB250229, 69 Erysiphe_abbreviata_AB271785, 70 Erysiphe_sp_ex_Quercus_AB292713; TREE Fig._2 = [&R] (1,(2,((((((((((3,4),5),(((41,(11,12,13,14)),(42,43)),(44,(((45,69),((46,(((((47,48),(59,((60,61),(62,(63,64))))),((52,(53,54)),(55,(56,(57,58))))),51),(49,50))),((66,67,68,21,22,((23,24,25,26,29,30,31),28),27),(70,16),((17,18),(19,20))))),65)))),35),(((7,8,9),10),36)),34),(39,40)),((32,33),15)),(37,38)),6))); END;