#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 3:34 GMT TreeBASE (cc) 1994-2008 Study reference: Jaklitsch W.M. 2009. European species of Hypocrea Part I. Studies in Mycology, 63(1): 1-91. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10085] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=137; TAXLABELS Aphysiostroma_stercorarium Hypocrea_aeruginea Hypocrea_alcalifuscescens Hypocrea_alni Hypocrea_alutacea Hypocrea_americana Hypocrea_atrogelatinosa Hypocrea_atroviridis Hypocrea_aureoviridis Hypocrea_avellanea Hypocrea_brunneoviridis Hypocrea_candida Hypocrea_catoptron Hypocrea_ceracea Hypocrea_ceramica Hypocrea_chlorospora Hypocrea_chromosperma Hypocrea_cinereoflava Hypocrea_cinnamomea Hypocrea_citrina Hypocrea_costaricensis Hypocrea_crassa Hypocrea_cremea Hypocrea_crystalligena Hypocrea_cuneispora Hypocrea_dacrymycella Hypocrea_danica Hypocrea_decipiens Hypocrea_delicatula Hypocrea_dorotheae Hypocrea_epimyces Hypocrea_estonica Hypocrea_eucorticioides Hypocrea_flaviconidia Hypocrea_fomiticola Hypocrea_gelatinosa Hypocrea_jecorina Hypocrea_koningii Hypocrea_leucopus Hypocrea_lixii Hypocrea_longipilosa Hypocrea_lutea Hypocrea_megalocitrina Hypocrea_melanomagna Hypocrea_microcitrina Hypocrea_minutispora Hypocrea_moravica Hypocrea_neorufa Hypocrea_nigrovirens Hypocrea_novaezelandiae Hypocrea_nybergiana Hypocrea_ochroleuca Hypocrea_pachybasioides Hypocrea_parapilulifera Hypocrea_parepimyces Hypocrea_parestonica Hypocrea_parmastoi Hypocrea_petersenii Hypocrea_phyllostachydis Hypocrea_pilulifera Hypocrea_placentula Hypocrea_protopulvinata Hypocrea_pseudostraminea Hypocrea_psychrophila Hypocrea_pulvinata Hypocrea_rodmanii Hypocrea_rogersonii Hypocrea_rufa Hypocrea_schweinitzii Hypocrea_semiorbis Hypocrea_seppoi Hypocrea_sinuosa Hypocrea_sp.1 Hypocrea_sp.10 Hypocrea_sp.11 Hypocrea_sp.12 Hypocrea_sp.13 Hypocrea_sp.14 Hypocrea_sp.15 Hypocrea_sp.16 Hypocrea_sp.17 Hypocrea_sp.18 Hypocrea_sp.2 Hypocrea_sp.3 Hypocrea_sp.4 Hypocrea_sp.5 Hypocrea_sp.6 Hypocrea_sp.7 Hypocrea_sp.8 Hypocrea_sp.9 Hypocrea_spinulosa_CBS121272 Hypocrea_spinulosa_CBS121280 Hypocrea_spinulosa_CBS311.50 Hypocrea_stilbohypoxyli Hypocrea_straminea Hypocrea_strictipilosa Hypocrea_subalpina Hypocrea_sulawesensis Hypocrea_sulphurea Hypocrea_surrotunda Hypocrea_tawa Hypocrea_thailandica Hypocrea_thelephoricola Hypocrea_tremelloides Hypocrea_victoriensis Hypocrea_virens Hypocrea_virescentiflava Hypocrea_viridescens Hypocrea_voglmayrii Protocrea_farinosa Protocrea_pallida Trichoderma_aggressivum Trichoderma_arundinaceum Trichoderma_asperellum Trichoderma_austrokoningii Trichoderma_brevicompactum Trichoderma_cerinum Trichoderma_erinaceus Trichoderma_fertile Trichoderma_hamatum Trichoderma_helicum Trichoderma_intricatum Trichoderma_koningiopsis Trichoderma_longibrachiatum Trichoderma_oblongisporum Trichoderma_ovalisporum Trichoderma_paucisporum Trichoderma_protrudens Trichoderma_pubescens Trichoderma_rossicum Trichoderma_saturnisporum Trichoderma_scalesiae Trichoderma_spirale Trichoderma_strigosum Trichoderma_stromaticum Trichoderma_theobromicola Trichoderma_tomentosum ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=41; TAXLABELS Hypocrea_aeruginea_CBS120541 Hypocrea_alni_CBS120633 Hypocrea_alni_CPK2494 Hypocrea_alni_CPK2854 Hypocrea_alni_CPK2858 Hypocrea_aureoviridis_CPK2848 Hypocrea_aureoviridis_CPK2849 Hypocrea_aureoviridis_CPK2857 Hypocrea_brunneoviridis_CBS120928 Hypocrea_brunneoviridis_CBS121130 Hypocrea_brunneoviridis_CPK2425 Hypocrea_ceramica_CBS114576 Hypocrea_dacrymycella_WU29044 Hypocrea_danica_CBS121273 Hypocrea_epimyces_CBS120534 Hypocrea_epimyces_CPK1980 Hypocrea_epimyces_CPK2417 Hypocrea_epimyces_CPK2487 Hypocrea_estonica_CBS111147 Hypocrea_estonica_CBS121556 Hypocrea_gelatinosa_CPK1618 Hypocrea_lixii_CPK1934 Hypocrea_lixii_CPK1935 Hypocrea_lixii_CPK1941 Hypocrea_longipilosa_CBS120953 Hypocrea_parepimyces_CBS122768 Hypocrea_parepimyces_CBS122769 Hypocrea_parestonica_CBS120636 Hypocrea_parestonica_CPK2427 Hypocrea_phyllostachydis_CBS114071 Hypocrea_sinuosa_CPK1595 Hypocrea_sinuosa_CPK2008 Hypocrea_spinulosa_CBS121272 Hypocrea_spinulosa_CBS121280 Hypocrea_spinulosa_CPK1510 Hypocrea_strictipilosa_CPK1601 Hypocrea_strictipilosa_CPK3135 Hypocrea_thelephoricola_CBS120925 Hypocrea_thelephoricola_CPK2480 Trichoderma_cerinum_CBS120637 Trichoderma_tomentosum_CPK2563 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4581] TITLE tefgreen; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1405; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Hypocrea_aeruginea_CBS120541 ?????????????????????TTACTTCATTAATTCAATTCT------CGTTTCA----CATTTCAATGTGGTCG--AA-CTTTCAACAGAGTTCT---GTCAACCACG--------CGTCACCCCGCTTTCTG--TTATCGTTACCCC--TCCTTCACAGCAACGCCAAAA----AAAATTTGCAGCCTCGAA---TTTTT----TGTG-GGGTTGCA---CCCCACCAA-------TTATTTTTTTCC-GCGC-----------------CGATGT-CTCTCAA-TA--T-GCTCT-GCGCCTTTGAT----CATGTTTTAA--TCCATGCTAAT---------CCC-ATCA-TAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTT-ACACCTGATGTACCAAGTGCTTCTCATTTTCAATCCGATGCTAACA------TGCTACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATCCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTTGGTGTCAAGCAGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTTGCCGCCTCCAGCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCTGGCAAGGTCACCGGCAAGACCCTCCTTGAGGCCATTGACTCCATCGAGCCTCCCAAGCGTCCTACGGAGAAGCCCCTTCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGGAACGGTCCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGCATGGTCGTCACCTTTGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTCTTCCCGGTGACAACGTTGGCTTCAACGTGAAGAACGTTTCCGTTAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCCTGGGTGCCGCTTCTTTCACTGCCCAGGTCATCATCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCCCCCGTCCTTGAC????????????????????????????? Hypocrea_alni_CBS120633 ????????????????????????GATTTTCGCCTCGA-TTCT--CCC---TTCA----CATCCAATTGTGCTCGATCA-TTCTGAAGAGAATCTTCGTGTCGACAATTTTT-----CACCACCCCGCTTTG--------GGTTACCCC--TCATTTGCAGCGACGCAAA------TTTTTTTGCTGT-CGTTTG--GTTTT----AGTG-GGGTCCCTTGTGTA-CCCC---------ACTAGCTCACTGC-TTTTTTTGTGCTTCACTCTCACTGC-TCAGCCATCA----TTCAGCGCGCTC---TGTCTCTCATCATGCA--GCGATGCTAACCAC----TTTTCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGCGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-CTACATCAACT-----TCATGCTGCGATTGCGAGCCAGTGCTAACAGACAATTCT--CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACCGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGCTTGGCAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGACCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCACCGAGGGTCAGCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCCTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGCCAGGTCGGTGCCGGCTACGCCCCCGTC??????????????????????????????????? Hypocrea_alni_CPK2494 ?????????????????????????????????CTCGA-TTCT--CCC---TTCA----CATCCAATTGTGCTCGATCA-TTCTGAAGAGAATCTTCGTGTCGACAATTTTT-----CACCACCCCGCTTTG--------GGTTACCCC--TCATTTGCAGCGACGCAAA------TTTTTTTGCTGT-CGTTTG--GTTTT----AGTG-GGGTCCCTTGTGTA-CCCC---------ACTAGCTCACTGC-TTTTTTTGTGCTTCACTCTCACTGC-TCAGCCATCA----TTCAGCGCGCTC---TGTCTCTCATCATGCA--GCGATGCTAACCAC----TTTTCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGCGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-CTACATCAACT-----TCATGCTGCGATTGCGAGCCAGTGCTAACAGACAATTCT--CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACCGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGCTTGGCAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGACCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCACCGAGGGTCAGCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCCTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGCCAGGTCGGTGCCGGCTAC???????????????????????????????????????????? Hypocrea_alni_CPK2854 ?????????????????????????TGACTTCGCTCGA-TTCT--CCC---TTCA----CATCCAATTGTGCTCGATCA-TTCTGAAGAGAATCTTCGTGTCGACAATTTTT-----CACCACCCCGCTTTG--------GGTTACCCC--TCATTTGCAGCGACGCAAA------TTTTTTTGCTGT-CGTTTG--GTTTT----AGTG-GGGTCCCTTGTGTA-CCCC---------ACTAGCTCACTGC-TTTTTTTGTGCTTCACTCTCACTGC-TCAGCCATCA----TTCAGCGCGCTC---TGTCTCTCATCATGCA--GCGATGCTAACCAC----TTTTCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGCGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-CTACATCAACT-----TCATGCTGCGATTGCGAGCCAGTGCTAACAGACAATTCT--CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACCGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGCTTGGCAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGACCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCACCGAGGGTCAGCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCCTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGCCAGGTCGGTGCCGGCTACGCC????????????????????????????????????????? Hypocrea_alni_CPK2858 ??????????????????????????????CGACTCGA-TTCT--CCC---TTCA----CATCCAATTGTGCTCGATCA-TTCTGAAGAGAATCTTCGTGTCGACAATTTTT-----CACCACCCCGCTTTG--------GGTTACCCC--TCATTTGCAGCGACGCAAA------TTTTTTTGCTGT-CGTTTG--GTTTT----AGTG-GGGTCCCTTGTGTA-CCCC---------ACTAGCTCACTGC-TTTTTTTGTGCTTCACTCTCACTGC-TCAGCCATCA----TTCAGCGCGCTC---TGTCTCTCATCATGCA--GCGATGCTAACCAC----TTTTCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGCGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-CTACATCAACT-----TCATGCTGCGATTGCGAGCCAGTGCTAACAGACAATTCT--CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACCGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGCTTGGCAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGACCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCACCGAGGGTCAGCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCCTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGCCAGGTCGGTGCCGGCTACGCCCCC?????????????????????????????????????? Hypocrea_aureoviridis_CPK2848 ????AGAGGTAAGCTGAATCAACGAATTCTCATCCCCATTTT-------CCTCGG----GCCTCGATTGTGACGAGCAA-TTCTTCATCGAATTCCCTTGTCAACGAGTTTC-----CGTCACCCCGCTTTCACACTGCCCATTACCCC--TCCTTTGCTGCGGCGTGCAAT-TTTTTTTTTGGCAGCCTTCAT----TTTT----AGTG-GGACTGCA----CCAGCTG-----CTCCGCCACTGTTCAACAGCTTATTGCAACCTCATTGCCTCTT-ACCTCGTCAATTCCATTCGAACGCTTTTAATCA-T--CCCTCTCA--GTGATGCTAACCATC---TTTCCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATTGCTCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTCTGCCTCATGACTC----TTTGCTCGCCCTTTGCAAGCCTGTACTGATGCGAGTTTTGTACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCCGTTCTCATCATTGCCGCCGGTACTGGTGAGTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAACTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGCTTGAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGCGCCGCTTCCTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCCGTCCTCGACTGCCACACTGCCCACAT???????????? Hypocrea_aureoviridis_CPK2849 ?TCGAGAGGTAAGCTGAATCAACGAATTCTCATCCCCATTTT-------CCTCGG----GCCTCGATTGTGACGAGCAA-TTCTTCATCGAATTCCCTTGTCAACGAGTTTC-----CGTCACCCCGCTTTCACACTGCCCATTACCCC--TCCTTTGCTGCGGCGTGCAAT-TTTTTTTTTGGCAGCCTTCAT----TTTT----AGTG-GGACTGCA----CCAGCTG-----CTCCGCCACTGTTCAACAGCTTATTGCAACCTCATTGCCTCTT-ACCTCGTCAATTCCATTCGAACGCTTTTAATCA-T--CCCTCTCA--GTGATGCTAACCATC---TTTCCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATTGCTCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTCTGCCTCATGACTC----TTTGCTCGCCCTTTGCAAGCCTGTACTGATGCGAGTTTTGTACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCCGTTCTCATCATTGCCGCCGGTACTGGTGAGTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAACTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGCTTGAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGCGCCGCTTCCTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCCGTCCTCGACTGCCACACTGCCCACATGCC????????? Hypocrea_aureoviridis_CPK2857 ????????????????????AACGAATTCTCATCCCCATTTT-------CCTCGG----GCCTCGATTGTGACGAGCAA-TTCTTCATCGAATTCCCTTGTCAACGAGTTTC-----CGTCACCCCGCTTTCACACTGCCCATTACCCC--TCCTTTGCTGCGGCGTGCAAT-TTTTTTTTTGGCAGCCTTCAT----TTTT----AGTG-GGACTGCA----CCAGCTG-----CTCCGCCACTGTTCAACAGCTTATTGCAACCTCATTGCCTCTT-ACCTCGTCAATTCCATTCGAACGCTTTTAATCA-T--CCCTCTCA--GTGATGCTAACCATC---TTTCCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATTGCTCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTCTGCCTCATGACTC----TTTGCTCGCCCTTTGCAAGCCTGTACTGATGCGAGTTTTGTACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCCGTTCTCATCATTGCCGCCGGTACTGGTGAGTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAACTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGCTTGAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGCGCCGCTTCCTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCCGTCCTCGACTGCC????????????????????????? Hypocrea_brunneoviridis_CBS120928 ????????????????????????????????GCTCGA-TTCT--CCCCGCTTCA----CATTCAATTGCGTCCGACAA-TTCTGAAGGGAATTTTCGTGTCGACAACTTTT-----CATCTCCCCGCTTTC--------CGTTACCCC--TCCTTTGCAGCAACGCAAAAT----TTTTTTTGCTGTGCTTTTG--GTTTT----AGTG-GAGTTTCTTGTGCA-CCCC---------ACTAGCTCACTGC-TTTTTT-GTGCTTGACTCTCACTTCGCCAGTCATCA----TTCAACGTGTTCC-GTGTCTTTGGTCATTCA--GCGATGCTAACCAC----TTTTTCATCAATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTCCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-CTTCATCAACT-----TTATGCTACAATTGCAAGCCAGTGCTAACAGGCAATTCG--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACTGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGCTTGGCAAGTACACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGATAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGTTGAGGGTCAACCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTACGCCCCCGTCCTTGACTGCCACACTGCTCACATC??????????? Hypocrea_brunneoviridis_CBS121130 ??CGAGAAGGTAAGCTCATCAACTGATTTTCGCCTCGA-TTCT--CCCCGCTTCA----CATTCAATTGCGTCCGACAA-TTCTGAAGGGAATTTTCGTGTCGACAACTTTT-----CATCTCCCCGCTTTC--------CGTTACCCC--TCCTTTGCAGCAACGCAAAAT----TTTTTTTGCTGTGCTTTTG--GTTTT----AGTG-GAGTTTCTTGTGCA-CCCC---------ACTAGCTCACTGC-TTTTTT-GTGCTTGACTCTCACTTCGCCAGTCATCA----TTCAACGTGTTCC-GTGTCTTTGGTCATTCA--GCGATGCTAACCAC----TTTTTCATCAATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTCCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-TTTCATCAACT-----TTATGCTACAATTGCAAGCCAGTGCTAACAGGCAATTCG--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACTGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGCTTGGCAAGTACACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGATAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGTTGAGGGTCAACCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTACGCCCCCGTCCTTGACTGCCACACTGCCCACATC??????????? Hypocrea_brunneoviridis_CPK2425 ?TCGAGAAGGTAAGCTCATCAACTGATTTTCGCCTCGA-TTCT--CCCCGCTTCA----CATTCAATTGCGTCCGACAA-TTCTGAAGGGAATTTTCGTGTCGACAACTTTT-----CATCTCCCCGCTTTC--------CGTTACCCC--TCCTTTGCAGCAACGCAAATT----TTTTTTTGCTGTGCTTTTG--GTTTT----AGTG-GAGTTTCTTGTGCA-CCCC---------ACTAGCTCACTGC-TTTTTT-GTGCTTGACTCTCACTTCGCCAGTCATCA----TTCAACGTGTTCC-GTGTCTTTGGTCATTCA--GCGATGCTAACCAC----TTTTTCATCAATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTCCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-CTTCATCAACT-----TTATGCTACAATTGCAAGCCAGTGCTAACAGGCAATTCG--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACTGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGCTTGGCAAGTACACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGATAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGTTGAGGGTCAACCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTACGCCCCCGTCCTTGACTGCCACACTGCCCACATTGCCTGCAAGTT Hypocrea_ceramica_CBS114576 ??????GCGAGAAGGTAAGCTCAATCAACTGATTCACGCCTCAACTTTCCCTTCA----CATTCAATTGTGCCCGACCA-TTCTGAACGGAAT-CTCGTGTCAA-CACAATTTT-T-CATCACCCCGCTTTCGC--TTCCCATTACCCC--TCCTTTGCAGCGACGCAGAAA----TTTTT--GCTGCCTCTGG---ATTTT----AGTG-GGGTTGTACCAGTAACCCC------ACTACTACTACTCA-CTACTTTTTGCACTTCTCTACCAC-AC-CCAGTGGTCA----TTC--AACGCCTTTGTCCCTCGTCACTTTGA--GCGATGCTAACCATA---CTTCT-CTCAACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-ATTCATCACCT-----CAATGCGGCTGTGGCAAACAAATGCTAACAGAAATCTCG--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCTACGGACAAGCCCCTTCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCCGTCCTCGACTGC?????????????????????????? Hypocrea_dacrymycella_WU29044 ???????????????TATCGCATCGCCCCCTTCCCCCCCGGCGACCCTCTCTTCA----TAGTCAATTTTGATGGGCGA-TTCTGAACAGAACTCCCGTATCAAA--CAATTTTT--CATCACCGCGCTTTC--------CTTTACCCC--TCGTTGACAGCGACGCAAAT-----TTTTTTTGATGTCCTTTGG---TTTT----AGTG-GGGTTTTCTTCACGCCCCA----------CTCGCCAA---CTGG-TTTTGTGCTTCCCTCTCACTAT-TCAGTCGCCA----TCCAACGTGTCTCTGTGTCCT--CAATTCCA--GCGATTCTAACTAACCAATGTTATATCGATAGGAAGCCTCTGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTTCTATGTCACCGTCATTGGTATGTCTG-GCTCATCAACT-----TCATGCGGCAATTACAAGCCAGTGCTAATAAATGCTTCA--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTTGAGGCTGGTATTTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGTCCGAGGAGCGTTACAAGGAAATCATCAAGGAGACCTCCAGCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTCGAGGATTCTCCAAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGATCAAGAGTGGCAAAGTCACCGGCAAGACCCTCCTTGATGCTATCGACGCTATCGAGTCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTCCCCCTCCAGGATGTGTACAAGATCAGTGGCATCGGAACAGTCCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGCATGGTCGTTACCTTCGCCCCCGCCAACGTTACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCCAGGAGGGTTTACCCGGTGACAACGTGGGTTTCAACGTGAAGAACGTTTCCGTGAAGGACATTCGCCGTGGCAACGTTGCCGGTGACTCCAAGGACGACCCCCCCTCGGGTGTCGCTCATTTCACCGCCCAGAT-ATCGTCATGAACCACCCCGGCCAGATCGGTGCCGGCTACGCCCCGCTCG?????????????????????????????????? Hypocrea_danica_CBS121273 ?????????????????????????????TAATGCCTATTTC------CTTTTCG----CATTCAATCGTGATGGGAAA-ACTCC--CGGTTTTCTCATGTCAACCACATTTC----TATCACCCCGCTTTCGC--CTGTCGCTACCCCCCTCCTTCGCACCAGCGCACAAAGTTTTTTTTTTTCAGCCTTGCAAATCTTTT----AGTGCGGGGGTCAAAGCCCCGCTGAGCGCGCCTTCCTTTTTTCT-GTCCTTTTTTCG---------CGAATG-ACCTCATCCA--TCGCACAAATGCTCTTAAT----CGTCTTTTCA--GCCATGCTAATCAAT---TTCCC-ATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTTTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT----TCTCATGA-------TGCACTCACCATCTTCCA-TATG-GCTAACAA----CCTCGACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCTCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCTACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGAACGGTCCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGCATGGTCGTCACCTTTGCCCCCTCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCTCCGAGGGTAACCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCCTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCCCCCGT???????????????????????????????????? Hypocrea_epimyces_CBS120534 ??????????????????????????????????TCGA-TTCT--CCC---TCCG----CATTCAATTGTGCTCGATCA-TTTCGAAGAGAATTTTCGTGTCGATAATTCTT-----CATCACCCCGCTTTC--------CGTTACCCC--TCCTTTGCAGCGACACAA-------TTTTTTTGCTGT-CGTTGG--GTTTT----AGTG-GGGTTCCCTGTGCA-CCCC---------ACTAGCTCACTGCCTTTTTTTGTGCTTCACTCTCACTGC-CCAGCCGTCG----TTCAACGTGCTC---TGTCTC--GTCATTCA--GCGATGCTAACCACT---TTTTCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTC-CTTCATCATCT-----TGATGCAGCAATCACGAGCCAGTGCTAACAGGCAATTCA--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCTTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACCGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCAAAAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCGCGAGTGGCAAGTTCACAGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGAGAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAGGCCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTACGCCCCCGTCT?????????????????????????????????? Hypocrea_epimyces_CPK1980 ?????????????????????????????????CTCGA-TTCT--CCC---TCCG----CATTCAATTGTGCTCGATCA-TTTCGAAGAGAATTTTCGTGTCGATAATTCTT-----CATCACCCCGCTTTC--------CGTTACCCC--TCCTTTGCAGCGACACAA-------TTTTTTTGCTGT-CGTTGG--GTTTT----AGTG-GGGTTCCCTGTGCA-CCCC---------ACTAGCTCACTGCCTTTTTTTGTGCTTCACTCTCACTGC-CCAGCCGTCG----TTCAACGTGCTC---TGTCTC--GTCATTCA--GCGATGCTAACCACT---TTTTCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTC-CTTCATCATCT-----TGATGCAGCAATCACGAGCCAGTGCTAACAGGCAATTCA--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCTTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACCGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCAAAAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCGCGAGTGGCAAGTTCACAGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGAGAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAGGCCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTACGCCCCCGTCT?????????????????????????????????? Hypocrea_epimyces_CPK2417 ??????????????????????????????????TCGA-TTCT--CCC---TCCG----CATTCAATTGTGCTCGATCA-TTTCGAAGAGAATTTTCGTGTCGATAATTCTT-----CATCACCCCGCTTTC--------CGTTACCCC--TCCTTTGCAGCGACACAA-------TTTTTTTGCTGT-CGTTGG--GTTTT----AGTG-GGGTTCCCTGTGCA-CCCC---------ACTAGCTCACTGCCTTTTTTTGTGCTTCACTCTCACTGC-CCAGCCGTCG----TTCAACGTGCTC---TGTCTC--GTCATTCA--GCGATGCTAACCACT---TTTTCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTC-CTTCATCATCT-----TGATGCAGCAATCACGAGCCAGTGCTAACAGGCAATTCA--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCTTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACCGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCAAAAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCGCGAGTGGCAAGTTCACAGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGAGAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAGGCCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTACGCCCCCGTCT?????????????????????????????????? Hypocrea_epimyces_CPK2487 ???????????????????????????????GACTCGA-TTCT--CCC---TCCG----CATTCAATTGTGCTCGATCA-TTTCGAAGAGAATTTTCGTGTCGATAATTCTT-----CATCACCCCGCTTTC--------CGTTACCCC--TCCTTTGCAGCGACACAA-------TTTTTTTGCTGT-CGTTGG--GTTTT----AGTG-GGGTTCCCTGTGCA-CCCC---------ACTAGCTCACTGCCTTTTTTTGTGCTTCACTCTCACTGC-CCAGCCGTCG----TTCAACGTGCTC---TGTCTC--GTCATTCA--GCGATGCTAACCACT---TTTTCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTC-CTTCATCATCT-----TGATGCAGCAATCACGAGCCAGTGCTAACAGGCAATTCA--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCTTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACCGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCAAAAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCGCGAGTGGCAAGTTCACAGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGAGAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAGGCCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTACGCCCCCGTCTCCTACCC??????????????????????????? Hypocrea_estonica_CBS111147 ???????????AAGGTAAGCTCAATCAACTGATTCTCACCTCAACCTTCCCTTCG----CATTCAATTTTGCCCGACAA-TTCTGAACGGAATTCTCTTGTCAA-CACAATTTTTT-CATCACCCCGCTTTCGC--TTCCCATTACCCC--TCCTTTGCAGCGACGCAATTT----TTTTTTTGCTGTTCTTTG---GTTTT----AGTG-GGGTGACACCAGCAACCCC------ACCACTGCCACTCG-CTGCTTTTTGCACTTCTCTACCACTAC-CCAGTGGTCA----TTC--AACGCCTTTGTCCCTCATCACTTTCA--GCGATGCTAACCATA---TTTCT-CTCAACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-ATTCATCACCT-----CAATGCGGCAATGGCGAACAAATGCTAACAGAAATCTCG--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTGTTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCCGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCCGTCCTCGACTGCCACACTGCCCAC?????????????? Hypocrea_estonica_CBS121556 ???????????????????????????????????CTACCTCA-CCTTCCCTTCG----CATTCAATTTTGCCCGACAA-TTCTGAACGGAATTCTCTTGTCAA-CACAATTTTTT-CATCACCCCGCTTTCGC--TTCCCATTACCCC--TCCTTTGCAGCGACGCAATTT----TTTTTTTGCTGTTCTTTG---GTTTT----AGTG-GGGTGACACCAGCAACCCC------ACCACTGCCACTCG-CTGCTTTTTGCACTTCTCTACCACTAC-CCAGTGGTCA----TTC--AACGCCTTTGTCCCTCATCACTTTCA--GCGATGCTAACCATA---TTTCT-CTCAACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-ATTCATCACCT-----CAATGCGGCAATGGCGAACAAATGCTAACAGAAATCTCG--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTGTTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCCGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCCGTCCT????????????????????????????????? Hypocrea_gelatinosa_CPK1618 TTCTCGCGTCACTTCCACTTGATTGTTATTCAGTTGTGCTCGACAATTCTGTTCAGAGTCATCCAGTTGTGCTCGACAA-TTCTGTTCAGAGTCATCGAGCCAA---CAATTTTTT-CATCACCCCGCTTTCGC--TTCACTTTACCCC--TCCTTTGCAGCAATGCAAATT----TTTG---GCCGTCTCTTG---GTTTT----AGTG-GGGTGGCACCAGCATTCCCCCC--CACCACCACCTCTCA-CTGCTTTCTGCTCTTGTCTACCGCTAC-ACTGTTGCCA----TTC--AGCGCTTTTGTGTCTCGT----------GCGATGCTAACCGCC---TTTCC-CTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACTGTCATTGGTATGTCTG-ATCTATGACCG-----TCCTCCGACA---GCTAGCCCGTGCTAATCGAAGTCTCACACAGATGCTCCCGGCCATCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCTCTGCTCGCCTACACTCTTGGTGTCAAGCAGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCTGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACTGGCAAGACCCTCCTCGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATCGGAACGGTCCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGCATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCTTTCACTGCTCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGATATGCCCCCGTCCTTGACTGCCAC??????????????????????? Hypocrea_lixii_CPK1934 ?????????????????????????GATTTCGCCTCGAATTCTA-TCCTCCTTCA----CATTCAATTGTGCCCGACAA-TTCTGCAGAGAATTTTCGTGTCGACAATTTTT-----CATCACCCCGCTTTC--------CATTACCCC--TCCTTTGCAGCGACGCAAAAA----ATTTTTTGCTGTCGTTTGG--TTTTT----AGTG-GGGTTCTCTGTGCAACCCC---------ACTAGCTCACTGC--TTTTTCCTGCTTCACTCTCACTTC-CTAGTCATCA----TTCAACACGCTTT-GTGGCTTTGGTCATTCA--GCGATGCTAACCAC----TTTTCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCC----TCATCAATC-----TCATGGTGCAACTGCGAGCTAGTGCTAACATGCAATTCA--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTTCACCGGCAAGACCCTCCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGT-AAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTAACGCCCCGTCTA????????????????????????????????? Hypocrea_lixii_CPK1935 ?????????????????????????GATTTCGCCTCGAATTCTA-TCCTCCTTCA----CATTCAATTGTGCCCGACAA-TTCTGCAGAGAATTTTCGTGTCGACAATTTTT-----CATCACCCCGCTTTC--------CATTACCCC--TCCTTTGCAGCGACGCAAAAA----TTTTTTTGCTGTCGTTTGG--TTTTT----AGTG-GGGTTCTCTGTGCAACCCC---------ACTAGCTCACTGC--TTTTTCCTGCTTCACTCTCACTTC-CTCGTCATCA----TTCAACACGCTTT-GTGGCTTTGGTCATTCA--GCGATGCTAACCAC----TTTTCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCT----TCATCAATC-----TCATGGTGCAACTGCGAGCTAGTGCTAACATGCAATTCA--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTTCACCGGCAAGACCCTCCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGT-AAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTAACGCCCCGTCTA????????????????????????????????? Hypocrea_lixii_CPK1941 ?????????????????????????GATTTCGCCTCGAATTCTA-TCCTCCTTCA----CATTCAATTGTGCCCGACAA-TTCTGCAGAGAATTTTCGTGTCGACAATTTTT-----CATCACCCCGCTTTC--------CATTACCCC--TCCTTTGCAGCGACGCAAAAA----TTTTTTTGCTGTCGTTTGG--TTTTT----AGTG-GGGTTCTCTGTGCAACCCC---------ACTAGCTCACTGC--TTTTTCCTGCTTCACTCTCACTTC-CTCGTCATCA----TTCAACACGCTTT-GTGGCTTTGGTCATTCA--GCGATGCTAACCAC----TTTTCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCC----TCATCAATC-----TCATGGTGCAACTGCGAGCTAGTGCTAACATGCAATTCA--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTTCACCGGCAAGACCCTCCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGT-AAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTAACGCCCCGTCTA????????????????????????????????? Hypocrea_longipilosa_CBS120953 ??????????????TAAGCTCAATCCAACTGATTCACAACCCAAATTCTCCCTTGG---CGTTCAATTGTGCCCGACAA-TTC--AACGGAATTCTCGTGTCAA---CAATTTTTT-CGTCACCCCGCTTTCGC--TTCACACTACCCC--TCCTTTGCAGCGACGCAAATT----TTTTT--GCTGTCGTTTG---ATTTT----AGTG-GGGGCGCAC-AGCAACCCC------ACCACTGCCATTCA-CTGGTTTTTGCACTTCACTACAACT-C-CCAGCTGCCA----CTC--AGCACCTCTATATCTCGTCACTTTCA--GCGATGCTAACCATC---TTTCC-CCCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-ATTCATCATTT-----CTGTGCTGCGTCTGCAAGCTTGTGCTAATGCAAACATGA--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCCATTCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGAGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACCGGCAAGACCCTTCTTGAGGCTATCGACGCCATCGAGGCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTGCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCCGCCGCTTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGATACGCCCCCGTCCTTGATTGCCACACTGC?????????????????? Hypocrea_parepimyces_CBS122768 ??????????????TAAGCGCCAACTGATTTCGCCTGA-TTCT--CCC---TCCA----CATTCAATTGTGCGCGATCA-TTCTGCAGAGAATTTTCGTGTCGACAATGTTT-----CATCACCCCGCTTTC--------CGTTACCCC--TCCTTTGCAGCGGCGCAAAAAAA--TTTTTTTGCTGT-CGTTTG--GGTTG----AGTG-GGGTTCCCTGTGCA-CCCC---------ACTAGCTCACTGC-TTTTTTTGTGCTTCACTCTCACTGC-CCAGCCGTCA----TTCAACGTGCTC---TGTCTCTGGTCATTTG--GCGATGCTAACCACC---TTTTCCATCAATAGGAAGCCGCCGAACTCGGTAAGGGCTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTC-ATTCATCACCT-----TGTTGCCGCAATTGTGAGCCGCTGCTAACAGGCAATTCG--CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGCATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACCGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGTCGAAGGAGACCGCGACTGGCAAGTACACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAACCCCCCAAGCGTCCCACGGAGAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAGGCCCGGCATGGTCGTCACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCGGTCGAGATGCACCACGAGCAGCTCACCGAGGGTCGGCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCTTGGGTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTACGCCCCCGTTCTTGACTGCCACACTGCCCACAT???????????? Hypocrea_parepimyces_CBS122769 ??????????????TAAGCGCCAACTGATTTCGCCTGA-TTCT--CCC---TCCA----CATTCAATTGTGCGCGATCA-TTCTGCAGAGAATTTTCGTGTCGACAATGTTT-----CATCACCCCGCTTTC--------CGTTACCCC--TCCTTTGCAGCGACGCAAAAAAA--TTTTTTTGCTGT-CGTTTG--GGTTG----AGTG-GGGTTCCCTGTGCA-CCCC---------ACTAGCTCACTGC-TTTTTTTGTGCTTCACTCTCACTGC-CCAGCCGTCA----TTCAACGTGCTC---TGTCTCTGGTCATTCG--GCGATGCTAACCACC---TTTTCCATCAATAGGAAGCCGCCGAACTCGGTAAGGGCTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTC-ATTCATCACCT-----TGTTGCCGCAATTGTGAGCCGCTGCTAACAGGCAATTCG--CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGCATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACCGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGTCGAAGGAGACCGCGACTGGCAAGTACACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAACCCCCCAAGCGTCCCACGGAGAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAGGCCCGGCATGGTCGTCACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCGGTCGAGATGCACCACGAGCAGCTCACCGAGGGTCGGCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCCAGAACGACCCCCCCTTGGGTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTACGCCCCCGTTCTTGACTGCCACACTGCCCACAT???????????? Hypocrea_parestonica_CBS120636 ???????????????????????????ATACTGATCTACCTCA-CCCTCCCTTCA----CATTCAATTGTGCCCGACAA-TTCTGAACGGAATTCGCGTGTCAAACACAATTTTCT-CATCACCCCGCTTTCGC--TTCCCATTACCCC--TCCTTTGCAGCGACGCAAATT----TTTTT--GCTGTTCTTTG---GTTTT----AGTG-GGGTGACACCAGCAACCCC------ACCACTGCCACTCA-CTGCTTTTTGCACTTCTCTACCACTAC-CCAGTGGTCC----TTC--AACGCCTTTGTCCCTC---GCTTTCA--GCGATGCTAACCATA---TTCCT-CTCAACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-ATTCATCACCT-----CAATGCGGCAATGACGAACAAATGCTAACAGAAATCTGG--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCAGCGGCAAGACCCTCCTTGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCTACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCTACT??????????????????????????????????? Hypocrea_parestonica_CPK2427 ???????????????????????????ATACTGATCTACCTCA-CCCTCCCTTCA----CATTCAATTGTGCCCGACAA-TTCTGAACGGAATTCGCGTGTCAAACACAATTTTCT-CATCACCCCGCTTTCGC--TTCCCATTACCCC--TCCTTTGCAGCGACGCAAATT----TTTTT--GCTGTTCTTTG---GTTTT----AGTG-GGGTGACACCAGCAACCCC------ACCACTGCCACTCA-CTGCTTTTTGCACTTCTCTACCACTAC-CCAGTGGTCC----TTC--AACGCCTTTGTCCCTC---GCTTTCA--GCGATGCTAACCATA---TTCCT-CTCAACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-ATTCATCACCT-----CAATGCGGCAATGACGAACAAATGCTAACAGAAATCTGG--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCAGCGGCAAGACCCTCCTTGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCTACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCTACT??????????????????????????????????? Hypocrea_phyllostachydis_CBS114071 ???????????????TAAGCTCAATCAAATGATTCTCGCCTCATTTTTTCCCTTTCA--CACTCAATTGTGCCCGAGAA-TTCTGAACAG--TTCTCTTGCCAA---CATTTTTTTTCGTCACCCCGCTTCCGC--TTCCCATTACCCC--TCCTTTGTAGCGACGCAAATT----TTTTTG-GCTGTCCCTTT---TTTTTTTTAAGTG-GGGGCGCACCGGCAACCCC------ACCACTGCCACT---------TTTGCCCTTCACTGCCGTTAT-CCAGTTACCA----TTTCAAACGCTTTTGTGTGTCATCACTTTCACAGCGATGCTAACCATT---TTTCC-CTCGATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGCATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCTCAACTACGTGGTCACCGTCATTGGTATGTCTG-ATCCATCACCT-----CGATGCGGCATTCGCAAGCCTATGCTAACGCAAACTTGA--CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGTGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTATCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGCCCTCCAAAAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTTCAGCGGCAAGACCCTTTTTGAGGCTATCGACGCCATCGAGCCCCCCAAACGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTACCCTCAAGCCCGGCATGGTCATCACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAACTCGCTGAGGGCTTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGATATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCTCGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGATATGCCCCCGTCCTTGACTGCCACACTGCCCACT????????????? Hypocrea_sinuosa_CPK1595 ?????????TAAGCTCAATCAACTGATTCCGACTCTGATTTTT-TCCCCATTTCC----TGCTCAATTGTGACGGAAAAATTCTCAACGGAATTCTCTTGTCAACATTTTTTTTT-GCATCACCCCGCTTTCAC--TTCCCATTACCCC--TCCTTTGCAGCGACGCAAAAA-TTTTT-----GCAGCCTCGAG----TTTT----AGTG-GGGTCGCT----TGTGCACACCCCCCCCACTACCATTCA-CTGCTTTTTTGCCCTTGACTGCGTGT--ACCTTGTCA---TCATTCCA-CGCTCTTGATCA-TCTCTTTTTCA--GCGATGCTAACCATC---TTTCC-ATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTT-CTGCACGGATC----TT-GTTCCATGTTCGCCAGCCCGTACTAATGCCAATTTG--ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACCGGCAAGACCCTCCTTGAGGCCATTGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGTGGTATTGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACACCAAGAACGACCCCCCCATGGGCGCCGCTTCTTTCACCGCCCAGGTCATTGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCCGTCCTTGACTGCCACACTGC?????????????????? Hypocrea_sinuosa_CPK2008 ???????????????CAATCAACTGATTCCGACTCTGATTTTT-TCCCCATTTCC----TGCTCAATTGTGACGGAAAAATTCTCAACGGAATTCTCTTGTCAACATTTTTTTTTTGCATCACCCCGCTTTCAC--TTCCCATTACCCC--TCCTTTGCAGCGACGCAAAAA-TTTTT-----GCAGCCTCGAG----TTTT----AGTG-GGGTCGCT----TGTGCACACCCCCCC-ACTACCATTCA-CTGCTTTTTTGCCCTTGACTGCGTGT--ACCTTGTCA---TCATTCCA-CGCTCTTGATCA-TCTCTTTTTCA--GCGATGCTAACCATC---TTTCC-ATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTT-CTGCACGGATC----TT-GTTCCATGTTCGCCAGCCCGTACTAATGCCAATTTG--ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACCGGCAAGACCCTCCTTGAGGCCATTGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGTGGTATTGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACACCAAGAACGACCCCCCCATGGGCGCCGCTTCTTTCACCGCCCAGGTCATTGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCCGTCCT????????????????????????????????? Hypocrea_spinulosa_CBS121272 ?????????????????????????TAAGCTTTGTTCA-TTT------TCCTTCA----CATTCAATAGTGGCAGAGAA-CTCCCAACGGATTTCTTCTGTCAAC---GTTTC----CATCACCCCGCTC-------TGTCGTTACCCC--TCATTGGTGCCTACGCAAA------AATTTTTGCAGCCTTGAA----ATTT----AGTGCGAGTGGCAGGGCCC-ACCGAGCGC--CTTCCTTTTTTCT-GTCCTTTTTTTCTCTCTTT--CAATGG-ACAGCATCTA--TCGCACTCGCG-TTTTGATGATCTTTATTTTCA--GCCATGCTAATCATT---TTCCC-ATCAATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTTTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-CCTCTTAATCT----TTACGTTACTATTCGCCAGCATGTGCTAACC-----CCAATACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCGGCTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGGCCACCGGCAAGACCCTTCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTGCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGAACGGTTCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGCATGGTCGTTACCTTTGCTCCCTCCGGTGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGCCGAGGGTAACCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCCAGGCTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTATGCCCCCGTCCTCGACTG??????????????????????????? Hypocrea_spinulosa_CBS121280 ??????????????????TAAGCTTTTTTATTTTTTTA-TTT------TTCTTCA----CATTCAATTGTGGCAGAAGA-CTCCCAACGGATTTCTTCTGTCAACCACGTTTC----CATCACCCCGCTCTCAC--TTGTCGTTACCCC--TCATTGGCACCTACGCAAA------TTTTTTTGCAGCCTTGAA----TTTT----AGTGCGGGTAGCAGGGCCC-ACCGAGCGC--CTTCCTTTTTTCT-GTCCTTTTTCTCTCTCTTC--CGATGG-ACTGCATCTA--TCGCACTCACGCTTTTGATCATCTTTATTTTCA--GCCATGCTAATCATT---TTCCC-ATCAATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTTTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-CCTCTTAATCT----TGATGCTACTATTTGCCAGCATGTGCTAACC-----CCAAGACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGGCCACCGGCAAGACCCTTCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTGCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGCATGGTCGTTACCTTTGCTCCCTCCGGTGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGCCGAGGGTAACCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCCAGGCTGCCGCTTCTTTCACCGCTCAGGTCATTGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTATGCCCCCGTCCTCGACTG??????????????????????????? Hypocrea_spinulosa_CPK1510 ?????????????????????????TAAGCTATTTTCAATTT------TCCTTCA----CATTCAATTGTGGCAGGGAA-CTTCCAACGGATTTCTTCTGTCAAC---GTTTC----CATCACCCCGCTCTCAC--TTGTCGTTACCCC--TCATTAGCGCCTACGCAAA------TTTTTTTGCAGCCTTGAA----TTTT----AGTGCGGGTGGCAGGGCCC-ACCGAGCGC--CTTCCTTTTTTCT-GTCCTTTTTTTTTCCCCTCTCCGATGG-ATTGCATCTA--TCGCACTCGCTCTTTTAAT---CTTTATTTTCA--GCCTTGCTAATCATT---TTCCC-ATCAATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTTTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-CCTCGTAATCT----TGATGCTACTATTCGCCAGCATGTGCTAATC-----CCAAACCAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGGCCACCGGCAAGACCCTTCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCTCTCCGTCTGCCCCTTCAGGATGTGTACAAGATTGGCGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGCATGGTCGTTACCTTTGCTCCTTCCGGTGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGCCGAGGGTAACCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCCAGGCTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGTCAGGTCGGTGCCGGCTATGCCCCCGTCCTCGACTG??????????????????????????? Hypocrea_strictipilosa_CPK1601 ?????????????????????????????TGATTCGCGCCCAAAATTTCCCTTCA----CATTCAGTTGTGCCCGACGA-TTCT------------TGTGTCGA---CAATTTTTTTCGTCACCCCGCTTTCGC--TTCACATTACCCC--TCCTTTGCCGCGACGCAGATT----TTTTTTTGCTGTCTCT-G---GTTTT----AGTG-GGGTG-TACCGGCAACCCC---------ACTGCCGCTCA-CTG--TTCTGCCCTTCATTACCACTGC-CCAGT-GTCA----TTC--AACGCTTTTGTGCCTGTC-ACTTGCA--GCGATGCTAACCATG---TTTCC-CTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATCGCTCTGTGGAAGTTCGAGACTCCCAGGTACTATGTCACCGTCATTGGTATGTCTG-ATTCATCACAT-----TCATGCGGCATCGGCAAGCATGTGCTAACACAAA-CTCG-ACAGACGCTCCCGGCCATCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGTGCTATCCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTTCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGAGACAACATGCTCCAGGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACCGGCAAGACCCTTCTGGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGATGTGTACAAGATCGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCCGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCCGTCCTTGATTG??????????????????????????? Hypocrea_strictipilosa_CPK3135 ???????????????TAAGCTCAATTCACTGATTCTCGCCCAAAATTTCCCTTCA----CATTCAGTTGTGCCCGACGA-TTCT------------TGTGTCGA---CAATTTTTTTCGTCACCCCGCTTTCGC--TTCACATTACCCC--TCCTTTGCCGCGACGCAGATT----TTTTTTTGCTGTCTCT-G---GTTTT----AGTG-GGGTG-TACCGGCAACCCC---------ACTGCCGCTCA-CTG--TTCTGCCCTTCATTACCACTGC-CCAGT-GTCA----TTC--AACGCTTTTGTGCCTGTC-ACTTGCA--GCGATGCTAACCATG---TTTCC-CTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATCGCTCTGTGGAAGTTCGAGACTCCCAGGTACTATGTCACCGTCATTGGTATGTCTG-ATTCATCACAT-----TCATGCGGCATCGGCAAGCATGTGCTAACACAAA-CTCG-ACAGACGCTCCCGGCCATCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGTGCTATCCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTTCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGAGACAACATGCTCCAGGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACCGGCAAGACCCTTCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGATGTGTACAAGATCGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCCGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCCGTCCTTGATTG??????????????????????????? Hypocrea_thelephoricola_CBS120925 ??????????????????????CTGATTCCTACTCTGATTTT------CATTCCA----TGCTCAGTTGTGACGGACAA-TTCTCAACGGAATTATCCTGTCGACAATCTTT-----CATCACCCCGCTTTCAC--TTCCCATTACCCC--TCCTTTGCAGCGACGCAAAAA-AATTT-----GCAGCCTCGAA----TTTT----AGTG-GGGTCGGC----TGTGCAT-----CCCCACCACCATCCA-CTGCTTTTT-GCCCTTGACTGCGTGT--ACCT-GTCA---TCATTCCA-CGCTCTTCATC------TCTTTCA--GCGATGCTAACCATG---TTTCC-ACCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATCGGTATGTCTT-CTTCACGGATC----CC-GTTGCTCATTCGCCAGCCTGTACTAATGCCGATTCG--ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTGTTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGAACAGTCCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGCGACACCAAGAACGACCCCCCCATGGGCGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-TCCT????????????????????????????????? Hypocrea_thelephoricola_CPK2480 ????????????????AGCATTCTGATTCCTACTCTGATTTT------CATTCCA----TGCTCAGTTGTGACGGACAA-TTCTCAACGGAATTATCCTGTCGACAATCTTT-----CATCACCCCGCTTTCAC--TTCCCATTACCCC--TCCTTTGCAGCGACGCAAAAA-AATTT-----GCAGCCTCGAA----TTTT----AGTG-GGGTCGGC----TGTGCAT-----CCCCACCACCATCCA-CTGCTTTTT-GCCCTTGACTGCGTGT--ACCT-GTCA---TCATTCCA-CGCTCTTCATC------TCTTTCA--GCGATGCTAACCATG---TTTCC-ACCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATCGGTATGTCTT-CTTCACGGATC----CC-GTTGCTCATTCGCCAGCCTGTACTAATGCCGATTCG--ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTGTTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGAACAGTCCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGCGACACCAAGAACGACCCCCCCATGGGCGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-TCCTA???????????????????????????????? Trichoderma_cerinum_CBS120637 ?????????????????????ACTGATTTTCGCCTCGA--TCC--CCC---TTCA----CATTCAATTGTGCTCGACAA-TTCTGAATAGAATTTTCGTGTCGACAATTTTT-----CACCACCCCGCTTTC--------TATTACCCC--TCCTTTGCAGCGACGCAAA------TTTTTTTGCTGT-CTTTGA--GTTTT----AGTG-GGGTTCTTTGTGTA-CCCC---------ACTAGCTCACTGC--TTTTTTCTGTTTCGCTCTCACTAC-CCAGTCGTCA----CTCAACGCGCTTT-GTGTCTTGTCACTTTCA--GCGATGCTAACCAC----TTTTCCGTCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTACGTCTG-ATTCACCAACT-----TCATGCATCAATTGCAAGTCAGTGCTAACAGAAATTCCA--CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGAGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACCGGCAAGACCCTTCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTTAGGTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGATACGCC????????????????????????????????????????? Trichoderma_tomentosum_CPK2563 ??????????????????????????ATTTCGCCTCGA--ATC--CCC---TACA----CATTCAATTGTGCTCGACAA-TTCTGAATAGAATTTTCGTGTCAACAATTTTT-----CACCACCCCGCTTTC--------CATTACCCC--TCCTTTGCAGCGACGCAAA------TTTTTTTGCTGT-CTTTTG--ATTTT----AGTG-GGGTTCTCTGTGTA-CCCC---------ACTAGCTCACTGC--TTTTT-CTGTTTTGCTCTCGCTAC-CCAGTCGTCA----TTCAACGCGCTTT-GTGTCTTGTCACTTTCA--GCGATGCTAACCAC----TTTTTCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-ATTCACCAACT-----TCATGTATCAATTGCAAGTCAGTGCTAACAGAAGTTCCA--CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGAGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACTGGCAAGACCCTTCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTTGGATTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCTTTCACCGCCCAGGT-ATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC?????????????????????????????????????? ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = tefgreen) = N: 1-1405; CODONPOSSET * CodonPositions (CHARACTERS = tefgreen) = N: 1-1405; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4664] TITLE rpbtefcomb; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2919; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aphysiostroma_stercorarium ????????????????????????????????????????????????????????????CTGTTCCGTGGTATCATGCGAAGGATGAACACCGAGCTGGCCAACTATCTAAGACGCTGTGTTGAGGGTAACCGACACTTCAACCTTGCTGTTGGTATTAAACCTGGCACGCTTTCTAACGGCTTGAAGTACTCTCTTGCCACTGGTAACTGGGGTGACCAGAAGAAGGCCATGAGCTCTACCGCAGGTGTGTCTCAGGTGCTTAACCGCTATACATTTGCTTCTACTCTATCACATTTGCGTCGTACCAACACACCCATTGGACGAGACGGCAAGCTGGCCAAACCACGACAACTGCACAACACACACTGGGGCTTGGTCTGCCCAGCAGAGACACCTGAAGGACAGGCTTGTGGCTTGGTCAAAAACTTGTCTTTGATGTGTTATGTCAGTGTCGGATCTCCTTCCGAGCCTCTGATCGAGTTCATGATCAATAGAGGTATGGAAGTCGTCGAAGAGTATGAGCCACTGCGGTATCCTCATGCTACAAAGATCTTCGTGAACGGTGTCTGGGTTGGAGTCCATCA-AGACCCCAAA-CATCTCGTGAACCAAGTTCTGGATACTCGTCGTAAATCCTATCTACAGTACGAAGTGTCTCTTATCAGAGACATCCGAGACCAGGAATTCAAAATCTTCTCTGACGCGGGTCGTGTTATGCGACCTGTCTTTACCGTTCAGCAAGAAGATGACCCGGATACGGGCATTAACAAAGGCCACTTGGTCTTGACCAAGAGCCTTGTCAATCAGCTTGCGAAGGAACAGGCTGAACCCCCAGAAGATCCTAGCCAGAAACTTGGTTGGGAGGGCTTAATTAGGGCTGGTGCGGTTGAATATCTCGATGCGGAAGAAGAGGAGACGTCTATGATTTGCATGACTCCCGAAGATCTTGAGCTCTATCGTCTTCAGAAAGCTGGCATTGCCACGGAAGAAGACATGGGAGACGATCCGAATAAGCGACTCAAGACAAAAACGAATCCAACAACTCACATGTACACGCATTGTGAAATTCACCCCAGCATGATCTTAGG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TCGCTT--GAATTTTTGTGCCA-ATT--TCT-----TGCGCGCCACCCC--GCTTTCTCTGCCTCTACCCCTCCTTT-GGCGCACGC----AAATTTTTT------TTGCTGCCAC-GTTAAT-TTT-AGTGGG---ACTGTTGATCG-------CAACCCC------GCCAC-TGCCCTCGACTTC--AATCTGTG-TGACCGTCAGCGTCA--TCACAGCATTGTGTGATTCATTTCGTCCAGCTCTGTCGCTCAGTTT-GCC------GTTTGTTTC-AACCATGCTAACCAT-GTTCCTGTCTATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTTATTGGTATGTA---------TTTTCTACGTCGTGAATTTTGTTTCC--CGTCAAACTCGTCGCTAATTCAAT-----------CCCACAGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGATTACTGGTACTTCCCAGGCTGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACTCTGGGTGTTAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGTTGACTGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTTCTCGAGGCCATCGACTCCATCGAGGCTCCCAAGCGTCCCTCCGACAAGCCCCTCCGTCTGCCCCTTCAGGACGTGTACAAGATCGGTGGTATCGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGCTGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCTCCCCAGGGTGCTGCTTCTTTCACCGCCCAGGTCATCGTCATGA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_aeruginea ????????????????????????????????????????????????????????CCAGCTGTTTCGTGGCATCATGCGGAGGATGAACACCGAGTTGGCCAACTATCTGAGACGCTGCGTGGAAGGCAACCGACACTTCAACCTTGCTGTGGGTATCAAGCCCGGCACGCTCTCCAACGGACTGAAATACTCTCTTGCCACTGGAAACTGGGGCGACCAGAAAAAGGCCATGAGCTCGACTGCAGGCGTGTCTCAGGTGCTGAACCGCTACACGTTTGCTTCCACTCTGTCCCACTTGCGTCGTACCAACACACCCATTGGAAGAGATGGCAAGCTGGCCAAGCCTCGACAGCTTCACAACACGCATTGGGGGTTGGTATGCCCGGCCGAGACGCCCGAAGGACAGGCTTGTGGCCTGGTCAAGAACCTATCCTTGATGTGTTACGTCAGTGTCGGCTCCCCCTCGGAACCTCTGATTGAGTTCATGATCAACCGAGGGATGGAGGTCGTCGAAGAGTACGAGCCGCTGCGATATCCTCATGCCACCAAGATTTTTGTCAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCCAAG-CATCTGGTGAACCAGGTTCTCGACACCCGCCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTGGTACGAGAAATTCGAGATCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTGTTCACCGTTCAGCAAGAGGATGACCCCGAAACGGGAATCAACAAGGGTCATTTGGTCTTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAGGCCGAACCGCCCGAGGATCCAAGCATGAAGATGGGATGGGAGGGCTTGATCAGGGCTGGTGCGGTGGAGTATCTTGACGCCGAGGAAGAGGAGACGTCCATGATTTGCATGACACCGGAAGATCTCGAGCTCTATCGTCTTCAAAAAGCCGGTATCTCTACCGAAGAGGACATGGGAGATGACCCCAACAAGCGGTTAAAGACAAAGACCAATCCGACCACTCACATGTACACTCATTGCGAGATTCACCCGAGCATGATTCTGGGCATTTGTGCTAGTATCATTCCTTTTCCCGATCACAACCAGGTATGT-GT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTACTTCATTAATTCAATTCTCGT-----TTCACATTTCAATGTGGTCG--AA-CTTTCA------ACAGAGTTCT---GTCAA--C------CACG---CGTCACCCCGCTTTCTG--TTATCGTTACCCC--TCCTTCACAGCAACGC--CAAAA----------AAAATTT----GCAGCCTCGA-A---TT---TTT----TGTG-GGGTTGCA---CCC----CACCAA---------TTATTTTTTTCCGCGC-------------------CGATGTCTCTC--AA-TAT-GCTCT--G-CGCCTTTGAT----CATGT------TTTAA--TCCAT----GCTAAT-------CCCATCA-TAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTT-ACACCTGATGTAC-----CAAGTGCTTCTCATTTTCAATCCGATGCTAACA--TGCT---------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATCCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTTGGTGTCAAGCAGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTTGCCGCCTCCAGCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGGTCACCGGCAAGACCCTCCTTGAGGCCATTGACTCCATCGAGCCTCCCAAGCGTCCTACGGAGAAGCCCCTTCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGGAACGGTCCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGCATGGTCGTCACCTTTGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTCTTCCCGGTGACAACGTTGGCTTCAACGTGAAGAACGTTTCCGTTAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCCTGGGTGCCGCTTCTTTCACTGCCCAGGTCATCATCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCCCCC-GTCCTTGAC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_alcalifuscescens ???????????????????????????????????????????????????????????????????????????????????????AACACCGAGCTGGCCAACTACCTGAGACGATGCGTGGAGGGCAACCGGCACTTTAACCTTGCTGTTGGCATCAAGCCTGGCACGCTGTCCAACGGTCTGAAGTACTCGCTAGCCACCGGCAACTGGGGCGACCAGAAGAAGGCGATGAGTTCAACCGCGGGCGTGTCTCAGGTGCTCAACCGGTACACCTTTGCTTCGACTCTGTCGCATTTGCGACGTACCAACACGCCCATCGGAAGAGATGGCAAGCTGGCAAAGCCGCGACAACTCCACAACACGCACTGGGGCCTGGTCTGTCCTGCCGAGACCCCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACCTGTCGCTGATGTGTTACGTCAGCGTCGGGTCTCCTTCCGAGCCCCTGATTGAGTTCATGATTAACAGGGGCATGGAAGTCGTCGAAGAGTACGAGCCTCTTCGGTATCCCCAT-CCACGAAGATCTTTGTCAACGGCGTCTGGGTCGGAGTTCATCA-GGACCCCAAG-CACCTGGTCAACCAGGTCTTGGACACGCGTCGCAAATCCTACCTGCAGTATGAGGTCTCTCTCATTCGAGACATCCGAGACCAGGAGTTCAAAATCTTCTCTGATGCCGGCCGCGTCATGCGCCCCGTATTGACTGTGCAGCAAGAGGATGACCCGGACACGGGCATCAACAAGGGCCACCTAGTCTTGACCAAAGACTTGGTCAACCGGCTGGCCAAGGAGCAGGCCGAGCGCCCCGAAGACCCAAGCATGAAGCTTGGATGGGAAGGGCTGATCAGGGCCGGCGCAGTCGAGTATCTCGATGCCGAAGAAGAAGAGACATCGATGATTTGCATGACGCCCGAGGACCTTGAACTTTATCGTCAGCAGAAAGCTGGTGAGGCTGTCGACGAGGATCCCGGTGATGATCCCAACAAGAGGCTCAAGACGAAGACGAATCCAACCACTCACATGTACACCCACTGCGAGATTCACCCTAGCATGATCCTAGGTATCTGCGCCAGCATCATAC?GTTCCCCGACCACAACCAGGTACGT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATCGAGAAAGTCGAGAAGGTAAGATACCACTCTGCTTGGTTTTGTTCAACGTCTCTTCACTGG------GAAATGGTCTATTACCGCTCA--TGGAAATTGTC-GACATTTCTCTGAGCTGATTTTGAATATTACCCCTCTTTGGTGCG-CAC--AAATTTTCG------GCGAG------GCCTAATTGG-CTCTGG---CGGGGT-CAAACTCGCATCCCCGCCATAGCGAGCAGGCGGAGATAA--------TTTTT----TTTGTGCAACAGC--TTCTCATTACGCC--AGCCTCATCAGAAGCATCATCGCCTGGAGGGCA--------CGTCTCGTCTCTACGATGCTAATATTGTCTCTGTCTACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGGTACTATGTCACCGTCATTGGTATGTTGGAAAATGCCTATTC-------TTGCGCT--TATTCGGGCAAAATTGACTAACGTGCAATGT-------------GCAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCTGTTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCTTACACCCTGGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACATCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCCGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTGGCTGCCTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTTCTCGAGGCCATTGACGCCATTGAGCCTCCCAAGCGCCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGACGTCTACAAGATTGGCGGTATCGGAACGGTCCCTGTCGGCCGTATCGAGACGGGTATCCTCAAGCCCGGCATGGTCGTCACCTTTGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACATCAAGAACGTGTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGCGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCCGGCCAGGTCGGTGCTGGTTACGCTCCT-GTCCTTGACTGCCACACTGCCCACATTGCCCTGCAAGT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_alni ?????????????????????????????????????????GGCGGTCCTGCTGGCCA-GCTGTTCCGTGGCATCATGCGAAGGATGAACACCGAATTGGCCAACTATCTGAGACGGTGCGTTGAAGGTAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACTCTTTCAAACGGATTGAAGTATTCTCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCTGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTGGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTCGGAATTCACCA-AGACCCTAAG-CACTTGGTGAACCAGGTTCTAGACACTCGTCGCAAGTCCTATCTCCAGTACGAAGTCTCTCTCGTGAGAGAAATCCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAACAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCCGAGCCTCCGGAAGACCCCAGCATGAAGATGGGATGGGAGGGATTGATTAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACACCAGAGGATCTCGAAATGTATCGTCTTCAGAAGGCCGGTATTAACACCGAGGAAGACATGGGAGATGATCCGAACAAGCGACTCAAGACAAAGACAAACCCCACAACTCACATGTACACCCATTGCGAGATTCATCCAAGTATGATCTTAGGCATTTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGTCGTCCACCCTTCCACTTCCAGTCTATCAATGAAGAAAATACTAACGGCCCGTGCA????????????????????????????????????????????????????????????????????????????????????????????????????????????????GATTTTCGCCTCGATTCTCCC-----TTCACATCCAATTGTGCTCGATCA-TTCTGA------AGAGAATCTTCGTGTCGA-----CAATTTTT---CACCACCCCGCTTTG--------GGTTACCCC--TCATTTGCAGCGACGC--AA------A------TTTTTTT----GCTGT-CGTT-TGG--T---TTT----AGTGGGGTCCCTTGTGTA-----CCCCAC--TAGCTCACTGC-TTTTTTTGTGCTTCACTCTCACTGC-------TCAGCCATC--ATTCAGCGCGCTC---TGTCTCTCAT--------C------ATGCA--GCGAT----GCTAACCAC-TTTTCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGCGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-CTACATCAA---C-----TTCATGCTGC--GATTGCGAGCCAGTGCTAACAGACAATTC-------------TCAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACCGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---CTTGG---CAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGACCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCACCGAGGGTCAGCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCCTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGCCAGGTCGGTGCCGGCTACGCCCCC-GTC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_alutacea ?????????????????????????????????????TGGCGGGTC-ACTGCTGGCCA-GTTGTTCCGTGGTATCATGCGAAGGATGAATACTGAGTTGGCCAACTACCTGAGACGGTGTGTTGAGGGTAACCGACATTTCAACCTCGCTGTTGGTATTAAACCCGGCACGCTTTCCAATGGGTTGAAGTATTCGCTTGCCACTGGAAACTGGGGTGACCAGAAGAAGGCTATGAGCTCGACAGCAGGTGTGTCACAGGTGCTTAACCGTTACACTTTTGCTTCGACACTGTCCCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGGCAGCTTCACAACACACATTGGGGCTTGGTCTGCCCGGCTGAGACACCTGAAGGACAGGCTTGTGGCCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGGTCTCCCTCTGAGCCTCTAATTGAGTTTATGATCAACAGAGGTATGGAAGTCGTCGAGGAGTACGAGCCACTGCGGTATCCCCATGCCACAAAGATTTTTGTGAACGGTGTCTGGGTTGGCATTCACCA-GGATCCCAAG-CATCTGGTGAACCAGGTGTTGGACACTCGTCGCAAATCTTATCTACAATACGAAGTCTCTCTGATCAGAGACATTCGTGATCAGGAATTCAAAATCTTCTCTGACGCAGGTCGTGTTATGCGTCCTGTTTTTACTGTGCAGCAAGAAGATGATCCGGAAACGGGCATTAACAAAGGCCACCTGGTCTTGACGAAGGATCTCGTCAACAGACTTGCAAAGGAGCAGGTCGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGCGCGGTGGAATATCTCGATGCAGAGGAAGAAGAGACGTCTATGATTTGCATGACCCCAGAGGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGCATTGCCACAGAAGAGGACATTGGAGATGATCCAAACAACCAACTCAAGACTAAGACGAACCCACCAACTCACATGTACACGCATTGCGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGT--CGACTT--GA------CAATTTCTTTT???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTTTTTTTTTAACTCATTTCTTCCCTTTTTATACCATGTAGCTGTGCTCG--ATAATTCTCT---GAATTTTCTTGCCAATTTC-CTTCTCTCTCCCACCGTCACCCCGCTTTCGCTACCTACCCCTCCTTTTGCC-------AACGAAAACTTTTTTTG----GGCTGGCTCTTTTGGCTTTA-GTGGGT-TGCTC----TTTATGTGGCAA--CTCCATCACTATCTC--CGACCACCAGTTCTTCGCCTCTCTTCTGTTCG-----------ATCAACGCTGCATTTTAATTTATCAAGCCGCGTTGCCTGCTCCGTTT------CCGTCGTTCCGTTAATGCTAATCATGTTTCCCTCA-ATAGGAAGCTGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTACGTTTTGATCTACTTT------AGATCGCCG-CAATCGAAAAG--CC-AACGCTAATAC-CAAATT-----------CCACAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATCCTCATTATCGCTGCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCTTGGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACCGCCAACTGGGCCGAGGCTCGTTACCAGGAAATTATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTTGCATTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGTTGGCTGAATCCTCCAACTGCTCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTTCCCCTCCAGGACGTGTACAAGATTGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACTACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGCCAGCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTTTCCGTCAAGGATATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCCTCTTTCAACGCCCAGGTCATTGTCATGAACCACCCTG-CCAGGTCAGTGCCGGATACGCACC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_americana ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATTAAACCCGGCACGCTTTCCAACGGCTTGAAGTATTCTCTTGCCACTGGCAACTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTATCTCAGGTGCTTAACCGTTATACCTTTGCTTCTACTCTATCACATTTGCGTCGTACCAACACGCCCATTGGACGAGACGGCAAGTTGGCAAAGCCACGACAACTGCACAACACACATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGCTTGGTCAAAAATTTGTCTCTGATGTGCTATGTGAGTGTCGGATCTCCCTCCGAGCCTCTGATCGAGTTCATGATCAACAGAGGTATGGAAGTTGTCGAAGAGTATGAGCCACTGCGGTATCCTCATGCTACAAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTCCATCAAGGATCCCAAAACATCTCGTGAACCAAGTTCTGGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTGTCTCTCATCAGAGACATTCGAGACCAGGAATTCAAAATCTTCTCTGACGCAGGTCGTGTTATGCGGCCTGTCTTCACAGTCCAGCAGGAAGATGACCCGGACACGGGCATTAACAAGGGTCACTTGGTCTTGACCAAGAGCCTCGTCAATCAGCTTGCGAAGGAGCAAGCCGAACCTCCAGAAGACCCGAGCTTGAAACTGGGCTGGGAGGGCTTAATTAGAGCTGGTGCGGTTGAATATCTCGATGCGGAAGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAAGATCTTGAGCTCTATCGTCTTCAGAAAGCTGGCATTGTCACAGATGAAGACATAGGAGATGATCCGAATAAGCGACTCAAGACAAAGACGAATCCAACGACTCACATGTACACGCATTGTGAAATCCACCCCAGCATGATG??AGGTATCTGTGCTAGTATCATTCCTTTCCCAGATCA????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---GACTT?ATCAAGAACATGATTACTGGTACTTCCCAGGCTGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTTGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCTGAGGCTCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGAGTGTCGCTTTCGTCCCCATCTCTGGCTTCAACGGTGACAACATGTTGGCTACCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTTCTCGAGGCTATCGACTCCATCGAGGCCCCCAAGCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATCGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCACTGAGGGCCACCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCTGTCAAGGAAATCCGTCGTGGAAACGTTGCCGGTGACTCCAAGAACGACCCCCCTATGGCTGCTGCTTCTTTCACCGCCCAGGTTATTGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGCCGTACCGGTAAGGCTACCGAGACCTCTCCCAAGTTCATCAAGTCTGGTGACTCTGCCATCGTCAAGATGATTCCTTCCAAGCCCATGTGTGTTGAGGCTTTCACCGAGTACCCTCCCCTGGGTCGTTTCGCCGTCCGTGACATGCGTCA Hypocrea_atrogelatinosa ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACCAATACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGTCAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACGCCCGAAGGACAGGCTTGTGGTCTAGTCAAAAACCTGTCTTTGATGTGTTATGTCAGTGTCGGTTCTCCCTCTGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTTGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CACTTAGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACAGGTATCGACAAGGGCCACCTGGTGTTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCTGAGGAAGAAGAGACATCCATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATTTCCACCGAGGAAGACATGGGAGATGATCCGAACAAGCGACTAAAGACAAAGACAAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGCATCTGTGCTAGTATCATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTTCTCGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCCCCCTCCAACGTCACCACGGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGCGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCCGCCGCTTCTTTCATCGCCCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTCCTTGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_atroviridis ????????????????????????????????????????????????CTGCTGGCCAAGCTGTTCCGTGGTATCATGCGCAGAATGAATACAGAGCTGGCCAACTACCTCAGACGATGTGTTGAGGGTAACCGCCACTTCAACCTTGCTGTTGGCATTAAGCCCGGCACACTTTCCAACGGACTAAAGTACTCGCTCGCCACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTCTCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTTTCCCATTTGCGCCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGTTTGGTGTGCCCGGCTGAGACCCCTGAAGGTCAAGCTTGTGGTCTGGTCAAGAATTTGTCTCTCATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCCCATGCTACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCACCA-AGACCCCAAG-CATCTGGTAAACCAAGTTTTGGATACTCGTCGCAAATCCTATCTGCAGTACGAGGTCTCTCTGATCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCTGACGCCGGCCGTGTCATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGACCTTGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTCGGATGGGAAGGGCTGATTAGAGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAGGATCTGGAGCTCTATCGTCTTCAAAAGGCCGGCATTGCCACGGATGAAGACATAGGAGACGATCCAAATAAGCGTCTCAAGACCAAGACAAATCCGACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGT--CAACCGAGAAG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATTTCTGCTTTTTCACTCCGCT-CCCTGAGCACAA-TCGTGTCCGACAATTCTGTCCTC----AGTCTTG--TCAT-TTTTTTTCCTCGCAGCATCA-CACCCCGCTTTACCTGTCT----ACCCCTCCTTTGGCACAGCA---AAA-TTTT------CTGGCTGCCTTGCTTGGCTTTT-AGTGGGG--TGCCAACTTTTTTTTGTTTGGCTGCAACCCCGCTATCGCCACT-GTCCC------------GTCCCAA--CGAAT-------TGTACTC----AATTGCATCGTCTT----CTCCAT--------------CTCTGTGTGGTTCATT-GTGCTAATCAT-GCTTCAATCAATAGGAAGCCGCCGAGCTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTTCGCTTTT--------CCTCATTGATACTTG--GAG-AC-CAAGATTCTAACGTGCCGCTC------------TGTAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATCCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCTTGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGTTGGCTGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTTCTCGAGGCCATTGACGCCATTGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTTCCCCTTCAGGATGTTTACAAGATCGGTGGTATTGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGTCGAGGGTGTCCCCGGTGACAACGTTGGATTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGTCC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_aureoviridis ????????????CATTTTGGAAAGAAGCGTCTCGATCTGGCGGGTCCCCTGTTGGCTAAGCTGTTCCGTGGCATAATGCGAAGGATGAACACCGAGCTGGCCAACTATCTGAGACGATGCGTTGAAGGCAACCGACACTTCAACCTTGCTGTTGGCATCAAGCCCGGTACGCTTTCGAATGGATTGAAGTACTCGCTTGCCACCGGAAACTGGGGTGATCAGAAGAAAGCCATGAGTTCAACAGCTGGTGTGTCCCAGGTGCTTAATCGTTACACGTTTGCTTCGACCCTGTCACATTTGCGCCGTACCAACACACCCATTGGAAGAGATGGTAAACTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGCTTGGTCTGCCCGGCCGAGACACCCGAAGGCCAAGCCTGTGGTCTGGTCAAAAACCTGTCGTTGATGTGTTACGTCAGTGTCGGTTCCCCTTCCGAACCTCTGATTGAGTTCATGATCAACCGAGGTATGGAGGTCGTCGAAGAGTACGAGCCACTGCGATATCCCCACGCAACCAAGATTTTTGTAAATGGTGTCTGGGTCGGAGTTCACCA-AGATCCTAAG-CACCTGGTGAACCAGGTTCTGGACACTCGCCGCAAGTCTTATTTGCAGTACGAAGTCTCTCTTGTCAGAGAAATTCGAGACCAGGAGTTCAAAATCTTTTCGGACGCAGGTCGTGTCATGCGGCCCGTGTTTACAGTTCAGCAGGAAGACGACCCTGAAACGGGCATCAACAAGGGTCATCTGGTATTGACCAAGGAACTCGTCAACAGACTGGCCAAAGAGCAGGCCGAACCCCCAGAGGACCCAAGCATGAAGATGGGGTGGGAGGGGTTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACATCCATGATTTGCATGACTCCAGAAGATCTCGAGCTCTATCGTCTTCAAAAGGCCGGTATTTCTACGGAAGAGGACATGGGAGATGATCCGAATAAGCGACTCAAGACAAAGACAAACCCAACAACTCACATGTACACTCATTGTGAAATTCACCCAAGCATGATATTGGGCATCTGCGCTAGTATTATTCCTTTCCCCGATCACAATCAGGTATGTCGTCAAGTCTTCCATTTTTGTTCTCGAAGAATCTCACTAACGGCTTGCCCAGTCGCCCCGTAATACTTACCAATCTGCATGGCAC??????????????????????????????????????????????????????????????AGAGGTAAGCTGAATCAACGAATTCTCATCCCCATTTT------CCTCGGGCCTCGATTGTGACGAGCAA-TTCTTC------ATCGAATTCCCTTGTCAA--C--GAGTTTC----CGTCACCCCGCTTTCACACTGCCCATTACCCC--TCCTTTGCTGCGGCGT--GCAATTT-T------TTTTTTG----GCAGCCTTCA-T----T---TTT----AGTGGGACTGCACCAGCTG---------C--TCCGCCACTGTTCAACAGCTTATTGCAACCTCATTGCC------TCTTACCTC--GTCAATTCCATTCGAACGCTTTTAATCAT---CCC------TCTCA--GTGAT----GCTAACCATCTTTCCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATTGCTCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTCTGCCTCATGAC---------TCTTTGCTCGCCCTTTGCAAGCCTGTACTGATGCGAGTTTTGT-----------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCCGTTCTCATCATTGCCGCCGGTACTGGTGAGTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAACTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGCTTGAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGCGCCGCTTCCTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCTCGACTGCCACACTGCCCACAT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_avellanea ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGCGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCCCAGGTGCTTAACCGGTACACTTTTGCCTCGACGCTATCACATTTGCGCCGTACCAACACGCCCATCGGCAGAGACGGCAAGTTGGCGAAGCCTCGACAGCTGCACAACACCCATTGGGGCTTGGTCTGTCCCGCCGAGACACCCGAGGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGATCTCCCTCGGAGCCCCTGATCGAGTTCATGATCAACAGAGGCATGGATGTCGTGGAAGAGTACGAGCCGTTGCGGTATCCCCACGCCACAAAGATCTTTGTGAACGGTGTCTGGGTGGGAGTCCACCA-GGACCCCAAG-CATCTGGTGAACCAAGTTCTGGACACGCGTCGCAAATCCTACCTGCAGTACGAGGTCTCCCTGATTAGAGACATTCGTGACCAGGAGTTCAAAATCTTCTCCGACGCAGGTCGGGTCATGCGTCCTGTCTTTACCGTTCAGCAGGAGGATGACCCGGAAACGGGCATCAACAAGGGCCATTTGGTTTTGACCAAGGATCT?GTCAACAGACTGGCAAAGGAGCAGGCTGAGCCTTCGGAAGACCCGAGCACAAAGGTTGGATGGGAGGGTTTAATTAGAGCCGGTGCGGTGGAATATCTCGATGCCGAGGAAGAAGAGACGACTATGATTTGCATGACGCCGGAGGACCTTGAGCTTTATCGTCTTCAGAAAGCTGGCATTGCCACCGATGAAGACCCGGGTGATGACCCGAACAAGCGACTCAAAACCAAGACGAACCCGACCACGCACATGTACACTCATTGCGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GAGTTTGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTTGCCATCAATAAGATGGACACTGCCAACTGGGCCGAGAATCGTTACCTGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTTGGCTACAACCCCAAAACCGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGCTTGCTGCCTCTACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCAACTGGCAAGACTCTTCTTGAGGCCATCGACAGCATCGATCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTCCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCTGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGTCGAGGGTGTACCCGGTGACAACGTTGGATTCAACGTGAAGAACGTCTCCGTCAAGGATATCCGCCGTGGCAATGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGCGCCGCTTCTTTCACCGCCCAGGTCATCATAATGAATCACCCTGGTGCGGTTGGCAATGGATACGCTCCC-GTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCATCGAGAAGATCGACCGCCGTACCGGCAAGGCTACCGAGAGTAACCCCAAGACCATCAAGTCTGGTGACTCCGCCATCGTCAAGATGGTTCCCT????????????????????????????????????????????????????????????????????????? Hypocrea_brunneoviridis ??????????????????????????????????????TGGCGGGTCCCTGCTGGCCA-GCTGTTCCGTGGCATCATGCGAAGGATGAACACTGAATTGGCCAACTACCTGAGACGGTGCGTTGAGGGCAATCGACACTTCAACCTTGCTGTGGGCATCAAGCCCGGCACGCTCTCAAACGGTTTAAAGTATTCGCTTGCCACAGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTCGCTTCGACCTTGTCACACTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGCAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAAAACCTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAATTCATGATCAACAGAGGTATGGAAGTCGTCGAGGAGTACGAGCCGCTGCGGTATCCTCATGCTACAAAGATTTTCGTGAACGGTGTCTGGGTTGGAGTCCACCA-AGACCCTAAG-CACTTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCCGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGGTTGGCCAAGGAGCAGGCTGAACCTCCAGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCGGTTGAGTATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAAGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTTCCACTGAGGAAGACATGGCAGATGATCCGAACAAGCGACTAAAGACCAAGACAAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGCATCTGCGCCAGTATCATTCCTTTCCCCGATCACAACCAGGTATGTCGTCCACTCTTCCAGTCTTATCAAGGAAAGAAAATACTAACGGCGCGTGCA????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GCTCGATTCTCCCC--GCTTCACATTCAATTGCGTCCGACAA-TTCTGA------AGGGAATTTTCGTGTCGA-----CAACTTTT---CATCTCCCCGCTTTC--------CGTTACCCC--TCCTTTGCAGCAACGC--AAAA----T------TTTTTTT----GCTGTGCTTT-TGG--T---TTT----AGTGGAGTTTCTTGTGCA-----CCCCAC--TAGCTCACTGC--TTTTTTGTGCTTGACTCTCACTTCG------CCAGTCATC--ATTCAACGTGTTCCG-TGTCTTTGGT--------C------ATTCA--GCGAT----GCTAACCAC-TTTTTCATCAATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTCCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-CTTCATCAA---C-----TTTATGCTAC--AATTGCAAGCCAGTGCTAACAGGCAATTC-------------GCAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACTGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---CTTGG---CAAGTACACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGATAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGTTGAGGGTCAACCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTACGCCCCC-GTCCTTGACTGCCACACTGCTCACATC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_candida ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGCGATCAGAAGAAAGCCATGAGTTCAACTGCAGGTGTGTCTCAGGTGCTTAACCGTTACACGTTTGCCTCGACCCTATCGCATTTGCGCCGTACCAACACACCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGCTTGGTCTGCCCAGCCGAGACACCCGAAGGACAAGCTTGTGGCCTGGTCAAAAACCTGTCGTTGATGTGTTACGTCAGTGTCGGTTCCCCTTCCGAACCTCTGATTGAGTTCATGATCAACCGAGGTATGGAGGTCGTCGAAGAGTACGAGCCTCTGCGATATCCCCATGCCACTAAGATTTTTGTAAATGGTGTCTGGGTCGGAGTTCACCA-AGATCCTAAG-CACCTGGTGAACCAGGTTCTGGACACTCGCCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCGGACGCAGGCCGTGTCATGCGGCCTGTGTTCACAGTTCAGCAGGAAGATGACCCTGAAACGGGTATCAACAAGGGTCATCTGGTACTGACCAAGGAGCTCGTCAACAGACTGGCCAAAGAGCAGGCCGAACCCCCAGAGGACCCAAGCATGAAAATTGGATGGGAGGGGCTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATTTGCATGACACCAGAAGATCTCGAGCTCTATCGTCTTCAAAAAGCCGGTATTTCTACGGAAGAGGACATGGGAGATGACCCGAATAAGCGACTAAAGACCAAGACAAACCCAACGACTCACATGTACACTCATTGTGAAATCCACCCAAGCATGATTTTGGGCATCTGCGCTAGTATTATTCCTTTCC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGCTTGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGTCGAAGGAGGTCGGT---GCCAA---CAAGTACGCCGGCAAGACCCTCCTTGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCCTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_catoptron ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCGCATTTGCGTCGTACCAACACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTTGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CACTTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTTGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAAGATGACGCCGAAACGGGCATCAACAAGGGCCACCTTGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGCTGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACTTCCATGATCTGCATGACGCCAGAGGATCTCGAACTGTATCGTCTTCAGAAGGCCGGCATCTCTACCGAGGAAGACATGGGAGATGATCCGAACAAGCGACTAAAGACCAAGACAAACCCGACGACTCACATGTATACCCATTGCGAGATTCACCCAAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTTGCTTTCGTCCCCATCTCTGGTTTCAACGGTGACAACATGCTTGAGGCCTCCAAGAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACGCCATCGAGGCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTTGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGCCCAGGGTGTTCCCGGTGACAACGTTGGATTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTCCTTGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_ceracea ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACCAATACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGTCAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACGCCCGAAGGACAGGCTTGTGGTCTAGTCAAAAACCTGTCTTTGATGTGTTATGTCAGTGTCGGTTCTCCCTCTGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTTGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CACTTAGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACAGGTATCGACAAGGGCCACCTGGTGTTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCTGAGGAAGAAGAGACATCCATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATTTCCACCGAGGAAGACATGGGAGATGATCCGAACAAGCGACTAAAGACAAAGACAAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGCATCTGTGCTAGTATCATTCCTTTCC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTTCTCGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCCCCCTCCAACGTCACCACGGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGCGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCCGCCGCTTCTTTCATCGCCCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTCCTTGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_ceramica ?????????GATCATTTTGGAAAGAAGCGTCTGGATCTGGCGGGTCCCCTGTTGGCCAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACCGAATTGGCCAACTATCTGAGACGGTGTGTTGAGGGCAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTCAACCGTTACACGTTTGCTTCGACCCTGTCACACTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCCCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAAAACCTGTCGTTGATGTGTTACGTCAGTGTAGGCTCTCCCTCCGAGCCCCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCCACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CATCTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTTGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAAGATGACCCTGAAACGGGCATCAACAAGGGCCACTTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCAAGCATGAAGATTGGGTGGGAGGGATTAATCAGGGCTGGCGCGGTCGAATATCTCGACGCTGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATTTCAACTGAGGAAGACATGGGAGATGATCCGAACAAGCGACTAAAGACAAAGACAAACCCAACAACTCACATGTACACCCATTGCGAGATCCACCCAAGCATGATCTTAGGTATCTGTGCCAGTATCATTCCTTTCCCCGATCACAACCAGGTATGTTGTCAACCCCCCAATCTCATTCTCAAAGAAATCTCTAACAGCGTTTACAGTCCCCCCGTAACACTTACCAATCTGCCA????????????????????????????????????????????????????????????????GCGAGAAGGTAAGCTCAATCAACTGATTCACG-CCTCAACTTTCCCT----T-CACATTCAATTGTGCCCGACCATTCT-GA------ACGGAAT-CTCGTGTCAA-CA--CAATTTT-T--CATCACCCCGCTTTCGC--TTCCCATTACCCC--TCCTTTGCAGCGACGC--AGAAA----------TTTTT------GCTGCCTCTG-GA---T---TTT----AGTGGGGTTGTACCAGTAA----CCCCACTACTACTACTCACTACTTTTTGCACTTCTCTACCAC-AC-------CCAGTGGTC--ATTC--AACGCCT--TTGTCCCTCGTC------AC------TTTGA--GCGAT----GCTAACCAT-ACTTCTCTCAACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-ATTCATCAC---C-----TCAATGCGGC--TGTGGCAAACAAATGCTAACAGAAATCTC-------------GCAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCTACGGACAAGCCCCTTCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCTCGACTGC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_chlorospora ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTCAACCGCTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACACCCATTGGAAGAGATGGCAAGTTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCCGCCGAGACACCCGAAGGGCAAGCTTGTGGTCTTGTCAAAAATCTGTCGTTGATGTGTTATGTCAGTGTCGGTTCCCCATCTGAACCTCTGATTGAGTTCATGATCAACCGAGGTATGGAAGTTGTAGAGGAGTATGAGCCACTACGATATCCTCATGCTACCAAGATTTTTGTCAACGGTGTATGGGTTGGAGTTCACCA-AGATCCCAAG-CACCTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCTTACTTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCGGGCCGTGTCATGCGACCTGTGTTTACCGTCCAGCAAGAAGATGACCCTGAAACGGGTATTAACAAGGGCCATTTGGTACTGACCAAGGAACTCGTCAATAGGCTGGCCAAGGAGCAGGCCGAACCTCCAGAGGACCCGAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACACCAGAAGATCTCGAGCTTTATCGCCTTCAAAAGGCTGGTATCTCTACTGAAGAGGACATGGGAGACGATCCGAACAAGCGATTGAAAACAAGGACAAACCCAACAACTCACATGTACACTCATTGTGAGATTCATCCAAGCATGATTTTGGGCATCTGCGCCAGTATTATTCCATTCC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATCGGTGGTATTGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACACCAAGAACGACCCCCCCATGGGCGCCGCTTCTTTCACCGCCCAGGTCATTGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCTTGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_chromosperma ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGCGATCAGAAGAAGGCCATGAGCTCAACTGCGGGCGTGTCCCAGGTGCTTAACCGTTACACGTTTGCCTCAACCCTATCGCATTTGCGTCGTACCAACACACCCATCGGGAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACGCACTGGGGTTTGGTCTGCCCGGCAGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAAAATCTGTCTTTGATGTGCTACGTCAGTGTTGGTTCACCCTCCGAACCGTTGATTGAGTTCATGATCAACAGAGGAATGGAAGTGGTCGAGGAGTACGAGCCGCTGCGATACCCGCATGCTACCAAGATTTTTGTTAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCCAAG-CACCTGGTGAACCAGGTGTTGGACACTCGTCGCAAATCATATCTGCAGTACGAAGTTTCGTTGGTCAGAGAAATCCGAGATCAGGAATTCAAAATCTTTTCCGATGCGGGCCGTGTCATGCGACCCGTATTCACCGTCCAGCAGGAAGATGACCCTGAAACAGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAACAGGCTGAACCGCCGGAAGACCCGAGCATGAAGATTGGGTGGGAGGGGCTGATTAGGGCTGGTGCGGTTGAATACCTCGATGCCGAGGAAGAGGAGACGGCTATGATTTGCATGACGCCAGAGGACCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATTTCTACCGAGGAAGACATGGGAGACGATCCGAACAAGCGACTGAAGACAAAGACAAATCCAACGACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTGGGCATCTGCGCCAGTATCATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTTCAGGCCTCCACCAACTGCCCTTGGTACAAGGGCTGGAACAAGGAGACCGCC---AATGG---CAAGTACACTGGTAAGACTCTCCTTGAGGCCATCGACTCCATTGAGCCTCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATTGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACCGGTATCCTCAAGCCCGGCATGGTCGTTACCTTTGCCCCCTCCAACGTTACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCACTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCTCCCATGGGTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCTCCC-GTCCTCGACTGCCACACTGCCCATATTGCCTGCAAGTTCGCCGAGCTTCAGGAGAAGATCGACCGT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_cinereoflava ???????????????????????????????????????????????????????????????????????????????????????AACACTGAACTGGCCAACTACCTGAGACGTTGCGTGGAAGGCAACCGCCACTTTAACCTTGCCGTGGGCATCAAGCCCGGCACCCTGTCAAACGGTCTCAAGTACTCGCTCGCCACTGGTAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCTGGTGTGTCTCAGGTGCTCAACCGATACACATTCGCATCGACCTTGTCCCATTTGCGACGTACCAACACGCCCATTGGAAGAGATGGCAAGTTGGCGAAGCCGCGACAACTTCACAACACCCACTGGGGTTTGGTCTGCCCTGCCGAGACCCCTGAAGGACAGGCCTGTGGTCTGGTCAAAAACCTGTCTCTGATGTGCTACGTCAGTGTTGGATCCCCGTCTGAGCCCCTCATTGAATTTATGATCAACAGAGGCATGGAAGTCGTCGAGGAGTATGAACCCCTTCGATATCCTCATGCCACCAAGATCTTTGTCAATGGTGTCTGGGTCGGTGTTCATCA-GGACCCCAAG-CATCTGGTCAACCAGGTCTTGGATACCCGTCGCAAGTCCTACCTGCAGTATGAAGTGTCCCTCATTCGAGATATCCGAGACCAGGAGTTTAAGATTTTCTCTGATGCCGGTCGCGTCATGCGCCCCGTATACACTGTCCAGCAAGAGGACGATCCGGAGACGGGCATCAACAAGGGCCACCTGGTTCTCACCAAGGACCTGGTCAACAGGCTGGCCAAGGAGCAGGCCGAGCCTCCCGAAGACCCGAGCATGAAGGTTGGATGGGAAGGGCTGATTAGGGCTGGTGCGGTCGAGTATCTCGATGCCGAAGAAGAAGAGACTTCGATGATTTGCATGACGCCGGAGGACTTGGAGCTCTACCGTCTCCAGAAGGCCGGTCACGCTATCGACGAGGACATGGCTGACGACCCCAACAAGCGACTCAAGACGAAGACGAATCCCACAACTCACATGTATACCCACTGTGAGATTCACCCTAGCATGATTCTCGGTATTTGCGCCAGTATCATTCCCTTTCCTGATCACAATCAGGTATGT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACCGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGTTGACTGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGAACAAGGAGACCAAA---GCCGG---CAGCTCCACCGGTAAGACTCTTCTCGAGGCCATTGACGCCATTGAGCCTCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGCGGTATCGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGCATGGTTGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGCCGAGGGTGTTCCCGGTGACAACGTCGGCTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCCCAGGTCATTGTCATGAACCACCCTGGCCAGGTCGGTGCCGGTTACGCTCCC-GTCCTTGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATTGACCGCCGTACCGGTAAGGCTGTTGAGGACAAGCCCAAGTTCATCAAGTCTGGTGACTCTGCCATTGTCAAGATGATTCCCTCCAAGC??????????????????????????????????????????????????????????????????? Hypocrea_cinnamomea ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTGTCGCATTTGCGTCGTACCAACACTCCCATTGGAAGAGATGGTAAGCTGGCCAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCTGAAGGACAGGCTTGTGGTCTAGTCAAAAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGTTATCCTCATGCGACAAAGATCTTTGTGAACGGCGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CACTTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTAAGAGAAATTCGAGACCAGGAATTCAAAATCTTCTCCGACGCAGGCCGTGTCATGCGACCTGTCTTTACTGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAACCTCCGGAAGATCCTAGCATGAAGATCGGATGGGAGGGATTAATCAGAGCCGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCCGAGGATCTTGAGCTGTATCGTCTTCAGAAGGCCGGTATTTCTACTGACGAAGATATGGGAGATGATCCGAACAAGCGACTCAAGACAAAGACAAATCCGACAACCCACATGTACACCCATTGCGAGATTCACCCAAGTATGATTTTAGGTATCTGTGCTAGTATCATTCCTTTCC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGAGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGGTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTTCTCAAGCCTGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTGCTTGATTGCCACACTGTCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_citrina ?????????????????????????????????????????????TCCCTGCTGGCCAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACCGAGTTGGCCAATTATTTAAGACGCTGTGTAGAGGGCAACAGACACTTCAACCTTGCTGTTGGTATTAAACCCGGTACGCTTTCCAACGGCTTGAAGTATTCTCTTGCCACTGGCAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTATCTCAGGTGCTTAACCGTTATACCTTTGCTTCTACTCTATCACATTTGCGTCGTACCAACACGCCCATTGGACGAGACGGCAAGTTGGCAAAGCCACGACAACTGCACAACACACATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGCTTGGTCAAAAATTTGTCTCTGATGTGCTATGTCAGTGTCGGATCTCCCTCCGAGCCTCTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTATGAGCCACTGCGATATCCTCATGCTACAAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTCCATCA-GGATCCCAAA-CATCTCGTGAACCAAGTTCTGGATACTCGTCGTAAATCCTATCTACAGTACGAAGTCTCTCTCATCAGAGACATTCGAGACCAGGAATTCAAAATCTTCTCTGACGCAGGTCGTGTTATGCGGCCTGTCTTTACAGTCCAGCAGGAAGATGACCCGGACACGGGCATTAACAAGGGTCACTTGGTCTTGACCAAGAGCCTCGTCAATCAGCTTGCGAAGGAGCAGGCCGAACCTCCAGAAGACCCGAGCCTGAAACTTGGTTGGGAGGGCTTGATTAGAGCTGGTGCGGTTGAATATCTCGATGCGGAAGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAAGATCTTGAGCTCTATCGTCTTCAGAAAGCTGGCATTGCCACGGATGAAGACATGGGAGATGATCCGAATAAGCGACTCAAGACAAAGACGAATCCGACGACTCACATGTACACGCATTGTGAAATCCACCCCAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCAGATCACAACCAGGTAGGTCGGCTTACTGATACATGCTTGATT-CACTTACTAACATTGTG--TAGTCCCCCCGTAACACCTACCAATCTGCCATGGGCAACAAGC????????????????????????????????????????????????????????????????CGAGAAGGTGAGATCAATTCAATGAATT-TTGATAT---TTTTCCTCCCATCCGAAGTCATTGTGCACGACAATTCACTC--GAATTTTCATGCCAAATT--TCTTGGAATGGTTG-CCACCCC-GCTTTCTCTTCC--TACCCCTCCTTT-GGCGCACACGC--AAAAATTTT------TTGCTGCCTTGGATGAT-TTA-AGTGG----GGCATTGACCG-------CAACTCC------GCCAC-TACCCTCGACTTAC-AATCTGTG-TGACCATCGG-------TGTCAGCATTGTG--ATTCATCTTGCTCATTT--------------------------TTGTTTC-AATCTCGCTAACCAT-GCTTCGCTTTATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTTATTGGTATGTG---------T----TATTTCGTGAATCTTTTCTTCGCCAA-----CTGGCGCTAATTCAAT-----------TCCATAGATGCTCCCGGCCACCGTGACTTCATCAAGAACATGATTACTGGTACTTCCCAGGCTGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGTTGACTGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTTCTCGAGGCTATCGACTCCATCGAGGCTCCCAAGCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATCGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACTACTGAAGTGAAGTCCGTTGAGATGCACCACGAGCAGCTCGCTGAGGGCCACCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATTCGTCGTGGCAACGTCGCCGGTGACTCCAAGAACGATCCCCCCATGGGCGCTGCTTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTCCTCGATTGCCACACTGCCCACAT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_costaricensis ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCTATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTCAACCGCTACACGTTTGCTTCGACCCTGTCGCATTTGCGTCGTACCAACACACCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCCGCCGAGACACCCGAAGGGCAAGCTTGTGGCCTGGTCAAAAACCTGTCGTTGATGTGTTACGTCAGTGTCGGTTCCCCATCCGAACCTCTGATTGAGTTCATGATCAATCGAGGTATGGAAGTTGTCGAAGAGTACGAGCCATTGCGATATCCTCATGCTACCAAGATTTTTGTGAACGGTGTATGGGTCGGAGTTCACCA-AGATCCTAAG-CACCTGGTGAACCAGGTTCTGGACACTCGTCGCAAATCTTACTTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTATTCACCGTTCAGCAAGAAGATGACCCCGAAACGGGTATCAACAAGGGCCATTTGGTACTGACCAAGGAACTCGTCAATAGGCTGGCCAAAGAGCAGGCCGAGCCTCCAGAGGACCCAAGCATGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAAACGTCCATGATCTGCATGACACCAGAAGATCTCGAGCTTTATCGCCTTCAAAAGGCTGGTATTTCCCCTGAAGAGGACATGGGAGATGATCCGAACAAGCGACTGAAGACAAAGACAAACCCAACGACTCACATGTCCACTCATTGCGAAATTCACCCA????????????????????----?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCCGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTGGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTTCTCGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGTGGTATTGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTCACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACACCAAGAACGACCCCCCCATGGGCGCCGCTTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCTTGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATTGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_crassa ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCCGGTGTGTCTCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACCCCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTGTGTCCAGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTTCTCCCTCCGAACCACTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGATATCCTCATGCTACCAAGATTTTCGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CATCTGGTGAACCAGGTTCTAGACACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAGGATGACCCTGAAACAGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAACAGATTGGCCAAGGAACAAGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGACTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAAGAAGAGGAGACGTCGATGATTTGCATGACACCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATCTCTACCGATGAAGACATGGGAGATGACCCGAACAAGCGACTCAAGACAAAGACCAACCCAACAACCCACATGTACACACATTGCGAGATTCACCCAAGCATGATCTTGGGCATCTGTGCTAGTATCATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTCCAGCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCTTGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_cremea ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTCAACCGCTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACGCCCATTGGAAGAGATGGCAAGTTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCCGCCGAGACACCTGAAGGGCAAGCTTGTGGTCTGGTCAAAAATCTGTCCTTGATGTGTTACGTCAGTGTCGGTTCCCCATCTGAACCTCTGATTGAGTTCATGATCAACCGAGGTATGGAAGTTGTGGAGGAGTATGAGCCACTACGATATCCTCATGCTACCAAGATCTTTGTGAACGGTGTATGGGTTGGAGTTCACCA-AGATCCCAAG-CACCTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCTTATTTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCGGGCCGTGTCATGCGACCTGTGTTTACCGTTCAGCAAGAAGATGACCCTGAAACGGGTATTAACAAGGGCCATTTGGTACTGACCAAGGAACTCGTCAATAGGCTGGCCAAGGAGCAGGCCGAGCCTCCAGAGGACCCGAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACACCAGAAGATCTCGAGCTTTATCGCCTTCAAAAGGCTGGTATCTCTACTGAAGAGGACATCGGAGACGATCCGAACAAGCGATTGAAAACAAAGACAAACCCAACAACTCACATGTACACTCATTGTGAGATTCATCCAAGCATGATTTTGGGCATCTGCGCCAGTATTATTCCATTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCTACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACACCAAGAACGACCCCCCCATGGGCGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTTCTTGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_crystalligena ?????????????????????????????????????????????????????????CAGCTGTTCCGTGGTATTATGCGAAGGATGAACACTGAATTGGCCAACTATCTGAGGCGTTGTGTGGAAGGTAATAGGCATTTCAATCTTGCTGTTGGCATTAAACCTGGTACGCTCTCCAACGGCTTGAAATATTCACTGGCCACTGGCAACTGGGGTGATCAGAAGAAGGCCATGAGTTCGACTGCAGGTGTATCTCAGGTGCTTAATCGCTATACTTTTGCTTCCACGCTGTCACATTTACGTCGTACCAACACACCCATTGGGAGAGATGGTAAATTGGCGAAGCCGCGACAACTTCATAACACACATTGGGGTTTGGTCTGCCCAGCTGAGACTCCTGAGGGACAGGCTTGTGGTTTGGTCAAAAACTTGTCTTTGATGTGCTATGTCAGTGTCGGGTCTCCCTCTGAACCCCTGATTGAGTTTATGATCAACAGAGGCATGGAAGTCGTAGAAGAATATGAGCCACTGCGATATCCTCATGCCACTAAGATCTTTGTCAACGGTGTCTGGGTTGGAGTACATCA-GGACCCCAAG-CATCTTGTCAATCAGGTTCTGGACACTCGTCGCAAATCCTATCTACAGTACGAAGTCTCTCTGATTAGAGACATCCGAGACCAAGAATTCAAAATCTTTTCTGACGCAGGTCGTGTGATGCGGCCTGTGTTTACCGTTCAGCAGGAGGATGACCCAGAGACGGGCATTAACAAAGGTCACTTGGTTTTAACAAAGGAACTGGTCAATAGGATTGCAAAGGAGCAGGCTGAGCCTCCAGACGACCCAAGCATGAAGATTGGATGGGAGGGTTTAATTAGGGCTGGTGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACATCCATGATTTGCATGACTCCGGAAGATCTTGAGCTCTATCGTCTTCAGAAAGCTGGTATTTCCACTGAGGAAGATCTGGGAGACGATCCAAACAAGCGACTCAAGACAAAGACAAACCCAACAACTCACATGTACACGCACTGTGAGATTCACCCGAGCATGATTTTAGGTATCTGTGCTAGTATCATTCCTTTCCCAGATCACAACCAGGTATGTG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ACTATAACTCCCGCCCGTATTCTCGTT------TT------TTTTGTGCTC-GA--ATTTTTTTTCCTGTTGGCGCACCCCGCTCCTCTGCCTACCCCTCCTTT--GGCGCAGAGAC--AAATTTGTT------TTGGGT-----GCCTCAATTG-GTTTGG---TGGGGC-AAATCTCGCCACA---------TTACTTC-ACTT-TGGCTTCTCTATCA-----------CTGTCGTCA----ACTTGTCA-TC--TCTGC-ACCAAGT--TTCTTCTGCT--GCTGCTGC------TTCTT--CTTAAATCATGCTGACCATGTCTTCTTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCGTGTCAACATCTCTCTCATTTCC-ATGTT--ACAACAGTTTGCTAATTATAATTTTTTTTTTTTTTTTTTCGTTAATAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGTGCTATCCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTTGGTGTCAAGCAGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTTGGCTTCAACCCCAAGTCTGTTGCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGTTGGCTGCCTCTAGCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGACCACCGGCAAGACCCTTCTTGAGGCCATTGACGCCATCGAGGCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATCGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCTGCTTCTTTCACCGCCCAGGT-ATCGTCATGAACCACCCCGGTCAGGTCGGTGCTGGATACGCACCT???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_cuneispora ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGCTACACGTTTGCTTCAACCCTGTCACATTTGCGTCGAACCAACACACCTATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGTGGTCTAGTCAAAAACTTGTCGTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTGGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGATCCTAAG-CATCTGGTGAACCAAGTTCTGGACACTCGTCGCAAGTCCTACCTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTATTTACTGTTCAGCAGGAAGATGATCCTGAAACGGGTATCAACAAGGGCCATTTGGTATTGACCAAAGAGCTCGTCAACAGACTGGCCAAGGAGCAGGCTGAACCTCCGGAAGATCCGAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGCCTTCAGAAAGCCGGCATTTCTACTGAGGAAGACATTGGAGATGATCCGAACAAGCGACTAAAGACAAAGACAAATCCAACAACTCACATGTACACCCATTGCGAGATTCATCCAAGTATGATCTTGGGTATTTGCGCCAGTATCATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGAGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGAAAGACCCTTCTTGAGGCTATCGACGCCATCGAGGCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTGCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCCGCCGCTTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGATACGCCCCC-GTCCTTGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_dacrymycella ??????????????????????????????????????????GGCGGTCCTGCTGGCAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACTGAATTGGCCAACTATTTGAGACGGTGCGTTGAGGGCAACCGACACTTTAACCTTGCTGTCGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACGGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACTCCCATCGGAAGAGACGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTCTGGTCTGCCCAGCCGAGACACCCGAGGGACAGGCTTGTGGTCTGGTCAAAAACCTGTCCTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAGGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTCAACGGCGTCTGGGTTGGGGTTCACCA-AGACCCCAAG-CACCTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATCCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGAGACCGGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACAGGCATCAACAAGGGCCACTTGGTATTGACCAAGGAGCTCGTCAATCGATTGGCCAAGGAGCAGGCTGAGCCCCCGGAAGACCCCGGCATGAAGGTCGGATGGGAGGGATTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTTGAGCTGTACCGTCTTCAGAAGGCCGGTATTTCCACCGAGGAAGACATGGGAGATGATCCGAACAAGCGACTAAAGACGAAGACGAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATATTAGGCATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGTCTTTCACCATCCCCGGTCTAACTAACGAACGGAATGCTGATGGCACGTACAGTCCCCGCGTAACACTTACCAATCGGCCATG??????????????????????????????????????????????????????????????????????TATCGCATCGCCCCCTTCCCCCCCGGCGACCCTCTC-----TTCATAGTCAATTTTGATGGGCGA-TTCTGA------ACAGAACTCCCGTATCAA--A--CAATTTTT---CATCACCGCGCTTTC--------CTTTACCCC--TCGTTGACAGCGACGC--AAATT-----------TTTTTT----GATGTCCTTT-GG---T---TTT----AGTGGGGTTTTCTTCACG-----CCCCAC--TCGCCAACTGG--TTTT--GTGCTTCCCTCTCACTAT-------TCAGTCGCC--ATCCAACGTG-TCTC-TGTGTCCTCA--------A------TTCCA--GCGATTCTAACTAACCAA-TGTTATATCGATAGGAAGCCTCTGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTTCTATGTCACCGTCATTGGTATGTCTG-GCTCATCAA---C-----TTCATGCGGC--AATTACAAGCCAGTGCTAATAAATGCTTC-------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTTGAGGCTGGTATTTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGTCCGAGGAGCGTTACAAGGAAATCATCAAGGAGACCTCCAGCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTCGAGGATTCTCCAAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGATCAAG---AGTGG---CAAAGTCACCGGCAAGACCCTCCTTGATGCTATCGACGCTATCGAGTCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTCCCCCTCCAGGATGTGTACAAGATCAGTGGCATCGGAACAGTCCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGCATGGTCGTTACCTTCGCCCCCGCCAACGTTACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCCAGGAGGGTTTACCCGGTGACAACGTGGGTTTCAACGTGAAGAACGTTTCCGTGAAGGACATTCGCCGTGGCAACGTTGCCGGTGACTCCAAGGACGACCCCCCCTCGGGTGTCGCTCATTTCACCGCCCAGAT-ATCGTCATGAACCACCCCGGCCAGATCGGTGCCGGCTA-CGCCCC-GCTCG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_danica ?????????????????????????????????????TGGCGGGTCCC-TGCTGGCTA-GCTGTTCCGTGGCATCATGCGAAGGATGAACACCGAGCTGGCCAACTACCTGAGACGCTGCGTCGAAGGCAACCGACACTTCAACCTTGCCGTCGGTATCAAGCCCGGCACGCTATCCAACGGGTTGAAGTACTCTCTCGCCACCGGAAATTGGGGCGATCAGAAAAAGGCCATGAGCTCAACGGCGGGCGTGTCTCAGGTGCTCAACCGCTACACGTTCGCTTCCACCCTGTCACATTTGCGTCGCACCAACACGCCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTACACAACACGCATTGGGGCTTGGTATGCCCAGCCGAGACGCCCGAAGGACAAGCTTGCGGTCTGGTCAAAAACCTGTCATTGATGTGTTATGTCAGTGTAGGTTCCCCCTCGGAACCTCTGATCGAGTTCATGATCAACCGAGGGATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGATACCCTCATGCGACCAAGATTTTCGTCAATGGTGTCTGGGTTGGAGTTCACCA-AGACCCCAAG-CATCTGGTCAACCAGGTTCTGGACACTCGCCGCAAGTCTTATCTGCAGTACGAAGTGTCTCTCGTGAGAGAGATCCGAGACCAGGAATTCAAAATCTTTTCGGACGCAGGCCGTGTCATGCGACCGGTATATACCGTTCAGCAAGAAGACGACCCCGATACGGGTATCAACAAGGGTCATTTGGTATTGACCAAGGAACTCGTCAACAGGCTGGCAAAGGAGCAGGCCGAACCCCCGGAGGATCCAAGCCTCAAGATTGGATGGGAGGGCTTGATCAGGGCCGGTGCGGTGGAATATCTCGACGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACACCAGAAGATCTCGAGCTCTATCGTCTTCAAAAAGCCGGTATCTCCACCGACGAGGATATTGGAGATGATCCGAACAAGCGATTAAAGACGAGGACCAATCCGACAACGCACATGTACACTCATTGCGAGATTCACCCAAGCATGATTTTGGGCATATGCGCCAGTATCATTCCCTTCCCCGATCACAATCAGGTATGTCGTT-GAACCGTC------TGAAGCTTGAGGAACCTTAT-AACGGCGTGTAA-CACA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????TAATGCCTATTTCCTT-----TTCGCATTCAATCGTGATGGGAAA-ACTCC--------CGGTTTTCTCATGTCAA--C--CACATTTC---TATCACCCCGCTTTCGC--CTGTCGCTACCCCCCTCCTTCGCACCAGCGC--ACAAAGTTT------TTTTTTT----TCAGCCTTGC-AAATCT---TTT----AGTGCGGGGGTCAAAGCCC----CGCTGA--GCGCGCCTTCCTTTTTTCTGTCCTTTTTTCG-----------CGAATGACCTC--ATCCATCGCACAA-A-TGCTCTTAAT----CGTCT------TTTCA--GCCAT----GCTAATCAA-TTTCCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTTTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT----TCTCATGA-----------TGCACTCACC-ATCTTCCA-TATG-GCTAACAACCTCG---------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCTCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCTACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGAACGGTCCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGCATGGTCGTCACCTTTGCCCCCTCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCTCCGAGGGTAACCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCCTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCCCCC-GT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_decipiens ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTTGGTATTAAACCCGGCACGCTTTCCAACGGCTTGAAGTACTCTCTTGCCACTGGTAACTGGGGTGACCAGAAGAAGGCCATGAGCTCAACCGCAGGTGTGTCTCAGGTGCTCAACCGTTATACATTTGCTTCTACTCTATCACATTTGCGTCGTACCAACACACCCATTGGACGAGACGGCAAGCTGGCCAAACCACGACAACTGCACAACACACACTGGGGCTTGGTCTGCCCAGCAGAGACACCTGAAGGACAGGCTTGTGGCTTGGTCAAAAACTTGTCTTTGATGTGTTATGTCAGTGTCGGATCTCCTTCCGAGCCTCTGATCGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCACTGCGGTATCCTCATGCTACAAAGATTTTCGTGAACGGTGTATGGGTTGGAGTCCATCA-AGACCCCAAA-CATCTCGTGAACCAAGTTCTGGATACTCGTCGTAAATCCTATCTACAGTACGAAGTGTCTCTTATCAGAGACATCCGAGACCAGGAATTCAAAATCTTCTCTGACGCGGGTCGTGTTATGCGACCTGTCTTTACCGTTCAGCAAGAAGATGACCCGGATACGGGCATTAACAAAGGCCACTTGGTCTTGACCAAGAGCCTTGTCAATCAGCTTGCGAAGGAACAGGCTGAACCCCCAGAAGATCCTAGCCAGAAACTTGGTTGGGAGGGCTTGATTAGGGCTGGTGCGGTTGAATATCTTGATGCGGAAGAAGAGGAGACGTCTATGATTTGCATGACTCCTGAAGATCTTGAGCTCTATCGTCTTCAGAAAGCTGGCATTGCCACGGAAGAAGACGTAGGAGACGATCCGAATAAGCGACTCAAGACAAAGACGAATCCAACGACTCACATGTACACGCATTGTGAAATTCACCCCAGCATGATCTTAGGTATCTGTGCTAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGAGTTCAAATCAATGAATA-ATTTTTT-----CTA---TCTCTCCAAAGTAATCTGGCA--CAATTCGCTT--GAAATTTTGTGCCAGATT--TCTC----TGCTCGTCACCCCCCGCTTTCCCTGCCTCTACCCCTCCTTT-GGCGCACACGCA-AATTTTTTT------TTGCTGCCTCAGTTGAT-TTT-AGTGGG---GCTGCTGATCG-------CAACCCC------GCTAC-TGCCCTCGACTTC--AATCTGTG-TGACCACCAGCGTCA--TCGCAGCATTGTG--ATTTATTTCGTCCAGCTCTATCGCTCGGTTTTGCC------ATTTGTTTCCAATCATGCTAACCAT-GTTCCTCTCTATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTTATTGGTATGTA---------TTTTCTACGTCAAAGTTTTTATTTTCTGCGTCAAACTTGTCGCTAATTCAAT-----------CCCACAGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGATTACTGGTACTTCCCAGGCTGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGTTGACTGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTTCTCGAGGCCATCGACTCTATCGAGGCCCCCAAGCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATCGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGCTGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCTCCCCAGGGTGCTGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCTCGACTGCCACACTGCC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_delicatula ????????????CATTTTGGAAAGAAACGTTTGGACCTGGCGGGTCCCTTGCTGGCCAAGCTGTTCCGTGGCATCATGCGAAGGATGAACACGGAATTGGCCAACTACCTGAGACGGTGTGTGGAGGGCAACCGACACTTCAACCTCGCCGTGGGTATCAAGCCCGGCACGCTCTCCAACGGACTGAAGTATTCACTCGCCACTGGAAATTGGGGCGATCAGAAGAAGGCGATGAGCTCGACCGCGGGCGTGTCCCAGGTGCTCAACCGCTACACTTTCGCCTCGACGCTATCGCATTTGCGTCGTACCAACACGCCCATCGGAAGAGATGGTAAGTTGGCGAAGCCTCGACAGCTGCACAACACCCATTGGGGCTTGGTCTGTCCTGCCGAGACGCCTGAGGGTCAGGCTTGCGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGATCTCCCTCCGAACCCCTGATCGAGTTCATGATCAACAGAGGCATGGAAGTTGTTGAAGAGTATGAGCCGCTGCGGTATCCTCACGCCACCAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTCCATCA-AGATCCTAAA-CACCTGGTGAACCAGGTTCTGGACACCCGTCGCAAATCTTACCTGCAGTACGAAGTCTCCCTGATCAGAGACATTCGTGACCAGGAGTTCAAGATCTTCTCCGACGCAGGTCGCGTCATGCGTCCTGTCTTTACCGTCCAGCAGGAGGATGATCCCGACACGGGCATTGACAAGGGTCATCTGGTTTTGACCAAGGATCTGGTGAACAGACTGGCTAAGGAACAGGCTGAGCCTCCGGAAGACCCGAGCATGAAAGTTGGATGGGAGGGGTTAATCAGAGCCGGTGCGGTTGAATATCTCGATGCAGAGGAAGAAGAGACGTCTATGATTTGCATGACGCCAGAGGATCTTGAGCTCTATCGTCTCCAGAAAGCTGGTCTCTCTACTGACGAAGACCCGGGCGATGATCCGAACAAGCGACTCAAGACCAAGACGAACCCGACGACTCACATGTACACGCATTGCGAGATTCACCCGAGCATGATTTTAGGCATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGTTTGACCTACTACACCCATGGGGCTTGTGGTAACTTACTAATGCTGTGCAGT??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTTCACTTTTTCGTCGTGATTTTTTTCCTTTCCTTTAGCTGCGTATTTGCGCACCTGCCATTTTTTTTCCTGCGC-CTGTGTTCCTTCCCAATCACCCCGCTTTCACAGGCTACCCCTCCCACAGC----------AGCAAATTTTTTCCT----GGCTACCTTGTTTGGTTTTA-GTGGGG-GCACATAATTTTTTTGTGTGG--CGATCTCACAATAGCCTCTGGATGTCATTTGTCAATTTCCTGTTGCCAA-------------TCATGACACAAATCTATCTGTCC-----ACCTCTAGCCTCCTTTC-------TTCTTGGTCAGCTTCGCTAATCGGTCATCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTAGGTTTCTTTTCCATTC----GCCTTGCATCTGATTCCAAAAAAGTGACGTCGCTAATGC-CAAAC------------TCACAGACGCTCCCGGCCACCGTGACTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTTGGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTTGCCTTTGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTGGCTGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTCCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGCGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTGGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCTGTGGAGATGCACCACGAGCAGCTCACCGAGGGTCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCTCTGGCCGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGTCAGGTCGGTGCCGGCTACGCCC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_dorotheae ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TACTCACTCGCTACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTATCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGCAAGCTGGCGAAGCCTCGACAGCTGCACAACACACACTGGGGCTTGGTGTGCCCGGCTGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGTTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTACGAGCCACTGAGATATCCCCATGCTACAAAGATCTTTGTGAACGGTGTCTGGGTTGGAATTCACCA-AGATCCTAAG-CATCTGGTAAACCAAGTTTTGGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGAAATTCGAGACCAGGAGTTCAAAATCTTCTCTGATGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGAACTCGTCAACAGATTGGCCAAAGAGCAGGCTGAGCCTCCTGAAGACCCAAGCCAGAAGCTTGGATGGGAAGGGTTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTGTATCGTCTTCAGAAGGCCGGCATTGCCACGGACGAAGACATAGGAGATAATCCGAACCAGCGTCTGAAGACCAAGACAAATCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_epimyces ????????????????????????????????????????????????????????????????????????????????????????????????TTGGCCAACTATCTGAGACGGTGCGTTGAAGGTAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTCTCAAACGGATTGAAGTATTCTCTTGCCACAGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGGCAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACTCCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTTCTCCCTCCGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTCGGAGTTCACCA-AGACCCGAAG-CACTTGGTGAACCAGGTCCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCCGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATCGGATGGGAGGGATTAATTAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAAAAGGCCGGTATTAACACTGAGGAAGACATGGGAGATGATCCGAACAAGCGACTCAAGACAAAGACAAACCCCACAACTCACATGTACACCCATTGCGAGATTCAACCAAGTATGATCTTAGGCATCTGTGCTAGTATCATTCCTTTCCC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TCGATTCTCCC-----TCCGCATTCAATTGTGCTCGATCA-TTTCGA------AGAGAATTTTCGTGTCGA-----TAATTCTT---CATCACCCCGCTTTC--------CGTTACCCC--TCCTTTGCAGCGACAC--AA-------------TTTTTTT----GCTGT-CGTT-GGG--T---TTT----AGTGGGGTTCCCTGTGCA-----CCCCAC--TAGCTCACTGCCTTTTTTTGTGCTTCACTCTCACTGC-------CCAGCCGTC--GTTCAACGTGCTC---TGTCTC--GT--------C------ATTCA--GCGAT----GCTAACCACTTTTTCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTC-CTTCATCAT---C-----TTGATGCAGC--AATCACGAGCCAGTGCTAACAGGCAATTC-------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCTTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACCGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCAAAAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCGCG---AGTGG---CAAGTTCACAGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGAGAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAGGCCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTACGCCCCC-GTCT??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_estonica ??????????????????????????????????ATCTGGCGGGTCCC-TGTTGGCCA-GCTGTTCCGTGGTATCATGCGAAGGATGAACACCGAATTGGCCAACTATCTGAGACGGTGTGTTGAGGGCAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTCAACCGTTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCCCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAAAATCTGTCGTTGATGTGTTACGTCAGTGTCGGCTCTCCCTCCGAACCCCTGATTGAATTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCCACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CATCTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTTGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAAGATGACCCTGAAACGGGCATCAACAAGGGCCACTTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAGGCCGAACCTCCGGAAGACCCAAGCATGAAGATTGGGTGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATTTCTACCGAGGAAGACATGGGAGATGATCCGAACAAGCGACTAAAGACAAAGACAAATCCAACAACTCACATGTACACCCATTGCGAGATCCACCCAAGCATGATCTTAGGTATCTGTGCCAGTATCATTCCTTTCCCCGATCACAACCAGGTATGTCGTCAAATCCTTCA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CTACC-TC---ACCTTCCCT----T-CGCATTCAATTTTGCCCGACAATTCT-GA------ACGGAATTCTCTTGTCAA-CA--CAATTTTTT--CATCACCCCGCTTTCGC--TTCCCATTACCCC--TCCTTTGCAGCGACGC--AATTT----------TTTTTTT----GCTGTTCTTT-GG---T---TTT----AGTGGGGTGACACCAGCAA----CCCCACCACTGCCACTCGCTGCTTTTTGCACTTCTCTACCACTAC-------CCAGTGGTC--ATTC--AACGCCT--TTGTCCCTCATC------AC------TTTCA--GCGAT----GCTAACCAT-ATTTCTCTCAACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-ATTCATCAC---C-----TCAATGCGGC--AATGGCGAACAAATGCTAACAGAAATCTC-------------GCAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTGTTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCCGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_eucorticioides ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTGGGTATCAAGCCCGGCACGCTGTCCAACGGCTTGAAATACTCTCTTGCCACTGGCAACTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTCAACCGATACACCTTTGCTTCCACCCTGTCGCATTTGCGTCGTACCAACACACCCATTGGACGAGATGGCAAGTTGGCAAAGCCTCGACAGCTGCACAACACACATTGGGGCCTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGCTTGGTCAAGAACTTGTCTTTGATGTGTTATGTCAGTGTCGGCTCTCCTTCTGAGCCATTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCACTGCGGTATCCTCATGCCACCAAGATCTTTGTGAATGGTGTTTGGGTCGGAGTCCATCAGGATTCCCAAG-CATCTCGTGAACCAAGTTCTGGATACTCGTCGTAAATCCTACCTCCAGTACGAAGTCTCTCTCATCAGAGACATTCGAGACCAAGAATTCAAAATCTTCTCTGACGCAGGCCGTGTGATGCGGCCTGTCTTTACCGTTCAGCAGGAGGATGACCCGGAAACCGGCATTAACAAGGGCCATTTGGTCCTGACCAAGAACCTTGTCAATCAGCTTGCAAAGGAGCAGGCCGAGCCCCCAGAAGATCCAAGCATGAAGCTTGGCTGGGAAGGCCTGATTAGAGCTGGCGCGGTTGAGTATCTTGATGCGGAAGAAGAAGAGACTTCTATGATCTGCATGACGCCAGAAGATCTAGAACTCTATCGCCTTCAGAAAGCCGGCATTGCCACAGATGAAGACATGGGAGATGACCCGAACAAGCGACTCAAGACGAAGACGAACCCGACCACTCACATGTACACGCATTGCGAGATTCATCCTAGCATGATCTTAGGTATCTGTGCTAG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAACTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTGGCTCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTTCTCGAGGCCATCGACTCCATCGAGCCTCCCAAGCGTCCTTCCGACAAGCCCCTTCGTCTTCCCCTCCAGGACGTGTACAAGATTGGCGGTATCGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCTGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGCCAGCCCGGCGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCTATGGGCGCCGCTTCTTTCACCGCTCAGGTCATTGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCTTGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTTCAGGAGAAGATCGACCGCCGTACCGGTAAGGCTGTCGAGACCGCCCCCAAGTTCATCAAGTCTGGTGACTCTGCCATCGTCAAGATGATTCCCTCCAAG???????????????????????????????????????????????????????????????????? Hypocrea_flaviconidia ???????????????????????????????????????????????????????????????????????????????????????????????????????????????AGACGATGTGTTGAGGGTAATCGCCACTTCAACCTTGCTGTGGGCATCAAGCCCGGCACACTCTCCAACGGATTGAAGTATTCACTTGCCACCGGAAATTGGGGTGACCAGAAGAAGGCCATGAGCTCGACTGCAGGCGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCGACACTTTCTCATCTGCGTCGTACAAACACACCCATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTACACAACACACACTGGGGTTTGGTGTGCCCGGCCGAGACCCCTGAAGGACAAGCTTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCCTTGATCGAGTTTATGATCAACAGAGGTATGGAGGTCGTTGAGGAGTATGAACCGCTGAGAAATCCCCATGCGACAAAGATCTTTGTGAATGGAGTTTGGGTTGGAATCCACCA-AGACCCCAAG-CATCTTGTGAACCAAGTTTTGGATACTCGTCGCAAATCCTATCTGCAATACGAAGTCTCTCTGATCAGAGACATTCGTGACCAAGAATTCAAAATCTTCTCTGACGCCGGCCGTGTTATGCGTCCCGTCTTTACTGTACAACAAGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACTTGGTTTTGACCAAGGACCTTGTCAACAGACTGGCTAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTGGAATATCTCGATGCCGAGGAAGAAGAAACGGCCATGATTTGCATGACACCGGAGGATCTTGAATTTTATCGTCTTCAGAAAGCTGGCATATCCACAGATGAAGACATGGGAGACGATCCAAACAAGCGTCTCAAGAC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CG-TTTTGGGCACAA-TTGTGTCCGACAATACTGTTTTTCTCAAGTCTTG--TCAA-CTTTTTCACC---AGCATCG-CACCCCGCTTTGCCTACCT----ACCCCTCCTTTGGCACAGCA---AAAATTTT------CTGGCTGCCTTGTTTGGTTTTT-AGTGGGG--GGCCAATTGTT-------TGGCAGCAACCCCGCTATCGCCACT-GGCCCTCGTCCATC---G-CCCAA--CACAC-------T---CTCG---AGTTGC---------------------------------TCTTTTGGGTTCATG-GTGCTAATCAT-ACTTCGATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTTCAGTCCG--------ACTAGTCGATATTCC--AAC-AT-CATCTCGCTAACATGCTGCCG------------TCCAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCTGTCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCGCCAACTGGGCTGAGGCCCGTTACCTTGAGATTATCAAGGAAACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTTGCCTTCGTCCCCATCTCTGGCTTCAACGGTGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGG-TTGGGAGAA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_fomiticola ??????????????????????????????????????????????TCCTGTTGGCTAGGCTGTTCCGTGGTATCATGCGAAGGATGAACACCGAGCTGGCCAACTATCTAAGACGATGCGTGGAGGGCAACCGCCATTTTAACCTTGCTGTTGGTATCAAGCCCGGTACGCTTTCAAACGGGTTGAAGTACTCGCTTGCCACCGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGCCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAACTTCACAACACGCATTGGGGTCTGGTCTGCCCAGCCGAGACACCCGAAGGACAAGCTTGTGGCTTGGTCAAAAACCTGTCTTTGATGTGCTACGTCAGTGTCGGGTCCCCCTCCGAACCCTTGATTGAGTTCATGATCAACAGAGGCATGGAGGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCCACCAAGATTTTTGTCAACGGTGTCTGGGTTGGAGTCCACCA-AGATCCTAAG-CATCTAGTGAACCAGGTTCTGGACACTCGTCGCAAATCCTATCTACAGTACGAAGTCTCTCTCATCAGAGACATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCGGGCCGTGTTATGCGACCCGTCTTTACCGTTCAGCAGGAAGATGACCCGGAGACGGGCATTAACAAGGGCCACTTGGTATTGACCAAGGAACTCGTCAACAAACTGGCGAAAGAGCAGGCTGAACCTCCAGAAGACCCGAGCATGAAGATTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTTGAATATCTCGACGCTGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATTGCTACTGAGGAGGACGTGGGAGAAAATCCGAACCAGCGACTCAAGACAAAGACGAATCCAACAACTCACACGTACACACATTGTGAGATTCATCCGAGCATGATCTTAGGCATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGTCGTCGACTCGACAATCTTTTTTATT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CAGATTCTCAGCCTCAATTTTC-CTATTGTCA-GCAATTTTCGAAC------GAATTTGCGCGGCCACAATGC--TCTCCCTTGCCAACATCATCACCCCGCTCTCGTTGCCTAC--CCCTCCTTTGCAGCGACGC--AAATTTTTT------TGGCT------GCCTGGTTTT-TGTTGG---TGGGGT-TGCACCTGTGGCGACCCCACCACAGCCTTGGGCCTACTTCATACCTTTGTCT----ATTACCACACAAA--ACTTTTCCATTCC--ATCCATATCCACATCAGGCTTCAAACGTCTTCAAC------CTGTTGCTTTTAGCGATGCTAACCAGATTTCTCTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGATACTATGTCACCGTCATTGGTATGTCTAATACATCACCCACA------TTCAGCA--TCCACAAGC-CAGC--GCTAATACAAGTCCC-------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCTCAGGCTGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTGGCTGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAGGGAGACCAAG---GGTGG---CAAGTTCTCCGGAAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGCCAGCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCCGCCGCTTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCCGGCCAGGTCGGTGCCGGATATGCCCCC-GTCCTCGATTGC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_gelatinosa ??????????????????????????????????????????????????????GGCCAGCTGTTCCGTGGCATCATGCGAAGGATGAACACCGAATTGGCCAACTATCTGAGACGATGCGTTGAGGGCAACAGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTATTCTCTTGCCACCGGAAACTGGGGCGATCAGAAGAAGGCCATGAGCTCAACTGCCGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCCTCGACCCTATCGCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCACTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGGCAGGCTTGTGGCCTGGTCAAAAACCTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCGCTAATTGAGTTCATGATCAATAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCCCATGCCACCAAGATTTTTGTCAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CATCTGGTGAGCCAGGTCCTAGACACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCGCTGGTCAGAGAAATTCGAGACCAGGAGTTCAAAATATTTTCCGACGCAGGCCGTGTCATGCGACCCGCATTTACCGTTCAGCAGGAAGATGACCCCGAAACAGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGGTTAATCAGGGCCGGCGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGGCTATGATTTGCATGACGCCGGAGGATCTCGAGCTGTATCGTCTACAGAAAGCCGGTATTTCTACCGAGGAAGATATGGGGGATGATCCGAACAAGCGACTAAAGACGAAGACAAATCCAACGACTCACATGTACACCCATTGCGAGATTCACCCAAGCATGATCTTGGGCATCTGTGCCAGTATCATCCCCTTCCCCGATCATAACCAGGTATG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CAATCAATGCTTCTCGCGTCACTTCCACTTGATTGTTATTCAGTTGTGCTCGACAATTCTGTTCAGAGTCATCCAGTTGTGCTCGACAA-TTCTGT------TCAGAGTCATCGAGCCAA-----CAATTTTTT--CATCACCCCGCTTTCGC--TTCACTTTACCCC--TCCTTTGCAGCAATGC--AAA-------------TTTTTG----GCCGTCTCTT-GG---T---TTT----AGTGGGGTGGCACCAGCATTCCCCCCCACCACCACCTCTCACTGCTTTCTGCTCTTGTCTACCGCTAC-------ACTGTTGCC--ATTCA--GCGCTT--TTGTGTCTCGT----------------------GCGAT----GCTAACCGC-CTTTCCCTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACTGTCATTGGTATGTCTG-ATCTATGAC-----------CGTCCTCC--GACAGCTAGCCCGTGCTAATCGAAGTCTCAC-----------ACAGATGCTCCCGGCCATCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCTCTGCTCGCCTACACTCTTGGTGTCAAGCAGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCTGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACTGGCAAGACCCTCCTCGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATCGGAACGGTCCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGCATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCTTTCACTGCTCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGATATGCCCCC-GTCCTTGACTGCCAC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_jecorina ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GAGGGCAATAGGCATTTCA-CCTCGCGGTCGGCATCAAGCCTGGCACGCTCTC-AACGGCTTGAAGTATTCGCTCGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGAGTGTCTCAGGTGCTCAACCGATACACGTTCGCCTCGACCCTCTCGCATTTGCGCCGCACCAACACGCCCATCGGAAGAGACGGCAAGCTGGCGAAGCCTCGACAGCTGCACAACACCCATTGGGGTCTGGTCTGCCCGGCCGAGACGCCCGAAGGACAGGCCTGTGGTCTTGTCAAGAACCTGTCTCTGATGTGTTATGTCAGTGTCGGCTCTCCCTCAGAGCCGTTGATCGAGTTTATGATCAATAGGGGCATGGAAGTGGTCGAGGAATACGAGCCGCTGCGTTATCCTCACGCTACCAAGATCTTTGTCAACGGTGTCTGGGTGGGCATTCACCA-AGATCCCAAA-CATCTGGTGCAGCAGGTCGTGGACACTCGTCGTAAGTCGTACCTGCAGTACGAGGTCTCTCTGGTCAGAGAAATTCGAGACCAGGAGTTCAAGATCTTCTCCGACGCAGGCCGCGTCATGCGACCCGTCTTTACCGTCCAGCAAGATGACGAGTCGGACACTGGCATTCCCAAGGGCCACTTGGTCCTGACCAAAGACCTCGTTAATAAATTGGCCCAGGAGCAGGCCGAGCCTCCAGAAGACCCAAGCATGAAGATTGGTTGGG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGCGTCTCTGCGATGAACATCCGAAACTGACGTTCTGTTACAGACTGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGTACCATTGAGAAGT------TCGAGAAGGTAAGCTTCGTTC--CTTAAATCTCCAGACGCGAGCCCAATCTTTGCCCATCTGCCCAGCATCTGGCGAACGAATG--CTGTGCCGA------CACGATT----TTTTTTTTCA-TCACCC---CGCTTTCTCCTACCCCTCCTTCGAGCGACGCAAATTTTTTTTGCTGCCTTACGAGTTTTAGTGGGGTCGCACCTCA--CAACCCCACTACT--GCTCTCTGGCCGCTCCCCAGTCACCCAACGTCATC------AACGCAGCAGTTTTCAATCAGCGATGCTAACCATATTCCCTCGAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTGGCAGCCA-----TCACCTCACTGCGTCGTTGACACATCAAACTAACAATGCCCTC-----------ACAGACGCTCCCGGCCACCGTGACTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATCCTCATCATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCACCCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTGCGTCTTCCCCTCCAGGACGTCTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGCTGAGGGCCAGCCTGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGCGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGCCAGGTCGGTGCCGGCTACGCCCCC-GTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGTAAGGCTACCGAGTCTGCCCCCAAGTTCATCAAGTCTGGTGACTCCGCCATCGTCAAGATGATCCCCTCCAAG???????????????????????????????????????????????????????????????????? Hypocrea_koningii ????????????????????????????????????????????????????????????????????????ATCATGCGCAGAATGAATACTGAGCTGGCAAATTACCTGAGACGATGTGTTGAGGGCAACCGCCACTTCAATCTTGCTGTTGGCATCAAGCCCGGCACGCTTTCTAACGGATTGAAATACTCACTCGCTACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGCTACACTTTTGCTTCTACACTATCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACATTGGGGCTTGGTGTGCCCGGCTGAGACCCCTGAGGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGCGTTGGATCTCCTTCTGAGCCTCTGATCGAGTTTATGATCAACAGAGGCATGGAAGTCGTTGAGGAGTACGAGCCACTGAGATATCCTCATGCTACAAAGATCTTTGTGAACGGTGTCTGGGTTGGAATCCACCA-AGACCCTAAG-CATCTGGTAAACCAAGTTTTGGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCTGATGCTGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACTTGGTTTTGACCAAGGAACTGGTCAATAGATTGGCAAAGGAGCAGGCTGAGCCTCCGGAAGACCCAAGCATGAAGATTGGATGGGAAGGGTTAATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCTATGATTTGCATGACCCCGGAAGATCTTGAGCTTTATCGTCTTCAGAAGGCCGGTATTTCCACGGAGGAAGACATGGGAGATGATCCAAACAAGCGACTCAAGACAAAAACAAACCCAACAACTCACATGTACACGCATTGTGAGATTCACCCGAGCATGATTTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGT--CGACCTCCTGTCCCCCACTTACGCCTATTATAAATTGTTATTGAAATCTAGTCCCCTCGTAACACTTACAAATCTGCTATGGGCAATAAGCCATGGGATCTGTAATGGGAAAAA???????????????????????????????????????????????????????????????CACTGCTTTTTCACCACGCTTGACACAA-TCGTGTCCGACAATTCTGTTCTC----AGTCTTG--TCCA-TCTTCCTCGC---AGCATCA-CACCCCGCTTTGCCTGTCT----ACCCCTCCTTTGGC--AGCA---AAATTTTTT-----CTG-CTGCATCGTTTGGTTTTT-AGTGGGG--TGTCAATTTTTTT--------GAGCAACCCCGCTATCGCCGCT-GTCCCTCGTCCATC---GTCTCAA--CAAAT-------TGCACTCTTTCAATCGCA--------------------------------TCGCCTTTATTCATT-GTGCTGATCAT-GTTTCAATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCATT--TCTA---------ACTCTTGACATGTCGAAATTCATCATCATTCTAACGTGCCGC--------------TGCAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATCCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACTGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGCTCCAGGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTTCTCGAGGCCATTGACGCCATTGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTGCCCCTTCAGGACGTTTACAAGATCGGTGGTATGGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACTTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGCCAGCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCTGGTGACTCCAAGAACGATCCCCCCATGGCCGCCGCTTCCTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_leucopus ?????????????????????????????????????????????TCACTGCTGGCCA-GCTGTTCCGTGGCATCATGCGAAGGATGAATACCGAACTGGCCAACTACCTGAGACGATGCGTAGAGGGCAACCGGCATTTCAACCTTGCCGTTGGTATCAAACCCGGCACGCTTTCCAACGGGTTGAAGTATTCACTTGCCACTGGGAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGCGTGTCACAGGTGCTTAACCGTTACACTTTTGCCTCGACGCTATCGCATCTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGGCAGCTTCATAACACCCATTGGGGTCTTGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTTGGTTCTCCGTCCGAGCCCCTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTACGAGCCACTGCGGTATCCGCACGCAACCAAGATCTTCGTGAACGGCGTCTGGGTCGGAGTTCATCA-GGATCCCAAG-CATCTGGTGAACCAAGTCTTGGACACTCGTCGCAAATCTTATCTACAATACGAAGTCTCTCTGATCAGAGACATTCGTGACCAGGAATTCAAAATCTTCTCCGACGCGGGCCGTGTTATGCGTCCTGTTTTCACTGTGCAGCAGGAAGATGACCCGGAAACGGGCATTAACAAAGGCCACTTGGTCTTGACGAAGGATCTCGTCAATAGACTGGCAAAGGAGCAGGCTGAGCCTCCAGAAGACCCGAGCATGAAGATTGGATGGGAGGGGTTAATTAGGGCCGGTGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACGTCTATGATTTGCATGACCCCGGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCTGGCATTGCCACAGAAGAAGACATCGGAGATGATCCAAACAAGCGTCTCAAGACCAAAACAAACCCGACAACTCACATGTACACGCATTGTGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATCCCTTTCCCCGATCACAACCAGGTATGT--TGACTTCAAG-----CCCCCCATTCTCCTCTTTTGTCGTAT??????????????????????????????????????????????????????????????????????????????????????????????????????????????TAAGCTCAGTCCACCTCTTGTTTATTGGATCTCCCTGTTTCCGCCTTGCAATCGTGCCCTGCAATTTTCT-------TG---ATTTTCGTATC-AATT--TTCTTTGCCC----ACCTTCACCCCGCTTGCACTGCCTTACCCCTCCTTTAGCCAACGCAA--ATTTTTTTT------TGACTGCGTTGTTTGGCTTTA-GTGGGGCTGTGCAGTTTGT-GTGGCGACCCCACTAGCTCCCTCGAACGCTCATCATTCTACTTTCTCCTTCATTTTGGCTTAATC--GCCCAGCACTACA--AGCCATAATGGCAAATTAC----CCTGCCTTCCCT------TGGT---TTCATCTATGCTGACCAT-CTTTCCCTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTACT-ATCCCTCTTGTG--------CCCGTTGTCATCGAAAATCCAGTGCTGACATCATTTCCCCCC---------ACAGACGCTCCCGGCCACCGTGACTTTATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCCAGCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAATTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCCGTCGCCTTCGTCCCCATCTCTGGCTTCAACGGTGACAACATGCTTGCCCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGACGAAGGAGACCAAG---GCTGG---CTCGTTCTCCGGCAAGACTCTCCTTGAGGCTATCGACTCCATCCAGCCTCCCAAGCGTCCCGTCGACAAGCCCCTCCGTCTTCCCCTTCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAATGACCCTCCCCTGGCCGCTGCTTCCTTCAATGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCTCGACTGCCACACTGCCCACAT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_lixii ???????????????????????????????????????????????CCTGCTGGCCAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACTGAGTTGGCCAACTACCTGAGACGATGCGTTGAGGGCAACCGACATTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACAGGCAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCTTGTCGCATTTGCGTCGTACCAATACTCCTATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCTGAACCTCTCATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCTCTGCGGTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTCCACCA-AGACCCTAAG-CACTTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCTGGCCGTGTCATGCGACCAGTCTTTACCGTTCAACAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTAACACCGAGGAAGACATGGGAGATGACCCGAACAAGCGACTAAAGACCAAGACCAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGCATCTGTGCTAGTATCATTCCTTTCCC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GATTTCGCCTCGAATTCTATCCTC-C-----TTCACATTCAATTGTGCCCGACAA-TTCTGC------AGAGAATTTTCGTGTCGA-----CAATTTTT---CATCACCCCGCTTTC--------CATTACCCC--TCCTTTGCAGCGACGC--AAAAA----------ATTTTTT----GCTGTCGTTT-GGT--T---TTT----AGTGGGGTTCTCTGTGCAA----CCCCAC--TAGCTCACTGC--TTTTTCCTGCTTCACTCTCACTTC-------CTAGTCATC--ATTCAACACGCTTTG-TGGCTTTGGT--------C------ATTCA--GCGAT----GCTAACCAC-TTTTCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTC----CTCATCAA---T-----CTCATGGTGC--AACTGCGAGCTAGTGCTAACATGCAATTC-------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTTCACCGGCAAGACCCTCCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGT-AAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTAACGCCCC-GTCTA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_longipilosa ????????????CATTTTGGAAAGAAGCGTCTGGATCTGGCAGGTCCTTTGTTGGCTAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACCGAATTGGCCAATTATCTGAGACGGTGTGTCGAGGGCAACAGACACTTTAACCTTGCCGTTGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAATATTCGCTTGCCACCGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGCTACACGTTTGCTTCAACCCTGTCACATTTGCGTCGAACCAACACACCTATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGCCAGGCTTGTGGTCTAGTCAAAAACTTGTCGTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTGGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGATCCTAAG-CATCTGGTGAACCAAGTTCTGGACACTCGTCGCAAGTCCTACCTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTATTTACTGTTCAGCAGGAAGATGATCCTGAAACGGGTATCAACAAGGGCCATTTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAGGCTGAACCTCCGGAAGATCCGAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGCCTTCAGAAAGCCGGCATTTCTACTGAGGAAGACATTGGAGATGATCCGAACAAGCGACTAAAGACAAAGACAAATCCAACAACTCACATGTACACCCATTGCGAGATTCATCCAAGTATGATCTTGGGTATTTGCGCCAGTATCATTCCTTTCCCCGATCACAACCAGGTA-ATCGTCAACCC-TTTAATTGGACTGGCAA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TAAGCTCAATCCAACTGATTCACAACCCAAATTCTCCCT----T-GGCGTTCAATTGTGCCCGACAATTC---A------ACGGAATTCTCGTGTCAA-----CAATTTTTT--CGTCACCCCGCTTTCGC--TTCACACTACCCC--TCCTTTGCAGCGACGC--AAATT----------TTTTT------GCTGTCGTTT-GA---T---TTT----AGTGGGGGCGCAC-AGCAA----CCCCACCACTGCCATTCACTGGTTTTTGCACTTCACTACAACT-C-------CCAGCTGCC--ACTC--AGCACCT--CTATATCTCGTC------AC------TTTCA--GCGAT----GCTAACCAT-CTTTCCCCCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-ATTCATCAT---T-----TCTGTGCTGC--GTCTGCAAGCTTGTGCTAATGCAAACATG-------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCCATTCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGAGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTTCTTGAGGCTATCGACGCCATCGAGGCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTGCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCCGCCGCTTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGATACGCCCCC-GTCCTTGATTGCCACACTGC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_lutea ?????????????????????????????????????????TGGCGGTCCTGCTGGCCAGCTGTTCCGTGGTATCATGCGAAGGATGAATACCGAGTTGGCCAACTACTTGAGGCGATGTGTAGAGGGCAACCGCCACTTCAACCTTGCTGTCGGCATCAAGCCCGGCACGCTTTCCAACGGCTTGAAGTACTCACTGGCCACCGGCAACTGGGGCGACCAGAAGAAGGCCATGAGCTCGACCGCAGGCGTGTCCCAGGTGCTGAACCGTTACACTTTTGCTTCGACTCTGTCACATTTGCGTCGTACCAACACACCCATCGGACGAGATGGTAAACTGGCCAAGCCTCGTCAGCTTCACAACACGCACTGGGGCTTGGTCTGCCCGGCTGAGACGCCCGAGGGACAAGCTTGTGGCTTGGTCAAGAACTTGTCTCTGATGTGTTATGTCAGTGTCGGATCTCCCTCTGAACCCCTGATCGAGTTTATGATCAACAGAGGCATGGAAGTCGTTGAAGAATATGAACCTCTGCGATATCCTCATGCCACCAAGATCTTTGTCAACGGTGTCTGGGTTGGCGTTCACCA-AGATCCTAAG-CACCTGGTGAACCAAGTCTTGGACACGCGTCGCAAATCCTATCTCCAGTACGAGGTCTCTCTGATCAGAGACATTCGTGATCAGGAATTCAAAATCTTTTCCGACGCAGGTCGTGTCATGCGTCCTGTGTTTACGGTCCAACAGGAGGATGACCCCGAGACGGGCATTGAGAAGGGCCACTTGGTCCTGACGAAGGAGCTCGTCAACAAGTTGGCAAAGGAGCAGGCAGAGCCCCCCGAAGACCCGAGCATGAAGGTCGGATGGGAAGGGCTCATTCGGGCGGGTGCGGTTGAATATCTCGATGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACGCCGGAGGATCTCGAGCTCTATCGTCTTCAGAAGGCTGGCATTGCCACGGAAGAAGACATGAGCGACGATCCGAACAAGCGACTCAAGACGAAGACGAATCCTACGACTCACATGTACACGCATTGCGAGATTCACCGAAGTATGATCTTGGGCATCTGTGCTAGTATCATTCCTTTCCC-GATCACAACCAGGTATGTCACC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TAAGCTTCGACCGACTTTATTTTCTTTGTCTTGTTTTTTTCTTTCCATTTGATTTCCCTGCCAATTCTGCCGACAATTCTCTTGGGAATTTTCGTGTCAACAA--TTTTTTTTCCCAAATCACCCC--GCTTTTGCTG-C-CTACCCCTCCTTTTGGCGGACGCAA--AATTTTTTT------TGCTGGCCATTCTGGTT--TT-AGTGGGAACGC-ATGTGCAG-------CGACCCCACCATTGCCTCTGGCTCTTATCTCTGCTGCCTTTGGCTGCCCTTCATCTCC--GGTCGCATCTTTCGTTATCTCATTGGGCATCC--ATCGCCATCATATCTT------GTTCGCATTCAATCGTGCTAACCAT-GGTTCCCTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT-----------TGTCCGATACATT---TGCCTTTGTAAAACA------ATCGCTAACATGT----------GCCTCGCAGACGCTCCCGGCCACCGTGACTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGGTTCAACGGCGACAACATGCTTGCCCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACCCTTCTCGAGGCTATCGACTCCATCGAGCCTCCCAAGCGTCCCACGGACAAGCCTCTCCGTCTTCCCCTCCAGGACGTGTACAAGATTGGCGGTATTGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGCCGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGCGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGCCAGGTCGGTGCCGGCTACGCCCCC-GTCCTCGACTGCCACACT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_megalocitrina ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCTATGAGTTCGACCGCAGGTGTATCTCAGGTGCTTAACCGTTATACTTTTGCTTCAACACTGTCACATTTACGTCGTACCAACACACCCATCGGAAGAGATGGCAAATTGGCAAAGCCGCGACAACTTCATAACACGCACTGGGGCTTGGTCTGCCCAGCTGAGACTCCTGAGGGGCAGGCTTGTGGCCTGGTCAAAAACTTGTCTTTGATGTGCTATGTCAGTGTCGGGTCTCCCTCCGAACCTTTGATCGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTATGAACCGCTGCGATATCCTCATGCCACAAAGATCTTTGTGAACGGCGTCTGGGTCGGAGTCCATCA-GGACCCCAAG-CACCTTGTGAATCAGGTTCTGGATACTCGTCGCAAATCCTATCTACAGTATGAAGTCTCCCTGATCAGAGACATTCGAGATCAGGAATTCAAAATCTTCTCTGATGCGGGTCGTGTTATGCGGCCTGTGTTTACCGTTCAGCAGGAGGATGACCCAGAAACGGGCATTAACAAAGGCCACTTGGTTTTGACAAAGGAACTCGTCAATAGGCTTGCAAAGGAGCAGGCTGAGCCCCCAGAAGACCCGGGCATGAAGATTGGATGGGAGGGCTTAATTAGGGCTGGTGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACATCTATGATTTGCATGACCCCGGAGGATCTTGAGCTTTATCGTCTTCAGAAAGCTGGCATTGCCACGGAAGAAGATATGGGAGACGATCCAAACAAGCGACTCAAGACAAAGACGAATCCAACAACTCACATGTACACGCACTGTGAGATTCACCCAAGCATGATCTTAGGTATCTGTGC?AGTATCATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTCCTTGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_melanomagna ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGCGACCAGAAGAAGGCCATGAGCTCGACCGCAGGCGTGTCCCAGGTGCTGAACCGTTACACTTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACACCCATCGGACGAGATGGTAAACTGGCCAAGCCTCGTCAGCTTCACAACACGCACTGGGGCTTGGTCTGCCCGGCTGAGACGCCCGAGGGACAAGCTTGTGGCTTGGTCAAGAACTTGTCTCTGATGTGTTATGTCAGTGTCGGATCTCCCTCTGAACCCCTGATCGAGTTTATGATCAACAGAGGCATGGAAGTCGTTGAAGAATATGAACCTCTGCGATATCCTCATGCCACCAAGATCTTTGTCAACGGTGTCTGGGTTGGCGTTCACCA-AGATCCTAAG-CACCTGGTGAACCAAGTCTTGGACACGCGTCGCAAATCCTATCTCCAGTACGAGGTCTCTCTGATCAGAGACATTCGTGATCAGGAATTCAAAATCTTTTCCGACGCAGGTCGTGTCATGCGTCCTGTGTTTACGGTCCAACAGGAGGATGACCCCGAGACGGGCATTGAGAAGGGCCACTTGGTCCTGACGAAGGAGCTCGTCAACAAGTTGGCAAAGGAGCAGGCAGAGCCCCCCGAAGACCCGAGCATGAAGGTCGGATGGGAAGGGCTCATTCGGGCGGGTGCGGTTGAATATCTCGATGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACGCCGGAGGATCTCGAGCTCTATCGTCTTCAGAAGGCTGGCATTGCCACGGAAGAAGACATGAGCGACGATCCGAACAAGCGACTCAAGACGAAGACGAATCCTACGACTCACATGTACACGCATTGCGAGATTCACCCGAGTATGATCTTGGGCATCTGTGCTAGTATCATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTTGCCCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACCCTTCTCGAGGCTATCGACTCCATCGAGCCTCCCAAGCGTCCCACGGACAAGCCTCTCCGTCTTCCCCTCCAGGACGTGTACAAGATTGGCGGTATTGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGCCGAGGGCCAGCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGCGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGCCAGGTCGGTGCCGGCTACGCCCCC-GTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATTGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_microcitrina ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATTAAACCCGGCACGCTTTCTAACGGCTTGAAGTATTCACTTGCCACTGGCAACTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTATCCCAGGTGCTTAACCGTTATACCTTTGCTTCTACTCTATCACATTTGCGTCGCACCAACACGCCCATTGGACGAGACGGCAAGTTGGCAAAGCCACGACAACTGCACAACACACACTGGGGCTTGGTCTGCCCAGCCGAGACTCCCGAAGGACAGGCTTGTGGCTTGGTCAAAAACTTGTCACTGATGTGTTATGTCAGTGTCGGATCTCCCTCCGAACCCCTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTATGAGCCACTGCGGTATCCTCATGCCACGAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTCCATCA-GGATCCCAAA-CATCTCGTGAACCAAGTTCTGGATACTCGTCGTAAATCCTACCTACAGTACGAAGTCTCTCTCATCAGAGACATTCGAGACCAGGAATTCAAAATCTTCTCTGACGCGGGTCGTGTTATGCGGCCTGTCTTTACCGTCCAGCAGGAAGATGACCCGGATACGGGCATTAACAAGGGCCACTTGGTCTTGACCAAGAGCCTCGTAAATCAGCTTGCGAAGGAACAGGCTGAACCCCCAGAAGACCCGAGTCTGAAACTTGGTTGGGAAGGCTTAATTAGGGCTGGTGCGGTTGAATATCTTGATGCAGAAGAAGAGGAGACGTCTATGATCTGCATGACGCCAGAAGATCTTGAGCTTTATCGTCTTCAGAAGGCTGGCATTGCCACGGAGGAAGACATGGGAGACGATCCGAATAAGCGACTCAAGACAAAGACGAATCCAACAACTCACATGTATACGCATTGTGAAATTCACCCCAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCGGATCA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTTGCCTACACTCTTGGTGTTAAGCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCTGGCTTCAACGGTGACAACATGTTGACTGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTTCTCGAGGCTATCGACTCCATTGAGGCCCCCAAGCGTCCCTCCGACAAGCCTCTTCGTCTTCCCCTCC?GGATGTGTACAAGATCGGTGGTATCGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGCTGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCTCCCCAGGGCGCTGCTTCTTTCACTGCCCAGGTTATTGTCATGAACCACCCCGGTCAGGTCGGTGCGGGATACGCCCCC-GTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTTCAGGAGAAGATCGACCGCCGTACCGGTAAGGCTACCGAGACATCCCCCAAGTTCATCAAGTCTGGTGACTCTGCCATCGTCAAGATGATTCCCTCCAAG???????????????????????????????????????????????????????????????????? Hypocrea_minutispora ???????????????ATTGGAAAGAAGCGTCTGGATCTGGCGGGTCCATTGCTGGCCAAGCTGTTCCGTGGTATCATGCGAAGGATGAATACCGAATTGGCCAACTACCTGAGACGGTGCGTCGAGGGTAACCGACATTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCCAACGGATTGAAATATTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTGTCACAGGTGCTTAACCGTTACACTTTTGCTTCGACACTGTCCCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACATTGGGGTTTGGTCTGCCCGGCCGAGACGCCTGAAGGACAGGCTTGTGGCCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGGTCTCCCTCCGAGCCCCTAATTGAGTTTATGATCAACAGAGGTATGGAAGTCGTCGAGGAGTACGAGCCACTGCGGTATCCCCACGCCACAAAGATCTTTGTGAACGGTGTCTGGGTCGGAATCCACCA-GGATCCCAAG-CATCTGGTGAACCAGGTGTTGGACACTCGTCGCAAATCGTATCTACAATACGAAGTCTCTCTGATCAGAGACATTCGTGACCAGGAATTCAAAATCTTCTCTGATGCAGGTCGTGTTATGCGTCCTGTCTTTACTGTGCAGCAAGAAGATGATCCGGAAACGGGCATCAACAAGGGCCATCTGGTCTTGACGAAAGATCTCGTCAACAGACTGGCCAAGGAGCAGGTTGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGATTGATTAGGGCTGGCGCGGTGGAATATCTCGATGCCGAGGAAGAAGAGACGTCTATGATTTGCATGACCCCAGAGGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGCATTGCCACAGAAGAGGACATTGGAGATGATCCAAACAAGCGACTCAAGACTAAGACGAATCCAACAACTCACATGTACACGCATTGCGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGT--CAATTT--GC------CAATTTCTTTTCTTTTCG--------TTTGTATTATGCTCAAATCACTGAC-TTTTGCTGT-GCAGTCCCCCCGTAACACTTACCAATCTGC????????????????????????????????????????????????????????????????TTTCTACTCATTTTCTCCCTTTTGATGCCATACAATTGTGCTCG--ATAATTCTCC---GAATTTTCCTGTCAATTCT-TTTTTC-CTTCCACCGTCACCCCGCTTTCTCTACCTACCCCTCCTTTGGGC-------GACGCAAATTTTTTTTG----G-CTGTCTCGTTTGGCTTTA-GTGGGGGTGCTCGCTCTTTGTGTGGCAG--CCCCACCATTACCTCTACGACCACCATTTGTTGGCGTCTCTT--GCTCG-----------ATCTGCGTTGCAATTCATTTTATCAAGCCGCGTTACCTGCTTTGTTT------CATTCGTGTCATCAATGCTAACCATGTTTCCCTCA-ATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGATACTATGTCACCGTCATTGGTACGTTTTGATCTATTCT------CGCTCGCCG-TATACCGAAAG--CCAAA-GCTAATAC-CAAATT-----------TCACAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATCACCGGAACTTCCCAGGCTGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGTTGGCTGCCTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTCCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGACGTGTACAAGATCGGTGGTATTGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGTCAGCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTTTCCGTCAAGGATATCCGCCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCTTGGCCGCTGCCTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCACCC-GTCCTTG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_moravica ?????????????????????????????????????????????CCCCTGTTGGCTAAGCTGTTCCGTGGCATCATGCGAAGGATGAACACCGAATTGGCCAATTATCTGAGACGGTGCGTAGAGGGTAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGTACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACCGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTCGCTTCGACCTTGTCACATTTGCGCCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCATAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAGGGACAAGCTTGTGGCTTGGTCAAAAACTTGTCGTTGATGTGCTACGTCAGCGTCGGGTCTCCTTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGCATGGAGGTCGTGGAAGAGTATGAGCCGCTGCGATATCCTCACGCCACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTACACCA-AGACCCTAAG-CATCTGGTGAACCAGGTTCTGGACACTCGCCGCAAATCCTATCTACAGTACGAAGTCTCTCTCATCAGAGACATTCGAGACCAGGAATTCAAAATCTTTTCCGATGCAGGCCGTGTTATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACAGGCATTAACAAGGGCCACTTGGTATTGACCAAAGAACTCGTCAACAGACTGGCGAAAGAGCAGGCTGAGCCTCCAGAAGACCCGAGCATGAAGATTGGATGGGAGGGGTTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCTATGATTTGCATGACACCAGAGGACCTCGAGCTGTATCGTCTCCAGAAAGCAGGTATTGCGACAGAGGAGGACATAGGAGACAACCCGAACCAGCGACTCAAGACAAAGACCAATCCAACAACTCACATGTACACGCATTGTGAGATTCACCCGAGCATGATCTTAGGCATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCGGGTATGTC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATGATGTCGAGCACATTCCCCTCCCTTTTCATGCAATTCCCGAAC------GGATTTACGCGTCGACAAT----TCTGCCTCTTCCGCATCATCACCCCGCTCTCGTTGCCTAC--CCCTCCTTTGCAGCGACGC--AAATTTTTC------TTACT------ACCAATTTTT-TTTTGG---TGGGGG-TACGCATGTAGCGACCCCACAACAGCCTC------------------------------ACCACACAAA--ACTCAACCCATGC--AACT-CATGCACATCAAG-TTCCAACGTCTTCA-T------TTATTACTTTCCGTGATGCTAATCATATTCCCCTCTACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTCATTCATGACCTTGA------TTCAACA--TCCACGAGC-TAGC--GCTAATGACAATCTC-------------GCAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTTGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTTGCTGCCTCCACCAACTGCCCCTGGTATAAGGGTTGGGAGAAAGAGACCAAG---GCTGG---CAAGTACAGCGGCAAGACCCTTCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGCATGGTCGTTACCTTTGCTCCTTCCGGCGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGCCAGCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCATGGCTGCCGCTTCTTTCACCGCCCAGGTCATTGTCATGAACCACCCCGGCCAGGTCGGTGCCGGCTATGCCCCT-GTCCTCGT??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_neorufa ??????????????ATTTGGAAAGAAGCGTCTGGATCTGGCGGGTCCGCTGCTGGCCAAGCTGTTCCGTGGTATCATGCGCAGAATGAATACTGAGTTGGCCAACTACCTGAGACGGTGTGTTGAAGGTAACCGCCATTTCAACCTTGCGGTTGGCATCAAGCCCGGCACGCTTTCCAATGGATTGAAATATTCACTCGCCACTGGAAACTGGGGTGATCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCGCAGGTGCTTAACCGTTACACTTTTGCTTCAACACTATCCCATTTGCGTCGTACCAATACCCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACACTGGGGTTTGGTATGCCCGGCCGAGACACCTGAAGGACAGGCTTGTGGCCTGGTCAAAAACTTGTCCCTGATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCTTTGATCGAATTTATGATCAACAGAGGCATGGAGGTCGTTGAAGAGTACGAACCACTGAGGTATCCCCATGCTACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCATCA-AGATCCCAAG-CATTTGGTAAACCAAGTTTTGGACACTCGTCGTAAATCTTATCTGCAGTACGAAGTCTCTCTGATCAGAGACATTCGTGACCAAGAATTCAAAATCTTCTCTGACGCCGGTCGTGTAATGCGTCCTGTCTTTACTGTACAGCAAGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACTTGGTTTTGACCAAGGATCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTGGAATATCTCGATGCTGAGGAAGAAGAAACGTCTATGATCTGCATGACGCCGGAGGATCTTGAACTCTATCGTCTTCAGAAAGCTGGCATTGCCACAGATGAAGACATAGGAGACGATCCAAACAAGCGTCTCAAAACCAAGACAAATCCAACCACACACATGTACACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCTGATCACAACCAGGTATGT--CAACCCAAGAAGCTATCCCCCCCCCTCTTTTTTTTTGGCGCT??????????????????????????????????????????????????????????????????????????????????????????????????????????????????TAAGCCCTTGCAACTTTTTTTCCATCTTTTTTTTTTTTTTTGGTATTCACGTGTGCGCGACGATTCTGTTCTC----AGCTTTG--TCAA-TTCTTTTCACTCTCCCACAATCACCCCGCTTTGCCTGTCT----ACCCCTCCTTTGGCATGGTGC--AAAATTTTT-----CTGGCTGCCTTGTTTGGTTTTTTAGTGGGGTGTTTCAATTCTTT-------GGCAGCAACCCCGCTATCGCCACT-GTCCCTCATCCATC------GCAA--CACAAT------TTGTCTC-CTCCATTGCACCGTCTGC--CCTC-AAA-------------TGCTTTGTGATTCATT-GTGCTGACCAG-GTATTCAATTATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTTCTGTTCT--------TCTCCCAGACCGCGTCTGAAGAT-GGCCATTCTAACACGCTGCTT------------CACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATCCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCTGAGGCTCGTTACCTGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATTCAACCCCAAGACCGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCACTGCCTCCACCAACTGCAGTTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCGGC---CAAGGTCACCGGTAAGACTCTCCTTGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGTGGTATCGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCTTGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGCGCCGGCTACGCTCCC-GTCCTCGACTGCCACACTGCCCACATC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_nigrovirens ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAAAAGGCCATGAGCTCGACTGCCGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACGCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCATAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAATCTGTCCTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCCCTGATTGAGTTCATGATCAACCGGGGTATGGAAGTCGTTGAAGAGTATGAGCCGTTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTCGGAGTACATCA-AGACCCCAAG-CATCTGGTGAACCAGGTTCTGGACACCCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCCCTGGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCCGTGTTTACCGTCCAGCAGGAAGATGACCCTGAAACAGGCATCAACAAGGGACACTTGGTATTGACCAAGGAGCTTGTCAACAGGCTGGCCAAGGAACAGGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCAGTCGAATACCTCGACGCCGAGGAAGAGGAGACGTCCATGATTTGTATGACACCAGAGGATCTCGAGCTGTATCGTCTGCAAAAGGCCGGTATTTCTACCGAAGAAGACATGGGAGATGATCCGAACAAGCGACTCAAGACGAAGACAAATCCTACAACTCACATGTACACCCATTGTGAGATTCACCCAAGTATGATCCTGGGTATCTGTGCTAGTA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTATCAGGAGATTATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTTGCCCCCTCTACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTTCACTGGCAAGACCCTCCTTGAGGCCATCGACTCCATTGAGCCCCCCAAGCGTCCCACGGACAAGCCTCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCTGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACCGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCTGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCTCAGGTCATTGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTTCTCGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_novaezelandiae ?????????????????????????????????????????????????????????????????????????????GCGAAGAATGAATACCGAACTAGCCAACTACCTGAGACGGTGCGTGGAGGGCAACCGACACTTCAACCTCGCTGTTGGTATCAAGCCCGGCACGCTTTCCAACGGCTTGAAGTATTCGCTCGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCCGGCGTGTCTCAGGTGCTGAACCGCTACACGTTTGCCTCGACCCTCTCGCATTTGCGCCGCACCAACACGCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGCCAGCTTCACAACACCCATTGGGGTCTGGTCTGTCCGGCCGAGACACCCGAAGGACAGGCTTGTGGCCTTGTCAAGAACCTGTCTCTGATGTGTTATGTCAGTGTCGGTTCTCCATCAGAGCCGCTGATTGAGTTCATGATCAATCGAGGCATGGAAGTTGTTGAGGAGTACGAGCCACTGCGTTATCCTCACGCCACCAAGATCTTCGTCAACGGTGTCTGGGTGGGCGTTCACCA-AGACCCTAAG-CATCTCGTGGGCCAAGTCCTAGACACGCGTCGTAAGTCGTACCTGCAGTACGAAGTCTCTCTCATCAGAGAAATTCGAGACCAGGAATTCAAAATCTTCTCCGACGCAGGCCGTGTCATGCGACCCGTCTTTACCGTCCAGCAAGGTGACGAGGCTGATGCTACCGTTGAAAAGGGCCACTTGGTGCT???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_nybergiana ??????????????????????????????????????????GGTCCGCTGCTGGCCA-GCTGTTCCGTGGTATCATGCGAAGGATGAATACTGAATTGGCCAACTACCTGAGACGATGTGTGGAGGGTAACCGACATTTCAACCTTGCTGTTGGTATCAAACCCGGTACGCTTTCCAACGGATTGAAGTATTCACTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCGCGAGCTCGACCGCAGGTGTGTCCCAGGTGCTTAACCGTTACACTTTTGCCTCGACACTATCACATTTGCGTCGTACCAACACGCCCATCGGGAGAGATGGTAAGCTGGCGAAGCCTCGGCAGCTTCATAACACCCATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCTTTGATGTGCTATGTCAGTGTTGGTTCTCCCTCCGAGCCCCTGATTGAGTTTATGATCAACAGAGGCATGGAAGTCGTCGAGGAGTACGAGCCACTGCGATATCCCCACGCAACAAAGATCTTTGTGAACGGTGTCTGGGTCGGAGTTCACCA-AGATCCCAAG-CATTTGGTGAACCAAGTTCTGGACACTCGTCGCAAATCTTATCTACAGTACGAAGTGTCTCTGATCAGAGACATTCGTGAACAGGAATTCAAAATCTTCTCTGACGCGGGCCGTGTCATGCGCCCTTGTTTCACTGTACAGCAGGAGGATGACCCGGAAACGGGCATTAACAAAGGCCACTTGGTCTTGACGAAGGATCTCGTTAATAGGCTGGCAAAGGAGCAGGCCGAGCCTCCAGAAGACCCGAGCATGAAGGTTGGATGGGAGGGGTTAATCAGGGCCGGTGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACGTCTATGATTTGCATGGCCCCAGAGGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGCATTGCCACGGAAGAAGACGTGGGAGATGACCCGAACAAGCGAATCAAGACTAGAACGAACCCGACAACTCACATGTACACGCATTGTGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGT--CGACTTGACAGGTTTTCCTTTGTTTTCCTTTCCTTTCTCTTTAATGCATCACGCTCCAATAACTGACCATACCGCGCA?????????????????????????????????????????????????????CATCGAGAAAGTCGAGAAGGTAAACTCGGTCCAATTATTTTTTTT-----CCCCCTCTTCTCGCTTTGCAATCGTGCCCAACAATTCTCT-------TGTAAATTTTCGTGTCGAATT--TTTTTTCCCT----GCCGTCACCCCGCTTTCACTGCCTTACCCCTCCTTTAGCCGACGCAG--AAATTTTTG------T--CTGC-TTGCTTGGCTTTA-GTGGGG--GTGCACTTTTG-GTGGCAACCCCACCGGCTCCCTCTGACTCTCATCATTCGTCT-----CATCGCCCAGCGAAAGCC--ATTTTGC----CA--AACCACGTTGCCTG---------CCTTCGTTTGTT------TTAT---TTCATCCATGCTAACCAT-CTGTCCCTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTTTGATCCCTCTTGT---------CCCGTGGGCATCGAAAACCCAGCGCTAATATAAACTTCATCC---------A--GACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCCAGCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGTCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCGGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGCTCCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAGGGAGACCAAG---ACTGG---CAAGTTCAGCGGCAAGACTCTCCTTGACGCCATCGACTCCATCCAGCCCCCCAAGCGTCCCGTCGACAAGCCCCTCCGTCTTCCCCTTCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTCTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGATATCCGCCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCTCCCTTGGCTGCTGCTTCTTTCAATGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCTCGACTGCCACACTGCCCACATC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_ochroleuca ???????????????????????????????????????????????????????????CAAGTGGAGGTCTGGACATATATATGGGCAACAAGCCATGGCCAACTATCTGAGACGATGTGTTGAGGGTAACCGTCACTTCAATCTTGCTGTTGGCATCAAGCCCGGCACGCTTTCTAACGGATTGAAGTACTCACTCGCCACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTATCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGCTTGGTGTGCCCGGCTGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGCATGGAGGTCGTTGAGGAGTACGAGCCACTGAGATATCCCCATGCCACAAAGATCTTTGTGAATGGTGTTTGGGTTGGAGTTCACCA-AGATCCCAAG-CATCTGGTAAACCAAGTTTTGGATACCCGTCGCAAATCCTACCTGCAGTACGAAGTCTCCCTGATTAGAGAAATTCGAGATCAAGAGTTTAAAATTTTCTCTGACGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCATCTGGTTTTGACCAAGGAACTGGTCAATAGATTGGCTAAAGAGCAGGCTGAGCCTCCTGAAGACCCAAGCCAGAAGCTGGGATGGGAAGGGTTGATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCTATGATTTGCATGACGCCGGAAGATCTTGAGCTTTATCGTCTTCAGAAGGCCGGCATTGCCACGGATGAAGACATAGGAGATAATCCGACCAAGCGTCTGAAGACCAAGACAAATCCAACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTGGGTATCTGTGCCAGTATCATTCCTTTCCCCGATCACAACCAGGTATGT--CACCCGAGAGGCTGTCCTTTCCCATTTAACCGCCATTTTTTTTTCTTCCCTTTATTCCTCCGTCCCAAATCCCTAAATGGATG??????????????????????????????????????????????????????????????????????????????TTTCCCCGCTTTTTTTTTTTTTTTCCTCACTGCACTTGGCACAAATCGTGTCCGACAATTCTGTTCTCA----GTCTTG--TCTA-TTTTCCTCGC---CGCGTCA-CACCCCGCTTTGCCTGTCT----ACCCCTCCTTGGGC--AGCA---AAATTTT-------CTG-TTGCCTTGTTTGACTTTT-AGTGGGGG-TGCCAACTTTTTTTT--CTGGCA---ACCCCGCTATTGTCGCT-GTGCCTCGTCCATCATCGTCCCAA--CAAAAG------TCCATTCTCTCAGTCGCATCGCCTCTCGATTCAGT--------------TTCTCTGTTGTTCATTTGTGCTAATCAT-GCTTCAATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACAATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGGTACTATGTCACCGTCATTGGTATGTTGTT--TTCG---------GTCCCTGACATGTCG-AGATCATCGTCATTCTAACGCGCCAC--------------TGCAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTGTTCTCATCATCGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCTTGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTTGCCTTTGTCCCCATCTCCGGCTTCAACGGCGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTTCTCGAGGCCATTGACGCCATTGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTTTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCCAGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCCCC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_pachybasioides ???????????????TTTGGAAAGAAACGTCTGGATCTGGCGGGTCCACTGCTGGCCAAGCTGTTCCGTGGTATCATGCGAAGGATGAATACTGAATTGGCCAACTATCTGAGACGATGCGTTGAGGGTAACCGACATTTCAATCTTGCTGTTGGTATTAAACCTGGCACGCTTTCCAACGGATTGAAGTATTCACTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTATACTTTTGCCTCGACACTATCCCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACATTGGGGTTTGGTCTGCCCGGCCGAGACACCTGAAGGACAGGCTTGTGGCCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGATCTCCCTCCGAGCCCCTAATTGAGTTTATGATCAACAGAGGTATGGAAGTCGTCGAGGAATATGAGCCACTGCGATATCCTCATGCCACGAAGATCTTTGTGAACGGTGTCTGGGTTGGAATCCACCA-GGATCCCAAG-CATCTGGTGAACCAAGTTTTGGACACTCGTCGCAAATCTTACCTGCAATACGAAGTCTCTCTGATCAGAGAAATTCGTGACCAGGAATTCAAAATCTTCTCTGACGCAGGTCGTGTTATGCGTCCCGTTTTTACTGTACAGCAAGAAGATGACCCTGAAACGGGCATTAACAAAGGCCACTTGGTCTTGACGAAGGATCTCGTCAACAGGCTGGCAAAGGAGCAGGTTGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGCTAATTAGGGCTGGTGCGGTGGAATATCTCGATGCCGAGGAAGAAGAGACATCTATGATCTGCATGACCCCGGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCTGGTATTAATACGGAAGAAGACATCGGAGATGATCCAAACAAGCGACTCAAGACTAAGACGAATCCAACAACTCACATGTATACACATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATTATTCCTTTCCCCGATCACAACCAGGTATGT--CGACTT--GC------CT-TTTTTCTTCTTCTTCCATGTTGTTCTGTATTATGCTCAAATAACTGAC--TAATGTTGTACAGTCCCCCCGTAATACCTATCAATCTGCCATGGGGCAAACAAA???????????????????????????????TAAGCTCAGTCGCTGATTTTTTTTTTGCTTCTTTCCCATTTCACAC-ATATGATTGTGCCCGACAAAATTCTCTGATGAATTTC---GTTGATTTT-TTTCTC----CCACTGTCACCCCGCTTTCTGTACCTACCCCTCCTTTTGGCA------GACGCAAATTTTTTTC-----GCTGGCCTTGTTCGACTTTA-GTGGGGACACT-----TTTGTGTAGCAA-CCCCCACTATTGGCC--------------------TCTCTTTTTGCTTTGG-------TCGATCACCACTGCAGTCGATTTCCTCAAGCCGCATTGCCTGTCTTGCTTTCTCCATTTCTTTTTCATCAATGCTAACAA-ATGTCCCTCA-ATAGGAAGCCGCCGAACTCGGAAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCCGATACTATGTCACCGTCATTGGTATGTTTTAACTCCTTCT------CATTCATC-----TCAGAGATACACCAGTGCTAACAA--CAATT-----------TCACAGATGCTCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGTTGGCTGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTCCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATTGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGCCAGCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTTTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCCGCTGCCTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCACCC-GTCCTTGATTGCCACACTGCCACTG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_parapilulifera ???????????????????????????????????????????????????CTGGCCA-GCTGTTCCGTGGTATCATGCGAAGGATGAATACTGAATTGGCCAATTACCTGAGACGATGTGTTGAGGGTAACCGACATTTCAATCTTGCTGTTGGCATTAAACCCGGCACGCTTTCCAACGGATTGAAGTATTCACTTGCTACTGGAAATTGGGGTGATCAGAAGAAGGCAATGAGCTCGACTGCAGGTGTGTCACAGGTTCTTAACCGTTATACTTTTGCTTCGACACTATCCCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGCAAGCTGGCGAAGCCTCGACAGCTTCACAACACACATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGCCTGGTCAAAAACTTGTCTTTGATGTGCTATGTTAGTGTCGGATCTCCCTCTGAGCCCCTAATTGAGTTTATGATCAACAGAGGTATGGAAGTCGTCGAGGAATATGAGCCTCTGCGATATCCTCATGCCACGAAGATCTTTGTCAACGGTGTATGGGTTGGAATTCACCA-GGATCCTAAG-CATCTGGTGAACCAAGTTTTGGACACTCGTCGTAAATCTTATCTACAGTATGAAGTCTCTCTGATTAGAGACATTCGTGATCAGGAATTCAAAATCTTCTCTGACGCAGGTCGTGTTATGCGTCCTGTCTTTACTGTACAGCAAGAAGATGATCCGGAAACGGGCATTAACAAAGGTCACCTGGTATTGACGAAGGATCTCGTCAACAGACTGGCAAAGGAGCAGGTTGAGCCTCCAGAAGACTCAAGCATGAAGCTTGGATGGGAGGGGCTGATTAGGGCTGGTGCGGTGGAATATCTCGATGCCGAGGAAGAGGAGACGACTATGATTTGCATGACGCCAGAGGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGTATTTCCACAGAAGAAGACATCGGAGATGATCCAAACAAGCGACTCAAGACTAAAACGAATCCGACAACTCACATGTACACGCATTGCGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGT--CAACTT--GA------CGATTTCTTTTCTTCTTC-------TTCCGTATTATGCTCGAATAC????????????????????????????????????????????????????????????????????????????????????????????????????????GACATTTTATTTCACTTT----CC-GCTTCATGCGATACAATTGTCCCGA-CAAAAT-CTTTTCTGATCTTGT---TCAATTTT-TTCTTC----CCACTGTCACCCCGCTTTCTTTACCTACCCCTCCTTT-GGCA------GACGCAAATTTTTTTTG----G-CTGCCT---TTGGCTTTA-GTGGGG-TGCTC----TCTGT-----AA--CCCCACCATTACCTCACCTCT-----GATTCTTATCTGTTCCCATCTTT-----------TTCGTCTTCGTCGATCACCACTGCAATCCAACTTATCAGGCCGTC-T------TCTTGGTTCCAT-AATGCTAACAATATTTCCCTCA-ATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCCGTTACTATGTCACCGTTATTGGTATGTTGTGATTCCTTGC------CA----------TTGGAAAAAAATCCAGCGCTAACAA-CAA-TC-----------CTACAGATGCTCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTTAAGCAGCTGATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGTTGGCTGCCTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTCCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATTGGAACAGTTCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGCCAGCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTTTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCCGCTGCCTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCACCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_parepimyces ??????????????????????????????????????????????????GCTGGCCA-GCTGTTCCGTGGCATCATGAGAAGGATGAACACCGAAGTGGCCAACTATCTGAGACGGTGCGTTGAAGGTAACCGACACTTCAACCTCGCTGTTGGTATCAAGCCCGGCACTCTTTCAAACGGATTGAAGTATTCTCTTGCCACAGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCCACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCCTGTGGGCTGGTCAAGAACTTATCTTTGATGTGTTACGTCAGTGTCGGTTCTCCATCCGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCTCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CATTTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTCCAGTACGAAGTCTCTCTCGTGAGAGAAATCAGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCAGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATCGGATGGGAGGGATTAATTAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAAAAGGCCGGTATTAACACCGAGGAAGACATGGGAGACGATCCGAACAAGCGACTCAAGACCAAGACAAACCCCACAACTCACATGTATACCCATTGCGAGATTCACCCAAGTATGATCTTGGGCATCTGTGCTAGTATCATTCCTTTCCCCGATC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TAAGCGCCAACTGATTTCGCCTGATTCTCCC-----TCCACATTCAATTGTGCGCGATCA-TTCTGC------AGAGAATTTTCGTGTCGA-----CAATGTTT---CATCACCCCGCTTTC--------CGTTACCCC--TCCTTTGCAGCGACGC--AAAAAA--A------TTTTTTT----GCTGT-CGTT-TGG--G---TTG----AGTGGGGTTCCCTGTGCA-----CCCCAC--TAGCTCACTGC-TTTTTTTGTGCTTCACTCTCACTGC-------CCAGCCGTC--ATTCAACGTGCTC---TGTCTCTGGT--------C------ATTCG--GCGAT----GCTAACCACCTTTTCCATCAATAGGAAGCCGCCGAACTCGGTAAGGGCTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTC-ATTCATCAC---C-----TTGTTGCCGC--AATTGTGAGCCGCTGCTAACAGGCAATTC-------------GCAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGCATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACCGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGTCGAAGGAGACCGCG---ACTGG---CAAGTACACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAACCCCCCAAGCGTCCCACGGAGAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAGGCCCGGCATGGTCGTCACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCGGTCGAGATGCACCACGAGCAGCTCACCGAGGGTCGGCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCCAGAACGACCCCCCCTTGGGTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTACGCCCCC-GTTCTTGACTGCCACACTGCCCACAT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_parestonica ?????????????????????????????????????????????????????????????TGTTCCGTGGTATCATGCGAAGGATGAACACCGAACTGGCCAACTATCTGAGACGGTGTGTTGAGGGCAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTACTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTCAACCGTTACACATTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACACCCATCGGAAGAGACGGTAAGCTGGCGAAGCCCCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAAAACCTGTCGTTGATGTGTTACGTCAGTGTCGGCTCTCCCTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCCACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CATCTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTTGTCAGAGAAATACGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAAGATGACCCTGAAACGGGCATCAACAAGGGCCACTTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCCAGCATGAAGATTGGGTGGGAGGGATTGATCAGGGCTGGCGCGGTCGAATATCTCGACGCTGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATTTCTACTGAGGAAGACATGGGAGATGATCCGAACAAGCGACTAAAGACAAAGACAAATCCAACAACTCACATGTACACCCATTGCGAGATCCACCCAAGCATGATCTTAGGTATCTGTGCCAGCATCATTCCTTTCCCCGATCACAACCAGGTA-GTCG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATACTGATCTACC-TC---ACCCTCCCT----T-CACATTCAATTGTGCCCGACAATTCT-GA------ACGGAATTCGCGTGTCAAACA--CAATTTTCT--CATCACCCCGCTTTCGC--TTCCCATTACCCC--TCCTTTGCAGCGACGC--AAATT----------TTTTT------GCTGTTCTTT-GG---T---TTT----AGTGGGGTGACACCAGCAA----CCCCACCACTGCCACTCACTGCTTTTTGCACTTCTCTACCACTAC-------CCAGTGGTC--CTTC--AACGCCT--TTGTCCCTCG---------C------TTTCA--GCGAT----GCTAACCAT-ATTCCTCTCAACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-ATTCATCAC---C-----TCAATGCGGC--AATGACGAACAAATGCTAACAGAAATCTG-------------GCAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCAGCGGCAAGACCCTCCTTGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCTACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCT-ACT???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_parmastoi ???????????????????????????????????????????????????????TACCGCAGTTCCGCGGTATCATGCGAAGGATCAACACTGAATTGGCTAATTACTTGAGGCGATGTGTGGAAGGCAACCGGCATTTCAATCTTGCTGTCGGCATTAAGCCCGGCACGCTTTCAAACGGCTTGAAGTATTCGCTTGCCACTGGCAACTGGGGTGACCAGAAGAAGGCCATGAGCTCAACCGCAGGTGTATCCCAGGTGCTTAACCGGTACACTTTCGCTTCAACCCTGTCACATTTGCGGCGTACCAACACACCCATTGGAAGAGATGGCAAGCTGGCAAAACCCCGACAGCTTCACAATACTCACTGGGGCTTGGTCTGTCCAGCCGAGACTCCCGAAGGGCAGGCTTGTGGTCTGGTGAAAAACCTGTCCCTGATGTGCTACGTCAGTGTCGGATCCCCCTCCGAGCCTCTGATAGAATTCATGATCAACAGAGGTATGGAAGTTGTTGAGGAATACGAACCTCTGCGCTACCCTCACGCTACCAAGATTTTTGTGAACGGTGTTTGGGTTGGAGTCCATCA-AGACCCTAAG-CATCTTGTGAATCAGGTTTTGGACACTCGTCGCAAATCCTATTTACAGTACGAAGTCTCTCTTATCAGAGATATCCGAGATCAGGAGTTCAAAATCTTCTCTGACGCGGGCCGTGTTATGCGTCCCGTGTTCACTGTTCAGCAAGAGGACGATGCGGAGACGGGTATCAACAAGGGCCACTTGGTTTTGACCAAGGAGCTGGTAAATAGGCTGGCCAAGGAGCAGGCTGAACCTCCGGAGGACCCGTCCATGAAGATCGGATGGGAAGGATTGATTAGGGCTGGCGCAGTTGAATACCTCGATGCCGAGGAAGAAGAGACATCCATGATCTGCATGACACCGGAGGACCTCGAGTTATATCGTCTTCAGAAAGCTGGTATCGCTACGAACGAGGATATGGGAGATGATCCGAACAAGCGACTCAAGACAAAGACGAATCCAACGACTCACATGTATACGCACTGTGAGATTCATCCCAGCATGATTTTGGGCATCTGTGCTAGTATCATCCCTTTCCCTGATCATAACCAGGTATGTCACTGCTTCTGCTAGGTGCTTTGT???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTCCTGCCGTTCTATTTCGGC--TCAAATG------------CAAATCCA-------TTTT-----CCATGTGAAAACTCTTT----TCATGTTGCC-------CCC--GCCGCTATCA-T-TTACCCCTC-CTTTGGTGTA-G-AT--AAATTTTC-------TTCAAGTCTTATTGGTC--TT-GGTGGGGTGGCGGTGTTTGTCT-----CGACCCCACCATGACAA------ACTGGCC------------TTGGAATCTCG----G--CTGCCCAGTCATT--CTTTTCATCAT----C---ATCGTCCATC---ATC------ATTT---TACAGCCATGCTAACCAT-GTTCCCTCCGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTCCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT-------TTCTCTCTCGCCTCATC--GTCGTTCTCATGTCAG-----CGAAACTAACCTGTA------------TTCTAGACGCTCCCGGCCATCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGCGCCATTCTGATCATTGCCGCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGCGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAAGTGGTCCGAGGATCGTTACCTGGAAATCATCAAGGAGACTTCCAGCTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTTGCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTGGCTGCTTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGACCACTGGCAAGACCCTCCTCGAGGCCATTGACGCCATTGAGGCTCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTTCCCCTTCAGGATGTCTACAAGATTGGCGGTATCGGAACTGTCCCTGTCGGCCGTATCGAAACCGGTATCATCAAGCCTGGTATGGTTGTTACCTTCGCTCCCTCCGGCGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGCCAGCCTGGTGACAACGTCGGCTTCAACGTGAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGAAACGTTGCCGGTGACTCCAAGAACGACCCCCCTCTGGGCTGTGCCTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCTGGTCAGATCGGCGCTGGCTACGCCCCC-GTCCTTG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_petersenii ????????????????????????????????????????????????????????????????????????????????????GGGCAACAAGCCATGGCCAACTGCCTTAGACGATGTGTTGAGGGTAACCGCCACTTCAATCTTGCCGTTGGCATCAAGCCCGGCACGCTTTCTAACGGATTGAAGTACTCACTCGCTACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTATCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGCTTGGTGTGCCCGGCTGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGCATGGAAGTCGTCGAGGAGTACGAGCCACTGAGATATCCCCATGCTACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAGTTCACCA-AGATCCCAAG-CATCTGGTAAACCAAGTTTTGGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTCATCAGAGAAATTCGAGATCAAGAATTCAAAATCTTCTCTGATGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGAACTCGTCAACAGATTGGCTAAAGAGCAGGCTGAGCCTCCTGAAGACCCAAGCCAGAAGCTTGGATGGGAAGGGCTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCTATGATTTGCATGACACCAGAAGATCTTGAGCTTTATCGTCTTCAGAAGGCCGGCATTGCCACGGAGGAAGACATAGGAGATAATCCGAACCAGCGTCTGAAGACCAAGACAAATCCAACAACTCACATGTATACGCATTGCGAGATCCACTCGAGTATGATCTTAGGTATCTGTGCCAGTATCATTCCTTTCCCAGATCACACCCAGGTATGT--CCACCCAAGA--??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TAAGCTCATTTCACTGCTTTTTTACTATGCTTGGCACAA-TCGTGTCCTACAATTCTGTTTTCAC--AGTCTTG--TCCA-TCTTCCTCGC---AGCGTCA-CACCCCGCTTTGCCTGTCT----ACCCCTCCTTTGGC--AGCA---AATTTTTT------CTG-CTGCCTCGTTTGACTTTT-AGTGGGG--TGCCAACTTTCTTTTTCCTGGCACAAACCCCGCTATTGTCACTTGTACCTCATCC--CATCGCCTCG---CAA------------------------------------GACTCAAT--------------TTCTCTGTGGTTCATT-GTGCTGATCAT-GCTTCAATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATCGGTATGTTATT--TTCG---------GTCCTTGACATGTCCCAGACCATCATCATTCTAACATGCCAT--------------CACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATCCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCTTGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTTGCCTTTGTCCCCATCTCCGGCTTCAACGGCGACAACATGCTCCAGGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCTCCGGCAAGACCCTTCTCGAGGCCATTGACGCCATTGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTGCCCCTTCAGGACGTTTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCGCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCTCCC-GTCCTCGATTGCCACACTGC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_phyllostachydis ???????????????TTCGGAAAGAAGCGTCTGGATCTGGCGGGTCCTTTGTTGGCTAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACCGAGCTGGCCAACTATCTGAGACGGTGTGTTGAGGGCAACAGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTCTCAAACGGATTGAAATATTCGCTTGCCACCGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTTTCCCAGGTGCTTAACCGCTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGAACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCTGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAAAACCTGTCGTTAATGTGTTACGTCAGTGTCGGCTCTCCCTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTGGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCCACAAAGATTTTCGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CATCTGGTGAACCAGGTTCTGGACACTCGTCGCAAATCCTATCTACAGTACGAAGTCTCTCTCATCAGAGAAATTCGAGATCAGGAATTCAAAATCTTTTCTGACGCGGGCCGTGTCATGCGACCTGTATTCACCGTTCAGCAAGAAGATGACCCCGAAACGGGCATCAACAAGGGCCACTTGGTCTTGACCAAGGAGCTCGTCAACAGGCTGGCTAAGGAGCAGGCTGAACCTCCGGAAGACCCGAGCCTAAAGATTGGATGGGAGGGGTTGATTAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAGGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGCCTTCAGAAAGCTGGTATTTCCACTGAGGAAGACATGGGAGATGATCCGAACAAGCGACTCAAGACTAAGACGAATCCAACGACTCACATGTACACCCACTGTGAGATTCACCCAAGTATGATCTTGGGCATCTGCGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATTGCGTCAACCCCTTCAATTCTATCCTCGAAAAAATTACTAATGAAGTGTACAGTCCCCCCGTAGCACTAACCAATCTGCCATGG?????????????????????????????????????????????????????????????????????TAAGCTCAATCAAATGATTCTCGCCTCATTTTTTCCCT----TTCACACTCAATTGTGCCCGAGAATTCT-GA------ACAG--TTCTCTTGCCAA-----CATTTTTTTT-CGTCACCCCGCTTCCGC--TTCCCATTACCCC--TCCTTTGTAGCGACGC--AAATT----------TTTTTG-----GCTGTCCCTT-TT---T---TTTTTTAAGTGGGGGCGCACCGGCAA----CCCCACCACTGCCAC--------TTTTGCCCTTCACTGCCGTTAT-------CCAGTTACC--ATTTCAAACGCTT--TTGTGTGTCATC------AC------TTTCACAGCGAT----GCTAACCAT-TTTTCCCTCGATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGCATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCTCAACTACGTGGTCACCGTCATTGGTATGTCTG-ATCCATCAC---C-----TCGATGCGGC--ATTCGCAAGCCTATGCTAACGCAAACTTG-------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGTGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTATCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGCCCTCCAAAAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTTCAGCGGCAAGACCCTTTTTGAGGCTATCGACGCCATCGAGCCCCCCAAACGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTACCCTCAAGCCCGGCATGGTCATCACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAACTCGCTGAGGGCTTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGATATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCTCGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGATATGCCCCC-GTCCTTGACTGCCACACTGCCCACT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_pilulifera ???????????????TTCGGAAAGAAACGTCTGGATCTGGCGGGTCCACTGCTGGCCAAGCTATTCCGTGGTATCATGCGAAGGATGAACACTGAATTGGCCAACTACCTGAGACGATGTGTTGAGGGTAACCGACATTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCCAACGGATTGAAGTATTCACTTGCCACTGGAAACTGGGGTGATCAGAAAAAGGCAATGAGCTCAACCGCAGGTGTCTCACAGGTGCTAAACCGTTATACTTTTGCCTCGACGCTATCACATTTGCGCCGTACCAACACACCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACATTGGGGTTTGGTCTGTCCGGCCGAGACACCTGAGGGACAGGCCTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCCTCCGAGCCCCTGATTGAGTTTATGATCAACCGAGGTATGGAAGTCGTTGAGGAATACGAGCCGCTGCGGTATCCCCATGCCACGAAGATCTTTGTGAACGGTGTCTGGGTTGGAATCCACCA-GGATCCCAAG-CATCTGGTGAACCAAGTTTTGGACACTCGTCGCAAATCCTATCTACAATACGAAGTCTCTCTGATCAGAGAAATCCGTGACCAGGAATTCAAAATCTTCTCTGACGCAGGTCGTGTTATGCGCCCTGTTTTCACTGTACAGCAAGAAGATGACCCGGAAACGGGCATTAACAAAGGCCACCTGGTATTGACGAAGGATCTCGTCAACAGACTAGCAAAGGAGCAGGCTGAGCCTCCGGAAGACCCGGGCATGAAGCTAGGATGGGAGGGATTAATTAGGGCTGGCGCGGTGGAATATCTCGATGCCGAGGAAGAAGAGACGTCTATGATTTGCATGACCCCGGAGGATCTAGAACTATATCGTCTTCAGAAAGCTGGCATTGCCACAGAAGAAGACATGGGAGATGATCCAAACAAGCGACTCAAGACAAAGACGAATCCAACAACTCACATGTACACGCATTGCGAAATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCATAACCAGGTATGT--CGACTT--GA------CAACTTCTTTTCTCCTTC----------CATATCGTGTTTAAATAACTGAC--TAATGCTGTGCAGTCCCCCCGTAACACCTACCAATCTGCC?????????????????????????????????????????????????CATTCACTGACTTTTTTTCACTCTTTTTTTCC-ACTTCATGCCAAACAATTGCGACGAACAAAATTCTCTTCTGAATTTTCCTGTCAATTTT-GTTCTC----TCACTGTCACCCCGCTTTCTTTACCTACCCCTCCTTT-GCCA------GACGCAAATTTTTTT-G----G-CTGCCTCGTTTGGTATTA-GTGGGG-TGCTT----TTTGTGTAGCAA--CCCCACCATGACCTACGACAC-----TCTGTCTATGTGCCTCTCGTTCT-----------GTCTACGTCGTCGATCACCCCATCAATTCCTTTCATCAAGCCGCTAT------TTTTCGTTTCGTCAATGCTAACAATGTTTCCCTCT-GTAGGAAGCCGCCGAACTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGATACTATGTCACCGTCATTGGTATGTCTTGATTCTTTTT------CGCTCATCG-ATTTCGAAAAAAATCCAGTGCTAACAA-CAA-TT-----------TGACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGTTGGCTGTCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTCCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGACGTGTACAAGATCGGTGGTATTGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGATCGTTACCTTCGCCCCTGCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGCCAGCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTTTCCGTCAAGGATATCCGCCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCATGGCCGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCACCC-GTCCTT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_placentula ??????????????????????????????????????????????CACTTCTGGCCA-GCTGTTCCGTGGTATCATGCGAAGGATGAATACTGAATTGGCCAACTACCTGAGACGATGTGTTGAGGGTAACCGACATTTCAATCTTGCTGTTGGTATTAAACCCGGCACCCTTTCCAACGGATTGAAGTATTCACTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGCTACACTTTTGCTTCAACACTATCCCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTAGCGAAGCCTCGGCAGCTTCACAACACACATTGGGGTTTGGTCTGCCCAGCCGAGACGCCTGAAGGACAGGCTTGTGGCCTGGTCAAAAATTTGTCTTTGATGTGCTATGTCAGTGTCGGGTCTCCCTCCGAGCCCTTGATTGAGTTTATGATCAACAGAGGTATGGAAGTCGTCGAGGAGTACGAGCCACTGCGGTATCCCCATGCCACAAAGATCTTTGTGAACGGCGTCTGGGTTGGAATTCACCA-GGATCCCAAG-CATCTGGTAAACCAAGTTTTGGACACTCGTCGCAAATCTTATCTACAATACGAAGTCTCTCTGATCAGAGACATTCGTGACCAGGAATTCAAAATCTTCTCTGACGCAGGTCGTGTTATGCGTCCTGTCTTTACTGTACAGCAAGAAGATGACCCAGAAACGGGCATCAACAAAGGCCACCTGGTCTTGACGAAAGATCTCGTCAATAGGCTGGCAAAGGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTAATCAGGGCTGGTGCGGTTGAATATCTTGATGCCGAGGAAGAAGAGACGTCTATGATTTGCATGACACCGGAGGATCTCGAACTCTATCGTCTTCAGAAAGCTGGCATTGCCACAGAAGAGGACATCGGAGATGATCCAAACAAGCGACTCAAGACTAAGACAAATCCAACAACTCACATGTACACGCATTGCGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGT--CGATTT--GA------CAATAGGTTTTTTTCTTC-----TTCTTCGTATTACGCTCAAATAATTGAC--TAAT?????????????????????????????????????????????????????????????????????????????????????????????ATGATTTTTCTTGTGCTCGTTTCCCCCTATCCAT-ATGTAATTGTGCTCG--ACAATTCTCCTA-AAATTTCTGAT-GAATTTT-TTTTTC--TCCCACCGTCACCCCGCTTTCACTGTCTACCCCTCCTTT-TTCG------GACGCAGATTTTTTTTT----GGCTGCCTTGTTTGACTTTA-GTGGGGG------TGCTCTGGGTGGCAA--CCCCACCATCG--TCTCCGGCCCTTATCTATTA-CCTCTTTTGTCTTCA--------TCGTCCAGCGCTGCAATCCATTTTATCAAGACGCGTTGCT-ATTTCAGTT------CATTCATTTCACCACAGCTAACCATGTGTCCCTTA-ACAGGAAGCCGCCGAACTCGGAAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGGTACTATGTCACCGTCATTGGTATGTTTTGATTCCTCTT------CTCTCGCCGATATCCGAAAGAAG-CCAGTGCCAACAT--CAATT-----------TCACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTTAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGTTGGAGGCCTCCAAGAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACTGGTAAGACTCTCCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTGCGTCTTCCCCTCCAGGACGTGTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGCCAGCCCGGTGATAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGATATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGCGCCGCTTCCTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCACCC-T?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_protopulvinata ?????????????????????????????????????????????????????????????????????????????????????????????AGCTTGGCCAACTATCTAAGACGCTGTGTAGAAGGCAACAGACACTTCAACCTTGCTGTTGGTATTAAACCCGGCACGCTTTCCAACGGCTTGAAGTATTCTCTTGCCACTGGCAACTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTATCTCAGGTGCTTAACCGTTATACCTTTGCTTCTACTCTATCACATTTGCGTCGTACCAACACGCCCATTGGACGAGACGGCAAGTTGGCAAAGCCGCGACAACTGCACAACACACATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGCTTGGTCAAAAATTTGTCCCTGATGTGCTATGTGAGTGTCGGATCTCCCTCCGAGCCTCTGATCGAGTTTATGATCAACAGAGGTATGGAAGTTGTCGAAGAGTATGAGCCACTGCGATATCCTCATGCTACAAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTCCATCA-GGATCCCAAA-CATCTCGTGAACCAAGTTCTGGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTGTCTCTCATCAGAGACATCCGAGACCAGGAATTTAAAATCTTCTCTGACGCAGGTCGTGTTATGCGGCCTGTCTTTACAGTCCAGCAGGAAGATGACCCGGACACGGGCATCAACAAGGGTCACTTGGTCTTGACCAAGAGCCTCGTCAATCAGCTTGCGAAGGAGCAGGCCGAACCTCCAGAAGACCCGAGCCTGAAACTTGGTTGGGAGGGCTTAATTAGAGCTGGTGCGGTTGAATATCTCGATGCGGAAGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAAGATCTTGAGCTCTATCGTCTTCAGAAAGCTGGCATTGTCACGGATGAAGACATAGGAGATGATCCGAATAAGCGACTCAAGACAAAGACGAATCCAACGACTCACATGTACACGCATTGTGAAATCCACCCCAGCATGATCTTAGGCATCTGTGCTAGTATCATTCCTTTCCCAGATC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????T-CAATTTCGGATTTCCCTATCATCCAAAGTCATTGCGCAC---AATTCTCTC--GATTTTTTTCGGATTTTT--TGTGTGAATACTGGTCCCCCCC-GCTTTCTCGGCC--TACCCCTCCTTT-GGCGTACGCA---AATTT--TT------TTGCTGCTTTAGATGGA-GTT-AGTGGGGGGGGCAATGATCG-------CGACCCC------GCCACATGCCCTTGACT-GT-GACCAACA-GTATCATC---------TCTCAACAATGCG--ATTCAT---GTTCATCT--------------------------TCGCTTC-AATTTTGCTAACCAT-GCTTCGCTTTATAGGAAGCTGCCGAGCTCGGCAAGGGTTCTTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTTATTGGTATGTA---------TATA-TACGTCGTGGATCGCTTCTTTATAATAAT--CTGGCGCTAATCCGAT-----------CCCATAGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGATTACTGGTACTTCCCAGGCTGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCTGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGAGTGTCGCTTTCGTCCCCATCTCTGGCTTCAACGGTGACAACATGTTGGCTGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTTCTCGAGGCTATCGACTCCATCGAGGCCCCCAAGCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATCGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTTACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGCTGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGAAATCCGTCGTGGAAACGTCGCTGGTGACTCCAAGAACGACCCCCCCATCGGCGCTGCTTCTTTCACCGCCCAGGTTATTGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_pseudostraminea ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATTAAACCTGGCACGCTTTCCAACGGCTTGAAGTACTCGCTTGCCACTGGCAACTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTATCTCAGGTGCTTAACCGTTATACCTTTGCTTCTACTCTATCACATTTGCGTCGTACCAACACACCCATCGGACGAGACGGCAAGCTGGCAAAGCCACGACAACTGCACAACACGCATTGGGGCCTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGTGGCTTAGTCAAAAATTTGTCTCTAATGTGTTATGTCAGTGTCGGATCTCCCTCCGAGCCCCTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTATGAGCCACTGCGGTATCCTCATGCCACAAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTCCATCA-GGATCCCAAA-CATCTCGTGAACCAAGTTCTGGATACTCGTCGTAAATCCTACCTACAGTACGAAGTCTCTCTCATCAGAGACATTCGAGACCAGGAATTCAAAATCTTCTCTGACGCGGGTCGTGTTATGCGGCCTGTCTTTACCGTCCAGCAGGAAGATGACCCGGATACGGGCATTAACAAGGGCCACTTGGTCTTGACCAAGAGCCTCGTCAATCAGCTTGCGAAGGAACAGGCTGAACCCCCAGAAGACCCGAGCCTGAAACTTGGTTGGGAAGGCTTAATTAGGGCTGGTGCGGTTGAATATCTTGATGCAGAAGAAGAGGAGACGTCTATGATTTGCATGACGCCGGAAGATCTTGAGCTTTATCGTCTTCAAAAGGCTGGCATTGCCACGGAAGAAGACATGGGAGACGATCCGAATAAGCGACTCAAGACCAAGACGAATCCAACAACTCACATGTATACGCATTGTGAAATTCACCCCAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCGGATCA????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGAGCTCAATTCGACGATTT-TTTTTTC-----TCAATCTCGTTCCAAGCAATTGCACGA--CAATCCGCAC--AAATTTCACTGCCA-ATT--TCTTTGGATGCTGGCCACCCC--GCTTTCTCTGCC--TACCCCTCCTTT-CGCGCACAAGCAAAATTTTTTT------TTGCTGCC----TTGGT-TTT-AGTGGG---GCCATC-ATCG-------CAACCCC------ACTAC-TGCCCTCGACTCCC-AGTCGGCGGTGACACTATCCGGTG--TCACT-CGTTGAT--CTTCGTCTCGTCAAGCTCTGTCACTCAGTAAAGT--------TTTGATGC-AGCCATGCTAACCAT-GTTTCTCTCTATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTTATTGGTATGTA---------TTTTCTATGTCGTGAATTTT-TTTCCCGCTTCGTGAACAGCGCTAATTCGGT-----------CCTATAGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGATTACTGGTACTTCCCAGGCTGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTCCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGTTGGCTGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTTCTCGAGGCTATCGACTCCATCGAGGCTCCCAAGCGTCCTTCCGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATCGGAACTGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGCTGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCCCCCATGGGCGCTGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_psychrophila ???????????????ATTGGAAAGAAGCGTCTGGATCTGGCTGGTCCCCTGTTGGCTAAGCTTTTCCGTGGCATCATGCGAAGGATGAACACTGAATTGGCCAACTATCTGAGACGGTGCGTGGAAGGTAACAGGCATTTCAATCTTGCTGTTGGCATTAAACCTGGTACGCTCTCCAACGGCTTGAAATACTCCCTCGCCACCGGTAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTATCTCAGGTGCTTAACCGTTATACTTTTGCTTCAACGCTGTCACATTTACGTCGTACCAACACGCCCATCGGGAGAGATGGTAAATTGGCAAAGCCTCGACAGCTTCATAACACGCATTGGGGTTTGGTCTGTCCAGCCGAGACTCCTGAGGGACAGGCTTGTGGCTTGGTCAAAAACTTATCGTTGATGTGCTATGTCAGTGTCGGGTCTCCATCTGAACCTCTGATCGAGTTCATGATCAACAGAGGTATGGAAGTCGTTGAAGAGTACGAGCCACTGCGATACCCTCACGCCACCAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTCCACCA-GGACCCCAAG-CATCTCGTGAACCAAGTTCTGGACACTCGTCGCAAATCTTATCTACAGTACGAAGTCTCTCTAATCAGAGACATTCGAGACCAGGAATTCAAAATCTTCTCCGACGCAGGCCGTGTTATGCGGCCTGTGTTTACAGTTCAGCAAGAGGATGACCCAGAAACGGGCATCAACAAGGGCCACTTGGTTTTAACAAAGGAACTGGTCAATAGGATTGCAAAGGAGCAGGCTGAGCCTCCGGAAGACGCAAGCGCGAAGATTGGTTGGGAGGGTTTAATTAGGGCTGGTGCTGTTGAGTATCTTGACGCCGAGGAAGAAGAGACATCCATGATTTGCATGACTCCGGAGGATCTTGAGCTTTATCGTCTTCAGAAAGCCGGTATTTCCACCGAGGAAGATTTGGGAGACGATCCAAATAAGCGACTCAAGACAAAGACAAATCCAACAACCCACATGTACACCCACTGTGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCTGATCACAACCAGGTATGTTGAGCTTGTTCATCCACTCC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTTCTGTATATTTTTCTGCTATTCCTCAATACAATTCTACTCCAACCCTTTTGTCTGTATCTTTTTT------TTGTTACCTTTTCTGCTACTC--AATTTCTTTTTCGCTGGTCACCCC-GCTTCTCTGTCTACCCCTCCTTTTTGGTACAGACAA--CAGTTCTTT------TTTTTTTTTGGGTGCCATTGG-GTTTGG---TGGGGGGTGCACTGGTCGTACCTT----TTAGTCACTGCTTCTAGCTTCTCTGCCCAT-----GCGCCTGTCTTCA--GCATCCGTCTCTC--AATATTGTCAATT--------TATCAAGCTTCTTT------TGTTCATTTTCAGTCATGCTAACCGCATTTTCTTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCCGATACTATGTCACCGTCATTGGTATGTGCTCCCGACATGTGGATTTTTTTT-GTCCA-GTCATCAGCC-GCTAATAC-AAGCTTCTCTA--------------ATAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGATTGCGCTGTTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGTCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGTTGGCTGTCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGACCACCGGCAAGACCCTCCTTGAGGCCATTGACGCCATTGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATTGGAACAGTTCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTCCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTCTCCGTCAAGGAAATTCGCCGTGGCAACGTCGCTGGTGACTCCAAGAACGACCCCCCCAAGGCTGCTGCCTCCTTCACCGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCTGGATACGCTCCC-GTCCTTGATTGCCACACTGC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_pulvinata ??????????????ATTTGGAAAGAAGCGTCTCGATCTGGCAGGTCCCCTGCTGGCCAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACCGAGTTGGCCAACTATCTAAGACGCTGTGTAGAAGGCAACCGACACTTCAACCTTGCTGTTGGTATTAAACCCGGCACGCTTTCCAACGGCTTGAAGTATTCTCTTGCCACTGGCAACTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTATCTCAGGTGCTTAACCGTTATACCTTTGCTTCTACTCTATCACATTTGCGTCGTACCAACACGCCCATTGGACGAGACGGCAAGTTGGCAAAGCCACGACAACTGCACAACACACATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGCGGCTTGGTCAAGAATTTGTCTCTAATGTGCTATGTGAGTGTCGGATCCCCCTCCGAGCCTCTGATCGAGTTCATGATCAACAGAGGTATGGAAGTTGTCGAAGAGTATGAGCCACTGCGGTATCCTCATGCTACAAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTCCATCA-GGATCCCAAA-CATCTCGTGAACCAAGTTCTGGATACTCGACGCAAATCCTATCTGCAGTACGAAGTGTCTCTCATCAGAGACATTCGAGACCAGGAATTCAAAATATTCTCTGACGCAGGTCGTGTTATGCGGCCTGTCTTTACAGTCCAGCAGGAAGATGACCCGGACACGGGCATTAACAAGGGTCACTTGGTCTTGACCAAGAGCCTCGTCAATCAGCTTGCGAAGGAGCAGGCCGAACCTCCAGAAGACCCGAGCCAGAAACTGGGTTGGGAGGGCTTAATTAGAGCTGGTGCGGTTGAATATCTCGATGCGGAAGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAAGATCTTGAGCTCTATCGTCTTCAGAAAGCTGGCATTGTCACAGATGAAGACATAGGAGATGATCCGAATAAGCGACTCAAGACAAAGACGAATCCAACGACTCACATGTACACGCATTGTGAAATCCACCCCAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCAGATCACAACCAGGTATGTCGACTTACTGATACGTGCTTGATTTCACTTACTAACGTTGTGTGTAGTCCCCCCGTAACACCTACCAATCTGCCATGG????????????????????????????????????????????????????????????????????????TTCGAGAGGTGAGTTCCATTCAATAATTT-TTTTTTCCGAATCTCCCCTCATCCAAAATCATTGTACAC---AATTCCCTC--GAATTTTCG-AGATTTTT--C---TGAAAGATGA-CCCCCCC-GCTTTCTCGGCC--TACCCCTCCTTT-GGCGCACGCA---AAAAAAATT------TTGCAGCTTTGGACGGA-GTT-AGTGG----GGCAACGATCG-------CGACCCC------GCCACATGCCCTTAACT-GT-GACCAACA-GTATCATC---------TC--AACAATACG--ATTCATCATGCTCATCT--------------------------TTACTTC-AATTTTGCTAATCAG-GCTTCGCTTTATAGGAAGCTGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACTGTTATTGGTATGTA---------TATT-TACGTCGTGGATCGCTTCTTTATCAT-----CTGGCGCTAATCCGAT-----------CCCATAGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGATTACTGGTACTTCCCAGGCTGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTTGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCTGAGGCTCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGAGTGTCGCTTTCGTCCCCATCTCTGGCTTCAACGGTGACAACATGTTGGCTGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAGGGAGACCAAG---GGTGG---CAAGTTTACCGGTAAGACTCTTCTCGAGGCTATCGACTCCATCGAGGCCCCCAAGCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATCGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTTACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGCTGAGGGCCACCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCTGTCAAGGAAATCCGTCGTGGAAACGTCGCCGGTGACTCCAAGAACGACCCCCCTATCGGTGCTGCTTCTTTCACCGCCCAGGTTATTGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTCCTCGACTGC-ACACTGCCCACTTGCCTGCAAGTT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_rodmanii ?????????????????????????????????????TGGCGGGTCCCCTGCTGGCCAAGCTGTTCCGTGGTATTATGCGAAGGATGAACACCGAGTTGGCCAACTACCTGAGACGATGTGTAGAGGGCAACCGGCATTTCAACCTTGCTGTGGGCATTAAACCCGGTACGCTTTCAAACGGATTGAAGTATTCACTTGCCACTGGTAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTTAACCGTTACACTTTTGCTTCTACCCTATCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGTTGGCGAAGCCTCGACAGCTTCATAACACGCACTGGGGTCTGGTCTGCCCAGCCGAGACACCTGAAGGACAGGCCTGTGGCTTGGTCAAAAACTTGTCGTTGATGTGCTACGTCAGTGTTGGATCTCCTTCCGAACCCCTGATCGAGTTTATGATCAACAGAGGCATGGAGGTCGTTGAAGAGTACGAGCCGCTGCGGTATCCTCATGCCACAAAGATTTTTGTGAACGGTGTCTGGGTCGGAGTTCACCA-GGATCCTAAG-CATCTGGTGAACCAAGTCCTGGACACTCGTCGCAAGTCCTATCTACAGTATGAAGTCTCTCTGATCAGGGACATTCGTGACCAGGAATTCAAAATCTTCTCCGACGCAGGCCGTGTTATGCGGCCTGTCTTTACTGTTCAGCAAGAAGACGACCCAGAAACGGGTATCAACAAGGGCCATTTAGTTTTGACGAAGGAGCTCGTCAACAGACTGGCAAAGGAGCAGGCTGAGCCTCCGGAAGACCCGAGCATGAAGATTGGGTGGGAGGGGTTAATTAGGGCTGGTGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACGTCTATGATTTGCATGACCCCTGAAGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGTATTTCCACAGAAGAAGACATGGGAGATGATCCAAACAAGCGACTCAAGACCAAGACGAATCCGACGACTCACATGTACACGCATTGCGAGATTCACCCAAGCATGATCTTAGGCATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGT--CGACTTGACAAATCCCTCCCTTTGTTTCTGCTCACATAGCTAATT-GTACAGTCCCCCC???????????????????????????????????????????????????????????????????????????????CGAGAAGGTAAGCTCAGTCGCCTCAGTTTTTTT---CTCATTTTTCAT-CATATTTCCATGCAATTGTGCCCGACAATGCCCAT------CTGGGAGTTTCGTGTGAACAAATTTTTTTTCCCTGCATGGTCACCCCGCTTTCCCTGCCT-ACCCCTCCTTTGGGGGCGGACTTGCAAATTTTTT------TTGCTGTCTTGATTGGTTTTA-GTGGGG---TGAATTCGTCGCAACCCCACCACTGCCTCTGGCTGTCTGTTTGGTCGTCACCCTCATCGTCGCCCAATGGAACCAA--CTCACA--TTGCCT-----------TGTCTTTGCTCCT------------------GTCTCTTTTCAGTCATGCTAACCAT-GTTTCCCTCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTTATTTTCA-TCTC-------CCGCTTTTGGTGCCGACAAGCCAGGCGCTAACACCACCCTC-------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTTGCTGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTCCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTGCGTCTGCCCCTTCAGGACGTGTACAAGATCGGCGGTATCGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTCCTCGACTGCCACACTGCCCAC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_rogersonii ??????????????????????????????CTGGATCTGGCGGGTCCATTGCTGGCCAAGCTGTTCCGTGGTATCATGCGCAGAATGAATACTGAGCTGGCCAACTACTTGAGACGATGTGTTGAGGGTAACCGCCACTTCAACCTTGCTGTCGGCATCAAGCCTGGCACGCTTTCCAACGGATTGAAGTACTCACTCGCCACCGGAAATTGGGGTGATCAGAAGAAGGCAATGAGCTCAACCGCGGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTTTCCCATTTGCGTCGAACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACACTGGGGTTTGGTGTGCCCTGCTGAGACTCCAGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGCATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCCCACGCCACAAAGATCTTCGTGAATGGTGTTTGGGTTGGAATCCATCA-AGATCCCAAG-CATCTGGTAAACCAAGTTTTGGATACCCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGATATCCGTGACCAAGAGTTCAAAATCTTCTCCGACGCCGGTCGTGTCATGCGTCCCGTCTTTACTGTACAGCAAGAAGATGACCCGGAAACAGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGATCTCGTCAATAGGCTGGCCAAAGAGCAGGCTGAGCCTCCGGAAGACCCAAGCATGAAGCTTGGATGGGAGGGATTGATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAAAAGGCTGGTATCAACACGGAGGAAGACATGGGAGACGATCCAAACAAGCGTCTCAAGACCAAGACAAATCCGACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCCAGTATCATCCCTTTCCCCGATCACAACCAGGTATGT--CAACCCGAGAGGCTTTTCTCTCTTCTTGTCCATATGTATCCAA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATTTTCATTTTTTTCGCTTCACATCTTTGAACACAG-CCGTGTCCGACAATTCTGTTCTC----AGAACTG--TCAAATTTTTCTCTCAGCATCACCA-CACCCCGCTTTGCCTGTCT----ACCCCTCCTTTGGCACAGCA---AATTTTTTT-----CTGTCTGCCTTGTTTGGCCTTT-AGTGGGG--TACCATTTTTTTT-----TGGTAGCAACCCCGCTATCGTCACT-GTGTCTTGTCCATC---GTCCCAA--CCAAT-------TCCAA-------------TCGCATCGTCGCTCAAG---------------TCTTTCTTTTTCATT-GTGCTGATCAT-CATTCAATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTCACATGTCC----------TCGTTGACGACGCG-AAA-GATCATCATTTTAACATGCTGCTT------------CACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATCCTGATTATCGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCTTGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTGCAAGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGGTCAAG---GGTGC---CAAGGTCACCGGCAAGACCCTCCTCGAGGCCATTGACGCCATTGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTTTACAAGATCGGTGGTATTGGAACTGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCGCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCTCCC-TGCCTCAGTACC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_rufa ????????????????????????????????????CTGGCGGGTCCACTGCTGGCCAAGCTGTTCCGTGGTATTATGCGCAGAATGAATACTGAACTGGCCAACTACTTGAGACGATGTGTTGAGGGTAACCGCCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACACTTTCCAACGGACTAAAGTACTCACTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTCTCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTTTCCCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACATTGGGGTTTGGTGTGCCCGGCTGAGACCCCTGAGGGACAGGCTTGTGGTCTGGTCAAGAATCTGTCTCTAATGTGCTACGTTAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCCCATGCCACAAAGATTTTTGTGAATGGTGTCTGGGTTGGAATCCATCA-AGACCCCAAG-CATCTGGTAAACCAAGTTTTGGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTTTCTCTGATCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCAGATGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGAATCAACAAGGGCCACCTGGTTTTGACCAAGGACCTCGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCCCCAGAAGACCCAAGCATGAAGCTCGGATGGGAGGGGCTGATTAGAGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAAAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAAAAGGCCGGCATTTCCACGGATGAAGACATAGGAGATGACCCAAATAAGCGTCTCAAGACCAAGACAAATCCGACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGT--CAACCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATTTCTGCTTTTTCACTACGCG-TTCCTGGCCCAA-TCGTGCCCGACAATTCTGTTCTC----AGTCTTG--TCAA-CTTTGCCCTCG-CAGCATCA-CACCCCGCTTTGCCTGCCTC--TACCCCTCATTTTGCACAGCA---AAAATTTT------CTGGCTGTCTTATTTGGCTCTG-AGTGGGG--TGCCAACTTTTGT-----TGGCAGCGACCCCGCTATCGCCACT-GTCCCTCATCCATC---GTCCCAA--CACAT-------TGTGCTCATTCAATCGCATCGTCTTTTGCCTCAAT--------------TCCTTTGGGGTTTATT-GTGCTGATCAT-GTTTCAATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGATACTATGTCACCGTCATTGGTATGTTTTTGGTTCC--------CTCAAT-GACATTTC--GCC-AT-CATCATTCTAACGTGCCACTC------------TGCAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATCCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCTTGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGTTGGCCGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTTCTCGAGGCCATTGACGCCATTGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTGCCCCTTCAGGATGTTTACAAGATCGGTGGTATTGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCGCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTCCCCGGTGACAACGTTGGATTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGCCGTGGAAACGTTGCCGGTGACTCCAAGAACGACCCTCCCATGGCTGCCGCTTCTTTCAACGCCCAGGTCATTGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCTCCC-TGCTCA????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_schweinitzii ???????????????????????????????????????????????????????????GCTGTTCCGTGGCATCATGCGAAGAATGAACACGGAGCTGGCCAACTATCTGAGACGGTGTGTGGAGGGCAACCGACACTTCAATCTCGCGGTTGGTATCAAGCCCGGCACGCTTTCCAACGGCTTGAAGTACTCGCTCGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACGGCAGGTGTGTCTCAGGTGCTCAACCGCTACACGTTTGCCTCGACCCTCTCGCATTTGCGCCGCACCAACACGCCCATCGGAAGAGACGGCAAGCTGGCGAAGCCTCGACAGCTTCACAACACCCATTGGGGCCTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGTCTTGTCAAGAACCTGTCTCTGATGTGTTACGTCAGTGTCGGCTCTCCGTCGGAGCCGTTGATTGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAGGAATACGAGCCATTGCGTTATCCTCACGCTACCAAGATCTTCGTCAACGGTGTCTGGGTGGGCGTTCACCA-AGACCCCAAG-CATCTGGTTCAACAGGTTTTGGACACTCGTCGTAAATCTTACCTGCAGTACGAGGTCTCTCTTGTCCGAGAAATTCGAGACCAGGAGTTCAAAATCTTCTCCGACGCCGGCCGCGTCATGCGACCCGTCTTCACCGTCCAGCAAGATGACGAATCCGACAATGGCATTCCAAAGGGCCACTTGGTACTGACCAAAGAACTGGTTAATAAGTTGGCTCAAGAGCAGGCCGAGCCTCCAGAAGACCCAAGCATGAAGATTGGTTGGGAGGGGCTCATCAGGGCTGGTGCAGTCGAATATCTCGACGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACGCCCGAGGATCTCGAACTGTATCGTGCTCAGAAGGCGGGCGTCCAGATGGAAGAGGATGTTGGCGACGATCCTAACAAGAGACTCCAGACGAAGACGAACCCCACAACGCACATGTACACGCATTGTGAGATTCATCCAAGCATGATCTTGGGCATTTGTGCAAGCATCATTCCTTTCCCCGATCACAACCAGGTAT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATCCTTCAGTTTCGAGCCCATTT---TCCGCCTCATGCCTCTGTGCCCA------ATATTTGTCGTCGAACGGATG--CCCGTTTCGACAGGGACTTGCCCATCACCCCGCTTTCCCTTACCCCTCCTTTGAGCGACGC--AAATTTTTT------TTGCT------GCTTCATCAA-TTTTAG---TGGGGG-TGCATCTCGAGCAACCCCGCTACTGCCTTCAGACCACTA--------TTTTC----TTGCTGTGTCCTA--CAACAGTCTCACT--GCACTCGTCCGCGTCATCATCACT--------G--------CAGCTGTATTTCGCGATGCTAACCATCTTCCCCTTAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGCATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT--GGATCCATTGCCTCA------CCGCGTC--TCTTCGGACACGGC--ACTAACGATTCCCGC-------------ACAGACGCTCCCGGCCACCGTGACTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCACCCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTGCCCCTTCAGGACGTCTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGCTGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGCGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-TGCCT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_semiorbis ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGTTCGACCGCAGGTGTGTCCCAGGTGCTTAACCGTTATACGTTCGCTTCGACCCTATCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCTGCCGAGACACCCGAAGGACAAGCTTGTGGCTTGGTCAAAAACCTGTCTTTGATGTGCTACGTCAGTGTCGGGTCTCCCTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGATATCCTCATGCCACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-GGACCCTAAG-CATCTGGTGAACCAGGTTCTGGACACTCGTCGCAAATCCTATCTACAATACGAAGTCTCTCTCATCAGAGAGATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTTATGCGACCTGTCTTTACTGTTCAGCAAGAAGATGACCCGGAAACTGGCATTAACAAGGGCCACTTGGTATTGACCAAGGAACTCGTCAACAGGCTGGCGAAAGAGCAGGCTGAACCTCCAGAAGACCTGAGCATGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGATGCCGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAACTATATCGTCTTCAGAAAGCTGGTGTTGCTACTGAAGAAGACATATTAGAAAACCCGAACCAGCGACTCAAGACAAAGACGAATCCAACAACTCACATGTACACACATTGTGAGATTCACCCGAGCATGATCTTAGGCATCTGTGCTAGTATCATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATTATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGTTTCAACGGTGACAACATGCTTGCTGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAGGGAGACCAAG---GGTGG---CAAGTTCTCCGGAAAGACCCTCCTTGAGGCCATCGACTCCATTGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGACGTTTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCGGCGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGTAACCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCATGGCCGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGATATGCCCCC-GTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_seppoi ??????????????????????????????????????????GGGTCACTGCTGGCCA-GCTGTTCCGTGGCATCATGCGAAGGATGAATACTGAATTGGCCAACTACCTGAGACGATGTGTAGAGGGTAACCGACATTTCAACCTTGCTGTTGGTATCAAACCCGGCACGCTTTCCAACGGGTTGAAGTATTCACTTGCCACCGGAAACTGGGGTGATCAGAAGAAGGCCGCGAGCTCGACCGCAGGTGTGTCCCAGGTGCTTAACCGTTACACTTTTGCCTCGACGCTATCACATTTGCGTCGTACCAACACGCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGGCAGCTTCATAATACCCATTGGGGTTTGGTCTGTCCGGCCGAGACACCAGAAGGACAGGCTTGTGGTCTGGTAAAAAACCTGTCTTTGATGTGCTACGTCAGTGTTGGTTCTCCCTCCGAGCCCCTGATTGAGTTTATGATCAACAGAGGTATGGAAGTCGTGGAAGAGTACGAGCCACTGCGGTATCCCCACGCAACAAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGATCCCAAG-CATTTGGTGAACCAAGTTCTGGACACTCGTCGCAAATCCTATCTACAATACGAAGTCTCCCTGATCAGAGACATTCGTGAGCAGGAATTCAAAATCTTCTCTGACGCAGGCCGTGTTATGCGTCCTGTTTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGCATTAACAAAGGCCACTTGGTCTTGACGAAGGAACTCGTCAATAGACTGGCAAAGGAGCAGGCTGAGCCTCCAGAAGATCCGAGTATGAAGGTTGGATGGGAGGGGTTAATTAGGGCCGGTACGGTTGAATATCTCGATGCCGAGGAAGAAGAGACGTCTATGATTTGCATGACCCCGGAGGATCTCGAGCTTTATCGTCTCCAGAAAGCTGGCATTGCCACAGAAGACGACATAGGAGATGATCCAAACAAGCGAATCAAGACTAAAACGAACCCGACAACTCACATGTACACTCATTGTGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGT--TGCCTTGACA--------TTTCTTTTCAGAT---TTCATTTATACGTATTACGATCCAATAACTGACCATACCGTGCA?????????????????????????????????????????????????????????????????????????????CCCCCCCCCCCCCCTTTTTTT----------TTTTATTGCCTGGCAATTGTGCCCAACGATTCTCTGTTCTCTTGGAAATTTTCGTATCAATTT--TTTTTTTCCTTCCCACCGTCACCCCGCTTTCACTGCCTTACCCCTCATTTAGCCGACGCAA--AAATTTTTG------G--CTGC-TTGCTTGGATTTA-GTGGGG---TGCATTTTTTTGTGGCAATCCCACTGGCTCG-TCTGACTCTATGCACTGGCCCT----TACTTTTTGCCTTCAATC--GCCCAACTCCATA--AGCAATTTTGCCAAACTACGGTGTCTATCTTGGTT------TCATCGTTTCATCCATGCTGACCAT-TT------CAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAATTACTATGTCACCGTCATTGGTATGTT-TTGATCCCTCTTGT---------ACCGTTGGCATCGAAAGGCCGCCGCTAACGCAAGCCTCACAC---------A--GACGCTCCCGGCCACCGTGACTTCATCAAGAACATGATTACTGGTACTTCCCAGGCTGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCCAGCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGTCTCGTTACCAGGAAATTATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCCGTTGCCTTCGTTCCCATCTCCGGCTTCAACGGTGACAACATGCTTACTCCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGGTCAAG---GGTGGTGCCAAGTTCACCGGCAAGACTCTCCTTGAGGCCATCGACTCCATCCAGCCCCCCAAGCGTCCTGTCGACAAGCCCCTCCGTCTTCCTCTTCAGGACGTGTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTCTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCACTGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCCTGGGTGCCGCTTCTTTCAACGCCCAGGTCATTGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTCCTCGACTGCCACACTGCCCACATGCCCTGGCAAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sinuosa ??????????????????????????????????????????????????????????AGCTGTTCCGTGGCATCATGCGAAGGATGAACACCGAGTTGGCCAACTATCTGAGACGCTGCGTTGAGGGTAACCGGCACTTTAACCTTGCCGTTGGTATCAAGCCCGGCACGCTTTCAAACGGCCTAAAGTACTCGCTTGCCACCGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCCACTGCAGGCGTGTCCCAGGTGCTCAACCGCTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACGCCCATTGGAAGAGATGGCAAGTTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCCGCCGAGACACCTGAAGGGCAAGCTTGTGGTCTGGTCAAAAACCTGTCCTTGATGTGTTACGTTAGTGTCGGTTCCCCATCTGAACCTCTGATTGAGTTCATGATCAACCGAGGTATGGAGGTTGTGGAGGAGTATGAGCCACTACGATATCCTCATGCTACCAAGATTTTTGTCAACGGTGTATGGGTTGGAGTTCACCA-AGATCCCAAG-CACCTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCTTATTTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCGGGCCGTGTCATGCGACCTGTGTTTACCGTCCAGCAAGAAGATGACCCTGAAACGGGTATCAACAAGGGCCATTTGGTACTGACCAAGGAACTCGTCAATAGGCTGGCCAAGGAGCAGGCCGAGCCTCCAGAGGACCCGAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACACCAGAAGATCTCGAGCTTTATCGCCTTCAAAAGGCTGGTATCTCTACTGAAGAGGACATTGGAGACGATCCGAACAAGCGATTGAAAACAAAGACAAACCCAACAACTCACATGTACACTCATTGTGAGATTCATCCAAGCATGATTTTGGGCATCTGCGCTAGTATTATTCCATTCCCCGATCACAACCAGGTATGCAGTCAAAAG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TAAGCTCAATCAACTGATTCCGACTCTGATTTTTTCCCCATTTCCTGCTCAATTGTGACGGAAAAATTCTCA------ACGGAATTCTCTTGTCAA--C--ATTTTTTTTTGCATCACCCCGCTTTCAC--TTCCCATTACCCC--TCCTTTGCAGCGACGC--AAAAATT-T------TT---------GCAGCCTCGA-G----T---TTT----AGTGGGGTCGCTTGTGCAC----ACCCCC--CCCACTACCATTCA-CTGCTTTTTTGCCCTTGACTGCG------TGT-ACCTT--GTCA---TCATTCCA-CGCTCTTGATCATCT-CTT------TTTCA--GCGAT----GCTAACCATCTTTCC-ATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTT-CTGCACGGA---------TCTT-GTTCCATGTTCGCCAGCCCGTACTAATGCCAATTTG-------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTCCTTGAGGCCATTGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGTGGTATTGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACACCAAGAACGACCCCCCCATGGGCGCCGCTTCTTTCACCGCCCAGGTCATTGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCTTGACTGCCACACTGC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.1 ????????????????????????????????????????????????????????????CTGTTCCGTGGTATCATGCGAAGAATAAATACTGAGCTGGCTAACTATCTGAGACGATGTGTGGAGGGTAACCGCCATTTCAACCTTGCTGTTGGTATTAAACCCGGCACGCTTTCAAATGGCCTGAAGTATTCACTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCACAGGTGCTTAACCGTTACACTTTTGCTTCGACCTTGTCGCATTTGCGTCGTACCAACACGCCTATCGGAAGAGATGGTAAGTTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAAGCGTGTGGCTTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGATCTCCCTCCGAACCCCTGATCGAGTTTATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCACGCCACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-GGATCCCAAG-CATCTGGTTAACCAGGTTCTGGACACGCGTCGCAAGTCCTATCTACAGTACGAAGTATCTCTGATTAGAGACATTCGAGACCAGGAATTCAAGATCTTTTCTGATGCCGGACGTGTTATGCGACCTGTCTTTACTGTTCAGCAGGAAGATGACCCAGAAACGGGTATTAACAAGGGCCACTTGGTCTTGACCAAGGAACTCGTCAATAGGTTGGCAAAAGAGCAGGCTGAACCTCCGGAAGACCCGAGCTTGAAGGTTGGATGGGAGGGGTTGATTAGGGCTGGTGCGGTTGAATATCTCGATGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACGCCAGAGGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGTATTTCTACTGAAGAAGACATAGGAGATGATCCAAACAAGCGACTCAAGACCAAGACAAATCCAACAACTCACATGTACACGCATTGTGAGATTCACCCGAGCATGATTTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGT--CGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGATTCTGACTCATCTTTTTATTCTCTTCCCGTGCAA-TTGTTGCGGACAATTCTCATCTTG---AATTTTGCGTCCAACAATTATTTT----CCACCGTCACCCCGCTTTCGCAGCCT----ACCCCTCCTTTTGAGCGACGC--AAATTTTT-------TTGCTGTCTTTTTTGATTTT--AGTGGGGG-TACACATTCTGACGACCCCACTACTCTGGCTCCTTACTCTATTTGTCCATCTTTGTCCAATGTCACGAAGCAATCA------TCGGTTCACACCATCGAGCCCTGTTACACCTGTTTTCCAT---------CATTATCACGTTTAACCAAGCTAACCAA-ATGTCCCTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTCACATGTCC----------TCGTTGACGACGC--GAAAGATCATCATTTTAACATGCTGCTT------------CACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATCCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCTTGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTGCAAGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GGTGC---CAAGGTCACCGGCAAGACCCTCCTCGAGGCCATTGACGCCATTGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTTTACAAGATCGGTGGTATTGGAACTGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCGCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCTCCT-GCTCATAG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.10 ????????????????????????????????????????????????CTGCTGGCCA-GCTGTTCCGCGGTATCATGCGAAGGATGAATACTGAATTGGCCAACTACTTGAGACGATGTGTAGAGGGTAACCGACATTTCAACCTTGCCGTTGGTATTAAACCCGGCACGCTTTCTAACGGACTGAAGTATTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGTTCGACCGCAGGTGTGTCACAGGTGCTTAACCGTTACACTTTTGCTTCAACACTATCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACACTGGGGTTTGGTCTGCCCGGCAGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGGTCTCCCTCCGAGCCCCTAATTGAGTTCATGATCAACAGAGGTATGGAGGTCGTCGAGGAGTACGAGCCGCTGCGATATCCCCATGCCACAAAGATCTTTGTCAACGGTGTCTGGGTTGGAGTTCACCA-GGATCCCAAG-CACCTGGTGAACCAAGTTTTGGACACCCGTCGCAAATCTTATCTACAGTACGAGGTTTCTCTGATCAGAGATATTCGTGATCAGGAATTCAAAATCTTCTCTGATGCGGGTCGTGTCATGCGTCCTGTTTATACTGTGCAGCAGGAAGATGACCCGGAAACGGGCATTAACAAAGGCCACCTAGTCTTGACGAAGGATCTCGTCAATAGGCTGGCGAAGGAGCAGGCTGAGCCTCCGGAAGACCCGAGCATGAAGGTTGGATGGGAGGGGTTAATTAGGGCTGGCGCGGTGGAATATCTCGATGCCGAGGAAGAAGAGACGTCTATGATTTGCATGACCCCGGAGGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGCATTGCCACAGAGGAGGATATCGGAGATGATCCAAACAAGCGACTCAGGACTAAGACGAATCCAACAACCCACATGTACACGCATTGTGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGTC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GATTTTCTTGCTTTTCCATTCCTTGCATGCCC-ATCGAATCGTGCCCG--ACAATTTCTTCT-GAATTTT--GT-CAATTTT-TTTTTC--TCCCATCGTCACCCCGCTTTCTCTGCCTACCCCTCCTTT-GGCA------GACGCAAATTTTTTTTTGGCTGGCTGCCCAGTTTGGCTTTA-GTGGGGTG-----GTTTTTGTGTGGCAAACCCCCACCATCG--CCTCTGACTCTTATCTACTTGTCTCTCTTTTTTTTCGGTCTTCGTCGCCCAACACTGCAATCCGTCTTATCAAGCCGCGTTGCCTGCCTTGGTT------CTTTCGTTTCATGCATGCTAATCATGTCTCCCTCC-ATAGGAAGCCGCCGAACTCGGAAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTTGATCCCTTTT------CTCTCGTCGAAATCC----CAAAGCCAGCGCTAACGG--CCGTT-----------TCGCAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATCCTCATTATCGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGTTGGCTGCCTCCGCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCCGG---CAAGACCACCGGTAAGACTCTCCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTTTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGTTACGCTCCC-GT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.11 ?????????????ATTTTGGAAAGAAGCGTCTGGATCTGGCGGGCCCATTGCTGGCCAAGCTGTTCCGTGGTATCATGCGAAGGGTGAATACCGAATTGGCCAACTACCTGAGACGGTGTGTTGAGGGTAACCGACATTTCAACCTTGCTGTTGGTATTAAGCCCGGCACTCTTTCCAACGGATTGAAGTATTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTGTCACAGGTGCTTAACCGTTACACTTTTGCTTCGACACTGTCCCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACATTGGGGTTTGGTCTGCCCGGCCGAAACGCCTGAAGGACAGGCTTGTGGCCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGGTCTCCCTCCGAGCCCCTAATTGAGTTTATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCACTGCGGTATCCCCACGCCACAAAGATCTTTGTGAACGGTGTCTGGGTCGGAATCCACCA-GGATCCCAAG-CATCTGGTGAACCAGGTGTTGGACACTCGTCGCAAATCCTATCTACAATACGAAGTCTCTCTGATCAGAGACATTCGTGATCAGGAATTCAAAATCTTCTCTGATGCAGGTCGTGTTATGCGTCCTGTCTTTACTGTGCAGCAAGAAGATGATCCGGAAACGGGCATCAACAAGGGCCATCTGGTTTTGACGAAGGATCTCGTCAATAGACTGGCCAAGGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGACTAATTAGGGCTGGCGCGGTGGAATATCTCGATGCCGAGGAAGAAGAGACGTCTATGATTTGCATGACCCCAGAGGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGCATTGCCACAGAAGAGGACATTGGAGATGATCCAAACAAGCGACTCAAGACTAAGACGAACCCAACAACTCATATGTACACGCATTGCGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGTTTCGACTT--GC------CAATTTCTTTTCTTCT----------TCTGTGTTATGCTCAAATCACTGACGTTTTGCTGTTGCAGTCCCCTCGTAACACCTACCAATCTGCCATGGGTAACAA???????????????????????????????????????????????????ATTTCTACTCATTTTCTCC-TTTTCATGCCATGCAATTGTGCTCG--ATAATTCTCTTCTGAATTTTCTTGTCAATTTT-TTTCCC-CTTGCACCGTCACCCCGCTTTCTCT----ACCCCTCCTTTGGGCA------GACGCAAATTTTTGTTG----G-CTGCCTCGTTTGGCTTTA-GTGGGGGTGCTC----TTTCTGGGGCAA--CC--ACCGTTACCT--ACGAC------------------------------------------TGCATTGCAATTCATTTCATCAAGCCGCGCTGTCTGCTTTGTTT------CATTCATATCATCAATGCTAACCATTTTTCCCTCG-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGATACTATGTCACCGTCATTGGTATGTTTTGATCTATTCT------CGCTCGCCG-CTTTCGGAAAG--CCCAACGCTAATAC-CAAATT-----------TCACAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATCACCGGAACTTCCCAGGCTGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTTATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGTCTGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGTTGGCTGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTCCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGACGTGTACAAGATTGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGTCAGCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTTTCCGTCAAGGATATCCGCCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCATGGCCGCTGCCTCTTTCAACGCCCAGGTCATTGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCACCC-GTC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.12 ??????????????????????????????CTGGATCTGGCGGGTCCGCTGCTGGCCAAGCTGTTCCGTGGTATCATGCGCAGAATGAATACTGAGTTGGCCAACTACCTGAGACGATGTGTTGAGGGTAACCGCCATTTCAACCTTGCGGTTGGCATCAAGCCCGGCACGCTTTCCAATGGATTGAAATATTCACTCGCCACTGGAAACTGGGGTGATCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCAACACTATCTCATTTGCGTCGTACCAATACCCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACACTGGGGTTTGGTATGCCCGGCCGAGACACCTGAAGGACAGGCTTGTGGCCTGGTCAAAAACTTGTCCCTGATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGCATGGAGGTCGTTGAAGAGTACGAACCACTGAGGTATCCCCATGCTACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCATCA-AGATCCTAAG-CATTTGGTAAACCAAGTTTTGGACACTCGTCGTAAATCTTATCTGCAGTACGAAGTCTCTCTGATCAGAGACATTCGTGACCAAGAATTCAAAATCTTCTCTGACGCCGGTCGTGTAATGCGTCCTGTCTTTACTGTACAGCAAGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACTTGGTTTTGACCAAGGATCTCGTCAATCGATTGGCCAAGGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTGGAATATCTCGATGCTGAGGAAGAAGAAACGTCTATGATTTGCATGACGCCGGAGGATCTTGAACTCTATCGTCTTCAGAAAGCTGGCATTGCCACAGATGAAGACATAGGAGACGATCCGAACAAGCGTCTCAAAACCAAGACAAATCCGACTACACACATGTACACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCTGATCACAACCAGGTATGT--CAACCCAAGAAGCTATCTCCTTTTTTTACGCTTC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATTGCAACCTTTTTTTC----TTGTCTTTTTTTTTTGTATTCGCGTGTGCGCGACAATTCTGTTCTC----AGCTTTG--TCAA-TTCTTTTCACTCTCCCACAATCACCCCGCTTTACCTGCCT----ACCCCTCCTTTGGCATCGCGC--AAAATTTTT-----CTGGCTGCCTTGTTTGGTTTTTTAGTGGGGTGTTTCAATTTTTT-------GGCAGCAACCCCGCTATCACCACT-GTCCCTCATCCATC------GCAA--CACAAT------TTGTCTC-CTCCATTGCACCGGCTGC--CCTCCAAA-------------TGCTTTGTAATTCATT-GTGCTAACCAG-GTATTCGGTTATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTTCTGTTCT--------TCTCCTAGACCTCGTCTGAAGAT-GGCCATTCTAACACGCTGCTT------------CACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATCCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCTGAGGCTCGTTACCTTGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTCGCCTTCGTCCCCATCTCTGGCTTCAACGGCGACAACATGCTTACTGCCTCTACCAACTGCAACTGGTACAAGGGCTGGGAGAAGGAGACCAAG---ACAGC---CAAGGTCAGCGGCAAGACTCTCCTCGAGGCCATCGACGCCATCGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGTGGTATCGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCTGGTATGGTCGTCACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCCTGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC---TCTCGAC-GCCA????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.13 ?????????????????????????????????????????????TCGCTGCTGGCCA-GCTGTTCCGTGGTATCATGCGAAGGATGAATACTGAATTGGCCAACTACCTGAGACGATGTGTTGAAGGTAACCGACATTTCAACCTCGCTGTTGGTATTAAACCCGGCACGCTTTCCAACGGATTGAAGTATTCACTTGCCACTGGAAACTGGGGCGACCAGAAGAAAGCAATGAGCTCGACCGCAGGTGTGTCACAGGTGCTTAACCGTTACACATTTGCTTCGACACTGTCCCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACATTGGGGTTTGGTCTGCCCTGCCGAGACACCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGGTCTCCCTCCGAGCCTTTAATTGAGTTTATGATCAACAGAGGCATGGAGGTCGTCGAAGAGTACGAGCCACTGCGGTATCCCCATGCCACAAAGATCTTTGTGAACGGTGTCTGGGTTGGAATTCATCA-GGATCCCAAG-CATCTGGTGAACCAAGTTTTGGATACTCGTCGCAAATCTTATCTACAATACGAAGTCTCTCTAATCAGAGACATTCGTGATCAGGAATTCAAAATCTTCTCTGACGCAGGTCGTGTCATGCGTCCTGTTTTTACTGTACAGCAAGAAGATGATCCGGAAACAGGCATTAACAAAGGCCACCTGGTCTTGACGAAAGACCTTGTCAACAGACTTGCAAAGGAGCAAGCTGAGCCTCCAGAAGACCCGAGCATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGCGCGGTGGAATATCTCGATGCCGAGGAAGAAGAGACGGCTATGATTTGCATGACCCCGGAGGATCTCGAGCTTTATCGTCTACAGAAAGCTGGCATTGCCACGGAAGAGGACATCGGAGATGATCCAAACAAGCGACTCAAGACCAAGACGAATCCAACAACCCACATGTACACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGT--CGGCTT--GA------CAACTTCTTCC------------------ATATTATGCTCAGGTAACTGAC--TAATGCTGTACAGTCCCCCCGTAACACCT??????????????????????????????????????????????????????????TAAGCTCAATTCACTGCTTTTTCCTTCCTTTCTCCCTTTCATGGCATGCAATTATGCTCG--ACAATTCACT---GAATTTGT---CCAATTTT-TTTTCTCTTCCCACCGTCACCCCGCTTTCTTTGCCTACCCCTCCTTTTGTC-------AAGGCAAATTTTTTTT-----GGCTGCCTTGTTTGGCTTTA-GTGGGGTCCTTG---CCCTGT-TAGCAA--CCCCACCATCGCCT---CCAGCTTTATCTACTGGCCTCTTTTATCTTCG--------TCAATCAACCCTGCAGCCCATTTTATTAGGCCGCGTTGCCTATCTTTTGTG-----TGTGCGTTGCATCAATGCTAATTTTATCTCCCTCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTAAGATTCCTCTT------CCTTT-TTGACATCTAAACTG-----GGTACTAATAC--CAATC-----------TTACAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATCACCGGAACTTCCCAGGCTGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGTTGGCTGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTCCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGACGTGTACAAGATCGGTGGTATTGGAACAGTTCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGCCAGCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTCTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCTTGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCCCCC-GTCCTTGATTGCCACACTGC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.14 ??????????????????????????????????????????????????????????????????????????????????????????????CTATGGCCAACTATCTAAGACGCTGTGTAGAGGGCAACCGACACTTCAACCTTGCTGTTGGCATTAAACCCGGCACGCTTTCCAACGGCTTGAAGTATTCTCTTGCCACTGGTAACTGGGGTGACCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTATCTCAGGTGCTTAACCGTTATACCTTTGCTTCTACTCTATCACATTTGCGTCGTACCAACACACCCATTGGACGAGACGGCAAGTTGGCAAAGCCGCGACAACTGCACAACACACACTGGGGCTTGGTCTGCCCAGCCGAGACACCCGAAGGACAAGCTTGTGGCTTGGTCAAAAACTTGTCTTTGATGTGTTATGTCAGTGTCGGATCTCCCTCTGAGCCTCTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTATGAGCCACTGCGGTATCCTCATGCCACGAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTACATCA-GGACCCCAAG-CATCTTGTGAACCAAGTTCTGGATACTCGTCGTAAATCCTATCTACAGTACGAAGTCTCTCTCATCAGAGACATTCGAGACCAGGAATTCAAAATCTTCTCTGACGCGGGTCGTGTTATGCGGCCTGTCTTCACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATTAACAAGGGCCACTTGGTCTTGACCAAGAGCCTCGTCAATCAGCTTGCGAAGGAGCAAGCTGAACCGCCAGAAGACCCAAGTCTGAAACTTGGCTGGGAGGGCTTAATTAGGGCTGGTGCGGTTGAATATCTCGATGCGGAAGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTTGAGCTCTATCGTCTTCAGAAAGCTGGCATTGCCACGGAGGAAGATATCGGAGACGATCCCAATAAGCGACTCAAGACTAAGACCAATCCAACAACTCACATGTACACGCACTGTGAAATTCACCCCAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCGGATCACAACCAGGTATGTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGAGTCATACCGATACAATT-TTGTATTT--TTTCCCCCCTATTCAGCCAATATCGGCACGATAATTCTCACATGAATTGGCGTGTCGATTT--TCTTTGGATGCTGGTCACCCC--GCTTTCTCTGCC--TACCCCTCCTTTAGGCGCACAAGC--AATTTTTTT------TTTTTGCTGC-CTTGGT-TTT-AGTGG----GGCAGTGATTG-------CAACCCCC-----GCCAC-AGCCGTCAACACA--ATTTTGTG-TCACTATCAGTGTCT--CATCTCCATCAAG--CTTTGTC--GCTCAGTCTA------------------------TCGTTTA-AACTCAGCTAACCAT-TTTTCGCTCTACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTTATTGGTATGTC---------TTTGTTCCGCCGTGATTTTTTTCTGTA---------ACAACACTAATTCAAT-----------CCCATAGATGCCCCCGGTCACCGTGACTTCATCAAGAACATGATTACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCTTGTTGGCCTACACTCTCGGTGTCAAGCAGTTGATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGATTCAACCCCAAGGCCGTCGCTTTCGTCCCCATTTCCGGCTTCAACGGTGACAACATGTTGGCTGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAGAGAGACCAAG---GCTGG---CAAGTCCTCCGGTAAGACTCTTCTCGAGGCCATCGACTCCATTGAGGCCCCCAAGCGTCCCTCAGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCATCACGAGCAGCTCACTGAGGGCCACCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGAGATTCGTCGTGGAAACGTCGCTGGTGACTCCAAGAACGACCCCCCCATGGGTGCTGCTTCTTTCACCGCTCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGATACGCACCC-GTCCTCGATTG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.15 ?????????????????????????????????TGGATTGGCGGTCCCCTGTTGGCTAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACTGAATTGGCTAACTATCTGAGACGATGTGTCGAAGGCAACAGACATTTCAATCTTGCCGTTGGCATTAAACCTGGTACACTCTCCAACGGCTTGAAATATTCACTCGCCACCGGCAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTTAACCGTTATACTTTTGCTTCTACGCTGTCACATTTACGTCGTACCAACACACCTATTGGAAGAGATGGTAAATTGGCAAAGCCGCGACAACTTCATAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACTCCTGAGGGGCAGGCTTGTGGCTTGGTCAAAAACTTATCTTTGATGTGCTATGTCAGTGTCGGGTCTCCATCCGAACCTCTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAAGAGTATGAGCCGCTGCGATACCCTCATGCCACCAAGATCTTCGTGAACGGTGTCTGGGTTGGAGTCCATCA-GGACCCCAAG-CATCTTGTGAGCCAAGTTCTAGACACTCGTCGTAAATCTTATCTACAGTACGAAGTCTCTCTGATTAGAGAAATTCGAGACCAAGAATTTAAAATTTTCTCTGACGCAGGTCGTGTTATGCGGCCTGTGTTTACGGTTCAGCAGGAGGATGACCCGGAAACGGGCATTAACAAAGGCCACTTGGTTTTAACAAAGGAACTGGTCAATAAGATTGCAAAGGAGCAAGCTGAGCCTCCAGATGATCCAAGCGTGAAGATTGGTTGGGAGGGTTTGATTAGGGCTGGTGCAGTTGAATATCTCGATGCTGAGGAAGAAGAGACATCCATGATTTGCATGACTCCGGAAGATCTTGAGCTTTATCGTCTCCAGAAAGCTGGTATCTCCACTGAGGAAGATTTGGGAGACGATCCAAACAAGCGACTCAAGACAAAGACAAATCCAACGACTCACATGTACACGCACTGTGAGATTCATCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCTGATCACAACCAGGTAAATTGAGCTG--TCATCCACTACTTTCACCGAAATGATTTGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGATTTTGTTATTCTTCCGCCTTTTATTGTTGTCCGATACATCAATTTTTGCCTGTATCAATTTT------TT------TTTCTTGCACTCA--ATTTTTTTTCCCGCTGGTCACCCC-GCTTCTTTGCCTACCCCTCCTTTT-GGCAGAGACAA--AAAAAAATT------GTGTGCA----ATTGGATTTG-GT---G---GGGGGA-TGCAACGGTCGCAAATTCTTTCTCGCCACTACTT-CTGGCTCTGCACATTT-------GCCTGTCTTCA--CCACCCATCATTC--AATATTGTCAACTCGTTCATTTACCCAGTTTCTGA------TATTTTTTTCAGCCA-TGCTAACCATGTATCCTTCAACAGGAAGCTGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGATACTATGTCACCGTCATTGGTATGT--TTGCTCGACATCTAGTGTCTCTTGTCCCCATCATCAGTC-GCTAATAC-AAGTTTCCTTT--------------ATAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCCGATTGCGCTGTCCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAAGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGTTGGCTGTCTCCGCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGACCAGCGGAAAGACCCTTCTTGAGGCCATTGACGCCATTGAGCCCCCTAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATCGGAACCGTTCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGATCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACATCAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCCCCCAAGGCTGCTGCCTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCTGGATATGCCCCA-GTCTA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.16 ?????????????ACTTTGGAAAGAAGCGTCTGGATCTGGCGGGTCCCCTGCTGGCCAAGCTGTTCCGCGGCATCATGCGAAGGATGAACACGGAATTGGCTAACTACCTGAGACGGTGCGTAGAGGGCAACCGCCATTTCAACCTTGCTGTTGGCATCAAGCCCGGCACGCTCTCCAACGGGCTGAAGTATTCGCTCGCCACCGGAAACTGGGGCGATCAGAAGAAGGCCATGAGCTCGACCGCAGGCGTGTCCCAGGTGCTCAACCGGTACACCTTTGCCTCGACCCTATCACATCTGCGCCGCACCAACACACCGATCGGAAGGGATGGCAAGCTAGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGCTTGGTCTGCCCAGCCGAGACACCCGAGGGGCAAGCCTGCGGCCTGGTCAAAAACCTGTCTTTGATGTGCTACGTCAGTGTCGGCTCTCCATCCGAGCCCTTGATCGAGTTCATGATCAACAGAGGCATGGAGGTCGTCGAGGAGTACGAGCCGCTGCGGTATCCCCATGCCACCAAGATCTTCGTGAATGGCGTCTGGGTCGGCGTTCACCA-AGACCCTAAG-CACCTGGTGAACCAGGTCCTCGACACTCGCCGCAAGTCCTATCTGCAGTACGAAGTCTCGCTCATCAGGGACATCCGAGACCAGGAATTCAAGATCTTCTCCGACGCTGGCCGTGTTATGCGGCCCGTCTTCACCGTCCAGCAGGAAGACGACCCGGAAACGGGCATCGACAAGGGCCACCTGGTACTGACCAAGGAACTCGTCAACAGGCTGGCGAAAGAGCAGGCCGAACCCCCAGAAGACCCGAGCATGAAGATTGGGTGGGAGGGCTTGATCAGGGCCGGCGCGGTGGAGTATCTCGACGCCGAGGAAGAGGAGACGGCTATGATTTGCATGACGCCCGAGGATCTGGAGCTGTACCGCCTTCAGAAAGCGGGCATCGCCACCATGGAGGACATGGCAGACGATCCGAACAAGCGACTCAAGACGAAGACGAACCCGACCACTCACATGTACACACACTGCGAGATTCATCCGAGCATGATCTTGGGCATCTGCGCCAGTATCATTCCTTTCCCCGATCACAACCAGGTAAGTTATCGACTTTTCTTCTTTTTCTTCTTCTTCTTCTTCTTCTTCGCCCCCTTCAACTCGTGCTCCAAGAACCTTGTGCTAACGG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TACTTCCCAGGCCGACTGCGCTATTCTCATCATTGCTGCTGGCACTGGTGAGTTCGAGGCTGGAATCTCCAAGGATGGCCAAACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGTTAATCGTCGCCATCAACAAGATGGACACTGCCGCCTGGTCCGAGTCTCGTTACGTGGAAATCATCAAGGAGACTTCCAATTTCATCAAGAAGGTCGGCTACAACCCCAAGTCGGTGGCCTTCGTTCCCATCTCCGGCTTCAACGGTGACAACATGCTTGCCGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAGGGAGACCAAG---GCTGG---AAAGTCCTCCGGCAAGACCCTTCTTGAGGCCATCGATTCCATCGAGCCCCCGAAGCGTCCTACAGACAAGCCTCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGTGGCATCGGAACAGTCCCCGTCGGCCGTATCGAGACAGGTGTCCTCAAGGCCGGTATGGTTGTCACATTTGCTCCCTCTAACGTCACTACGGAAGTCAAGTCCGTCGAGATGCATCACGAGCAGCTCTCCCAGGGATTACCCGGCGACAACGTTGGCTTCAACGTGAAGAACGTTTCCGTGAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCAAAGAACGACCCACCAATGGCTGCTGCTTCTTTCACCGCCCAGGTTATTGTCATGAACCACCCGGGCCAGGTTGGTGCCGGTTACGCCCCC-GTCCTCGACT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.17 ?????????????????????????????????????????????????????????????????????????????????????????????????TGGCCAACTATCTGAGACGATGTGTTGAGGGCAACCGCCATTTCAACCTTGCTGTTGGCATCAAGCCTGGCACGCTTTCCAACGGATTGAAGTACTCACTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCAACCGCAGGTGTATCACAGGTGCTTAACCGTTATACTTTTGCTTCTACACTATCCCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACACTGGGGTTTGGTGTGCCCGGCCGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCCTCTGAGCCTTTGATCGAGTTTATGATCAATAGAGGCATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCTCATGCCACAAAGATCTTTGTGAATGGTGTCTGGGTCGGAATCCATCA-AGATCCCAAG-CATCTGGTAAACCAAGTTTTGGATACTCGTCGCAAATCCTACCTGCAATACGAAGTCTCTCTGATCAGAGATATTCGAGACCAAGAATTCAAAATTTTCTCCGACGCCGGTCGTGTCATGCGTCCTGTCTTTACTGTTCAGCAAGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGATCTTGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAACTTGGATGGGAGGGATTAATTAGGGCTGGCGCGGTGGAATATCTCGACGCCGAGGAAGAGGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTCTATCGTCTTCAAAAGGCTGGTATTTCCACGGAGGAAGACATAGGAGACGATCCAAACAAGCGTCTCAAGACCAAGACAAATCCGACAACTCACATGTACACGCATTGCGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTTCCCGATCACAACCAGGTATGT--CAACCCGAGGAGTTATTCTATCGTTTCTGTCCACCTTTCTTTATACTACGTTCAAATCGCTAACCGATGCTAAACA????????????????????????????????????????????????????????????????????????????????????????????????????????GTTTGCTTCGCA-CTATGGGCGCAA-TCGTGTCCGACAGTTCTGTCCTC----AGCATTG--TCAT-TTTTTCTCTCAGCATCACCA-C--CCCGCTTTGCCTGTCTT---ACCCCTCCTTTGGCATAGCA---AAATTTTT------CTGTCTGCCTTGTTGGGCTCTT-AGTGGGG--TGCCGTGTTTTT-------GGCAGCAACCCCGCTATCGCCGCT-GTGCCTCGTCCATTTT-GCTCCAA--CAGTT-------TCCATCCACTCTGTTGCCTCGTATCTTCGCTCAAAA-------------TTCATTCTTGTTTATT-GTGCTGATCAT-GATTCAATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTTTATGTC------------TGCTCACAAGTCG-AAACGACCATCGTTCTAACATGCTGCCT------------CACAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATCCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCTTGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAGGGCCGTTGCCTTTGTCCCCATCTCCGGCTTCAACGGCGACAACATGCTGGCTGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGGTCACCGGCAAGACCCTTCTCGAGGCCATTGACGCCATCGAGGCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTTTACAAGATCGGTGGTATTGGAACTGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTCACCTTCGCTCCCGCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACTGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCATGGCTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGAGCCGG-TACG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.18 ??????????????????????????????????ATCTGGCGGGTCCCTTGCTGGCCGAGCTGTTCCGTGGTATCATGCGCAGAATGAATACTGAGCTGGCCAATTACCTGAGACGATGTGTTGAGGGTAACCGGCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACACTTTCCAACGGACTAAAGTACTCACTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTCTCACAGGTGCTTAACCGTTACACTTTTGCTTCTACTCTTTCCCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAACCTCGACAGCTCCACAACACACACTGGGGTTTGGTGTGCCCGGCTGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGCTACGTCAGTGTTGGGTCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCCCATGCCACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCATCA-AGACCCCAAG-CATCTGGTAAACCAAGTTTTGGATACTCGTCGCAAATCCTATCTGCAGTACGAGGTCTCTCTGATCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCTGATGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTGCAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACAAAGGACCTCGTCAACAGACTGGCCAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTCGGATGGGAGGGGCTGATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAAAAGGCCGGCATTGCCACGGATGAGGACATAGGAGATGATCCAAATAAGCGTCTCAAGACCAAGACAAATCCGACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGC--CAACCCGAGAAGTTATCCTTTCCCCTTTCCTCTCATTTTTTTCTTTCTGTCTCTTACGTTCAGATCGCTGACTGATGCTATACA???????????????????????????????????????????????????????????????????????????????????????CATTTCTTTTCTTCCTACGCA-TCTT-GGCACAA-TCGTGTCCGACAATGCTGTTCTC----AGTCTTG--TCAA-TTTTTTTTCT--CAGCGTCA-CACCCCGCTTTGCCTGTCT----ACCCCTCCTTTGGCACAGCA---AAAATTTT------CTGGCTGCCACGGTTGGCTTTT-AGTGGGG--TGCCAACTTTTTTTT--TTGGCAGCAACCCCGCTATCGCCACT-GTCCCTCGTCAATC---GCCCCGA--CACAT-------TGTGCTCACTCAATCGCGTCGTCTTTCGCCTCAA----------------TCTCTGTGGTTCATT-GTGCTGATCAT-GCTTCAATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTGT---TTTC--------AGTCCTTGACATCTC--GGG-AT-CACCATGCTAACGTGCTCGTC------------TACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATCCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCTTGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGTTGGCCGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTTCTCGAGGCCATTGACGCCATTGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTGCCCCTTCAGGATGTTTACAAGATCGGTGGTATTGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCGCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTCCCCGGTGACAACGTTGGATTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGCCGTGGAAACGTTGCCGGTGACTCCAAGAACGACCCTCCCATGGCTGCCGCTTCTTTCAACGCCCAGGTCATTGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCTCCC-TCCTCAGTAG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.2 ??????????????????????????????????????TCTGGCGGTCCTGCTGGCCA-GCTGTTCCGTGGCATCATGCGAAGGATGAACACCGAACTGGCCAATTATCTGAGACGATGTGTAGAGGGCAACCGCCATTTCAACCTTGCTGTGGGTATCAAACCCGGTACGCTTTCAAACGGATTGAAGTATTCACTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTCTCTCAGGTGCTTAACCGTTACACTTTTGCTTCTACCCTTTCACATTTGCGTCGTACCAACACACCCATCGGAAGAGACGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTCTGGTCTGCCCGGCCGAGACACCCGAAGGACAAGCTTGTGGTTTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTTGGATCTCCTTCCGAACCCTTGATCGAGTTTATGATCAACAGAGGCATGGAGGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCGCATGCCACAAAGATCTTTGTGAACGGTGTCTGGGTCGGAGTTCATCA-GGACCCTAAG-CACCTAGTGAACCAGGTTCTGGACACTCGTCGCAAATCCTATCTACAGTACGAAGTCTCTCTGATTAGAGACATTCGTGATCAGGAATTCAAAATCTTCTCCGACGCAGGTCGTGTCATGCGTCCCGTCTTCACTGTCCAGCAAGAAGACGACCCAGAAACGGGTATTAATAAGGGCCATCTGGTATTGACAAAGGAGCTCGTCAACAGACTGGCAAAGGAGCAGGCTGAGCCTCCGGAAGACCCGAGCATGAAGATTGGGTGGGAGGGGTTAATCAGAGCTGGTGCGGTTGAATATCTCGATGCAGAGGAAGAAGAGACGTCTATGATTTGCATGACTCCCGAAGATCTCGAGCTCTATCGTCTTCAGAAAGCTGGTATTTCCACAGAAGAAGATATGGGAGATGATCCCAACAAGCGACTCAGGACCAAGACGAATCCGACGACTCACATGTATACGCATTGTGAAATTCACCCAAGTATGATCTTAGGCATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGT--CGGCTTGACAAGTTCTTCCCCTCT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGAAGTAAGCTCAGTCACCTCATTTTCTGTCAAATTTTTTTCCCATCGTCTTTCCAAGCAGTTGTGCCCGACAATCTCCA-------CTGGGATTTTCGTGTCGACGAA-TTTTTTTTTTTCCATCGCCACCCCGCTTTCCCTGCCTTACCCCTCCTTTGGAACAGACCTGGAAAAAAAATT------TTGCTGCCTTGTCTGGTTTTA-GTGAGGGGCTACATTGGTCGTCACTCCACCACTGCCTCTGGCGATCTGTT-GCCTTTCCGACTCTTCGTCACCCATCAGCACCAT--TTCTCAAGTTGCTCATCACATCACATACCATTGGCTCTACTACC----TG------TTTTCGTCTCAGTCATGCTGACCAT-GAATCCGTCGACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTGATATTCGGCCCC-------CCGCTTTTGGTTCCGACAAGTCAA-TGCTGACACCAATCTC-------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTTGCCATCAACAAGATGGACACCGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTTGCTGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCTTCCGGCAAGACTCTCCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACCGACAAGCCCCTCCGTCTGCCTCTTCAGGACGTGTACAAGATTGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCATCAAGGCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCGTCGGTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCTCGACTGCCACACTGCCCACTG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.3 ?????????????????????????????????????????????????TGCTGGCCA-GCTGTTCCGTGGTATCATGCGAAGGATGAACACTGAGCTGGCCAACTATCTCAGACGCTGTGTCGAGGGCAACAGGCATTTCAACCTTGCCGTTGGTATCAAGCCCGGCACGCTGTCCAATGGCTTGAAGTATTCTCTTGCCACCGGCAATTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTTAACCGCTATACCTTCGCTTCCACTTTGTCACATTTGCGTCGTACCAACACACCCATTGGACGAGACGGCAAGTTGGCAAAGCCTCGACAACTGCACAACACGCATTGGGGCTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGCTTGGTCAAAAACTTGTCTTTGATGTGTTACGTCAGTGTCGGATCTCCCTCCGAGCCTTTGATCGAATTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCACTGCGGTATCCTCATGCCACAAAGATCTTCGTCAACGGTGTCTGGGTTGGTGTTCACCA-AGATCCCAAG-CATCTCGTCAACCAAGTCTTGGATACTCGTCGTAAATCCTACCTTCAGTACGAAGTCTCTCTCATCAGAGACATTCGAGACCAAGAATTCAAAATCTTCTCTGACGCCGGCCGTGTTATGCGGCCTGTCTTTACCGTCCAGCAGGAGGATGACCCGGACACGGGCATTAACAAGGGCCACTTGGTCTTGACCAAGAGCCTCGTCAACCAGCTTGCGAAGGAGCAGGCCGAGCCCCCAGAAGATCCAAGCATGAAGCTTGGCTGGGAAGGCTTGATTAGGGCTGGTGCGGTTGAATATCTCGATGCGGAAGAAGAGGAGACGTCTATGATTTGCATGACGCCGGAAGATCTCGAGCTCTATCGTCTTCAGAAAGCTGGCATTGTCACGGAAGAAGACATGGGCGACGATCCCAACAAGCGTCTCAAGACAAAGACGAACCCGACGACTCACATGTACACGCATTGTGAAATTCACCCCAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCAGATCACAACCAGGTACGTCGAGATATCGATGCATGTTTGATTGACTTTACTAAAAACA???????????????????????????????????????????????????????????????????????????????????????????????????????????CGAGAAGGTTAGTCTATTCTACTTTTTTCCCT--CTTCCCATCTTTTGCCAGCACCCAAAGCAAATCTGCAGAACAATTCGCACG-AATTTTCCATGTCAGTTT--TGCTTGGGTGCCAGACGACCCC-GCTTTCTCTGCC--TACCCCTCCTTT-GGCGCACACAAGCAAATTTTTTTCTATCTTTTTGCTGC-CTTCGG-TTT-TGTGGA---GACACTCATCA-------CAAACCCC-----GCCACCA-CCCTCGAGTCC--AATCTATG-TGACCATT-GTAGCA--ACACTACAATGCA--ATTCACTTCTCGTCATTATGCTCCGCCTCTGTGCG------TTTCTGGTCCAAATATGCTAACCAT-GATTTGCTCTACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTTATTGGTATGTA---------TCCCATGTGCGATTCTCTTCATCTCAACGAC-----TCGACGCTAATTCAAA-----------TGTGCAGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGATTACTGGTACTTCCCAGGCCGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGTTGGCTGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTTCTCGAGGCTATCGACTCCATCGAGGCCCCCAAGCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATTGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCTCTGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCCGCTGCTTCTTTCACCGCTCAGGTCATTGTCATGAACCACCCCGGCCAGGTCGGTGCCGGCTATGCCCCC-GTCCTCGATTGCCACACTGCCCACAT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.4 ATGATAGGTGATCACTTTGGAAAGAAACGTCTAGATCTGGCGGGTCCACTGCTGGCCAAGCTGTTCCGTGGTATCATGCGAAGGATGAATACAGAATTGGCCAACTACCTGAGACGATGTGTTGAGGGTAACCGGCATTTCAACCTGGCTGTTGGTATCAAACCCGGCACGCTTTCCAACGGATTGAAATATTCGCTTGCCACTGGAAACTGGGGCGATCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTGTCACAGGTGCTTAACCGTTACACTTTTGCTTCGACACTGTCCCATTTGCGTCGTACCAACACACCCATTGGAAGAGACGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACTCATTGGGGCTTGGTCTGCCCTGCCGAGACACCTGAGGGACAGGCTTGTGGCCTGGTCAAAAACTTGTCTTTGATGTGTTACGTCAGTGTCGGGTCTCCCTCCGAGCCCCTAATTGAGTTTATGATCAACAGAGGTATGGAAGTCGTGGAGGAGTATGAGCCGCTGCGGTATCCCCATGCTACAAAGATCTTTGTCAACGGTGTCTGGGTTGGAATTCACCA-GGATCCCAAG-CATCTGGTGAACCAAGTTTTGGACACTCGTCGCAAATCCTATCTACAATACGAAGTCTCTCTGATCAGAGACATTCGTGATCAGGAATTTAAAATCTTCTCTGACGCAGGCCGTGTCATGCGTCCTGTTTTTACTGTACAGCAAGAAGATGACCCGGAAACGGGCATTAACAAAGGCCACCTGGTCTTGACGAAGGATCTCGTCAATAGACTGGCAAAGGAGCAAGCTGAGCCTCTGGAAGACCCAAGCATGAAACTTGGATGGGAGGGGTTGATTAGGGCTGGTGCGGTTGAATATCTTGATGCCGAGGAAGAAGAGACGACTATGATTTGCATGACACCGGAGGATCTCGAACTTTATCGTCTTCAGAAAGCTGGCATTGCCACAGAAGAGGATATTGGAGATGATCCAAACAAGCGACTCAAGACGAAGACGAACCCAACAACTCACATGTACACGCATTGCGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCCTTTCCCGATCACAACCAGGTATGT--CGAACTACGA------AAATTGTTCCCTTTCTCT-------CGTCGTATTATGCTCAAATAACTGAC--TAATGCTGTGCAGTCCCCCCGTAACACCTACCAATCTGCCATG??????????????????????????AAGGTAAGCCCAATCCCCTGATTTTTTCGCTCTTTTTTTTTTCCCCCCTCTCCCCAGTCTGCCACGTAATCGTGTCCG--ACTTCATTGCGC-ATTTTCTTGGTCAAATTAT-TTTCTC--TCCCGCCGTCACCCCGCTTTCACTGCCTACCCCTCCTTT-GGTA------GACGCAAATTTTTTT------GGCTGCCTTGTTTGGCTTTA-GTGGGGTGCTCTTTGCTTCGTGTGACTA--CCCCACCATCGCCTCTCTGAGTCTTATCTGCTGGCTTCTTTTTTTCTTC--------CCACCCAACACTACAATCCATTCAATCAAGCGGCTTCCTC-A----AGTT------TCTTCCTTTCATCCTTGCTAACCATGTGTCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATATTTTGATCTCTCTT------CTGTCAACTTCGAAAGGGCTAGGGCTGGCGCTAACACACCAATT-----------TCATAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTCATCATCGCTGC-GGTACTGGCGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACCTTACCAATTGGTCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAATTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTTCCTTACGTCCCCATCTCCGGCTTCCACGGTGACAACATGTTGGAGAACTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTCCTTGAGGCTATCGACGCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACAGGTATCCTCAAGGCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGCCATCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCTGTCAAGGATATCCGCCGTGGTAACGTTGCTGGTGACTCAAAGAACGACCCCCCCTTGGGTGCCGCTTCTTTCAACGCCCAGGTCATCATGATGAACCACCCTGGTCAGGTCGGTGCCGGATACGCACC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.5 ??????????????ATTTGGAAAGAAGCGTCTGGATCTGGCAGGTCCCCTGCTGGCTAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACTGAATTGGCCAACTATTTGAGGCGATGTGTGGAAGGTAACAGGCATTTCAATCTTGCTGTTGGCATTAAACCTGGTACACTCTCCAACGGCTTGAAATATTCACTGGCCACTGGCAACTGGGGTGACCAGAAGAAGGCCATGAGTTCGACCGCAGGTGTATCTCAGGTGCTCAATCGTTATACTTTTGCTTCAACGCTGTCACATTTACGTCGTACCAACACACCCATTGGAAGAGACGGTAAATTGGCGAAGCCGCGACAGCTTCATAACACGCATTGGGGTTTGGTGTGCCCAGCTGAGACTCCTGAGGGACAGGCTTGTGGTTTGGTCAAAAATTTATCTTTGATGTGCTATGTTAGTGTCGGGTCTCCCTCTGAACCTCTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAAGAGTATGAGCCCCTGCGATACCCTCATGCCACTAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTCCATCA-GGATCCCAAG-CATCTTGTGAACCAAGTTCTGGACACTCGTCGCAAATCTTATCTACAGTACGAAGTCTCTCTGATTAGAGATATTCGAGACCAGGAATTTAAAATCTTCTCTGACGCAGGTCGTGTTATGCGGCCTGTGTTTACCGTTCAACAGGAGGATGACCCAGAAACGGGCATTAACAAAGGTCACTTGGTTTTGACAAAGGAACTGGTCAATAGGCTTGCAAAGGAGCAAGCTGAGCCTCCAGAAGACCCAAGCATGAAGATTGGATGGGAAGGTTTAATTAGGGCTGGTGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACATCCATGATTTGCATGACTCCGGAAGATCTTGAGCTTTATCGTCTTCAGAAAGCTGGTATTTCCACCGAAGAAGATATGGGAGATGATCCAAACAAGCGACTCAAGACAAAAACAAACCCAACAACTCACATGTACACGCACTGTGAGATTCACCCGAGCATGATTTTAGGTATCTGTGCTAGTATCATTCCTTTCCCTGATCACAACCAGGTATGTTGAGCTT--CTGTCCACCACGTATGCCGATTATAGCTTGCTAATGATTATCTAGTCCCCTCGTAACACCTACCAATCTGCTATGGG???????????????????????????????????????????????????????????????????????????????TGATTTTTTTCTGC----TATTTTCCCCCAAAAAATTACAACTCGCCTGTATAA--TAT------TT------TTTTTTGCACAGA--ATATTTTTTTCTGCTGGCTACCCCCGCTTCTT--CCTACCCCTCATTT--GACGCAGACAC--AAATTTTTT------TGGGGCT----GCCTCAATTG-GTTTGG---TGGGGT-TGCTTTGGTCGCAAAT-----CTCATCACTACTT-TGGTTTCTTCACATATTAATCAGGCCCTTCTTCA--TCATCCGTCACTC--ACTGCCGTCAACT--TTCTTCTGCT--GCTTCTTT------TTTTTCCCTCAAATAATGCTGACCATGTGTCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGGTACTATGTCACCGTCATTGGTATGTCTTTTGTGGAAATCTCTCATATCCGACGTT--TCAGCAGTT-GCTAATGCCAAGTTTCCTTTT-------------ATAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGTGCTATCCTCATCATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGTTGGCTGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACTAAG---TCTGG---CAAGTCCACCGGCAAGACCCTTCTTGAGGCCATTGACTCCATTGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCCCCCAAGGCTGCTGCCTCTTTCACTGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCTGGATATGCA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.6 ?????????????????????????????????????TGGCGGGTCCTCTGCTGGCCA-GCTGTTCCGCGGTATTATGCGAAGAATGAACACCGAGTTGGCCAACTACCTGAGACGATGTGTAGAGGGCAACCGACATTTCAACCTTGCTGTTGGCATTAAACCCGGTACGCTTTCAAACGGATTGAAGTATTCACTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTTAACCGTTACACTTTTGCTTCTACCCTATCACATTTGCGTCGTACCAACACGCCCATCGGAAGAGATGGCAAGTTGGCGAAGCCTCGACAGCTTCATAACACGCATTGGGGCTTAGTGTGCCCAGCTGAGACACCTGAAGGACAAGCTTGTGGCTTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTTGGATCTCCTTCCGAACCCCTGATTGAGTTTATGATCAACAGAGGCATGGAGGTCGTTGAGGAGTACGAGCCGCTGCGGTATCCTCATGCCACAAAGATCTTTGTGAACGGTGTCTGGGTCGGAGTTCACCA-GGATCCCAAG-CATCTGGTGAATCAAGTTCTGGACACTCGTCGCAAGTCCTATCTACAGTATGAAGTCTCTCTGATCAGGGACATTCGTGACCAAGAATTCAAAATCTTCTCCGACGCAGGTCGTGTTATGCGTCCTGTATTTACTGTTCAGCAAGAAGACGACCCAGAAACGGGTATTAACAAGGGCCATTTGGTTTTGACGAAGGAGCTCGTCAACAGACTGGCAAAGGAGCAGGCTGAGCCTCCGGAAGACCCGAGCATGAAGATTGGGTGGGAGGGGTTAATTAGGGCCGGTGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACGTCTATGATTTGCATGACCCCTGAAGATCTCGAGCTTTATCGTCTTCAGAAGGCTGGTATTTCCACAGAAGAAGACATGGGAGATGATCCGAACAAGCGACTCAAGACCAAGACGAATCCGACAACTCACATGTACACGCATTGCGAGATTCACCCGAGTATGATCTTAGGCATTTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGT--CGACTTGATAAATTCCTTCCTTTGCTT-TGCTCACATAGCTGATTTGCACAGTCCCCCCGAAACACCTACCAATCTGCCAT??????????????????????????????????????????????????????????GAGAAGGTAAGCGCAGTCGCCCTTTTTTTTTTGGCTTCATTCTTCTTTCATCTTTCCATGCAATTGTCCCCGACAATGCCCAT------CTGGGATTTTCGTGTCAACAA--TTTTTTTCCTCCAATGGTCACCCCGCTTTCCCTGCCT-ACCCCTCCTTTGGGAACGGACTTGGAAAAACTTT------TTACAGCCTTGGTTGGCTTTA-GTGGGG---TGAACTCGTCGCAACCCCACCACTGCCTCTGGCTGTCTGTT-GCTCGTCACCATCATCGTCGCCCAAAGGCACCAA--CTCACA--TTGTCC-----------TATCTTTGCTTCT------------------TTCTCTTTGCAGTCATGCTGACCAT-GTTCCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTCATTTTCA-TCTC-------CTGCTTTCAGTGCCGACAAGTCAA-CGCTAACACCACCCTC-------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTTGCTGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTCCTTGAGGCTATCGACTCCATCGACCCCCCCAAGCGTCCCACGGACAAGCCCCTGCGTCTGCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCCAAGTTACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCTCTGAGGGCCAGCCCGGTGACAACGTCGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCCAGGGTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCTCCC-GTCCTCGACTGCCACACTGCCCACAT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.7 ?????????????????????????????????????????????????????????????TGTTCCGTGGTATCATGCGAAGAATGAACACCGAATTGGCCAACTATCTGAGACGTTGTGTTGAGGGCAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAATACTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGATACACGTTTGCTTCGACCTTGTCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTCTGGTCTGCCCAGCCGAGACACCCGAAGGACAAGCTTGTGGTCTGGTCAAAAATCTGTCCTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCTGAACCCCTAATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAGGAGTATGAGCCTCTGCGGTATCCTCACGCCACCAAGATTTTTGTAAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCCAAG-CATCTGGTGAACCAGGTTCTGGACACGCGTCGCAAATCCTATCTCCAGTACGAAGTATCCCTCGTCAGAGAGATTCGAGACCAGGAATTCAAGATCTTTTCCGACGCAGGCCGTGTTATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGACCCTGAAACAGGCATCAACAAGGGCCACTTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCTAAGGAGCAGGCTGAACCTCCGGAAGACCCGAGCATGAAGGTTGGTTGGGAAGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAAGAAGAAGAGACGTCCATGATTTGCATGACGCCAGAGGATCTCGAGATGTATCGCCTTCAGAAAGCCGGTATTTCGACCGAGGAAGACATGGGAGATGACCCGAACAAGCGACTGAAGACCAAGACAAATCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCCTAGGCATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CTCAATCAACTGATTCTCC--CATCAATTTTCCT----T-CGCACTCAATTGTGTCCGACAATTCTCAA------AAGGAATTTTCGTGCCGA-CA--CAATTTTTTG-CATCACCCCGCTTTCGC--TTCCCATTACCCC--TCCTTTGCAGCGACGC--AAATT----------TTTTTT-----GCTGCCTGT--GG---T---TTT----AGTGGGGGTGCACGAGTAA----CCCCACCACTACCTCAACGACTTTTTCACTCTGCTCTATCACTAC-------CCAGCTGTC--CTTG--GACAGCT--TTGTGTCTCGTC------AC------TATCA--GTGAT----GCTAATCAT-TTTTCCCTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCCGATACTACGTCACCGTCATTGGTATGTCTG-ATTCATCAC---C-----TCCAAGTGAC--AACAGCAAGTCAGTTCTAACAAAAACGAC-------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTGGAAGCCTCCAAGAACTGCCCCTGGTACAAGGGCTGGGAGAGAGAGACCAAG---GGTGG---CAAGTTCAGCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGATGTGTACAAGATCGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACCGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTCCTCGATTGCCACACTG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.8 ????????????????????AAAGAAGCGTCTGGATCTGGCAGGTCCCTTGCTTGCTAAGCTGTTCCGTGGTATCATGCGGAGGATGAATACCGAGTTGGCCAACTACCTGAGACGATGTGTCGAGGGTAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGCTTGAAGTACTCGCTTGCCACTGGAAACTGGGGCGATCAGAAGAAGGCCATGAGTTCGACTGCGGGTGTGTCTCAGGTGCTTAACCGTTACACTTTTGCTTCGACCTTGTCACATTTGCGTCGTACCAACACCCCCATCGGACGAGATGGTAAATTGGCCAAGCCTCGACAGCTTCACAACACACATTGGGGTTTGGTCTGCCCAGCTGAGACACCTGAGGGACAAGCTTGTGGCTTGGTCAAAAACTTGTCTCTGATGTGTTATGTCAGTGTCGGATCTCCCTCTGAACCCCTGATCGAGTTTATGATCAACAGAGGCATGGAAGTCGTGGAAGAATATGAACCTTTGCGATATCCTCATGCCACAAAGATCTTTGTAAACGGTGTTTGGGTTGGAGTCCACCA-GGACCCTAAG-CATCTGGTGAATCAAGTTCTGGACACTCGTCGCAAATCTTATCTCCAGTACGAAGTCTCTCTGATCAGAGACATTCGTGATCAGGAATTCAAAATCTTTTCCGACGCAGGTCGTGTTATGCGTCCCGTCTTTACTGTCCAGCAAGAGGACGACCCAGACACGGGTATTAACAAGGGCCACTTGGTCCTGACAAAAGAGCTCGTCAACAGATTGGCAAAGGAGCAGGCGGAACCCCCAGAAGACCCGAGCATGAAGGTTGGATGGGAAGGGCTCATTAGGGCTGGTGCGGTTGAATATCTCGATGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACGCCAGAGGATCTCGAGCTTTATCGTCTTCAGAAGGCTGGCATTGCCACAGAAGAAGACATGGGAGATGATCCGAACAAGCGTCTCAAGACCAAGACGAATCCTACGACTCACATGTACACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCATAACCAGGTACGTCAATTCCCTTCCCCATGTTTTTTTTTAAAACCCTTCTTACTAACATCCGTGCAGTCACCCCGTAATACCTACCAATCTGCC???????????????????????????????????????????????????????????????????TAAGCCT-AGCCGA-TTAGTTATTTTTG---TATTTTTCTTTTTTCACTCG----------CAATTGTGCCGACAATTCGCACCTGAAGTTTCGAGTCAACAC--AATTTTTTTCC--TCCACCCC--GCTTTTGCTGGC-CTACCCCTCCTTTTGGCAGA-ACGC--AAATTTTTT------TGCTGGCTTTTCTGCTT--TT-GGTGGGGGCGC-AGATACAG-------CGACTCCACCATTGCTT--AGCTCTTATCTGT-CTGCTA--------CCTTTATCTCC--GATCCCAACCTTTCGCATCTTATCAGGCATC---ATCGCCTTCATGTCTT------CTTTCTATTCAATTGTGCTAATCAT-CTTTCCTTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCTAAGTACTATGTCACCGTCATTGGTATGT-----------T-TTCGATTCATC---TTGTTGAAATGAACA------ATCGCTAATACATT---------GCCTCACAGACGCTCCCGGCCACCGTGACTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCTGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTTGCCCCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACCCTTCTCGAGGCTATCGACTCCATCGAGCCTCCCAAGCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTCACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTTGAAATGCACCACGAGCAGCTCGTTGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGCGCCGCTTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTCCTCGACTGCCACACTGC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sp.9 ?????????????????TGGAAAGAAGCGTCTGGATCTGGCGGGTCCACTGCTGGCCAAGCTGTTCCGTGGTATCATGCGGAGAATGAATACTGAGCTGGCCAACTACCTGAGACGATGTGTTGAGGGTAACCGCCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACACTTTCCAACGGACTCAAGTACTCACTCGCCACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTCTCACAGGTGCTTAACCGTTACACTTTTGCCTCTACACTTTCCCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGTTTGGTGTGCCCGGCAGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAAAATTTGTCTCTGATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGCATGGAAGTCGTTGAGGAGTATGAGCCACTAAGGTATCCCCATGCCACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCATCA-AGACCCCAAG-CATCTGGTGAACCAAGTTTTGGATACTCGTCGCAAATCCTATCTGCAGTATGAGGTCTCTCTGATCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCTGATGCCGGTCGCGTTATGCGTCCCGTCTTCACCGTACAGCAGGAAGATGATCCCGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAAGACCTCGTCAACAGACTGGCCAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTCGGATGGGAGGGGCTGATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACCTCCATGATTTGCATGACACCAGAAGATCTTGAGCTTTATCGTCTTCAAAAGGCCGGCATATCCACGGATGAAGATATAGGAGATGATCCAAATAAGCGTCTCAAGACCAAGACAAATCCGACAACCCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGACCACAATCAGGTACGT--CGACCCGAGAAGCTGTTCTCTCTTCTTCCTTCATCTTTATGTATTTTACGTTCAAAACGCTAACTGATGCAAAACAGTCCCCCGTACACTACCAATCCGCATGGCA??????????????????????????????????????????????????????????????????????????????ACTACGTT-TTCTTGGCACCA-TCGTGTCCGACAATGCTGTTCTC----AGCCTTG--ACAA-TTTTTCTGC----ATCGTCA-CACCCCGCCCTACCTGTCTGCATACCCCTCCTTTGGCACAGAA---AATTTTTT------CTGGCTGTCTTGTTTGGCTTTT-AGTGGGG--TGCCATTCTTTT------GGGCTACAACCCCGCTGTCGCCGCT-GTCCCT---CCATC---GTCCCAA--CAATC-------TGTTTTCACTTGATCACATCGTCTTTTGCTTCATT--------------TTCTCCGCGGTTCATT-GTGCTGATCAT-GATTCAATCAATAGGAAGCCGCCGAGCTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTTGATTTC----------CTCACTGACACTCCC-GAA-ATTCATCATTCTAACGTGCCGCCC------------CACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGAACCTCCCAGGCTGACTGCGCTATCCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAAATGGGCCGAGGCTCGTTACGTTGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCCGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGTTGGAAGTCTCTACCAACTGCGCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGACTGGAGGCAAGACCCTCCTCGAGGCCATTGACGCCATTGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTGCCCCTTCAAGATGTCTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGCATGGTCGTTACCTTCGCTCCCGCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTTACTGAGGGTGTCCCCGGTGACAATGTTGGTTTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCATGGGCGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGTCAGGTCGGTGCCGGATACGCT??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_spinulosa_CBS121272 ????????????????????????????????GGATCTGGCGGGTCCCTTGTTGGCCAAGCTGTTCCGTGGCATCATGCGAAGGATGAACACCGAGTTGGCCAACTACCTGAGACGCTGCGTCGAAGGCAACCGACACTTCAACCTTGCCGTTGGTATCAAGCCCGGCACGCTATCCAACGGATTGAAATACTCTCTCGCCACCGGAAACTGGGGCGATCAGAAAAAGGCCATGAGCTCAACGGCAGGCGTGTCGCAGGTGCTTAACCGCTACACATTTGCTTCCACTCTGTCGCATTTGCGTCGCACTAACACACCCATCGGAAGAGATGGTAAGCTGGCCAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTATGCCCAGCCGAGACGCCTGAAGGACAAGCTTGCGGTCTGGTCAAGAACCTGTCATTGATGTGTTACGTCAGTGTCGGTTCCCCTTCCGAACCTCTGATTGAGTTCATGATCAACCGAGGCATGGAAGTCGTCGAAGAGTACGAGCCATTGCGATACCCTCATGCGACCAAGATTTTCGTCAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCCAAG-CATCTGGTCAACCAGGTTCTGGACACTCGCCGCAAGTCTTATCTGCAGTACGAAGTCTCTCTCGTAAGAGAAATCCGAGATCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTATTTACTGTTCAGCAAGAAGATGACCCCGAAACGGGTATCAACAAGGGTCATTTGGTATTGACCAAGGAACTCGTCAACAGGCTGGCAAAAGAACAGGCCGACCCCCCCGAGGATCCAAGCATGAAGACTGGATGGGAGGGCTTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACACCAGAAGATCTCGAGCTCTATCGTCTTCAAAAAGCCGGTATTTCTACCGATGAGGACATTGGAGATGATCCGAACAAGCGATTAAAGACCAAGACCAATCCGACAACGCACATGTACACCCACTGCGAGATTCACCCAAGCATGATTTTGGGTATCTGCGCTAGTATTATTCCCTTTCCCGATCACAATCAGGTATGTCGTTCGAACCGTCCGCGTTTGAAGCTCGAGGAAATGTATTAATGGCGTGTAAACACAGTCCCCCCGTAACACGTACCAATCGGCCATGGG??????????????????????????????????????????????????????????????????????????????TAAGCTTTGTTCA-TTTTCC-----TTCACATTCAATAGTGGCAGAGAA-CTCCCA------ACGGATTTCTTCTGTCAA--C-----GTTTC---CATCACCCCGCTC-------TGTCGTTACCCC--TCATTGGTGCCTACGC--AAA------------AATTTTT----GCAGCCTTGA-A----A---TTT----AGTGCGAGTGGCAGGGCCC-----ACCGA--GCGC--CTTCCTTTTTTCTGTCCTTTTTTTCTCTCTTT----CAATGGACAGC--ATCTATCGCACTC-G-CG-TTTTGATGATCTTTAT------TTTCA--GCCAT----GCTAATCAT-TTTCCCATCAATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTTTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-CCTCTTAAT---C-----TTTACGTTACT-ATTCGCCAGCATGTGCTAACC-CCAAT---------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCGGCTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGGCCACCGGCAAGACCCTTCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTGCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGAACGGTTCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGCATGGTCGTTACCTTTGCTCCCTCCGGTGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGCCGAGGGTAACCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCCAGGCTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTATGCCCCC-GTCCTCGACTG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_spinulosa_CBS121280 ????????????????????????????????GGATCTGGCGGGTCCCCTGTTGGCCAAGCTGTTCCGTGGCATCATGCGAAGGATGAACACCGAGTTGGCCAACTACCTGAGACGCTGCGTCGAAGGCAACCGACACTTCAACCTTGCCGTTGGTATCAAGCCGGGCACGCTATCCAACGGATTGAAGTACTCTCTCGCCACCGGAAACTGGGGAGATCAGAAAAAGGCCATGAGCTCAACGGCAGGCGTGTCGCAGGTGCTTAACCGCTACACGTTTGCTTCCACTCTGTCGCATTTGCGTCGCACCAACACACCCATCGGAAGAGATGGTAAGCTGGCCAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTATGCCCAGCCGAGACGCCTGAAGGACAAGCTTGCGGTCTGGTCAAGAACCTGTCATTGATGTGTTACGTCAGTGTCGGTTCCCCTTCCGAACCTCTGATTGAGTTCATGATCAACCGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGATACCCTCATGCGACCAAGATTTTCGTCAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCCAAG-CATCTAGTCAACCAGGTTCTGGACACTCGCCGCAAGTCTTATCTGCAATACGAAGTCTCTCTCGTAAGAGAAATCCGAGATCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTTTTTACTGTTCAGCAAGAAGATGACCCCGAAACGGGTATCAACAAGGGTCATTTGGTATTGACCAAGGAACTCGTCAACAGGCTGGCAAAAGAACAGGCCGACCCCCCCGAGGATCCAAGCATGAAGACTGGATGGGAGGGCTTGATCACGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACACCAGAAGATCTCGAGCTCTATCGTCTTCAAAAAGCCGGTATTTCTACCGATGAGGACATTGGAGATGATCCGAACAAGCGATTAAAGACAAAGACCAATCCGACAACGCACATGTACACCCACTGCGAGATTCATCCAAGCATGATTTTGGGTATCTGCGCTAGTATTATTCCCTTTCCCGATCACAATCAGGTATGTCGTTCGAACCGTCCGCGTTTGAAGCTCGAGGAAATGTATTAATGGCGTGTAAACACAGTCCCCCCGTAACACGTACCAATCGG??????????????????????????????????????????????????????????????????????????????TAAGCTTTTTTATTTTTTTA-TTTTTC-----TTCACATTCAATTGTGGCAGAAGA-CTCCCA------ACGGATTTCTTCTGTCAA--C--CACGTTTC---CATCACCCCGCTCTCAC--TTGTCGTTACCCC--TCATTGGCACCTACGC--AAA------------TTTTTTT----GCAGCCTTGA-A----T---TTT----AGTGCGGGTAGCAGGGCCC-----ACCGA--GCGC--CTTCCTTTTTTCTGTCCTTTTTCTCTCTCTTC----CGATGGACTGC--ATCTATCGCACTC-A-CGCTTTTGATCATCTTTAT------TTTCA--GCCAT----GCTAATCAT-TTTCCCATCAATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTTTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-CCTCTTAAT---C-----TTGATGCTACT-ATTTGCCAGCATGTGCTAACC-CCAAG---------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGGCCACCGGCAAGACCCTTCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTGCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGCATGGTCGTTACCTTTGCTCCCTCCGGTGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGCCGAGGGTAACCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCCAGGCTGCCGCTTCTTTCACCGCTCAGGTCATTGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTATGCCCCC-GTCCTCGACTG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_spinulosa_CBS311.50 ATGATAGGTGATCATTTTGGAAAGAAGCGTCTGGATCTGGCGGGTCCCCTGTTGGCCAAGCTGTTCCGTGGCATCATGCGAAGGATGAACACCGAGTTGGCCAACTACCTGAGACGCTGCGTCGAAGGCAACCGACACTTCAACCTTGCCGTTGGTATCAAGCCCGGCACGCTATCCAACGGATTGAAGTACTCTCTCGCCACCGGAAACTGGGGCGATCAGAAAAAGGCCATGAGCTCAACGGCAGGCGTGTCGCAGGTGCTTAACCGCTACACGTTTGCTTCCACTCTGTCGCATTTGCGTCGCACCAACACACCCATCGGAAGAGATGGTAAGCTGGCCAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTATGCCCAGCCGAGACGCCTGAAGGACAAGCTTGCGGTCTGGTCAAGAACCTGTCATTGATGTGTTACGTCAGTGTTGGTTCCCCTTCCGAACCTCTGATTGAGTTCATGATCAACCGAGGCATGGAAGTCGTCGAAGAGTACGAGCCACTGCGATACCCTCATGCGACCAAGATTTTCGTCAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCCAAG-CATCTGGTCAATCAGGTTCTGGACACTCGCCGCAAGTCTTATCTGCAGTACGAAGTCTCTCTCGTAAGAGAAATCCGAGATCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTATTTACTGTTCAGCAAGAAGATGACCCCGAAACGGGTATCAACAAGGGTCATTTGGTATTGACCAAGGAACTCGTCAACAGGCTGGCAAAAGAACAGGCCGACCCCCCCGAGGATCCAAGCATGAAGACTGGATGGGAGGGCTTGATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAGGAGACAGCCATGATTTGCATGACACCAGAAGATCTCGAGCTCTATCGTCTTCAAAAAGCCGGTATTTCTACCGATGAGGACATTGGAGATGATCCGAACAAGCGATTAAAGACAAAGACCAATCCGACAACTCACATGTACACCCACTGCGAGATTCACCCAAGCATGATTTTGGGTATCTGCGCCAGTATTATTCCCTTTCCCGATCACAATCAGGTATGTCGTTCGAACCGTCCGCGTTTGAAGCTCGAGGAAATGTATTAATGGCGTGTAAACACAGTCCCCCCGTAACACGTACCAATCGGCCATGGGTAACAA????????????????????????????????????????????????????????????????????????TAAGCTATTTTCAATTTTCC-----TTCACATTCAATTGTGGCAGGGAA-CTTCCA------ACGGATTTCTTCTGTCAA--C-----GTTTC---CATCACCCCGCTCTCAC--TTGTCGTTACCCC--TCATTAGCGCCTACGC--AAA------------TTTTTTT----GCAGCCTTGA-A----T---TTT----AGTGCGGGTGGCAGGGCCC-----ACCGA--GCGC--CTTCCTTTTTTCTGTCCTTTTTTTTTCCCCTC--TCCGATGGATTGC--ATCTATCGCACTC-G-CTCTTTTAAT---CTTTAT------TTTCA--GCCTT----GCTAATCAT-TTTCCCATCAATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTTTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTG-CCTCGTAAT---C-----TTGATGCTACT-ATTCGCCAGCATGTGCTAATC-CCAAA---------------CCAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGGCCACCGGCAAGACCCTTCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCTCTCCGTCTGCCCCTTCAGGATGTGTACAAGATTGGCGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGCATGGTCGTTACCTTTGCTCCTTCCGGTGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGCCGAGGGTAACCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCCAGGCTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCTCGACTG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_stilbohypoxyli ??????????????????????????????????????????GGTCCACTGTTAGCCAAGCTGTTCCGTGGTATCATGCGCAGAATGAATACTGAGCTGGCCAACTACCTGAGACGATGTGTTGAGGGTAACCGCCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACACTTTCCAACGGACTCAAGTACTCACTCGCCACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTCTCCCAGGTGCTTAACCGTTACACTTTTGCTTCTACACTTTCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACACTGGGGCTTGGTGTGCCCGGCCGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGATCTCCCTCTGAGCCCTTGATCGAGTTTATGATCAACAGAGGTATGGAGGTCGTGGAGGAGTATGAGCCACTGAGGTATCCCCATGCCACAAAGATTTTTGTGAATGGTGTCTGGGTTGGAATCCACCA-AGACCCCAAG-CATCTGGTAAACCAAGTTTTGGATACTCGTCGTAAATCCTATCTGCAGTACGAGGTCTCTCTGATCAGAGAAATTCGGGACCAAGAATTCAAAATCTTCTCTGATGCCGGCCGCGTTATGCGTCCCGTATTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGATCTCGTCAATAGATTGGCCAAAGAGCAGGCCGAGCCTCCAGAAGACCCAAGCATGAAGCTCGGATGGGAGGGGTTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAAAAGGCCGGCATTGCCACGGACGAAGACATAGGAGATAACCCAAACCAGCGTCTTAAGACCAAGACGAATCCGACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTGGGTATCTGTGCTAGTATCATTCCTTTCCC-GACCACAACCAGGTATGT--CACCC--GGAAGCTATCCTTCCCCTTTACTGTATCCTACGTTGAGATCGCTAACTGATGCTGTACAGTCCCCCCGTAACCC????????????????????????????????????????????????????????????????????????????????????????CATTTCACTGATTTCGCTACGCA-TTCTTGGCACAA-TCGTGTCCGACAATTCTGTTCTC----AGTCTTG--TCAA-TTTTTCTCAC---GTCGTCA-CACCCCGCTCTACCTGTCT----ACCCCTCCTTTTGCACAGCA---AAAATTTT------CTGTCTGCC-TGGTTGGCTTTT-AGTGGGG--TGCCAACTTTTTTTTTTGGGCAACCACCCCCGCTACTTCTACT-GTCTCTCATCCATC---ATCCCGA--C-CAT-------TGATCTC----AATCGCATCGTCAT-----TTCTC--------------AATTTTGTAATTCATT-GTGCTGATCAT-GTTTCAATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGGTACTATGTCACCGTCATTGGTATGTTTTTGGTTTCTT------CCTCATTGACATCGC--GAA-AG-CATCATACTAACTTGCCAC--------------TACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGCGCTATCCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCTGAGGCTCGTTACACTGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCGCCACCGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGTTGGCCGCCTCCAACAACTGCCCCTGGTACAAGGGCTGGAACAAGACTGTCGGC---GGAAA---CAAGGTCACCGGCAAGACCCTTCTCGAGGCCATTGACGCCATTGACCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTTTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGTACGCTCCCT-GCCTCAGTACC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_straminea ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACTCTGTCACATTTACGTCGTACCAACACTCCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAATACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCTTTGATGTGTTACGTCAGTGTCGGCTCTCCTTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGTTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CACTTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAGTTCAAGATCTTTTCTGACGCAGGTCGTGTCATGCGACCTGTCTTCACTGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTTGTATTGACCAAGGAGCTCGTCAATAGACTGGCCAAGGAGCAGGCTGAACCTCCGGAAGATCCCAGCATGAAGATCGGATGGGAGGGATTAATCAGAGCCGGTGCGGTTGAATATCTTGACGCCGAGGAAGAGGAGACGTCTATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTTCCACTGATGAAGACATGGCAGATGATCCGAACAAGCGACTAAAGACAAAGACAAACCCGACAACTCACATGTACACCCATTGCGAGATTCATCCAAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGAGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTTCACCGGCAAGACTCTCCTTGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTCCCCGGTGACAACGTTGGATTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACTGCCCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGATACGCTCCC-GTCCTTGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_strictipilosa ??????????????ATTTGGAAAGAAGCGTCTGGATCTGGCGGGTC-TTTGTTGGCTAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACCGAATTGGCCAACTATTTGAGACGATGTGTTGAGGGTAACAGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAATATTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGCTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGAACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAAAACCTGTCGTTGATGTGTTATGTCAGTGTCGGTTCTCCCTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTGGTTGAGGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTATGGGTTGGAGTTCACCA-GGATCCTAAG-CATCTGGTGAACCAGGTCCTGGACACTCGTCGCAAGTCTTACCTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAAGATGACCCTGAAACGGGCATCAACAAGGGCCACTTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCAAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCTATGATTTGCATGACACCAGAGGATCTCGAGCTGTATCGACTTCAGAAAGCCGGTATTTCTACCGAGGAAGACGTGGGAGATGATCCGAACAAGCGACTAAAGACAAGGACAAATCCAACAACTCACATGTACACCCATTGCGAGATTCACCCAAGCATGATCTTGGGCATCTGCGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGTCGCCAACCC-TTGAGTTTTAATCTCAGAGAAATTACTAACAGCGTGTGCAGTCCCCCCGGTAACAACTTACCCAATCTGCCATGGG???????????????????????????????????????????????????????????????????????????????TGATTCGCG-CCCAAAATTTCCCT----T-CACATTCAGTTGTGCCCGACGATTCT-------------------TGTGTCGA-CA---ATTTTTTT--CGTCACCCCGCTTTCGC--TTCACATTACCCC--TCCTTTGCCGCGACGC--AGATT----------TTTTTTT----GCTGTCTCT--GG---T---TTT----AGTGGGGTG-TACCGGCAA----CCCCA---CTGCCGCTCACTG--TTCTGCCCTTCATTACCACTGC-------CCAGTG-TC--ATTC--AACGCTT--TTGTGCCT-GTC------AC------TTGCA--GCGAT----GCTAACCAT-GTTTCCCTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATCGCTCTGTGGAAGTTCGAGACTCCCAGGTACTATGTCACCGTCATTGGTATGTCTG-ATTCATCAC---A-----TTCATGCGGC--ATCGGCAAGCATGTGCTAACACAAACTCG-------------ACAGACGCTCCCGGCCATCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGTGCTATCCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTTCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGAGACAACATGCTCCAGGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTTCTGGAGGCTATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGATGTGTACAAGATCGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCCGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCTTGATTG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_subalpina ????????????????????????????????CTGGATCTGGCGGTCCCTGCTGGCCAAGCTGTTCCGCGGCATCATGCGAAGGATCAACACCGAGCTGGCCAACTACCTGAGGCGGTGCGTAGAGGGCAACCGACACTTCAACCTCGCCGTGGGTATCAAGCCCGGCACGCTCTCCAACGGGCTCAAGTACTCGCTTGCCACCGGAAACTGGGGCGACCAGAAGAAGGCCATGAGCTCGACCGCGGGCGTGTCTCAGGTGCTCAACCGTTACACCTTTGCCTCGACGTTGTCCCATCTGCGTCGTACCAACACGCCCATCGGAAGGGATGGCAAGCTGGCGAAGCCTCGACAGCTCCACAACACGCACTGGGGCTTGGTCTGTCCGGCCGAGACTCCCGAAGGGCAGGCCTGCGGTTTGGTCAAGAACTTGTCCCTGATGTGTTACGTCAGCGTCGGGTCTCCCTCCGAGCCCCTGATCGAGTTCATGATCAACCGGGGCATGGAGGTGGTCGAGGAGTACGAGCCGCTGCGGTATCCTCACGCCACGAAGATCTTTGTCAACGGTGTCTGGGTCGGCATCCACCA-GGATCCCAAG-CACCTGGTGAACCAGGTGCTGGACACGCGTCGCAAGTCTTATCTGCAGTACGAGGTCTCCCTGATCAGGGACATCCGCGACCAGGAATTCAAGATCTTCTCCGACGCAGGTCGCGTCATGCGGCCCGTCTTCACCGTCCAGCAGGAGAACGACCCGGAGACGGGCCTCGACAAGGGACAGTTGGTCCTCACCAAGGATCTCGTCAACAGGCTTGCCAAGGAGCAGGCAGAGCCGCCAGAAGACCCCAGCACGAAGATTGGGTGGGAGGGCCTTATCAGGGCCGGTGCGGTCGAGTATCTCGATGCCGAGGAAGAAGAGACGTCCATGATCTGCATGACGCCGGAGGACCTCGAGTTCTACCGTCTCCAGAAAGCTGGCATAGCCCAGGAGGAAGATACCGGAGAAGACCTGAACAAGCGACTCAAGACGAAGACGAACCCGACGACTCACATGTACACCCACTGCGAGATTCACCCAAGCATGATCTTGGGTATCTGTGCTAGTATCATTCCTTTCCCAGATCACAACCAGGTTCGTTCGTTCGTTTGATACCGGCTCGTCCCTTTTGGTTGGTTCTTGCTCAGTT?????????????????????????????????????????????????????????????????????????????????????????????????????CGTGCTCTTTTTTTTCCATCCAGATTATTTCCCCTTGCCACGCCATTGTTTGCGCCCGACTATTCTCAAGAATATCCGAGCCGATAAATTCCCCTCCCCTCC-CCTCGTGGTCACCCCGCTTTCACTGTCTGCCTACCCCTCCTTTGGGCGACGCAGCAGGAAAGGAAAAATTTTCTG----GACTGTCTTGTTTGGTTCTA-GTGGGGCACACTTGTGGCCACCCCTCCT--CCCATTTATTGATCCCTTATCTTGCCGCCCTTGAAATCACGTTTGCCCA-------------AAACCCAATTCATCCTATCACCATCAGGACACGTTGCCGCCATGT-------TTTTGTTGTCTCAATGCTGACCGAGTCTGTCTCATACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGGTACTATGTCACCGTCATTGGTATGTTTTTTGTCCATTCC---AAGGAGCGGAAGAAGCAAAACCAGGCCGATAGCTAATCC-CATACC-----------TCGCAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATCCTCATCATTGCCGCCGGTACTGGTGAATTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCCGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGTTGGCTGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGCATGGTCGTTACCTTCGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTGGAGATGCACCACGAGCAGCTTGCCGAGGGCAACCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTCTCCGTCAAGGATATCCGCCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCTCTGGGCGCCGCTTCCTTCAACGCCCAGGTCATCGTCATGAACCACCCCGGCCAGGTCGGTGCCGGATACGCCCCC-GTTCTCGAC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sulawesensis ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGCGATCAGAAAAAGGCCATGAGCTCGACTGCGGGCGTGTCGCAGGTGCTTAACCGCTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGAACTAACACACCCATCGGAAGAGATGGTAAGCTGGCCAAGCCTCGACAGCTTCACAACACGCATTGGGGCTTGGTCTGCCCGGCCGAGACGCCCGAAGGACAGGCTTGTGGTCTTGTCAAGAACCTGTCGCTGATGTGTTACGTCAGTGTCGGTTCTCCCTCTGAGCCCCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTGGTCGAGGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTCGTCAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CATCTGGTGAACCAGGTCTTGGACACCCGCCGCAAGTCGTATCTGCAGTACGAAGTCTCTCTCGTCAGGGAGATTCGAGACCAGGAGTTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTATTTACTGTTCAGCAGGAAGACGACCCCGAAACGGGCATCAACAAGGGTCACCTGGTATTGACCAAGGAGCTCGTCAACAGGCTGGCCAAGGAGCAGGCCGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGGCTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACGCCAGAGGACCTCGAGCTATATCGCCTGCAGAAAGCCGGCATCTCGACGGAGGAAGACATGGGAGACGACCCGAACAAGCGACTGAAGACGAGGACAAACCCCACGACTCACATGTACACGCATTGCGAGATCCACCCCAGCATGATCTTGGGTATCTGCGCTAGTATCATCCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAAGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGGTGTTTGTTTCGTCCCCATTTCTGGTTTCAACGGTGACAACATGCTTGAGCCTTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGGTCAAG---GGTGC---CAAGGTCACTGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCTCCCAAGCGTCCCACGGAGAAGCCCCTCCGTCTTCCCCTCCAGGACGTGTACAAGATCGGTGGTATCGGAACGGTCCCTGTCGGCCGTATTGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAATGTCACCACTGAAGTCAAGTCTGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTCTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTACGCCCCC-GTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTTCTGGAGAAGATCGACCGT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_sulphurea ???????????????????????????????????CCTGGCAGGTCCGCTGCTGGCCAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACTGAGCTGGCCAACTATCTCAGACGCTGTGTCGAGGGCAACAGGCATTTCAACCTTGCCGTTGGTATCAAGCCCGGCACGCTGTCCAATGGCTTGAAGTATTCTCTTGCCACCGGCAATTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTTAATCGCTATACCTTCGCTTCCACTTTGTCACATTTGCGTCGTACCAACACACCCATTGGACGAGACGGCAAGTTGGCAAAGCCTCGACAACTGCACAACACGCATTGGGGCTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGCTTGGTCAAAAACTTGTCTTTGATGTGTTATGTCAGTGTCGGATCTCCCTCCGAGCCTTTGATCGAATTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCACTGCGGTATCCTCATGCCACAAAGATCTTCGTCAACGGTGTTTGGGTTGGTGTTCACCA-AGATCCCAAG-CATCTCGTCAACCAAGTCCTTGATACTCGTCGTAAATCCTACCTTCAGTACGAAGTCTCTCTCATCAGAGACATTCGAGACCAAGAATTCAAAATCTTTTCTGACGCCGGCCGTGTTATGCGGCCTGTCTTTACCGTCCAGCAGGAGGATGACCCGGACACGGGCATCAACAAGGGCCACTTGGTCTTGACCAAGAGCCTCGTCAACCAGCTTGCGAAGGAGCAGGCTGAGCCCCCAGAAGATCCAAGCATGAAGCTTGGCTGGGAAGGCTTGATCAGGGCTGGTGCGGTTGAGTATCTCGATGCGGAAGAAGAGGAGACGTCTATGATTTGCATGACGCCGGAAGATCTCGAGCTCTATCGTCTTCAGAAAGCTGGCATTGTCACGGAAGAAGACATTAGCGAAGATCCCAACAAGCGTCTCAAGACAAAGACGAACCCGACGACTCACATGTACACGCATTGTGAAATTCACCCCAGCATGATCTTAGGTATCTGTGCTAGTATTATTCCTTTCCCGGATCACAACCAGGTACGTCGAGAT??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CTATTCTACTTATTTTTTTACCCTCTCATGTTTTGCCAGCACCCAAAGCAAATCTGCAGGACAATTCGCACG-AATTTTCT-TGTCAGTTT--TGCTTGGGTGCCGGTCGACCCC-GCTTTCTCTGCC--TACCCCTCCTTT-GGCGCACACAAGCAAATTTTTT-CTTTCTTTTTGCTGC-CTTGGT-TTT-TGTGGA---GACATTCAACA-------CAAACCCC-----GCCACTATCCCTCGAGTCC--AATCTATG-TGACCATT-GTAGCG--ACAC---AATGCG--ATTCACTTCTCGTCATTATGCCCCGCCACTCTGCG------TTTCTGGTCCAAGTATGCTAACCAT-GATTTGCTCTACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTTATTGGTACGTA---------TCTCGTGTGCGATTATCCCAATCTCATCGAC-----TCGACGCTGATTCAAA-----------TGTGCAGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGATTACTGGTACTTCCCAGGCCGACTGCGCTATCCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACACTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGTTGGCTCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTTCTTGAGGCTATCGACTCCATCGAGGCCCCCAAGCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATTGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACTTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTGGAGATGCACCACGAGCAGCTCGCTGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCTATGGCCGCTGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCCGGCCAGGTCGGTGCCGGCTATGCCCCC--TCCT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_surrotunda ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTCAACCGCTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACGCCCATTGGAAGAGATGGCAAGTTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCCGCCGAGACACCTGAAGGGCAAGCTTGTGGTCTGGTCAAAAATCTGTCCTTGATGTGTTACGTCAGTGTCGGATCCCCATCTGAACCTCTGATTGAGTTCATGATCAACCGAGGTATGGAGGTTGTAGAGGAGTATGAGCCACTACGATATCCTCATGCTACCAAGATTTTTGTGAACGGTGTATGGGTTGGAGTTCACCA-AGATCCCAAG-CACCTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCTTATTTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCGGGCCGTGTCATGCGACCTGTGTTTACCGTTCAGCAAGAAGATGACCCTGAAACGGGTATTAACAAGGGCCATTTGGTACTGACCAAGGAACTCGTCAATAGGCTGGCCAAGGAGCAGGCCGAGCCTCCAGAGGACCCGAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACACCAGAAGATCTCGAGCTTTATCGCCTTCAAAAGGCTGGTATCTCTACTGAAGAGGACATCGGAGACGATCCGAACAAGCGATTGAAAACAAAGACAAACCCAACAACTCACATGTACACTCATTGTGAGATTCATCCAAGCATGATTTTGGGCATCTGCGCCAGTATTATTCCATTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTCCTCGAGGCCATCGACTCTATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATCGGTGGTATTGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGCTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACACCAAGAACGACCCCCCCATGGGCGCCGCTTCTTTCACCGCCCAGGTCATTATCATGAACCACCCCGGTCACGTCGGTGCCGGCTATGCCCCC-GTCCTTGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_tawa ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGCGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAGGTTGTCGAAGAGTACGAGCCGCTGCGATATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTCGGAGTTCATCA-AGACCCTAAG-CACTTGGTGAACCAGGTTCTGGATACTCGTCGCAAGTCCTATCTCCAGTACGAAGTCTCTCTTGTGAGAGAAATTAGAGACCAGGAATTTAAAATTTTTTCCGACGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATCGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAAGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTAACACCGAGGAAGACATGGGAGACGATCCGAACAAGCGACTCAAGACCAAGACAAACCCCACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGCATCTGTGCTAGTATCATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACACCGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGAAAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGGGACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGCGGGTCAACCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTACGCCCCC-GTCCTTGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_thailandica ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAAGCCATGAGTTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCAACCCTGTCTCATTTGCGTCGAACCAATACACCCATTGGAAGAGATGGCAAGCTAGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGCTTGGTCTGCCCGGCCGAGACACCTGAAGGACAAGCTTGTGGCCTGGTCAAAAACCTTTCATTGATGTGCTACGTCAGTGTCGGTTCCCCCTCTGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGATATCCCCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-GGACCCCAAG-CATCTGGTAAACCAGGTTTTGGACACTCGCCGCAAGTCTTATCTGCAGTACGAAGTCTCTCTCGTCAGGGAAATTCGAGACCAGGAATTCAAAATCTTTTCTGACGCAGGTCGTGTCATGCGACCTGTTTTTACTGTTCAGCAGGAAGATGACCCTGAGACGGGTATCAACAAGGGCCACTTGGTCTTGACCAAGGAACTCGTCAACAGACTGGCCAAAGAACAGGCCGAACCTCCGGAAGACCCGAGCATGAAGATTGGGTGGGAAGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGATGCTGAGGAAGAGGAGACTTCCATGATTTGCATGACGCCAGAAGATCTCGAGCTGTACCGCCTTCAAAAAGCCGGTATTTCTACTGAGGAAGACATGGGAGATGACCCAAACAAGCGACTAAAGACGAAGACAAACCCAACCACTCACATGTACACTCATTGTGAAATTCACCCAAGCATGATTCTGGGCATCTGCGCTAGTATTATCCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCCTCTTTCACCGCCCAGGTCATTGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTACGCTCCC-GTTCTTGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATTGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_thelephoricola ?????????????????????????????????????????????????????????CAGTTGTTCCGTGGCATCATGCGAAGGATGAACACTGAGTTGGCTAACTATCTGAGACGCTGCGTTGAGGGCAACCGGCACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGCTTGAAGTACTCGCTTGCCACCGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTCAACCGCTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACGCCCATTGGAAGAGATGGCAAGTTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCCGCCGAGACACCTGAAGGGCAAGCTTGTGGTCTGGTCAAAAATCTGTCGTTGATGTGTTACGTCAGTGTCGGTTCCCCCTCTGAACCTCTGATTGAATTCATGATCAACCGAGGTATGGAAGTTGTAGAGGAGTATGAGCCACTGCGATATCCTCATGCTACCAAGATTTTTGTGAACGGTGTATGGGTTGGAGTTCACCA-AGATCCCAAG-CACCTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCTTATTTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCTGACGCGGGCCGTGTCATGCGACCTGTGTTTACCGTTCAGCAAGAAGATGACCCTGAAACGGGTATTAACAAGGGCCATTTGGTACTGACCAAGGAACTCGTCAACAGGCTGGCCAAGGAGCAGGCCGAACCTCCAGAGGACCCGAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAAGATCTCGAGCTTTATCGCCTTCAGAAGGCTGGTATCTCTACTGAAGAGGACATGGGAGACGATCCGAACAAGCGATTGAAAACAAAGACAAACCCAACAACTCACATGTACACTCATTGTGAGATTCATCCAAGCATGATTTTGGGCATCTGCGCTAGTATTATTCCATTCCCCGATCACAACCAGGTATGCAGTCAAAGTTTCCATTTA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CTGATTCCTACTCTGATTTT-----CATTCCATGCTCAGTTGTGACGGACAA-TTCTCA------ACGGAATTATCCTGTCGA--C--AATCTTT----CATCACCCCGCTTTCAC--TTCCCATTACCCC--TCCTTTGCAGCGACGC--AAAAAAA-T------TT---------GCAGCCTCGA-A----T---TTT----AGTGGGGTCGGCTGTGCAT---------C--CCCACCACCATCCA-CTGCTTTTT-GCCCTTGACTGCG------TGT-ACCT---GTCA---TCATTCCA-CGCTCTTCATC------TC------TTTCA--GCGAT----GCTAACCATGTTTCC-ACCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATCGGTATGTCTT-CTTCACGGA---------TCCC-GTTGCTCATTCGCCAGCCTGTACTAATGCCGATTCG-------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTGTTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGAACAGTCCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGCGACACCAAGAACGACCCCCCCATGGGCGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC--TCCT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_tremelloides ?????????????????????AAGAAGCGTCTGGATCTGGCGGGTCCCCTGCTGGCCAAGCTGTTCCGCGGCATCATGCGGAGGATGAACACGGAATTGGCCAACTACCTGAGACGGTGCGTAGAGGGCAACCGCCACTTCAACCTTGCCGTCGGCATCAAGCCCGGCACGCTCTCCAACGGGCTGAAGTACTCGCTCGCCACCGGCAACTGGGGCGATCAGAAGAAGGCCATGAGCTCGACCGCAGGCGTGTCCCAGGTGCTCAACCGGTACACCTTCGCCTCGACCCTGTCGCATCTGCGCCGCACCAACACGCCCATCGGAAGAGACGGCAAGCTGGCGAAGCCTCGGCAGCTTCACAACACGCATTGGGGCTTGGTCTGCCCAGCCGAGACGCCCGAGGGGCAAGCCTGCGGCCTGGTCAAAAACCTGTCCCTGATGTGCTACGTCAGCGTCGGCTCTCCCTCGGAGCCCCTGATCGAGTTCATGATCAACAGAGGCATGGAGGTGGTGGAGGAGTACGAGCCGCAGCGGTATCCCCACGCCACCAAGATCTTTGTCAACGGCGTCTGGGTTGGCGTTCACCA-AGACCCCAAG-CACCTGGTGAACCAGGTCCTCGACACTCGCCGCAAGTCCTATCTGCAGTACGAAGTCTCGCTCATCAGAGACATCCGAGACCAGGAATTCAAAATCTTCTCCGACGCCGGCCGCGTCATGCGGCCCGTCTTCACCGTCCAGCAGGAAGACGACCCGGAAACGGGCATCGACAAGGGCCACCTGGTGCTGACCAAGGAGCTCGTCAACAGGCTGGCGAAGGAGCAGGCCGAACCCCCGGAAGACCCGAGCACGAAGATCGGCTGGGAGGGCTTGATCAGGGCCGGCGCGGTGGAGTATCTCGACGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACGCCCGAGGACCTGGAGCTGTACCGCCTTCAGAAGGCGGGCATCGCCACCGAGGAGGACGTGGCAGACGACCCGAACAAGCGACTCAAGACGAAGACGAACCCGACCACTCACATGTACACCCACTGCGAGATTCATCCGAGCATGATCTTGGGCATCTGCGCCAGCATCATTCCTTTTCCCGACCACAACCAGGTAAGTGCTC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CAGTTTTTCTTGTTTGATATTGTCCCTCACATCGC----------TGTACCCGA--AAAATTCTTGCACCAATTTTCGAGTTGCAAT--TTTCTCTCTTC-----ACCCC--GCTTTCACTG-C-CTACCCCTC-CTTTGCCACG-CCAG--AAATTTTTG------CTCAAGTATCTCTTTGCCTGA-AGCGTGTGGGCTGTACTTTGAA-----CAACCTC--CACTGCTGC---CTTTTGGCT------------GCCTTCTCTCATTCCC--CATCAAGTCCCTA--TGTCGCATCATCCAGC---TGCATCTTTT---GTG------CTGAAAACCGGGCGATGCTAATAAT-TTTTC--TCAACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGATATTGCCCTGTGGAAGTTCGAGACTCCCAAGTTCTATGTTACCGTCATTGGTATGTT------TTCTTCATCGCCTTTT---GTTGCTTCTATCCACA----CCAATGCTGA--TGCAA--------ACGCCACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCATCCTCATCATCGCTGCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTTGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACAGCCAATTGGGCCGAGGCTCGTTACCTGGAAATCATCAAGGAAACCTCCAACTTCATTAAGAAGGTCGGCTTCAACCCCAAAGCCGTAGCCTTCGTTCCCATTTCCGGCTTCAACGGTGACAACATGCTCAACGTCTCCACCAATTGTCCCTGGTACAGGGGCTGGGAGAAGGAGACCAAG---ACTGG---CAAATTCAGTGGCAAGACCCTCCTTGAGGCCATCGACGCCATTGAACCCCCCAAGCGCCCCACTGACAAGCCTCTCCGTCTTCCCCTACAAGATGTGTACAAGATTGGTGGCATCGGAACAGTCCCCGTCGGTCGTATCGAGACTGGTACCATCAAGCCCGGCATGGTCGTCACCTTTGCTCCCTCTAACGTCACTACGGAAGTCAAGTCTGTCGAGATGCACCACGAGCAGCTCACTGAGGGTTGTCCCGGCGACAACGTTGGCTTCAATGTGAAGAACGTTTCCGTGAAGGAAATTCGCCGTGGCAACGTTGCCGGCGACTCCAAGAACGACCCCCCCATGGCCGCTGCCTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCGGGCCAGGTTGGTGCCGGCTACGCCCCC-GTCCTCGA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_victoriensis ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTTGGTATCAAGCCCGGCACGCTGTCCAATGGCTTGAAGTATTCTCTTGCCACCGGCAATTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTTAACCGCTATACCTTCGCTTCCACTTTGTCACATTTGCGCCGTACCAACACACCCATTGGACGAGACGGCAAGTTGGCAAAGCCTCGACAACTGCACAACACGCATTGGGGCTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGCTTGGTCAAAAACTTGTCTTTGATGTGTTATGTCAGTGTCGGATCTCCCTCCGAGCCTTTGATCGAATTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCACTGCGGTATCCTCATGCCACAAAGATCTTCGTCAACGGTGTTTGGGTTGGCGTTCACCA-AGATCCCAAG-CATCTCGTCAACCAAGTCTTGGATACTCGTCGTAAATCCTACCTTCAGTACGAAGTCTCTCTCATCAGAGACATTCGAGACCAAGAATTCAAAATCTTCTCTGACGCCGGCCGTGTTATGCGGCCTGTCTTTACCGTCCAGCAGGAGGATGACCCGGACACGGGCATTAACAAGGGCCACTTGGTCTTGACCAAGAGCCTCGTCAACCAGCTTGCGAAGGAGCAGGCTGAGCCCCCAGAAGATCCAAGCATGAAGCTTGGCTGGGAAGGCTTGATTAGGGCTGGTGCGGTTGAGTATCTCGATGCGGAAGAAGAGGAGACGTCTATGATTTGCATGACGCCGGAAGATCTCGAGCTCTATCGTCTTCAGAAAGCTGGCATTGTCACGGAAGAAGACATGGGCGACGATCCCAACAAGCGTCTCAAGACAAAGACGAACCCGACGACTCACATGTACACGCATTGTGAAATTCACCCCAGCATGATCTTAGGTATCTGTGCTAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CGAGAAGGTTAGTCTATTCTACTTTTTTTCCT--CTTTCCGTCTTTTGC-AGCACCCAAAGCAATTCTGCAGGACAATTCGCACG-AATTTTCCATGTCAGTTT--TGCTTGGGTGTCGGACGACCCC-GCTTTCTCTGCC--TACCCCTCCTTT-GGCGCACACAAGCAAATTTTTT-CTTTCTTTTTGCTGC-CTTGGA-TTT-TGTGGA---GACACTCATCA-------CAAACCCC-----GCCACCA-CCCTCGAGTCC--AATCTATG-TGACCAAT-GCAGCA--ACACTACAATGCA--GTTCACTTCTCGTCATTATGCTCCGCCACTGTGCG------TTTCTGGTTCAAGTATGCTAACCAT-GATTTGCTCTACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTTATTGGTATGTA---------TCCCATGTGCGATTCT---CATCTCAACGAC-----TCCACGCTAATTCAAA-----------TGTGCAGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGATTACTGGTACTTCCCAGGCCGACTGCGCTATCCTCATTATCGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGTTGGCTGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTTCTCGAGGCTATCGACTCCATCGAGGCCCCCAAGCGTCCTACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATTGGAACGGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCCGCTGCTTCTTTCACCGCTCAGGTCATTGTCATGAACCACCCCGGCCAGGTCGGTGCCGGCTATGCCCCC-GTCCTCGATTGCCACACTGCCCACATT???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_virens ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCTGGTGTGTCTCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACTAACACCCCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTGTGTCCAGCCGAGACACCCGAAGGGCAGGCTTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTTCTCCCTCCGAACCACTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGATATCCTCATGCTACCAAGATTTTCGTGAATGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CATCTGGTGAACCAGGTTCTAGACACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAGATTCGAGACCAGGAATTCAAAATCTTTTCCGATGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAGGATGACCCTGAAACAGGCATCAACAAGGGCCACCTGGTATTAACTAAGGAGCTCGTCAACAGATTGGCTAAGGAGCAAGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGACTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAAGAAGAGGAGACGTCGATGATTTGCATGACACCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATCTCTACCGATGAAGACATGGGAGATGATCCGAACAAGCGACTAAAGACAAAGACCAACCCAACAACCCACATGTACACACATTGCGAGATTCACCCAAGCATGATCTTGGGCATCTGTGCTAGTATCATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TACTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATTAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTCCAGCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTCCTTGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_virescentiflava ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAAGCCATGAGTTCAACTGCCGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCAACCCTGTCTCATTTGCGTCGAACCAATACACCCATTGGAAGAGATGGCAAGCTAGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGCTTGGTCTGTCCAGCCGAGACACCTGAAGGACAAGCTTGTGGCCTGGTCAAAAACCTGTCATTGATGTGCTACGTCAGTGTCGGTTCCCCCTCTGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGATATCCTCATGCTACCAAGATTTTCGTGAACGGTGTCTGGGTTGGAGTTCACCA-GGACCCCAAG-CATCTGGTAAACCAGGTTTTGGACACTCGCCGCAAGTCTTATCTGCAGTACGAAGTCTCTCTCGTCAGGGAAATTCGAGACCAGGAATTCAAAATCTTTTCTGACGCAGGCCGTGTCATGCGACCTGTTTTCACTGTTCAGCAGGAAGATGACCCTGAGACGGGTATCAACAAGGGCCACTTGGTCTTGACCAAGGAACTCGTCAACAGACTGGCCAAAGAGCAGGCCGAACCTCCGGAAGACCCGAGCATGAAGATTGGGTGGGAAGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGATGCTGAGGAAGAGGAGACTTCCATGATTTGCATGACGCCAGAAGATCTCGAGCTGTACCGCCTTCAAAAAGCCGGTATTTCTACTGAGGAAGACATGGGAGATGATCCAAACAAGCGACTAAAGACGAAGACAAATCCAACCACTCACATGTACACTCATTGCGAAATTCACCCAAGCATGATTCTGGGCATCTGCGCTAGTATTATCCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTTCCCATCTCCGGCTTCAACGGTGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTTCACCGGCAAGACCCTTCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATCGGTGGTATTGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCCTCTTTCACCGCCCAGGTCATTGTCATGAACCACCCTGGCCAGGTCGGTGCCGGCTACGCCCCC-GTTCTTGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATTGACCGT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_viridescens ??????????????????????????????????????????????????-TTGGCCA-GCTGTTCCGTGGTATCATGCGGAGAATGAATACTGAGCTGGCCAACTACCTGAGACGATGTGTTGAGGGTAACCGCCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACACTTTCCAACGGACTCAAGTACTCACTCGCCACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTCTCACAGGTCCTTAACCGTTACACTTTTGCTTCTACACTTTCCCATTTGCGTCGTACCAATACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGTCAGCTCCACAACACACATTGGGGTTTGGTGTGCCCGGCCGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGCATGGAAGTCGTTGAGGAGTACGAGCCACTGAGGTATCCCCATGCCACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCATCA-AGACCCCAAG-CATCTGGTGAACCAAGTTTTGGATACTCGTCGTAAATCCTATCTGCAGTACGAGGTCTCTCTGATCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCTGATGCCGGTCGTGTTATGCGTCCCGTCTTCACCGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGACCTCGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTCGGATGGGAGGGGCTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAAAAGGCCGGCATTTCCACGGAAGAAGATATAGGAGATGATCCAAATAAGCGTCTCAAGACCAAGACAAATCCGACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTGGGTATCTGTGCCAGTATCATTCCTTTCCCCGATCACAACCAGGTACGT--CAACCCGAGAAGCTATTCTCT??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATTTCACTGCTTTTTCACTACGCT-CCCTTGGCACAA-TCGTGTCCGACAATTCTGCTCTC----AGTCTTG--ACAA-TTTTCCTCGC---GTCGTCA-CACCCCGCTCTACCTGTCT----ACCCCTCCTTTGGCACAGCA---GAAATTTT------CTGGCTGCCTTGTTTGGGTTTT-AGTGGGG--TGCCATTTTTTTTT----TGGCAACAACCCCGCTATCACCGTT-GTCCCTCAGCCATC---GTCCCAA--CAATT-------GGATCTCACTCAATCACGTCGTCTGCTGCCTCATT--------------TTCTCCGTGGTTCATT-GTGCTGATCAT-GATTCAATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTTGGTTTC----------CTCATTGACGCCCCC-GGA-AT-CATTATTCTAACATGCCGCTC------------CACAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATCCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCTTGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCCGTTGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGTTGGCTGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTCCTCGAGGCCATTGACGCCATTGAGGCCCCCAAGCGCCCCACGGACAAGCCCCTCCGTCTGCCCCTTCAGGATGTTTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCGCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGTTGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGCCGTGGAAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGTCCCG-TCCTC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hypocrea_voglmayrii ?????????????????????????????????????????????????????????????????????????????????AGAATGAATACGGAGCTGGCCAACTACCTGAGACGATGTGTCGAGGGTAACCGACATTTCAATCTTGCTGTTGGTATCAAACCCGGCACGCTTTCTAACGGGTTGAAATATTCGCTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCAACCGCAGGCGTATCACAGGTGCTTAACCGATACACATTTGCTTCGACACTCTCCCATTTGCGTCGTACTAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCACTGGGGTTTGGTATGCCCGGCTGAGACGCCCGAAGGTCAGGCTTGTGGCCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCATCTGAGCCTCTGATCGAATTCATGATCAACAGAGGCATGGAGGTCGTCGAAGAGTACGAACCACTGAGGTATCCTCATGCGACAAAGATCTTTGTAAACGGTGTTTGGGTCGGAATCCACCA-AGACCCCAAG-CATCTGGTGAACCAAGTTCTGGACACCCGTCGCAAGTCCTATCTACAATACGAAGTCTCTCTGATCAGAGACATTCGTGACCAAGAATTCAAGATCTTCTCTGACGCCGGTCGTGTGATGCGTCCTGTATTCACTGTGCAGCAAGAAGATGACCCCGAAACGGGCATAAACAAAGGCCACTTAGTATTGACCAAAGATCTCGTCAATAGACTGGCAAAGGAGCAGGCTGAGCCTCCGGAAGACCCAAGTATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTGGAATATCTCGATGCAGAGGAAGAAGAAACGTCCATGATTTGCATGACACCAGAGGATCTTGAGCTTTATCGTCTTCAGAAAGCAGGCATCGCCACAGACGAAGACATGGGAGATGATCCCAACAAGCGTCTCAAGACCAAGACGAATCCAACCACCCACATGTACACGCATTGCGAAATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAAGTATGT--CGGCTTGACAATTAATCTCCTTTTCTGCGCCC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATTTTCACGCTGTTTTACAGATTCCTTCACGCAGTTATGCC------------CAATTCTGC--CTACTTTC-----CTGTCAAGAAATTTTTTC--CTCACAATGTC-----ACCCC--GCTTTATCTG-T-CTACCCCTCTCTTTGGCAGA-GCAA--AAATTTTC-------TGGCTGCCTTGTTTGGCCTTT-AGCGGGGTCGCTTTTTCCTTGTGGCTGCAACCCCGCTATCGCCAC---CGACTGGGCAGCTCGATT--GTCTGTGTTTCGTTGCA--TAACACAATCATT--TCTTTGCTCACGTCGC---GTCGCTTGCCTCAATC------ACTTGGGTTTGTCCATGCTAACCAT-GATTCCATCAATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTTGATCTTTTTTTTTTTTTCCTCCAACCGGCCTCAAATAAAGC-TTTGATTCTAACCTGTCA--------ATCTTACAGACGCTCCTGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGTCTGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCGACCCCAAGGCTGTTCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTTGAGGCCTCCAAGAACTGCCCCTGGTACAAGGGCTGGGTCAAGGAGACTAAGACCGCTGG---CAAGTCCACCGGTAAGACTCTCCTCGAGGCTATCGACGCCATCGAGGCTCCCAAGCGTCCCAACGACAAGCCCCTCCGTCTTCCCCTTCAGGATGTCTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTTACCACCGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGCCGAGGGCCAGCCTGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCTGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCCAGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCCTGTCCT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Protocrea_farinosa ???????????????????????????????????????????????????????????GCTGTTCCGTGGTATCATGCGAAGAGTGAACACTGAACTTGCCAACTATTTGAGGAGATGTGTCGAGGGCAATCGTCATTTCAACCTGGCTGTGGGTATCAAGCCCGGAACTCTGTCCAATGGTTTGAAATATTCGTTGGCGACGGGTAACTGGGGTGATCAGAAAAAGGCCATGAGCTCCACAGCTGGTGTGTCTCAAGTGCTTAATCGATATACATTTGCGTCCACATTATCACATCTTCGACGAACAAACACTCCTATTGGAAGAGACGGTAAAATAGCTAAGCCACGACAGCTGCATAATACACATTGGGGCTTGGTCTGTCCTGCCGAAACCCCAGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGTTATGTCAGTGTGGGCTCTCCTTCTGAACCTTTGATTGAATTCATGATCAACAGAGGTATGGAAGTGGTCGAGGAGTATGAGCCTTTGAGATATCCACATGCAACAAAGATTTTCGTCAACGGAGTTTGGGTTGGTGTGCACCA-AGATCCCAAG-CACCTGGTCAGCCAAGTCCTTGATACTCGTCGTAAATCTTATTTACAGTATGAAGTGTCCTTGATCCGAGACATCAGGGATCAAGAGTTCAAGATCTTCTCTGATGCAGGACGGGTTATGCGCCCCGTGTTTACTGTGCAGCAGGAAGATGACCCTGAGACGGGTATCAACAAGGGCCACCTGGTCCTAACAAAGGAGTTGGTGAATAGGCTTGCCAAGGAGCAGGCTGAGCCTCCTGAGGACCCTAGTATGAAGCTTGGTTGGGAAGGACTCATTAGGGCAGGAGCTGTGGAATATCTAGATGCTGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCTGAAGATCTGGAGCTCTACCGTCTTCAGAAGGCTGGTGTGGAGATGGATGATGACATGGGCGATGACTTGAACAAGCGATTGAAAACAAAGACAAACCCAACTACTCACATGTATACGCATTGTGAGATTCACCCTAGCATGATTCTTGGTATCTGCGCCAGCATTATTCCCTTCCCTGATCACAACCAGGTATGTT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AATCGAGAAGGTAAGCACTCAATTTTTTCAATCAATCAATCAATCAGCGA------AATGGAAATTTTGGGCA---------TTTTTTTGGGACACGCAGCCGGCCTGCATTTTTTTTGTGTACCCCTCT----TGCCAC--GAAAATTTT------TCCCT------TGGAAATTTT-TGGTGG---GGTACT-CTAAAAAGTGACCCCGCTAGTCTGCTCGTGTCTCAAAAAA----------------ACGAGGCACCAAA--ACAGTTCTGTCTC--AAAACCATCTACGCTATTGAATTCATAA-------------CCACTTGTATCATCAATGCTGAC-----TGCCATCTATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTAAGTTTGATCACCAGTTTCTAAACAAATGAAACA--TTTCGCATCAT-TTTGTCTAACAATTTTTTT-------------TCAGACGCTCCCGGTCACCGTGACTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTCCTCGCCTACACCCTCGGTGTTAAGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAACTGGTCTGAGGCCCGTTTCCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGGTACAACCCCAAGAATGTTGCCTTCGTCCCCATCTCTGGCTTCAACGGCGACAACATGCTTGAGGTCTCCCCCAACGCTCCTTGGTACAAGGGCTGGGAGAGAGAGACCAAG---CTTGG---CAAGTACAGCGGCAAGACCCTCCTCGAGGCCATTGACTCCATTGAGCCCCCTAGCCGTCCTACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGAACAGTTCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCGCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGCCCAGCTCGAGTGCGGTAACCCTGGTGACAACGTCGGCTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGAAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCCCAGGTCATTGTCATGAACCACCCTGGCCAGGTCGGTGCTGGATACGCCCCA-GTTCTTGACTGCCACACTGCCCACATGCCTGCAGTTGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Protocrea_pallida ???????????????????????????????????????????????CTCTGTTGGCGAGCTGTTCCGTGGTATCATGCGAAGAGTGAACACTGAACTTGCCAACTATTTGAGGAGATGTGTCGAGGGCAATCGTCATTTCAACCTGGCTGTGGGTATCAAGCCCGGAACTCTGTCCAATGGTTTGAAATATTCGTTGGCGACGGGTAACTGGGGTGATCAGAAAAAGGCCATGAGCTCCACAGCTGGTGTGTCTCAAGTGCTTAATCGATATACATTTGCGTCCACATTATCACATCTTCGACGAACAAACACTCCGATTGGAAGAGACGGTAAAATAGCTAAACCACGACAGCTGCATAATACACATTGGGGCCTGGTCTGTCCTGCCGAAACCCCAGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGTTATGTTAGTGTTGGCTCTCCTTCTGAACCTTTGATTGAATTCATGATCAACAGAGGTATGGAAGTGGTCGAGGAGTATGAGCCTTTGAGATATCCACATGCAACAAAGATTTTCGTCAACGGAGTTTGGGTTGGTGTGCACCA-AGATCCCAAG-CACCTGGTCAGCCAAGTCCTTGATACTCGTCGTAAATCTTATCTACAGTATGAAGTGTCTTTGATCCGAGACATCAGAGATCAAGAGTTCAAGATCTTTTCAGATGCAGGACGGGTTATGCGCCCCGTATTCACTGTGCAGCAGGAAGATGACCCTGAGACGGGTATTAACAAGGGCCACCTAGTCCTAACAAAGGAGTTGGTGAATAAGCTTGCCAAGGAGCAGGCTGAGCCTCCTGAGGACCCTAGCATGAAGCTTGGTTGGGAAGGACTCATTAGGGCAGGAGCTGTGGAATATCTAGATGCTGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCTGAAGATCTGGAGCTCTATCGTCTTCAGAAGGCTGGTGTGGAGATGGATGATGACATGGGCGATGACTTGAACAAGCGATTGAAAACAAAGACGAACCCAACTACTCACATGTACACGCATTGTGAGATCCACCCTAGCATGATTCTTGGTATCTGCGCCAGCATCATTCCCTTTCCTGATCACAACCAGGTATGTTTGAAATCTGATAACTACGTTATATCTGTTTACTAATACAT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AATCGAGAAGGTAAGCACTCATTTTTTTCAATC--------AATCAGCGA------AATGGAGATTTTGGGCAAT------TTTTTTTTGGGACACGCAGCCGGCCTACATTTTTTT-GGGTACCCCTCT----CGCCAC--GAAAAATTT------TCCCT------GGGAAATTTT-TGGTGG---GGTACT-TTCAGAAGTGACCCCGCTAGTCTGCTCGTGTCTCACAAAA----------------ACGAGCCACCAAA--ACAATTCTGTCTC--AAAACCACCTACGCTATTGAAATCATAA-------------CCACTTGTGTCATCAATGCTGAC-----TGCCATCTATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTAAGTTTTATCACTAGTTTCTAAACAAATGCAATA--TTTGGCATCATGTTTGTCTAACAATACTTT---------------CAGACGCTCCCGGTCACCGTGACTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTCCTCGCCTACACCCTCGGTGTTAAGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAACTGGTCTGAGTCCCGTTTCCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGAGTGTTGCCTTCGTCCCCATCTCTGGCTTCAACGGCGACAACATGCTTGAGCCCTCCCCCAACGCTCCTTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTCCTCGAGGCCATTGACTCCATTGAGCCCCCTAGCCGTCCTACCGACAAGCCCCTCCGTCTTCCCCTTCAGGATGTCTACAAGATCGGTGGTATTGGAACAGTTCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCGCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACACCCAGCTCGAGTGCGGTAACCCTGGTGATAACGTCGGCTTCAACGTGAAGAACGTTTCCGTCAAG-AAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCCTTCACCGCCCAGGTCATTGTCATGAACCACCCTGGCCAGGTCGGTGCTGGATACGCCCCA-GTTCTGGACTGCCACACTGCCCAC-TG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_aggressivum ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGCGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGGCAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTATGTCAGTGTCGGTTCTCCTTCCGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCACTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTCGGAGTTCACCA-AGACCCTAAA-CATTTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTCCAGTACGAAGTCTCTCTCGTGAGAGAGATCAGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGATGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAAAAGGCCGGTATCAACACCGAGGAAGACATGGGAGATGATCCGAACAAGCGACTCAAGACAAAGACAAACCCCACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGCATCTGTGCTAGTATCATTCCTTTC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_arundinaceum ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TATTCTCTTGCCACTGGAAACTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTCAATCGCTACACTTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCATAATACGCATTGGGGTCTGGTCTGCCCAGCCGAGACACCTGAAGGCCAAGCTTGTGGTTTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGATCTCCTTCCGAACCCCTGATCGAGTTCATGATCAACAGAGGTATGGAGGTCGTCGAAGAGTATGAGCCGTTGCGGTATCCCCACGCTACGAAGATCTTTGTCAACGGTGTATGGGTGGGAGTTCATCA-AGATCCCAAG-CACCTGGTGAACCAGGTTCTGGACACTCGTCGCAAATCCTATCTGCAGTATGAAGTCTCCCTGATCAGGGACATTCGTGACCAGGAATTCAAAATCTTCTCCGACGCAGGTCGTGTTATGCGTCCCGTCTTTACTGTTCAGCAAGAAGACGACCCAGAAACTGGCATTAATAAGGGCCATTTGGTTTTGACAAAGGAGCTGGTCAACAGGCTGGCAAAGGAGCAGGCCGAGCCTCCGGAGGACCCGAGCATGAAGATTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACGGCAATGATTTGCATGACCCCCGAGGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGTATATCCACAGAAGAAGACATGGCAGATGATCCAAACAAGCGACTCAAGACGAAGACGAATCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_asperellum ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TATTCTCTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCGACACTTTCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACACTGGGGTTTGGTATGCCCGGCCGAGACCCCTGAGGGACAGGCTTGTGGTTTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCTTCCGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAGGTCGTTGAGGAGTACGAACCGCTGAGGTATCCCCATGCGACAAAGATTTTTGTGAATGGTGTCTGGGTTGGAATCCACCA-AGACCCCAAG-CATCTGGTAAACCAAGTTTTGGACACTCGTCGTAAATCCTATCTGCAATACGAAGTCTCTCTGATCAGAGATATTCGTGACCAAGAATTCAAAATCTTCTCTGACGCCGGTCGTGTTATGCGTCCTGTCTTTACTGTACAGCAAGAGGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTTTTAACCAAGGATCTTGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCTCCGGAAGACCCAAGCATGAAGCTTGGATGGGAAGGGTTAATTCGGGCTGGTGCGGTGGAATATCTCGATGCTGAGGAAGAAGAAACGGCTATGATTTGCATGACACCGGAGGATCTTGAGCTTTACCGTCTTCAGAAGGCTGGCATTGCCACAGATGAAGACATGGGAGACGATCCAAACAAGCGTCTCAAGACCAAGACAAATCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_austrokoningii ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CTTCAACCTTGCTGTCGGCATCAAGCCCGGCACGCTTTCCAACGGATTGAAGTACTCGCTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCAACCGCGGGTGTATCCCAGGTGCTTAACCGTTACACTTTTGCTTCCACACTATCCCATTTGCGTCGAACCAACACACCCATCGGAAGAGATGGTAAGCTGGCCAAGCCTCGACAGCTTCACAACACACACTGGGGTTTGGTGTGCCCTGCCGAGACTCCCGAAGGACAGGCCTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCCTCTGAGCCTCTGATTGAGTTCATGATCAATAGAGGCATGGAAGTTGTTGAAGAGTATGAGCCACTGAGGTATCCCCACGCCACAAAAATCTTTGTGAATGGTGTCTGGGTTGGAATCCATCA-AGATCCCAAG-CATCTGGTGAACCAGGTTCTGGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGATATTCGTGACCAGGAATTCAAAATCTTCTCCGACGCCGGTCGTGTCATGCGTCCCGTCTTTACTGTGCAGCAAGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTTGTGTTGACCAAGGATCTCGTCAACAGACTTGCCAAGGAACAGGCTGAGCCCCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAAAAGGCGGGTATCTCCACGGAGGAAGACATGGGAGACGATCCAAACAAGCGTCTCAAGACCAAGACAAATCCGACAACTCACATGTATACGCA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_brevicompactum ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TATTCACTTGCCACTGGAAACTGGGGTGACCAGAAGAAGGCCATGAGCTCAACCGCAGGTGTGTCTCAGGTGCTTAATCGCTACACTTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAATTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTCTGGTCTGCCCAGCTGAAACTCCTGAAGGACAAGCTTGTGGCTTGGTCAAAAACCTGTCCTTGATGTGCTACGTCAGTGTCGGATCTCCTTCCGAACCCCTGATCGAGTTCATGATCAACAGAGGCATGGAGGTTGTCGAAGAGTACGAGCCGCTGCGGTATCCCCATGCTACAAAGATCTTTGTAAACGGTGTCTGGGTGGGAGTTCACCA-AGATCCCAAG-CACCTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTGATTAGGGACATTCGTGATCAGGAGTTCAAAATCTTCTCCGATGCAGGTCGTGTTATGCGTCCCGTCTTCACTGTTCAGCAAGAAGACGACCCGGAAACTGGCATTAATAAGGGCCATTTGGTTTTGACAAAGGAGCTGGTCAACAGGCTGGCAAAGGAGCAGGCTGAGCCTCCGGAGGACCCGAGCATGAAGATTGGATGGGAGGGGTTAATTAGGGCTGGCGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACGGCCATGATTTGCATGACCCCTGAGGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGCATTAACACAGAAGAAGACATGGCAGATGATCCAAACAAGCGACTCAAGACGAAGACGAATCC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GCAGCTCATTGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGCTTACTGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACTCTCCTTGAGGCTATCGACTCCATTGAGCCCCCCAAGCGTCCCAACGACAAGCCCCTCCGTCTTCC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_cerinum ????????????????????????????????????????????????????????????????????????ATCATGCGAAGGATGAACACCGAATTGGCCAACTATCTGAGACGGTGCGTTGAGGGCAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACAGGAAACTGGGGTGACCAGAAGAAGGCCATGAGCTCAACCGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACCAATACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGTCAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACGCCCGAAGGACAGGCTTGTGGTCTAGTCAAAAACTTGTCTTTGATGTGTTATGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACTAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CACTTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGTCGTGTCATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACAGGCATCAACAAGGGCCACCTGGTATTAACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAACCTCCTGAAGACCCAAGCATGAAGATGGGATGGGAGGGATTAATTAGGGCTGGTGCGGTTGAATATCTCGACGCTGAGGAAGAGGAGACATCTATGATTTGCATGACGCCAGAAGATCTCGAGCTGTATCGTCTTCAAAAGCCTGGTATTTCCACTGAGGAAGACATGGGAGATGATCCGAACAAGCGTCTAAAGACAAAGACAAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTAGGGCATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGTCGTCACCTCCGTCTATTACA????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ACTGATTTTCGCCTCGATCCCC-C-----TTCACATTCAATTGTGCTCGACAA-TTCTGA------ATAGAATTTTCGTGTCGA-----CAATTTTT---CACCACCCCGCTTTC--------TATTACCCC--TCCTTTGCAGCGACGC--AAAT------------TTTTTT----GCTGTC-TTT-GAG--T---TTT----AGTGGGGTTCTTTGTGTA-----CCCCAC--TAGCTCACTGC--TTTTTTCTGTTTCGCTCTCACTAC-------CCAGTCGTC--ACTCAACGCGCTTTG-TGTCTTGTCA--------C------TTTCA--GCGAT----GCTAACCAC-TTTTCCGTCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTACGTCTG-ATTCACCAA---C-----TTCATGCATC--AATTGCAAGTCAGTGCTAACAGAAATTCC-------------ACAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGAGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTTCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTTAGGTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGATA-CGCC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_erinaceus ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TACTCACTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACTGCGGGTGTCTCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTATCCCATTTGCGTCGTACCAATACACCCATCGGAAGAGACGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGTTTGGTGTGTCCGGCCGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTCATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCCCATGCCACAAAGATTTTTGTGAATGGTGTCTGGGTTGGAATCCACCA-AGATCCCAAG-CATCTGGTAAACCAAGTTCTGGATACTCGTCGCAAATCTTATCTGCAATACGAAGTCTCTTTGATCAGAGACATTCGTGACCAAGAATTCAAAATCTTCTCTGACGCCGGTCGTGTTATGCGTCCCGTCTTTACTGTGCAGCAAGAAGATGACCCAGAAACGGGCATCAACAAGGGCCACCTGGTGTTGACCAAGGATCTCGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCTCCAGAAGACCCGAGCATGAAGCTTGGATGGGAGGGACTAATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTAGAGCTTTATCGTCTCCAGAAGGCCGGCATTGCCACGGATGAGGACATGGGAGACGATCCAAACAAGCGTCTCAAGACCAAGACAAATCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_fertile ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTCGCTTCGACCTTGTCACATTTGCGCCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAGGGACAAGCTTGTGGCCTGGTCAAAAACCTGTCGCTGATGTGCTACGTCAGTGTCGGGTCTCCCTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTATGAGCCGCTGCGATATCCTCATGCCACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CATCTGGTGAACCAGGTTTTGGACACTCGTCGCAAATCCTATCTACAGTACGAAGTCTCTCTCATCAGAGACATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTTATGCGACCCGTCTATACCGTTCAGCAGGAAGATGACCCGGAAACAGGCATTAACAAGGGCCACTTGGTATTGACCAAGGAACTCGTCAACAGACTGGCGAAAGAGCAGGCCGAGCCTCCAGAAGACCCGAGCATGAAGATTGGATGGGAGGGGTTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAAGAAGAGGAGACGTCTATGATTTGCATGACGCCGGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCAGGTATTGCTACTGAGGAAGACATTGGAGACAACCCGAACCAGCGACTCAAGACAAAGACAAATCCAACAACTCACATGTACACACATTGTGAGATTCACCCGAGCATGATCTTAGGCATCTGTGCTAGTATCATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTTGCTGCCTCCGCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTACTCCGGCAAGACTCTTCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGACGTGTACAAGATCGGCGGTATTGGAACAGTTCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGCCAGCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTTTCCGTCAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCCGCCGCTTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_hamatum ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGACCAGAAGAAGGCAATGAGCTCGACTGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCCTCGACACTTTCTCATTTGCGTCGTACCAACACACCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACATTGGGGTTTGGTGTGCCCAGCCGAGACCCCCGAAGGACAAGCTTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAATAGGGGTATGGAGGTTGTTGAGGAGTACGAACCACTGAGGTATCCCCATGCTACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCACCA-AGACCCCAAG-CATCTGGTAAACCAAGTTTTGGACACTCGTCGTAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGATATTCGTGACCAAGAATTCAAAATCTTCTCTGACGCCGGTCGTGTTATGCGTCCTGTCTTTACTGTACAGCAAGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACTTGGTATTGACCAAGGACCTCGTCAACAGACTTGCCAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGGCTATGATTTGCATGACACCGGAGGATCTTGAACTTTATCGTCTTCAGAAGGCTGGTATTTCCACGGATGAAGACATGGGAGACGATCCAAACAAGCGTCTTAAGACCAAGACAAATCCGACAACTCACATGTACACGCATTGCGAGATTCACCCAAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCTTGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGCTTCAACGGTGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACCCTCCTCGAGGCCATTGACGCCATCGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTGCCCCTTCAGGATGTCTACAAGATCGGTGGTATCGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTCCCCGGTGACAACGTTGGATTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCTCCC-GTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCTGAGCTCCTCGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_helicum ?????????????????????????????????????????????????????????????TCTTCCGTGGTATCATGCGGAGAATGAACACCGAATTGGCCAACTACCTAAGACGCTGTGTTGAGGGCAACCGACACTTCAACCTTGCTGTCGGTATCAAGCCCGGCACGCTTTCAAACGGACTGAAATACTCGCTTGCTACAGGAAACTGGGGTGACCAGAAGAAGGCCATGAGCTCAACTGCTGGTGTGTCTCAGGTGCTTAACCGATACACGTTTGCTTCGACCTTGTCACATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCCAAGCCTCGACAGCTTCACAACACGCATTGGGGTCTGGTCTGCCCAGCCGAGACACCCGAAGGACAAGCTTGTGGTCTGGTCAAGAATCTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAGCCCCTGATTGAGTTCATGATCAACAGAGGTATGGAGGTCGTCGAAGAGTATGAGCCTCTGCGATATCCTCATGCTACCAAGATTTTTGTCAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCCAAG-CATTTGGTGAACCAGGTTCTAGACACTCGTCGCAAGTCCTATCTCCAGTATGAAGTCTCTCTTGTCAGAGAAATCCGAGACCAGGAATTCAAGATCTTTTCCGACGCGGGCCGTGTCATGCGACCTGTCTTTACCGTTCAGCAAGAAGATGATCCTGAAACAGGCATCAACAAGGGCCACTTGGTACTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAAGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGCTGGGAGGGATTGATCAGGGCCGGTGCGGTCGAATACCTTGACGCCGAGGAAGAAGAGACGTCCATGATTTGCATGACGCCAGAGGACCTCGAGCTGTATCGCCTTCAGAAAGCTGGTATTAATACTGAGGAAGACATGGGAGATGACCCGAACAAGCGACTAAAGACAAAGACAAATCCAACAACTCAC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GCAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCTGGTTTCAACGGTGACAACATGCTTGAGGCCTCCAAGAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATTGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAAAACGTTTCCGTCAAGGAA-TCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCCTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_intricatum ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TACTCACTCGCTACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTATCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGCTTGGTGTGCCCGGCTGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGGTCTCCTTCTGAGCCTTTGATTGAGTTTATGATCAACAGAGGCATGGAGGTCGTTGAGGAGTACGAGCCACTGAGATATCCCCATGCCACAAAGATCTTTGTGAATGGTGTTTGGGTTGGAGTTCACCA-AGATCCCAAG-CATCTGGTAAACCAAGTTTTGGATACTCGTCGCAAATCCTACCTGCAGTACGAAGTCTCCCTGATTAGAGAAATTCGAGATCAAGAGTTCAAAATTTTCTCTGACGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCATCTGGTTCTGACCAAGGAACTCGTCAATAGATTGGCTAAAGAGCAGGCTGAGCCTCCTGAAGACCCAAGCCAGAAGCTTGGATGGGAAGGGTTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCTATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAGAAGGCCGGCATTGCCACGGACGAAGACATAGGAGATAATCCGAACCAGCGTCTGAAGACCAAGACAAATCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_koningiopsis ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TACTCACTCGCCACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCGGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTATCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGCTTGGTGTGCCCGGCTGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGCATGGAAGTCGTTGAGGAGTACGAGCCACTGAGATATCCCCATGCTACAAAGATCTTTGTGAACGGTGTCTGGGTTGGAATCCACCA-AGATCCCAAG-CATCTGGTAAACCAAGTTTTGGATACTCGTCGCAAATCCTATCTTCAGTACGAAGTCTCTCTGATTAGAGAAATTCGAGACCAAGAGTTCAAAATCTTCTCTGATGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTTTTGACCAAGGACCTCGTCAATAGATTGGCTAAAGAGCAGGCTGAGCCTCCTGAAGACCCAAGCCAGAAGCTTGGATGGGAAGGGTTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCTATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAGAAGGCGGGTATTGCCACGGACGAAGACATAGGAGATAATCCGAACCAGCGTCTGAAGACCAAGACAAATCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_longibrachiatum ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AACGGCTTGAAGTATTCGCTCGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGAGTGTCTCAGGTGCTCAACCGATACACGTTCGCCTCGACCCTCTCGCATTTGCGCCGCACCAACACGCCCATCGGAAGAGACGGCAAGCTGGCGAAGCCTCGACAGCTGCACAACACCCATTGGGGTCTGGTCTGCCCGGCCGAGACGCCCGAAGGACAGGCCTGTGGTCTTGTCAAGAACCTGTCTCTGATGTGTTATGTCAGTGTCGGCTCTCCCTCAGAGCCGTTGATCGAGTTTATGATCAATAGGGGCATGGAAGTGGTCGAGGAATACGAGCCGCTGCGTTATCCTCACGCTACCAAGATCTTTGTCAACGGTGTCTGGGTGGGCATTCACCA-AGATCCCAAA-CATCTGGTGCAGCAGGTCGTGGACACTCGTCGTAAGTCGTACCTGCAGTACGAGGTCTCTCTGGTCAGAGAAATTCGAGACCAGGAGTTCAAGATCTTCTCCGACGCAGGCCGCGTCATGCGACCCGTCTTTACCGTCCAGCAAGATGACGAGTCGGACACTGGCATTCCCAAGGGCCACTTGGTCCTGACCAAAGACCTCGTTAATAAATTGGCCCAGGAGCAGGCCGAGCCTCCAGAAGACCCAAGCATGAAGATTGGTTGGGAGGGACTCATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACTCCCGAGGATCTCGAGCTGTATCGTGCGC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTGATCCCGTGCACTCA------TTGCATC--ATCGCCACAACAACATACTAATGCCCTCTG--------------ACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCACCCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTGCGTCTGCCCCTGCAGGACGTCTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGCATGGTCGTCACCTTCGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGCCGAGGGCCAGCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTG-CAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGCGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGCCAGG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_oblongisporum ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTCGCTTCGACCTTATCACATTTGCGCCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAGGGACAAGCTTGTGGCTTGGTCAAAAACCTGTCGTTGATGTGCTACGTCAGTGTCGGATCTCCTTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGCATGGAGGTCGTCGAAGAGTATGAGCCGCTGCGATATCCTCATGCCACCAAAATTTTTGTGAACGGTGTCTGGGTTGGAGTCCACCA-AGACCCTAAG-CATCTGGTGAACCAGGTTCTGGACACTCGTCGCAAATCCTATCTACAGTACGAAGTTTCTCTCATCAGAGACATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTTATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACAGGCATTAACAAGGGCCACTTAGTATTGACCAAGGAACTCGTCAACAAACTGGCGAAGGAGCAGACTGAGCCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGGTTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCAGGTATTGCTACTGAGGAGGACATAGGAGAAAACCCGAATCAGCGACTCAAGACAAAGACAAATCCAACAACGCACATGTACACACATTGTGAGATTCACCCGAGCATGATCTTAGGCATCTGTGCTAGTATCATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATTGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGTCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTTGCTGTCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTACACCGGCAAGACCCTTCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGACGTGTACAAGATCGGCGGTATTGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTCACCTTCGCTCCTTCCGGCGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGCCAGCCCGGTGACAACGTTGGATTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCATGGCTGCCGCTTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCCGGCCAGGTCGGTGCCGGCTATGCCCCC-GTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_ovalisporum ???????????????????????????????????????GCGGGTCCATTGCTGGCCAAGCTGTTCCGTGGTATCATGCGCAGAATGAACACTGAGCTGGCAAACTACCTGAGACGATGTGTTGAGGGTAACCGCCACTTCAATCTTGCTGTTGGCATCAAGCCCGGCACGCTTTCTAACGGATTGAAGTATTCACTCGCTACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTATCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGCTTGGTGTGCCCGGCTGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTCTGATCGAGTTTATGATCAACAGAGGCATGGAAGTTGTTGAGGAGTACGAGCCACTGAGATATCCCCATGCTACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAGTTCACCA-AGATCCCAAG-CATCTGGTAAACCAAGTTTTGGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGATTAGAGAAATTCGAGACCAAGAGTTCAAAATCTTCTCTGATGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGAACTCGTCAATAGATTGGCTAAAGAGCAGGCTGAGCCTCCTGAAGACCCAAGCCAGAAGCTTGGATGGGAAGGGTTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCTATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAGAAGGCCGGCATTGCCACGGACGAAGACATAGGAGATAATCCGAACCAGCGTCTGAAGACCAAGACAAATCCAACAACTCACATGTATACTCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCCAGTA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_paucisporum ???????????????????????????????????????????????????????????????????????????????????????????????????????????????AGACGATGTGTTGAGGGTAACCGCCACTTCAATCTTGCTGTTGGCATCAAGCCTGGCACGCTCTCCAACGGATTGAAGTACTCACTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCAACACTTTCTCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAATACACACTGGGGTTTGGTGTGCCCGGCCGAGACGCCTGAAGGACAAGCTTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCCTTGATCGAGTTCATGATCAACAGAGGTATGGAGGTCGTTGAAGAGTACGAACCGCTGAGATATCCCCATGCGACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCATCA-AGACCCCAAA-CATCTGGTGAACCAAGTTTTGGACACTCGTCGTAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGGGATATTCGTGACCAAGAGTTCAAGATCTTCTCTGACGCCGGTCGTGTTATGCGTCCTGTCTTTACCGTACAGCAAGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTTTTGACCAAGGATCTCGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCTCCGGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTGGAATATCTCGATGCCGAGGAAGAAGAAACGGCTATGATTTGCATGACACCGGAGGACCTTGAGCTTTATCGTCTTCAGAAAGCTGGTATTTCCACAGATGAAGACATGGGAGACGATCCAAACAAGCGTCTCAAGAC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_protrudens ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TATTCGCTTGCCACTGGAAACTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCCGGTGTGTCTCAGGTGCTTAATCGTTACACTTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGCAAGTTGGCGAAGCCTCGACAGCTTCACAATACGCATTGGGGTCTGGTCTGCCCAGCCGAGACACCTGAGGGACAAGCTTGTGGCTTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGATCTCCTTCCGAACCCCTGATCGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCACACGCTACAAAGATCTTTGTAAACGGTGTCTGGGTGGGAGTTCATCA-AGATCCCAAG-CACCTGGTGAACCAGGTTCTGGACACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGGGATATTCGTGATCAGGAATTCAAAATTTTCTCCGATGCAGGTCGTGTTATGCGTCCCGTCTTTACTGTTCAGCAAGAAGACGATCCTGAAACTGGCATCAACAAGGGCCATTTGGTTTTGACAAAGGAGCTGGTCAACAGGCTGGCAAAGGAGCAGGCTGAGCCTCCGGAGGACCCGAGCATGAAGATTGGATGGGAGGGATTAATTAGGGCTGGTGCGGTTGAATATCTCGATGCTGAGGAAGAAGAGACGGCCATGATTTGCATGACCCCCGAGGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGTATTTCCACAGAAGAAGACATGGCAGATGATCCAAACAAGCGACTCAAGACAAAGACGAATCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_pubescens ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TATTCACTTGCCACCGGAAACTGGGGTGACCAGAAGAAGGCTATGAGCTCGACTGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCGACGCTTTCTCATTTGCGTCGTACAAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACACTGGGGTTTGGTGTGCCCGGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAAAATTTGTCTCTGATGTGCTACGTTAGTGTCGGATCTCCTTCTGAGCCCTTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTACGAACCACTGAGGTATCCCCATGCCACAAAGATCTTTGTGAATGGTGTCTGGGTTGGTATCCACCA-AGACCCCAAG-CATCTGGTAAACCAAGTTTTGGACACTCGTCGTAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGACATTCGTGACCAAGAATTCAAAATCTTCTCTGACGCCGGTCGTGTTATGCGTCCTGTCTTTACTGTACAGCAAGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACTTGGTTTTGACCAAGGATCTCGTCAACAGACTGGCTAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGCTAATTAGGGCTGGTGCGGTGGAATATCTCGATGCCGAGGAAGAAGAAACGTCTATGATTTGCATGACACCGGAGGATCTTGAACTTTACCGTCTTCAAAAAGCTGGTATTTCCACGGATGAAGACATGGGAGACGATCCAAACAAGCGTCTCAAGACCAAGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCTGAGGCTCGTTACCTTGAGATTATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTTGCCTTCGTCCCCATCTCTGGCTTCAACGGTGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGTAAGACCCTCCTCGAGGCCATTGACGCCATTGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTGCCCCTTCAGGATGTCTACAAGATCGGTGGTATTGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGATTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGATACGCTCCC-GTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCTGAGCTCCTCGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_rossicum ??????????????????????????????????????????????????????????AGCTGTTCCGTGGTA-CATGCGAAGGATGAACACTGAATTGGCCAACTATCTGAGACGGTGCGTTGAGGGCAACCGACATTTCAACCTTGCTGTTGGCATCAAGCCCGGCACGCTTTCAA-CGGATTGAAGTATTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCTCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTCTCACATTTGCGTCGTACCAACACGCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCACTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAAGCTTGCGGTCTGGTCAAAAACCTGTCTCTGATGTGCTACGTCAGTGTCGGCTCTCCCTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGTATGGAGGTTGTCGAAGAGTATGAGCCGCTGCGATATCCTCATGCTACCAAGATTTTTGTCAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCCAAG-CATCTGGTGAACCAGGTTCTGGACACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGATCCGGAAACAGGCATCAACAAGGGCCACTTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCTAAGGAGCAGGCTGAACCTCCGGAAGACCCTAGCATGAAGATTGGGTGGGAGGGATTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAAGAGACGTCCATGATTTGCATGACGCCGGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCTGGTATTTCTACTGATGAGG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_saturnisporum ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CGGCTTGAAGTATTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTCAACCGCTACACGTTTGCCTCGACCCTCTCGCATTTGCGCCGCACCAACACGCCCATCGGACGAGATGGCAAGCTGGCGAAGCCTCGACAGCTTCACAACACCCATTGGGGTCTGGTCTGCCCAGCCGAAACCCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAATCTGTCTCTGATGTGTTACGTCAGTGTCGGCTCTCCATCAGAGCCGTTGATTGAGTTTATGATCAACAGGGGCATGGAAGTTGTCGAGGAATACGAGCCGCTGCGTTATCCTCACGCTACCAAGATATTTGTCAACGGTGTCTGGGTGGGCATCCACCA-GGATCCCAAG-CATCTGGTTCAACAGGTCGTGGACACTCGTCGTAAATCTTACCTGCAGTACGAGGTCTCTCTCGTCAGAGAAATTCGAGACCAAGAGTTCAAGATCTTCTCCGACGCAGGCCGCGTCATGCGACCCGTCTTTACCGTCCAGCAAGATGAAGAATCGGACACTGGCATTCCAAAGGGCCACTTGGTACTGACCAAAGAGCTTGTTAATAAGCTGGCCCAAGAGCAGGCCGACCCTCCAGAAGACCCAAGCATGAAGATTGGTTGGGAGGGACTCATCAGGGCTGGTGCTGTTGAATATCTCGAC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_scalesiae ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TACTCACTCGCCACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTCTCACAGGTGCTTAACCGCTACACTTTTGCTTCTACACTTTCCCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGTTTGGTGTGCCCGGCTGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATTGAGTTTATGATCAACAGAGGCATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCCCATGCCACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATTCATCA-AGACCCCAAG-CATCTGGTAAACCAAGTTTTGGATACTCGTCGCAAATCCTATCTGCAGTACGAGGTCTCTCTGATCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCTGATGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTTTTGACCAAGGACCTCGTCAATAGACTGGCCAAAGAGCAGG?TGAGCCTCCAGAAGACCCAAGCATGAAGCTCGGATGGGAGGGGTTGATTAGGGCTGGTGCGGTGGAATATCTTGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTTTAT???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_spirale ???????????????????????????????????????GCGGGTCCCTTGTTGGCCAAGCTATTCCGTGGTATTATGCGAAGAATGAACACTGAGTTGGCCAACTATCTGAGACGATGTGTTGAGGGCAACAGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAATGGATTGAAATATTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGCTACACGTTTGCCTCGACCCTGTCGCATTTGCGTCGAACCAACACGCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCTGAAGGACAGGCTTGTGGTTTGGTCAAAAACTTGTCTTTGATGTGTTACGTCAGTGTGGGTTCTCCCTCCGAACCCTTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTATGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CATCTGGTGAACCAGGTTCTAGACACTCGTCGCAAATCCTACTTGCAGTACGAAGTCTCTCTTGTCAGAGAAATTCGAGACCAAGAATTCAAAATCTTTTCTGACGCAGGCCGTGTCATGCGACCTGTTTTTACTGTTCAGCAGGAAGATGACCCGGAAACAGGTATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGACTGGCCAAGGAGCAGGCTGAACCTCCTGAAGACCCAAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAAGAAGAGGAGACAGCTATGATTTGCATGACACCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCTGGTATTTCTACTGAGGAAGACATGGGAGATGATCCAAACAAGCGACTAAAGACGAAGACAAACCCAACCACTCACATGTACACCCATTGTGAGATTCACCCAAGTATGATCTTGGGCATTTGCGCTAGTA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTTCTTGAGGCCATCGACTCCATTGAGCCCCCCAAGCGTCCCACGGAGAAGCCCCTTCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGCTGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCCGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTATGCCCCC-GTCCTTGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_strigosum ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTTTCCCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGTTTGGTGTGCCCGGCTGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGCTACGTCAGTGTTGGATCGCCTTCTGAGCCCTTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCCCACGCCACAAAGATCTTTGTGAATGGTGTCTGGGTTGGTATCCACCA-AGATCCCAAG-CACCTGGTAAACCAAGTTTTGGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGGTCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCTGACGCCGGTCGTGTTATGCGTCCTGTCTTTACCGTGCAGCAAGAAGATGACCCGGAGACGGGTATCAACAAGGGTCACCTGGTCTTGACCAAGGATCTCGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCGCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGATTAATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGGCCATGATCTGCATGACACCGGAAGATCTTGAGCTGTACCGTCTTCAGAAGGCCGGTATTTCCACAGAGGAAGACATGGGAGATGATCCAAACAAGCGTCTCAAGACCAAGACAAATCCGACAACTCACATGTACACGCATTGCGAGATTCACCCTAGTATGATCTTAGGTATCTGTGCTAGTATTATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCTTGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACTGTTGCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTTGCCCCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACCGGCAAGACCCTTCTCGAGGCCATTGACGCCATTGAGCCCCCCAAGCGTCCCACAGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTTTACAAGATCGGTGGTATTGGAACAGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGATTCAACGTCAAGAACGTCTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCCAGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGTTACGCTCCC-GTCCTCGACTGCCACACCGCCCACATTGCCTGCAAGTTCTCTGAGCTCCTCGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_stromaticum ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCTCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTCTCACATTTGCGTCGTACCAACACGCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCACTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAAGCTTGCGGTCTGGTCAAAAACTTGTCTCTGATGTGTTACGTCAGTGTCGGCTCTCCTTCCGAACCCCTGATCGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTATGAGCCGCTGCGATATCCTCATGCTACCAAGATTTTTGTCAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CATCTGGTGAACCAGGTTCTGGACACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTTGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGATCCGGAAACAGGCATCAACAAGGGCCACTTGGTATTGACCAAGGAGCTCGTCAACAGACTTGCCAAGGAGCAGGCCGAACCTCCGGAAGACCCTAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAAGAGACGTCCATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCTGGTATTTCTACTGATGAGGACATGGGAGATGATCCGAACAAGCGACTCAAGACTAAGACGAATCCAACCACGCACATGTACACGCATTGTGAGATTCACCCGAGCATGATTTTGGGTATCTGTGCCAGTATCATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTTGCCATCAACAAGATGGACACTGCCGGCTGGGCTGAGGCCCGTTACCAGGAGATCATCAGGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGTCTGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGCTCGAGCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTTCAGGATGTGTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTCTCCGTCAAGGATATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCAACGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTTATCGAGAAGATCGACCGT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_theobromicola ???????????????????????????????????????????????????????????????????????????????????????????????????????????????AGACGATGTGTTGAGGGTAACCGCCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACGCTCTCCAACGGTTTGAAGTACTCACTCGCCACCGGAAACTGGGGTGACCAGAAAAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCGACACTTTCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAATACACACTGGGGTTTGGTGTGCCCGGCCGAGACGCCTGAAGGACAAGCTTGTGGTCTGGTCAAAAACTTGTCTCTAATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAGGTCGTTGAAGAGTACGAACCACTGAGATATCCCCATGCGACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCACCA-AGACCCCAAG-CATCTGGTGAACCAAGTCCTGGATACTCGTCGTAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGATATTCGTGACCAAGAATTCAAAATCTTCTCTGACGCCGGTCGTGTTATGCGTCCTGTCTTTACCGTACAGCAAGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTTTTGACCAAGGATCTCGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCTCCGGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTGGAATATCTTGATGCCGAGGAAGAAGAAACGGCTATGATTTGCATGACACCGGAGGATCTTGAGCTTTATCGTCTTCAGAAGGCTGGTATTTCCACGGATGAAGACATGGGAGACGATCCAAACAAG??????????????????????????????----????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Trichoderma_tomentosum ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGGGTGATCAGAAGAAGGCCATGAGCTCAACCGCAGGTGTCTCTCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACCAATACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGTCAGCTCCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACGCCCGAAGGACAGGCTTGTGGTCTAGTCAAAAACTTGTCTTTGATGTGTTATGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAATACGAGCCGCTGCGGTATCCTCATGCTACTAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCA-AGACCCTAAG-CACCTGGTGAACCAGGTTCTGGATACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGTCGTGTCATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACAGGCATCAACAAGGGCCACCTGGTATTAACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAAGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGATTAATTAGGGCTGGTGCGGTTGAATATCTCGACGCTGAGGAAGAAGAGACATCCATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATTTCCACCGAGGAAGACATGGGAGATGATCCGAACAAGCGTCTAAAGACAAAGACAAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGCATCTGTGCTAGTATCATTCCTTTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCTGTCGCTTTCGTCCCCATCTCCGGCTTCAACGGAGACAACATGCTCCAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---GCTGG---CAAGTCCACTGGCAAGACCCTTCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTATCCTCAAGCCCGGTATGGTCGTTACCTTCGCCCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTTGGATTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGCTGCCGCTTCTTTCACCGCCCAGGTTATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCC-GTCCTTGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ; END; BEGIN SETS; CHARSET tef1 (CHARACTERS = rpbtefcomb) = 1262-2919; CHARSET rpb2 (CHARACTERS = rpbtefcomb) = 1-1261; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = rpbtefcomb) = N: 1-2919; CODONPOSSET CodonPositions (CHARACTERS = rpbtefcomb) = N: 1-2919; END; BEGIN TREES; TITLE Tb10618; LINK TAXA = Taxa2; TRANSLATE 1 Hypocrea_alni_CPK2494, 2 Hypocrea_alni_CPK2854, 3 Hypocrea_alni_CBS120633, 4 Hypocrea_alni_CPK2858, 5 Hypocrea_brunneoviridis_CBS121130, 6 Hypocrea_brunneoviridis_CBS120928, 7 Hypocrea_brunneoviridis_CPK2425, 8 Hypocrea_epimyces_CPK1980, 9 Hypocrea_epimyces_CPK2487, 10 Hypocrea_epimyces_CBS120534, 11 Hypocrea_epimyces_CPK2417, 12 Hypocrea_parepimyces_CBS122769, 13 Hypocrea_parepimyces_CBS122768, 14 Hypocrea_lixii_CPK1935, 15 Hypocrea_lixii_CPK1941, 16 Hypocrea_lixii_CPK1934, 17 Trichoderma_cerinum_CBS120637, 18 Trichoderma_tomentosum_CPK2563, 19 Hypocrea_spinulosa_CBS121280, 20 Hypocrea_spinulosa_CBS121272, 21 Hypocrea_spinulosa_CPK1510, 22 Hypocrea_danica_CBS121273, 23 Hypocrea_aeruginea_CBS120541, 24 Hypocrea_aureoviridis_CPK2848, 25 Hypocrea_aureoviridis_CPK2857, 26 Hypocrea_aureoviridis_CPK2849, 27 Hypocrea_sinuosa_CPK1595, 28 Hypocrea_sinuosa_CPK2008, 29 Hypocrea_thelephoricola_CBS120925, 30 Hypocrea_thelephoricola_CPK2480, 31 Hypocrea_estonica_CBS111147, 32 Hypocrea_estonica_CBS121556, 33 Hypocrea_parestonica_CPK2427, 34 Hypocrea_parestonica_CBS120636, 35 Hypocrea_ceramica_CBS114576, 36 Hypocrea_strictipilosa_CPK1601, 37 Hypocrea_strictipilosa_CPK3135, 38 Hypocrea_gelatinosa_CPK1618, 39 Hypocrea_longipilosa_CBS120953, 40 Hypocrea_dacrymycella_WU29044, 41 Hypocrea_phyllostachydis_CBS114071; TREE PAUP_2 = [&R] ((((((((((1,2,3,4),((8,9,10,11),(12,13))),(5,6,7)),(14,(15,16))),(17,18)),40),38),(((31,32),(33,34)),35)),((36,37),39)),(((((19,(20,21)),22),23),(24,25,26)),((27,28),(29,30))),41); TREE Fig._2 = [&R] ((((((((((1,2,3,4),((8,9,10,11),(12,13))),(5,6,7)),((14,15),16)),(17,18)),40),38),(((31,32),(33,34)),35)),((36,37),39)),(((((19,(20,21)),22),23),(24,25,26)),((27,28),(29,30))),41); END; BEGIN TREES; TITLE Tb10617; LINK TAXA = Taxa1; TRANSLATE 1 Aphysiostroma_stercorarium, 2 Hypocrea_aeruginea, 3 Trichoderma_aggressivum, 4 Hypocrea_sp.1, 5 Hypocrea_alcalifuscescens, 6 Hypocrea_alni, 7 Hypocrea_alutacea, 8 Hypocrea_americana, 9 Trichoderma_arundinaceum, 10 Trichoderma_asperellum, 11 Hypocrea_atrogelatinosa, 12 Hypocrea_atroviridis, 13 Hypocrea_sp.2, 14 Hypocrea_aureoviridis, 15 Hypocrea_sp.3, 16 Trichoderma_austrokoningii, 17 Hypocrea_avellanea, 18 Hypocrea_sp.4, 19 Trichoderma_brevicompactum, 20 Hypocrea_brunneoviridis, 21 Hypocrea_sp.5, 22 Hypocrea_candida, 23 Hypocrea_sp.6, 24 Hypocrea_catoptron, 25 Hypocrea_ceracea, 26 Hypocrea_ceramica, 27 Trichoderma_cerinum, 28 Hypocrea_chlorospora, 29 Hypocrea_chromosperma, 30 Hypocrea_cinereoflava, 31 Hypocrea_cinnamomea, 32 Hypocrea_citrina, 33 Hypocrea_costaricensis, 34 Hypocrea_crassa, 35 Hypocrea_cremea, 36 Hypocrea_crystalligena, 37 Hypocrea_cuneispora, 38 Hypocrea_dacrymycella, 39 Hypocrea_danica, 40 Hypocrea_decipiens, 41 Hypocrea_delicatula, 42 Hypocrea_dorotheae, 43 Hypocrea_epimyces, 44 Trichoderma_erinaceus, 45 Hypocrea_estonica, 46 Hypocrea_eucorticioides, 47 Trichoderma_fertile, 48 Hypocrea_flaviconidia, 49 Hypocrea_fomiticola, 50 Hypocrea_gelatinosa, 51 Trichoderma_hamatum, 52 Trichoderma_helicum, 53 Trichoderma_intricatum, 54 Hypocrea_jecorina, 55 Hypocrea_sp.9, 56 Hypocrea_koningii, 57 Trichoderma_koningiopsis, 58 Hypocrea_leucopus, 59 Hypocrea_lixii, 60 Trichoderma_longibrachiatum, 61 Hypocrea_longipilosa, 62 Hypocrea_lutea, 63 Hypocrea_sp.10, 64 Hypocrea_sp.8, 65 Hypocrea_megalocitrina, 66 Hypocrea_melanomagna, 67 Hypocrea_microcitrina, 68 Hypocrea_minutispora, 69 Hypocrea_sp.11, 70 Hypocrea_moravica, 71 Hypocrea_neorufa, 72 Hypocrea_sp.12, 73 Hypocrea_nigrovirens, 74 Hypocrea_novaezelandiae, 75 Hypocrea_nybergiana, 76 Trichoderma_oblongisporum, 77 Hypocrea_ochroleuca, 78 Trichoderma_ovalisporum, 79 Hypocrea_pachybasioides, 80 Hypocrea_sp.13, 81 Hypocrea_parapilulifera, 82 Hypocrea_parepimyces, 83 Hypocrea_parestonica, 84 Hypocrea_parmastoi, 85 Trichoderma_paucisporum, 86 Hypocrea_petersenii, 87 Hypocrea_sp.14, 88 Hypocrea_phyllostachydis, 89 Hypocrea_pilulifera, 90 Hypocrea_placentula, 91 Hypocrea_protopulvinata, 92 Trichoderma_protrudens, 93 Hypocrea_pseudostraminea, 94 Hypocrea_psychrophila, 95 Trichoderma_pubescens, 96 Hypocrea_pulvinata, 97 Hypocrea_sp.15, 98 Hypocrea_rodmanii, 99 Hypocrea_rogersonii, 100 Trichoderma_rossicum, 101 Hypocrea_rufa, 102 Hypocrea_sp.16, 103 Trichoderma_saturnisporum, 104 Trichoderma_scalesiae, 105 Hypocrea_schweinitzii, 106 Hypocrea_semiorbis, 107 Hypocrea_seppoi, 108 Hypocrea_sp.7, 109 Hypocrea_sinuosa, 110 Hypocrea_spinulosa_CBS121280, 111 Hypocrea_spinulosa_CBS121272, 112 Hypocrea_spinulosa_CBS311.50, 113 Trichoderma_spirale, 114 Hypocrea_stilbohypoxyli, 115 Hypocrea_straminea, 116 Hypocrea_strictipilosa, 117 Trichoderma_strigosum, 118 Trichoderma_stromaticum, 119 Hypocrea_subalpina, 120 Hypocrea_sp.17, 121 Hypocrea_sulawesensis, 122 Hypocrea_sulphurea, 123 Hypocrea_surrotunda, 124 Hypocrea_tawa, 125 Hypocrea_thailandica, 126 Hypocrea_thelephoricola, 127 Trichoderma_theobromicola, 128 Trichoderma_tomentosum, 129 Hypocrea_tremelloides, 130 Hypocrea_sp.18, 131 Hypocrea_victoriensis, 132 Hypocrea_virens, 133 Hypocrea_virescentiflava, 134 Hypocrea_viridescens, 135 Hypocrea_voglmayrii, 136 Protocrea_farinosa, 137 Protocrea_pallida; TREE Fig._1 = [&R] (136,(((((((1,40),(((8,96),91),32),(67,93),87),(15,122,131)),46),(((((2,(39,(110,(111,112)))),((14,22),(((28,((35,109),123)),126),33))),(125,133)),((((((((3,82),43),6),124),20),59),((24,38),(31,115))),((11,25),(27,128))),((26,83),45),(29,50),(34,132),((37,61),113,116),(52,108),((((((54,60),103),105),74),((102,129),119)),121),73,88,(100,118)),(((47,(70,76)),106),49)),4,(((((((7,(68,69)),((79,81),89)),(18,90)),80),63),(58,(75,107))),((((10,(((48,95),51),(85,127))),(((((12,(55,134),101,104,130),(((42,((53,77),78,86),57),56),114)),117),44),((16,99),120))),(71,72)),135)),(((9,92),19),(13,(23,98))),(17,41),((21,36,(94,97)),65),((62,66),64)),84),(5,30)),137); END;