#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 13:26 GMT TreeBASE (cc) 1994-2008 Study reference: Ito M., & Takamatsu S. 2009. Molecular phylogeny and evolution of subsection Magnicellulatae (Erysiphaceae: Podosphaera) with special reference to host plants. Mycoscience, 51(1): 34-43. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10070] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=41; TAXLABELS Acalypha_australis Ajuga_reptans Arctium_lappa Aster_ageratoides Aster_tataricus Bidens_frondosa Boehmeria_nipononivea Calendula_officinalis Cayratia_japonica Clerodendrum_trichotomum Cosmos_bipinnatus Crotalaria_juncea Cucumis_sativus Cucurbita_moschata Dunbaria_villosa Erigeron_canadensis Gerbera_hybrida Glycine_max Helianthus_annuus_MUMH324 Helianthus_annuus_MUMH337 Impatiens_balsamina Impatiens_noli_tangere Impatiens_textorii Kalimeris_pinnatifida Lactuca_indica Lactuca_raddeana Lycopus_lucidus Melothria_japonica Peristrophe_japonica Podosphaera_longiseta_ex_Prunus_grayana Podosphaera_tridactyla_ex_Prunus_japonica Rudbeckia_sp Solanum_melongena Taraxacum_albidum Taraxacum_officinale Trichosanthes_kirilowii Verbena_x_hybrida Veronicastrum_sibiricum Vigna_angularis Vigna_unguiculata Zinnia_elegans ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=95; TAXLABELS Abelmoschus_ficulneus_AB040293 Acalypha_australis_AB040306 Ajuga_reptans_AB026142 Arctium_lappa_AB040310 Aster_ageratoides_AB040335 Aster_tataricus_AB040341 Bidens_frondosa_AB040295 Boehmeria_nipononivea_AB026139 Cacalia_hastata_AB040314 Calendula_officinalis_AB040317 Carpesium_abrotanoides_AB040350 Carthamus_tinctorius_AB040298 Cayratia_japonica_AB026151 Clerodendrum_trichotomum_AB026145 Coreopsis_lanceolata__AB046990 Coreopsis_lanceolata_EF442023 Cosmos_bipinnatus_AB040299 Cosmos_bipinnatus_AB040300 Cosmos_bipinnatus_AB040301 Cosmos_bipinnatus_AB040302 Cosmos_bipinnatus_AB040303 Crotalaria_juncea_AB040304 Cucumis_sativus_AB026146 Cucumis_sativus_AB040321 Cucumis_sativus_AB040322 Cucumis_sativus_AB040323 Cucumis_sativus_AB040324 Cucumis_sativus_AB040325 Cucumis_sativus_AB040326 Cucumis_sativus_AB040327 Cucumis_sativus_AB040328 Cucumis_sativus_AB040329 Cucumis_sativus_AB040330 Cucurbita_moschata_AB040315 Dunbaria_villosa_AB040334 Erigeron_canadensis_AB040313 Euryops_chrysanthemoides_DQ205330 Euryops_pectinatus_AB046989 Farfugium_japonicum_AB040346 Fatoua_villosa_AB040320 Gerbera_hybrida_AB040309 Glycine_max_AB040305 Gynostemma_pentaphylla_D84378 Helianthus_annuus_AB040311 Helianthus_annuus_AB040312 Helianthus_annuus_EF010913 Helianthus_x_multiflorus_AB040319 Hibiscus_mutabilis_AB040308 Hypochaeris_brasiliensis_AY739113 Impatiens_balsamina_MUMH1125 Impatiens_balsamina_MUMH1225 Impatiens_balsamina_MUMH1608 'Impatiens noli-tangere AB040318' 'Impatiens noli-tangere MUMH2658' 'Impatiens noli-tangere MUMH2841' 'Impatiens noli-tangere MUMH2890' Impatiens_textori_AB040344 Impatiens_textorii_MUMH1231 Impatiens_textorii_MUMH1496 Kalimeris_pinnatifida_AB040353 Lactuca_indica_AB040294 Lactuca_raddeana_AB040352 Leontodon_autumnalis_AB040331 Lycopus_lucidus_AB040343 Matricaria_matricarioides_AB046988 Melampyrum_nemorosum_AB040332 Melothria_japonica_D84387 Peristrophe_japonica_AB026135 Petasites_japonicus_AB040307 Physalis_angulata_EF050036 Physalis_sp._AB040336 Podosphaera_longiseta_ex_Prunus_grayana_AB000945 Podosphaera_tridactyla_ex_Prunus_japonica_AB000936 Rudbeckia_hirta_AB040296 Rudbeckia_sp._AB040337 Saintpaulia_ionantha_AB040338 Saintpaulia_sp._AB040339 Solanum_melongena_AB040333 Syneilesis_palmata_AB040349 Taraxacum_albidum_AB040342 Taraxacum_officinale_AB026148 Taraxacum_officinale_AB046987 Trichosanthes_kirilowii_AB040316 Tussilago_farfara_AB040345 Verbena_bonariensis Verbena_x_hybrida_AB040347 Verbena_x_hybrida_AB046985 Veronica_spicata_AB046986 Veronicastrum_sibiricum_AB026144 Verononia_sp._AB040348 Vigna_angularis_AB040297 Vigna_unguiculata_AB040340 Youngia_denticulata_AB040351 Zinnia_elegans_AB040354 Zinnia_elegans_AB040355 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4218] TITLE Fig._1; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1162; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Acalypha_australis CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Ajuga_reptans CTGAGCGCGAGGCCCCGCAGCGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCGCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCAGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGGGCGGCGACGGCACCCGCCAGAACCCC---AATTTTTGG---ACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTCGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAAGGGTGCATCATCGACCGATCCT------- Arctium_lappa CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCC-AGTCTTTGG--------------------------------------TCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Aster_ageratoides CTGAGCGCGAGGCCCCGCAGTACGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCAGCTAT--CTCGCGACAGGGCGGCGACGGCACCCGCCAGAACCCC---AATTTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCCCTAGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTCGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAGAGTGAACGTAGGTGAGAACCCGTAAGGGTGCATCATCGACCGATCCTGATGTCT Aster_tataricus CTGAGCGCGAGGCCCCGCGGTGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCC-TCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCAGCTAT--CTCGCGACAGGGCGGCGACGGCACCCGCCAGAACCCC---AATTTTTGG---------------------------------TGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCCCTAGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTCGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAAGGGTGCATCATCGACCGATCCTGATGTCT Bidens_frondosa CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCC-TCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGTGACGGCACCCGCCAGAACCCC---AGTCTTTGG-------------------------------TTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTCGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Boehmeria_nipononivea CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGG------------------------------------------GCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Calendula_officinalis CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGG-TAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTCGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTCGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Cayratia_japonica CTGAGCGCGAGGCCCTGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Clerodendrum_trichotomum CTGAGCGCGAGGCCCCGCAGCGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTGATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTGTGAGTGTTGTCTGAGGAAATGTGGAATGAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTATATCTCGCGACAGGGCGGCGACGGCACCCGCCATAACCCC---AATTTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCGGGTGGAATGTGGCTGTCTTCGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Cosmos_bipinnatus CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCACTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGTGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTCGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCGAGGGTGCATCATCGACCGATCCTGATGTCT Crotalaria_juncea CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGTGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Cucumis_sativus CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGTGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Cucurbita_moschata CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGTGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Dunbaria_villosa CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTC- Erigeron_canadensis CTGAGCGCGAGGCCCCGCAGCGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTAGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGGGCGGCGACGGCACCCGCCAGAACCCC---TATTTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTCGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAAGGGTGCATCATCGACCGATCCTGATGTCT Gerbera_hybrida CTGAGCGCGAGGCCCCGCAGCGCTTGCGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGACCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTCGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Glycine_max CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGTGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Helianthus_annuus_MUMH324 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGTGACGGCACCCGCCAGAACCCC---AGTCTTTGG-------------------------------------ATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTCGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Helianthus_annuus_MUMH337 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGTGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Impatiens_balsamina CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGTGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Impatiens_noli_tangere CTGAGCGCGAGGCCCCGCAGCGCTTGCGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGG-----------------------------------AAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTCGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Impatiens_textorii CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTCGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Kalimeris_pinnatifida CTGAGCGCGAGGCCCCGCAGTGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCAGCTAT--CTCGCGACAGGGCGGCGACGGCACCCGCCAGAACCCC---AATTTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCCCTAGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTCGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Lactuca_indica CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCC-AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Lactuca_raddeana CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCC-AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Lycopus_lucidus CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGTGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Melothria_japonica CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGTGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Peristrophe_japonica CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTCGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGG------------------------------------AATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTCGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_longiseta_ex_Prunus_grayana CCGAGCGCGAGGCCACGCGGGGCGCCTGTCCTGCGTTGGCTGACCCTCCACCCGTGTGAACTATATCTATTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTC--AGTGTGGTCTGAGTGAATGTGGAATTAATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTTGCTTGGTCTTGGGGCTCGCCGGCT-GGCGGCCCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGTGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGGACCTGCCAGAAGCCTC-AATTTTCTAGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCTCCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTCGGGCAGTGTTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTGAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_tridactyla_ex_Prunus_japonica CCGAGCGCGAGGCCACGCAGGGCGCCTGTCCTGTGTTGGCTGACCCTCCACCCGTGTGAATTATATCTATTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTC--AGTGTTGTCTGAGTGAATGTGGAATTAATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCT-GGCGGCCCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGTGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGGACCTGCCAGAACCCCCCAATTTTCTTGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGGAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCTCCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTCGGGCAGTGTTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTGAGGGTGCATCATCGACCGATCCTGATGTCT Rudbeckia_sp CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGGAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAAAACCCGCAAGGGTGCATCA------------------- Solanum_melongena CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGG----CGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Taraxacum_albidum CTGAGCGCGAGGCCCCGCAGCGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGTGTAGTCATGTAT--CTCGCGACAGGGCGGCGACGGCACCCGCCAGAACCTC---AATTTTTGG------GCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTCGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAAGGGTGCATCATCGACCGATCCTGATGTCT Taraxacum_officinale CTGAGCGCGAGGCCCCGCAGCGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGTGTAGTCATGTAT--CTCGCGACAGGGCGGCGACGGCACCCGCCAGAACCTC---AATTTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCGCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTCGGACAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAAGGGTGCATCATCGACCGATCCTGATGTCT Trichosanthes_kirilowii CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGTGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGG-----------------------------------AAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Verbena_x_hybrida CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCC-AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Veronicastrum_sibiricum CTGAGCGCGAGGCCCCGTCGAGCGCCTGCTCGGCGGCGGCTGACCCTCCACCCGTGTCAACTTTTTTC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCTGGCTCCGGCTGGCGCGTGCCCGCCAGAGAAGCCCCAACTCGTGCTATG--CGTGTTGTCTGAGTGAATGCGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCCTCAAGCCTCGCTTGGTCTTGGGGCTCGCCCGCTGGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGGGCGGCGACGACACCCGCCAGAACCCC---TCTTTCTGG--------------------------------------TCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCCGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTCGATCCGCGAGGGTTCTCTCTCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTCGGGCAGTGTTATAGCCACCAGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGACCCCGTAAGGGCGCATCATCGACCGATCCTGATGTCT Vigna_angularis CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGTGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Vigna_unguiculata CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Zinnia_elegans CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTAT--CTCGCGACAGAGTGGCGACGGCACCCGCCAGAACCCC---AGTCTTTGGGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTTGGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = Fig._1) = N: 1-1162; CODONPOSSET * CodonPositions (CHARACTERS = Fig._1) = N: 1-1162; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4410] TITLE 'Magnicellulatae/ITS95'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=484; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Abelmoschus_ficulneus_AB040293 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Acalypha_australis_AB040306 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Ajuga_reptans_AB026142 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCGCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCAGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCCC-AATTTTTGG Arctium_lappa_AB040310 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCC-AGTCTTTGG Aster_ageratoides_AB040335 CTGAGCGCGAGGCCCCGCAGTACGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCAGCTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCCC-AATTTTTGG Aster_tataricus_AB040341 CTGAGCGCGAGGCCCCGCGGTGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCAGCTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCCC-AATTTTTGG Bidens_frondosa_AB040295 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGTGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Boehmeria_nipononivea_AB026139 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cacalia_hastata_AB040314 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCACTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGTGACGGCACCCGCCAGAA--CCCC-CGTCTTTGG Calendula_officinalis_AB040317 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Carpesium_abrotanoides_AB040350 CTGAGCGCGAGGCCCCGCAGTGCGCCAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--GGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCTGCGCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCAGCTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCCC-AATTTTTGG Carthamus_tinctorius_AB040298 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGTGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cayratia_japonica_AB026151 CTGAGCGCGAGGCCCTGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Clerodendrum_trichotomum_AB026145 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTGATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTGTGAGTGTTGTCTGAGGAAATGTGGAATGAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTATATCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCCC-AATTTTTGG Coreopsis_lanceolata__AB046990 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCACTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGTGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Coreopsis_lanceolata_EF442023 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTC--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cosmos_bipinnatus_AB040299 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCACTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGTGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cosmos_bipinnatus_AB040300 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCACTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGTGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cosmos_bipinnatus_AB040301 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCACTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGTGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cosmos_bipinnatus_AB040302 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCACTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGTGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cosmos_bipinnatus_AB040303 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCACTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGTGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Crotalaria_juncea_AB040304 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cucumis_sativus_AB026146 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cucumis_sativus_AB040321 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTT?GGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cucumis_sativus_AB040322 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cucumis_sativus_AB040323 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cucumis_sativus_AB040324 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cucumis_sativus_AB040325 ---AGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGC?AGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cucumis_sativus_AB040326 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cucumis_sativus_AB040327 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cucumis_sativus_AB040328 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cucumis_sativus_AB040329 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cucumis_sativus_AB040330 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Cucurbita_moschata_AB040315 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Dunbaria_villosa_AB040334 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Erigeron_canadensis_AB040313 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTAGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCCC-TATTTTTGG Euryops_chrysanthemoides_DQ205330 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Euryops_pectinatus_AB046989 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Farfugium_japonicum_AB040346 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Fatoua_villosa_AB040320 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGCGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Gerbera_hybrida_AB040309 CTGAGCGCGAGGCCCCGCAGCGCTTGCGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGACCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Glycine_max_AB040305 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Gynostemma_pentaphylla_D84378 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Helianthus_annuus_AB040311 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGTGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Helianthus_annuus_AB040312 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Helianthus_annuus_EF010913 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGCCAGGGCGGCG-------------------------------- Helianthus_x_multiflorus_AB040319 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGTGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Hibiscus_mutabilis_AB040308 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Hypochaeris_brasiliensis_AY739113 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCCC-AATTTTTGG Impatiens_balsamina_MUMH1125 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Impatiens_balsamina_MUMH1225 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Impatiens_balsamina_MUMH1608 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG 'Impatiens noli-tangere AB040318' CTGAGCGCGAGGCCCCGCAGCGCTTGCGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG 'Impatiens noli-tangere MUMH2658' CTGAGCGCGAGGCCCCGCAGCGCTTGCGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG 'Impatiens noli-tangere MUMH2841' CTGAGCGCGAGGCCCCGCAGCGCTTGCGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG 'Impatiens noli-tangere MUMH2890' CTGAGCGCGAGGCCCCGCAGCGCTTGCGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Impatiens_textori_AB040344 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Impatiens_textorii_MUMH1231 -------------------GCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Impatiens_textorii_MUMH1496 ----------------GCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTG---------------------------------------------------------------------------- Kalimeris_pinnatifida_AB040353 CTGAGCGCGAGGCCCCGCAGTGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCAGCTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCCC-AATTTTTGG Lactuca_indica_AB040294 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCC-AGTCTTTGG Lactuca_raddeana_AB040352 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCC-AGTCTTTGG Leontodon_autumnalis_AB040331 ------GCGAGGCCCCGCAGCGCGCAAGCTCTGCGGCGGCTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTCGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCCC-AATTTTTGG Lycopus_lucidus_AB040343 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Matricaria_matricarioides_AB046988 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGTGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCCC-AATTTTTGG Melampyrum_nemorosum_AB040332 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGCCAGGGCGGCGACGGCACCCGCCAGAA--CCCC-AATTTTTGG Melothria_japonica_D84387 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Peristrophe_japonica_AB026135 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTCGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Petasites_japonicus_AB040307 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Physalis_angulata_EF050036 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGC-CCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCTAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCC-AGTCTTTGG Physalis_sp._AB040336 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCC-AGTCTTTGG Podosphaera_longiseta_ex_Prunus_grayana_AB000945 CCGAGCGCGAGGCCACGCGGGGCGCCTGTCCTGCGTTGGCTGACCCTCCACCCGTGTGAACTATATCTATTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTC--AGTGTGGTCTGAGTGAATGTGGAATTAATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTTGCTTGGTCTTGGGGCTCGCCGGCT-GGCGGCCCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGTGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGGACCTGCCAGAA-GCCTCAATTTTCTAG Podosphaera_tridactyla_ex_Prunus_japonica_AB000936 CCGAGCGCGAGGCCACGCAGGGCGCCTGTCCTGTGTTGGCTGACCCTCCACCCGTGTGAATTATATCTATTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTC--AGTGTTGTCTGAGTGAATGTGGAATTAATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCT-GGCGGCCCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGTGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGGACCTGCCAGAACCCCCCAATTTTCTTG Rudbeckia_hirta_AB040296 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Rudbeckia_sp._AB040337 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Saintpaulia_ionantha_AB040338 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Saintpaulia_sp._AB040339 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Solanum_melongena_AB040333 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Syneilesis_palmata_AB040349 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Taraxacum_albidum_AB040342 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGTGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCTC-AATTTTTGG Taraxacum_officinale_AB026148 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGTGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCTC-AATTTTTGG Taraxacum_officinale_AB046987 CTGAGCGCGAGGCCCCGCAGCGCGCAAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGTGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCCC-AATTTTTGG Trichosanthes_kirilowii_AB040316 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Tussilago_farfara_AB040345 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCC-AGTCTTTGG Verbena_bonariensis CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCC-AGTCTTTGG Verbena_x_hybrida_AB040347 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCC-AGTCTTTGG Verbena_x_hybrida_AB046985 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Veronica_spicata_AB046986 CAGAGTGCGAGGCCCCGCGGAGCGCATGCCCTGCGGTGGCTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCCTCGGCTGGCGCGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTC--AGTGTCGTCTGAGTGAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCTCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACACAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGGGCTGCAGCGGCACCCGCCAGAA--CCCC-ATTTTCTGG Veronicastrum_sibiricum_AB026144 CTGAGCGCGAGGCCCCGTCGAGCGCCTGCTCGGCGGCGGCTGACCCTCCACCCGTGTCAACT--TTTTTCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCTGGCTCCGGCTGGCGCGTGCCCGCCAGAGAAGCCCCAACTCGTGCTATG--CGTGTTGTCTGAGTGAATGCGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCCTCAAGCCTCGCTTGGTCTTGGGGCTCGCCCGCTGGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGACACCCGCCAGAA--CCCC-TCTTTCTGG Verononia_sp._AB040348 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Vigna_angularis_AB040297 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Vigna_unguiculata_AB040340 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Youngia_denticulata_AB040351 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCC-AGTCTTTGG Zinnia_elegans_AB040354 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG Zinnia_elegans_AB040355 CTGAGCGCGAGGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACT--CTTATCTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACACCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCC-AGTCTTTGG ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = 'Magnicellulatae/ITS95') = N: 1-484; CODONPOSSET * CodonPositions (CHARACTERS = 'Magnicellulatae/ITS95') = N: 1-484; END; BEGIN TREES; TITLE Tb10577; LINK TAXA = Taxa1; TRANSLATE 1 Peristrophe_japonica, 2 Cucurbita_moschata, 3 Vigna_angularis, 4 Lycopus_lucidus, 5 Helianthus_annuus_MUMH337, 6 Zinnia_elegans, 7 Glycine_max, 8 Crotalaria_juncea, 9 Melothria_japonica, 10 Impatiens_balsamina, 11 Cucumis_sativus, 12 Trichosanthes_kirilowii, 13 Solanum_melongena, 14 Acalypha_australis, 15 Dunbaria_villosa, 16 Vigna_unguiculata, 17 Rudbeckia_sp, 18 Gerbera_hybrida, 19 Impatiens_noli_tangere, 20 Arctium_lappa, 21 Boehmeria_nipononivea, 22 Lactuca_indica, 23 Lactuca_raddeana, 24 Verbena_x_hybrida, 25 Helianthus_annuus_MUMH324, 26 Cosmos_bipinnatus, 27 Bidens_frondosa, 28 Calendula_officinalis, 29 Impatiens_textorii, 30 Aster_ageratoides, 31 Kalimeris_pinnatifida, 32 Aster_tataricus, 33 Cayratia_japonica, 34 Ajuga_reptans, 35 Erigeron_canadensis, 36 Clerodendrum_trichotomum, 37 Taraxacum_albidum, 38 Taraxacum_officinale, 39 Veronicastrum_sibiricum, 40 Podosphaera_longiseta_ex_Prunus_grayana, 41 Podosphaera_tridactyla_ex_Prunus_japonica; TREE Fig._1 = [&R] ((((((1,(((((2,3,4,5,6,7,8,9,10,11,12),13,14,15,16),17),20,21,22,23,24,33),(18,19)),(25,26,27),28,29),((30,32),31)),36),34,35,(37,38)),39),(40,41)); END; BEGIN TREES; TITLE Tb10576; LINK TAXA = Taxa2; TRANSLATE 1 Physalis_angulata_EF050036, 2 Physalis_sp._AB040336, 3 Hypochaeris_brasiliensis_AY739113, 4 Euryops_chrysanthemoides_DQ205330, 5 Helianthus_annuus_EF010913, 6 Coreopsis_lanceolata_EF442023, 7 'Impatiens noli-tangere MUMH2658', 8 'Impatiens noli-tangere MUMH2841', 9 'Impatiens noli-tangere MUMH2890', 10 Impatiens_textorii_MUMH1231, 11 Impatiens_textorii_MUMH1496, 12 Impatiens_balsamina_MUMH1125, 13 Impatiens_balsamina_MUMH1225, 14 Impatiens_balsamina_MUMH1608, 15 Verbena_bonariensis, 16 Gynostemma_pentaphylla_D84378, 17 Melothria_japonica_D84387, 18 Verbena_x_hybrida_AB046985, 19 Abelmoschus_ficulneus_AB040293, 20 Vigna_angularis_AB040297, 21 Crotalaria_juncea_AB040304, 22 Glycine_max_AB040305, 23 Helianthus_annuus_AB040312, 24 Cucurbita_moschata_AB040315, 25 Trichosanthes_kirilowii_AB040316, 26 Cucumis_sativus_AB026146, 27 Cucumis_sativus_AB040324, 28 Cucumis_sativus_AB040325, 29 Cucumis_sativus_AB040326, 30 Cucumis_sativus_AB040327, 31 Cucumis_sativus_AB040328, 32 Cucumis_sativus_AB040329, 33 Cucumis_sativus_AB040330, 34 Cucumis_sativus_AB040321, 35 Cucumis_sativus_AB040322, 36 Cucumis_sativus_AB040323, 37 Saintpaulia_ionantha_AB040338, 38 Saintpaulia_sp._AB040339, 39 Lycopus_lucidus_AB040343, 40 Zinnia_elegans_AB040354, 41 Zinnia_elegans_AB040355, 42 Acalypha_australis_AB040306, 43 Hibiscus_mutabilis_AB040308, 44 Solanum_melongena_AB040333, 45 Dunbaria_villosa_AB040334, 46 Vigna_unguiculata_AB040340, 47 Verononia_sp._AB040348, 48 Rudbeckia_hirta_AB040296, 49 Petasites_japonicus_AB040307, 50 Rudbeckia_sp._AB040337, 51 Gerbera_hybrida_AB040309, 52 'Impatiens noli-tangere AB040318', 53 Cayratia_japonica_AB026151, 54 Boehmeria_nipononivea_AB026139, 55 Lactuca_indica_AB040294, 56 Arctium_lappa_AB040310, 57 Fatoua_villosa_AB040320, 58 Tussilago_farfara_AB040345, 59 Verbena_x_hybrida_AB040347, 60 Youngia_denticulata_AB040351, 61 Lactuca_raddeana_AB040352, 62 Coreopsis_lanceolata__AB046990, 63 Cosmos_bipinnatus_AB040300, 64 Cosmos_bipinnatus_AB040302, 65 Cosmos_bipinnatus_AB040303, 66 Cosmos_bipinnatus_AB040301, 67 Cosmos_bipinnatus_AB040299, 68 Bidens_frondosa_AB040295, 69 Carthamus_tinctorius_AB040298, 70 Helianthus_annuus_AB040311, 71 Helianthus_x_multiflorus_AB040319, 72 Cacalia_hastata_AB040314, 73 Euryops_pectinatus_AB046989, 74 Calendula_officinalis_AB040317, 75 Impatiens_textori_AB040344, 76 Farfugium_japonicum_AB040346, 77 Syneilesis_palmata_AB040349, 78 Peristrophe_japonica_AB026135, 79 Aster_ageratoides_AB040335, 80 Aster_tataricus_AB040341, 81 Carpesium_abrotanoides_AB040350, 82 Kalimeris_pinnatifida_AB040353, 83 Taraxacum_officinale_AB026148, 84 Taraxacum_albidum_AB040342, 85 Matricaria_matricarioides_AB046988, 86 Taraxacum_officinale_AB046987, 87 Clerodendrum_trichotomum_AB026145, 88 Ajuga_reptans_AB026142, 89 Erigeron_canadensis_AB040313, 90 Melampyrum_nemorosum_AB040332, 91 Leontodon_autumnalis_AB040331, 92 Veronica_spicata_AB046986, 93 Veronicastrum_sibiricum_AB026144, 94 Podosphaera_tridactyla_ex_Prunus_japonica_AB000936, 95 Podosphaera_longiseta_ex_Prunus_grayana_AB000945; TREE Fig._2 = [&R] (((((((((1,2,(7,8,9,51,52),(((12,13,14,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41),42,43,44,45,46,47),48,49,50),15,53,54,55,56,57,58,59,60,61),5),(4,6,10,((62,63,64,65,66,67),68,69,70,71,72),73,74,75,76,77,78),11),(79,80,81,82)),3,((83,84),85,86),87,88,89,90),91),93),92),(94,95)); END;