#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 3:40 GMT TreeBASE (cc) 1994-2008 Study reference: Moriwaki J., & Tsukiboshi T. 2009. Colletotrichum echinochloae, a new species on Japanese barnyard millet (Echinochloa utilis). Mycoscience, 50: 273-280. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10094] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=15; TAXLABELS Colletotrichum_caudatum_MAFF238574 Colletotrichum_cereale_NJ4990 Colletotrichum_cereale_NJ6795 Colletotrichum_echinochloae_MAFF511152 Colletotrichum_echinochloae_MAFF511328 Colletotrichum_echinochloae_MAFF511471 Colletotrichum_echinochloae_MAFF511472 Colletotrichum_echinochloae_MAFF511473 Colletotrichum_falcatum_MAFF306170 Colletotrichum_gloeosporioides_MAFF239930 Colletotrichum_gloeosporioides_MAFF239933 Colletotrichum_graminicola_ATCC26416 Colletotrichum_graminicola_MO100178 Colletotrichum_sublineolum_MAFF511474 Colletotrichum_sublineolum_S3001 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4509] TITLE SOD2; LINK TAXA = Taxa1; DIMENSIONS NCHAR=395; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Colletotrichum_caudatum_MAFF238574 CACCAAGCATACGTTACAAACCTGAACAAGGCCATCGAGACTTACAATGCCAACCCCCTCCAAAACCGCATCGCCGTCCTCGCGGCCCTCAACTTTAACGGCGGCGGCCACATCAACCACTCTCTCTTCTGGGAGAACCTGTCCCCAGCCTCGAGCGCAGATGCATCACCCAGTGCGGCACCCAAGCTCGTCGCTGAGATCACCCGCATATGGGGCGGGCTCGACCAGTTCAAGCAGGCTTTCAACGCCACGCTGCTGGGTATCACCGGTAGCGGCTGGGGTTGGCTGGTCAAGGACGACGTGACGGGCCTCAGCATCGTCACGACGAAAGACCAGGACCCTGTCACCAAGGGCGTGCCCATCTTTGGTGTCGACATGTGGGAGCACGCGTACTA Colletotrichum_cereale_NJ4990 CACGAAGCATACGTTACAAATCTAAACAAGGCCGTCGAGACCTACAACGCGAACCCCCTCCAGAACCGCATCGCCGTCCTCCCAGCCCTCAACTTCAACGGCGGCGGCCACATCAACCACTCCCTCTTCTGGGAAAACCTGTCCCCTGCCTCGAGCCCAGACGCCTCGCCAGACGCCGCGCCGAAGCTCGTCGCTGAGATCGCCCGGGTCTGGGGCGGGCTCGACCAGTTCAAGCAGGCTTTCAACGCCACGCTTCTGGGTATCACCGGCAGCGGCTGGGGATGGCTGGTCAAGGACGACGTAACGGGTCTGAGCATCATCACGACGAAAGACCAGGACCCTGTCACCAAGGGCGTGCCCATCTTCGGCGTGGACATGTGGGAGCACGCGTACTA Colletotrichum_cereale_NJ6795 CACCAAGCATATGTTACAAATTTGAACAAGGCCGTCGAGACCTACAACGCGAACCCCCTTCAAAACCGCATCGCCGTCCTCGCAGCCCTCAACTTCAACGGTGGCGGCCACATCAACCACACCCTCTTCTGGGAGAACCTGAGCCCAGCCTCGAGCCCAGACGCCTCGCCCGACGCCGCGCCCAAGCTCGTCGCTGAGATCACCCGGGTCTGGGGCGGGCTCGACCAGTTCAAGCAGGCTTTCAACGCCACGCTGCTGGGTATCACCGGCAGCGGCTGGGGGTGGCTGGTCAAGGACGACGTAACGGGTCTCAGCATCATCACGACGAAAGACCAGGACCCTGTCACCAAGGGCGTGCCCATCTTCGGCGTGGACATGTGGGAGCACGCGTACTA Colletotrichum_echinochloae_MAFF511152 CACCAAGCATACGTTACAAATTTGAACAAGGCCGTCGAGACCTACAACGCAAACCCCCTCCAGAACCGCATCGCCGTCCTCGCAGCCCTCAACTTCAACGGCGGCGGCCACATCAACCACTCCCTCTTCTGGGAGAACCTGTGCCCGGCCTCGAGCGCAGATGCCTCGCCCGACGCGGCGCCCAAGCTCATTGCCGAGATCACCCGTGTCTGGGGCGGGCTGGAGCAGTTCAAGCAGGCCTTCAACGCCACGCTGCTGGGTATCACCGGCAGCGGCTGGGGATGGCTGGTCAGAGACGAAGTGACGGGTCTCGGCATCGTCACCACAAAGGACCAGGACCCCGTCACCAAGGGCGTGCCCATCTTTGGCGTCGACATGTGGGAGCACGCGTACTA Colletotrichum_echinochloae_MAFF511328 CACCAAGCATACGTTACAAATTTGAACAAGGCCGTCGAGACCTACAACGCAAACCCCCTCCAGAACCGCATCGCCGTCCTCGCAGCCCTCAACTTCAACGGCGGCGGCCATATCAACCACTCCCTCTTCTGGGAGAACCTGTGCCCGGCCTCGAGCGCAGATGCCTCGCCCGACGCGGCGCCCAAGCTCATTGCCGAGATCACCCGTGTCTGGGGCGGGCTGGAGCAGTTCAAGCAGGCCTTCAACGCCACGCTGCTGGGTATCACCGGCAGCGGCTGGGGATGGCTGGTCAGAGACGAAGTGACGGGTCTCGGCATCGTCACCACAAAGGACCAGGACCCCGTCACCAAGGGCGTGCCCATCTTTGGCGTCGACATGTGGGAGCACGCGTACTA Colletotrichum_echinochloae_MAFF511471 CACCAAGCATACGTTACAAATTTGAACAAGGCCGTCGAGACCTACAACGCAAACCCCCTCCAGAACCGCATCGCCGTCCTCGCAGCCCTCAACTTCAACGGCGGCGGCCATATCAACCACTCCCTCTTCTGGGAGAACCTGTGCCCGGCCTCGAGCGCAGATGCCTCGCCCGACGCGGCGCCCAAGCTCATTGCCGAGATCACCCGTGTCTGGGGCGGGCTGGAGCAGTTCAAGCAGGCCTTCAACGCCACGCTGCTGGGTATCACCGGCAGCGGCTGGGGATGGCTGGTCAGAGACGAAGTGACGGGTCTCGGCATCGTCACCACAAAGGACCAGGACCCCGTCACCAAGGGCGTGCCCATCTTTGGCGTCGACATGTGGGAGCACGCGTACTA Colletotrichum_echinochloae_MAFF511472 CACCAAGCATACGTTACAAATTTGAACAAGGCCGTCGAGACCTACAACGCAAACCCCCTCCAGAACCGCATCGCCGTCCTCGCAGCCCTCAACTTCAACGGCGGCGGCCATATCAACCACTCCCTCTTCTGGGAGAACCTGTGCCCGGCCTCGAGCGCAGATGCCTCGCCCGACGCGGCGCCCAAGCTCATTGCCGAGATCACCCGTGTCTGGGGCGGGCTGGAGCAGTTCAAGCAGGCCTTCAACGCCACGCTGCTGGGTATCACCGGCAGCGGCTGGGGATGGCTGGTCAGAGACGAAGTGACGGGTCTCGGCATCGTCACCACAAAGGACCAGGACCCCGTCACCAAGGGCGTGCCCATCTTTGGCGTCGACATGTGGGAGCACGCGTACTA Colletotrichum_echinochloae_MAFF511473 CACCAAGCATACGTTACAAATTTGAACAAGGCCGTCGAGACCTACAACGCAAACCCCCTCCAGAACCGCATCGCCGTCCTCGCAGCCCTCAACTTCAACGGCGGCGGCCATATCAACCACTCCCTCTTCTGGGAGAACCTGTGCCCGGCCTCGAGCGCAGATGCCTCGCCCGACGCGGCGCCCAAGCTCATTGCCGAGATCACCCGTGTCTGGGGCGGGCTGGAGCAGTTCAAGCAGGCCTTCAACGCCACGCTGCTGGGTATCACCGGCAGCGGCTGGGGATGGCTGGTCAGAGACGAAGTGACGGGTCTCGGCATCGTCACCACAAAGGACCAGGACCCCGTCACCAAGGGCGTGCCCATCTTTGGCGTCGACATGTGGGAGCACGCGTACTA Colletotrichum_falcatum_MAFF306170 CACCAGGCATACGTTACGAATCTGAACAAGGCCGTCGAGGCTTACAGCGCGAACCCCCTCCAGAACCGCATCGCCGTCCTCGCGGCCCTCAACTTCAACGGCGGCGGCCACATCAACCACTCCCTCTTCTGGGAGAACCTCTCGCCGGCCTCGAGCCCGGACGCCTCGCCCGACGCGGCACCCGCGCTCGTCGCCGAGATCACCCGCGTCTGGGGCGGGCTCGACCGGTTCAAGCAGGCCTTCAACGCCGCGCTGCTGGGCATCACCGGCAGCGGCTGGGGCTGGCTGGTCAGGCACGACGCCACGGGCCTCGCCATCGTCACGACCAAAGACCAGGACCCCGTCACCAAGGGCGTGCCCGTCTTCGGGGTCGACATGTGGGAGCACGCCTACTA Colletotrichum_gloeosporioides_MAFF239930 CACCAGACCTACGTCACAAACCTAAACAAGGCTATCGAAACATACAACGCCAACCCTCTCCAAAGCCGCATCGCCGTTTTGGCAGCACTCAACTTCCACGGCGGAGGCCACATCAACCACTCCCTCTTCTGGGAGAACCTCTCTCCCGCTTCTAGCCCGGATGCTTCTCCCGACTCCGCACCCAGCCTGATCGCCGAGGTCACCCGCGTCTGGGGCGGCCTCGACAAGTTCAAGCAAGCTTTCAACGCTGCGCTGTTGGGCATCACCGGCAGCGGCTGGGGCTGGCTGGTCAAAGACGACACGACAGGTCTCAGCATCATCACGACCAAGGACCAGGACCCCGTCACCAAGGGCGTGCCTATCTTCGGTGTCGACATGTCCGAGCACGCGTACTA Colletotrichum_gloeosporioides_MAFF239933 CACCAGACCTACGTCACAAACCTAAACAAGGCTATCGAAACATACAACGCCAACCCTCTCCAAAGCCGCATCGCCGTTTTGGCAGCACTCAACTTCCACGGCGGAGGCCACATCAACCACTCCCTCTTCTGGGAGAACCTCTCTCCCGCTTCTAGCCCGGATGCTTCTCCCGACTCCGCACCCAGCCTGATCGCCGAGGTCACCCGCGTCTGGGGCGGCCTCGACAAGTTCAAGCAAGCTTTCAACGCTGCGCTGTTGGGCATCACCGGCAGCGGCTGGGGCTGGCTGGTCAAAGACGACACGACAGGTCTCAGCATCATCACGACCAAGGACCAGGACCCCGTCACCAAGGGCGTGCCTATCTTCGGTGTCGACATGTCCGAGCACGCGTACTA Colletotrichum_graminicola_ATCC26416 CATCAAGCATACGTTACAAATCTGAACAAGGCCATCGAGACTTACAATGCAAACCCGCTCCAGAATCGCATCGCCGTCCTCGCGGCCCTAAACTTCAACGGCGGCGGCCACATCAACCATTCCCTATTCTGGGAGAACCTTTCCCCAGCCTCGAGCGGTGATGCCTCGCCCGATGCGGCGCCAAAGCTCGTCGCCGAGATCACCCGCGTCTGGGGCGGGCTCGACCAGTTCAAGCAGGCTTTCAACACCACGCTGCTGGGTATCACCGGTAGCGGCTGGGGGTGGCTTGTTAAGGATGACATAACGGGCCTCAGCATTATCACGACGAAAGACCAGGACCCTGTCACCAAGGGCGTGCCCATCTTTGGTATTGACATGTGGGAGCACGCGTACTA Colletotrichum_graminicola_MO100178 CATCAAGCATACGTTACAAATCTGAACAAGGCCATCGAGACTTACAATGCAAACCCGCTCCAGAATCGCATCGCCGTCCTCGCGGCCCTAAACTTCAACGGCGGCGGCCACATCAACCATTCCCTATTCTGGGAGAACCTTTCCCCAGCCTCGAGCGGTGATGCCTCGCCCGATGCGGCGCCAAAGCTCGTCGCCGAGATCACCCGCGTCTGGGGCGGGCTCGACCAGTTCAAGCAGGCTTTCAACACCACGCTGCTGGGTATCACCGGTAGCGGCTGGGGGTGGCTTGTTAAGGATGACATAACGGGCCTCAGCATTATCACGACGAAAGACCAGGACCCTGTCACCAAGGGCGTGCCCATCTTTGGTATTGACATGTGGGAGCACGCGTACTA Colletotrichum_sublineolum_MAFF511474 CACCAAGCATACGTTACAAATCTGAACAAAGCCATCGAGGCTTACAATGCAAACCCCCTCCAAAACCGCATCGCCGTCCTTGCGGCCCTCAACTTCAATGGAGGCGGCCACATCAACCACTCCCTCTTCTGGGAGAACCTGTCCCCAGCCTCGAGCCCAGATGCCTCGCCCGATGCGGCGCCCAAGCTCGTCGCTGAGATCACCCGCGTCTGGGGCGGGCTCGACCAGTTCAAGCAGGCTTTCAACGCCACACTGCTGGGTATCACCGGCAGCGGCTGGGGATGGCTGGTCAAGGACGACGTAACGGGCCTCAGCATCATCACGACGAAAGACCAAGACCCTGTCACCAAGGGCGTGCCCATTTTTGGTGTCGACATGTGGGAACACGCGTACTA Colletotrichum_sublineolum_S3001 CACCAAGCATACGTTACAAATCTGAACAAAGCCATCGAGGCTTACAATGCAAACCCCCTCCAAAACCGCATCGCCGTCCTTGCGGCCCTCAACTTCAATGGAGGCGGCCACATCAACCACTCCCTCTTCTGGGAGAACCTGTCCCCAGCCTCGAGCCCAGATGCCTCGCCCGATGCGGCGCCCAAGCTCGTCGCTGAGATCACCCGCGTCTGGGGCGGGCTCGACCAGTTCAAGCAGGCTTTCAACGCCACACTGCTGGGTATCACCGGCAGCGGCTGGGGATGGCTGGTCAAGGACGACGTAACGGGCCTCAGCATCATCACGACGAAAGACCAAGACCCTGTCACCAAGGGCGTGCCCATTTTTGGTGTCGACATGTGGGAACACGCGTACTA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = SOD2) = N: 1-395; CODONPOSSET CodonPositions (CHARACTERS = SOD2) = N: 1-395; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4717] TITLE rDNA_ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=561; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Colletotrichum_caudatum_MAFF238574 GAGTTACCGCTCTATAACCCTTTGTGAACATACCTT--ACTGTTGCTTCGGCGGGTTGGGGGACTCCGTC-----------CCCCCCCGGCCGCGCCCCTCGC---------GGGGCGTGGCGCCCGCCG----------------GAGGATACCAAAACTCTAT-----------------TTTAACGACGTCTCTTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCCGCTTGGTGTTGGGGCCCTACGGT---GGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTA-ACGTCTCGCATCGGGATCCGGAGGGACT-CCTGCCGTAAAACCCCC-AACTTCTTA-CTGGTTGACCTCGAATCAGGTA Colletotrichum_cereale_NJ4990 GAGTTACCGCTCTACAACCCTTTGTGAACATACCTA--ACTGTTGCTTCGGCGGGC-AGGGGGTCCCCTC----GGGGACGCCCTCCCGGCCGCGGCCCCC--CC-----GGGGGACGTGGCGCCCGCCGCCCGGCCCCGCCCCCCGAGGATA-CCTAACTCTAT-----------------TTTAACGACGTTTCTTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCCGCTTGGTGTTGGGGCCCTACGGT---GGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTA-ACGTCTCGCATCGGGATCCGGAGGGACTACTTGCCGTAAAACCCCC-AATTTTTCAA-TGGTTGACCTCGGATCAGGTA Colletotrichum_cereale_NJ6795 GAGTTACCGCTCTACAACCCTTTG-GAACATACCTA--ACTGTTGCTTCGGCGGGC-AGGGGGTCCCCCC----GGGGACGCCCTCCCGGCCCCGCCCCCCTACC-----AGGGGACGTGGCGCCCGCCGCCCGGCCCCGCCCCCCGAGGATA-CCCAACTCTAT-----------------TTTAACGACGTTTCTTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCCCTACGGT---TGACGTAGGCCCTCAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTA-ACGTCTCGCATCGGGATCCGGAGGGACT-CTTGC-GTAAAACCCCCCAATTTTTCAA-TGGCTGACCTCCGATCAGGTA Colletotrichum_echinochloae_MAFF511152 GAGTTACCGCTCTATAACCCTTTGTGAACATACCTG--ACCGTTGCTTCGGCGGGTTAGGGCGCCCCCCC----GGGGACGCCCCCCCGGCCGCGCCCCACCC---------GGGGCGGGGCGCCCGCCG----------------GAGGATAACCAAACTCTGT-----------------TTTAACGACGTTTCCTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCGGCTTGGTGTTGGGGCCCTACGGT---CGACGTAGGCCCTTAAAGATAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTA-ACGTCTCGCATCGGGATCCGGAGGGACT-CCTGCCGTAAAACCCCC-ATCTTTTTA-CTGGTTGACCTCGGATCAGGTA Colletotrichum_echinochloae_MAFF511328 GAGTTACCGCTCTATAACCCTTTGTGAACATACCTA--ACCGTTGCTTCGGCGGGTTAGGGCGCCCCCCC----GGGGACGCCCTCCCGGCCGCGCCCCACCC---------GGGGCGGGGCGCCCGCCG----------------GAGGATAACCAAACTCTGT-----------------TTTAACGACGTTTCCTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCGGCTTGGTGTTGGGGCCCTACGGT---CGACGTAGGCCCTTAAAGATAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTA-ACGTCTCGCATCGGGATCCGGAGGGACT-CCTGCCGTAAAACCCCC-ATCTTTTTA-CTGGTTGACCTCGGATCAGGTA Colletotrichum_echinochloae_MAFF511471 GAGTTACCGCTCTATAACCCTTTGTGAACATACCTA--ACCGTTGCTTCGGCGGGTTAGGGCGCCCCCCC----GGGGACGCCCTCCCGGCCGCGCCCCACCC---------GGGGCGGGGCGCCCGCCG----------------GAGGATAACCAAACTCTGT-----------------TTTAACGACGTTTCCTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCGGCTTGGTGTTGGGGCCCTACGGT---CGACGTAGGCCCTTAAAGATAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTA-ACGTCTCGCATCGGGATCCGGAGGGACT-CCTGCCGTAAAACCCCC-ATCTTTTTA-CTGGTTGACCTCGGATCAGGTA Colletotrichum_echinochloae_MAFF511472 GAGTTACCGCTCTATAACCCTTTGTGAACATACCTA--ACCGTTGCTTCGGCGGGTTAGGGCGCCCCCCC----GGGGACGCCCTCCCGGCCGCGCCCCACCC---------GGGGCGGGGCGCCCGCCG----------------GAGGATAACCAAACTCTGT-----------------TTTAACGACGTTTCCTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATAGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCGGCTTGGTGTTGGGGCCCTACGGT---CGACGTAGGCCCTTAAAGATAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTA-ACGTCTCGCATCGGGATCCGGAGGGACT-CCTGCCGTAAAACCCCC-ATCTTTTTA-CTGGTTGACCTCGGATCAGGTA Colletotrichum_echinochloae_MAFF511473 GAGTTACCGCTCTATAACCCTTTGTGAACATACCTA--ACCGTTGCTTCGGCGGGTTAGGGCGCCCCCCC----GGGGACGCCCTCCCGGCCGCGCCCCACCC---------GGGGCGGGGCGCCCGCCG----------------GAGGATAACCAAACTCTGT-----------------TTTAACGACGTTTCCTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATAGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCGGCTTGGTGTTGGGGCCCTACGGT---CGACGTAGGCCCTTAAAGATAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTA-ACGTCTCGCATCGGGATCCGGAGGGACT-CCTGCCGTAAAACCCCC-ATCTTTTTA-CTGGTTGACCTCGGATCAGGTA Colletotrichum_falcatum_MAFF306170 GAGTTACCGCTCTTCAACCCTTTGTGAACATACCCA--ACTGTTGCTTCGGCGGGTCGGGGCGCCCTCCC----GGGGGCGCCCCCCAGGCCCGGTCCCGCTC---------GGGGCCGAGCGCCCGCCG----------------GAGGATCACCCAACTCTAT-----------------TTTAACGACGTTTCTTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTCGCTTGGTGTTGGGGCACTACGGT---CGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTA-ACGTCTCGCATCGGGATCCGGAGGGACT-CCTGCCGTAAAACCCCC-ACACTTTTT-CTGGTTGACCTCGGATCAGGTA Colletotrichum_gloeosporioides_MAFF239930 GAGTTTACGCTCTACAACCCTTTGTGAACATACCTATAACTGTTGCTTCGGCGGGT---AGGGTCTCCGT---------GACCCTCCCGGCCTCCCGCCCCCG--------GGCGGGTCGGCGCCCGCCG----------------GAGGATAACCAAACTCTGA-----------------TTTAACGACGTTTCTTCTGAGTGGTACAAGCAAATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCCCTACAGC---TGATGTAGGCCCTCAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTTTACGTCTCGCACTGGGATCCGGAGGGACT-CTTGCCGTAAAACCCCCCAATTTTCCAA-AGGTTGACCTCGGATCAGGTA Colletotrichum_gloeosporioides_MAFF239933 GAGTTTACGCTCTACAACCCTTTGTGAACATACCTATAACTGTTGCTTCGGCGGGT---AGGGTCTCCGT---------GACCCTCCCGGCCTCCCGCCCCCG--------GGCGGGTCGGCGCCCGCCG----------------GAGGATAACCAAACTCTGA-----------------TTTAACGACGTTTCTTCTGAGTGGTACAAGCAAATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCCCTACAGC---TGATGTAGGCCCTCAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTTTACGTCTCGCACTGGGATCCGGAGGGACT-CTTGCCGTAAAACCCCCCAATTTTCCAA-AGGTTGACCTCGGATCAGGTA Colletotrichum_graminicola_ATCC26416 GAGTTACCGCTCTATAACCCTTTGTGAACATACCTA--ACCGTTGCTTCGGCGGGTTAGGGGGTCCCCTCTCCGGGGGACGCCCTCCCGGCCGGGCCCCACTGC--------GGGGCTCGGCGCCCGCCG----------------GAGGATAACCAAACTCTGA-----------------TTTAACGACGTCTCTTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCCGCTTGGTGTTGGGGCCCTACGGCGTACGTCGTAGGCCCTTAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTA-ACGTCTCGCATCGGGATCCGGAGGGACT-CTTGCCGTAAAACCCCC-AACTTTTTAACTGGTTGACCTCGGATCAGGTA Colletotrichum_graminicola_MO100178 GAGTTACCGCTCTATAACCCTTTG-GAACATACCTA--ACCGTTGCTTCGGCGGGTTAGGGGGTCCCCTCTCCGGGGGACGCCCTCCCGGCCGGGCCCCACTGC--------GGGGCTCGGCGCCCGCCGCCCGGCCGCGCCCTCCGAGGATAACCAAACTCTGA-----------------TTTAACGACGTCTCTTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCCGCTTGGTGTTGGGGCCCTACGGCGTACGTCGTAGGCCCTTAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTA-ACGTCTCGCATCGGGATCCGGAGGGACT-CTTGCCGTAAAACCCCC-AACTTTTTAACTGGTTGACCTCGGATCAGGTA Colletotrichum_sublineolum_MAFF511474 GAGTTACCGCTCTATAACCCTTTGTGAACATACCTA--ACTGTTGCTTCGGCGGGTTAGGGGGTCCCCCC----GGGGACGCCCTCCCGGCCGCGCCCTCCTCCTCCGGGAGGGGTCGCGGCGCCCGCCG----------------GAGGATAACCAAACTCTGA-----------------TTTAACGACGTTTCTTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTTCGCTTGGTGTTGGGGCACTACGGT---TGACGTAGGCCCTCAAAAGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTA-ACGTCTCGCATCGGGATCCGGAGGGACT-CTTGCCGTAAAACCCCCTAACTTTT-AACTGGTTGACCTCGGATCAGGTA Colletotrichum_sublineolum_S3001 GAGTTACCGCTCTATAACCCTTTGTGAACATACCTA--ACTGTTGCTTCGGCGGGTTAGGGGGTCCCCCC----GGGGACGCCCTCCCGGCCGCGCCCTCCTCCTCCGGGAGGGGTCGCGGCGCCCGCCG----------------GAGGATAACCAAACTCTGAGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTTCGCTTGGTGTTGGGGCACTACGGT---TGACGTAGGCCCTCAAAAGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTA-ACGTCTCGCATCGGGATCCGGAGGGACT-CTTGCCGTAAAACCCCCTAACTTTT-AACTGGTTGACCTCGGATCAGGTA ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = rDNA_ITS) = N: 1-561; CODONPOSSET * CodonPositions (CHARACTERS = rDNA_ITS) = N: 1-561; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4657] TITLE HMG; LINK TAXA = Taxa1; DIMENSIONS NCHAR=230; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230] [ . . . . . . . . . . . . . . . . . . . . . . .] Colletotrichum_caudatum_MAFF238574 ATTCTCTACCGCAAGGATCGTCAAGCGCAAGTCAAGCAGATGGATCCTCAGATTCAGAACAAAGGCATCTGTGAGGCTACAAGCATAACA----CCCTGCGACTTCCC-TTCGCTGACA-TTT-ACACAGCGCAGCTTCTGGGCAAGGCCTGGAATGCCGAGTCCCACGAGGTCCGCGAAAAATATAGGGCACTCGCAAAAGCATACAAAGAGCGCCATAA--CAAACTG Colletotrichum_cereale_NJ4990 AATCTCTACCGCAAGGATCGCCAAGCGCATGTCAAGCAGATGGATCCTCAGATCCAGAACAAAGGCATCTGTGAGTTTTCAAGCATGGCT----TCCTTCAACTCCCC-ATCACTGACC-TTT-GCATAGCGCGGATTCTGGGTAAAGCCTGGAATGCCGAGTCCCACGAGGTTCGAGAAAAATACAGGGCACTCGCAAAAGCATACAAAGAGCGCCATAA--CAAACTG Colletotrichum_cereale_NJ6795 AATCTCTACCGCAAGGATCGCCAAGCGCATGTCAAGCAGATGGATCCTCAGATCCAGAACAAAGGCATCTGTGAGTTTACAAGCATGGCG----TCCTTCAACTCCCC-ATCACTGACC-TTT-GCATAGCGCGGATCCTGGGTAAAGCCTGGAATGCCGAGTCCCACGAGGTTCGAGAAAAGTACAGGGCACTCGCAAAAGCATACAAAGAGCGCCATAA--CAAACTG Colletotrichum_echinochloae_MAFF511152 ATTCTCTACCGCAAGGATCGTCAAGCGCACGTCAAGCTTATGGATCCTCAGATCCAGAACAAAGGCATCTGTGAGTTTACGAGCATGACT----TACTTCAACTTCCC-ATCGCTGACC-TTT-GCGCAGCACAACTTCTAGGCAAAGCCTGGAACGCCGAGTCCCACGAGGTTCGGGAAAAATATAGGGCACTCGCAAAAGCGTACAAAGAGCGCCATAA--CAAACTG Colletotrichum_echinochloae_MAFF511328 ATTCTCTACCGCAAGGATCGTCAAGCGCACGTCAAGCTTATGGATCCTCAGATCCAGAACAAAGGCATCTGTGAGTTTACGAGCATGACT----TACTTCAACTTCCC-ATCGCTGACC-TTT-GCGCAGCACAACTTCTAGGCAAAGCCTGGAACGCCGAGTCCCACGAGGTTCGGGAAAAATATAGGGCACTCGCAAAAGCGTACAAAGAGCGCCATAA--CAAACTG Colletotrichum_echinochloae_MAFF511471 ATTCTCTACCGCAAGGACCGTCAAGCGCACGTCAAGCTTATGGATCCTCAGATCCAGAACAAAGGCATCTGTGAGTTTACGAGCATGACT----TACTTCAACTTCCC-ATCGCTGACC-TTT-GCGCAGCACAACTTCTAGGCAAAGCCTGGAACGCCGAGTCCCACGAGGTTCGGGAAAAATATAGGGCACTCGCAAAAGCGTACAAAGAGCGCCATAA--CAAACTG Colletotrichum_echinochloae_MAFF511472 ATTCTCTACCGCAAGGACCGTCAAGCGCACGTCAAGCTTATGGATCCTCAGATCCAGAACAAAGGCATCTGTGAGTTTACGAGCATGACT----TACTTCAACTTCCC-ATCGCTGACC-TTT-GCGCAGCACAACTTCTAGGCAAAGCCTGGAACGCCGAGTCCCACGAGGTTCGGGAAAAATATAGGGCACTCGCAAAAGCGTACAAAGAGCGCCATAA--CAAACTG Colletotrichum_echinochloae_MAFF511473 ATTCTCTACCGCAAGGACCGTCAAGCGCACGTCAAGCTTATGGATCCTCAGATCCAGAACAAAGGCATCTGTGAGTTTACGAGCATGACT----TACTTCAACTTCCC-ATCGCTGACC-TTT-GCGCAGCACAACTTCTAGGCAAAGCCTGGAACGCCGAGTCCCACGAGGTTCGGGAAAAATATAGGGCACTCGCAAAAGCGTACAAAGAGCGCCATAA--CAAACTG Colletotrichum_falcatum_MAFF306170 ATTCTCTACCGCAAGGATCGCCAAGCACACGTCAAGCAGATGGATCCTCAGATCCAGAACAAAGGCATCTGTGAGTTTACAAGCTTGACTCACTTCCTTCGACCCCCC-TTTGCTGACT-TTTTGCACAGCACAGCTTCTGGGCAAGGCCTGGAATGCCGAGTCTCACGAGGTTAGGGAAAAGTATAGGGCACTCGCAAAGGCGTACAAGGAGCGCCATAA--CAAACTG Colletotrichum_gloeosporioides_MAFF239930 ATTCTCTACCGCAAAGATCGCCATGCCACCATGAAGCAGGAAAACAGTCACCTAAGCAACAACGATATTTGTGAGTACTTTGACTTGGTT----CCCCTCGGGG-ACA-GGCGCTAACC-AAC--AATAGCCATTAGCTTAGGCAAGAAATGGAACAGCGAATCACCAGCCGTGCGCCAGAAATATACCGAACTTGCAAAGATGCACAAGGAGCGCCTCTT--GATGATG Colletotrichum_gloeosporioides_MAFF239933 ATTCTCTACCGCAAAGATCGCCATGCCACCATGAAGCAGGAAAACAGTCACCTAAGCAACAACGATATTTGTGAGTACTTTGACTTGGTT----CCCCTCGGGG-ACA-GGCGCTAACC-AAC--AATAGCCATTAGCTTAGGCAAGAAATGGAACAGCGAATCACCAGCCGTGCGCCAGAAATATACCGAACTTGCAAAGATGCACAAGGAGCGCCTCTT--GATGATG Colletotrichum_graminicola_ATCC26416 ATTCTCTACCGCAAGGATCGCCAAGCGCATGTCAAGCAGATGGATCCTCAGATTCAGAACAAAGGCATCTGTGAGTTTGCAAGCATAGCT----TCCTTCGACTTCCC-ATCGCTGACCCTTT--CACAGCGCAGCTTCTGGGTAAAGCCTGGAATGCTGAGTCCCATGAGGTTCGGGAAAAATACAGGGCACTCGCAAAAGCGTACAAAGAGCGCCATAATACAAACTG Colletotrichum_graminicola_MO100178 ATTCTCTACCGCAAGGATCGCCAAGCGCATGTCAAGCAGATGGATCCTCAGATTCAGAACAAAGGCATCTGTGAGTTTGCAAGCATAGCT----TCCTTCGACTTCCC-ATCGCTGACCCTTT--CACAGCGCAGCTTCTGGGTAAAGCCTGGAATGCTGAGTCCCATGAGGTTCGGGAAAAATACAGGGCACTCGCAAAAGCGTACAAAGAGCACCATAA--CAAACTG Colletotrichum_sublineolum_MAFF511474 AATCTCTACCGCAAGGATCGCCAAGCGCAAGTCAAGCAGATGGATCCTCAGATCCAGAACAAAGGTATCTGTGAGTATACAAGCATGACT----TCCTGCGACTTCCCCATCGCTGACC-TTT-GCACAGCGCAACTTCTGGGTAAAGCATGGAATGCCGAGTCCCACGAGGTTCGGGAAAAATATAGGGCACTCGCAAAAGCGTATAAAGAGCGCCATAA--CAAACTG Colletotrichum_sublineolum_S3001 AATCTCTACCGCAAGGATCGCCAAGCGCAAGTCAAGCAGATGGATCCTCAGATCCAGAACAAAGGTATCTGTGAGTATACAAGCATGACT----TCCTGCGACTTCCCCGTCGCTGACC-TTT-GCACAGCGCAACTTCTGGGTAAAGCATGGAATGCCGAGTCCCACGAGGTTCGGGAAAAATATAGGGCACTCGCAAAAGCGTATAAAGAGCGCCATAA--CAAACTG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = HMG) = N: 1-230; CODONPOSSET CodonPositions (CHARACTERS = HMG) = N: 1-230; END; BEGIN TREES; TITLE Tb10640; LINK TAXA = Taxa1; TRANSLATE 1 Colletotrichum_echinochloae_MAFF511152, 2 Colletotrichum_echinochloae_MAFF511328, 3 Colletotrichum_echinochloae_MAFF511471, 4 Colletotrichum_echinochloae_MAFF511472, 5 Colletotrichum_echinochloae_MAFF511473, 6 Colletotrichum_graminicola_MO100178, 7 Colletotrichum_graminicola_ATCC26416, 8 Colletotrichum_sublineolum_MAFF511474, 9 Colletotrichum_sublineolum_S3001, 10 Colletotrichum_falcatum_MAFF306170, 11 Colletotrichum_caudatum_MAFF238574, 12 Colletotrichum_cereale_NJ6795, 13 Colletotrichum_cereale_NJ4990, 14 Colletotrichum_gloeosporioides_MAFF239930, 15 Colletotrichum_gloeosporioides_MAFF239933; TREE Fig._4 = [&R] (((((1,2,(3,4,5)),(((6,7),(12,13)),(8,9))),11),10),(14,15)); END; BEGIN TREES; TITLE Tb10639; LINK TAXA = Taxa1; TRANSLATE 1 Colletotrichum_echinochloae_MAFF511152, 2 Colletotrichum_echinochloae_MAFF511328, 3 Colletotrichum_echinochloae_MAFF511471, 4 Colletotrichum_echinochloae_MAFF511472, 5 Colletotrichum_echinochloae_MAFF511473, 6 Colletotrichum_graminicola_MO100178, 7 Colletotrichum_graminicola_ATCC26416, 8 Colletotrichum_sublineolum_MAFF511474, 9 Colletotrichum_sublineolum_S3001, 10 Colletotrichum_falcatum_MAFF306170, 11 Colletotrichum_caudatum_MAFF238574, 12 Colletotrichum_cereale_NJ6795, 13 Colletotrichum_cereale_NJ4990, 14 Colletotrichum_gloeosporioides_MAFF239930, 15 Colletotrichum_gloeosporioides_MAFF239933; TREE Fig._3 = [&R] (((((((1,(2,3,(4,5))),10),11),(6,7)),(8,9)),(12,13)),(14,15)); END; BEGIN TREES; TITLE Tb10641; LINK TAXA = Taxa1; TRANSLATE 1 Colletotrichum_echinochloae_MAFF511152, 2 Colletotrichum_echinochloae_MAFF511328, 3 Colletotrichum_echinochloae_MAFF511471, 4 Colletotrichum_echinochloae_MAFF511472, 5 Colletotrichum_echinochloae_MAFF511473, 6 Colletotrichum_graminicola_MO100178, 7 Colletotrichum_graminicola_ATCC26416, 8 Colletotrichum_sublineolum_MAFF511474, 9 Colletotrichum_sublineolum_S3001, 10 Colletotrichum_falcatum_MAFF306170, 11 Colletotrichum_caudatum_MAFF238574, 12 Colletotrichum_cereale_NJ6795, 13 Colletotrichum_cereale_NJ4990, 14 Colletotrichum_gloeosporioides_MAFF239930, 15 Colletotrichum_gloeosporioides_MAFF239933; TREE Fig._5 = [&R] ((((1,(2,3,4,5)),((((6,7),11),(8,9)),(12,13))),10),(14,15)); END;