#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 18:22 GMT TreeBASE (cc) 1994-2008 Study reference: P├Ątsch R., Hentschel J., Linares-palomino R., Zhu R., & Heinrichs J. 2010. Diversification and taxonomy of the liverwort Jubula Dumort. (Jungermanniopsida: Porellales) inferred from nuclear and chloroplast DNA sequences. American Journal of Botany, 35(1): 6-12. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10110] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=30; TAXLABELS Jubula_hutchinsiae_bogotensis_Costa_Rica Jubula_hutchinsiae_bogotensis_Mexico1 Jubula_hutchinsiae_bogotensis_Mexico2 Jubula_hutchinsiae_bogotensis_Peru Jubula_hutchinsiae_hutchinsiae_British_Isles1 Jubula_hutchinsiae_hutchinsiae_British_Isles2 Jubula_hutchinsiae_hutchinsiae_Madeira1 Jubula_hutchinsiae_hutchinsiae_Madeira2 Jubula_hutchinsiae_hutchinsiae_Madeira3 Jubula_hutchinsiae_japonica_Japan1 Jubula_hutchinsiae_japonica_Japan2 Jubula_hutchinsiae_javanica_China1 Jubula_hutchinsiae_javanica_China2 Jubula_hutchinsiae_javanica_China3 Jubula_hutchinsiae_javanica_China4 Jubula_hutchinsiae_javanica_China5 Jubula_hutchinsiae_javanica_Malaysia1 Jubula_hutchinsiae_javanica_Malaysia2 Jubula_hutchinsiae_javanica_Vietnam1 Jubula_hutchinsiae_javanica_Vietnam2 Jubula_hutchinsiae_pennsylvanica_USA1 Jubula_hutchinsiae_pennsylvanica_USA2 Jubula_hutchinsiae_pennsylvanica_USA3 Jubula_hutchinsiae_pennsylvanica_USA4 Jubula_hutchinsiae_pennsylvanica_USA5 Jubula_hutchinsiae_pennsylvanica_USA6 Jubula_hutchinsiae_pennsylvanica_USA7 Jubula_hutchinsiae_pennsylvanica_USA8 Nipponolejeunea_pilifera Nipponolejeunea_subalpina ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=30; TAXLABELS Jubula_hutchinsiae_bogotensis_Costa_Rica Jubula_hutchinsiae_bogotensis_Mexico1 Jubula_hutchinsiae_bogotensis_Mexico2 Jubula_hutchinsiae_bogotensis_Peru Jubula_hutchinsiae_hutchinsiae_British_Isles1 Jubula_hutchinsiae_hutchinsiae_British_Isles2 Jubula_hutchinsiae_hutchinsiae_Madeira1 Jubula_hutchinsiae_hutchinsiae_Madeira2 Jubula_hutchinsiae_hutchinsiae_Madeira3 Jubula_hutchinsiae_japonica_Japan1 Jubula_hutchinsiae_japonica_Japan2 Jubula_hutchinsiae_javanica_China1 Jubula_hutchinsiae_javanica_China2 Jubula_hutchinsiae_javanica_China3 Jubula_hutchinsiae_javanica_China4 Jubula_hutchinsiae_javanica_China5 Jubula_hutchinsiae_javanica_Malaysia1 Jubula_hutchinsiae_javanica_Malaysia2 Jubula_hutchinsiae_javanica_Vietnam1 Jubula_hutchinsiae_javanica_Vietnam2 Jubula_hutchinsiae_pennsylvanica_USA1 Jubula_hutchinsiae_pennsylvanica_USA2 Jubula_hutchinsiae_pennsylvanica_USA3 Jubula_hutchinsiae_pennsylvanica_USA4 Jubula_hutchinsiae_pennsylvanica_USA5 Jubula_hutchinsiae_pennsylvanica_USA6 Jubula_hutchinsiae_pennsylvanica_USA7 Jubula_hutchinsiae_pennsylvanica_USA8 Nipponolejeunea_pilifera Nipponolejeunea_subalpina ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4319] TITLE 'cpDNA trnL-F'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=477; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Jubula_hutchinsiae_bogotensis_Costa_Rica CTTAATTCTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTATTTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAA-CTATATTTGAAATAATAAAAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAAATTTTTCATTACAATTAGAAAAATAATAGTAGCA-GCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_bogotensis_Mexico1 CTTAATTCTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTATTTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAA-CTATATTTGAAATAATAAAAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAAATTTTTCATTACAATTAGAAAAATAATAGTAGCC-GCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_bogotensis_Mexico2 CTTAATTCTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTATTTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAA-CTATATTTGAAATAATAAAAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAAATTTTTCATTACAATTAGAAAAATAATAGTAGC???????????????????????????????????????????? Jubula_hutchinsiae_bogotensis_Peru ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Jubula_hutchinsiae_hutchinsiae_British_Isles1 CTTAATTTTTTGAGCTTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTTATTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAA-CTATATTTGAAATAATAAAAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAATTTTTTCATTACAATTAGAAAAATAATAGTAGCCGGCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_hutchinsiae_British_Isles2 CTTAATTTTTTGAGCTTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTTATTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAA-CTATATTTGAAATAATAAAAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAATTTTTTCATTACAATTAGAAAAATAATAGTAGCC-GCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_hutchinsiae_Madeira1 CTTAATTTTTTGAGCTTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTTATTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAA-CTATATTTGAAATAATAAAAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAATTTTTTCATTACAATTAGAAAAATAATAGTAGCCGGCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_hutchinsiae_Madeira2 CTTAATTTTTTGAGCTTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTTATTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAA-CTATATTTGAAATAATAAAAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAATTTTTTCATTACAATTAGAAAAATAATAGTAGCCGGCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_hutchinsiae_Madeira3 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Jubula_hutchinsiae_japonica_Japan1 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Jubula_hutchinsiae_japonica_Japan2 CTTAATTTTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTTTTTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTAATTACAAAAAAA--CTATATTTGAAATAATAAAAATATCTAATAATTATT---CATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAAATTTTTCATTACAATTAGAAAAATAATAGTAGCC-GCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_javanica_China1 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Jubula_hutchinsiae_javanica_China2 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Jubula_hutchinsiae_javanica_China3 CTTAATTTTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTTTTTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAA-CTATATTTGAAATAATAATAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAAATTTTTCATTACAATTAGAAAAATAATAGTAGCC-GCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_javanica_China4 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Jubula_hutchinsiae_javanica_China5 CTTAATTTTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCATATTCAGGGAAACCTAGGATTAATTTTATATATTAAGGTAATCCTGAGCCAAATTATTTATAAAATAGGTGCAGAGACTCGACGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAA-CTATATTTGAAATAATAATAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAAGATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAAATTTTTCATTACAATTAGAAAAATAATAGTAACC-GCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_javanica_Malaysia1 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Jubula_hutchinsiae_javanica_Malaysia2 CTTAATTTTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTATTTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAA-CTATATTTGAAATAATAATAATATCTAATAATTATTATTCATTTTTCAATTCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAAAATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAGATTTTTCATTACAATTAGAAAAATAATAGTAGCC-GCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_javanica_Vietnam1 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Jubula_hutchinsiae_javanica_Vietnam2 CTTAATTTTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGATTAATTTTATATATTAAGGTAATCCTGAGCCAAATTATTTATAAAATAGGTGCAGAGACTCGACGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAA-CTATATTTGAAATAATAATAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAAGATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAAATTTTTCATTACAATTAGAAAAATAATAGTAGCC-GCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_pennsylvanica_USA1 CTTAATTTTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTATTTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAAACTATATTTGAAATAATAAAAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAAATTTTTCATTACAATTAGAAAAATAATAGTAGCCGGCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_pennsylvanica_USA2 CTTAATTTTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTATTTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAAACTATATTTGAAATAATAAAAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAAATTTTTCATTACAATTAGAAAAATAATAGTAGCCGGCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_pennsylvanica_USA3 CTTAATTTTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTATTTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAAACTATATTTGAAATAATAAAAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAAATTTTTCATTACAATTAGAAAAATAATAGTAGCC-GCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_pennsylvanica_USA4 CTTAATTTTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTATTTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAAACTATATTTGAAATAATAAAAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAAATTTTTCATTACAATTAGAAAAATAATAGTAGCCGGCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_pennsylvanica_USA5 CTTAATTTTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTATTTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAAACTATATTTGAAATAATAAAAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAAATTTTTCATTACAATTAGAAAAATAATAGTAGCCGGCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_pennsylvanica_USA6 CTTAATTTTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTATTTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAAACTATATTTGAAATAATAAAAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAAATTTTTCATTACAATTAGAAAAATAATAGTAGCCGGCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_pennsylvanica_USA7 CTTAATTTTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCACATTCAGGGAAACCTAGGGTTAATTTTATATATTAAGGTAATCCTGAGCCAAATTATTTATAAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTTTGTTTCATTACAAAAAAAAACTATATTTGAAATAATAAAAATATCTAATAATTATTATTCATTTTTCAATCCATAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTATTATATGTCATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTGAAAAAAAAAGATTAAAAAATTTTTCATTACAATTAGAAAAATAATAGTAGCC-GCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Jubula_hutchinsiae_pennsylvanica_USA8 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Nipponolejeunea_pilifera CTTAATTTTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCATATTCAGGGAAACCTAGGGTTGATTTTATATATTAAGGTAATCCTGAGCCAAA--TTTTTTTAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTAGAATTTTTTT-GTTTGACTACAAAAAAAAGCTATATTTGGAATAATAAAAATATCTAATAATTATTATTCATTTTTCAATACGTAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTAGTATATGTAATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTAGAAAAAAA-GATTGACAAAATTTTCATTGCAGTTAGAGAAATGAAAGTAGCCGGCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT Nipponolejeunea_subalpina CTTAATTTTTTGAGCCTTAGTAGAGAAATCAACTAAGTGATTGTTTCCATATTCAGGGAAACCTAGGGTTGATTTTATATATTAAGGTAATCCTGAGCCAAA-TTTTTTTTAAATAGGTGCAGAGACTCGAAGGAAACTATCCTAACGAAAAATTTTTTCGGTATTAATCAGTATAATTTTTTT-GTTTGACTACAAAAAAAAGCTATATTTGGAATAATAAAAATACCTAATAATTATTATTCATTTTTCAATACGTAATTATAGACGAGGATAAAGGGAGAGTCCTTTTTTACAAATATATATTTTAATATATGTAATTGTAAAAAGAAAATCCGTTGGCTTTATAGACCTTGAGGGTTCAAGTCCCTCTACCCCCATTAGAAAAAAAAGATTGACAAAATTTTCATTGCAGTTAGAGAAATGAAAATAGCC-GCCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCT ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = 'cpDNA trnL-F') = N: 1-477; CODONPOSSET * CodonPositions (CHARACTERS = 'cpDNA trnL-F') = N: 1-477; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4420] TITLE nrDNA_ITS_region; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1053; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Jubula_hutchinsiae_bogotensis_Costa_Rica ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCGGGGGGCGAATTGGATGCGAGTGGAATTGGCCAGTCCGGGGGCACCCGACGGAAAACCCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTCGGGAGGGTCGCGAGAAGGTGGTCCGTACTCCAGAGGAGGGGGCGGACGATCCGAATCGGAGCGATCCTCCCGTCGTCCGCTCTATGGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_bogotensis_Mexico1 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGGAAAAACCCAGCGAACTGTTGTCGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGTTGCCCGATGTCCTTCGGGGCCCGCCGTCCTCCGCTCGTATTGAGAGCGTCGAGGACGTCGCGCGGATATCCGTGTCGGCGTTGCGCGGCACGAGTTTGGCTCGCCGTCGTCGGGGAGTTCTCAGCATGGCGTCGCGGTCGTGTCCGGACCCTCGGGAAGCGTTCCAAGGAGCCTCGCCCTTTCGTCCGGAGGTG-TCGCGGTCGGGGGCTTCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGGATCGGTGCCGC---TTTTTTTTCTTCTTCCAAAACGTCGGAAATCCAAAACCAATTGCGGCTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAGCCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCGGGGGGCGAATTGGATGCGAGTGGAATTGGCCAGTCCGGGGGCACCCGATGGAAAACTCGATCGAGGACGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTTGGGAGGGTCGCGAGAAGGTAGTCCGTACTCCAAAGGAGGGGGCGGATGATCCGAATCGGAGCGATCCTCCCGTCGTCCGCTCTATCGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_bogotensis_Mexico2 ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TC-AAAAC-TCGGAA-TCCAAA-CCAA-TGCGGCTCTCTCC-TTTCGGGAGTGCGTC-GTCGCGCTCCGAAA-GATGAAAGCCAAAACGGCTCTCAGCAACGGATATCTTG-CTCTTGCAACGATGAAAAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTTCGGCTCAAACCACCCACCCACAAAAATCCGGGGGGCGAATTGGATGCGAGTGGAATTGGCCAGTCCGGGGGCACCCGATGGAAAACTCGATCGAGGACGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTTGGGAGGGTCGCGAGAAGGTAGTCCGTACTCCAAAGGAGGGGGCGGATGATCCGAATCGGAGCGATCCTCCCGTCGTCCGCTCTATCGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCAC??????????????????????????????????????????????????????????------------------------------ Jubula_hutchinsiae_bogotensis_Peru ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CAACGATGAAGAACGCAGCGAAATGCGATAC-TAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCGGGGGGCGAATTGGATGCGAGTGGAATTGGCCAGTCCGGGGGCACCCGACGGAAAACCCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTCGGGAGGGTCGCGAGAAGGTGGTCCGTACTCCAAAGGAGGGGGCGGACGATCCGAATCGGAGCGATCCTCCCGTCGTCCGCTCTATCGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_hutchinsiae_British_Isles1 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGAAAAAACCCAGCGAACTGTTGTCGTCCATCGAGGGATCGCACTCGGAGGTGCGGTTGGCGACGGCGTTGCCCGATGTCCTTCGGGGCTCGCCGTCCTCCGCTCGTATTGAGAGCGTCGAGGACGGTGTGCCGATATCCGTGTCGGCGTTGCGCGGCGCGAGTTTGGCTCGTCGTCGTCGGGGAGTTCTCACCATGGCGTCGCGGTCGTGTCCAGACACTCGGGAAGCGTTCCTAGGAGCCTCGCCGTTTTGTCCGGAGGTG-TCGCGGTCGGGGGCTCCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGGACCGGTGCCAC-----TTTTTTTTTTTTCCAAAACGTCGGAAATCCAAAACCAAATGCGGGTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCCGGGGGCGAATTGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAAACTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTCGGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAAGGAGGGGGCGGACTATCCGAATCGGAGCGATCCTACCGTCGTCCGCTCTATGGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACAGTTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_hutchinsiae_British_Isles2 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGAAAAAACCCAGCGAACTGTTGTCGTCCATCGAGGGATCGCACTCGGAGGTGCGGTTGGCGACGGCGTTGCCCGATGTCCTTCGGGGCTCGCCGTCCTCCGCTCGTATTGAGAGCGTCGAGGACGGTGTGCCGATATCCGTGTCGGCGTTGCGCGGCGCGAGTTTGGCTCGTCGTCGTCGGGGAGTTCTCACCATGGCGTCGCGGTCGTGTCCAGACACTCGGGAAGCGTTCCTAGGAGCCTCGCCGTTTTGTCCGGAGGTG-TCGCGGTCGGGGGCTCCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGGACCGGTGCCAC------TTTTTTTTTTTCCAAAACGTCGGAAATCCAAAACCAAATGCGGGTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCCGGGGGCGAATTGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAAACTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTCGGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAAGGAGGGGGCGGACTATCCGAATCGGAGCGATCCTACCGTCGTCCGCTCTATGGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACAGTTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_hutchinsiae_Madeira1 ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTCGGAAATCCAAAACCAAATGCGGGTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCCGGGGGCGAATTGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAAACTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTCGGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAAGGAGGGGGCGGACTATCCGAATCGGAGCGATCCTACCGTCGTCCGCTCTATGGAAGGCGAAG-----GGAGTCCCGCCGCGAGGCGGGACGCACAGTTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_hutchinsiae_Madeira2 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ACGTCGGAAATCCAAAACCAAATGCGGGTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCCGGGGGCGAATTGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAAACTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTCGGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAAGGAGGGGGCGGACTATCCGAATCGGAGCGATCCTACCGTCGTCCGCTCTATGGAAGGCGAAG-----GGAGTCCCGCCGCGAGGCGGGACGCACAGTTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_hutchinsiae_Madeira3 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCCGGGGGCGAATTGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAAACTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTCGGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAAGGAGGGGGCGGACTATCCGAATCGGAGCGATCCTACCGTCGTCCGCTCTATGGAAGGCGAAG-----GGAGTCCCGCCGCGAGGCGGGACGCACAGTTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_japonica_Japan1 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGAAAAAACCCAGCGAACCGTTGTCGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGTTGCCCGATGTCCTTCAGGGCTCACCGTCCTCCGCTCGTATTGAGAGCGTTGAGGACGGCGCGCCGATATCCGTGTCGGCGTTGCGTGGCACGAGTCTGGCTCGCCGTCGTCGGGGAGTTCTCACCAGAGCGTCGCGGTCGTGTCCGGGCCCTAGGGAAGCGTTCCAAGGAGCCTCGCCCTTTTGTCCGGGGGTG-TCGCGGTCGGGGGCTTCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGGATCGGTGCCGC--TTTTTTTTTCCTCTTCGAAAACGTCGGAAATCCAAAACCAATTGCGGCTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCTGGGGGCGAATTGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAAACTCGGTCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTCAGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAAGGAGGGGGCGGACGATCCGAATCGGAGCGATCCTCCCGTCGTCCGCTCTACGGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_japonica_Japan2 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGAAAAAACCCAGCGAACCGTTGTCGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGTTGCCCGATGTCCTTCAGGGCTCACCGTCCTCCGCTCGTATTGAGAGCGTCGAGGACGGCGCGCCGATATCCGTGTCGGCGTTGCGTGGCACGAGTCTGGCTCGCCGTCGTCGGGGAGTTCTCACCAGAGCGTCGCGGTCGTGTCCGGGCCCTAGGGAAGCGTTCCAAGGAGCCTCGCCCTTTTGTCCGGAGGTG-TCGCGGTCGGGGGCTTCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGGATCGGTGCCGC----TTTTTTTCCTCTTCGAAAACGTCGGAAATCCAAAACCAATTGCGGCTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCCGGGGGCGAATTGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAAACTCGGTCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTCGGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAAGGAGGGGGCGGACGATCCGAATCGGAGCGATCCTCCCGTCGTCCGCTCTACGGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_javanica_China1 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGAAAAAACCCAGCGAATTGTTGTCGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGCCGCCCGATATCCCTCGGGGCTCGTAATCCTCCGCTCGTATTGAGAGCGTCGAGGACGGCGCGCCGATATCCGTGTCGGCGTTGCGTGGCACGAGTTGGGCTCGCCGTCGTCGGGGAGTTCTCACCATCGCATCGTGGTCGTCTCCGGACACGCGG-AAGGGTTCCACGGAGCCTTGCC-TTTTGTCCGGAGGCG-TCG--GCCGGGGGCTTCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGAACCGGTGCCAC-------TTTTCTTTTTCCAAAACGTCGGAAATCCAAAAAGGAATTCGCCTCTCT----CTCGGGAGTCCGTCGGTCGCGCTCCGAAAAGACGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACGACCCTCCCGGGGGCGGATTGGATGCGGGTGGAATTGGCCAGTCCGGGGGTACCCGATG-AAAGCTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTGCCGGGAGGGTCGCGAGAAGGTAGT--GTCCTCCTTCGGA-GGGGCGGACGATCCGAATCGGAGCGATCCTCCCGTCGTCCGCCCTGCGGA-GGCGAAGGGAATGGAGTTCCGCCGCGAGGCGGGGCGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_javanica_China2 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGAAAAAACCCAGCGAATTGTTGTCGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGCCGCCCGATGTCCTTCGGGGCTCGTCATCGTCCGCTCGTACTGAGAGCGTCGAGGACGGCGCGCGGATATCCGTGTCGGCGTTGCGTGGCACGAGTTGGGCTCGCCGTCGTCGGGGAGTTCTCGCCATCGCATCGTGGTCGTCTCCGGACACGCGG-AAGGGTTCCACGGAGCCTTGCC-TTTTGTCCGGAGGCG-TCG--GCCGGGGGCTTCCCCC-TCCGCCGTCCCTGGAAGGCGTTCCCGTTGGAGGAGCGTCTCGATGGGACCGGTGCCGC-------TTTTTATCTTCCAAAACGTCGGAAATCCAAAAAACGATGCGGCTCTCTC--TCTCGGGAGTCCGCCGGTCGCGCTCCGAAAAGACGAAAACCGAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACGACCCTCCCGGGGGCGGATTGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATG-AAATCTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTGCCGGGAGGGTCGCGAGAAGGTGATCC--CCTCCAGAGGA-GGGGCGGACGATCCGAATCGGAGCGATCCTCCCGTCGTCCACTCTGCGGA-GGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGGCGCACAGGTATTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_javanica_China3 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGAAAAAACCCAGCGAACTGTTGTCGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGTTGCCCGATGTCCTTCGGGGCTCGCCGTCCTCCGCTCGTATTGAGAGCGTCGAGGACGGTGCGCCGATATCCGTGTCGGCGTTGCGTGACACGAGTTTGGCTCGCCGTCGTCGGGGAGTTCTCACCACAGCGTCGCGGCCGTGTCCGGACCCTCGGGAAGTGTTCCAAGGAGCCTCGCCCTTTCGTCCGGAGGTG-TCTCGGTCGGGGGCTTCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGCGGAGCGTCTCGATGGGATCGGTGCCAC--TTTTTTTCTTTTCTTCCAAAACGTCGGAAATCCAAAACCAATTGCTGCTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCCGGGGGCGAATTGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGACGGAAATCTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTCGGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAGGGAGGGGGCGGCCGATCCGAATCGGAGCGATCCTCCCGTCGTCCGCTCTATGGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCATAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_javanica_China4 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CGGCTCTCTCCCTCTCGGGAGTGCGTCGGTCACGCTCCGAAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCCGGGGGCGAATCGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAAGCTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTCGGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAAGGAGGGGGCGGCCGATCCGAATCGGAGCGATCTTCCCGTCGTCCGCTCTATGGAAGGCGAAGGGAATGGCATCCCGCCGCGAGGCGGGACGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_javanica_China5 ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCCGGGGGCGAATTGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAATCTCTATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTCGGGAGGGTCGCGAGAAGGTGGTCCGTCCTCCAAAGGAAGGGGCGGCCGATCCGAATCGGAGCGATCCTCCCGTCGTCCGCTCTATGGAAGGCGAAGGGAACGGAGTCCCGCCGCGAGGCGGGACGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_javanica_Malaysia1 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGAAAAAACCCAGCGAACTGTTGTAGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGTTGCCCGATGTCCTTGGGGGCTCGCCGTCCTCCGCTCGTATTGAGAGCGTCGAGGACGGTGCGCCGATATCCGTGTCGGCGTTGCGTGACACGAGTTTGGCTCGCCGTCGTCGGGGAGTTCTCACCATAGCGTCGCGGCCGTGTCCGGACCCTCGGGAAGCGTTCCAAGGAGCCTCGCCCTTTTGTCCGGAGGTG-TCGCGGTCGGGGGCTTCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGGATCGGTGCCAC----TTTTTTTCTTCTTCCAAAACGTCGGAAATCCAAAACCAATCGCGGCTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCAGGGGGCGAATCGGATGCGAGTGGAATTGGCCAGTCCGGGGATACCCGATGGAAACCTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTCGGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAAGGAGGGGGCGGCCGATCCGAATCGGAGCGATCTTCCCGTCGTCCGCTCCATGGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACTGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_javanica_Malaysia2 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGAAAAAACCCAGCGAACTGTTGTCGTCCATCGAGGGATCGCACTCGGAGGTGCGGTTGGCGACGGCGTTGCCCGATGTCATTCGGGGCTCGTCGTCCTCCGCTCGTATTGAGAGCGTCGAGGACGGTGCGCCGATATCCGTGTCGGCGTTGCGTGACACGAGTATGGCTCGCCGTCGTCGGGGAGTTCTCACCATAGCGTCGCGGCCGTGTCCGGACCCTCGGGAAGCGTTCCAAGGAGCCTCGCCCTTTTGTCCGGAGGTG-TCGCGGTCGGGGGCTTCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGGATCGGTGCCAC-TTTTTCTCGTCTCCTTCCAAAACGTCGGAAATCCAAAACCAATTGCGGCTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGGAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCCGGAGGCGAATTGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAATCTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTCGGGAGGGTCGCGAGAAGGTGGTCCGTCCTCCCAAGGAGGGGGCGGCCGATC-G-ATCGGAGCGATCTTCCCGTCGTCCGCTCTGTGGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACTCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_javanica_Vietnam1 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGAAAAAACCCAGCGAATCGTTGTCGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGTCGCCCGATGTCCTTCGGGGCTCGCCGTCCTCCGCTCGTATTGAGAGCGTCGAGGGCGGTGCGCCGATATCCGTGTCGGCGTTGCGTGACACGAGTTTGGCTCGCCGTCGTCGGGGAGTTCTCACCACAGCGTCGCGGCCGTGTCCGGACCCTCGGGAAGCGTTCCAAAGAGCCTCGCCCTTTTGTCCGGAGGTG-TCGCGGTCGGGGGCTTCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGGATCGGTGCCACTTTTCTTTCTTCTTCTTCCAAAACGTCGGAAATCCAAAACCAATTCCGGCTCTCTCTCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAGAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCCGGGGGCGAGTTGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAATCTCTATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTCGGGAGGGTCGCGAGAAGGTGGTCCGTCCTCCAAAGGAAGGGGCGGCCGATCCGAATCGGAGCGATCCTCCCGTGGTCCGCTCTATGGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_javanica_Vietnam2 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGAAAAAACCCAGCGAATCGTTGTCGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGTCGCCCGATGTCCTTCGGGGCTCGCCGTCCTCCGCTCGTATTGAGAGCGTCGAGGGCGGTGCGCCGATATCCGTGTCGGCGTTGCGTGACACGAGTTTGGCTCGCCGTCGTCGGGGAGTTCTCACCACAGCGTCGCGGCCGTGTCCGGACCCTCGGGAAGCGTTCCAAAGAGCCTCGCCCTTTTGTCCGGAGGTG-TCGCGGTCGGGGGCTTCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGGATCGGTGCCACTTTTCTTTCTTCTTCTTCCAAAACGTCGGAAATCCAAAACCAATTCCGGCTCTCTCTCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAGAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCCGGGGGCGAGTTGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAATCTCTATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTCGGGAGGGTCGCGAGAAGGTGGTCCGTCCTCC-AAGGAAGGGGCGGCCGATCCGAATCGGAGCGATCCTCCCGTGGTCCGCTCTATGGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_pennsylvanica_USA1 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGGAAAAACCCAGCGAACTGTTGTCGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGTTGCCCGATGTCCTTCGGGGCTCGCCGTCCTCCGCTCGTATTGAGAGCGTCGAGGACGGCGCGCCGATATCCGTGTCGGCGTTGCGCGGCACGAGTTTGGCTCGCCGTCGTCGGGGAGTTCTCACCATGGCGTCGCGGTCGTGTCCGGACCCTCGGGAAGCGTTCCAAGGAGCCTCGCCCTTTGGTCCGGAGGTG-TCGCGGTCGGGGGCTTCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGGATCGGTGCCAC-TTTTTTTCTTCTTCTTCCAAAACGTCGGAAATCCAAAACCAATTGCGGCTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCGGGGGGCGAATCGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAAACTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGGCCGTCGTGGAGCGTTTTGGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAAGGAGGGGGCGGACGATCCGAATCGGAGCGATCCTCCCGTCGTCCGCTCTATCGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_pennsylvanica_USA2 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGGAAAAACCCAGCGAACTGTTGTCGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGTTGCCCGATGTCCTTCGGGGCTCGCCGTCCTCCGCTCGTATTGAGAGCGTCGAGGACGGCGCGCCGATATCCGTGTCGGCGTTGCGCGGCACGAGTTTGGCTCGCCGTCGTCGGGGAGTTCTCACCATGGCGTCGCGGTCGTGTCCGGACCCTCGGGAAGCGTTCCAAGGAGCCTCGCCCTTTGGTCCGGAGGTG-TCGCGGTCGGGGGCTTCCCCC-TCCGCCGTTCCTGGAAGGCGTTCTCGTTCGAGGAGCGTCTCGATGGGATCGGTGCCAC-TTTTTTTTTTCTTCTTCCAAAACGTCGGAAATCCAAAACCAATTGCGGCTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCGGGGGGCGAATCGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAAACTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGGCCGTCGTGGAGCGTTTTGGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAAGGAGGGGGCGGACGATCCGAATCGGAGCGATCCTCCCGTCGTCCGCTCTATCGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_pennsylvanica_USA3 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGGAAAAACCCAGCGAACTGTTGTCGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGTTGCCCGATGTCCTTCGGGGCTCGCCGTCCTCCGCTCGTATTGAGAGCGTCGAGGACGGCGCGCCGATATCCGTGTCGGCGTTGCGCGGCACGAGTTTGGCTCGCCGTCGTCGGGGAGTTCTCACCATGGCGTCGCGGTCGTGTCCGGACCCTCGGGAAGCGTTCCAAGGAGCCTCGCCCTTTGGTCCGGAGGTG-TCGCGGTCGGGGGCTTCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGGATCGGTGCCAC--TTTTTTTTTCTTCTTCCAAAACGTCGGAAATCCAAAACCAATTGCGGCTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCGGGGGGCGAATCGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAAACTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGGCCGTCGTGGAGCGTTTTGGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAAGGAGGGGGCGGACGATCCGAATCGGAGCGATCCTCCCGTCGTCCGCTCTATCGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_pennsylvanica_USA4 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGGAAAAACCCAGCGAACTGTTGTCGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGTTGCCCGATGTCCTTCGGGGCTCGCCGTCCTCCGCTCGTATTGAGAGCGTCGAGGACGGCGCGCCGATATCCGTGTCGACGATGCGCGGCACGAGTTTGGCTCGCCGTCGTCGGGGAGTTCTCACCATGGCGTCGCGGTCGTGTCCGGACCCTCGGGAAGCGTTCCAAGGAGCCTCGCCCTTTCGTCCGGAGGTG-TCGCGGTCGGGGGCTTCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGGATCGGTGCCAC-TTTTTTTTGTTTTCTTCCAAAACGTCGGAAATCCAAAACCAATTGCGGCTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAACCAAAACGACTCTCAG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------------------------------ Jubula_hutchinsiae_pennsylvanica_USA5 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGGAAAAACCCAGCGAACTGTTGTCGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGTTGCCCGATGTCCTTCGGGGCTCGCCGTCCTCCGCTCGTATTGAGAGCGTCGAGGACGGCGCGCCGATATCCGTGTCGGCGTTGCGCGGCACGAGTTTGGCTCGCCGTCGTCGGGGAGTTCTCACCATGGCGTCGCGGTCGTGTCCGGACCCTCGGGAAGCGTTCCAAGGAGCCTCGCCCTTTCGTCCGGAGGTG-TCGCGGTCGGGGGCTTCCCCCCTCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGGATCGGTGCCACTTTTTTTTTGTTTTCTTCCAAAACGTCGGAAATCCAAAACCAATTGCGGCTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCGGGGGGCGAATCGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAAACTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTTGGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAAGGAGGGGGCGGACGATCCGAATCGGAGCGATCCTCCCGTCGTCCGCTCTATCGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_pennsylvanica_USA6 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGGAAAAACCCAGCGAACTGTTGTCGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGTTGCCCGATGTCCTTCGGGGCTCGCCGTCCTCCGCTCGTATTGAGAGCGTCGAGGACGGCGCGCCGATATCCGTGTCGGCGTTGCGCGGCACGAGTTTGGCTCGCCGTCGTCGGGGAGTTCTCACCATGGCGTCGCGGTCGTGTCCGGACCCTCGGGAAGCGTTCCAAGGAGCCTCGCCCTTTCGTCCGGAGGTG-TCGCGGTCGGGGGCTTCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGGATCGGTGCCAC-TTTTTTTTGTTTTCTTCCAAAACGTCGGAAATCCAAAACCAATTGCGGCTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCGGGGGGCGAATCGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAAACTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTTGGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAAGGAGGGGGCGGACGATCCGAATCGGAGCGATCCTCCCGTCGTCCGCTCTATCGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_pennsylvanica_USA7 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGGAAAAACCCAGCGAACTGTTGTCGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGTTGCCCGATGTCCTTCGGGGCTCGCCGTCCTCCGCTCGTATTGAGAGCGTCGAGGACGGCGCGCCGATATCCGTGTCGGCGTTGCGCGGCACGAGTTTGGCTCGCCGTCGTCGGGGAGTTCTCACCATGGCGTCGCGGTCGTGTCCGGACCCTCGGGAAGCGTTCCAAGGAGCCTCGCCCTTTCGTCCGGAGGTG-TCGCGGTCGGGGGCTTCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGGATCGGTGCCAC-TTTTTTTTGTTTTCTTCCAAAACGTCGGAAATCCAAAACCAATTGCGGCTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCGGGGGGCGAATCGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAAACTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTTGGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAAGGAGGGGGCGGACGATCCGAATCGGAGCGATCCTCCCGTCGTCCGCTCTATCGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Jubula_hutchinsiae_pennsylvanica_USA8 CGTTGTGAGAAGTTCATTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCACACACGATGGAAAAACCCAGCGAACTGTTGTCGTCCATCGAGGGACCGCACTCGGAGGTGCGGTTGGCGACGGCGTTGCCCGATGTCCTTCGGGGCTCGCCGTCCTCCGCTCGTATTGAGAGCGTCGAGGACGGCGCGCCGATATCCGTGTCGGCGTTGCGCGGCACGAGTTTGGCTCGCCGTCGTCGGGGAGTTCTCACCATGGCGTCGCGGTCGTGTCCGGACCCTCGGGAAGCGTTCCAAGGAGCCTCGCCCTTTCGTCCGGAGGTG-TCGCGGTCGGGGGCTTCCCCC-TCCGCCGTTCCTGGAAGGCGTTCCCGTTCGAGGAGCGTCTCGATGGGATCGGTGCCAC-TTTTTTTTGTTTTCTTCCAAAACGTCGGAAATCCAAAACCAATTGCGGCTCTCTCCCTCTCGGGAGTGCGTCGGTCGCGCTCCGAAAAGATGAAAACCAAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACCCACAAAACTCCGGGGGGCGAATCGGATGCGAGTGGAATTGGCCAGTCCGGGGGTACCCGATGGAAAACTCGATCGAGGATGCCGCGGTCGGCTGAAATAGGGACCGTCGTGGAGCGTTTTGGGAGGGTCGCGAGAAGGTAGTCCGTCCTCCAAAGGAGGGGGCGGACGATCCGAATCGGAGCGATCCTCCCGTCGTCCGCTCTATCGAAGGCGAAGGGAATGGAGTCCCGCCGCGAGGCGGGACGCACAGGTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Nipponolejeunea_pilifera ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACACAAACACC------------A-TGTGTGCGAGTGGAATTGGCTTGTCCGGG-CCATC-GGTG----TCTGGATCGAGGATGCCGCGGTCGGCTGAAACACGTGCCCTCG-GGAGCGTGCCGGGAGGGTCGCGAGATGGTGATCG-TCCTCGCAAGGAGGACGCCGTCGATCCCTA--GCAGCGACCTTCCC-TGGTCGACTCT-CGGGAGGCGAAGGAGCGGGAGTCCCGCCGCCAGGCGGGGCTCTCCGTTACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTAAGCATATCACTAAG------------------------------ Nipponolejeunea_subalpina ??????????????????????????????????????????????????????????????????????????????????????TTGAACACACGATCAAAAAACCCCGTGAATCGTTGCCGTACATCGAGGGATCGCACTCGGAGGTGCGATTGGCGACGGCGCTGCCAGGGAGGTCGCGTCGCCGGGGATCGACCTCGGCCCGGAAACGGGCAGGGGGAGGTTCGCCGACGTCCGTGTCGCCGGCGCGTGGCACAAGGCTCGC-CGTCGTCG---GGGCGT-CTCCGC-TCGCGT---GGCCTCGTCCCCCCTCTCGG-TTGCGTGCCAC-GAGCC--GC--AACGGAGAGGGAGTGGCCGGGGTCGGGG-CGCCCTCC-TCCGCCGATCCCCGAATTCGTT----------------------GGGATCGGTGCCGC--------TTTTTCCTTCCAAAACGTCGGGTGACCCCGAGAAAACTCGGG-----------CGGGGGTATCTCGGTCCCGTCCCGAAAAAGTGAAAACCGAAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTCGTCCCGAGGGCATGCCTGCCTGAGCGTCCGGCTCAACCCACCCACACAGACACC------------GTTGTGTGCGAGTGGAATTGGCTTGTCCGGG-CTATC-GGTG----TCTGGATCGAGGATGCCGCGGTCGGCTAAAACGCGTGCCCTCG-GGAGCGTGCCGGGAGGGTCGCGAGATGGTCTTCGCTCCTCGCAAGGAGGAGGCCGTCGATCCCCA--GCAGCGACCTTCCCCTGGTCGACTCT-CGGGAGGCGAAGGGGCGGGAGTCCCGCCGCCAGGCGGGGCTCTCCGTCACTCGGACCTCAGATCAGGCAAGACCACCCGCTGAGTTTGAGCATATCACTAAG------------------------------ ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = nrDNA_ITS_region) = N: 1-1053; CODONPOSSET CodonPositions (CHARACTERS = nrDNA_ITS_region) = N: 1-1053; END; BEGIN TREES; TITLE Tb10673; LINK TAXA = Taxa2; TRANSLATE 1 Nipponolejeunea_pilifera, 2 Nipponolejeunea_subalpina, 3 Jubula_hutchinsiae_javanica_China1, 4 Jubula_hutchinsiae_javanica_China2, 5 Jubula_hutchinsiae_javanica_Malaysia2, 6 Jubula_hutchinsiae_javanica_Malaysia1, 7 Jubula_hutchinsiae_javanica_China4, 8 Jubula_hutchinsiae_javanica_China3, 9 Jubula_hutchinsiae_javanica_China5, 10 Jubula_hutchinsiae_javanica_Vietnam1, 11 Jubula_hutchinsiae_javanica_Vietnam2, 12 Jubula_hutchinsiae_japonica_Japan1, 13 Jubula_hutchinsiae_japonica_Japan2, 14 Jubula_hutchinsiae_hutchinsiae_Madeira1, 15 Jubula_hutchinsiae_hutchinsiae_Madeira2, 16 Jubula_hutchinsiae_hutchinsiae_British_Isles1, 17 Jubula_hutchinsiae_hutchinsiae_British_Isles2, 18 Jubula_hutchinsiae_hutchinsiae_Madeira3, 19 Jubula_hutchinsiae_bogotensis_Peru, 20 Jubula_hutchinsiae_bogotensis_Costa_Rica, 21 Jubula_hutchinsiae_bogotensis_Mexico2, 22 Jubula_hutchinsiae_bogotensis_Mexico1, 23 Jubula_hutchinsiae_pennsylvanica_USA8, 24 Jubula_hutchinsiae_pennsylvanica_USA7, 25 Jubula_hutchinsiae_pennsylvanica_USA4, 26 Jubula_hutchinsiae_pennsylvanica_USA5, 27 Jubula_hutchinsiae_pennsylvanica_USA6, 28 Jubula_hutchinsiae_pennsylvanica_USA1, 29 Jubula_hutchinsiae_pennsylvanica_USA2, 30 Jubula_hutchinsiae_pennsylvanica_USA3; TREE Fig._1 = [&R] (1,2,((3,4),(((5,(9,(10,11))),(6,7),8),(12,13),(14,15,16,17,18),(((19,20),(21,22)),(23,24,25,26,27),(28,29,30))))); END;