#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 22:18 GMT TreeBASE (cc) 1994-2008 Study reference: Springer Y. 2009. Do extreme environments provide a refuge from pathogens? A phylogenetic test using serpentine flax. American Journal of Botany, 96: 2010-2021. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10078] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=78; TAXLABELS Hesperolinon_adenophyllum_0102P Hesperolinon_adenophyllum_0103P Hesperolinon_adenophyllum_0104P Hesperolinon_adenophyllum_0106P Hesperolinon_adenophyllum_0107P Hesperolinon_bicarpellatum_0201P Hesperolinon_bicarpellatum_0202P Hesperolinon_bicarpellatum_0203P Hesperolinon_bicarpellatum_0204P Hesperolinon_bicarpellatum_0205P Hesperolinon_breweri_0301P Hesperolinon_breweri_0302P Hesperolinon_breweri_0303P Hesperolinon_breweri_0304P Hesperolinon_breweri_0305P Hesperolinon_californicum_0401P Hesperolinon_californicum_0402P Hesperolinon_californicum_0403P Hesperolinon_californicum_0404P Hesperolinon_californicum_0405P Hesperolinon_californicum_0406P Hesperolinon_californicum_0407P Hesperolinon_californicum_0408P Hesperolinon_californicum_0409P Hesperolinon_californicum_0410P Hesperolinon_californicum_0411P Hesperolinon_californicum_0412P Hesperolinon_californicum_0413P Hesperolinon_californicum_0414P Hesperolinon_californicum_0415P Hesperolinon_californicum_0416P Hesperolinon_clevelandii_0502P Hesperolinon_clevelandii_0503P Hesperolinon_clevelandii_0504P Hesperolinon_clevelandii_0506P Hesperolinon_clevelandii_0507P Hesperolinon_congestum_0601P Hesperolinon_congestum_0602P Hesperolinon_congestum_0603P Hesperolinon_congestum_0604P Hesperolinon_congestum_0605P Hesperolinon_congestum_0606P Hesperolinon_didymocarpum_0701P Hesperolinon_didymocarpum_0702P Hesperolinon_didymocarpum_0703P Hesperolinon_didymocarpum_0704P Hesperolinon_didymocarpum_0705P Hesperolinon_disjunctum_0801P Hesperolinon_disjunctum_0805P Hesperolinon_disjunctum_0806P Hesperolinon_disjunctum_0807P Hesperolinon_disjunctum_0808P Hesperolinon_drymarioides_0901P Hesperolinon_drymarioides_0902P Hesperolinon_drymarioides_0903P Hesperolinon_drymarioides_0905P Hesperolinon_drymarioides_0906P Hesperolinon_micranthum_1001P Hesperolinon_micranthum_1002P Hesperolinon_micranthum_1003P Hesperolinon_micranthum_1004P Hesperolinon_micranthum_1005P Hesperolinon_sharsmithiae_1101P Hesperolinon_sharsmithiae_1102P Hesperolinon_sharsmithiae_1103P Hesperolinon_sharsmithiae_1104P Hesperolinon_sharsmithiae_1106P Hesperolinon_spergulinum_1201P Hesperolinon_spergulinum_1202P Hesperolinon_spergulinum_1203P Hesperolinon_spergulinum_1204P Hesperolinon_spergulinum_1205P Hesperolinon_tehamense_1301P Hesperolinon_tehamense_1302P Hesperolinon_tehamense_1303P Hesperolinon_tehamense_1304P Hesperolinon_tehamense_1305P Linum_neomexicanum_LNEO1 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4617] TITLE Hesperolinon; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2949; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Hesperolinon_adenophyllum_0102P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCAGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTTAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCGCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTCTATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTGTATTCTACTGCCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTAAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_adenophyllum_0103P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATAGAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCAGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTTAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCGCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTCTATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTGTATTCTACTGCCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTAAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_adenophyllum_0104P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCAGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTTAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCGCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTCTATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTGTATTCTACTGCCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTAAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_adenophyllum_0106P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCCTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGTATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCAAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCGCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTTGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_adenophyllum_0107P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTCGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCCTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGTATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATAAAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCGCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTTGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_bicarpellatum_0201P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGGTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCCACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCGCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCTTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_bicarpellatum_0202P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGGTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCCACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCGCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTAGTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCTTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_bicarpellatum_0203P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGGTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCCACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCGCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTAGTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCTTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_bicarpellatum_0204P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCCTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGCAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTTTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTATTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTCGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTTTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_bicarpellatum_0205P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCCTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGCAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCGACAATGGAGACTCTAAAAAATTTTAATAGAATTTTTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTATTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTCGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTTTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_breweri_0301P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTAAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_breweri_0302P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTAAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCAGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATAATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_breweri_0303P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTAAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_breweri_0304P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACTAATTTTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGAGAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCTATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_breweri_0305P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_californicum_0401P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_californicum_0402P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_californicum_0403P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTGAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_californicum_0404P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_californicum_0405P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTGAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_californicum_0406P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_californicum_0407P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTGAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_californicum_0408P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_californicum_0409P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_californicum_0410P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGACAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGAATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_californicum_0411P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_californicum_0412P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTATTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGAATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_californicum_0413P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGAATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_californicum_0414P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGAATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCAGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_californicum_0415P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTAAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_californicum_0416P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_clevelandii_0502P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGG-TAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGCAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTTTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTATTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTCGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTTTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_clevelandii_0503P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGG-TAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGCAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTTTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTATTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTCGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTTTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_clevelandii_0504P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGG-TAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGCAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTTTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTATTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTCGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTTTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_clevelandii_0506P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTCCCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGCAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTCTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTTTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTATTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTCGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTTTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_clevelandii_0507P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCATTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGAAAGTCGGCGGTTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCTGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTTTTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTATAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAAGCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCAGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTGTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_congestum_0601P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_congestum_0602P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_congestum_0603P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACGGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_congestum_0604P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACGGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_congestum_0605P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGAATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_congestum_0606P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAACGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAAATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTCCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTAATTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_didymocarpum_0701P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGGTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCCACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCGCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTAGTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCTTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_didymocarpum_0702P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGGTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCCACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCGCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTAGTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCTTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_didymocarpum_0703P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGGTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCCACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCGCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTAGTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCTTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_didymocarpum_0704P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGGTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCCACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACCCGTTCCAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCGCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCTTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_didymocarpum_0705P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGGTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCCACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCGCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTAGTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCTTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_disjunctum_0801P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCCTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGCAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTTTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTATTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTCGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTTTCATTTTTTTTCGTAAAATTTTTAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATATAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_disjunctum_0805P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTATTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTAGCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_disjunctum_0806P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTAACGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_disjunctum_0807P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCCTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGCAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATAGACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTTTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTATTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTCGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTTTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_disjunctum_0808P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCCTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGCAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCAAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTTTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTATTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTCGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTTTCATTTTTTTTCGTAAAATTTTTAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATATAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_drymarioides_0901P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTTGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTT---------------------------------------------------------------------------------------TTAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCGTTATCTTTCTCATTCATTGAATTCTTTTACAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCTTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGATCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCATTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACGGATTCTTTCTTTGATTCCAAGAATTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATAGAAATTTTCCATAAATGATCAAATGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAACAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAACTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCCTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTTTTTCTTTTATTAAAATGAAAATGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATATAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCTAAATTCAATAATATCAAAATAAAAAATATTCGCGGGCGAATATTCACTCGTTCAAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGC-AAAATAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTTATTTAATTATAGATTAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGGCTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCTATTTTTGCTTTACAATTCAAAATTGTAGTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCC-TTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTTAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTCTATTCATATTAATTTTGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTTGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_drymarioides_0902P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTTGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTT---------------------------------------------------------------------------------------TTAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTATTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCGTTATCTTTCTCATTCATTGAATTCTTTTACAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATAATTATTCGGACTGAAACTTACAAAATCTTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGATCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCATTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAATTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATAGAAATTTTCCATAAATGATCAAATGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAACAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAACTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATGAAAATGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATATAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCTAAATTCAATAATATCAAAATAAAAAATATTCGCGGGCGAATATTCACTCGTTCAAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGC-AAAATAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTTATTTAATTATAGATTAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGGCTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCTATTTTTGCTTTACAATTCAAAATTGTAGTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCC-TTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTTAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTCTATTCATATTAATTTTGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTTGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_drymarioides_0903P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTTGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTT---------------------------------------------------------------------------------------TTAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTATTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCGTTATCTTTCTCATTCATTGAATTCTTTTACAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATAATTATTCGGACTGAAACTTACAAAATCTTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGATCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCATTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAATTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATAGAAATTTTCCATAAATGATCAAATGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAACAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAACTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCCTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATGAAAATGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATATAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCTAAATTCAATAATATCAAAATAAAAAATATTCGCGGGCGAATATTCACTCGTTCAAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGC-AAAATAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTTATTTAATTATAGATTAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGGCTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTCTCTATTTTTGCTTTACAATTCAAAATTGTAGTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCC-TTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTTAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTCTATTCATATTAATTTTGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTTGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_drymarioides_0905P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTTGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTT---------------------------------------------------------------------------------------TTAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTATTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTTGTTAACGGTTTCAAATTCGTTATCTTTCTCATTCATTGAATTCTTTTACAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCTTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGATCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCATTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAATTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATAGAAATTTTCCATAAATGATCAAATGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAACAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAACTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATGAAAATGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATATAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCTAAATTCAATAATATCAAAATAAAAAATATTCGCGGGCGAATATTCACTCGTTCAAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGC-AAAATAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTTATTTAATTATAGATTAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGGCTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCTATTTTTGCTTTACAATTCAAAATTGTAGTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCC-TTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTTAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTCTATTCATATTAATTTTGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTTGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_drymarioides_0906P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTTGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTT---------------------------------------------------------------------------------------TTAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTATTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCGTTATCTTTCTCATTCATTGAATTCTTTTACAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATAATTATTCGGACTGAAACTTACAAAATCTTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGATCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCATTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAATTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATAGAAATTTTCCATAAATGATCAAATGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAACAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAACTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCCTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATGAAAATGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATATAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTCGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCTAAATTCAATAATATCAAAATAAAAAATATTCGCGGGCGAATATTCACTCGTTCAAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGC-AAAATAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTTATTTAATTATAGATTAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGGCTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCTATTTTTGCTTTACAATTCAAAATTGTAGTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCC-TTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTTAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTCTATTCATATTAATTTTGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTTGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_micranthum_1001P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCTATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCTCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAAGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTGATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCTATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCAAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTCTTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_micranthum_1002P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCTATTTTTTTTTCTAGAGAAAAAAATAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAAGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTGATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCAAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTCTTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_micranthum_1003P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCATTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGAAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCTGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTTTTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTATAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAAGCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCAGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTGTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_micranthum_1004P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCTATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCTCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAAGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTGATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCAAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTCTTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_micranthum_1005P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCTATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCTCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAAGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTGATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCGTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCAAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTCTTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_sharsmithiae_1101P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCCTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGCAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCGACAATGGAGACTCTAAAAAATTTTAATAGAATTTTTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTATTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTCGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTTTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_sharsmithiae_1102P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCCTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGCAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCGACAATGGAGACTCTAAAAAATTTTAATAGAATTTTTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTATTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTCGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTTTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_sharsmithiae_1103P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCCTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGCAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCGACAATGGAGACTCTAAAAAATTTTAATAGAATTTTTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTATTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTCGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTTTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_sharsmithiae_1104P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAATAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCCTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCAACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGCAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTTTTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTCGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTTTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTCGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTATTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTCGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTTTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_sharsmithiae_1106P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCATTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGAAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCTGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTTTTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTATAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAAGCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCAGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTGTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_spergulinum_1201P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCTATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTCTTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTGATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTAATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCAAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTCTTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_spergulinum_1202P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTCTTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAA-TTTTTGATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTAATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCAAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTCTTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCAAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_spergulinum_1203P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATGCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGA-AT-----------------------------------------------------------AGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAAGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTGATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCAAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTCTTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGCAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_spergulinum_1204P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCTATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAAGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTGATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAAGAGCTTTTCAGTACTACTTTTATATGATAAATCAAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTCTTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_spergulinum_1205P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTATTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGGAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTAT--TTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACCTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTTTGATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTACCTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCAAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTCTTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATCCCGAGTCCTAGAAAA----TTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_tehamense_1301P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCTTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATCTAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTTATTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTAGCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_tehamense_1302P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTGATTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTAGCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_tehamense_1303P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGTTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTGATTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTAGCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_tehamense_1304P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGTTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTGATTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTAGCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Hesperolinon_tehamense_1305P GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGGAATCCTTCGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATGTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAACTAACCCGAATCCTTATCCTTTTTCGATTTTTTTT-CTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACAAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTCTCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGAATTCTTTTATAAAAGTATTGGGGGGTAATTTTTTTTTCTTTTCACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATCGTTTTTTTTAGGATATAAAACGTTTCTGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAAGTCGGCGGGTCGGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCAGTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTACCGACGAAAAACAGATTCTTTCTTTGATTCCAAGAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATTGAAATTTTCCATAAATGATCAAAGGAAGGGGTAAAAAAAAGTGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTTTGTCTAGGGGAAAATTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGTTTAAAAAATAGATATGGAATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTTTATTTTCTATAGAACCATCTATTCAATTTATATTCTAGATTTATTTTCTAGAGAATTTGATTATTTGAAGGTAGTTTTAGATAATGCCATTTTTGTTAGAATGTTCTAACGAATCTTAGTATTATTATTAATAATATGATATCAGATTGCTTAAAATTCCGAAATTCAATAATATCAAAATATAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGAGTTAATTCTTGACGCCGCCAAATTAAATGAATTGTCTCTTATTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTTTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCGATTTTTGCTTTACAATTCAAAATTGTATTGTTTTTTTATGCAAAAAATAGCTTTTCAGTACTACTTTTATATGATAAATCTAAATCTAGCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGGGTCCCCCTTTTTTGAGATTTAAATCATAATCTTATTCTTGAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTGGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCATATCGGAAACCTATATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTAAATACTCGAACGGTCGATTCTTTTCTTTTTTTCTATATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTCTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT Linum_neomexicanum_LNEO1 GAACTTACTAAGTGATACCTTTCAAATTCAGAGAAACCCTGGAATTAACAAAGGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAAATTCCTAAAGACAGAATAAAACAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAGGTGACCGCCTTGCGTTGGTAAAGTAAAGCAATCCTTTGATCAAACCAAAACTCTAGAAAAAAGAAAGTAAAGGATAACCCGATATACATATTATTATACATATCTAGGGGTACTGAAATACTATCTCAAATGATTAATGATAGCTAACCCGAATCCTTAT-TTTTTTCGATTTTTTTTTCTAGAGAAAAAAAGAGTTTTGGATCGATTCCAAATTGAAGAAAGAATCGAATATTAATTGATCAAATAAATTCACTCCAAAGTCTGATAGATAACAGATTAATCGGACGAGAATAAAGATAGAGTCCTATTCTACATGTCAGTATTGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGGGCCTGTTCGACTCCTGAATTATTTATATCCTATTCTATCTTTTCGTTAACGGTTTCAAATTCCTTATCTTTCTCATTCATTGCATTCTTTTACAAAAGTATTTGGGGTGAATTTTTTTTTCTTTTGACAAGTTAAGTCTTGTAATAGATATGATACACATAGAAATGAACATCTTTTATTTGAGCAAAACTCGGGACCCCCTGGAAATTGTAATGATTAACAATCAAAATCATTATTCGGACTGAAACTTACAAAATC-TTTTTTTTAGGATATAAAACGTTTCGGACATTGGAAAAAACTTTGAAATGTTTTTTTCGACCTTTTTTTTAATTGACTTTAATTGACATAGACCCAATCCATTTAGTAAAGTGAGGAACTCGGCGGGTCAGAAATGGCCGGGATAGAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCATTTTTTTGAAAAGGTTGGGGTCGGAATTGTTGGAAGAATTTTTTAACGACGAAAAACAGATTCTTTCTTTGATTCCAAAAACTTCGTCTATTTCACAAAGATTATATAAAGGACGGGTTTGGTATTTGGATATTGTTTGTATCAATGAACTGGCCCATGATAAAAATTTCTTTATCAAACATGGAAATAGAAATTTTCTATAAATGATCAAATGAAGGGGTAAAAAAAA-TGCATTTATTTCGATTATGAAATGTTCAGAAAGTATATCAGCAAGGATTGAGCAACTGAGTATTCAACTTTCTTCTGAGGTATGGGGTTCTGTCTAGAGGAAAACTGAGCTTTAGTTGTATACATAGGAAAAGCCGTGTGCAATGAAAATTGCAAGCACGGTTTGGGGAGGGTTTTTTTCTTTTATCCGTTTTTTTAAGAAAGAAATTTTCATGGATGTTTTTCAATTCCATCTCTAGTCCAAAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATGAAATGCTTAAAAAATAGATATGGGATTGGTAAATAATATACAGAATTATTTCTTTTATTAAAATTAAAACGTTGTGTATTTAGTATAAATTTGTATTGTATATTTTCTTTCTATTTTCTATATAACCATCTATTCAATTTATATT----------------------------------------------------------------------------------------------------------------------------------------------AAAATCAAAAATCTTCGCGGGCGAATATTCACTCGTTCCAATATTTAACTTCATTTGTAGATTTAATTCCTGACGCCGCCAAAATAAATGAATTGTCTCTTGGTTTTTTCGCCATCCTGCCTAAAAAATCATTAAGATTTAGAATCTTATGTATTCCCAGGTTCCGTCGTTCCCATCACTTCTCTATTAATGGTTAGGTCTTAATTCTACAATGGAGACTCTAAAAAATTTTAATAGAATTTGTTCTTGACTCAATTTTCTCAATTTTTATTGGATCGAGGCTCTTGATTTTTTTTGTTCTAGAAACAGATTCATTTAATTATAGATCAATCGGTATTGATGCTTTATTACATTGGCTTTTAACTTTTTATGAGACGACTCATAAACCTTACATATTGGAATCATATATCATTGCTATTCGTTTTCTCTTTTTCTGTCACCCTTCCATTTATCCACATAATTTTCTATTTTTGCTTTACAATTCAAAATTCGATTG-TTTTTTATGCAAAAAATCGCTTTTCAGTACTACTTTTCTATGATAAATCTAAATCTATCATATCTTGGCTGTTTCTTTCGATCCGGATAATGTGAAGCGATGAATTGCTTATTAGTTTTATAGTTATTAGTTCATATCATAAATATCATAACATAATAAGAGTCCCC-TTTTTTGAGATTTTAATCATAATCTTATTCTTTAATATTATGATTATTGTGGTATTGTGTCATTTTTTTCTTTCATTTAGATTTCTATTCTACTAGCTACTAGAACTGTTGAAATCATTAGATACCGAGTCCTAGAAAAGCCTTTTCTCTTATTTTTTTCTTGGATACCCTCTTTCATTTCCTATCGGAAACCTCTATTTGGTCTACTTACAAATGATTCTAGCATTTCTGTATCTGCAATTCAATATATATGTATATACGCCACATTTATTATAAACTAAGTGCCCCTTCCTCTCATTTTTTTTCGTAAAATTTTGAATACTCGAACGGTCGACTCTTTTCTTTTTTTCTAGATTCATATTAATTATGAATAACAAAAGAATGAAAAGTTAATAGCGAAGATTCTCGGAATTTAGGAAATTCCTATTTTTCCGCATATACAATTGCTCTTATGTGAGCCCGCTTAGCTCAGAGGTT ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = Hesperolinon) = N: 1-2949; CODONPOSSET * CodonPositions (CHARACTERS = Hesperolinon) = N: 1-2949; END; BEGIN TREES; TITLE Tb10597; LINK TAXA = Taxa1; TRANSLATE 1 Linum_neomexicanum_LNEO1, 2 Hesperolinon_adenophyllum_0102P, 3 Hesperolinon_adenophyllum_0103P, 4 Hesperolinon_adenophyllum_0104P, 5 Hesperolinon_adenophyllum_0106P, 6 Hesperolinon_adenophyllum_0107P, 7 Hesperolinon_bicarpellatum_0201P, 8 Hesperolinon_bicarpellatum_0202P, 9 Hesperolinon_bicarpellatum_0203P, 10 Hesperolinon_bicarpellatum_0204P, 11 Hesperolinon_bicarpellatum_0205P, 12 Hesperolinon_breweri_0301P, 13 Hesperolinon_breweri_0302P, 14 Hesperolinon_breweri_0303P, 15 Hesperolinon_breweri_0304P, 16 Hesperolinon_breweri_0305P, 17 Hesperolinon_californicum_0401P, 18 Hesperolinon_californicum_0402P, 19 Hesperolinon_californicum_0403P, 20 Hesperolinon_californicum_0404P, 21 Hesperolinon_californicum_0405P, 22 Hesperolinon_californicum_0406P, 23 Hesperolinon_californicum_0407P, 24 Hesperolinon_californicum_0408P, 25 Hesperolinon_californicum_0409P, 26 Hesperolinon_californicum_0410P, 27 Hesperolinon_californicum_0411P, 28 Hesperolinon_californicum_0412P, 29 Hesperolinon_californicum_0413P, 30 Hesperolinon_californicum_0414P, 31 Hesperolinon_californicum_0415P, 32 Hesperolinon_californicum_0416P, 33 Hesperolinon_clevelandii_0502P, 34 Hesperolinon_clevelandii_0503P, 35 Hesperolinon_clevelandii_0504P, 36 Hesperolinon_clevelandii_0506P, 37 Hesperolinon_clevelandii_0507P, 38 Hesperolinon_congestum_0601P, 39 Hesperolinon_congestum_0602P, 40 Hesperolinon_congestum_0603P, 41 Hesperolinon_congestum_0604P, 42 Hesperolinon_congestum_0605P, 43 Hesperolinon_congestum_0606P, 44 Hesperolinon_didymocarpum_0701P, 45 Hesperolinon_didymocarpum_0702P, 46 Hesperolinon_didymocarpum_0703P, 47 Hesperolinon_didymocarpum_0704P, 48 Hesperolinon_didymocarpum_0705P, 49 Hesperolinon_disjunctum_0801P, 50 Hesperolinon_disjunctum_0805P, 51 Hesperolinon_disjunctum_0806P, 52 Hesperolinon_disjunctum_0807P, 53 Hesperolinon_disjunctum_0808P, 54 Hesperolinon_drymarioides_0901P, 55 Hesperolinon_drymarioides_0902P, 56 Hesperolinon_drymarioides_0903P, 57 Hesperolinon_drymarioides_0905P, 58 Hesperolinon_drymarioides_0906P, 59 Hesperolinon_micranthum_1001P, 60 Hesperolinon_micranthum_1002P, 61 Hesperolinon_micranthum_1003P, 62 Hesperolinon_micranthum_1004P, 63 Hesperolinon_micranthum_1005P, 64 Hesperolinon_sharsmithiae_1101P, 65 Hesperolinon_sharsmithiae_1102P, 66 Hesperolinon_sharsmithiae_1103P, 67 Hesperolinon_sharsmithiae_1104P, 68 Hesperolinon_sharsmithiae_1106P, 69 Hesperolinon_spergulinum_1201P, 70 Hesperolinon_spergulinum_1202P, 71 Hesperolinon_spergulinum_1203P, 72 Hesperolinon_spergulinum_1204P, 73 Hesperolinon_spergulinum_1205P, 74 Hesperolinon_tehamense_1301P, 75 Hesperolinon_tehamense_1302P, 76 Hesperolinon_tehamense_1303P, 77 Hesperolinon_tehamense_1304P, 78 Hesperolinon_tehamense_1305P; TREE Fig._3 = [&R] (1,(((((2,4),3),((5,6),(7,(8,9,44,45,46,48),47))),(((10,(11,64,65,66),(49,53),52,67),33,34,35,36),((12,14,31),(13,15,(16,17,18,(19,21,23),20,22,24,25,27,32,38,39,(40,41),42,43),(26,28,29,30))),51),(37,61,68),(50,74,(75,(76,77,78))),((((59,62,63),60,72),71),(69,70),73)),(54,((55,(56,58)),57)))); END;