#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 11:54 GMT TreeBASE (cc) 1994-2008 Study reference: Uzuhashi S., Tojo M., & Kakishima M. 2010. Phylogeny of the genus Pythium and description of new genera. Mycoscience, 51(5): 337-365. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10152] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=127; TAXLABELS Albugo_occidentalis Albugo_tragopogonis Apodachlya_pyrifera Basidiophora_entospora Bremia_lactucae Dictyuchus_sterilis Elongisporangium_sp_ZSF0056 Elongisporangium_undulatum Globisporangium_heterothallicum Globisporangium_intermedium Globisporangium_irregulare_UZ370 Globisporangium_iwayamae_OPU1450 Globisporangium_macrosporum_UZ233 Globisporangium_nodosum Globisporangium_nunn_UZ041 Globisporangium_okanoganense_OPU1443 Globisporangium_paddicum_OPU1438 Globisporangium_paroecandrum Globisporangium_rostratifingens_OPU1440 Globisporangium_rostratifingens_UZ354 Globisporangium_rostratum_OPU1441 Globisporangium_sp_UZ164 Globisporangium_sp_UZ182 Globisporangium_sp_UZ213 Globisporangium_sp_UZ249 Globisporangium_sp_UZ253 Globisporangium_sp_UZ260 Globisporangium_sp_UZ275 Globisporangium_sp_UZ277 Globisporangium_sp_UZ284 Globisporangium_sp_UZ290 Globisporangium_sp_UZ304 Globisporangium_sp_UZ318 Globisporangium_sp_UZ382 Globisporangium_sp_UZ400 Globisporangium_sp_UZ416 Globisporangium_sp_UZ636 Globisporangium_sp_ZSF0030 Globisporangium_sp_ZSF0069 Globisporangium_spinosum_UZ150 Globisporangium_splendens_UZ174 Globisporangium_sylvaticum_UZ307 Globisporangium_ultimum_UZ056 Globisporangium_uncinulatum_Py2 Hyaloperonospora_erophilae Hyaloperonospora_parasitica Lagenidium_callinectes Lagenidium_giganteum Lagenidium_humanum Lagenidium_thermophilum Leptomitus_lacteus Ovatisporangium_boreale Ovatisporangium_helicoides Ovatisporangium_oedichilum Ovatisporangium_ostracodes Ovatisporangium_sp_UZ230 Ovatisporangium_sp_UZ248 Ovatisporangium_sp_UZ287 Ovatisporangium_vexans_UZ215 Ovatisporangium_vexans_UZ309 Paraperonospora_leptosperma Peronospora_aestivalis Peronospora_aparines Peronospora_arvensis Peronospora_boni_henrici Peronospora_calotheca Peronospora_conglomerata Peronospora_hiemalis Peronospora_lamii Peronospora_sanguisobae Peronospora_trivialis Peronospora_variabilis Phytophthora_boehmeriae Phytophthora_cactorum Phytophthora_capsici Phytophthora_cinnamomi Phytophthora_citricola Phytophthora_erythroseptica Phytophthora_gonapodyides Phytophthora_heveae Phytophthora_ilicis Phytophthora_insolita Phytophthora_multivesiculata Phytophthora_nicotianae Phytophthora_palmivora Phytophthora_quercina Phytophthora_ramorum Phytophthora_syringae Pilasporangium_apinafurcum_UZ300 Pilasporangium_apinafurcum_UZ301 Plasmopara_densa Plasmopara_megasperma Plasmopara_obducens Plasmopara_pusilla Plasmopara_viticola Pseudoperonospora_humuli Pseudoperonospora_urticae Pythiopsis_cymosa Pythium_acanthicum_UZ352 Pythium_aphanidermatum_UZ051 Pythium_aquatile_UZ216 Pythium_arrhenomanes Pythium_catenulatum_UZ264 Pythium_caudatum Pythium_deliense Pythium_dissotocum_UZ159 Pythium_graminicola Pythium_inflatum Pythium_insidiosum Pythium_monospermum Pythium_myriotylum Pythium_oligandrum Pythium_sp_OPU1448 Pythium_sp_OPU1449 Pythium_sp_UZ156 Pythium_sp_UZ190 Pythium_sp_UZ379 Pythium_sp_UZ419 Pythium_sp_UZ655 Pythium_sp_ZSF0011 Pythium_sulcatum Pythium_torulosum_UZ357 Pythium_vanterpoolii_OPU1445 Pythium_volutum_OPU1446 Saprolegnia_ferax Saprolegnia_parasitica Sapromyces_elongatus ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=208; TAXLABELS Achlya_americana Achlya_caroliniana Achlya_colorata Achlya_dubia Achlya_klebsiana Achlya_papillosa Achlya_racemosa Achlya_radiosa Achlya_spinosa Achlya_treleaseana Albugo_candida Albugo_evolvuli Aphanomyces_laevis Aphanomyces_stellatus Aplanes_androgynus Aplanopsis_spinosa Apodachlya_brachynema Basidiophora_entospora Bremia_lactucae Brevilegnia_bispora Brevilegnia_megasperma Calyptralegnia_achlyoides Dictyuchus_monosporus Elongisporangium_anandrum Elongisporangium_dimorphum Elongisporangium_helicandrum Elongisporangium_prolatum Elongisporangium_sp_ZSF0056 Elongisporangium_undulatum Globisporangium_acrogynum Globisporangium_cylindrosporum Globisporangium_echinulatum Globisporangium_heterothallicum Globisporangium_intermedium Globisporangium_irregulare_UZ067 Globisporangium_irregulare_UZ370 Globisporangium_iwayamae_OPU1450 Globisporangium_macrosporum_UZ233 Globisporangium_mastophorum Globisporangium_multisporum Globisporangium_nunn_UZ041 Globisporangium_okanoganense_OPU1443 Globisporangium_paddicum_OPU1438 Globisporangium_paroecandrum_OPU466 Globisporangium_perplexum Globisporangium_pleroticum Globisporangium_polymastum Globisporangium_rostratifingens_OPU1440 Globisporangium_rostratifingens_UZ354 Globisporangium_rostratum_OPU1441 Globisporangium_sp_UZ164 Globisporangium_sp_UZ182 Globisporangium_sp_UZ213 Globisporangium_sp_UZ249 Globisporangium_sp_UZ252 Globisporangium_sp_UZ253 Globisporangium_sp_UZ260 Globisporangium_sp_UZ263 Globisporangium_sp_UZ275 Globisporangium_sp_UZ277 Globisporangium_sp_UZ284 Globisporangium_sp_UZ285 Globisporangium_sp_UZ290 Globisporangium_sp_UZ304 Globisporangium_sp_UZ318 Globisporangium_sp_UZ382 Globisporangium_sp_UZ400 Globisporangium_sp_UZ416 Globisporangium_sp_UZ594 Globisporangium_sp_UZ636 Globisporangium_sp_ZSF0030 Globisporangium_sp_ZSF0069 Globisporangium_spinosum_UZ150 Globisporangium_spinosum_UZ405 Globisporangium_splendens_UZ174 Globisporangium_sylvaticum_UZ307 Globisporangium_ultimum_spo_OPU465 Globisporangium_ultimum_ult_UZ056 Globisporangium_uncinulatum_Py2 Halophytophthora_avicenniae Halophytophthora_polymorphica Hyaloperonospora_barbareae Hyaloperonospora_brassicae Hyaloperonospora_dentariae Hyaloperonospora_niessliana Hyaloperonospora_parasitica Hyaloperonospora_thlaspeos_arvensis Isoachlya_toruloides Lagenidium_callinectes Lagenidium_chthamalophilum Lagenidium_myophilum Lagenidium_thermophilum Leptolegnia_caudata Leptomitus_lacteus Ovatisporangium_boreale Ovatisporangium_cucurbitacearum Ovatisporangium_helicoides Ovatisporangium_oedichilum Ovatisporangium_ostracodes Ovatisporangium_sp_UZ230 Ovatisporangium_sp_UZ248 Ovatisporangium_sp_UZ287 Ovatisporangium_sp_UZ392 Ovatisporangium_sp_UZ612 Ovatisporangium_vexans_UZ215 Ovatisporangium_vexans_UZ309 Pachymetra_chaunorhiza Paraperonospora_leptosperma Peronospora_aestivalis Peronospora_alsinearum Peronospora_aparines Peronospora_arvensis Peronospora_boni_henrici Peronospora_bulbocapni Peronospora_calotheca Peronospora_conglomerata Peronospora_ficariae Peronospora_hiemalis Peronospora_lamii Peronospora_myosotidis Peronospora_potentillae_sterilis Peronospora_pulveracea Peronospora_rumicis Peronospora_sanguisobae Peronospora_silvestris Peronospora_sparsa Peronospora_trifolii_alpestris Peronospora_trifolii_hybridi Peronospora_trifolii_minoris Peronospora_trivialis Peronospora_variabilis Phytophthora_boehmeriae Phytophthora_cactorum Phytophthora_capsici Phytophthora_cinnamomi Phytophthora_citrophthora Phytophthora_clandestina Phytophthora_erythroseptica Phytophthora_europaea Phytophthora_gonapodyides Phytophthora_heveae Phytophthora_ilicis Phytophthora_insolita Phytophthora_multivesiculata Phytophthora_nicotianae Phytophthora_quercina Phytophthora_ramorum Phytophthora_syringae Pilasporangium_apinafurcum_UZ300 Plasmopara_baudysii Plasmopara_densa Plasmopara_geranii Plasmopara_halstedii Plasmopara_megasperma Plasmopara_obducens Plasmopara_pimpinellae Plasmopara_pusilla Plasmopara_sii Plasmopara_viticola Plasmoverna_isopyri_thalictroidis Plasmoverna_pygmaea Plectospira_myriandra Protoachlya_paradoxa Protoachlya_polyspora Pseudoperonospora_cubensis Pseudoperonospora_humuli Pythiopsis_cymosa Pythium_acanthicum_UZ352 Pythium_acanthicum_UZ364 Pythium_adhaerens Pythium_angustatum Pythium_aphanidermatum_UZ051 Pythium_apleroticum Pythium_aquatile_UZ216 Pythium_arrhenomanes Pythium_capillosum Pythium_catenulatum_UZ264 Pythium_conidiophorum Pythium_dissotocum_UZ159 Pythium_graminicola Pythium_inflatum Pythium_insidiosum Pythium_monospermum Pythium_oligandrum Pythium_sp_OPU1448 Pythium_sp_OPU1449 Pythium_sp_OPU797 Pythium_sp_UZ156 Pythium_sp_UZ190 Pythium_sp_UZ379 Pythium_sp_UZ419 Pythium_sp_UZ655 Pythium_sp_ZSF0011 Pythium_sp_ZSF0093 Pythium_torulosum_UZ006 Pythium_vanterpoolii_OPU1445 Pythium_volutum_OPU1446 Saprolegnia_anisospora Saprolegnia_diclina Saprolegnia_eccentrica Saprolegnia_ferax Saprolegnia_hypogyna Saprolegnia_litoralis Saprolegnia_monilifera Sapromyces_elongatus Scoliolegnia_asterophora Thraustotheca_clavata Viennotia_oplismeni ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4278] TITLE D1D2; LINK TAXA = Taxa2; DIMENSIONS NCHAR=692; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Achlya_americana TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT-----TTACATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATTTGGGATAAGTCCCTTGGAAAAGGGCAGCACAGAGGGTGATACTCCCGTCTTTGCTCAGAT-TGTCT-ATGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTAACATGT-CCAGTGT-TGTATCTTGT-GCATATTT-CATTAGT------------------------GGAGTA--------------------------------------------ATTT----ACTGGT-GCCCTGTGCATGAGTGTGACGTCAAAGTCAGTTTGTAT-GCTGCGGGAGATGGTT-AG--CAAGGAGGT-GCGTC----ACTT---TTGTGTCA----GTTATACCTTGTTA-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCTTATA-GAG-TAT-ATTGTTGTCTCGTTATTATACCTGT-TTGGATAGCTTGC Achlya_caroliniana TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT-----TTACATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATTTGGGATAAGTCCCTTGGAAAAGGGCAGCACAGAGGGTGATACTCCCGTCTTTGCTCAGAT-TGTCT-ATGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTAACATGT-CCAGTGT-TGTATCTTGT-GCATATTT-CATTAGT------------------------GGAGTA--------------------------------------------ATTT----ACTGGT-GCCCTGTGCATAAGTGTGACGTCAAAGTCAGTTTGTAT-GCTGCGGGAGATGGTT-AA--CAAGGAGGT-GCGTC----GCTT---TTGTGTCA----GTTATACCTTGTTA-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCTTATA-GAG-TAT-ATTGTTGTCTCGTTATTATACCTGT-TTGGATAGCTTGC Achlya_colorata TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT------TTCATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATCTGGGACAAGTCCCTTGGAAAAGGGCAGCATAGAGGGTGATACTCCCGTCTCTGCTCAGAT-TGTCT-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTAACATTT-CCAGTGT-TGTATCCTGT-GCATATTT-CATTAGC------------------------GGAGTA--------------------------------------------ATTT----GCTGGT-GCCCTGTGCATGGGTGTGACGTCAGGGTCAGTTTGTAT-GCTGCGGGAGATGGTT-AG--TAAGGAGGT-GCGTC----ACTTCG---GTGTCA----GTTATACCTTGCTA-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCT-TG-AAGTTCG-G-TGTTGTCTCGTTGTGGTGACTGC-TTGGATAGCTTGC Achlya_dubia TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT-----TTACATGGCGAATTGTACTCTATTGAGGCTGTTGTCAGCATAGCGATTTGGGATAAGTCCCTTGGAAAAGGGCAGCACAGAGGGTGATACTCCCGTCTTTGCTCAGAT-TGTCT-ATGTGTACGATACGCTTTCTTTGAATCGAGTTGTT-GGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTAACATGT-CCAGTGT-TGTATCTTGT-GCATATTT-CATTAGT------------------------GGAGCA--------------------------------------------ATTT----ACTGGT-GCCCTGTGCATGAGTGTGACGTCAAAGTCAGTTTGTAT-GCTGCGGGAGATGGTT-AG--CAAGGAGGT-GCGTC----ACTT----TGTGTCA----GTTATACCTTGTTA-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCTTATA-GAG-TAT-ATTGTTGTCTCGTTGTTATATCTGT-TTGGATAGCTTGC Achlya_klebsiana TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT-----TTACATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATTTGGGATAAGTCCCTTGGAAAAGGGCAGCACAGAGGGTGATACTCCCGTCTTTGCTCAGAT-TGTCT-ATGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTAACATGT-CCAGTGT-TGTATCTTGT-GCATATTT-CATTAGT------------------------GGAGTA--------------------------------------------ATTT----ACTGGT-GCCCTGTGCATGAGTGTGACGTCAAAGTCAGTTTGTAT-GCTGCGGGAGATGGTT-AG--CAAGGAGGT-GCGTC----ACTT----TGTGTCA----GTTATACCTTGTTA-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCTTATA-GAG-TAT-ATTGTTGTCTCGTTATTATATCTGT-TTGGATAGCTTGC Achlya_papillosa TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT------TACATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCACAGCGATCTGGGAAAAGTCCCTTGGAAAAGGGCAGCACAGAGGGTGATACTCCCGTCTTTGCTCAGAT-TGTCT-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TGTATCCTGT-GCATATTT-CATTGGC------------------------GGAGTA--------------------------------------------ATTT----GCTGGT-GCCCTGTGCATGGGTGTGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAGATGGTT-AG--GGAGAAGGT-GCGTC----ACTTCG---GTGAAA----GTTATAGCTCTCTA-AC---TAGTT-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCT-TG-GGGTTCC-G-TGCTGCCTCGTTTTGGTGACTGC-TTGGATAGCTTGC Achlya_racemosa -GAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT------TTCATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATCTGGGACAAGTCCCTTGGAAAAGGGCAGCATAGAGGGTGATACTCCCGTCTCTGCTCAGAT-TGTCT-GTGTGTACGATACGCTT-CTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTAACATTT-CCAGTGT-TGTATCCTGT-GCATATTT-CATTAGC------------------------GGAGTA--------------------------------------------ATTT----GCTGGT-GCCCTGTGCATGGGTGTGACGTCAGGGTCAGTTTGTAT-GCTGCGGGAGATGGTT-AG--TAAGGAGGT-GCGTC-----CTTCG---GTGAAA----GTTATACCTTGCTA-TC---TAGTA-CCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCTT-TG-AGGTTCG-G-TGTTGTCTCGTTGTGGTGACTGC-TTGGATAGCTTGC Achlya_radiosa TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT------TTCATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATCTGGGACAAGTCCCTTGGAAAAGGGCAGCATAGAGGGTGATACTCCCGTCTCTGCTCAGAT-TGTCT-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTAACATTT-CCAGTGT-TGTATCCTGT-GCATATTT-CATTAGC------------------------GGAGTA--------------------------------------------ATTT----GCTGGT-GCCCTGTGCATGGGTGTGACGTCAGGGTCAGTTTGTAT-GCTGCGGGAGATGGTT-AG--TAAGGAGGT-GCGTC----ACTTCG---GTGAAA----GTTATACCTTGCTA-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCT-TG-AGGTTCG-G-TGTTGTCTCGTTGTGGTGACTGC-TTGGATAGCTTGC Achlya_spinosa TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT------TACATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATCTGGGAAAAGTCCCTTGGAAAAGGGCAGCATAGAGGGTGATACTCCCGTCTTTGCTCAGAT-TGTCT-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TGTATCCTAT-GCATATTT-CATTGGC------------------------GGAGTA--------------------------------------------ATTT----GCTGGT-GCCCTGTGCATGGGTGTGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAGATGGTT-AG--TGAGGAGGT-GCGTC----ACTTCG---GTGAAA----GTTATACCTTGCTA-TC---TAGTT-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCC-TG-GGGTTCA-G-TGCTGCCTCGTTTTGGTGACTGC-TTGGATAGCTTGC Achlya_treleaseana TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT------TACATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATCTGGGAAAAGTCCCTTGGAAAAGGGCAGCACAGAGGGTGATACTCCCGTCTTTGCTCAGAT-TGTCT-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TGTATCCTGT-GCATATTT-CATTGGC------------------------GGAGTA--------------------------------------------ATTT----GCTGGT-GCCCTGTGCATGGGTGTGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAGATGGTT-AG--GGAGAAGGT-GCGTC----ACTTCG---GTGAAA----GTTATAGCTCTCTA-AC---TAGTT-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCT-TG-GGGTTCC-G-TGCTGCCTCGTTTTGGTGACTGC-TTGGATAGCTTGC Albugo_candida TGAAGCGGGAAGAGCTCAAGCTTGAAATCTCCGC-ACAAGTT-----TTGTGTGGCGAATTGTAGTCTATAGAAGC-GATGTCAGCATAGCTGCTCTAGTCAAGTTCCTTGGAAAAGGACAGCATGGAGGGTTATACTCCCGTCATTGCTGGAGCATGCT--GTGTGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATAAGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCGCAACATATTA-CAATGATGTGTTTTTGCTTTCC-GCGTGTAGGTAGTAGCC--TT-----GGTTGCACCTTGCGTGGATTGGTTG---------AGACATATCGTT-GCCCTGTGTTGTGGTGGGACGTCAAAGTCAGTTTGTAC-GTCGCAGGAAATGATTGAC---GAGGAAGATAGGTTTGCTGCTT-GCAGCGTTCC----ATTATATCCTTATCGAT---GTCT--GCTGTGACGGAGACTGAGGTGT-CTT---TAACATGCTC-TC-GAG-TCT-ATTAGACATTCACTTGGTTGAGTGC-GTAGATAGCTTGC Albugo_evolvuli TGAAGCGGGAAGAGCTCAAACTTGAAATCTCCAA-GCGTGTT-----ACGTTTGGCGAATTGTAGTCTATGGAATC-GATGTCAGCCGAATTTCCCGAGTCAAGTTCTCTGAAAGGAGACAGCATGGAGGGTTATACTCCCGTGATTACTTGGGC-AAATG-GTGCGTACGACACGTATTCGTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGGAGGTGGTAAATTCCATCTAAAGCTAAATACTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-AAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGATT-CGAGTGTCTATAATCCTTGGCATATTT-CAATGCGTATGGTCATGGATAGAGCATGTACGATGGAT-----------GAATTCACGTACATGCTGT--ATTG------CGTGTGCATGCGAGTTGCACTGTGCCATGGTGGGACGTCAACGTGAGTTTGGAT---CGTGGGAAAAGGTG-AC--TGTGGAAGATAGGAAGCATG-TTTACATGTTTCC----TTTATAACCACGTTGAC---TGGTA-GCCATGATGTAGACTGAGGAATCGTATAACAACCTGCTT-GC-AAGGCCA---TGTACG-TTGTTTGGTCGATTGCATTAGAAAGCTTGC Aphanomyces_laevis TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAC-GC------------AAGTGGCGAATTGTAGTCTATTGAAGCTGTTGTCAGCATAGCGACTTGGGAAAAGTCCCTTGGAAGAGGGCAGCATAGAGGGTGATACTCCCGTCTTTGCCCAAGT-TGTCT-GTGTGTACGAAACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTT-GAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTGT-CTAGTGT--GTATCCTGT-GCATATTT-CACTGGC-----------------------GGTCGCAA-------------------------------------------GATT----GCTGGT-GCCCTGTGCATGGGTGTGACGTCAGAGTCAGTTTGTGC---TGCGGGAGATGGCT-AG--TGAGGAGGT-GCGTC----CCTT-----GGGAAA----GTTACAGCTCGCTA-GC---TAGTA-GCCGTGGCGTAGACTGAGGTGC-CTA---CAACACGCTC-TG-GGG-TCT-TTTGTTGTCTCGTGTGGGTTGTTGC-CTGGATAGCTTGC Aphanomyces_stellatus TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAC-GC------------AAGTGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGACCTGAGACAAGTCCCTTGGAAGAGGGCAGCATGGAGGGTGATACTCCCGTCTCTGCTCAGGT-TGTCT-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CTAGTGT-T-TATCCTAT-GCATATTT-CATTGGC-----------------------GGTTGCAA-------------------------------------------AATT----GCTGGT-GCCCTGTGCATGGGTGTGACGTCAGAGTCAGTTTAAAT---TGCGGGAGATGGGT-AG--TGAGGAGGT-GCGTC----ACAT---TTGTGAAA----GTTACAGCTCGCTG-CC---TAGTA-GCCGTGGTTAAGACTGAGGTGC-CTA---CAACATGCCC-TG-GGG-TCT-GGTGTTGTCTCGTTTTATGTACTGC-TTGGATAGCTTGC Aplanes_androgynus -GAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT------TACATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATCTGGGAAAAGTCCCTTGGAAAAGGGCAGCACAGAGGGTGATACTCCCGTCTTTGCTCAGAT-TGTCT-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TGTATCCTGT-GCATATTT-CATTGGC------------------------GGAGTA--------------------------------------------ATTT----GCTGGT-GCCCTGTGCATGGGTGTGACGTCGA--TCAGTTTGTAT-GCTGCGGGAGATGGTT-AG--GGAGAAGGT-GCGTC----ACTTCG---GTGAAA----GTTATAGCTCTCTA-AC---TAGTT-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCT-TG-GGGTTCC-G-TGCTGCCTCGTTTTGGTGACTGC-TTGGATAGCTTGC Aplanopsis_spinosa TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT------TACATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATCTGGGAAAAGTCCCT-GGAAAAGGGCAGCATAGAGGGTGATACTCCCGTCTTTGCTCAGAT-TGTCT-GTGTGTACGATACGCTTTCTTTGAGTCA----GTGTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TGTATCCTAT-GCATATTT-CATTGGC------------------------GGAGTA--------------------------------------------ATTT----GCTGGT-GCCCTGTGCATGGGTGTGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAGATGGTT-AG--TGAGGAGGT-GCGTC----ACTTCG---GTGAAA----GTTATACCTCGCTA-TC---TAGTT-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCC-TG-GGGTTCA-G-TGCTGCCTCGTTTTGGTGACTGC-TTGGATAGCTTGC Apodachlya_brachynema TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGT-GCTAGTT-----TAGCATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCACAGCGACCTGGGACAAGTCTCTTGGAAGAGAGCAGCATAGAGGGTGATACTCCCGTCTCTGCTCAGGT-CTGCTTGTGTGTACGATACGCTTTCTTTGAGTCGAGTTGCTTGGGAATGCAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATAGGTGCGAGACCGATAGCGAACAAGCACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAATCGTATCGTTT-CCAGTGTCT-TATCCTTT-GCATATTT-CATTGGCGGATGTGGGTGTGTAGTGTG-CTTGTACTAGCAGTTCATTCTGCAGTCTGCGTTC-TACGC--TGCT------TATAT--TTGCTGGT-GCCCTGTGCATTGGTGTGACGTCAGAGTCAGTTTGTAC-GCTGCGGGAGATGGTT-GT--CGAGGAGGT-ATTTTGAACACAT---TTGTGTTTGGATGTTATATCTTGGCATAC---TAGTA-GTCGTGGCGGAGACTGAGGTGC-CTA---CAACATGCCT-TG-GGAGTCATGTGGG-GTCTCGTTTGAATAATTGT-TTGGATAGCTTGC Basidiophora_entospora TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCAT-ACAAATT-----TTGTATGGCGAATTGTAGTCTATAGATGC-GTGATCAGCGCGTGCACTTAGAGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTAATACTCCCGTCTATCTCTAAGT-TGCGT-GTGCGTACGATCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCATACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGTAACCAAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTGACGAGTGTGTTTGTGCATGTACTATGGCAGCTTCC--TTTTT--GGTAGCGCTTTGT-GTGTG-TGCGA------TGTGTGCTTGTTGGT-GCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTAT-ACTGCGACAAATGACT-GT--TGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGATAGAC---TAGTA-GTTGCGGTTGGGACTGAGGTGC-CTA---TAACATGCTTTTT-GAG-AAG-GATTGAATCTCCGTGTGCGCCGTGT-GCAAATAGCTTGC Bremia_lactucae TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-GCAAATT-----TTGCATGGCGAATTGTAGTCTATAGAGAC-GTGATTAGCATAGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTATCTCCGAGT-TGCTT-ATGCGTACAATCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCAAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTGGCGAATGTGTGCGTGCGTGTACTATGGCAGCGGCT--TTTT----GCTGCGCCTTGT-GTGTG-TGTG-------CACTTTCTCGCTGAT-GCCCTGTACCGTGGTGGGACGTCAATGTCGGTTCGTAA-ATTGCGGGAAATGACT-GC--CGAGGAGGT-AGGGCGAACGCTT-GCGTTTGTCT----GTTATATCTTGGCGGACG--TAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-AT-GAG-TAG-AATTGATTCTCCGTGTGCGCTGTGT-GCGGATAGCTTGC Brevilegnia_bispora TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTCT----TGACATGGCGAATTGTAGTCTATAGAAGCGATTATCAGCATAGCAATATGGGAAAAGTCCCTTGGAAAAGGGCAGCATAGAGGGTGATACTCCCGTCTTTGCCCAGGT-TGTCT-ATGTGTACGATACGTTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTAACATGT-CCAGTGT-TGTATCTCTT-ATATATTT-CATTAGT------------------------ACAGTA--------------------------------------------AT--GC--ACTGGT-GCCCTGTATAAGAGTGTGACGTCAAAGTCAGTTTGTAT-ATCGCGGGAGATGGTT-AA--TAAGGAGGT-GCGTC----ACTT---TTGTGTCA----GTTATATCTTATTA-AC---TAGTT-GCCGTGGTAGAGACTGAG-TGC-CTA---CAACATGCTTATC-AAG-TCT-ATGTTTGTCTCGTTATTCTATTTGT-TTGGATAGCTTGC Brevilegnia_megasperma TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-ACT--T------TTGTATGGCGAATTGTAGTCTATAGAAGC-GCTATCAGCATAGCAATATGGGATAAGTCCCTTGGAAAAGGGTAGCATAGAGGGTGATACTCCCGTCTTTGCCCAGGT-TGTCT-ATGTGTACGATACGTTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTAACATAT-CCAGTGT-TGTATCTCTT-ATATATTT-CACTAGT------------------------ACAGCA--------------------------------------------AT--GC--ACTGGT-GCCCTGTATAGGAGTGTGACGTCAAAGTCAGTTTGTAT-ATTGCGGGAGATGGTT-TG--TAAGGAGGT-GTGTC----ACTT---TTGTGTCA----GTTATACCTTATAA-AC---TAGTT-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCTTATC-GAG-TCT-ATGTGTATCTCGTTGTTATACTTGT-TTGGATAGCTTGC Calyptralegnia_achlyoides TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT------TACATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATCTGGGAAAAGTCCCTTGGAAAAGGGCAGCATAGAGGGTGATACTCCCGTCTCTGCTCAGAT-TGTCT-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TTAATCCTAT-GCATATTT-CATTGGC------------------------GGAGTA--------------------------------------------ATTT----GCTGGT-GCCCTGTGCATGGGTGTGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAGATGGTT-AG--TAAGAAGGT-GCGTC----ACTTCG---GTGAAA----GTTATATCTTGCTA-TC---TAGTT-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACACGCCC-TG-GGGTTCA-G-TAGTGTCTCGTTTTGGTGACTGC-TTGGATAGCTTGC Dictyuchus_monosporus TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-ATC--TT-----TGATATGGCGAATTGTAGTCTATAGAAGCGATTATCAGCATAGCAATATGGGAAAAGTCCCTTGGAAAAGGGCAGCATAGAGGGTGATACTCCCGTCTTTGCCCAGGT-TGTCT-ATGTGTACGATACGTTTTCTTTGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTAACATGT-CCAGTGT-TGTATCTCTT-ATATATTT-CATTAGT------------------------ACAGCA--------------------------------------------AT--GC--ACTGGT-GCCCTGTATAAGAGTGTGACGTCAAAGTCAGTTTGTAT-ATTGCGGGAGATGGTT-AG--TAAGGAGGT-GCGTC----ACTT---TTGTGTCA----GTTATACCTTATTA-TC---TAGTA-GCCGTGGTAGAGACTGAGGTGC-CTA---CAACATGCTTTTC-AAG-TCT-ATGTTTGTCTCGTTGTTCTATTTGT-TTGGATAGCTTGC Elongisporangium_anandrum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GATGTCAGTGCAGCTATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-AGCTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCCATGGCATATTT-CATTGGCGACTTGTTGCGTTC-AGTGCGTAGGAAGTAGTT--TAT-----TCTGCTCCTTGT-ATTGT--TTTG------CGATGTGTTGCTGGT-GCCCTGTGTTGTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGTTGAGCGCTT-GCGTTTAATT----GTTATATCTTGGTGTGC---TAGTA-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TA-AAG-TCT-TGTGGGGTCTCATGTGATAACGTGC-TTGGATAGCTTGC Elongisporangium_dimorphum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GATGTCAGTGCAGCTATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGT-AGCTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCCAATGCATATTT-CATTGTGGACTTGTTGCGTGC-AGTGCGTAGGAAGTAGTT--TAT-----TCTGCTCCTTGT-ATTGT--TGTG------CGATGTGTTGATGGT-GCCCTGTGTGTTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GT--CGAGGAGGT-AGGCTGAGCGCTT-GCGTTTAGCT----GTTATATCTTGGCGTGC---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TA-AAG-TCT-TGTGGGGTCTCATGTGATAACGTGC-TAGGATAGCTTGC Elongisporangium_helicandrum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GATGTCAGTGCAGCTATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGT-AGGTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCCATGGCATATTT-CATTGGCGACTTGTTGCGTAC-AGTGCGTAGGAAGTAGTT--TAT-----TCTGCTCCTTGT-ATTGT--TTTG------CGATGTGTTGCTGGT-GCCCTGTGTCGTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGCTGAGCGCTT-GCGTTTAGCT----GTTATATCTTGGTGTGC---TAGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TA-AAG-TCT-TGTGGGGTCTCATGTGATAACGTGC-TAGGATAGCTTGC Elongisporangium_prolatum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GATGTCAGTGCAGCTATTTGGGGTAAGTTCCTTGGAAAAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGT-AGCTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCCATGGCATATTT-CATTGGCGACTTGTTGCGTAC-AGTGCGTAGGAAGTAGTT--TAT-----TCTGCTCCTTGT-ATTGT--TTTG------CGATGTGTTGCTGGT-GCCCTGTGTCGTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GT--TGAGGAGGT-AGGTTGAGCGCTT-GCGTTTAGCT----GTTATATCTTGGCGTGC---TAGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TA-AAG-TCT-TGTGGGGTCTCATGTGATAACGTGC-TAGGATAGCTTGC Elongisporangium_sp_ZSF0056 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GATGTCAGTGCAGCTATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGT-AGCTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCCAATGCATATTT-CATTGTCGACTTGTTGCGTGC-AGTGCGTAGGAAGTAGTT--TAT-----TCTGCTCCTTGT-ATTGT--TGTG------CGATGTGTTGATGGT-GCCCTGTGTGTTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--TGAGGAGGT-AGGCTGAGCGCTT-GCGTTTAGCT----GTTATATCTTGGCGTGC---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TA-AAG-TCT-TGTGGGGTCTCATGTGATAACGTGC-TAGGATAGCTTGC Elongisporangium_undulatum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GATGTCAGTGCAGCTATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGT-AGCTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCCAATGCATATTT-CATTGTGGACTTGTTGCGTGC-AGTGCGTAGGAAGTAGTT--TAT-----TCTGCTCCTTGT-ATTGT--TGTG------CGATGTGTTGATGGT-GCCCTGTGTGTTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GT--CGAGGAGGT-AGGCTGAGCGCTT-GCGTTTAGCT----GTTATATCTTGGCGTGC---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TA-AAG-TCT-TGTGGGGTCTCATGTGATAACGTGC-TAGGATAGCTTGC Globisporangium_acrogynum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTAT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCAGGCATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GCTTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGTATGTGCGCGTGCT-GTGTGTAGGAAGTGACG--TTC-----GTTGCTCCTTGT-GCGGT--TCTG------CGTGTGTCTGCTGGT-GCCCTGTGTCATAGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--TGAGGAGGT-AGGTTAGGAG-TTCGCTCTTGGCT----GTTATATCTTGCTA-GC---TAGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TG-GGG-TCA-TGCGGGTTCTTGCTTGGCGCACTAC-TTGGATAGCTTGC Globisporangium_cylindrosporum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCGGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGC-GGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGACATATTT-CATTGGCGGCAGTGTGCGTGCTTTTGCGTCGGAAGCGGC---TTTT----GTTGCTCTGTGCTTTTGC--TGTG------CGCGCTGTTGCTGTT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCC-GC--CGAGGAGGT-AGGTCAGGA-TTTCGGTCTTGGCT----GTTATATCTTGGTG-GT---TTGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TT-GAG-TGT-GCCGGGTTCTCATTTGGTGGACTGT-TTGGATAGCTTGC Globisporangium_echinulatum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTAT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GCTGTCAGTGCAGGCATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GCTTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGTATGTGCGCGTGCT-GTGTATTGGAAGTGACG--TTC-----GTTGCTCCTTGT-GCGGT--TCTG------CGTGTGTCTGCTGGT-GCCCTGTGTCATAGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--TGAGGAGGT-AGGTTAGGAG-TTCGCTCTTGGCT----GTTATATCTTGATA-GC---TAGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TG-GGG-TCA-TACGGGTTCTTGCTTGGCGCACTAC-TTGGATAGCTTGC Globisporangium_heterothallicum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GATGTCAGTGCAGCTATTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-AGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCGA-TGCGTAAGAAGTAGCT--T-------GCTGCTCTTTGT-GTTGT--TCTG------CGCTTGCTTGCTGGT-GCCCTGTGTCGTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--CGAGGAGGT-AGGTTAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTATGC---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TA-AAG-TCT-TGCGGTGTCTTATTTGGTTAACTGT-TTGGATAGCTTGC Globisporangium_intermedium TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCGGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGC-GGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGGCGGTGCGCGTGCTTTTGCGTCGGAAGCGGCT--TTT-----GTTGCTCTGTGC-TTTTGC-TGTG------CGTGTTGTTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGTCAGGA-TTTCGGTCTTGGCT----GTTATATCTTGGTG-GT---TTGTT-GTCGTGGTTGAGACTGAGGTGC-CTA---CAATGTGCTT-TT-GAG-TGT-GCCGGGTTCTCATTTGGTGGACTGT-TTGGATAGCTTGC Globisporangium_irregulare_UZ067 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCGGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGC-GGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGGCTTTGTGCGTGCTATTGTTTCGGAAGCGGCT--TTT-----GTTGCTCTGTGC-TTTGGT-GTTG------CGCGTTGCTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGTCAGGA-CTTTTGTCTTGGCT----GTTATATCTTGGTG-GT---TTGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TT-GAG-TAT-GCTGGGTTCTCATTTGGTGGACTGT-TTGGATAGCTTGC Globisporangium_irregulare_UZ370 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCGGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGC-GGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGGCTTTGTGCGTGCTATTGTTTCGGAAGCGGCT--TTT-----GTTGCTCTGTGC-TTTGGT-GTTG------TGCGTTGCTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGTCAGGA-CTTTTGTCTTGGCT----GTTATATCTTGGTG-GT---TTGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TT-GAG-TAT-GCTGGGTTCTCATTTGGTGGACTGT-TTGGATAGCTTGC Globisporangium_iwayamae_OPU1450 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GCTGTCAGTGCGGCCGCTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GGTTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGACTGTGTGCGTGCG-GCGCGTCGGAAGTGGCT--TTT-----GTCGCTCCGTGT-GTTGTT-TCTG------CGTGCGGTTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAACGGCT-GC--TGAGGAGGT-AGGACGAGGGCTT-GCTCTTGTCT----GTTATATCTTGGCG-GT---TTGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TG-GAG-TGT-TCCGGGTTCTCACGTGGTGTGCTGT-TTGTATAGCTTGC Globisporangium_macrosporum_UZ233 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCAGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGC-GGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGGCGGTGTGCGTGCTATTGCGTCGGAAGCGGCT--TTT-----GTTGCTCTGTGC-TTTGGT-GTTG------CTTGTTGCTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGTCGGGA-TTTCGGTCCTGGCT----GTTATATCTTGGTA-GT---TTGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TT-GAG-TGT-GCCGGGTTCTCATTTGGTGGACTGT-TTGGATAGCTTGC Globisporangium_mastophorum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCACGGCGAATTGTAGTCTATGGAGGC-GTTGTCAGTGCGACCGCTTGGGATAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTGCCCGAGT-GTGTT-GCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCTTGGCATATTT-CACTGGCGAGTGTGTGCGTACT-GTGTGTGGGAAGCGGCT--TTT-----GTTGCTCTCTAT-GCGGT--TCTG------CGTGTGCTTGGTGGT-GCCCTGTGTCTTGGTGGGACGTCAGAGTCAGTTTGTAA-ATTGCGGGAAATGGCT-GT--GGAGGAGGT-AGGTCGGGG--TTCGC-CCTGGCT----GTTATATCTCTGCG-GT---TAGTT-GTTGTGGTTGGGACTGAGGTGC-CTA---TAACGTGCGTTTT-GGG-TCT-AACGGGTTCTCGTTTCTCAGTCTGC-GTGGATAGCTTGC Globisporangium_multisporum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GCTGTCAGTGCAGGCATTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GCTTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGCATGTGCGCGTGCT-GTGTGTTGGAAGTGGC---TTT-----GCTGCTCCGCGT-ACGGT--TCTG------CGTGTGTGTGCTGGT-GCCCTGTGTCATGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--TGAGGAGGT-AGGTCAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTA-GC---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TG-AGG-TCT-TGCGGGTTCTTGCTTGGCGGTCTGT-CTGGATAGCTTGC Globisporangium_nunn_UZ041 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGGCCACTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GTGTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCTTGGCATATTT-CATTGGCGCGTGTGCGCGTGCT-GTGCGTTGGAAGCAGCG--TTT-----GTTGCTCCATGC-TTGGC--TCTG------CGTGTGCTTGCTGGT-GCCCTGTGTCTTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--CGAGGAGGT-AGGTCCGGG--TTCGC-CTGGGCT----GTTATATCTCGGTA-GT---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TT-GGG-TCT-GTGGGTCTCTCGTTTCTCAGCGTGT-CTGGATAGCTTGC Globisporangium_okanoganense_OPU1443 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GCTGTCAGTGCAGCCGCTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GGTTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGACTGTGTGCGTGCGA-TGCGTTGGAAGTGGCT--TTT-----GTCGCTCCATGT-GTTGTT-TCTG------CGTGCGGTTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAACGTCT-GT--TGAGGAGGT-AGGTCGGGAGCTT-GCTCTTGTCT----GTTATATCTTGGCG-GA---TTGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TG-GAG-TGT-TCCGGGTTCTCACGTGGTGTGCTGT-TTGTATAGCTTGC Globisporangium_paddicum_OPU1438 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GCTGTCAGTGCGGCCGCTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GGTTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGACTGTGTGCGTGCG-GCGCGTCGGAAGTGGCT--TTT-----GTCGCTCCGTGT-GTTGTT-TCTG------CGTGCGGTTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAACGGCT-GC--TGAGGAGGT-AGGACGAGGGCTT-GCTCTTGTCT----GTTATATCTTGGCG-GT---TTGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TG-GAG-TGT-TCCGGGTTCTCACGTGGTGTGCTGT-TTGTATAGCTTGC Globisporangium_paroecandrum_OPU466 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCGGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGC-GGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGGCGGTGTGCGTGCTTTTGCGTCGGAAGCGGC---TTTT----GTTGCTCTGTGCTTTTGC--TGTG------CGCGCTGTTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCC-GC--CGAGGAGGT-AGGTCAGGA-TTTCGGTCTTGGCT----GTTATATCTTGGTG-GT---TTGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TT-GAG-TGT-GCCGGGTTCTCATTTGGTGGACTGT-TTGGATAGCTTGC Globisporangium_perplexum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTAT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGGCCACTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GTGTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCTTGGCATATTT-CATTGGCGCGTGTGCGCGTGCT-GTGCGTTGGAAGCAAC---TT------GTTGCTCCATGC-TTGGC--TCTG------CGTGTGCTTGCTGAT-GCCCTGTGTCTTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGGT-AT--CGAGGAGGT-AGGTCGGGG--TTCGC-CTCGGCT----GTTATATCTCGGTA-TC---TAGTC-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TA-AGG-TCT-GTTGGGTTCTCGTTTCTCAGCCTGT-CTGGATAGCTTGC Globisporangium_pleroticum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GCTGTCAGTGCAGGCATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGT-GCTTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGCATGTGCGCGTGCT-GTGTGTTGGAAGTGGC---TTT-----GCTGCTCCGCGT-ATGGT--TCTG------CGTGTGTGTGCTGGT-GCCCTGTGTCATGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--TGAGGAGGT-AGGTCAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTA-GT---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TG-GGG-TCT-TGCGGGTTCTTGCTTGGCGGTCTGT-CTGGATAGCTTGC Globisporangium_polymastum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATGGAGGC-GTTATCAGTGCGGCCACTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGT-GTGTT-GTGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCTTGGCATATTT-CATTGGCGAGTGTGTGCGTGCT-GTGTGTGGGAAGCGGCC--TTGT----GTTGCTCTCTAT-GCGGT--TCTG------CGTGTGCTTGCTGGT-GCCCTGTGTCTTGGTGGGACGTCAGAGTCAGTTCGTAT-ATTGCGGGAAATGGCT-GT--GGAGGAGGT-AGGTCGGGG--TTCGC-CCTGGCT----GTTATATCTCTGCG-GT---TAGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCAT-TT-AGG-TCT-AATGGGTTCTCGTTTCTCAGTCTGC-GTGGATAGCTTGC Globisporangium_rostratifingens_OPU1440 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GTCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GGCGTCAGTGCAGGCATTCGGGGTAAGTTCCTTGGAAGAGGGCAGCATCGAGGGTGATACTCCCGTTTGTACATGAGT-GC-TT-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGTATGTGTGCGTGTC-GCGTGTTGGAAGTGTT-GATTCATCAT--CGCTCTTTGC-GCGAC--TGTG------CGTGTGTCTGCTGGT-GCCCTGTGTCATGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GT--TGAGGAGGT-AGGTCAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTA-GC---TAGTA-ATCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TG-GGG-TCA-TTCGGCTTCTCCTTTGGTTGTCTGC-TAGGATAGCTTGC Globisporangium_rostratifingens_UZ354 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GTCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GGCGTCAGTGCAGGCATTCGGGGTAAGTTCCTTGGAAGAGGGCAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GC-TT-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGTATGTGTGCGTGTC-GCGTGTTGGAAGTGTT-GATTCATCAT--CGCTCTTTGC-GCGAC--TGTG------CGTGTGTCTGCTGGT-GCCCTGTGTCATGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GT--TGAGGAGGT-AGGTCAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTA-GC---TAGTA-ATCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TG-GGG-TCA-TTCGGCTTCTCCTTTGGTTGTCTGC-TAGGATAGCTTGC Globisporangium_rostratum_OPU1441 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GTCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCAGGCAGTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGACACTCCCGTTTGTACCTGACT-GC-TT-GTGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGTATGTGTGCGTGTT-GCGAGGTGGAAGTGGT-AATTCATTAT--CGCTCTGCGC-GCGAC--TCTG------CGTGTGTCTGCTGTT-GCCCTGTGTCATGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--CGAGGAGGT-AGGTCAGAAGCTT-GCTTTTGGCT----GTTATATCTTGGTA-GC---TAGTG-ATCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TG-GGG-TCA-CTCGGACTCTCCTTTGGGTGCCTGC-TAGGATAGCTTGC Globisporangium_sp_UZ164 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCGGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGC-GGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGGCGGTGTGCGTGCCTTGGCTTTGGAAGCGGCT--TTT-----GTTGCTCTGTGC-TTTGGT-GTTG------CGCGTTGGTGCTAAT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AC--CGAGGAGGT-AGGTCAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTG-GT---TTGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TT-GAG-TGT-GCCGGGTTCTCATTTGGTGGACTGT-TTGGATAGCTTGC Globisporangium_sp_UZ182 TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTGCAGGCATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGT-GCTTT-GCGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCTCGCGTGCGCGTGCG-GGTAGTTGGAAGTAGC---TT------GCTGCTCCGCTG-TCGGT--TCTG------CGTGTGTTGGTTGGT-GCCCTGTGTCATGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGTT-AC--GGAGGAGGT-AGGTCAGGGGCTT-GCTCTTGGCT----GTTATATCTCTGTG-AC---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GGG-TCT-TTCGGATTCTTGCGCCGCGTGTCGT-TTGGATAGCTTGC Globisporangium_sp_UZ213 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCAGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGC-GGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGGCGGTGCGCGTGCTTTTGCGTCGGAAGCGGCT--TTT-----GTTGCTCTGTGC-TTTTGC-TGTG------CGTGTTGTTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGTCGAGA-TTTCGGTCTTGGCT----GTTATATCTTGGTG-GT---TTGTT-GTCGTGGTTGAGACTGAGGTGC-CTA---CAATGTGCTT-TT-GAG-TGT-GCCGGGTTCTCATTTGGTGGACTGT-TTGGATAGCTTGC Globisporangium_sp_UZ249 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GATGTCAGTGCAGCTATTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-AGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCG-GCGCGTAAGAAGTAGCT--T-------GCTGCTCTTTGT-GTTGT--TCTG------CGCTTGCTTGCTGGT-GCCCTGTGTCGTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--CGAGGAGGT-AGGTTAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTATGC---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TA-AAG-TCT-TGCGGTGTCTTATTTGGTTAACTGT-TTGGATAGCTTGC Globisporangium_sp_UZ252 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCACGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGGCCACTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GTGTT-GTGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCTTGGCATATTT-CATTGGCGAGTGTGCGTGTGTT-GAGTGTGGGAAGCGGCG--TGA-----GTTGCTCTCTGC-TTGGCGTTTTG------CGTGTGCTTGCTGGT-GCCCTGTGTCTTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GT--GGAGGAGGT-AGGTCGGGG--TTCGC-CTCGGCT----GTTATATCTCTGCG-GC---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTTA--CAACGTGCTTTTT-GGG-TCT-GTCGGGCTCTCGTTTCTCAGTCTGT-CTGGATAGCTTGC Globisporangium_sp_UZ253 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGGCCACTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GTGTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCTTGACATATTT-CATTGGCGCGTGTGCGCGTGTT-GAGCGTTGGAAGCAAC---TT------GTTGCTCCATGC-TTGGC--TCTG------CGTGTGCTTGCTGTT-GCCCTGTGTCTTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--TGAGGAGGT-AGGTCAGGG--TTCGC-CTTGGCT----GTTATATCTTGGTA-GC---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TT-GGG-TCT-GTTGGGTTCTCGTTTCTCAACTTGT-CTGGATAGCTTGC Globisporangium_sp_UZ260 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GCTGTCAGTGCAGGCATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGT-GCTTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGCATGTGCGCGTGCT-GTGTGTTGGAAGTGGC---TTT-----GCTGCTCCGCGT-ATGGT--TCTG------CGTGTGTGTGCTGGT-GCCCTGTGTCATGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--TGAGGAGGT-AGGTCAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTA-GT---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TG-AGG-TCT-TGCGGGTTCTTGCTTGGCGGTCTGT-CTGGATAGCTTGC Globisporangium_sp_UZ263 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GATGTCAGTGCAGCTATTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-AGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCGA-TGCGTAAGAAGTAGCT--T-------GCTGCTCTTTGT-GTTGT--TCTG------CGCTTGCTTGCTGGT-GCCCTGTGTCGTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--CGAGGAGGT-AGGTCAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTATGC---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TA-AAG-TCT-TGCGGTGTCTTATTTGGTTAACTGT-TTGGATAGCTTGC Globisporangium_sp_UZ275 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GCTGTCAGTGCAGGCATTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GCTTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGCATGTGCGCGTGCT-GTGTGTTGGAAGTGGC---TTT-----GCTGCTCCGCGT-ATGGT--TCTG------CGTGTGTGTGTTGGT-GCCCTGTGTCATGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--TGAGGAGGT-AGGTCAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTA-GC---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TG-AGG-TCT-TGCGGGTTCTTGCTTGGCGGTCTGT-CTGGATAGCTTGC Globisporangium_sp_UZ277 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGGCCACTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GTGTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCTTGGCATATTT-CATTGGCGCGTGTGCGCGTGCT-GTGCGTTGGAAGCAGCG--TTT-----GTTGCTCCATGC-TTGGC--TCTG------CGTGCGCTTGCTGAT-GCCCTGTGTCTTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--CGAGGAGGT-AGGTCCGGG--TTCGC-CTGGGCT----GTTATATCTCGGTA-GT---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TC-GGG-TCT-GTGGGTCTCTCGTTTCTCAGCGTGT-CTGGATAGCTTGC Globisporangium_sp_UZ284 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GATGTCAGTGCAGCTATTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-AGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCGA-TGCGTAAGAAGTAGCT--T-------GCTGCTCTTTGT-GTTGT--TCTG------CGCTTGCTTGCTGGT-GCCCTGTGTCGTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--CGAGGAGGT-AGGTTAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTATGC---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TA-AAG-TCT-TGCGGTGTCTTATTTGGTTAACTGT-TTGGATAGCTTGC Globisporangium_sp_UZ285 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----CTGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGGCCACTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GTGTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAG{GT}AGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCTTGACATATTT-CATTGGCGCGTGTGCGCGTGTT-GAGCGTTGGAAGCAAC---TT------GTTGCTCCATGC-TTGGC--TCTG------CGTGTGCTTGCTGTT-GCCCTGTGTCTTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--TGAGGAGGT-AGGTCAGGG--TTCGC-CTTGGCT----GTTATATCTTGGTA-GC---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TT-GGG-TCT-GTTGGGTTCTCGTTTCTCAACTTGT-CTGGATAGCTTGC Globisporangium_sp_UZ290 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GCTGTCAGTGCAGGCATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGT-GCTTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGCATGTGCGCGTGCT-GTGTGTTGGAAGTGGC---TTT-----GCTGCTCCGCGT-ATGGT--TCTG------CGTGTGTGTGCTGGT-GCCCTGTGTCATGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--TGAGGAGGT-AGGTCAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTA-GT---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TG-GGG-TCT-TGCGGGTTCTTGCTTGGCGGTCTGT-CTGGATAGCTTGC Globisporangium_sp_UZ304 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GCTGTCAGTGCAGGCATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GCTTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGCATGTGCGCGTGCT-GTGTGTTGGAAGTGGC---TTT-----GCTGCTCCGCGT-ATGGT--TCTG------CGTGTGTGTGCTGGT-GCCCTGTGTCATGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--TGAGGAGGT-AGGTCAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTA-GC---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TG-GGG-TCT-TGCGGGTTCTTGCTTGGCGGTCTGT-CTGGATAGCTTGC Globisporangium_sp_UZ318 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCGGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGC-GGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGGCGGTGTGCGTGCTTTTGCGTCGGAAGCGGCT--TTT-----GTTGCTCTGTGC-TTTTGC-TGTG------CGTGCTGTTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGTCGAGA-TTTCGGTCTTGGCT----GTTATATCTTGGTG-GT---TTGTT-GTCGTGGTTGAGACTGAGGTGC-CTA---CAATGTGCTT-TT-GAG-TGC-ACCGGGTTCTCATTTGGTGGACTGT-TTGGATAGCTTGC Globisporangium_sp_UZ382 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCGGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGC-GGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGGCGGTGTGCGTGCTTTTGCGTCGGAAGCGGC---TTTT----GTTGCTCTGTGCTTTTGC--TGTG------CGCGTTGTTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCC-GC--CGAGGAGGT-AGGTCAGGA-CTTCGGTCTTGGCT----GTTATATCTTGGTG-GT---TTGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TT-GAG-TGT-GCCGGGTTCTCATTTGGTGGACTGT-TTGGATAGCTTGC Globisporangium_sp_UZ400 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCGGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGC-GGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGGCGGTGTGCGTGCTTTTGCGTCGGAAGCGGCT--TTT-----GTTGCTCTGTGC-TTTTGC-TGTG------CGTGCTGTTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGTCAGGA-TTTCGGTCTTGGCT----GTTATATCTTGGTG-GT---TTGTT-GTCGTGGTTGAGACTGAGGTGC-CTA---CAATGTGCTT-TT-GAG-TGT-GCCGGGTTCTCATTTGGTGGACTGT-TTGGATAGCTTGC Globisporangium_sp_UZ416 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GTCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GGCGTCAGTGCAGGCATTCGGGGTAAGTTCCTTGGAAGAGGGCAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GC-TT-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGTATGTGTGCGTGTT-GCGTGTTGGAAGTGTT-GATTCATCAT--CGCTCTTTGC-GCGAC--TGTG------CGTGCGTCTGCTGGT-GCCCTGTGTCATGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GT--TGAGGAGGT-AGGTCAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTA-GC---TAGTA-ATCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TG-GGG-TCA-TTCGGCTTCTCCTTTGGTTGTGTGC-TAGGATAGCTTGC Globisporangium_sp_UZ594 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GCTGTCAGTGCAGGCATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGT-GCTTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGCATGTGCGCGTGCT-GTGTGTTGGAAGTGGC---TTT-----GCTGCTCCGCGT-ATGGT--TCTG------CGTGTGTGTGCTGGT-GCCCTGTGTCATGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--TAAGGAGGT-AGGTCAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTA-GT---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TG-GGG-TCT-TGCGGGTTCTTGCTTGGCGGCCTGT-CTGGATAGCTTGC Globisporangium_sp_UZ636 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GCTGTCAGTGCAGGCATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGT-GCTTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGCATGTGCGCGTGCT-GTGTGTTGGAAGTGGC---TCT-----GCTGCTCCGCGT-ATGGT--TCTG------CGTGTGTGTGCTGGT-GCCCTGTGTCATGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AT--TGAGGAGGT-AGGTCAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTA-GT---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TG-GGG-TCT-TGCGGGTTCTTGCTTGGCGGTCTGT-CTGGATAGCTTGC Globisporangium_sp_ZSF0030 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCGGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGC-GGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGGCTTCGTGCGTGCTATTGTTTCGGAAGCGGCT--TTT-----GTTGCTCTGTGC-TTTGGT-GTTG------CTTGTTGGTGCTGAT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCC-GC--CGAGGAGGT-AGGTCAGGA-CTTTTGTCTTGGCT----GTTATATCTTGGTG-GT---TTGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TT-GAG-TGT-TCCGGGTTCTCATTTGGTGGACTGT-TTGGATAGCTTGC Globisporangium_sp_ZSF0069 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GATGTCAGTGCGGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGC-GGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGGCTTCGTGCGTGCTATTGTTTCGGAAGCGGCT--TTT-----GTTGCTCTGTGC-TTTGGT-GTTG------CTTGTTGGTGCTAAT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGTCGGGA-CTTTTGTCTTGGCT----GTTATATCTTGGTG-GT---TTGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TT-GAG-TGT-TCCGGGTTCTCATTTGGTGGACTGT-TTGGATAGCTTGC Globisporangium_spinosum_UZ150 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCGGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGC-GGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGGCGGTGTGCGTGCTTTTGCATCGGAAGCGGC---TTTT----GTTGCTCTGTGCTTTTGC--TGTG------CGTGCTGTTGCTGGT-GCCCTGTGTTGTAGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--TGAGGAGGT-AGGTCAGGA-CTTCGGTCTTGGCT----GTTATATCTTGGTA-GT---TTGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TT-GAG-TGT-GCCGGGTTCTCATTTGGTGGACTGT-TTGGATAGCTTGC Globisporangium_spinosum_UZ405 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCGGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGC-GGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGGCGGTGTGCGTGCTTTTGCATCGGAAGCGGC---TTTT----GTTGCTCTGTGCTTTTGC--TGTG------CGTGCTGTTGCTGGT-GCCCTGTGTTGTAGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--TGAGGAGGT-AGGTCAGGA-CTTCGGTCTTGGCT----GTTATATCTTGGTG-GT---TTGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TT-GAG-TGT-GCCGGGTTCTCATTTGGTGGACTGT-TTGGATAGCTTGC Globisporangium_splendens_UZ174 TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GCTGTCAGTGCAGCTATTTGGGATAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTGCCTGAGT-AGCTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGAGTAGGTGCGTGC-AGTATGTAGGAAGTGGTT--T-------TCTGCTCCTTGT-GCTGT--TGTG------CGTTTGCTTGTTGGT-GCCCTGTGTCGCGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGTGAGAAATGGCT-AC--TGAGGAGGT-AGGCTAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTA-GT---TAGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TA-AAG-TCT-TGGGGACTCTCGTTTGGTTACCTGT-TTGGATAGCTTGC Globisporangium_sylvaticum_UZ307 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATAGAGGC-GTTGTCAGTGCGGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGC-GGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGGCGGTGCGCGTGCTTTTGCGTCGGAAGCGGC---TTTT----GTTGCTCTGTGCTTTTGC--TGTG------CGTGCTGTTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCC-GC--CGAGGAGGT-AGGTCAGGA-CTTCGGTCTTGGCT----GTTATATCTTGGTG-GT---TTGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TT-GAG-TGT-GCCGGGTTCTCATTTGGTGGACTGT-TTGGATAGCTTGC Globisporangium_ultimum_spo_OPU465 TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTAT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GCTGTCAGTGCAGCTATTTGGGATAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTGCCTGAGT-AGCTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTAGCATATTT-CATTGGCGAGTAGGTGCGTGT-AGTACGTAAGAAGTGGTT--T-------TCTGCTCTTTGT-GCTAT--TCTG------CATTTGCTTGTTGGT-GCCCTGTGTTGCAGTGGGACGTCAGAGTCAGTTCGTAT-GCTGTGAGAAATGGCT-AC--TGAGGAGGT-AGGTTAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTA-GT---TAGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TA-AAG-TCT-TTGGGACTCTCGTTTGATTAGCTGT-TTGGATAGCTTGC Globisporangium_ultimum_ult_UZ056 TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTAT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GCTGTCAGTGCAGCTATTTGGGATAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTGCCTGAGT-AGCTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTAGCATATTT-CATTGGCGAGTAGGTGCGTGC-AGTATGTAAGAAGTGGTT--T-------TCTGCTCTTTGT-GCTGT--TCTG------CGTTTGCTTGTTGGT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGTGAGAAATGGCT-AC--TGAGGAGGT-AGGTTAGGAGCTT-GCTCTTGGCT----GTTATATCTTGGTA-GT---TAGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TA-AAG-TGT-TTGGGACTCTCGTTTGGTTACCTGT-TTGGATAGCTTGC Globisporangium_uncinulatum_Py2 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCACGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGGCCACTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGT-GTGTT-GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCTTGGCATATTT-CATTGGCGAGTGTGTGCGTGCT-GTGTGTGGGAAGCGGCC--TTGT----GTTGCTCTCTAT-GCGGT--TCTG------CGTGTGCTTGCTGGT-GCCCTGTGTCTTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GT--GGAGGAGGT-AGGTCGGGG--TTCGC-CCCGGCT----GTTATATCTCTGCG-GC---TAGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCAA-TT-GGG-TCT-AACGGGTTCTCGTTTCTCAGCCTGC-GTGGATAGCTTGC Halophytophthora_avicenniae TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-GCACGTT-----GTGCGCGGCGAATTGTAGTCTATTGATGC-GTGATCAGCGCGGACGCTCGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTTGTACCTGAGT-GTTTT-GCGCGTACGGTCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCTGCGGCATATTT-CACGTGCGAGTGCGTGCGTTTCGGCTTGGTGGCAGCGGTC--TTTT---GGCTGCGCCCGTT-GCTGT-TTGTG------CGTGTGCTTGCGTGT-GCCCTGTGCTGCGGTGGGACGTCAGGGTCAGTTCGTAT-GCTGCGGGAAATGGCC-GT--CGGGGAGGT-AGGTCTTGAGCTCTGCTTTTGGCT----ATTATATCTCGGCGGTT---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-CGC-GTGCGTGTCTCTGTGTGCGCGCTGT-GCGGATAGCTTGC Halophytophthora_polymorphica TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-GCACGTT-----GTGCGCGGCGAATTGTAGTCTATAGAAGC-GTGATCAGCGCGGGCGCCCGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTTGTACCTGGGT-GCTGT-GCGCGTACGGTCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCTGCGGCATATTT-CACGGGCGAGCGCGTGCGTTTCGGCTTTGTGGCAGCGGCCC-TTTTTG-GTCTGCGCCCGTT-GCTGT-TTGTG------CGTGCGCTTGGCTGT-GCCCTGTGCCGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCC-GT--CGGGGAGGT-AGGTCTTAAGCTCCGCTTTTGGCT----ATTATATCTCGGCGGTT---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-CGC-GTGCGCGTCTCTGTGTGCGCGGTCT-GCGGATAGCTTGC Hyaloperonospora_barbareae TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTCACAAATTTA-TTTTGTGCGGCGAATTGTAGTCTATAGAAGC-GTGGTCAGTGTAGGCGCTTGGGTTAAGTTCCTTGAAAAAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-GTCTT-ATGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGGATCGTTT-CTAGTGTCTATAATCCGTGACATATTT-CATTGGCGGGCGTGTGCGTATGTGTACTATGGCAGCGGCTA-ATT----GGCTGCGCTTGGT-GTGCG-TGCTG------TGTGTGCTTACTGGT-GCCCTGTGTTATGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AC--TGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGTT-----TT--GTCGTGGTTGGGACTGAGGTGTTCTA---CAACGTGCTC-TT-GAG-TGG-GTCTGCGTCTCCGTGTGCACCGTGT-GCAGATAGCTTGC Hyaloperonospora_brassicae TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTCACAAATTTA-TTTTGTGCGGCGAATTGTAGTCTATAGAGGC-GTGATCAGTGTAGGTACTTGAGATAAGTTTCTTGAAAAAGAACAGCATGGAGGGTGACACTCCCGTTCATACTTAAGT-GGCTT-GCACGTACGATCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTCTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CTAGTGTCTATAATCTATGACATATTC-CATTGGGAAGTGTGTGCGTGTGTATACTATGGCAGCGGCT--TTTTTTAAGCTGCGCTTGGT-GTGCG-TGCTG------TATGTGCTAACTGGT-GCCCTGTGTTATAGTGGGACGTCAAGGTCAGTTTGTAT-GCTGCGGGAAATGGCT-AC--TAGGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----ATTATATCTTGGTAGTT-----GT--GTCGTGGTTGAGACTGAGGTGTTCTA---CAACGTGCTT-AT-GAG-TGG-GTCTGTGTCTCCGTGTGCGCCGTGT-GCAGATAGCTTGC Hyaloperonospora_dentariae TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTCACAAATTTA-TTTTGTGCGGCGAATTGTAGTCTATAGAGGC-GTGATCAGTGTAGGCGCTTGAGGTAAGTTCCTTGAAAAAGGACAGCATGGAGGGTGAAACTCCCGTTCATACTTAAGT-GGCTT-GCACGTACGATTCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTCTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCAAATCGTTT-CTAGTGTCTATAATCTATGACATATTT-CATTGGGAAGTGTGTGCGTGTGTATACTATGGCAGCGGCT--TTTTTTA-GTTGCGCTTGGT-GTGCG-TGCTG------TATGTACTAACTGAT-GCCCTGTGTTATAGTGGGACGTCAAGGTCAGTTTGTAT-ACTGCGGGAAATGGCT-AC--TGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----ATTATATCTTGGTAGTT-----GT--GTCGTGGTTGAGACTGAGGTGTTCTA---CAACGTGCTT-AT-GAG-TGG-GTCTACGTCTCCGTGTGCGCCGTGT-GCAGATAGCTTGC Hyaloperonospora_niessliana TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTCACAAATTTA-TTTTGTGCGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTGTAGGCACTTGAGATAAGTTCCTTGAAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATACTTGAGT-GGCTT-ATGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGGATCGTTT-CTAGTGTCTATAATCTGTGACATATTT-CATTGGGGAGTGTATGCGTGTGTATACTGTGGCAGCGGCTA-TTTTT--GGCTGCGCTCGGT-GTGCG-TGCTG------TATGCGCTTACTGGT-GCCCTGTGTTGCGGTGGGACGTCAAGGTCGGTTTGTAT-ACTGCGGGAAATGGCT-AC--TGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGTT-----GT--GTCGTGGTTGAGACTGAGGTGT-CTA---CAACGTGCTT-TT-GAG-TGA-GTCTGTGTCTCCGTGTGCACCGTGT-GCGGATAGCTTGC Hyaloperonospora_parasitica TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGACACGAATTGAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTGTAAACACTTGGGTTAAGTTCCTTGAAAAAGGACAGCAATGAGGGTGATACTCCCGTTCATACTTAAGT-TGTTT-ATGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CTAGTGTCTATAATCTGTGACATATTT-CATTGGGGAGTGTGTGCGTGTGTATACCATGGCAGTGGCTAATTTATT-GGCTGCGCTAGGT-GTGCG-TGCTG------TATGTGCTTACTGGT-GCCCTGTGTTACGGTGGGACGTCAAAGTAGGTTTGTAT-GCTGCGGGAAATGGCT-AC--TGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGTT-----GT--GTCGTGGTTGAGACTGAGGTGTTCTA---TAACGTGCTT-TT-GAG-TGG-GTCTGATTCTCCGTGTGTACCGTGT-GCAGATAGCTTGC Hyaloperonospora_thlaspeos_arvensis TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTCACAAATTTA-TTTTGTGCGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTGTGGGCGCTTGAGATAAGTTCCTTGAAAGAGGACAGCATGGAGGGTGATACTCCCGTTTATTCTTGAGT-GGCTT-ATGCGTAAGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGGATCGTTT-CTAGTGTCTATAATCTGTGACATATTT-CATCGGAGAGTGTGTGCGTGTGTATACTATGGCAGCGGCTA-TTTTTT-GGCTGCGCTTGGT-GTGTG-TGCTG------TGTGCGCTTACTGGT-GCCCTGTGTTGCGGTGGGACGTCAAGGTCGGTTTGTAT-ACTGCGGGAAATGGCT-AC--TGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----ATTATATCTTGGTGGTT-----GT--GTCGTGGTTGAGACTGAGGTGT-CTA---CAACGTGTTT-TT-GAG-TGA-GACTGTGTCTCCGTGTGCACCGTGT-GCGGATAGCTTGC Isoachlya_toruloides TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT-----TTACATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATTTGGGATAAGTCCCTTGGAAAAGGGCAGCATAGAGGGTGATACTCCCGTCTTTGCTCAGAT-TGTCT-ATGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTAACATGT-CCAGTGT-TGTATCTTGT-GCATATTT-CATTAGT------------------------GGAGCA--------------------------------------------ATTT----ACTGGT-GCCCTGTGCATGAGTGTGACGTCAAAGTCAGTTTGTAT-GCTGCGGGAGATGGTT-AG--CAAGGAGGT-GCGTC----ACTT---TTGTGTCA----GTTATACCTTGTTA-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCTTATA-GAG-TAT-ATTGTTGTCTCGTTATTATATCTGT-TTGGATAGCTTGC Lagenidium_callinectes TGAAGCGGGATGAGCTCAAACTTAAAATCTCCAT-ACAAGTT-----TTGTGTGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGGTTATCTGGGATAAGTCTCTTGGAAAAGAGCAGCATCGAGGGTGATACTCCCGTTTGTGCCTAGAT-AGCTT-GCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTAT-CCAGTGTCTATAATCTGCAGCATATTT-CATTGGCGAGTCGATGCGTGTT-TTGTGTTGGTAGTTCGT---------AAGATCGCCGCGC-GGAAT--TCTG------CATTTGCTTGCTGGT-GCCCTGTGTTGTGGTGTGACGTCAGAGTCAGTTCGTAT-ACCGCGGGAAATGGCT-AAT-AGAGGAGGT-AGGTCAGGTGCTT-GCACTCGACT----GTTATATCTTTGTTAGC---TAGTG-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT--A-GAG-TCTTGCGGGTG-CTTGTCTGGTCGACTGC-TTGGATTGCTTGC Lagenidium_chthamalophilum TGAAGCGGGATGAGCTCAAACTTAAAATCTCCAT-ACAAGTT-----TTGTGTGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGGTTATCTGGGATAAGTCTCTTGGAAAAGAGCAGCATCGAGGGTGATACTCCCGTTTGTGCCTAGAT-AGCTT-GCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTAT-CCAGTGTCTATAATCTGCAGCATATTT-CATTGGCGAGTCGATGCGTGTT-TTGTGTTGGTAGTTCGT---------AAGATCGCCGCGC-GGAAT--TCTG------CATTTGCTTGCTGGT-GCCCTGTGTTGTGGTGTGACGTCAGAGTCAGTTCGTAT-ACCGCGGGAAATGGCT-AAT-AGAGGAGGT-AGGTCAGGTGCTT-GCACTCGACT----GTTATATCTTTGTTAGC---TAGTG-TTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT--A-GAGCTCTTGCGGGTG-CTTGTCTGGTCGAC-GC-TTGGATTGCTTGC Lagenidium_myophilum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTATCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTC--GCGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTT-CATTGGTGCGTAAGTGCGTGCA-GCGTTTTGGAAGTAGTT--TT-------CTGCTCCTGTC-GTTGT--TGTG------CATTTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTAT-GTTGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----ACTTCG---GTGGCT----GTTATATCCTGATA-AC---TAGTC-GTCGTGGCTGAGACTGAGGTGC-CTA---CAATGTGCTT-TC-GAG-TCT-GCGGGCTTCTCGTGTTGCTGTTTGC-TTGGATAGCTTGC Lagenidium_thermophilum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCAT-GCAAGTT-----TTGCGTGGCGAATTGTAGTCTATAGAGGC-GCTGTCAGTGCGGCTGTCTGGGATAAGTCTCTTGGAAAAGAGCAGCATCGAGGGTGATACTCCCGTTTGTGCCTGGGC-AGCTT-GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTAT-CCAGTGTCTATAATCCGCAGCATATTT-CATTGGCGAGTAGGTGCGTGCAGTGTTGTTGGCAGTTCGT---------AAGGACGCCGCGC-GTTGT--TCTG------CATTTGCTTGCTGGT-GCCCTGTGTTGTGGTGGGACGTCAGAGTCAGTTCGTAT-GCCGCGGGAAATGGCT-GAT-TGAGGAGGT-AGGTCAGGTGCTT-GCGCTTGACT----ATTATATCTCGATGAGC---TAGTC-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT--A-GAG-TCTTGCGGGTG-CTTGTCTGGTCAACTGT-TTGGATTGCTTGC Leptolegnia_caudata TGAAGCGGGAAGAGCTCAAACTTAAAATCTCTAC-----GTT------TACGTAGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGACCTGGGAGAAGTCCCTTGGAAAAGGGCAGCAAAGAGGGTGATACTCCCGTCTCTGCTCAGGT-TGTCT-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TGTATCCTGT-GCATATTT-CATTAGC------------------------GGAGCA--------------------------------------------ATTT----GCTGGT-GCCCTGTGCATGGGTGTGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAGATGGTT-AG--TAAGGAGGT-GATTC----ACTTCG---GTGAAA----GTTATACCTTGCTA-TC---TAGTT-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCTC-TG-GG-TTCA-G-TGCTGTCTCGTTTTGGTGACTGC-TTGGATAGCTTGC Leptomitus_lacteus TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTAT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCACGGCGATTTGGGACAAGTCCCTTGGAAAAGGGCAGCATAGAGGGTGATACTCCCGTCTCTGCTCAAGT-C-GCTTGTGTGTACGATACGCTTTCTTTGAGTCGAGTTGCTTGGGAATGCAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATAGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAATCGTATCGTTT-CCAGTGTCT-TATCCTTT-GCATATTT-CATTAGC------------------------GGAGCA--------------------------------------------ATTT----GCTGGT-GCCCTGTGTATTGGTGTGACGTCAGAGTCAGTTTGTAT-GTCGCGGGAGATGGTT-AT--CAAGGAGGT-ATTCTAGGCATGA---ATTTGTTTAGTTGTTATATCTTGGTA-TC---TAGTA--CCGTGGCTGAGACTGAGGTGC-CTA---CAACATGCCT-TG-GGGATCTGCTGG-TGTCTCATCTGAGTAATTGT-TTGGATAGCTTGC Ovatisporangium_boreale TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGC-GCAAGTT-----TTGCGCGGCGAATTGTAGTCTATAGACGC-TAAATCAGTGCGGCTATTCGGGTTAAGTTCCTTGGAAGAGGACAGCAATGAGGGTGATACTCCCGTTTGTACCTGAGT-ATGTT-GCACGTACGATTTGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCCTCGGCATATTT-CATTGCTGTGCGGGGCTGTGTC-GCGCGTTGGTAGTAGT---TTGTT----CTGCGCTGCGT-GTGTCGTTCGG-------CTTTGCTCGGCGGT-GCCCTGTGTCGTGGTGGGACGTCAGAGTCAGTTCGTGT-GCTGCGGGAAATGGCT-GT--CGAGGAGGT-AGGTCAGGAGCTT-GCTTCTGGCT----GTTATATCTTGGCGTGC---TAGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTTTTT-GAG-TGT-TTGTGCGTCTCTGTGTGCGTCCGGA-TTGGATAGCTTGC Ovatisporangium_cucurbitacearum TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATGGATGC-GCTATCAGTGCAGCCGCGCGGGCCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCCTGCCTGTGC-GTGTT-GTGCGTACGATGCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCTGCGGCATATTT-CATTGTCGGATGCGGCCGTGCGGCGCGTTTGGTAGTGGGT--TCGTC----CTGCACCGCGT-GTTGC-TGTGG-------TTGCGTTTGGTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTCGTGT-GCTGCGGGAAATGGCT-GC--TGGGGAGGT-AGGTCGGGGG-TTCGCCCTCGGCT----GTTATATCCTGGCGGAC---TAGTC-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGC-GGAGGTTTCTTCGTTTGCGCGTCGG-TTGGATAGCTTGC Ovatisporangium_helicoides TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGG-TCAGGTT-----CTGGTCGGCGAATTGTAGTCTATAGACGC-GTTATCAGTGTGGCCGGTCGGGGTAAGTTCCTTGGAAGAGGACAGCAATGAGGGTGATACTCCCGTTTGTACCTGATT-GTGTT-GCGCGTACGATGCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCCTTGGCATATTT-CATTGCCGTGTCTGTTTGTTCC-GCGTGTTTGTAGCAGT---TTGTT----CTGTGCATTGC-GTGGT-TGTGA-------GCGGTCGTGGCGGT-GCCCTGTGCTTTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGTC-GT--GCAGGAGGT-AGGTCGGGGGCTT-GCTCTCGGCT----GTTATATCTGTGCGTGC---CAGTA-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TCT-TTGGGTCGCTCTGTGCGCGCGTGTG-CGGGATAGCTTGC Ovatisporangium_oedichilum TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGC-GCAAGTT-----TTGCGTGGCGAATTGTAGTCTATAGACGC-GTAATCAGTGCGGCTGCTCGGGATAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTTGTGCCTGAGC-ATGTT-GCGCGTACGATTTGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCGTCGGCATATTT-CATTGCTGTGCGGGTCTGTGTC-GCGCGTTGGTAGTAGT---TTGTT----CTGCGCCGCGT-GTGTCGTTCAG-------GTTTGCTCGGCGGT-GCCCTGTGTCGGTGTGGGACGTCAGAGTCAGTTCGTGT-GCTGCGGGAAATGGCT-GT--CGAGGAGGT-AGGTCAGGAG-TTCGCTTTTGGCT----GTTATATCTTGGCGTGC---TAGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGC-GTGTGCGTCTCTGTTTGCGTGCGAG-TTGGATAGCTTGC Ovatisporangium_ostracodes TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGC-GCAAGTT-----TTGCGCGGCGAATTGTAGTCTATAGACGC-GATATCAGTGCGGCTATTCGGGGTAAGTTCCTTGGAAGAGGACAGCAATGAGGGTGATACTCCCGTTTGTACCTGAGT-ATGTT-GCACGTACGATGCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCCATGGCATATTT-CATTGCTGTGCGGGGCTGTGTC-GCGCATTGGTAGTAGT---TTGTT----CTGCACCGTGT-GTGGC-TGTGG-------CTTTGCTCGGCGGT-GCCCTGTGTCGTGGTGGGACGTCAGAGTCAGTTCGTGT-GCTGCGGGAAATGGCT-GT--CGAGGAGGT-AGGTCAGGAGCTT-GCTTTTGGCT----GTTATATCTCGGCGTGC---TAGTT-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTTTTTCGAG-TGT-TTGTGCGTCTCTGTGCGCGTCCGGA-TTGGATAGCTTGC Ovatisporangium_sp_UZ230 TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGC-GCAAGTT-----TTGCGCGGCGAATTGTAGTCTATAGACGC-GGCATCAGTGCGGCCGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCAATGAGGGTGATACTCCCGTTTGTACCCGAGT-GTGTT-GCACGTACGATGCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCCGCTGCATATTT-CATTGCTGTGCGAGTCCGTGTC-GCGCGTTGGTAGTAGT---TTGTT----CTGCACCGCGC-GTGTC-TGTGG-------GTTTGCTCGGCGGT-GCCCTGTGCGGTGGTGGGACGTCAGAGTCAGTTCGTGTTGCTGCGGGAAATGGCT-GT--CGAGGAGGT-AGGTCAGGAGCTT-GCTTTTGGCT----GTTATATCTTGGCTTGC---TAGTT-GTCGTGGTTGGGACTGAGGTGC-CTTA--CAACGTGCTTTTG-GAG-TGT-GTGTGCGTCTCTGTGTGCGTCCGGA-TTGGATAGCTTGC Ovatisporangium_sp_UZ248 TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGT-GCAGGTT-----CTGCTCGGCGAATTGTAGTCTATGGATGC-GTTATCAGTGTGGCCGGTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGACT-GTGTT-GCGCGTACGATGCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCCTTGGCATATTT-CATTGGTGCGAGTGTCTGTTCC-GCGTGCGTGTATCAGT---TTGTT----CTGTGCTGCGC-GTGGT-TGTGG-------GTGCTTGTGCCGGT-GCCCTGTGCTTTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGTC-GT--GCAGGAGGT-AGGTCGGGGGCTT-GCTCTCGGCT----GTTATATCTGTGCGTGC---CAGTA-GTCGTGGCTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TCT-TTGGGTCGCTCTGTGCGCGCGCGTG-CGGGATAGCTTGC Ovatisporangium_sp_UZ287 TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATGGATGC-GCTATCAGTGCAGCCGCGCGGGCCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCCTGCCTGTGC-GTGTT-GTGCGTACGATGCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCTGCGGCATATTT-CATTGTCGGATGCGGCCGTGTGGCGCGTTTGGTAGTGGGT--TCGTC----CTGCACCGCGT-GTTGC-TGTGG-------TTGCGTTTGGTGAT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--TGGGGAGGT-AGGTCGGGGG-TTCGCCCTCGGCT----GTTATATCCTGGTGGAC---TAGTC-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGC-AGAGGTTTCTTCGTTTGCGCGTCGG-TTGGATAGCTTGC Ovatisporangium_sp_UZ392 TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATGGATGC-GCTATCAGTACAGCCGCGCGGGCCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCCTGCCTGTGC-GTGTT-GTGCGTACGATGCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCTGCGGCATATTT-CATTGTCGGATGCGGCCGTGCGGCGCGTTTGGTAGTGGGT--TCGTC----CTGCACCGCGT-GTTGC-TGTGG-------TTGTGTTTGGTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGTT-GC--TGGGGAGGT-AGGTCGGGGG-TTCGCCCTCGGCT----GTTATATCCTGGTGGAC---TAGTC-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGT-GGAGGTTTCTTCGTTTGCGCGTCGG-TTGGATAGCTTGC Ovatisporangium_sp_UZ612 TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGT-GCAGGTT-----CTGCTCGGCGAATTGTAGTCTATGGATGC-GTTATCAGTGTGGCCGGTCGGGGTAAGTTCCTTGGAAGAGGACAGCAATGAGGGTGATACTCCCGTTTGTACCTGATT-GTGTT-GCGCGTACGATGCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCCTTGGCATATTT-CATTGCCGCGTCTGTTTGTTCT-GCGTGTTTGTAGCAGT---TTGTT----CTGTGCTGCGC-GTGGT-TGTGG-------GCGGTCGTGGCGGT-GCCCTGTGCTTTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGTC-GT--GCAGGAGGT-AGGTCGGGGG-TTCGCTCTCGGCT----GTTATATCTGTGCGTGC---CAGTC-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TCT-TTGGGTCGCTCTGTGCGCGCGTCGG-CGGGATAGCTTGC Ovatisporangium_vexans_UZ215 TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATGGATGC-GCTATCAGTACAGCCGCGCGGGCCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCCTGCCTGTGC-GTGTT-GTGCGTACGATGCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCTGCGGCATATTT-CATTGTCGGATGCGGCCGTGCGGCGCGTTTGGTAGTGGGT--TCGTC----CTGCACCGCGT-GTTGC-TGTGG-------TTGTGTTTGGTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--TGGGGAGGT-AGGTCGGGGG-TTCGCCCTCGGCT----GTTATATCCTGGTGGAC---TAGTC-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGT-GGAGGTTTCTTCGTTTGCGCGTCGG-TTGGATAGCTTGC Ovatisporangium_vexans_UZ309 TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATGGATGC-GTTATCAGTACAGCCGCGCGGGCCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCCTGCCTGTGC-GTGTT-GTGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCTGCGGCATATTT-CATTGTCGGATGCGGCCGTGCGGCGCGTTTGGTAGTGGGT--TCGTC----CTGCACCGCGT-GTTGC-TGTGG-------TTGTGTTTGGTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--TGGGGAGGT-AGGTCGGGGG-TTCGCCCTCGGCT----GTTATATCCTGGTGGAC---TAGTC-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGT-GGAGGTTTCTTCGTTTGCGCGTCGG-TTGGATAGCTTGC Pachymetra_chaunorhiza TGAAGCGG-AAAAGCTCAAGCTTAAAATCTCCAC-GC------------AAGTGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGACCTGGGACAAGTCCCTTGGAAGAGGGCAGCATGGAGGGTGATACTCCCGTCTCTGCTCAGGT-TGTCT-GTGTGTACGACACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATAGTCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CTAGTGT-T-TATCCTAT-GCATATTT-CATTGGC-----------------------GGTTGCAA-------------------------------------------AATT----GCTGGT-GCCCTGTGTATGGGTGTGACGTCAGAGTCAGTTTGAAT---TGCGGGAGATGGGT-AG--TGAGGAGGT-GCGTC----ACAT---TTGTGAAA----GTTACAGCTCGCTA-TC---TAGTA-ACCGTGGTTTAGACTGAGGTGC-CTA---CAACATGCTT-TG-GGG-TGT-ATGATGTTGTCGTGTGATGTATTGC-TTGGATAGCTTGC Paraperonospora_leptosperma TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-GCAAATT-----TTGCACGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCATCGGCACTTGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTTATCCCTGAGT-TGCTT-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGTAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCAAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTATGGCAGCGGCT--TTTT----GCTGCGCTTGGT-GTGTG-TGCTG------TGTGTGCTTGCTGGT-GCCCTGTGCCGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AC--TGAGGAGGT-AGGACTTACGTTT-TCGTTTGTCT----GTTACATCTTAGTGGAC---GAGTT-GTCGCGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-AT-GAG-TGG-GATTGAATCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Peronospora_aestivalis TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ACAAATT-----TTGTGCGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGCGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGTGGCT--TTTT----GCTGCGCTCGGT-GCGTG-TGCTG------TGTATGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAACGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTAGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGCATTTCCGTGTGTGCCGTGT-GCGGATAGCTTGC Peronospora_alsinearum TGAAGCGGGATGAGCTCAAGCTTAAAATCTTCGT-ACAAGTT-----TTGTATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGACGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTACAATCCGTGGCATATTTTCATTGGCGAGTGTGTGCGTGCGTGTGCT-TCGCAGCAGCC--ATG----AGCTGCGCTTGGC-GCGTG-TGGTG------TGTGTACTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAATGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGTGTCTTCGTGTGTACCGTGT-GCGGATAGCTTGC Peronospora_aparines TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCG--ACAAGTT-----TTGTATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTA-CATTGGCGAGTGTGTGCGTGCGTGTGCTATGGCAGCGGCT--TTT----GGCTGCGCTTGGC-GTGTG-TGCAG------TGTGTGCTTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----ATTATATCTTGGTGGAC---GAGTC-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-GT-GAG-TGG-GTCTGCGTCTCCGTGTGTGCTGTGT-GCGGATAGCTTGC Peronospora_arvensis T-AAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ACAAATT-----TTGTATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGCAAGTACTTGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTTATCCCTGAGT-GGCTT-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTTGCTAGGGTGCTGGTGCATGTGCTGTAGCAGTGGCC--TTCT---GGCTGCGCTTGGC-GCGTG-TGTTG------TGTGCGCTTGCCGAT-GCCCTGTGCTGCGGTGGGACGTCAATGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTAGAC---TAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTCTGCGTCTCTTTGTGCGCCGTGT-GCAGATAGCTTGC Peronospora_boni_henrici TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ACAAGTT-----TTGTACGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCGCTTAGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTATGGCAGCGGCC--TTTT---GGCTGCGCTTGGC-GCGTG-TGCTG------TGTATGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAATGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTCTGTGTCTCCGTGTGTACCGTGT-GCGGATAGCTTGC Peronospora_bulbocapni TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ACAAGTT-----TTGTACGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTAC-ACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCC--TTT----GGCTGCGCTTGGC-GCGTG-TGGTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAATGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGTGTCTCCGTGTGTGCCGTGT-GCGGATAGCTTGC Peronospora_calotheca TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ACAAGTT-----TTGTATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTA-CATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCT--TTT----GGCTGCGCTTGGC-GTGTG-TGCAG------TGTGTGCTTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-AT-GAG-TGG-GTCTGCGTCTCCGTGTGTGCTGTGT-GCGGATAGCTTGC Peronospora_conglomerata TGAAGC-GGATGAGCTCAAGCTTAAAATCTCCGT-ACAAGTT-----TTGTATGGCGAATTGTAG-CTATAGAGGC-GTGGT--GCATGAGCACTTGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTTATCCCTGAGT-GGCTT-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CTAGTGTCTATAATCCGTGATATATTT-CATTAACAAGTTTATACGGGCGGGCGTTGTGGAAGCGGCC--TTTTT--GGCTGCACCCGGC-GTTCG-TATTGACGGCGTGTTTACTTGTTGAT-GCCCTGTGCTGCGGTGGGACGTCAACGTCAGTTTGTAT-GCTGCGGGAAATGGCT-AT--TGAGGAGGT-AGGGCTTACGCTT-GCGTTTGCCT----GTTATATCTTGATAGAC---TAGTA-GTCGCGGTTGAGACTGAGGTGC-CTAT-GCAACGTGCTT-TT-GAG-TGT-GTCTGCGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Peronospora_ficariae TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ACAAGTT-----TTGTACGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCTCTTGGGGCAAGTTCCTTGGAAAAGGACAGCATGGAGGGTGATACTCCCGTTCATCTCCGAGT-GGCTC-GTGCGTAC-ACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCATACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCTGTGGCATATTT-CAT-GGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCC--TTTT---GGCTGCGCT-GGC-GTGTG-TGGTG------TGTGTGC--GCTGGT-GCCCTGTGCTGCGGTGGGACGTCAATGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGTGTCTCCGTGTGTGCCGTGT-GCGGATAGCTTGC Peronospora_hiemalis TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ACAAGTT-----TTGTACGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGAGCTCTTGGGGCAAGTTCCTTGGAAAAGGACAGCATGGAGGGTGATACTCCCGTTCATCTCCGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCATACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCC--TTTT---GGCTGCGCTTGGC-GCGTG-TGGTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAATGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGTGTCTCCGTGTGTGCCGTGT-GCGGATAGCTTGC Peronospora_lamii TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ACCATTA-----TGGTATGGCGAGTTGTAGCCTATAGAAAC-GTGGTTCACTCGGAC-CTCGGGGAAAGTTCCTTGGAAAAGGACAGCATGGAGGGTGATACTCCCGTTTATCCCTGAGAGTACCTTGTA-GTATGGCCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGCGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTGGCGAGTGTATGCGTGCGTGTGTTGTGGCAGCGGCC--TTTTT-TGGCTGCGCTCGGC-ACGTG-TGCTG------CGTGTGCTCGTTGAT-GCCCTGTGCTGCGGTGAGACGTTAACGTCAATTCGTAA-ACTGCGAGAAATGGCC-GC--CGAGGAGGT-AGGGCTTACGCAT-GCGTTTGCCT----ATTATAGCTTGGCGGTGTATGAGTT-GTCGCGGTTGGGATTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGTGTCTCTGTGTGCGCCGTGT-GC-GATAGCTTGC Peronospora_myosotidis TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ACAAGTT-----TTGTACGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTACGGGCGCTTAGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCTAAGCAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGTAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTATATAATCCGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTATGGCAGCGGCT--TTTT----GCTGCGCTTGGC-GCGTG-TGCTG------TGTATACTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGACTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGTGTCTCCGTGTGTACCGTGT-GCGGATAGCTTGC Peronospora_potentillae_sterilis TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-GCAAGTT-----TTGCACGGCGAATTGTAGTCTATAGAAGC-GTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTTATCCCCGAGT-GGCTC-GTGCGTAAGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGGATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTGGCGATCGTGTGCGTGCGTGTGCTATGGCAGCGGCT--TTTT----GCTGCGCTTGGC-GCGTG-TGCTG------TGCGTGTTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---TAACGTGCTT-TT-GAG-TGA-GACTGTGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Peronospora_pulveracea TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ACAAATT-----TTGTACGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCTCTTGGGGCAAGTTCCTTGGAAAAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTT-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCATACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCC--TTTTTG-GGCTGCGCTTGGC-GCGTG-TGGTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAACGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGTTT-TT-GAG-TGG-GTTTGTGTCTCCGTGTGTGCCGTGT-GCGGATAGCTTGC Peronospora_rumicis TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ACAAGTT-----TTGTATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCATACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGACATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTATGGCAGCGGCC--TTTTT--GGCTGCGCTTGGC-GTGTG-TGCTG------TGTGTGCTTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAATGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---TAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GTG-TGG-GTTTGTGTCTCCGTGTGTACCGTGT-GCGGATAGCTTGC Peronospora_sanguisobae TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ACAAGTT-----TTGTATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTGTGGGCACTTGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTTATCCCTGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCATACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGACATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTATGGCAGCGGCT--TTTTT--GGCTGCGCTTGGC-GTGTG-TGCTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAATGAGAGTTCGTAT-ACTGCGGGAAATGACT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTCGTGTCTCCGTGTGCGCCGTGT-GCAGATAGCTTGC Peronospora_silvestris TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCAT-ACAAGTT-----TTGTATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTGTGAGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTTATCCCTAAGT-AGCTT-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATAGTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGTTCTGGCAGCGGCT--ATTATGTGGCTGCGCTAGTC-GCGTG-TGTTG------TGTGTACTTGTTGGT-GCCCTGTGCTGCGGTGGGACGTCAAAGTCAGTTCTTAT-ACTGTGTGAGATGGCT-GCTATGTGAAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCCTGGTCAGTT--GCGTA-CTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GCTTGTAACTTTGTTTACGAAACAT-GCAGATTGCTTGC Peronospora_sparsa TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ATAAGTT-----TTGTACGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTGTGGGCACTTGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTAAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCATACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTATGGCAGCGGCT--TTTTT--GGCTGCGCTTGGC-GTGTG-TGCTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAATGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GCTTGTGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Peronospora_trifolii_alpestris --AAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ACAAGTT-----TTGTACGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGCGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTGGCGAGTGTATGCGTGCGTGTACTGTGGCAGCGGCT--TTTT----GCTGCGCTCGGT-GCTTG-TGCTG------TGTATACTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAACGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--TGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTAGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTCTGCGTTTCCGTGTGTGCCGTGT-GCGGATAGCTTGC Peronospora_trifolii_hybridi TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ACAAGTT-----TTGTACGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGCGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCC-TGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTATGCGTGCGTGTACTGTGGCAGCGGCT--TTTT----GCTGCGCTCGGT-GCTTG-TGCTG------TGTATACTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAACGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--TGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCTT---GTTATATCTTGGTAGAT---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTCTGCGTCTCCGTGTGTGCCGTGT-GCGGATAGCTTGC Peronospora_trifolii_minoris TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ACAAGTT-----TTGTACGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGCGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTTATCCCTGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTATGCGTGCGTGTACCGTGGCAGCGGCG--TTTT----GCTGCGCTCGGT-GCTTG-TGCTG------TATATACTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAACGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--TGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTAGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTCTGCGTCTCCGTGTGTGCCGTGT-GCGGATAGCTTGC Peronospora_trivialis TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCAT-ACAAGTT-----TTGTATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGAGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTTTAGCAGCGGCC--TTTTT--GGCTGCGCTTGGC-GCGTG-TGCTG------TGTGTACTTGCTGGT-GCCCTGTGCTACGGTGGGACGTCAATGTCAGTTCGTAT-ACTGCGAGAAATGGCC-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATAGCTTGGCGGTG-----GTT-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGA-GTTTGTGTCTCCGTGTGTACCGTGT-GCGGATAGCTTGC Peronospora_variabilis TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCAT--CAAGTT-----TTGTATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGCAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGTAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTC-CATTGGCGAGTGTATGCGTGCGTGTGCTATGGCAGCGGCC--TTTT---GGCTGCGCTTGGC-GCGTG-TGCTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAATGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AC--CGAGGAGGT-AGGGCTTACG-TTCGCGTTTGTCT----ATTATATCTTGGTGGAC---GAGTC-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGTGTCTCCGTGTTTGCCGTGT-GCGGATAGCTTGC Phytophthora_boehmeriae TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGC-GCAAGTT-----TTGCGTGGCGAATTGTAGTCTATAGAAGC-GTGGTCAGCGCGAGCGCTTGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATACCTGAGT-GGCTT-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTTTTGCAGTGGCT--TTTTT--GGCTGCGCTGGGT-GCGTG-CTGTG------CGTGTGTTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGGGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGT-GTGGAACTCTCTGTGTGCGCGCTGT-GCGGATAGCTTGC Phytophthora_cactorum TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGT-GCAAGTT-----TTGTGCGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-TGCTC-GTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCT--TTTTA--GGCTGCGCTCGGC-GTGTG-TGCTG------TGTGTGCTTGCTGGT-GCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGTGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Phytophthora_capsici TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGT-GCAAGTT-----TTGCGCGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCAGTGGCT--TTTTT--GGCTGCGCCTGGC-GTGTG-TGCTG------TGAGTGTTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTCCGCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGTGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Phytophthora_cinnamomi TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGT-GCAAGTT-----TTGCGCGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCT--TTTTT--GGCTGCGCTCGGT-GCGTG-TGCTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTCCGCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTCGTGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Phytophthora_citrophthora TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGT-GCAAGTT-----TTGCGCGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCAGTGGCT--TTTTT--GGCTGCGCCTGGT-GTGTG-TGGTG------TGAGTGTTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTCCGCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGTGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Phytophthora_clandestina TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGT-GCAAGTT-----TTGTGCGGCGAATTGTAGTCTATAGAAGC-GTGGTCAGCGTGGGCACTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-TGCTT-ATGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTATCTATAATCCGTGGTATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTATGGCAGCGGCT--TTTTT--GGCTGCGCTTGGC-GTGTG-TGCTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTAGAC---GAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGTGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Phytophthora_erythroseptica TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGT-GCAAGTT-----TTGCGCGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGT-GGCTC-TTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTGGTGAGTGTGTGCGTGCGTGTGCTTTGGCAGTGGCT--TTTTT--GGCTGCGCTGGGC-GTGTG-TGCTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTCCGCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGA-GTGTGGGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Phytophthora_europaea TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGT-GCAAGTT-----TTGCGCGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCC--TTTTT--GGTTGCGCTCGGT-GCGTG-TGCTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTCCGCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTCTGTGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Phytophthora_gonapodyides TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGT-GCAAGTT-----TTGCGCGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCGTGCGCTGTGGCAGTGGCT--TTTTT--GGCTGCGCTCGGT-GCGTG-TGTTG------TGCGTGTTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTCTGCGTTTGTCT----ATTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTGTGTGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Phytophthora_heveae TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-GCAAGTT-----TTGCACGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-TGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGTGGCT--TTTTT--GGCTGCGCTCGGT-GTGTG-TGCTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGTGTCTTCGTGTGCGCCGTGT-GCGGATAGCTTGC Phytophthora_ilicis TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGT-GCAAGTT-----TTGCACGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-TGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGTC--TTTAT--GGCTGCGCTCGGT-GTGTG-TGCTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTCCGCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGTGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Phytophthora_insolita TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGC-GCGAGTT-----TCGCGTGGCGAATTGTAGTCTATAGATGC-GTGGTCAGCGTTGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCAT-CCTGAGT-GGCTG-GCGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGCGGCATATTT-CATCGGCGAGTGTGTGCGTGCGTG-GCTTTGGCAGTGGCT--TTTTT--GGCTGCGCTGGGC-GTGTG-CTGTG------CGTGTGCTTGGTGGT-GCCCTGTGTTGCGGTGGGACGTCAAGGTCAGTTCGTGT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTCCGCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-CGA-GTGTGTGTCTCTGGATGCGTGCTGT-GCGGATAGCTTGC Phytophthora_multivesiculata TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGT-GCAAGTT-----TTGCGCGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGCGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGC-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAATGTTTGCGTGCGTGTGCTATGGCAGTGGCT--TTTTT--GGCTGCGCCTGGC-GTGTG-TGCTG------TGAGTGTTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTCCGCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGTGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Phytophthora_nicotianae TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGT-GCAAGTT-----TTGTGCGGCGAATTGTAGTCTATAGAAGC-GTGGTCAGCATGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATTTCTGAGT-TGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCT--TTTTT--GGCTGCGCTCGGC-GTGTG-TGCTG------TGTGTGCTTGCTGGT-GCTCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGTGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Phytophthora_quercina TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGT-GCAAGTT-----TTGTGCGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGACATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGTGGCT--TTTTT--GGCTGCGCTCGGT-GTGTG-TGCTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCTTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GTTTGTGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Phytophthora_ramorum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-GCAAGTT-----TTGCACGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTT-TTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGTGGCT--TTTTT--GGCTGCGCTCGGC-GTGTG-TGCTG------TGT-TGCTTGTTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTCCGCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGT-GTATGGGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Phytophthora_syringae TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGT-GCAAGTT-----TTGCGCGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-TTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGACGAGTGTGTGTGTGCGTGTGCTGTGGCAGTGGCT--TTTTT--GGCTGCGCTCGGC-GTGTG-TGCTG------CGTGTGCTTGTTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTCCGCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGA-GTGTGCGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Pilasporangium_apinafurcum_UZ300 TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATGGATGC-GTTATCAGTGCAGCTATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGT-AGCTT-GTGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTTCCAGTGTCTATAATCCGCGACATATTT-CATTGGCGAGTGTGTGCGTGCGA-TGTTTTGGAAGTAGCC--TCGC----GTTGCTCCGGAT-GTTGTATTTTG------CATGTATTTGCTGGT-GCCCTGTGTTGTGGTGGGACGTCAGAGTGAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CAAGGAGGT-AGGTCAGGA-TTTCGGTCTTGGCT----GTTATATCTTGGTGGAC---GAGTA-GTCGTGGTTGGGACTGAGGTGC-CTTA--CAACGTGCTT-TA-AAG-TGG-TTGGTAGTCTCTTTTGATGCTCTGT-TAGGACAGCTTGC Plasmopara_baudysii TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-GCAATTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTGTGGGCACTTAAGGTAAGTTCCTTGGAAAAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTTGAGT-TGCTT-GTGCGTACGACCCGTTTTCTTCGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCATACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAATAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCAAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTGGCGAGTGTGTGTGTGCGTGTGCTATAGCAGTGGCC--TTT----GGCTGCGCTTGGT-GTGTG-TGCTG------CGTGTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTAGAC---GAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GCTTGGGTCTCTGTGTGCGCCGTGT-GCGGATAGCTTGC Plasmopara_densa TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-GCAATTT-----TTGCACGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTGTGGGCACTTGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTAAGT-TGCTT-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCATACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAATAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCAAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTA-CATTGGCGAGTGTGTGCGTGCGTGTGCTGTTGCAGTGGC---TTTTT--GGCTGCGCTCGGC-GTGTG-TGCTG------TGTGTGCTTGCTGGT-GCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGACC-AC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GCTTGGGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Plasmopara_geranii TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-GCAATTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTATGAGCACTTGGAGAAAGTTCCTTGGAATAGGACAGCATGGAGGGTGATACTCCCGTTCATCTCTTAGC-TGCTT-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAATAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCAAATCGTTT-CCAGTGTCTATAATCCGTTGTATATTT-CATTGGCGAGTGTATGCGTGCGTGTGCTGTTGCAGTGGCC--TTTT---GGTTGCGCTCGGC-GCGTG-TGTTG------TGTGTGCTTGTTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AC--CGAGGAGGT-AGGGCTCACGCTT-GCGTTTGTCT----GTTATATCTTGGTAGAC---GAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GCTTGGGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Plasmopara_halstedii TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCAT-ACAATTT-----TTGTATGGCGAATTGTAGTCTATAGAAGC-GTGGTCAGTGTAGGCACTTGGGGTAAGTTCCTTGGAAAAGGACAGCATGGAGGGTGATACTCCCGTTTATCTCTAAGT-TGCTT-ATACGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAATAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCAAATCGTTT-CCAGTGTCTATAATCCGTGGTATATCA-CATCGGCGAGCGTGTGCGTGTGTGTGCTGTTGTAGTGGCC--TTTT---GGTTACGCTCGGC-GTATG-TGCTG------TATATGCTTGCTGGT-GCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGACT-AC--CAAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTAGAC---GAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GCTTGGGTCTTCGTGTGCGCCGTGT-GCGGATAGCTTGC Plasmopara_megasperma TGAAGCGGGAAGAGCTCAAGCCTAAAATCTCCGT-GCAATTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GTGGTTAGCATGGGCACTTGGAAAAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATTCCCAGGT-TGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCATACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAATAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCAAATCGTTT-CCAGTGTCTATAATCTGTGGTATATTA-CATTGGTGAGTGTGTGCGTGCGTGTGCTGTTGCAGTGGC---CTTTT--GGCTGCGCTCGGC-GTGTG-TGCTG------TGTGTGCTTGCTGGT-GCTCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGCAAATGGCT-AC--CGGGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCCTAGTGGAC---TAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---TAACGTGCTTTTT-GAG-TGG-ACTTGGGTCTCTGTGTGCGCCGTGT-GCGAATAGCTTGC Plasmopara_obducens TGAAGCGGGATGAGCTCAAGCTTAAAATCTTCGT-GCAATTT-----TTGCACGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTATAAGCACTTGGGGTAAGTTCCTTGGAAAAGGACAGCATGGAGGGTGATACTCCCGTTCATCTCTAAGT-TGCTT-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAATAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCAAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTGTTGCAGTGGC---TTTTT--GGCTGCGCTCGGT-GTGTG-TGCTG------TGTGTACTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AC--TGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTC-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GCTTGGGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Plasmopara_pimpinellae TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-GCAATTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTATGAGCACTTAGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTCATCCCTAAGT-TGCTT-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGCAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCATACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAATAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCAAATCGTTT-CCAGTGTCTATAATCCATGGTATATTC-CATTGGCGAGCGTGTGTGTGCGTGTGCTTTTGCAGTGGCC--TTTT---GGTTGCGCTAGGC-GTGTG-TG-TG------CGTGTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTAGAC---GAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---TAACGTGCTT-TT-GAG-TGG-ACTTGCGTCTCTGTGTGCGCTGTGT-GCGGATAGCTTGC Plasmopara_pusilla TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-GCAATTT-----TTGCATGGCGAATTGTAGTCTATTGAGGC-GTGGTCAGTATGAGCACTTTGAGAAAGTTCTTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTTATCTCTTAGC-TACTT-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAATAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCAAATCGTTT-CCAGTGTCTATAATCAGTGGTATATTT-CATTGGCGATTGTATGCGTGCGTGTGCTGTTGTAGTGGCC--TTTT---GGTTGCGCTCAGC-GCGTG-TGTTG------TGTATGCTTGTTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGTGGGAAATGGCT-AC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTAGAC---GAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TTG-ACTTGGGTCTCTATGTGCGCTGTGT-GCGGATAGCTTGC Plasmopara_sii TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-GCAATTT-----TTGCATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGTGTGGGCACTTGAGGTAAGTTCCTTGGAAAAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTTAAGT-TGCTT-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCATACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAACATAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCAAATCGTTT-CCAGTGTCTATAATCCATGGTATATTT-CATTGGCGAGCGTGTGCGTGCGTGTGCTATAGCAGTGGCC--TTT----GGCTGCGCTAGGC-GTGTG-TGCTG------CGTGTGCTTGCTGGT-GCCCTGTGCTATGGTGGGACGTCAAGGTCAGTTCGTAT-ACTGCGGGAAATGGCT-AC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTAGAC---GAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-GCTTGGGTCTCTGTGTGCGCCGTGT-GCGGATAGCTC-- Plasmopara_viticola TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-GCAATTT-----TTGCGCGGCGAATTGTAGTCTATAGAAGC-GTGGTCAGTATGGGCACTTGGGTTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCGTCCCCAAGT-TGCTT-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCATACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAATAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGTAACCAAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTGGCGAGTGTATGCGTGCGTGTGCTGTTGCAGTGGCC--TTTTT--GGCTGCGCTCGGC-GTGTG-TGTTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCC-AC--TGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTA-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGG-ATTTGGGTCTCCGTGTGCGCCGTGT-GCGGATAGCTTGC Plasmoverna_isopyri_thalictroidis TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-GTAAATT-----TTACATGACGAATTGTAGTCTATAGATAC-GTGGTTAGCATGAGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCTCTAAGT-TGCTC-GTGCGTACGACCCGTCTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCAAATCGTTT-CCAGTGTCTATAATCTGTGGTATATTT-CACTGGCGAGTGTGTGCGTGCGTGTACTATGGCAGTGGCT--TTTT----GCTACGCTTGGT-GCGTG-TGCTG------TGTTTGCTTGCTGGT-GCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AC--TGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----ATTATATCTTGGTGGAC---GAGTT-GTCGCGGTTGGGACTGAGGTGC-CTA---TAACGTGCTT-GT-GAG-TGG-GATTGCGTTTCTTTTTGCGCCGTGT-GCGGATAGCTTGC Plasmoverna_pygmaea TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGT-GTAAATT-----TTACATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCATGGGCACTTGGAGTAAGTTCCTTGGAAGAG-ACAGCATGGAGGGTGATACTCCCGTTCATCTCCGAAT-TGCTC-GTGCGTACGGCC-GTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTA--TATTGGTGCGAGACCGATAGCATACAAGT-CCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAA--GAGTACCTGAAACTGCTGAAAGGGAACCAAATCGTTT-CCAGTGTCTATAATCTGTGGTATATTT-CATTGGCGAGTGTGCGCGTGCGAATACTATGGCAGTGGCT--TTTT----GCTGCGCTTGGT-GCTTG-TGTTG------TGTGTGCTTGCTAGT-GCCCTGTACTACGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-AC--TGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTT-GTCGCGGTTGGGACTGAGGTGC-CTA---TAACGTGCTT-GT-GAG-TGG-GATTGCGTTTCTGTGTGCGCCGTGT-GCGGATAGCTTGC Plectospira_myriandra TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAC-GC------------AAGTGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATCTGGGATAAGTCCCTTGGAAGAGGGCAGCATGGAGGGTGATACTCCCGTCTTTGCTCAGGT-TGTCT-GTGTGTACGACACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGTTACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CTAGTGT--GTATCTTGT-ACATATTT-CATTGGC-----------------------GGTTGCAA-------------------------------------------AATT----GCTGGT-GCCCTGTGTATGAGTGTGACGTCAGAGTCAGTTTAAAT---TGCGGGAGATGAGT-AG--TGAGGAGGT-GCGTC----ACAT---TTGTGAAA----GTTACAGCTCATTA-CT---TAGTA-GCCGTGGTGAAGACTGAGGTGC-CTA---CAACATGCTT-TA-AAG-TGT-ATTGTTTTCTTGTGTTATGCTATGT-TTGGATAGCTTGC Protoachlya_paradoxa TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTGT----AAGCATGGCGAATTGTAGTCTATAGAGGCTGTTGTCAGCACAGCGATCTGGGAAAAGTCCCTTGGAAAAGGGCAGCACAGAGGGTGATACTCCCGTCTTTGCTCAGAT-CGTCTTGTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TATATCCTGT-GCATATTT-CATTAGC------------------------GGAGCA--------------------------------------------ATTT----GCTGGT-GCCCTGTGCATGGGTGTGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAGATGGTC-AG--TGAGGAGGT-GCTTC----ACTTCG---GTGAAA----GTTATATCTTGCTG-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCT-TG-GGGTTCG-G-GGCTGTCTTGTTTTGGAAACTGC-TTGGATAGCTTGC Protoachlya_polyspora TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-AC----------TTGTATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATCGCGATTGGGGACAAGTCCCTTGGAAAAGGGCAGCATAGAGGGTGATACTCCCGTCTCTGCTCCAAT-CTGCG-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TGTATCCTAT-GCATATTT-CATTCGC------------------------GGAGTA--------------------------------------------ATTT----GCGGGT-GCCCTGTGCATGGGTGTGACGTCAGGGTCAGTTTGTAT-GCTGCGGGAGATGGTC-AG--TGAGGAGGT-GCGTC----ACTTCG---GTGAAA----GTTATATCTCGCTG-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCT-TA-AGGTTCC-G-TGTTGTCTCGTGTTGGTGACTGC-TTTGATAGCTTGC Pseudoperonospora_cubensis TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGT-ACAAGTT-----TTGTATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCGCTTGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGTGGCT--TTTTT--GGCTGCGCTCGGC-GTGTG-TGCTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTT-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGA-GTTTGTGTCTCCGTGTGCGCCGTGT-GTGGATAGCTTGC Pseudoperonospora_humuli TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-ACAAGTT-----TTGTATGGCGAATTGTAGTCTATAGAGGC-GTGGTCAGCGTGGGCGCTTGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGT-GGCTC-GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTT-CATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGTGGCT--TTTTT--GGCTGCGCTCGGC-GTGTG-TGCTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTAT-GCTGCGGGAAATGGCT-GC--CGAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTT-GTCGCGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGA-GTTTGTGTCTCCGTGTGCGCCGTGT-GTGGATAGCTTGC Pythiopsis_cymosa TGAAGCGG-AAGAGCTCAAGCTTAAAATCTCCAT-----GTGT----AAGCATGGCGAATTGTAGTCTATAGTGGCTGTTGTCAGCACAGCGATCTGGGAAAAGTCCCTTGGAAAAGGGCAGCACAGAGGGTGATACTCCCGTCTTTGCTCAGAT-CGTCTTGTGTGTACGATACGCTTTCTTTGAGT-GAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAA-CTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TATATCCTGT-GCATATTT-CATTAGC------------------------GGAGCA--------------------------------------------ATTT----GCTGGT-GCCCTGTGCATGGGTGTGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAGATGGTC-AG--TGAGGAGGT-GCTTC----ACTTCG---GTGAAA----GTTATATCTTGCTG-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCT-TG-GGGTTCG-G-GGCTGTCTTGTTTTGGAAACTGC-TTGGATAGCTTGC Pythium_acanthicum_UZ352 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGATTGCGTGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTGTATGCCCGTGC-AATT--GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCA-TTGTTTTGGAAGCAGTT--TT-------CTGTTCCTGGC-TGTGT--TGTG------CATATGCTTGCTGGT-GCCCTGTGTCATGGTGGGACGTCAGAGTCAATTCGTAA-GTTGCGGGAGATGGCT-AT--TGGGGAGGT-AGGTC----GCTTCG---GTGGCT----GTTATATCCTGATA-GC---TAGTA-GTCGTGGCTGGGATTGAGGTGC-CTA---CAACGTGCTT-TC-GAG-TGT-CTGGGTGTCTCGTTTGGTAAGTTAT-CTTGACAGCTTGC Pythium_acanthicum_UZ364 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGATTGCGTGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTGTATGCCCGTGC-AATT--GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCA-TTGTTTTGGAAGCAGTT--TT-------CTGTTCCTGGC-TGTGT--TGTG------CATATGCTTGCTGGT-GCCCTGTGTCATGGTGGGACGTCAGAGTCAATTCGTAA-GTTGCGGGAAATGGCT-AT--TGGGGAGGT-AGGTC----GCTTCG---GTGGCT----GTTATATCCTGATA-GC---TAGTA-GTCGTGGCTGGGATTGAGGTGC-CTA---CAACGTGCTT-TC-GAG-TGT-CTGGGTGTCTCGTTTGGTAAGTTAT-CTTGACAGCTTGC Pythium_adhaerens TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GTCGGTT-----CGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGACTATGTGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTGT-AG-TT-GCGCGTACGACACGTTTTCTTTGAGTCGTGTTGTTTGGGAATGCAGCACAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACCGCTGAAAGGGAACCGGATCGTTT-CCAGTGTCTATAATCTATGGCATATTT-CATTGGCGTGTGGGTGCGTGCA-GCGTTTTGGAAGTAGTT--TT-------CTGCTCCTGTC-GTTGT--TTTG------CGCTCGCCTGCTGGT-GCCCTGTGCTGTAGTGGGACGTCAGAGTCAATTCGTAT-GCTGCGGGAAATGGTT-AC--TGGGGAGGT-AGGTC----ACTTCG---GTGGCT----GTTATATCCTGGTG-AC---TAGTC-GTCGTGGTTGGGATTGAGGTGC-CTA---CAATGTGCTT-TC-GAG-TCT-GTGGGTCTCTCGTTTGGCCGTTTGC-CTTGATAGCTTGC Pythium_angustatum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAAAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTT--GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCAAATCGTTT-CCAGTGTCTATAATCTATGGCATATTT-CATTGGCGAGTGAGTGCGTGCA-GCGTTTTGGAAGTGGTT--T--------CCGCTCCTGTC-GTTGT--TGTG------CATTTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTAT-GTTGCGGGAAATGATT-AT--TAGGGAGGT-AGGTC----GCTTCG---GTGGCT----GTTATATCCTGGTA-AT---TAGTC-GTCGTGGCTGAGACTGAGGTGC-CTA---CAACGCGCTT-TC-GAG-TCT-GCGGGTTTCTCGTGTGGCTGTTTGC-TCTGATAGCTTGC Pythium_aphanidermatum_UZ051 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GTCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGACTATTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTGT-AG-TT-GCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCTATGGCATATTT-CATTGGCGCGTGGATGTGTGTA-GCGTTTTGGAAGTAGGT--TT-------CTGCTCCTGGC-GTTGC--TTTG------CGTTCGCTTGCTGGT-GCCCTGTGCTGTAGTGGGACGTCAGAGTCAGTTCGTAT-GTTGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----GCTTCG---GTGGCT----GTTATATCCTGGTA-AC---TAGTC-GTCGTGGCTGGGACTGAGGTGC-CTA---CAATGTGCTT-TC-GAG-TCT-GCGGGCCTCTCGTTTGGCTGTTTGC-TTTGATAGCTTGC Pythium_apleroticum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTATCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTC--GCGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTT-CATTGGTGTGTAAGTGCGTGCA-GCGTTTTGGAAGTAGTT--TT-------CTGCTCCTGTC-GTTGT--TGTG------CATTTGCCTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTCGTGT-GTTGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----ACTTCG---GTGGCT----GTTATATCCTGATA-AC---TAGTC-GTCGTGGCTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TCT-GCGGGCTTCTCGTATTGCTGTTTGC-TTGGATAGCTTGC Pythium_aquatile_UZ216 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GTCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTATCAGTGCGATTGTTCGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTC--GCGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTT-CATTGGTGTGTAAGTGCGTGCA-GCGTTTTGGAAGTAGTT--TT-------CTGCTCCTGTC-GTTGT--TGTG------CATTTGCCTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTCGTGT-GTTGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----ATTTCG---GTGGCT----GTTATATCCTGATA-AC---TAGTC-GTCGTGGCTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TCT-GCGGGCTTCTCGTGTTGCTGTTTGC-TTGGATAGCTTGC Pythium_arrhenomanes TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTT--GCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTAT-CCAGTGTCTATAATCCATGGCATATTT-CATTGGCGAGTGAGTGCGTGCA-GCGTTTTGGAAGTGGTT--TT-------CCGCTCCTGTC-GTTGT--TGTG------CATTTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTAT-GTTGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----ACTTCG---GTGGCT----GTTATATCCTGGTA-AC---TAGTC-GTCGTGGCTGAGACTGAGGTGC-CTA---CAATGTGCTT-TC-GAG-TGT-GCGGGATTCTCGTGTGGCTGTTTGC-TTTGATAGCTTGC Pythium_capillosum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTATCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTC--GCGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTT-CATTGGTGCGTAAGTGCGTGCA-GCGTTTTGGAAGTAGTT--TT-------CTGCTCCTGTC-GTTGT--TGTG------CATTTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTAT-GTTGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----ACTTCG---GTGGCT----GTTATATCCTGATA-AC---TAGTC-GTCGTGGCTGAGACTGAGGTGC-CTA---CAATGTGCTT-TC-GAG-TCT-GCGGGCTTCTCGTGTTGCTGTTTGC-TTGGATAGCTTGC Pythium_catenulatum_UZ264 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTC--GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTT-CATTGGCGCGTGAGTGCGTGCA-GCGTTTTGGAAGCGGTC--T--------CCGCTCCTGTC-GTTGT--TGTG------CATTTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTAT-GTTGCGGGAAATGGTT-AT--CAGGGAGGT-AGGTC----GCTTCG---GTGGCT----GTTATATCCTGGTA-AC---TAGTC-GTCGTGGCTGAGACTGAGGTGC-CTA---CAACGCGCTT-TC-GAG-TCT-GCGGGCTTCTCGTGTGGCTGTTTGC-TTTGATAGCTTGC Pythium_conidiophorum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GATGTCAGTGCGACTGTTCGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTT--GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGA-CTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTAT-CCAGTGTCTATAATCCATGGCATATTT-CATTGGCGAATGAGTGCGTGCG-GCGTTTTGGAAGTGGTT--T--------CCGCTCCTGTC-GTTGT---GTG------CATTTTTTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----GCTTCG---GTGGCT----GTTATATCCTGGTG-AC---TAGTC-GTCGTGGCTGAGACTGAGGTGC-CTA---CAATGTGCTT-TC-GAG-TCT-GCGGATTTCTCGTGTGGATGTTTGC-TTGGATAGCTTGC Pythium_dissotocum_UZ159 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTATCAGTGCGATTGTTCGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTC--GCGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTT-CATTGGTGTGTAAGTGCGTGCA-GCGTTTTGGAAGTAGTT--TT-------CTGCTCCTGTC-GTTGT--TGTG------CATTTGCCTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTCGTGT-GTTGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----ACTTCG---GTGGCT----GTTATATCCTGATA-AC---TAGTC-GTCGTGGCTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TCT-GCGGGCTTCTCGTGTTGCTGTTTGC-TTGGATAGCTTGC Pythium_graminicola TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTT--GCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGCATATTT-CATTGGCGCGTGAGTGCGTGCA-GCGTTTTGGAAGTGGTT--T--------CCGCTCCGGTC-GCTGT--TGTG------CATTTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTAT-GTTGCGGGAAATGGTT-AT--TAGGGAGGT-AGGTC----GCTTCG---GTGGCT----GTTATATCCTGGTA-AC---TAGTC-GTCGTGGCTGAGACTGAGGTGC-CTA---CAATGTGCTT-TC-GAG-TCT-GCGGGCTTCTCGTGTGGCTGTTTGC-TTTGATAGCTTGC Pythium_inflatum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTT--GCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTT-CATTGGCGAGTGAGTGCGTGCA-GCGTTTTGGAAGTGGTT--T--------CCGCTCCTGTC-GTTGT--TGTG------CATTTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTAT-GTTGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----GCTTCG---GTGGCT----GTTATATCCTGGTA-AC---TAGTC-GTCGTGGCTGAGACTGAGGTGC-CTA---CAACGTGCTT-TC-GAG-TCT-GCGGGTTTCTCGTGTGGCTGTTTGC-TTTGATAGCTTGC Pythium_insidiosum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAGGTT-----CTGCATGGCGAATTGTAGTCTATGGAGGC-GATGTCAGTGCGGTTGTGCGGGATAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTGCCTGTAC-AGCT--GCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCCATGACATATTT-CATTGGCGCGTGAATGCGTGCA-GCGTTTTGGAAGTGGGT--TT-------CCTCTCCTGGC-GTTGT--TGTG------CGTTTGCTTGCTGGT-GCCCTGTGTTGTGGTGGGACGTCAGAGTCAGTTCGTAT-GCCGCGGGAAATGGCT-GT--CAGGGAGGT-AGGTC----GCTTCG---GTGATT----GTTATAGCCTGGCA-GT---TAGTA-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGCGCTT-TC-GAG-TCT-GCGGGACTCTCGTCTGGTTGCCTGC-TTGGACAGCTTGC Pythium_monospermum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGACTATGCGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTGT-AG-TT-GCGCGTACGACACGTTTTCTTTGAGTCGTGTTGTTTGGGAATGCAGCACAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCTATGGCATATTT-CATTGGCGTGTGGATGTGTGCG-GCGTTTTGGAAGTAGTT--TT-------CTGCTCCTGGC-GTTGT--TTTG------CGTTCGCCTGCTGGT-GCCCTGTGCTGTAGTGGGACGTCAGAGTCAGTTCGTAT-ACTGCGGGAAATGGTT-AC--TGGGGAGGT-AGGTC----ACTTCG---GTGGCT----GTTATATCCTGGTG-AC---TAGTC-GTCGTGGTTGGGACTGAGGTGC-CTA---CAATGTGCTT-TC-GAG-TCT-ATGGGACTCTCGTTTGGCTGTTTGC-TTTGATAGCTTGC Pythium_oligandrum TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGATTGCGTGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTGTATGCCTGTGC-AATT--GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCA-TTGTTTTGGAAGCAGTT--TT-------CTGTTCCTGGC-TGTGT--TGTG------CATATGCTTGCTGGT-GCCCTGTGTCGCGGTGGGACGTCAGAGTCAATTCGTAA-GTTGCGGGAAATGGCT-AT--TGGGGAGGT-AGGTC----ACTTCG---GTGGCT----GTTATATCCTGATA-GC---TAGTA-GTCGTGGCTGGGATTGAGGTGC-CTA---CAACGTGCTT-TC-GAG-TGT-CTGGGTGTCTCGTTTGGTAAGTTAT-CTTGACAGCTTGC Pythium_sp_OPU1448 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GTTGTCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTT--GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTAT-CCAGTGTCTATAATCTATGGCATATTT-CATTGGCGAGTGAGTGCGTGTA-GCGTTTTGGAAGTGGTT--TA-------CCGCTCTGGGC-GTTAT--TGTG------CATTTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTGT-GCTGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----ATTTCG---GTGGCT----ATTATATCCTGGTA-AC---TAGTC-GTCGTGGCTGAGACTGAGGTGC-CTA---CAATGTGCTT-TC-GAG-TGT-GCGGATTTCTCGTGTGGCTGTTTGC-TTTGATAGCTTGC Pythium_sp_OPU1449 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-ACCAGTT-----TGGTATGGCGAATTGTAGTCTATGGAGGC-GCTATCAGTGCGATTGTTCGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTC--GCGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTT-CATTGGTGCGTTAGTGCGTGCA-ACTTTTTGGAAGTAGTT--TT-------CTGCTCCTGTT-GTTGT--TGTG------CATTTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTCGTGT-GTTGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----ATTTCG---GTGGCT----ATTATATCCTGATA-AC---TAGTC-GTCGTGGCTGGGACTGAGGTGC-CTA---CAATGTGCTT-TC-GAG-TCT-GCGGGCTTCTCGTGTTGCTGTTTGC-TTGGATAGCTTGC Pythium_sp_OPU797 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCAAGTT-----TTGCATGGCGAATTGTAGTCTATGGAGGC-GATGTCAGTGCGACTGCGTGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTGT-AGTT--GCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCCGTGACATATTT-CATTGGCGCGTGGGTGCGTGCA-GTATTTTGGAAGTGGTT--TT-------CCTCTCCTGGT-GCTGT--TGTG------CGTCTGCTTGCTGGT-GCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTAT-GCTACGGGAAATGGCT-GT--TAGGAAGGT-AGGCT----GCTTCG---GTGGCT----GTTATATCCTGGCGTGC---TAGTC-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TCT-TCGGGACTCTCGTTTGGTCATTTGC-TTTGACAGCTTGC Pythium_sp_UZ156 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTATCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTC--GCGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTT-CATTGGTGTGTAAGTGCGTGCA-GCGTTTTGGAAGTAGTT--TT-------CTGCTCCTGTC-GTTGT--TGTG------CATTTGCCTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTCGTGT-GTTGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----ACTTCG---GTGGCT----GTTATATCCTGGTA-AC---TAGTC-GTCGTGGCTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TCT-GCGGGCTTCTCGTGTTGCTGTTTGC-TTGGATAGCTTGC Pythium_sp_UZ190 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTT--GCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTAT-CCAGTGTCTATAATCCATGGCATATTT-CATTGGCGAGTGAGTGCGTGCA-GCGTTTTGGAAGTGGTT--TT-------CCGCTCCTGTC-GTTGT--TGTG------CATTTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTAT-GTTGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----ACTTCG---GTGGCT----GTTATATCCTGGTA-AC---TAGTC-GTCGTGGCTGAGACTGAGGTGC-CTA---CAATGTGCTT-TC-GAG-TGT-GCGGGATTCTCGTGTGGCTGTTTGC-TTTGATAGCTTGC Pythium_sp_UZ379 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTT--GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTT-CATTGGCGTGTAAGTGCGTGCA-GCGTTTTGGAAGCGTTT--T--------TCGCTCCTGTC-GTTGT--TGTG------CATTTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTAT-GTTGCGGGAAATGGTT-AT--CAGGGAGGT-AGGTC----GCTTCG---GTGGCT----ATTATATCCTGGTA-AC---TAGTC-GTCGTGGCTGAGACTGAGGTGC-CTA---CAACGCGCTT-TC-GAG-TCT-GCGGGCTTCTCGTGTGGCTGTTTGC-TTTGATAGCTTGC Pythium_sp_UZ419 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTATCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTC--GCGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTT-CATTGGTGTGTAAGTGCGTGCA-GCGTTTTGGAAGTAGTT--TT-------CTGCTCCTGTC-GTTGT--TGTG------CATTTGCCTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTCGTGT-GTTGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----ACTTCG---GTGGCT----GTTATATCCTGATA-AC---TAGTC-GTCGTGGCTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TCT-GCGGGCTTCTCGTGTTGCTGTTTGC-TTGGATAGCTTGC Pythium_sp_UZ655 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGATTGCGTGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTGTATGCCTGTGC-AATT--GTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCTGTGGCATATTT-CATTGGCGAGTGTGTGCGTGCA-TTGTTTTGGAAGCAGTT--TT-------CTGTTCCTGGC-TGTGT--TGTG------CATTTGCTTGCTGGT-GCCCTGTGTCGCGGTGGGACGTCAGAGTCAATTCGTAA-GTTGCGGGAAATGGCT-AT--TGGGGAGGT-AGGTC----ACTTCG---GTGGCT----GTTATATCCTGATA-GC---TAGTA-GTCGTGGCTGGGATTGAGGTGC-CTA---CAACGTGCTT-TC-GAG-TGT-CTGGGTGTCTCGTTTGGTAAGTTAT-CTTGACAGCTTGC Pythium_sp_ZSF0011 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GATGTCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTTC-AGTT--GCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTT-CATCGGTGTGTGGGTGCGTGCA-GCGTTTTGGAAGTGGTT--TT-------CCGCTCCTGTC-GTTGT--TGTG------CATTCGCTCGCTGCT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTCGTGT-GTTGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----ATTTCG---GTGGCT----GTTATATCCTGGTA-AC---TAGTC-GTCGTGGCTGGGACTGAGGTGC-CTA---CAATGTGCTT-TC-GAG-TCT-GCGGATCTCTCGTCTTGCTGTTTGC-TTGGATAGCTTGC Pythium_sp_ZSF0093 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GATGTCAGTGCGACTGTTCGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTT--GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTAT-CCAGTGTCTATAATCCATAGCATATTT-CATTGGCGAATGAGTGCGTGCG-GCGTTTTGGAAGTGGTT--T--------CCGCTCCTGTC-GTTGT--TGTG------CATTTTTTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTAT-GTTGCGGGAAATGGTT-AT--CGGGGAGGT-AGGTC----ATTTCG---GTGGCT----GTTATATCCTGGTG-AC---TAGTC-GTCGTGGCTGAGACTGAGGTGC-CTA---CAATGTGCTT-TC-GAG-TCT-GCGGATTTCTCGTGTGGATGTTTGC-TTGGATAGCTTGC Pythium_torulosum_UZ006 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTC--GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTT-CATTGGCGCGTGAGTGCGTGCA-GCGTTTTGGAAGCGGTC--T--------CCGCTCCTGTC-GTTGT--TGTG------CATTTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTAT-GTTGCGGGAAATGGTT-AT--CAGGGAGGT-AGGTC----GCTTCG---GTGGCT----GTTATATCCTGGTA-AC---TAGTC-GTCGTGGCTGAGACTGAGGTGC-CTA---CAACGCGCTT-TC-GAG-TCT-GCGGGCTTCTCGTGTGGCTGTTTGC-TTTGATAGCTTGC Pythium_vanterpoolii_OPU1445 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AGTC--GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCTGCGGCATATTT-CATTGGCGAGTGAGTGCGTATA-GTGTTTTGGAAGTGGTT--TT-------CCGCTCCTGTC-GCTGT--TGTG------CGTTTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTGT-GTTGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----ATTTCG---GTGGCT----ATTATATCCTGGTA-AC---TAGTC-GTCGTGGCTGAGACTGAGGTGC-CTA---CAATGTGCTT-TC-GAG-TGT-ATGGGATTCTCGTGTGGCTGTTTGC-TTTGATAGCTTGC Pythium_volutum_OPU1446 TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-GCCAGTT-----TGGCATGGCGAATTGTAGTCTATGGAGGC-GCTGTCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTC-AATT--GCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTAT-CCAGTGTCTATAATCCATGGCATATTT-CATTGGCGAGTGAGTGCGTGCA-GCGTTTTGGAAGTGGTT--TT-------CCGCTCCTGTC-GTTGT--TGTG------CATTTGCTTGCTGGT-GCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTGT-GTCGCGGGAAATGGTT-AT--TGGGGAGGT-AGGTC----GCTTCG---GTGGCT----ATTATATCCTGGTA-AC---TAGTC-GTCGTGGCTGAGACTGAGGTGC-CTA---CAATGTGCTT-TC-GAG-TGT-GCGAGTTTCTCGTGTGGCTGTTTGC-TTTGATAGCTTGC Saprolegnia_anisospora TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT------TACATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATCCGGGACAAGTCCCTTGGAAAAGGGCAGCATGGAGGGTGATACTCCCGTCTCTGCTCGGAT-TGTCT-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TTTATCCTGT-GCATATTT-CATTAGC------------------------GGAGCA--------------------------------------------ATTT----GCTGGT-GCCCTGTGCATGGGTGTGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAGATGGTC-AG--TGAGGAGGT-GCGTC----ACTTCG---GTGAAA----GTTATATCTCGCTG-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCT-TG-GGGTTCA-G-TGTTGTCTCGTTTTGGTGACTGC-TTTGATAGCTTGC Saprolegnia_diclina TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-AC----------TTGTATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATCGCGATTGGGGACAAGTCCCTTGGAAAAGGGCAGCATAGAGGGTGATACTCCCGTCTCTGCTCCAAT-CTGCG-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TGTATCCTAT-GCATATTT-CATTCGT------------------------GGAGCA--------------------------------------------ATTT----GCGGGT-GCCCTGTGCATGGGTGTGACGTCAGGGTCAGTTTGTAT-GCTGCGGGAGATGGTC-AG--TGAGGAGGT-GCGTC----ACTTCG---GTGAAA----GTTATATCTCGCTG-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCT-TA-AGGTTCC-G-TGTTGTCTCGTGTTGGTGACTGC-TTTGATAGCTTGC Saprolegnia_eccentrica TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT-----TTACATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATCTGGGACAAGTCCCTTGGAAAAGGGCAGCATTGAGGGTGATACTCCCGTCTCTGCTCAGAT-TGTCT-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAACACCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TGTATCCTGT-GCATATTT-CATTAGC------------------------GGAGCA--------------------------------------------ATTT----GCTGGT-GCCCTGTGCATGGGTGTGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAGATGGTC-AG--TGAGGAGGT-GCGTC----ACTTCG---GTGAAA----GTTATATCTCGCTG-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCT-TG-GGGTTCA-G-TGTTGTCTCGTTTTGGTAACTGC-TTGGATAGCTTGC Saprolegnia_ferax TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-AC----------TTGTATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATCGCGATTGGGGACAAGTCCCTTGGAAAAGGGCAGCATAGAGGGTGATACTCCCGTCTCTGCTCCAAT-CTGCG-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TGTATCCTGT-GCATATTT-CATTCGC------------------------GGAGTA--------------------------------------------ATTT----GCGGGT-GCCCTGTGCATGGGTGTGACGTCAGGGTCAGTTTGTAT-GCTGCGGGAGATGGTC-AG--TGAGGAGGT-GCGTC----ACTTCG---GTGAAA----GTTATATCTCGCTG-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCT-TA-AGGTTCC-G-TGTTGTCTCGTGTTGGTGACTGC-TTTGATAGCTTGC Saprolegnia_hypogyna TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-AC----------TTGTATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATCGCGATTGGGGACAAGTCCCTTGGAAAAGGGCAGCATGGAGGGTGATACTCCCGTCTCTGCTCCAAT-CTGCG-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TGTATCCTAT-GCATATTT-CATTCGT------------------------GGAGTA--------------------------------------------ATTT----ACGGGT-GCCCTGTGCATGGGTGTGACGTCAGGGTCAGTTTGTAT-GCTGCGGGAGATGGTC-AG--TGAGGAGGT-GCGTC----ACTTCG---GTGAAA----GTTATATCTCGCTG-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCT-TA-AGGTTCT-A-TGTTGTCTCGTGTTGGTGACTGC-TTTGATAGCTTGC Saprolegnia_litoralis TGAAGCGGGAAGAGCTCAAGCTTAAA-TCTCCAT-AC----------CTGTATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATCGCGATTGGGGACAAGTCCCTTGGAAAAGGGCAGCATGGAGGGTGATACTCCCGTCTCTGCTCCAAT-TTGCG-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TGTATCCTAT-GCATATTT-CATTCGC------------------------GGAGCA--------------------------------------------ATTT----GCGGGT-GCCCTGTGCATGGGTGTGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAGATGGTC-AG--TGAGGAGGT-GCGTC----ACTTCG---GTGAAA----GTTATATCTCGCTG-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCT-TA-AAGTTCC-G-TGTTGCCTCGTGTTGATGACTGC-TTTGATAGCTTGC Saprolegnia_monilifera TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-AC----------TTGTATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATCGCGATCGGGGACAAGTCCCTTGGAAAAGGGCAGCATGGAGGGTGATACTCCCGTCTCTGCTCCGAT-TTGCG-GTGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTATCGTTT-CCAGTGT-TTTATCCTGT-GCATATTT-CATTCGC------------------------GGAGCA--------------------------------------------ATTT----GCGGGT-GCCCTGTGCATGGGTGTGAC-TCAGAGTCAGTTTGTAT-GCTGCGGGAGATGGTC-AG--TGAGGAGGT-GCGTC----ACTTCG---GTGAAA----GTTATATCTCGCTG-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCT-TG-GGGTTTC-G-TGTTGTCTCGTGTTAATAACTGC-TTTGATAGCTTGC Sapromyces_elongatus TGAAGCGGGATGAGCTCAAGCTTAAAATCTCCAT-ACAGGTT-----CTGTATGGCGAATTGTAGTCTATAGAGGCTGTTGTCAGTGCAGCTATCTGGGATAAGTCCCTTGGAAGAGGGTAGCATTGAGGGTGATACTCCCGTCTTTGCCCAGAT-ATGCG-GTGCGTACGACACGCTTTCTTTGAGTCGAGTTGCTTGGGAATGCAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATAAGTACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGT-TTTTGCCTTT-GCATATTT-CATTAATGAAAGCTTGTTGGTTCTTTGGTTTGTAGTAGTTA--------ATTCTTCACTGCC-ATTTTATTATG------CTTGTTTTTGTTGGT-GCCCTGTGTGAAGGTATGATGTCAAGGTCAATTCGTAA-GTCGCGGGAGATGGTTTAT--TGGGGAGGT-ATGTTAACTGATTC--TGTCATTTAACTGTTATACCCTGGTTTAC---TAGTA-GTCGTGGCTGGGATTGAGGTGC-CTA---CAACATGCCT-TG-AAAGTCTTGTGGA-ATTTTATTTGTCAATTTAC-TTGGATAGCTTGC Scoliolegnia_asterophora TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT-----TTGCATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATCCGGGACAAGTCCCTTGGAAAAGGGCAGCATAGAGGGTGATACTCCCGTCTCTGCTCGGAT-CTGCC-GTGTGTACGATACGCTTTCTTTGAGTCGATTTGTTTGGGAATACAGATCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGGTCAGAGGGAACCGTATCGCTT-CCAGTGT-TGTATCCTGT-GCATATTT-CATTAGC------------------------GGAGTA--------------------------------------------ATTT----GCTGGT-GCCCTGTGCACGGGTGTGACGTCAGAGTCAGTTTGTAT-GCTGCGGGAGATGGTC-AG--TGAGGAGGT-GCGTC----ACTTCG---GTGAAA----GTTATACCTTGCTG-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCCT-TG-AGGTTTA-G-TGCTGTCTTGTTTTGGTGACTGT-TTGGATAGCTTGC Thraustotheca_clavata TGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCAT-----GTT-----TTACATGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGCATAGCGATTTGGGATAAGTCCCTTGGAAAAGGGCAGCACAGAGGGTGATACTCCCGTCTTTGCTCAGAT-TGTCT-ATGTGTACGATACGCTTTCTTTGAGTCGAGTTGTTTGGGAATACAGCTCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGTTGAAAGGGAACCGTAACATGT-CCAGTGT-TGTATCTTGT-GCATATTT-CATTAGT------------------------GGAGCA--------------------------------------------ATTT----ACTGGT-GCCCTGTGCATGAGTGTGACGTCAAAGTCAGTTTGTAT-GCTGCGGGAGATGGTT-AG--CAAGGAGGT-GCGTC----ACTT----TGTGTCA----GTTATACCTTGTTA-TC---TAGTA-GCCGTGGTTGAGACTGAGGTGC-CTA---CAACATGCTTATA-GAG-TAT-ATTGTTGTCTCGTTATTATACCTGT-TTGGATAGCTTGC Viennotia_oplismeni TGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGT-ACAAATT-----TTGTGCAGCGAATTGTAGTCTATAGAAGC-GTAGTCAGCATGGACGCTTAGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATACCTGAGT-TGTTT-GTGCGTAAGACTCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAA-GAGTACCTGAAACTGCTGAAAGGGAACCAAATCGTTT-CCAGTGTCTATAATCTATAGCATATTT-CATTGGCGAGTGTGTGCGTGTGTGTGCTGTGGCAGCGGCT--TTTT---GGCTGCGCTCGGT-GCGTT-CGCTG------TGTGTGCTTGCTGGT-GCCCTGTGCTGTAGTGGGACGTCAAGGTCAGTTCGTAT-ACTGCGGGAAATGGCT-AC--CAAGGAGGT-AGGGCTTACGCTT-GCGTTTGTCT----GTTATATCTTGGTGGAC---GAGTA-GTCGTGGTTGGGACTGAGGTGC-CTA---CAACGTGCTT-TT-GAG-TGA-AACTGTGTTTCCGTATGCGCCGTGT-GCAGATAGCTTGC ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = D1D2) = N: 1-692; CODONPOSSET * CodonPositions (CHARACTERS = D1D2) = N: 1-692; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4548] TITLE COX_II; LINK TAXA = Taxa1; DIMENSIONS NCHAR=581; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Albugo_occidentalis ATGGAAGGAATTATAAATTTCCATCATGATTTAATGTATTTTTTAATAATTATTACCATTTTTGTATGTTGGATTTTATTTCGAATTGTTAATTTATTTAATGAAAAAAAAAATAAAATTTCGGAAACTTTTGTACATGGTTCTACAATTGAAATTGTTTGGACAACAATCCCTGCATTAATTTTATTAATTATAGCTATACCTCCTTTTGCGTTATTATATTCCATGGATGAAATTATTTATCCTATTATTACAATAAAAGTTATAGGAAGTCAATGGTTCTGGACTTACGAATATTCAGATATTTTAAATTATTTTGAAAATACACCAGATATAAATGAAAGTTTAATTTTTGATAGTTATATGATCCAAGAAAATGATTTAGAAATTGGTCAATTTAGACTTTTAGAAGTAGATAATCGATTAGTAATTCCCACTTCAACTCATATACGAATTTTAATAACATCTTCGGATGTATTACATTCATGGGCAATACCTTCCTTAGGTATCAAATTAGATGCATGTCCTGGAAGATTAAATCAAACTTCAATTTTTATTAAACGAGAAGGAGTTTTTTATGG Albugo_tragopogonis ATGGAAGGTATTATAAATTTTCATCATGATTTAATGTATTTTTTAATAATTATTACAATTTTTGTATGTTGGTTATTATTTCGAATTATAGTTTTATTTAATGAAAAAAAAAATAAAAATTTAGAAACTTTTGTACACGGTGCTACTATCGAAATAGTATGGACTACTATTCCTGCTTTAATTTTATTAATTATAGCAATCCCTTCATTTGCATTATTATATTCAATGGATGAGATTATTTATCCTATTATAACAATAAAAGTAGTAGGTAGTCAATGGTTTTGGACATATGAATATTCTGATATTTTAAATTATTTTGATAATA------ACGAAAATGAAAGTTTAATTTTTGATAGTTATATGATTCAAGAAAATGATTTAGAAATAGGTCAATTTAGGCTTTTAGAAGTAGATAATCGTTTAGTAATTCCAACATTAACTCATATTAGAATTTTAATTACATCATCCGATGTATTACATTCATGGGCAGTTCCTTCTTTAGGTATAAAATTAGATGCTTGTCCTGGAAGATTAAATCAAACTTCTATTTTTGTAAAAAGAGAAGGTGTTTTTTATGG Apodachlya_pyrifera ATGGAAGGGATTATTAATTTTCATCATGATTTGGTTTTTTTTTTAATTCTTATCGTTGTATTTGTAAGCTGGATTTTAGCTAGATGTATATATTTCTTTGATGAAGATAAACATAAAATAGCTGAAACATTTGTTCATGGTACTGTACTTGAAATTGTTTGGACTATAACCCCCGCTTTAGTATTAATTATTATAGCAATTCCATCATTTTCTTTATTATATGCTATGGATGAGGTAATTGATCCAATTACTACTGTTAAAGTAATAGGTAGCCAATGGTATTGGAGTTATGAATATTCTGATTCTTATACCGATACAAAT------------------GAATCTATTTTTTTTGATAGTTATATGGTATTGGAAGATGATTTAGATATAGGTCAATTCCGATTATTAGAAGTTGATAATCGTGTAGTTGTTCCAACTAATACACATATTCGTATGATTATTACTGCATCAGATGTTTTACATTCTTGGGCTGTTCCTTCTTTAGGTATTAAATTAGATGCATGTCCTGGTAGATTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Basidiophora_entospora ATGGAAGGAATTATTAATTTTCACCACGATATTATGTTTTTCTTAATTATGATTACAATTTTTGTTTGTTGGATGTTATTTAGAGTTGTTATTCTTTTTAACGAAAAAAAAAATAAGATTCCAGCTACAATTGTACACGGGGCGACAATTGAAATTATTTGGACCTCTATTCCAGCTTTAATTTTATTAATTGTTGCTATTCCATCATTTGCATTATTGTACTCAATGGATGAAATTATTGATCCAATTATTACATTAAAAGTAATTGGAAGTCAATGGTACTGGAGTTATGAATATTCAGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAGGAAGATGACCTAGCTATAGGTCAGTTTAGACTTTTAGAGGTAGACAATAGGGTAATAGTTCCAACAAATAGCCATATTAGGGTATTGATTACTGCATCTGATGTTTTACATTCATGGGCTATTCCGTCATTAGGTATAAAATTAGACGCTTGTCCTGGGCGTTTAAATCAAACCTCTATGTTTATAAAAAGAGAAGGTGTTTT------ Bremia_lactucae ATGGAAGGTATTATTAATTTTCATCATGATATTATGTTTTTTTTGATTATGATTACAATATTTGTTTGTTGGATGTTGTTTAGAGTTGTTACTCTTTTTGATGAGAAAATAAACAAAGTTCCGGCAACTATTGTTCACGGAGCCGCAATTGAAATCATTTGGACTTCCATTCCTGCTTTAATTCTTTTAATTATAGCAATACCTTCTTTTGCTTTATTATATTCAATGGATGAAATAATTGATCCTATCATTACATTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCCGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAGGAAGATGATTTAGCTATAGGTCAATTCAGACTTTTAGAAGTGGATAATAGAGTAATAGTTCCTACTAATAGTCACATACGAGTTTTAATTACAGCATCCGATGTTTTACATTCTTGGGCAATACCTTCATTAGGTATAAAATTAGACGCTTGTCCTGGACGACTAAATCAAACTTCAATGTTTATTAAACGTGATGGTGTTTTTTATGG Dictyuchus_sterilis GCAGAAGGTATTATAAATTTTCATCATGATTTAGTTTTTTTTTTAGTATTAATTGTAATCTTTGTTAGTTGGCTTTTAGCTAGATGTATTTTTTTTTTTAATGAAAATACCAATAAAAAAGCTGAAACTTTCGTTCATGGTACTGTAGTAGAAATTGTATGGACTATAACTCCAGCAATTATTTTAATTATTATAGCAATTCCTTCTTTTTCTTTATTATATGCTATGGATGAAGTAATTGATCCTATTTTAACTGTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATGC---------TACTGAT------------------GATTCTATTTTTTTTGATAGCTATATGGTTTTAGATGAAGATTTAGATAAAGGTCAGTTTCGTTTATTAGAAGTTGATAATCGTGTAGTAGTTCCTACTAATACTCATGTACGTTTAATAGTAACTGCAACAGATGTATTACATTCTTGGGCCGTACCTTCTTTAGGTGTAAAATTAGATGCATGTCCAGGTAGATTAAATCAAACTTCTATTTTTATAAAAAGAGAAGGTGTATTTTATGG Elongisporangium_sp_ZSF0056 ATGGAAGGTATTATAAACTTTCATCATGATTTAATGTTTTTTTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTGCTACTATAGTACATGGTGCTACTATTGAAATTATTTGGACTACTATTCCAGCTTTAATTTTATTAACAGTGGCTGTACCTTCATTTGCTTTATTATATTCTATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCAAAC------------------GAACCTTTAATTTTTGATAGTTATATGGTTCAAGAAGATGATTTAACTATAGGTCAATTTAAACTTTTAGAAGTAAATAATAAAATAGTTGTTCCTACAAATAGTCATATTAAAGTATTAATTACTGCTTCTGATGTTTTACATTCATGGGCTATTCCTTCATTAGGTATAAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Elongisporangium_undulatum ATGGAAGGTATTATAAACTTTCATCATGATTTAATGTTTTTTTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTGCTACTATAGTACATGGTGCTACTATTGAAATTATTTGGACTACTATTCCAGCTTTAATTTTATTAACAGTAGCTGTACCTTCATTTGCTTTATTATACTCTATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATAGGAAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTACATGGTTCAAGAAGATGATTTAACTATAGGTCAATTTAGACTTTTAGAAGTAGATAATAGAGTAGTTGTTCCTACAAATAGTCATATTAGAGTATTAATTACTGCTTCTGATGTTTTACATTCATGGGCTATTCCTTCATTAGGTATAAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Globisporangium_heterothallicum ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTGGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATAGCTTCTACCATTGTACATGGTGCTACTATTGAAATTATTTGGACCACAATACCAGCTTTAATTTTATTAACTGTAGCAGTTCCATCATTTGCTTTATTATATTCTATGGATGAAGTAATTGATCCTATAATTACTTTAAAAGTTATAGGTAGCCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCTGAT------------------GAGCCTTTAATTTTTGATAGTTACATGGTACAAGAAAATGATTTAGAATTAGGTCAATTTAGACTTTTAGAAGTAGATAACCGTGTAGTAGTTCCTACTAATAGTCATATTAGAGTGTTAATTACAGCTTCTGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTGTTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_intermedium ATGGAAGGTATAATTAACTTTCACCACGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACAGTTGTGCATGGTGCAACTATTGAAATTATTTGGACTTCAGTACCAGCTTTAATTTTATTAACTGTAGCAGTACCTTCATTTGCTTTATTATATTCTATGGATGAAGTTATTGATCCTATTATAACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGCTATGAATATTCTGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGATTATTAGAAGTAGATAATCGTATAGTAGTACCAACTAATAGTCATATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTATTAAATTGGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTGTTTTATGG Globisporangium_irregulare_UZ370 ATGGAAGGTATTATTAACTTTCACCCCGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATCCCTTCTACTGTTGTACATGGTGCAACTATTGAAATTATTTGGACTTCAGTACCAGCTTTAATTTTATTAACTGTAGCAGTACCTTCATTTGCTTTATTATATTCTATGGATGAAGTTATTGATCCTATTATAACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTTGTAGTACCAACTAATAGTCATATTAGAGTATTAATTACAGCTTCGGATGTTTTACATTCATGGGCTATACCCTCTTTAGGTATTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_iwayamae_OPU1450 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTGGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACTGTTGTACATGGTGCAACAATTGAAATTATTTGGACTTCAGTACCTGCTTTAATTTTATTAACAGTAGCAGTACCTTCATTTGCTTTATTATATTCAATGGATGAAGTTATTGACCCAATTATAACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGCTATGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATTGGTCAATTTAGACTTTTAGAAGTAGATAACCGTATTGTGGTACCAACTAATAGTCATATTAGAGTATTAATAACAGCATCTGATGTTTTACATTCTTGGGCAATACCTTCTTTAGGTATTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_macrosporum_UZ233 ATGGAAGGTATAATTAACTTTCACCACGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATCCCTTCTACAGTTGTACATGGTGCAACTATTGAAATTATTTGGACTTCAGTACCAGCTTTAATTTTATTAACAGTAGCAGTACCTTCATTTGCTTTATTATATTCTATGGATGAAGTTATTGACCCTATTATAACTTTAAAAGTAATAGGTAGTCAATGGTACTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATATAGACTTTTAGAAGTAGATAATCGTGTAGTAGTACCAACTAATAGTCATATTAGAGTATTAATTACAGCTTCGGATGTTTTACATTCTTGGGCTATACCTTCTTTAGGTATCAAATTAGATGCCTGTCCTGGTCGTTTAAATCAAACTTCTATGTTCATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_nodosum ATGGAAGGTATTATTAACTTTCACCATGATTTAATGTTTTTTTTAATTGTTATAACTACTTTTGTTTGTTGGTTATTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCATCAACTGTAGTTCATGGCGCAACCATTGAAATTATTTGGACATCTATTCCTGCATTAATTTTATTAACTGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAGTAATTGATCCAATTATTACAATAAAAGTAATTGGTAGTCAATGGTATTGGAGCTATGAATATTCAGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGATAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCTTCCTTAGGTATTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAACGAGAAGGTGTGTTTTATGG Globisporangium_nunn_UZ041 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTTATAACTACTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAACAAAGTTCCATCTACTATAGTTCACGGTGCAACTATTGAAATTATTTGGACTTCTGTTCCAGCTTTAATTTTATTAACTGTAGCAGTACCTTCATTTGCTTTATTATATTCTATGGATGAAGTAATTGATCCAATTATTACTATAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGCTATATGGTACAAGATAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTTTTACATTCTTGGGCTATTCCTTCTTTAGGTATAAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Globisporangium_okanoganense_OPU1443 ATGGAAGGTATAATTAACTTTCACCATGATTTAATGTTTTTTTTAATTGTGGTAACTATTTTTGTTTGTTGGATGTTATTCAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATCCCTTCTACAGTTGTACACGGTGCAACTATTGAAATTATTTGGACTTCAGTACCAGCTTTAATTTTATTAACTGTAGCAGTACCTTCATTTGCTTTATTATATTCTATGGATGAAGTTATTGATCCTATTATAACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGCTATGAATATTCAGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTAGTACCTACTAATAGTCATATTAGAGTATTAATTACTGCATCAGATGTTTTACATTCTTGGGCAATACCTTCTTTAGGTATTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_paddicum_OPU1438 ATGGAAGGTATTATTAACTTCCACCATGATTTAATGTTTTTTTTAATTGTGGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACTGTTGTACATGGTGCAACTATTGAAATTATTTGGACTTCGGTACCTGCTTTAATTTTATTAACAGTAGCTGTACCTTCATTTGCTTTATTATATTCAATGGATGAAGTTATTGATCCAATTATAACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAACTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTGGTTGTACCAACAAATAGTCATATTAGAGTGTTAATTACTGCATCGGATGTTTTACATTCTTGGGCAATCCCTTCTTTAGGTATTAAACTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_paroecandrum ATGGAAGGTATAATTAACTTTCACCACGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATAACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACTGTTGTACATGGTGCAACTATTGAAATTATTTGGACATCAGTGCCTGCTTTAATTTTATTAACTGTAGCTGTACCTTCATTTGCTTTATTATATTCTATGGATGAAGTTATTGATCCAATTATTACTTTAAAAGTAATAGGAAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTAGTTCCAACTAATAGTCATATTAGAGTATTAATTACAGCTTCAGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTATTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAGACTTCTATGTTTATTAAAAGAGAAGGAGTATTTTATGG Globisporangium_rostratifingens_OPU1440 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTTACAACAATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACAGTAGTACATGGAGCAACTATTGAAATTATTTGGACTTCAATACCTGCTTTAATTTTATTAACAGTAGCTATACCATCATTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCTATAATTACTATTAAAGTTATAGGTAGTCAATGGTACTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAGCCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGACTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAACCGTGTTGTTGTTCCAACTAATAGTCATATTAGAGTATTAATTACTGCTTCTGATGTTTTACATTCATGGGCAGTACCTTCATTAGGTATAAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Globisporangium_rostratifingens_UZ354 ATGGAAGGTATTATTAACTTTCACCATGATTTAATGTTTTTTTTAATTGTTACAACAATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACAGTAGTACATGGAGCAACTATTGAAATTATTTGGACTTCAATACCTGCTTTAATTTTATTAACAGTAGCTATACCATCATTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCTATAATTACTATTAAAGTTATAGGTAGTCAATGGTACTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAGCCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAACCGTGTTGTTGTTCCAACTAATAGTCATATTAGAGTATTAATTACTGCTTCTGATGTTTTACATTCATGGGCAATACCTTCATTAGGTATAAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Globisporangium_rostratum_OPU1441 ATGGAAGGTATTATTAACTTTCACCATGATTTAATGTTTTTTTTAATTGTTACAACAATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACAGTAGTACATGGAGCAACTATTGAAATTATTTGGACTTCAATACCTGCTTTAATTTTATTAACAGTAGCTATACCTTCATTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCTATAATTACTATTAAAGTTATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGCTATATGATACAAGAAAATGATTTAGAAATAGGTCAATTTAGATTATTAGAAGTAGATAATCGTGTAGTTGTTCCAACTAATAGTCATATTAGAGTATTAATTACTGCTTCTGATGTTTTACATTCATGGGCAATACCTTCATTGGGTATAAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTTTTCTATGG Globisporangium_sp_UZ164 ATGGAAGGTATAATTAACTTTCACCCCGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACTGTTGTACATGGCGCAACTATTGAAATTATTTGGACTTCAGTACCAGCTTTAATTTTATTAACTGTAGCTGTACCTTCTTTTGCTTTATTATATTCTATGGATGAAGTTATAGATCCTATTATAACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTAGTACCTACTAATAGTCATATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTATTAAATTAAATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTACGG Globisporangium_sp_UZ182 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTTGTGACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATAACACTTTTTGATGAAAAAAAAAATAAAATCCCTTCTACTGTAGTACATGGTGCAACTATTGAAATTATTTGGACATCAATTCCAGCTTTAATTTTATTAACCGTAGCAGTACCTTCTTTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCTATTATTACTATTAAAGTTATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTTCAAGAAAATGATTTAGAAATCGGTCAATTTAGACTTTTAGAAGTAGATAATAGAGTAGTAGTACCTACTAATAGTCATATTAGAGTATTAATAACTGCATCAGATGTTTTACATTCATGGGCTATTCCTTCTTTAGGTGTTAAATTAAATGCTTGTCCTGGACGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Globisporangium_sp_UZ213 ATGGAAGGTATAATTAACTTTCACCACGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATCCCTTCAACTGTTGTACATGGTGCAACTATTGAAATTATTTGGACTTCAGTACCTGCTTTAATTTTATTAACAGTAGCAGTACCTTCATTTGCTTTATTATATTCTATGGATGAAGTTATAGATCCTATTATAACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGCTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTAGTACCAACTAATAGTCATATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTATTAAATTGGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_sp_UZ249 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTGGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCTTCTACTGTTGTACATGGTGCTGCTATTGAAATTATTTGGACTACTATACCAGCTTTAATTTTATTAACTGTAGCAGTTCCATCATTTGCTTTATTATATTCTATGGATGAAGTAATTGATCCTATAATTACTTTAAAAGTTATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAGCCTTTAATTTTTGATAGTTACATGGTACAAGAAAATGATTTAGAATTAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTAGTTCCTACTAATAGTCATATAAGAGTATTAATTACAGCTTCTGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTGTTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_sp_UZ253 ATGGAAGGTATTATTAACTTTCACCATGATTTAATGTTTTTTTTAATTGTTATAACTACTTTTGTTTGTTGGTTATTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCGTCAACTGTAGTTCATGGCGCAACTATTGAAATTATTTGGACTTCTATTCCTGCATTAATTTTATTAACTGTAGCAGTGCCTTCATTTGCTTTATTATACTCTATGGATGAGGTAATTGATCCAATTATTACAATAAAAGTAATAGGTAGTCAATGGTATTGGAGCTATGAATATTCAGATAATTTAGAATTTTCTGAT------------------GAACCTCTAATTTTTGATAGTTATATGGTACAAGATAATGACTTAGAAATTGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTTGTTCCTACTAATAGTCATATTAGAGTGTTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTATTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAGGGCGTATTTTATGG Globisporangium_sp_UZ260 ATGGAAGGTATTATTAACTTTCACCCCGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACTGTTGTACATGGTGCAACTATTGAAATTATTTGGACTTCAATCCCTGCTTTAATTTTATTAACTGTAGCTGTTCCTTCTTTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCAATTATTACTGTAAAAGTAATTGGTAGTCAATGGTATTGGAGCTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAGCCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTCAGACTTTTAGAAGTAGATAATCGTGTAGTAGTACCAACTAATAGCCACATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCATGGGCTGTTCCTTCTTTAGGTATTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTCATTAAAAGAGAAGGTGTATTCTATGG Globisporangium_sp_UZ275 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTAATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACTGTTGTGCATGGTGCAACTATTGAAATTATTTGGACTTCAATTCCTGCTTTAATTTTATTAACAGTAGCTGTTCCATCTTTTGCTTTATTATATTCAATGGATGAGGTAATTGATCCTATAATTACTGTTAAAGTAATAGGTAGTCAATGGTACTGGAGCTATGAATATTCGGATAATTTAGAATTTTCAGAT------------------GAGCCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATTGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTAGTACCTACTAATAGTCATATTAGAGTATTAATAACAGCTTCTGATGTTTTACATTCTTGGGCTATCCCTTCTTTAGGTATAAAATTAGATGCTTGTCCAGGCCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTACGG Globisporangium_sp_UZ277 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTTATAACTACTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAACAAAGTTCCATCAACTATAGTTCATGGTGCAACTATTGAAATTATTTGGACTTCTGTTCCTGCTTTAATTTTATTAACTGTTGCAGTACCTTCATTTGCTTTATTATATTCTATGGATGAAGTAATTGATCCAATTATTACTATAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGATAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCGGATGTTTTACATTCTTGGGCTATACCTTCTTTAGGTATAAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTCTATGG Globisporangium_sp_UZ284 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTGGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCTTCTACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACCACTATACCAGCTTTAATTTTATTAACTGTAGCAGTTCCATCATTTGCTTTATTATATTCTATGGATGAAGTAATTGATCCTATAATTACTTTAAAAGTTATAGGTAGTCAATGGTATTGGAGCTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAGCCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAATTAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTAGTTCCTACTAATAGTCATATAAGAGTATTAATTACAGCTTCTGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTGTTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_sp_UZ290 ATGGAAGGTATTATTAACTTTCACCATGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACTGTTGTACATGGTGCAACTATTGAAATTATTTGGACTTCAATTCCTGCTTTAATTTTATTAACTGTAGCTGTTCCTTCTTTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCTATTATTACTGTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTAGTACCAACTAATAGTCATATTAGAGTATTAATTACTGCTTCTGATGTTTTACATTCATGGGCTGTTCCTTCTTTAGGTATTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTCATTAAAAGAGAAGGTGTATTTTACGG Globisporangium_sp_UZ304 ATGGAAGGTATTATTAACTTTCACCCCGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACTGTTGTGCACGGTGCAACTATTGAAATTATTTGGACTTCAATTCCCGCTTTAATTTTATTAACTGTAGCTGTTCCATCTTTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCTATTATTACTGTTAAAGTAATTGGTAGTCAATGGTACTGGAGCTATGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATTGGTCAATTTAGACTTTTAGAAGTAGACAATCGTGTAGTAGTACCTACTAATAGCCATATTCGAGTATTAATAACAGCTTCAAATGTTTTACATTCTTGGGCTATTCCTTCATTAGGTATTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCAATGTTCATTAAAAGAGAAGGTGTATTCTACGG Globisporangium_sp_UZ318 ATGGAAGGTATTATTAACTTTCACCACGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCCTCTACAGTTGTACATGGTGCTACTATTGAAATTATTTGGACTTCAGTACCGGCTTTAATTTTATTAACTGTAGCAGTACCTTCATTTGCTTTATTATATTCTATGGACGAAGTTATTGACCCTATTATAACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTAGTACCAACTAATAGTCATATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTATTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTGTTTTATGG Globisporangium_sp_UZ382 ATGGAGGGTATAATTAATTTTCACCACGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACCGTTGTACATGGTGCAACTATTGAAATTATCTGGACTTCAGTACCTGCTTTAATTTTATTAACTGTAGCTGTACCTTCATTTGCTTTATTATATTCTATGGATGAAGTTATTGATCCAATTATAACTTTAAAAGTAATAGGAAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTTCAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTAGTACCAACTAATAGTCATATTAGAGTATTAATTACAGCTTCAGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTATTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_sp_UZ400 ATGGAAGGTATAATTAACTTTCACCACGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACTGTTGTACATGGTGCAACTATTGAAATTATTTGGACTTCAGTACCTGCTTTAATTTTATTAACTGTAGCAGTACCTTCATTTGCTTTATTATATTCTATGGATGAGGTTATTGATCCTATTATAACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGCTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTAGTGCCAACTAATAGTCATATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTATTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAGGGTGTATTTTATGG Globisporangium_sp_UZ416 ATGGAAGGTATTATTAACCTTCACCATGATTTAATGTTTTTTTTAATTGTTACAACAATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACAGTAGTACATGGAGCAACTATTGAAATTATTTGGACCTCAATTCCTGCTTTAATTTTATTAACAGTAGCTATACCATCATTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCTATAATTACCATTAAAGTTATTGGTAGTCAATGGTACTGGAGTTATGAATATTCTGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAACCGTGTAGTTGTTCCTACTAATAGTCATATTAGAGTATTAATTACTGCTTCTGATGTTTTACATTCATGGGCAATACCTTCATTAGGTATAAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Globisporangium_sp_UZ636 ATGGAAGGTATTATTAACTTCCACCACGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGCTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACTGTTGTACATGGTGCAACCATTGAAATTATTTGGACTTCAATTCCTGCTTTAATTTTATTAACTGTAGCTGTTCCTTCTTTTGCTTTATTATACTCAATGGATGAAGTAATTGATCCTATTATTACTGTAAAAGTAATTGGTAGCCAATGGTATTGGAGCTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAGCCTTTAATTTTTGATAGCTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTGGATAATCGTGTAGTAGTACCAACTAATAGTCATATTAGAGTATTAATTACAGCTTCAGATGTTTTACATTCATGGGCTGTTCCTTCTTTAGGTATTAAATTAGATGCTTGTCCAGGCCGTTTAAATCAAACCTCTATGTTCATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_sp_ZSF0030 ATGGAAGGTATAATTAACTTTCACCACGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATAACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCGACTGTTGTACATGGTGCAACTATTGAAATTATTTGGACTTCAGTACCCGCTTTAATTTTATTAACTGTAGCTGTGCCTTCATTTGCTTTATTATATTCTATGGATGAAGTTATTGATCCTATTATAACTTTAAAAGTTATAGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGATTATTAGAAGTAGATAATCGTATAGTAGTACCAACTAATAGTCATATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTATTAAATTAGATGCTTGTCCTGGTAGATTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_sp_ZSF0069 ATGGAAGGTATTATTAACTTTCATCACGATTTAATGTTTTTTTTAATTGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACTGTTGTACATGGTGCAACTATTGAAATTATTTGGACTTCAGTACCAGCTTTAATTTTATTAACTGTAGCTGTACCTTCATTTGCTTTATTATATTCTATGGATGAAGTTATTGATCCTATTATAACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCGGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTATAGTAGTACCTACTAATAGTCATATTAGAGTGTTAATTACAGCTTCTGACGTTTTACATTCATGGGCTATACCTTCTTTAGGTATTAAATTAGATGCTTGTCCAGGTCGTTTAAACCAAACTTCTATGTTTATTAAAAGAGAGGGTGTATTTTATGG Globisporangium_spinosum_UZ150 ATGGAAGGTATAATTAACTTTCACCACGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACTGTTGTACATGGTGCAACTATTGAAATTATTTGGACTTCAGTACCAGCTTTAATTTTATTAACAGTAGCTGTACCTTCATTTGCTTTATTATATTCTATGGATGAAGTTATTGATCCAATTATAACTTTAAAAGTAATAGGAAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTTCAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTGGTAGTACCAACTAATAGTCATATTAGAGTATTAATTACAGCTTCAGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTATTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAGGGTGTATTTTATGG Globisporangium_splendens_UZ174 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATCACTCTTTTTGATGAAAAAAAAAATAAAGTACCTTCAACTATTGTACATGGTGCTACTATTGAAATTATTTGGACTACCATACCAGCCTTAATTTTATTAACAGTAGCTATTCCATCATTTGCTTTATTATATTCGATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGACTTAGAAATTGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAATTGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCATCATTAGGTGTTAAATTAGATGCTTGTCCGGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Globisporangium_sylvaticum_UZ307 ATGGAAGGTATTATTAACTTTCACCACGATTTAATGTTTTTTTTAATTGTTGTAACTATTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCTACTGTTGTACATGGTGCAACTATTGAAATTATTTGGACTTCAGTACCAGCTTTAATTTTATTAACTGTAGCAGTACCTTCATTTGCTTTATTATATTCTATGGATGAAGTTATTGATCCTATTATAACTTTAAAAGTAATAGGTAGTCAATGGTACTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTATAGTGGTACCAACTAATAGTCATATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCATGGGCTATACCTTCATTAGGTATTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTACGG Globisporangium_ultimum_UZ056 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATCGTTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCTTCAACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACTACAATACCAGCTTTAATTTTATTAACTGTAGCTGTTCCATCATTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGCCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAGTTTTCAGAT------------------GAGCCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTTGTTCCAACTAATAGCCATATTAGAGTATTAATTACAGCTTCTGATGTTTTACATTCATGGGCGATACCTTCATTAGGTGTTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Globisporangium_uncinulatum_Py2 ATGGAAGGTATAATTAACCTTCATCATGATTTAATGTTTTTTTTAATTGTTATAACTACTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCATCAACTGTTGTACATGGTGCAACTATTGAAATTATTTGGACTTCAATTCCAGCTTTAATTTTATTAACTGTAGCAATTCCATCATTTGCTTTATTATATTCGATGGATGAAGTTATTGATCCAATTATTACAATAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCAAATAATTTAGATTTTTCAAAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAGTGATTTAGAAATAGGTCAAATTAGACTTTTAGAAGTAGATAATCGTGTAGTTGTACCTGTTAATAGTCATATTAGAGTTTTAATAACAGCATCTGATGTTTTACATTCGTGGGCTATACCTTCTTTAGGTATTAAATTAGATGCTTGTCCTGGACGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAGGGTGTATTTTATGG Hyaloperonospora_erophilae ATGGAAGGTATTATAAACTTTCATCATGATTTAATGTTTTTTTTAATTATTATTACAGTATTTGTTTGTTGGATGTTATTTCGAGTTATTACTCTTTTTGATGAAAAAAAAAACAAAACCCCTTCAACAGTAGTACATGGTGCTACTATTGAAATTATTTGGACTTCTGTCCCAGCTTTAATTTTATTAATTGTTGCTATCCCTTCATTCGCTTTATTATATTCAATGGATGAAGTAATTGATCCAATTATTACTTTAAAAGTGATTGGAAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGATACAAGAAGATGATCTAACAGTAGGTCAATTTAGAATTTTAGAAGTAGATAATCGTGTAGTAGTTCCAGTTAATAGTCATATTCGTGTACTAATTACAGCATCAGATGTTTTACATTCTTGGGCTATCCCTTCATTAGGGATTAAATTAGATGCTTGTCCAGGTCGTTTAAACCAAACTTCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Hyaloperonospora_parasitica ATGGAAGGTATTATAAACTTTCATCACGATTTAATGTTTTTTTTAATTGTTATTACTGTCTTTGTTTGTTGGATGTTATACAGAGTTATTACTCTTTTTAATGAAAAAAGAAATAAAATGCCAGCAACTGTTGTTCATGGTGCTACTATTGAAATTATTTGGACGTCTATTCCAGCTTTAATTTTATTAATTGTGGCAATTCCTTCATTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCCATTATTACTTTAAAAGTAATAGGAAGTCAATGGTACTGGAGTTATGAATATTCCGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGATACAAGAAGATGATTTAACAATAGGTCAATTTCGACTTTTAGAAGTAGATAATCGTGTAGTGGTACCTACTAATAGTCATATTCGGGTGTTAATTACTGCATCAGATGTATTACATTCTTGGGCTATACCTTCATTAGGTATTAAATTAGACGCCTGTCCTGGGCGTTTAAATCAAACATCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Lagenidium_callinectes ATGGAAGGTATAATTAATTTCCATCACGATTTAATGTTTTTTTTAGTTATCATTACAGTTTTTGTAAGTTGGATGTTATTTCGAGTAATTATTTTATTTGATGAAAAAAAAAATCCAACACCTGCAACTTTTGTACATGGTGCTACTATTGAAATAATATGGACAACTATTCCAGCAATAATTTTATTGATAGTAGCGATTCCTTCAGTTGCTTTATTATATTCTATGGATGAGGTAATTGATCCTATTATAACTTTAAAAGTAATAGGTAGTCAATGGTATTGGACTTATGAATATTCTGATAATTTAGAATATGCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGTTACAAGAAGATGATTTAGAAATAGGACAATTTAGATTATTAGAAGTAGATAATCGTGTTGTTGTTCCGACTAATACTCATATACGTGTATTAATTACTGCTTCAGATGTACTTCATTCATGGGCTGTACCTTCATTAGGAGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTATTTTATGG Lagenidium_giganteum ATGGAAGGTATTATTAATTTCCATCATGATTTAATATTTTTTTTAATAATAGTAACTGTTTTTGTTGGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATCCTATTCCAGCTACATTTGTACACGGTGCTACTATTGAAATTATTTGGACTACTATTCCAGCTTTAATTTTATTAACTGTTGCTGTTCCTTCTTTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCAGTTATAACATTAAAAGTTATTGGTAGTCAATGGTATTGGACATATGAATATTCAGATAATTTAGAATATGCAGAT------------------GAACCTTTAATTTTTGATAGTTACATGATACAAGAAGATGATTTAGAAATTGGTCAATTAAGATTATTAGAAGTTGATAATCGTATAGTTGTGCCTACTAATACTCATATTAGGGTATTAATTACTGCTTCAGATGTATTACATTCTTGGGCTGTTCCTTCATTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Lagenidium_humanum ATGGAAGGTATTATTAATTTCCATCATGATTTAATATTTTTTTTAATAATAGTAACTGTTTTCGTTGGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATCCTATTCCAGCGACTTTTGTACACGGTGCTACTATTGAAATTATTTGGACTACTATACCAGCTTTAATCTTATTAACAGTAGCGGTTCCATCTTTTGCTTTATTATATTCAATGGATGAAGTTATTGATCCAGTTATTACTTTAAAAGTTATAGGTAGTCAATGGTATTGGACTTATGAATATTCTGATAATTTAGAATATGCAGAT------------------GAGCCTTTAATTTTTGATAGCTATATGGTGCAAGAAGATGATTTAGAAATAGGTCAATTAAGATTATTAGAAGTAGATAATCGTATTGTTGTTCCAACTAATACACATATTAGAGTATTAATTACAGCATCAGATGTATTACACTCTTGGGCTGTTCCTTCATTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Lagenidium_thermophilum ATGGAAGGTATAATTAATTTCCATCACGATTTAATGTTTTTTTTAGTTATCATTACAGTTTTTGTAAGTTGGATGTTATTTCGAGTAATTATTTTATTTGATGAAAAAAAAAATCCAACACCTGCAACTTTTGTACATGGTGCTACTATTGAAATAATATGGACAACTATTCCAGCAATAATTTTATTGATAGTAGCGATTCCTTCAGTTGCTTTATTATATTCTATGGATGAGGTAATTGATCCTATTATAACTTTAAAAGTAATAGGTAGTCAATGGTATTGGACTTATGAATATTCTGATAATTTAGAATATGCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGTTACAAGAAGATGATTTAGAAATAGGACAATTTAGATTATTAGAAGTAGATAATCGTGTTGTTGTTCCGACTAATACTCATATACGTGTATTAATTACTGCTTCAGATGTACTTCATTCATGGGCTGTACCTTCATTAGGAGTTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTATTTTATGG Leptomitus_lacteus ATGGAGGGTATTATTAGCTTTCATCATGACTTATTCTTTTTTTTAGTATTAATAGTTATTTTTGTAAGTTGGATTTTAGCTAGATTGATTTATTTTTTTGATGAAGATAAACAAAAAGTTGCTGATACTTTTGTTCATGGAACTACTGTGGAAATTGTATGGACTATTACTCCCGCATTAATCTTAGTTTTCATAGCTATTCCTTCATTTTCTTTATTATATGCAATGGATGAAGTAATTGATCCTATTTTAACTGTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATTCATATACTGATACTAAT------------------GAATCTATTTTTTTTGATAGTTATATGGTAGCAGAAGATGATTTAGAAATAGGTCAATTCAGATTATTAGAAGTAGATAATAGAATAGTAGTTCCTACTAATACACATATTCGTTTAATTATTACTGCTTCTGATGTTTTACATTCATGGGCTGTTCCTTCTTTAGGTATTAAATTAGATGCATGTCCCGGTAGATTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTCTATGG Ovatisporangium_boreale ATGGAAGGTATTATAAATTTTTATCATGATATAATGTTTTTTTTAGTTATTATAACAGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTTATCTTTTTGATGAACAAAAAAATAAAGTTCCTGCTACTGTTATACACGGTGCTACTATTGAAATTATTTGGACTACTATTCCAGCTTTAATTTTATTAACAGTTGCTATTCCTTCTTTTGCATTATTATATTCAATGGATGAAGTTATTGATCCTATTATTACTGTTAAAGTTATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGAAATTGGTCAATTAAGAGTATTAGAAGTTGATAATCGTGTTGTAGTACCTGCTAATAGTCATATAAGAGTTTTAATAACATCTTCTGATGTTTTACATTCATGGGCAATTCCTTCTTTAGGTATTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATAAAAAGAGAAGGTGTATTTTATGG Ovatisporangium_helicoides ATGGAAGGTATTATAAATTTTTATCATGATATAATGTTTTTTTTAGTTATTATAACAGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTTATCTTTTTGATGAAAAAAAAAATAAAGTTCCTTCAACTGTTATACATGGAGCTACTATTGAAATTATTTGGACAACAATTCCAGCTTTAATTTTATTAACTGTAGCAATTCCTTCTTTTGCTTTATTATATTCAATGGATGAAGTTATTGATCCTATTATTACAGTAAAAGTTATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGCTATATGGTACAAGAAGATGATTTAGAAATAGGTCAATTAAGAGTATTAGAAGTTGATAATCGTGTAGTTGTTCCTACTAATAGTCATATTAGAGTTCTTATAACATCATCTGATGTTTTACATTCTTGGGCAATTCCTTCTTTAGGTATTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Ovatisporangium_oedichilum ATGGAAGGTATTATAAATTTTTATCATGATATAATGTTTTTTTTAGTTATTATAACAGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTTATCTATTTGATGACCAAAAAAATAAAATTCCTTCTACTGTTATACATGGTGCTACTATTGAAATTATTTGGACTACTATTCCAGCTTTAATTTTATTAACAGTAGCTATTCCTTCTTTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCCATTATTACTGTAAAAGTTATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGAAATAGGTCAATTAAGAGTATTAGAAGTTGATAATCGTGTAGTAGTACCTACTAATAGTCATATTAGAGTGTTAATAACATCTTCAGATGTTTTACATTCATGGGCAATACCTTCATTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACCTCAATGTTTATAAAAAGAGAAGGTGTATTTTATGG Ovatisporangium_ostracodes ATGGAAGGTATTATAAATTTTTATCATGATATAATGTTTTTTTTAGTTATTATAACAGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTTATCTTTTTGATGAACAAAAAAATAAAACTCCTTCTACTGTTATACACGGTGCTACTATTGAAATTATTTGGACTACTATTCCAGCTTTAATTTTATTAACTGTTGCTATTCCTTCTTTTGCTTTATTATATTCAATGGATGAAGTTATTGACCCTATTATTACTGTTAAAGTTATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCATTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGAAATAGGACAATTAAGAGTATTAGAAGTTGATAATCGTGTTGTAGTACCAACTAATAGTCATATAAGAGTTTTAATAACATCTTCTGATGTTTTACATTCATGGGCAATTCCTTCTTTAGGTATTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Ovatisporangium_sp_UZ230 ATGGAAGGTATTATAAATTTTTATCATGATATAATGTTTTTTTTAGTTATTATAACAGTTTTTGTATGTTGGATGTTATTTAGAGTTATTTATCTTTTTGATGAAAATAAAAATAAAACTCCTTCTACTGTTATACACGGTGCTACTATTGAAATTATTTGGACTACTATTCCAGCTTTAATTTTATTAACAGTTGCTATTCCTTCTTTTGCTTTATTATATTCAATGGATGAAGTTATTGATCCTATTATTACTGTTAAAGTTATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGAAATAGGCCAATTAAGAGTATTAGAAGTTGATAATCGTGTTGTAGTACCTACTAACAGTCATATAAGAGTTTTAATAACATCTTCAGATGTTTTACATTCATGGGCTATTCCTTCTTTAGGTATTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTATTTTATGG Ovatisporangium_sp_UZ248 ATGGAAGGTATTATAAATTTTTATCATGATATAATGTTTTTTTTAGTTATTATAACAGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTTATCTTTTTGATGAAAAAAAAAATAAAGTTCCTTCTACTGTTATACATGGTGCTACTATTGAAATTATTTGGACAACAATTCCAGCTTTAATTTTATTAACTGTAGCAATTCCTTCTTTTGCTTTATTATATTCAATGGATGAAGTTATTGATCCTATAATCACAGTAAAAGTTATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGAAATAGGTCAATTAAGAGTATTGGAAGTTGATAATCGTGTAGTTGTTCCTACTAATAGTCATATTAGAGTTCTTATAACATCATCTGATGTTTTACATTCATGGGCAATTCCTTCTTTAGGTATAAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATAAAAAGAGAAGGTGTATTTTATGG Ovatisporangium_sp_UZ287 ATGGAAGGTATTATAAATTTTTATCATGATATTATGTTTTTTTTAGTTATTATAACAGTTTTTGTTTTTTGGATGTTATTTAGAGTTATTTATCTTTTTGATGAAAAAAAAAATAAAAATCCAGCAACTGTTATACATGGTGCTACTATTGAAATTATTTGGACTACTATTCCAGCTTTAATCTTATTAGTTGTAGCTATTCCTTCTTTTGCTTTATTATATTCAATGGATGAAGTAATAGATCCTATAATAACTGTTAAAGTTATAGGTAGTCAATGGTATTGGAGCTATGAATATTCAGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTACATGGTTCAAGAAGATGATTTAGAAATAGGTCAATTAAGAGTATTAGAAGTTGATAATCGTGTAGTTGTTCCTACTAATAGTCATATAAGAGTTTTAATAACATCTTCAGATGTTTTACATTCATGGGCTATTCCTTCTTTAGGTATCAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Ovatisporangium_vexans_UZ215 ATGGAAGGTATTATAAATTTTTATCATGATATTATGTTTTTTTTAGTTATTATAACAGTTTTTGTTTTTTGGATGTTATTTAAAGTTATTTATCTTTTTGATGAAAAAAAAAATAAAAATCCAGCAACTGTTATACATGGTGCTACTATTGAAATTATTTGGACTACTATTCCAGCTTTAATCTTATTAGTTGTAGCTATTCCTTCTTTTGCTTTATTATATTCAATGGATGAAGTAATAGATCCTATAATAACTGTTAAAGTTATTGGTAGTCAATGGTATTGGAGCTACGAATATTCAGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTACATGGTTCAAGAAGATGATTTAGAAATAGGTCAATTAAGAGTATTAGAAGTTGATAATCGTGTAGTTGTTCCTACTAATAGTCATATAAGAGTTTTAATAACATCTTCAGATGTTTTACATTCATGGGCTATTCCTTCTTTAGGTATTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Ovatisporangium_vexans_UZ309 ATGGAAGGTATTATAAATTTTTATCATGATATTATGTTTTTTTTAGTTATTATAACAGTTTTTGTTTTTTGGATGTTATTTAAAGTTATTTATCTTTTTGATGAAAAAAAAAATAAAAATCCTGCAACTGTTATACATGGTGCTACTATTGAAATTATTTGGACTACTATTCCAGCTTTAATCTTATTAGTTGTAGCTATTCCTTCTTTTGCTTTATTATATTCAATGGATGAAGTAATAGATCCTATAATAACTGTTAAAGTTATAGGTAGTCAATGGTATTGGAGCTATGAATATTCAGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTTCAAGAAGATGATTTAGAAATAGGTCAATTAAGGGTATTAGAAGTTGATAACCGTGTAGTTGTTCCTACCAATAGTCATATAAGAGTTTTAATAACATCATCAGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTATTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Paraperonospora_leptosperma ATGGAGGGTATTATTAATTTCCACCACGATATTATGTTTTTCTTAATCATGATTACTATCTTTGTTTGTTGGATGTTGTTTCGAGTGATTGTTCTTTTCGATGAAAAAAGAAATAAGATTCCAGCAACTGTTGTTCATGGAGCTACAATTGAAATTATATGGACTTCTATTCCCGCTTTAATTTTGCTAGTTATCGCAATACCTTCTTTCGCTTTATTGTATTCAATGGATGAAATAATTGATCCTATTATTACGTTGAAAGTAATTGGTAGCCAATGGTATTGGAGTTACGAATATTCGGATAATTTAGAATTTTCAGAT------------------GAACCTCTGATCTTTGATAGTTATATGGTACAGGAGGATGATTTAGCAATAGGTCAATTTAGACTTTTAGAAGTTGATAACCGCGTAATTGTACCAACTAATAGTCATATTCGGGTTTTAATTACAGCATCGGATGTTTTACATTCATGGGCTATACCTTCGTTAGGTATTAAATTAGATGCTTGCCCTGGACGCTTAAACCAAACTTCTATGTTTATTAAACGGGAAGGTGTTTTTTACGG Peronospora_aestivalis ATGGAAGGTATTATTAATTTTCATCATGATTTAATGTTTTTCTTAATTATTGTTACTGTCTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTAATGAAAAAAAAAATAAAATCCCATCTACTGTAGTACATGGAGCCACAATTGAAATTATTTGGACTTCTATCCCAGCTTTAATTTTATTAACTATAGCAATACCTTCATTTGCTTTATTATATTCAATGGATGAAGTTATTGATCCAATTATTACATTAAAAGTAATTGGAAATCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGCGATAGGTCAACTTAGACTTTTAGAAGTTGATAATCGGGTAATTGTTCCAACGAATAGTCATATTCGAATTTTAATTACGGCTTCAGATGTTTTACATTCATGGGCTATTCCATCATTAGGTATTAAATTAGATGCATGTCCTGGACGTTTAAATCAAACATCCATGTTTATAAAAAGAGAAGGTGTTTTTTATGG Peronospora_aparines ATGGAAGGTATTATAAACTTTCATCATGATTTAATGTTTTTTTTAATTATTGTTACGGTATTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAACAAAATCCCATCAACTGTTGTACATGGAGCTACTATTGAAATTATTTGGACTTCTATACCAGCTTTAATTTTATTGATTATTGCTATACCGTCATTTGCTTTATTATACTCGATGGATGAAGTAATTGACCCTATTATTACTTTAAAAGTAATTGGAAATCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGATTCAAGAAGATGATTTAGCAATAGGCCAATTTAGATTGTTAGAAGTTGATAATCGTGTTATTGTTCCAACTAATAGCCATATTAGGGTATTAATTACTGCTTCAGATGTTTTACATTCATGGGCTATCCCTTCATTAGGAATAAAACTAGATGCTTGTCCAGGTCGTTTAAATCAAACATCCATGTTTATTAAAAGAGAGGGTGTTTTTTATGG Peronospora_arvensis ATGGAGGGTATCATTAATTTCCATCACGATCTGATGTTTTTTTTAATTATTGTTACGGTATTTGTATGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAGACCCCAGCAACGGTAGTACATGGAGCTACTATTGAAATTATTTGGACTTCTATCCCAGCTTTAATTTTATTAATTGTGGCAATACCTTCTTTCGCTTTATTATATTCGATGGATGAAGTGATTGATCCTATTATCACTTTAAAGGTAATTGGGAATCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGATACAAGAAGATGATTTAGTAATAGGACAATTTAGACTTTTAGAAGTTGATAATCGTGTAATAGTTCCTACAAATAGTCATATTCGAGTATTAATTACTGCTTCGGATGTATTACATTCATGGGCTATTCCTTCATTAGGTATTAAATTAGATGCTTGTCCGGGACGTTTAAACCAAACATCTATGTTTATAAAAAGAGAAGGTGTTTTTTATGG Peronospora_boni_henrici ATGGAAGGTATTATTAACTTTCACCATGATTTAATGTTTTTTTTAATTATTGTTACAGTATTTGTTTGTTGGATGTTATTTAGAGTAATTACTCTTTTTGATGAAAAAAAAAATAAAATCCCAGCAACAGTAGTACATGGGGCTACTATTGAAATTATTTGGACTTCTATTCCAGCCTTAATTTTATTAATGGTTGCAGTACCTTCTTTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCTATTATTACATTAAAAGTAATAGGTAACCAATGGTACTGGAGTTATGAATATTCCGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTACATGGTACAAGAAGATGATTTAGCTATCGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTGGTTCCAACTAATAGTCATATTCGAATATTAATTACGGCTTCGGATGTTTTACACTCGTGGGCTATCCCTTCATTAGGTATTAAATTAGATGCTTGTCCAGGACGTTTAAATCAAACGTCAATGTTTATTAAAAGAGAGGGTGTTTTTTATGG Peronospora_calotheca ATGGAAGGTATTATAAACTTTCATCATGATTTAATGTTTTTTTTAATTATTGTTACTGTATTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAACAAAATTCCAGCAACTGTAGTACATGGCGCTACTATTGAAATTATTTGGACTTCTATACCAGCTTTAATTTTACTAATTGTTGCTATACCATCATTTTCTTTATTATATTCAATGGATGAAGTAATTGACCCGATTATTACTTTAAAAGTAATTGGAAATCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTTCAAGAAGAGGATCTAGCAATAGGCCAATTTAGGTTGTTAGAAGTTGATAATCGTGTTGTTGTTCCAACTAATAGTCATATTAGAGTATTAATTACTGCTTCCGATGTTTTACATTCATGGGCTATTCCTTCATTAGGGATAAAATTAGATGCTTGTCCTGGACGTTTAAATCAAACATCAATGTTTATTAAAAGAGAGGGGGTTTTTTATGG Peronospora_conglomerata ATGGAAGGTATTATTAACTTTCACCATGATTTAATGTTTTTTTTAATTATAGTTACGGTATTTGTATGCTGGATGTTATTTCGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCAGCAACTGTAGTACATGGTGCAACTATTGAAATTATTTGGACTTCTATTCCTGCTTTAATTTTATTAATTGTCGCAATACCTTCTTTTGCTTTATTATATTCTATGGATGAAATGATTGATCCAATTATTACCTTAAAAGTAATTGGAAATCAATGGTACTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCCTTAATTTTTGATAGTTATATGGTACAAGAAGATGATCTAGCAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTATTAGTGCCTACTAATAGTCATATTAGGTTATTAATCACAGCTTCAGATGTTTTACATTCATGGGCTATACCTTCATTAGGTATAAAATTAGATGCTTGTCCTGGACGTTTAAATCAAACATCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Peronospora_hiemalis ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTATTGTTACTGTATTTGTTTGTTGGATGTTATTTAGAGTAATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCATCAACTGTAGTACATGGAGCTACTATTGAAATTATTTGGACTTCTATTCCAGCTTTAATTTTATTAATAATTGCAGTACCTTCTTTTGCTTTATTATATTCAATGGATGAGGTAATTGATCCTATTATTACATTAAAAGTAATTGGAAATCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGCTATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAATTGTTCCAACTAATAGCCATATTAGGATATTGATTACAGCTTCTGATGTTTTACATTCTTGGGCTATACCTTCATTAGGTATTAAATTAGATGCCTGCCCCGGTCGTTTAAATCAAACATCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Peronospora_lamii ATGGAAGGCATTATTAATTTTCATCATGATTTAATGTTTTTTTTAATTATTGTTACAGTCTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTACCGAACATAAAAATCCCACACCATCAACTGTTGTACATGGGGCTACAATTGAAATTATTTGGACGTCAATTCCCGCTTTTATTTTATTAACAATTGCTATTCCTTCATTTGCATTATTATATTCAATGGATGAAATTATTGATCCAATCATTTCTTTAAAAGTTATAGGTAATCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTGCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGATTCAAGAAGATGATTTAGCTATTGGACAATTAAGACTTTTAGAAGTTGATAATCGAGTTGTTGTACCAACAAATAGTCATATTCGGGTTTTAATTACAGCATCTGATGTTTTACATTCTTGGGCGATTCCATCTTTAGGTATTAAATTAGATGCCTGCCCTGGAAGGTTAAATCAAACATCAATGTTTATTAAACGAGAGGGTGTTTTTTATGG Peronospora_sanguisobae ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTATAATTACTGTGTTTGTTTGTTGGATGTTATTCAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCTTCAACTGTAGTACATGGTGCTACTATTGAAATTATTTGGACAACTATTCCAGCTTTAATTTTATTAATTATTGCTGTACCTTCTTTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCAATTATTACATTAAAAGTGATAGGAAATCAATGGTACTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAGGAGGAGGATTTAGCAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTAGTTCCAACTAATAGTCATATTAGAATATTAATTACTGCTTCAGATGTTTTACATTCATGGGCTATCCCTTCATTAGGTATTAAATTAGATGCTTGTCCTGGACGTTTAAATCAAACATCAATGTTTATAAAAAGAGAAGGTGTTTTTTATGG Peronospora_trivialis ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTATCGTTACTGTATTTGTTTGTTGGATGTTATTTAAAGTAATTATTCTTTTTGATGAAAAAAAAAATAAAATTCCAGCAACCTTAGTACATGGGGCTACTATTGAAATCATTTGGACTTCTATCCCAGCTTTAATGTTATTAATGGTGGCAGTACCTTCTTTTGCTTTATTATATTCAATGGATGAAGTTATTGATCCTATTATCACATTAAAAGTAATTGGTAATCAATGGTACTGGAGTTATGAATATTCTGATAATTTAGAATTTTCGGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACCTGAGGCTGATTTAGCTATAGGTCAATTTAGGTTACTAGAAGTAGATAATCGTGTAGTGGTTCCAACTAATAGTCATATTAGAATATTAATCACTGCTTCGGATGTTTTACATTCATGGGCTATTCCTTCATTAGGTATTAAGTTAGATGCATGTCCAGGACGTTTAAATCAAACATCAATGTTTATTAAAAGAGAAGGCGTTTTTTATGG Peronospora_variabilis ATGGAGGGTATTATTAACTTTCATCATGATTTGATGTTTTTTTTAATTATTGTTACTGTATTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCAGCAACAATTGTACATGGAGCTACTATTGAAATTATTTGGACTTCTATTCCAGCTTTAATTTTATTAATGGTTGCAGTACCTTCTTTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCTATTATTACATTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGCTATAGGTCAATTTCGACTTTTAGAAGTAGATAATCGTGTAGTAGTTCCAACTAATAGTCATATTAGGATCTTAATTACTGCTTCGGATGTTTTACATTCATGGGCTATTCCTTCATTAGGTATTAAATTAGACGCCTGTCCCGGAAGATTAAATCAAACTTCAATGTTTATTAAGAGAGAAGGTGTTTTTTATGG Phytophthora_boehmeriae ATGGAAGGTATTATTAATTTTCATCATGATTTAATGTTTTATTTAATCCTTATAACCGTTTTTGTTTGTTGGTTGTTATTTAGAGTTATTACTCTTTTTAATGAAAAAAAAAATAAAATTCCATCAACTGTTGTACATGGTGCAACTATTGAAATTATTTGGACTTCAATTCCAGCTTTAATATTATTAACTGTTGCAATTCCATCTTTTGCTTTATTATATTCAATGGATGAAGTAATTGACCCTATTATTACTTTAAAAGTAATTGGAAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTTCAAGAAGATGATTTAGCTATTGGTCAATTTCGATTATTAGAAGTAGATAATCGTGTTGTAGTACCAACAAATAGTCATATTCGTGTATTAATTACAGCTTCAGATGTTTTACATTCATGGGCTATTCCTTCATTAGGTATTAAATTAGATGCATGTCCAGGTCGTTTAAATCAAACATCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Phytophthora_cactorum ATGGAAGGTATTATTAACTTTCACCATGATTTAATGTTTTTTTTAATTATGATTACTGTATTTGTTTGTTGGATGTTATTTAGAGTTATAACTCTTTTTGATGAAAAAAATAATAAAATTCCTTCAACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACTTCTATTCCAGCTTTAATTTTATTAACTGTTGCAGTTCCATCTTTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCAATTATTACTTTAAAAGTAATTGGTAGTCAATGGTACTGGAGTTATGAATATTCAGATAATTTAGAATTCTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGCTATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTAGTTCCAACTAATAGTCATATTAGGGTATTAATTACAGCATCAGATGTATTACATTCATGGGCAATCCCATCGTTAGGTATTAAATTAGATGCTTGTCCTGGCCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Phytophthora_capsici ATGGAAGGTATTATAAATTTTCATCATGATTTAATGTTTTTTTTAATTATGATTGTTGTATTTGTATGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCAGCAACTGTTGTACATGGTGCAACTATTGAAATTATTTGGACTTCTATTCCAGCTTTAATTTTATTAACAGTAGCTGTTCCATCTTTTGCATTATTATATTCAATGGACGAAGTAATAGATCCTATTATTACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGCAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTAGTTCCAACTAATAGTCATATTAGAGTATTAATTACAGCATCAGATGTTTTACATTCTTGGGCTATACCTTCATTAGGTTTAAAATTAGATGCATGTCCTGGCCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Phytophthora_cinnamomi ATGGAAGGTATTATTAATTTTCATCATGATTTAATGTTTTTTTTAATTACTATTACTGTTTTTGTGTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAGAAAAAAATAAAATTCCAGCAACTGTTGTGCATGGAGCAACTATTGAAATTATTTGGACTTCTATACCTGCTTTAATTTTATTAACTGTTGCTATACCATCATTTGCTTTATTATATTCAATGGATGAAGTTATTGATCCAATTATTACATTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGCTATTGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTTGTTCCAACTAATAGTCATATTAGAGTTTTAATTACAGCATCAGATGTTTTACATTCATGGGCTATACCATCATTAGGTATTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Phytophthora_citricola ATGGAAGGTATTATAAATTTTCATCATGATTTAATGTTTTTTTTAATTATGATTGTTGTATTTGTATGTTGGATGTTATTTAGAGTTGTTACTCTTTTTGATGAAAAAAAAAATAAAATTCCAGCAACTGTTGTACATGGTGCAACTATTGAAATTATTTGGACTACTATTCCAGCTTTAATTTTATTAACTGTAGCAATACCATCTTTTGCATTATTATATTCAATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATAGGTAGTCAATGGTACTGGAGTTATGAATATTCAGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGATACAAGAAGATGATTTAGCTATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTAGTTCCAACTAATAGTCATATTAGGGTATTAATTACAGCATCAGATGTTTTACATTCTTGGGCTATACCATCATTAGGTATAAAATTAGATGCATGTCCTGGACGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Phytophthora_erythroseptica ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTTTTAATTATGATTACTGTATTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCAGCAACAGTAGTACATGGTGCAACTATTGAAATTATTTGGACTTCTATTCCAGCTTTAATTTTATTAACTGTTGCAGTTCCTTCTTTTGCTTTATTATATTCTATGGATGAAGTAATTGACCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAGTATTCAGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGCTATAGGTCAATTTAGGGTATTAGAAGTAGATAACCGTGTTGTAGTTCCTACTAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTTTTACATTCTTGGGCTATACCTTCATTAGGTATTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Phytophthora_gonapodyides ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTCTTTTTAATAAGCATAGTTGTATTCGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAACAAAATCCCAGCTACTATTGTACACGGTGCTACTATTGAAATTATTTGGACATCTATTCCAGCTTTAATTTTATTAACAGTTGCAGTACCTTCTTTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATTGGGAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGCAATAGGTCAATTTCGAATTTTAGAAGTAGATAATCGTGTCGTTGTTCCAACTAATAGTCATATTAGAGTATTAATTACTGCATCAGATGTTTTACATTCTTGGGCAATACCTTCTTTAGGTATCAAATTAGATGCATGTCCTGGTCGCTTAAATCAAACATCAATGTTTATTAAAAGAGAAGGTGTGTTTTACGG Phytophthora_heveae ATGGAAGGAATTATTAATTTTCATCATGATTTAATGTTTTTTTTAATTACCATTACTGTATTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCATCAACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACTTCAATTCCAGCTTTAATTTTATTAACTGTTGCAATCCCATCTTTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCAATTATTACCTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCAGAT------------------GAGCCTCTAATCTTTGATAGTTATATGGTACAAGAAGATGATTTAGCAATAGGTCAATTTAGAGTTTTAGAAGTAGATAATCGTGTAGTAGTTCCAACTAATAGTCATATTCGAGTATTAATTACTGCTTCAGATGTTTTACATTCATGGGCTATACCTTCGTTAGGTATTAAATTAGATGCATGTCCAGGTCGTTTAAATCAAACATCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Phytophthora_ilicis ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTATGATTACTGTATTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAACAAATAAAATTCCATCAACTATTGTACATGGTGCTACAATTGAAATTATTTGGACGACTATTCCAGCTTTAATTTTATTAATGGTTGCTGTACCTTCTTTTGCATTATTATATTCGATGGATGAAGTAATTGATCCTATCATTACATTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTGCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGACGATTTAGCTTTAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTTGTTCCGACTAATAGTCATATTAGAGTATTAATTACAGCGTCAGATGTTTTACATTCATGGGCTATACCTTCATTAGGTATTAAATTAGATGCATGTCCAGGACGTTTAAATCAAACATCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Phytophthora_insolita ATGGAAGGTATTATTAATTTTCACCATGATTTAATGTTTTTTTTAATATTAATTGTTGTGTTTGTATGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATCCCAGCAACTGTTGTTCATGGTGCTACTATTGAAATTATTTGGACTTCTATTCCAGCTTTAATTTTATTAACCGTTGCAATTCCATCATTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCAATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAACTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTACATGGTTCAAGAAGATGATTTAGCTATCGGTCAATTTAGAATATTAGAAGTAGATAATCGTGTAGTTGTTCCAACTAATAGTCATATACGTGTATTAATTACTGCATCAGATGTTTTACATTCATGGGCAATTCCATCATTAGGTATTAAATTAGATGCATGTCCAGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTTTTTTACGG Phytophthora_multivesiculata ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTATGATTACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAGATTCCTGCAACTATTGTACATGGTGCTACTATTGAAATTATTTGGACATCTATTCCAGCTTTAATATTATTAACTGTTGCAATTCCATCTTTTGCATTATTATATTCAATGGATGAAGTAATTGACCCAATTATTACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAGGAAGATGATTTAGCAATAGGTCAATTTAGAATTTTAGAAGTAGATAATCGTGTAGTAGTTCCAACTAATAGTCATATTAGAGTACTAATTACAGCATCGGATGTTTTACATTCATGGGCTATACCTTCATTAGGTATTAAATTGGATGCATGTCCGGGACGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAGGGTGTTTTTTATGG Phytophthora_nicotianae ATGGAGGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTATGATTACAGTATTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATCCCATCAACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACATCTATTCCAGCTTTAATTTTATTAACAGTTGCAGTTCCATCTTTTGCATTATTATATTCAATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTACGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGCAATAGGTCAATTTAGACTTTTAGAAGTAGATAATCGTGTAGTAGTTCCAACTAATAGTCATATTAGAGTATTAATTACTGCATCAGATGTATTACATTCATGGGCTATTCCTTCATTAGGCATTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Phytophthora_palmivora ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTATGATTACTGTATTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAACAATAAAATCCCATCAACTATTGTACATGGTGCTACTATTGAAATTATTTGGACTTCTATTCCAGCTTTAATTCTATTAACTGTTGCAATTCCATCTTTTGCTTTATTATATTCTATGGATGAAGTAATTGATCCAATTATAACTTTAAAAGTTATAGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGAT------------------GAACCTTTAATTTTTGATAGTTACATGGTACAAGAGGATGATTTAGCAATTGGTCAATTTAGAATTTTAGAAGTAGATAATCGTGTAGTAGTTCCTACTAATAGTCATATTAGAGTATTAATTACTGCATCAGATGTTTTACATTCATGGGCTATACCTTCATTAGGTATTAAATTAGATGCATGTCCGGGACGTTTAAATCAAACATCAATGTTTATAAAAAGAGAAGGTGTTTTTTATGG Phytophthora_quercina ATGGAAGGTATTATCAACTTTCACCATGATTTAATGTTTTTTTTAATTATGATTACTGTATTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAATAAATAAAATCCCATCAACTATTGTACATGGTGCTACTATTGAAATTATTTGGACTTCAATTCCAGCTTTAATTTTATTAACTGTTGCAATACCATCTTTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCAATTATTACATTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCAGAT------------------GAACCTTTAATATTTGATAGTTATATGGTACAAGAAGATGATTTAGCAATAGGTCAATTTAGAATTTTAGAAGTAGATAATCGTGTAGTAGTTCCAACTAATAGTCATATTAGAGTATTAATTACAGCATCAGATGTTTTACATTCGTGGGCTATCCCTTCATTAGGTATTAAATTAGATGCATGTCCAGGTCGTTTAAATCAAACATCTATGTTTATAAAAAGAGAAGGTGTTTTTTATGG Phytophthora_ramorum ATGGAAGGTATTATTAACTTTCACCATGATTTAATGTTTTTTTTAATTATGATTACTGTATTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCAACGGTAGTACATGGAGCTACTATTGAAATTATTTGGACATCTATTCCAGCTTTAATTTTATTAGTTGTTGCAGTACCATCTTTTGCTTTATTATATTCAATGGATGAGGTAATTGATCCAATTATTACATTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTACATGATACAAGAAGATGATTTAGCAATAGGTCAATTTAGAGTTTTAGAAGTAGATAATCGTGTAGTTGTACCAACAAATAGTCATATTAGAGTATTAATTACCGCATCAGATGTTTTACATTCATGGGCTATTCCTTCATTAGGTATTAAATTAGATGCATGTCCTGGACGTTTAAATCAAACATCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Phytophthora_syringae ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTATGATTACTGTATTTGTTTGTTGGATGCTTTTTAGAGTTATTACTCTTTTTGATGAAAAAATCAATAAAACACCCGCTACTGTAATACATGGTGCAACTATTGAAATTATTTGGACATCTATTCCAGCTTTCATTTTATTAATTGTGGCTGTTCCTTCTTTTGCTTTATTATATTCAATGGATGAAGTAATTGATCCTATTATTACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCTGAT------------------GAGCCTTTAATTTTTGATAGTTATATGATACAAGAAGATGATTTAGCTATAGGTCAATTTAGAGTATTGGAAGTAGATAATCGTGTAGTAGTTCCAACTAATAGTCATATTAGAGTTTTAATTACTGCTTCAGATGTTTTACATTCATGGGCTATACCTTCATTAGGTATAAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACATCAATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Pilasporangium_apinafurcum_UZ300 ATGGAAGGTATTATTAATTTCCATCATGATTTAATGTTTTTTTTAATTATAATAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCAACTATTGTACATGGTGCTACTATTGAAATTATTTGGACTACTATTCCTGCATTAATTTTATTAGTTTTAGCAGTACCTTCTTTTGCTTTATTATATTCAATGGATGAAGTTATTGATCCAATAATTACTTTAAAAGTTATAGGTAGTCAATGGTATTGGAGCTATGAATATTCAGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGATACAAGAAGATGACTTAGAAATAGGTAATTTAAGATTATTAGAAGTAGATAATCGTGTAGTTGTACCTACAAATAGTCATATTAGAGTTTTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTATTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Pilasporangium_apinafurcum_UZ301 ATGGAAGGTATTATTAATTTCCATCATGATTTAATGTTTTTTTTAATTATAGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCTTCAACTATTGTACATGGTGCTACTATTGAAATTATTTGGACTACTATTCCTGCATTAATTTTATTAGTTTTAGCAGTACCTTCTTTTGCTTTATTATATTCAATGGATGAAGTTATTGATCCAATAATTACTTTAAAAGTTATAGGTAGTCAATGGTATTGGAGCTATGAATATTCAGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGATACAAGAAGATGACTTAGAAATAGGTAATTTAAGATTATTAGAAGTAGATAATCGTGTAGTTGTACCTACAAATAGTCATATTAGAGTTTTAATTACAGCATCTGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTATTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGTGTTTTTTATGG Plasmopara_densa ATGGAAGGTATTATTAATTTTCATCATGATATAATGTTTTTTTTAATTATGATTACGGTTTTTGTTTGTTGGATGTTATTCCGAGTTGTTACTCGTTTTGATGAACGAAAAAATACTATTCCGGCGACAGTTGTGCATGGTGCGACGATTGAAATTATTTGGACTTCTATTCCAGCTTTAATTTTATTAATTGTTGCAATACCATCATTTGCATTATTATATTCAATGGATGAAATAATCGATCCAATCATTACGCTAAAAGTAATTGGAAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCCGAT------------------GAACCATTAATTTTTGATAGCTATATGGTACAAGAAAATGATTTGGAAATAGGTCAATTTCGACTTTTAGAAGTAGATAATCGTGTAATAGTTCCTATTAATAGCCATATTCGTGTTTTAATTACAGCATCTGATGTTTTACATTCTTGGGCAATACCCTCATTAGGTATAAAACTTGACGCTTGTCCCGGTCGATTAAATCAAACTTCAATGTTTGTTAAAAGAGAAGGTGTTTTTTATGG Plasmopara_megasperma ATGGAAGGTATCATTAACTTTCATCATGACATAATGTTTTTTTTAATTATGATAACCGTATTTGTTTGTTGGATGCTATTTAGAGTTGTTACTCTTTTTGATGAAGAAATAAATAAAATCCCATCAACTGTTGTACATGGTGCAACTATTGAAATTATTTGGACGTCTATTCCAGCATTAATTCTATTGATTATTGCAATCCCATCGTTTGCGTTATTGTATTCTATGGATGAAATAATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAGTGGTACTGGAGTTACGAATATTCAGATAATTTAGAATTTTCAGAC------------------GAACCTTTAATTTTTGATAGTTATATGGTACAGGAAAATGATTTAGCAATAGGGCAGTTTCGACTTTTGGAAGTTGACAACCGTGTAATTGTGCCGACTAATAGTCATATTCGTGTATTAATTACTGCATCTGATGTATTACATTCATGGGCGATACCATCACTTGGTATAAAATTAGATGCGTGTCCTGGTCGGTTAAATCAAACTTCAATGTTTGTTAAACGAGAAGGTGTTTTTTATGG Plasmopara_obducens ATGGAAGGTATTATAAATTTTCACCATGATATAATGTTTTTTTTAATTATGATTACTGTATTTGTTTGTTGGATGTTATTTCGAGTTGTTACTCTTTTTGATGAAAAAAAAAATAAAATACCCGCTACTGTTGTTCACGGTGCAACTATTGAAATTATTTGGACTTCAATTCCAGCTTTAATTTTATTAGTTGTTGCAATCCCATCATTTGCGTTATTGTATTCTATGGATGAGATAATTGATCCTATCATTACTTTAAAAGTAATCGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTTCAGAC------------------GAACCTTTAATTTTTGATAGTTACATGGTACAGGAAAATGATCTAGAAATAGGACAATTTCGGTTATTAGAAGTAGATAATAGAGTAATTGTCCCGATTAATAGTCATATTCGTGTATTAATTACTGCATCAGATGTTTTACATTCTTGGGCAATACCGTCTTTAGGTATAAAATTAGACGCGTGTCCAGGACGTTTAAATCAAACTTCAATGTTTGTTAAACGGGAAGGTGTTTTTTACG- Plasmopara_pusilla ATGGAAGGTATTATTAACTTCCACCACGATATAATGTTTTTTTTAATTATGATTACGGTATTTGTTTGTTGGATGTTATTCAGAGTTGTTACTCTTTTTGATGAAGAAAAAAACAAAATCTCGTCAACAGTTGTGCACGGAGCAACTATTGAAATTATTTGGACCTCAATTCCAGCTTTAATTTTGTTAATTATTGCAATTCCATCATTTGCATTGCTTTACTCCATGGATGAAATAATTGACCCGATTATTACACTAAAAGTAATCGGAAGTCAATGGTACTGGAGCTATGAATATTCCGATAACTTAGAATTTGCCGAT------------------GAACCTTTAATTTACGATAGTTATATGGTACAGGAAAACGATTTAGCCTTAGGACAGTTTAGACTTTTGGAAGTGGATAATCGTGTAGTTGTTCCAACTAATAGTCATATTCGCGTATTAATTACTGCATCCGATGTTTTGCATTCGTGGGCAATTCCGTCACTGGGTATAAAATTAGATGCGTGTCCCGGACGATTAAACCAAACATCAATGTTTATTAAACGAGAAGGTGTTTTTTATGG Plasmopara_viticola ATGGAGGGTATTATTAACTTTCATCATGATATAATGTTTTTTTTAATTATGATAACTGTATTCGTTTGTTGGATGTTATTTAGAGTTGTTACTCTTTTTGACGAAAAAAAAAACAAAACACCCGCGACCGTTGTACATGGTGCAACTATTGAAATTATTTGGACTTCTATTCCTGCTTTAATTTTATTAATTATTGCTATACCATCGTTTGCATTATTGTATTCTATGGATGAAATAATTGATCCTATTATTACTTTAAAAGTAATTGGAAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCAGAT------------------GAGCCTTTAATTTTTGATAGCTATATGGTTCCGGAAAGTGATTTAGCAATAGGTCAATTTAGATTATTAGAAGTTGATAATCGTGTAATAGTTCCAACTAATAGTCATATTCGTGTATTGATTACTGCGTCAGATGTTTTACACTCATGGGCGATACCTTCATTGGGAATAAAATTAGATGCATGTCCGGGCCGCTTAAATCAAACGTCAATGTTTATTAAACGAGAAGGTGTTTTTTATGG Pseudoperonospora_humuli ATGGAAGGTATTATTAACTTTCATCATGATTTAATTTTTTTTTTAATTGTAGTTACAGTATTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATTCCAGCTACTGTTGTACATGGTGCTACTATTGAAATTATTTGGACTTCAATTCCAGCTTTAATTTTATTAATTGTAGCAATTCCTTCGTTTGCATTATTATATTCTATGGATGAAGTAATTGATCCTATTATTACATTAAAAGTTATTGGAAGTCAATGGTATTGGAGTTATGAATATTCCGATAATTTAGAATTTTCCGAT------------------GAACCTTTAGTTTTTGATAGTTATATGGTACAAGAAGATGATTTAGCGATCGGTCAATTTAGAATTTTAGAAGTAGATAATCGTGTAGTAGTTCCAACTAATAGCCATATTCGAGTATTAATTACAGCTTCTGATGTTTTACATTCATGGGCTATTCCTTCATTGGGTATAAAATTAGATGCATGCCCTGGACGTTTAAATCAAACATCAATGTTTATAAAAAGAGAAGGTGTTTTTTATGG Pseudoperonospora_urticae ATGGAAGGTATTATTAACTTTCATCATGATTTGATTTTTTTTTTAATTATAGTTACTGTCTTTGTTTGTTGGATGTTATTTAGAGTTATTACTCTTTTTGATGAAAAAAAAAATAAAATACCATCAACTGTTGTACATGGAGCCACTATTGAAATTATTTGGACTTCAATTCCAGCTATAATTTTGTTAATTGTAGCTATACCTTCATTTGCATTATTATACTCTATGGATGAAGTAATTGATCCTATTATTACATTAAAAGTAATTGGAAGTCAATGGTATTGGAGTTACGAATATTCAGATAATTTGGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGCAATTGGTCAATTTAGAATTTTGGAAGTAGATAATAGAGTAGTAGTTCCAACTAATAGTCATATTCGTGTATTAATTACAGCTTCGGATGTTTTACATTCATGGGCTATTCCTTCATTAGGTATTAAATTAGATGCATGTCCGGGTCGTTTAAATCAAACATCTATGTTTATTAAAAGAGAAGGCGTTTTTTATGG Pythiopsis_cymosa ATGGAGGGTATTATAAATTTTCATCATGATTTATTTTTTTTTTTAGTATTAATTGTTATATTTGTTAGTTGGATTTTAGCTAGATGTATTTTTTTTTTTAATGAAAATACAAATAAAAAAGCTGAAACTTTTGTGCATGGTACTGTTTTAGAAATTGTATGGACTATTACACCTGCACTTATTTTAATTATTATTGCTATACCTTCTTTTTCATTATTATATGCAATGGATGAAGTAATTGATCCTATTTTAACTTTAAAAGTTATAGGTAGTCAATGGTATTGGAGTTATGAGTATTCTGATGC---------AATGGAT------------------GATTCTATTTTTTTTGATAGTTATATGGTATTAGAAGAGGATTTAGACAAAGGTCAGTTTCGTTTATTAGAAGTAGACAACCGTATAGTAGTGCCAACTAATACTCATATACGTGTTATTATTACAGCTACAGATGTATTACATTCATGGGCAGTACCTTCATTAGGTGTTAAATTAGATGCTTGTCCAGGTAGATTAAATCAAACTTCAATTTTTATTAAAAGAGAAGGTGTTTTTTATGG Pythium_acanthicum_UZ352 ATGGAAGGTATTATTAACTTTCATCATGATTTAGTATTTTTTTTAATTATTGTGACTGTTTTTGTTTGTTGGATGTTATTTAGAGTAATTGTTTTATTCGATGAAAAAAAAAATCCAATACCTGCTACATTTGTACATGGAGCAACTATTGAAATTATTTGGACAACAATTCCAGCATTAATTTTATTAACAGTAGCAGTTCCATCTTTTGCTTTATTATATTCAATGGATGAAATTATTGATCCAATTATAACTTTAAAAGTAATCGGAAGTCAATGGTACTGGAGCTATGAATATTCTGATAATTTAGAATTTGCGGAT------------------GAACCTTTAATTTTTGATAGTTACATGGTTCAAGATAATGACTTAGAAATAGGACAATTTAGATTATTAGAAGTAGATAACCGTGTTGTTGTACCTACTAATAGTCATATTAGAGTTTTAATAACAGCTTCTGACGTTTTACACTCATGGGCTATACCTTCTTTAGGTTTAAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTTTATTAAAAGAGAAGGAGTATTTTACGG Pythium_aphanidermatum_UZ051 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTCTTAATTATTGTAACAGTTTTTGTTTGTTGGATGTTATTTAGAGTAATTACTTTATTTGATGAAAAAAAAAATCCAATACCTGCTACATTTGTACATGGTGCTACTATTGAAATTATTTGGACAACAATTCCAGCATTAATTTTATTAACAGTAGCTGTTCCTTCTTTTGCATTATTATATTCTATGGATGAAATTATTGATCCTATAATTACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGCTATGAATATTCTGATAATTTAGAATTTGCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTAGATTATTAGAAGTAGATAACCGTGTTGTGGTGCCAACAAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTATTACACTCTTGGGCTATTCCTTCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTATTTTATGG Pythium_aquatile_UZ216 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTTTTAATTATTGTAACAGTTTTTGTATGTTGGTTGTTATTTAGAGTAATCACATTATTTGATGAAAAAAAAAACCCAATACCTGCTACTTTTGTACATGGATCTACTATTGAAATTATTTGGACAACTATTCCAGCATTAATTTTATTAACAGTAGCCGTTCCATCATTTGCTTTATTATATTCTATGGATGAAATTATTGACCCAATTATTACTTTAAAAGTAATAGGTAGTCAATGGTACTGGAGCTATGAATATTCTGATAATTTAGAATTTGCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATCTAGAAATAGGACAATTTAGACTTTTAGAAGTAGATAATCGTATTGTTGTACCAACAAATAGTCATATTAGAGTATTAATTACAGCTTCAGATGTTTTACACTCATGGGCTGTTCCTTCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCAATGTATATTAAAAGAGAAGGTGTATTCTATGG Pythium_arrhenomanes ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTCCTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAATAAAAAATCCTATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATTCCTGCTTTAATTTTATTAACTGTAGCAGTACCATCATTCGCTTTATTATATTCTATGGATGAAATCATAGATCCTATTATTACATTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCCGATAATTTAGAATTTGCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGACAATTTAGACTTTTAGAAGTAGATAATCGTGTTGTTGTACCTACAAATAGTCATATAAGAGTATTAATAACAGCTTCAGATGTATTGCATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_catenulatum_UZ264 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTCTTAATTATTGTAACAGTTTTTGTTTGTTGGATGTTATTTAGAGTAATTACTTTATTCGATGAAAAAAAAAATCCTATTCCTGCTACATTTGTACACGGTGCTACTATTGAAATTATTTGGACAACTGTTCCAGCATTAATTTTATTAACTGTAGCTGTTCCATCATTTGCATTATTATATTCTATGGATGAAATTATTGATCCTATTATTACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAACTTAGAATTTGCAGAT------------------GAACCTTTAATCTTTGATAGTTATATGGTACAAGAAAATGACTTAGAAATAGGACAATTTAGACTTTTAGAAGTTGATAATCGTGTTGTTGTACCTACAAACAGTCATATTAGAGTATTAATAACAGCTTCTGATGTTTTACACTCTTGGGCTATCCCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTACATTAAAAGAGAAGGTGTATTTTATGG Pythium_caudatum ATGGAAGGTATAATAAACTTTCATCATGATTTAATGTTTTTTTTAATTATTGTAACAGTATTTGTTTGTTGGTTATTATTTAGAGTAATCACTTTGTTTGATGAAAAAAAAAACCCAATACCTGCTACTTTTGTGCATGGAGCTACTATCGAAATTATTTGGACAACTATTCCAGCATTAATTCTATTAACAGTAGCCGTTCCATCATTTGCTCTATTATATTCTATGGATGAAAT-ATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTACTGGAGTTATGAATATTCTGATAATTTAGAATTTGCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGACAATTTAGACTTTTAGAAGTAGATAATCGTATAGTTGTACCTACAAATAGCCATATTAGAGTATTAATTACTGCTTCTGATGTTTTACACTCATGGGCTGTTCCTTCTTTAGGTGTAAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATCAAAAGAGAAGGTGTATTTTATGG Pythium_deliense ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTATTGTAACAGTTTTTGTTTGTTGGATGTTATTTAGAGTAATTACTTTATTTGATGAAAAAAAAAATCCAATACCTGCTACATTTGTTCATGGTGCTACTATTGAAATTATTTGGACAACAATTCCAGCATTAATATTATTAACGGTAGCTGTTCCTTCTTTTGCATTATTATATTCTATGGACGAAATTATTGATCCTATAATTACTTTAAAAGTAATAGGTAGTCAATGGTACTGGAGTTATGAATACTCTGATAATTTGGAATTTGCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTTCGTTTATTAGAAGTAGATAATCGTGTTGTAGTACCAACAAATAGTCATATTAGAGTATTAATTACAGCATCTGATGTATTACATTCTTGGGCTATTCCTTCTTTAGGTGTTAAATTAGATGCTTGTCCTGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTATTTTATGG Pythium_dissotocum_UZ159 ATGGAAGGTATTATAAACTTCCATCATGATTTAATGTTTTTTTTAATTATTGTAACAGTTTTTGTATGTTGGTTGTTATTTAGAGTAATCACTTTATTTGATGAAAAAAAAAACCCAATACCTGCTACTTTTGTACATGGAGCTACTATTGAAATTATTTGGACAACTATTCCAGCATTAATTTTATTAACAGTAGCCGTTCCATCATTTGCTTTATTATATTCTATGGATGAAATTATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTACTGGAGCTATGAGTATTCTGATAATTTAGAATTTGCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATCGGACAATTTAGACTTTTAGAAGTAGATAACCGTATTGTAGTACCAACAAATAGTCATATTAGAGTATTAATAACCGCTTCTGATGTTTTACACTCTTGGGCTGTTCCATCATTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCAATGTATATTAAAAGAGAAGGTGTATTTTATGG Pythium_graminicola ATGGAAGGTATTATTAACTTTCACCATGATTTAGTGTTTTTCTTAATTATTGTAACAGTTTTTGTTTGTTGGATGTTATTTAGAGTAATAACATTATTTGATGAAAAAAAAAACCCTATTCCTGCTACATTTGTACATGGTGCTACTATAGAAATTATTTGGACAACTATTCCTGCTTTAATTTTATTAACAGTAGCTGTACCTTCTTTTGCTTTATTATATTCTATGGATGAAATTATTGATCCTATTATTACTGTTAAAGTAATTGGTAGTCAATGGTATTGGAGCTATGAATATTCTGATAATTTAGAATTTGCAGAT------------------GAACCTTTAATCTTTGATAGTTATATGGTACAAGAAAATGACTTAGAAATCGGACAATTTAGACTTTTAGAAGTTGACAACCGCGTTGTTGTGCCTACAAACAGTCATATTAGAGTATTAATAACAGCTTCTGATGTTTTACACTCTTGGGCTATTCCTTCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTATTCTATGG Pythium_inflatum ATGGAAGGTATTATTAACTTTCACCATGATTTAGTGTTTTTCTTAATTATTGTAACAGTTTTTGTTTGTTGGATGTTATTTAGAGTAATAACATTATTTGATGAAAAAAAAAATCCTATTCCTGCTACATTTGTGCATGGTGCTACTATAGAAATTATTTGGACAACTATTCCTGCTTTAATCTTATTATCAGTAGCTGTACCTTCTTTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTGTAAAAGTAATTGGTAGTCAATGGTACTGGAGTTATGAATATTCAGATAACTTAGAATTTGCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGTCAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGGGTATTAATAACAGCTTCTGATGTTTTACACTCTTGGGCTATTCCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_insidiosum ATGGAAGGTATTATTAACTTTCACCATGATCTAATGTTTTTTTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTAGTAACATTATTTGATGAAAAAAAAAATCCAATTCCAGCAACATTTGTTCATGGTGCTACTATAGAAATAATTTGGACTACTATTCCAGCATTAATTTTATTAACAGTAGCTGTTCCATCTTTTGCTTTATTATATTCTATGGATGAAATCATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGAC------------------GAACCTTTAATTTTTGATAGTTATATGGTTCAAGAAAATGATTTAGAAATAGGTCAATTTAGATTATTAGAAGTAGATAATAGAGTAGTTGTACCAACAAATAGTCATATTAGAGTTTTAATTACAGCATCAGATGTTTTACATTCATGGGCTATTCCTTCTTTAGGTATTAAATTAGACGCTTGTCCTGGCCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTCTATGG Pythium_monospermum ATGGAAGGTATTATAAACTTCCATCATGATTTAATGTTTTTTTTAATTATTGTAACAGTTTTTGTATGTTGGTTGTTATTTAGAGTAATCACTTTATTTGATGAAAAAAAAAACCCAATACCTGCTACTTTTGTACATGGAGCTACTATTGAAATTATTTGGACAACTATTCCAGCATTAATTTTATTAACAGTAGCCGTTCCATCATTTGCTTTATTATATTCTATGGATGAAATTATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTACTGGAGCTATGAGTATTCTGATAATTTAGAATTTGCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATCGGACAATTTAGACTTTTAGAAGTAGATAACCGTATTGTAGTACCAACAAATAGTCATATTAGAGTATTAATAACCGCTTCTGATGTTTTACACTCTTGGGCTGTTCCATCATTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCAATGTATATTAAAAGAGAAGGTGTATTTTATGG Pythium_myriotylum ATGGAAGGTATTATAAACTTTCATCATGATTTAATGTTTTTCTTAATTATCGTAACAGTTTTTGTTTGTTGGATGTTATTCAGAGTAATTACTTTATTTGATGAAAAAAAAAATCCTATTCCAGCTACTTTTGTACACGGTGCTACTATAGAAATTATTTGGACAACAATTCCAGCATTAATTTTATTAACAGTAGCTGTTCCTTCATTCGCTTTATTATATTCTATGGATGAAATTATAGACCCAATAATTACTTTAAAAGTTATTGGTAGTCAATGGTATTGGAGTTATGAGTATTCTGATAATTTAGAATTCGCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAACAATAGGAGAATTTAGACTTTTAGAAGTTGATAATCGTGTTGTTGTTCCTACAAACAGTCATATTAGAGTTTTAATAACAGCTTCTGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTGTAAAATTAGATGCATGTCCAGGTCGTTTAAATCAAACATCTATGTATATTAAAAGAGAAGGTGTTTTCTACGG Pythium_oligandrum ATGGAAGGTATTATTAACTTTCATCATGATTTAGTATTTTTTTTAATTATTGTGACTGTTTTTGTTTGTTGGTTATTATTTAGAGTAATCGTATTATTCGATGAAAAAAAAAACCCAATACCTGCTACATTTGTACATGGAGCAACTATTGAAATTATTTGGACAACAATTCCAGCATTAATTTTATTAACCGTAGCAGTTCCATCTTTTGCTTTATTATATTCAATGGATGAAATTATTGATCCAATTATAACTTTAAAAGTAATAGGTAGTCAATGGTACTGGAGTTATGAATATTCTGATAATTTAGAATTTGCAGAT------------------GAACCTTTAATTTTTGATAGTTACATGGTTCAAGATAATGACTTAGAAATAGGACAATTTAGATTATTAGAAGTAGACAACCGTGTTGTTGTACCAACTAATAGCCATATTAGAGTTTTAATAACAGCTTCTGACGTTTTACATTCATGGGCTATACCCTCTTTAGGTTTAAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAAGGTGTATTTTACGG Pythium_sp_OPU1448 ATGGAAGGTATTATTAATTTTCACCATGATTTAATGTTTTTTTTAATTATTGTAACCGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTTTATTTGATGAAAAAAAAAACCCTATTCCCGCTACATTTGTACATGGTGCTACTATAGAAATTATCTGGACAACTATTCCTGCTTTAATTTTATTAACAGTAGCTGTACCATCGTTTGCTTTATTGTATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGCCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAGGAAAATGATTTAGAAATAGGTCAATTTAGACTTTTAGAAGTTGATAATCGTGTTGTAGTGCCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGACGTATTACATTCTTGGGCAATACCTTCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACCTCAATGTATATTAAAAGAGAGGGTGTTTTTTATGG Pythium_sp_OPU1449 ATGGAAGGTATAATAAACTTTCATCATGATTTAATGTTTTTTTTAATTATTGTAACAGTTTTTGTTTGTTGGTTGTTATTTAGAGTAATCACTTTATTTGATGAAAAAAAAAACCCAATACCTGCTACTTTTGTACATGGAGCTACTATTGAAATTATCTGGACTACTATTCCAGCATTAATTTTATTAACTGTAGCTGTTCCATCATTTGCTTTATTATATTCTATGGATGAAATTATTGATCCTATTATTACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGCTATGAATATTCAGATAATCTAGAATTTGCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGAGATAGGTCAATTTAGATTATTAGAAGTAGATAATCGTATTGTTGTACCAACAAATAGTCATATTAGAGTATTAATTACAGCTTCAGACGTTTTACATTCTTGGGCTGTACCTTCTTTAGGTGTAAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTATTTTATGG Pythium_sp_UZ156 ATGGAAGGTATTATAAACTTCCATCATGATTTAATGTTTTTTTTAATTATTGTAACAGTTTTCGTATGTTGGTTGTTATTTAGAGTAATCACTTTATTTGATGAAAAAAAAAACCCAATACCTGCTACTTTCGTACATGGAGCTACTATTGAAATTATTTGGACAACTATTCCAGCATTAATTTTATTAACAGTAGCCGTTCCATCATTTGCTTTATTATATTCTATGGATGAAATTATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTACTGGAGCTATGAATATTCTGATAATTTAGAATTTGCTGAT------------------GAACCTTTAATTTTTGACAGTTATATGGTACAAGAAAATGATTTAGAAATCGGACAATTTAGACTTTTAGAGGTAGATAATCGTATTGTAGTACCAACAAATAGTCATATTAGAGTATTAATTACTGCTTCTGATGTTTTACACTCTTGGGCTGTTCCATCATTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCAATGTATATTAAAAGAGAAGGTGTATTTTATGG Pythium_sp_UZ190 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTCCTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCTATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATTCCTGCTTTAATTTTATTAACTGTAGCAGTACCATCATTTGCTTTATTATATTCTATGGATGAAATCATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCCGATAATTTGGAATTTGCTGAC------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGACAATTGAGACTTTTAGAAGTAGATAATCGTGTTGTTGTACCTACAAATAGTCATATAAGAGTGTTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_sp_UZ379 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTCTTAATCATTGTAACAGTTTTTGTTTGTTGGATGTTATTTAGAGTAATTACCTTATTCGATGAAAAGAAAAACCCTATTCCTGCTACATTTGTACACGGTGCTACAATTGAAATTATTTGGACAACTGTTCCAGCATTAATTTTATTAACAGTAGCTGTTCCTTCATTCGCTTTATTATATTCTATGGATGAAATTATAGACCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAGTATTCAGATAACTTAGAATTTGCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGACTTAGAAATAGGACAATTTAGACTTTTAGAAGTTGATAATCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCTGATGTTTTACACTCATGGGCTGTTCCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTATTTTATGG Pythium_sp_UZ419 ATGGAAGGTATTATAAACTTCCATCATGATTTAATGTTTTTTTTAATTATTGTAACAGTTTTTGTATGTTGGTTGTTATTTAGAGTAATCACTTTATTTGATGAAAAAAAAAACCCAATACCTGCTACTTTTGTACATGGAGCTACTATTGAAATTATTTGGACAACTATTCCAGCATTAATTTTATTAACAGTAGCCGTTCCATCATTTGCTTTATTATATTCTATGGATGAAATTATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTACTGGAGCTATGAGTATTCTGATAATTTAGAATTTGCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGACAATTTAGACTTTTAGAAGTAGATAACCGTATTGTAGTACCAACAAATAGTCATATTAGAGTATTAATAACCGCTTCTGATGTTTTACACTCTTGGGCTGTTCCATCATTAGGTGTTAAGTTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCAATGTATATTAAAAGAGAAGGTGTATTTTATGG Pythium_sp_UZ655 ATGGAAGGTATTATTAACTTTCATCATGATTTAGTGTTTTTTTTAATTATTGTGACTGTTTTTGTTTGTTGGTTATTATTTAGAGTAATAGTATTATTCGATGAAAAAAAAAACCCAATACCTGCTACATTTGTACATGGAGCAACTATTGAAATTATTTGGACAACAATTCCAGCATTAATTTTATTAACAGTAGCAGTTCCATCTTTTGCTTTATTATATTCAATGGATGAAATTATTGATCCTATTATAACTTTAAAAGTGATAGGTAGTCAATGGTACTGGAGCTATGAATATTCTGATAATTTAGAATTTGCAGAT------------------GAACCTTTAATTTTTGATAGTTACATGGTTCAAGATAATGACTTAGAAATAGGACAATTTAGATTATTAGAAGTAGATAATCGTGTTGTTGTACCAACTAATAGTCATATTAGAGTTTTAATAACAGCTTCTGATGTTTTACATTCATGGGCTATACCTTCTTTAGGTTTAAAATTAGATGCTTGTCCAGGCCGTTTAAATCAAACTTCAATGTTTATTAAAAGAGAGGGTGTTTTTTACGG Pythium_sp_ZSF0011 ATGGAAGGTATTATAAACTTTCATCATGATTTAGTGTTTTTTTTAATTATTGTAACAGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTGTTTTATTTGATGAAAAAAAAAATAAAAAACCTGCTACATTTGTACATGGAGCTACTATAGAGATTATTTGGACAACTGTTCCAGCATTAATTTTATTAACTGTAGCAGTTCCATCATTTGCTTTATTATACTCAATGGATGAAATTATTGATCCTATTATTACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCAGATAATTTAGAATTTGCTGAT------------------GAGCCTTTAATTTTTGATAGTTATATGGTTCAAGAAAATGATTTAGAAATAGGACAATTTAGATTACTAGAAGTAGATAACCGTATAGTAGTACCTACTAATAGTCATATAAGAGTATTAATTACAGCTTCTGATGTTTTACATTCTTGGGCTATCCCTTCTTTAGGTATTAAGTTAGATGCTTGTCCAGGTCGTTTAAATCAAACATCTATGTTTATTAAAAGAGAAGGTGTTTTCTATGG Pythium_sulcatum ATGGAAGGTATTATTAACTTCCATCATGATTTAATGTTTTTCTTAATTATTGTAACAGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACTTTATTTGATGAAAAAAAAAACTCTATTCCAGCTACTTTTGTACATGGTTCTACTATTGAAATTATTTGGACTACTATTCCAGCATTAATTCTATTAACAGTAGCTGTTCCTTCTTTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATAATAACTCTAAAAGTAATTGGTAGCCAATGGTATTGGAGCTATGAATATTCTGATAATTTAGAATTTGCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGACTTAGAAATAGGGCAATTTAGACTTTTAGAAGTTGATAATCGTATTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGATGTTTTACATTCTTGGGCTGTACCTTCTTTAGGTGTAAAATTAGATGCATGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTCTACGG Pythium_torulosum_UZ357 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTCTTAATTATTGTAACAGTTTTTGTTTGTTGGATGTTATTTAGAGTAATTACTTTATTCGATGAAAAAAAAAATCCTATTCCTGCTACATTTGTACATGGTGCTACTATTGAAATTATTTGGACAACAGTTCCAGCATTAATTTTATTAACTGTAGCTGTTCCATCATTTGCATTATTATATTCTATGGATGAAATTATTGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCAGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGACTTAGAAATAGGACAATTTAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAACAGTCATATTAGAGTATTAATAACAGCTTCTGATGTTTTACACTCTTGGGCTATTCCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTACATTAAAAGAGAAGGTGTATTTTATGG Pythium_vanterpoolii_OPU1445 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTTTTAATTATTGTAACAGTTTTTGTTTGTTGGATGTTATTTAGAGTAATTACTTTATTTGATGAGAAAAAAAATCCTATTCCTGCTACATTTGTACATGGTGCTACTATAGAAATTATTTGGACAACTATTCCTGCTTTAATTTTATTAACAGTAGCTGTACCTTCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAACTTAGAATTTGCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAGATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCTGATGTATTACATTCTTGGGCTGTTCCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCAATGTATATTAAAAGAGAAGGTGTATTTTATGG Pythium_volutum_OPU1446 ATGGAAGGTATAATAAACTTTCATCACGATTTAATGTTTTTTTTAATTATTGTAACAGTATTTGTTTGTTGGATGTTATTCAAAGTAATAATATTATTTGATGAAAAAAAAAATCCTACTCCAGCAACATTTGTACATGGTGCTACTATTGAAATTATTTGGACAACTATTCCTGCTTTAATTTTATTAACAGTGGCTGTACCTTCATTTGCTTTATTATACTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGCCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGACAATTTAGACTTTTAGAAGTTGATAATCGAGTTGTTGTACCTACAAATAGTCATATTCGAGTATTAATAACAGCTTCTGATGTATTACATTCGTGGGCTATACCATCATTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAGGGTGTATTTTATGG Saprolegnia_ferax ATGGAAGGTATCATTAACTTTCATCATGATTTAGTTTTTTTTTTAGTATTAATTGTAATATTTGTTAGTTGGATTTTAGCTAGATGTATTTTTTTTTTTAATGAAAATACTAATAAAAAAGCTGAAACTTTTGTACATGGTACTGTTTTAGAAATTGTATGGACCATTACTCCAGCTCTTATTTTAATTATTATAGCAATACCTTCATTTTCATTATTATATGCAATGGATGAAGTTATTGATCCTATTTTAACTTTAAAAGTTATAGGTAGCCAATGGTATTGGAGTTATGAATATTCTGATGC---------AATGGAT------------------GATTCTATTTTTTTTGATAGTTATATGGTATTAGAAGAAGATTTAGACAAAGGTCAATTCCGTCTTTTAGAAGTAGATAATCGTGTAGTAGTTCCTACTAATACACATATTCGTGTTATTATTACAGCTACTGATGTTTTACACTCATGGGCTGTACCTTCTTTAGGTGTAAAATTAGATGCATGTCCTGGTAGATTAAATCAAACTTCAATTTTTATTAAAAGAGAAGGTGTTTTTTATGG Saprolegnia_parasitica ATGGAAGGTATTATTAACTTTCATCATGATTTAGTTTTTTTTTTAGTATTAATTGTAATATTTGTTAGTTGGATTTTAGCTAGATGTATTTTTTTTTTTAATGAAAATACTAATAAAAAAGCTGAAACTTTTGTACATGGTACTGTTTTAGAAATTGTATGGACCATTACTCCAGCTCTTATTTTAATTATTATAGCAATACCTTCATTTTCATTATTATATGCTATGGATGAAGTTATTGATCCTATTTTAACTTTAAAAGTTATAGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATGC---------TATGGAT------------------GATTCTATTTTTTTTGATAGTTATATGGTATTAGAAGAAGATTTAGACAAAGGTCAATTCCGTCTTTTAGAAGTAGATAATCGTGTAGTAGTTCCTACTAATACACATATTCGTGTAATTATTACAGCTACTGATGTTTTACATTCATGGGCTGTACCTTCTTTAGGTGTAAAATTAGATGCTTGTCCAGGTAGATTAAATCAAACTTCAATTTTTATTAAAAGAGAAGGTGTTTTTTATGG Sapromyces_elongatus ATGGAAGGTATTATAAACTTTCATCATGATTTAATGTTTTTTTTAGTAATAACTGTTATTTTTGTATGTTGGATTTTAATTAGATGTATTTATTTTTTTGATGAAGAAAAAAATAAAATACCATCAACAACTGTACATGGTTCTACTATAGAAATAATTTGGACAACTATTCCAGCTTTAATTTTATTAAGTGTAGCAGTTCCTTCTTTCGCTTTATTATACTCAATGGATGAAGTTATTGATCCTATAATTACTTTAAAAGTTATAGGAAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTTCTGAT------------------GAACCTTTAATTTTTGATAGTTATATGGTTCAAGAAGATGATTTAGATATTGGTAAATTTAGATTATTAGAAGTAGATAATCGTGTTGTTGTACCTACTAATAGTCATATTAGAGTAGTTATAACTGCATCAGATGTTTTACATTCATGGGCAATTCCTTCATTAGGTATTAAATTAGATGCTTGTCCAGGTAGATTAAATCAAACTTCTATGTATATAAAAAGAGAAGGTGTTTTTTATGG ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = COX_II) = N: 1-581; CODONPOSSET * CodonPositions (CHARACTERS = COX_II) = N: 1-581; END; BEGIN TREES; TITLE Tb10760; LINK TAXA = Taxa2; TRANSLATE 1 Achlya_racemosa, 2 Achlya_radiosa, 3 Achlya_colorata, 4 Achlya_treleaseana, 5 Aplanes_androgynus, 6 Achlya_papillosa, 7 Achlya_spinosa, 8 Aplanopsis_spinosa, 9 Calyptralegnia_achlyoides, 10 Saprolegnia_anisospora, 11 Hyaloperonospora_dentariae, 12 Hyaloperonospora_parasitica, 13 Hyaloperonospora_niessliana, 14 Hyaloperonospora_thlaspeos_arvensis, 15 Hyaloperonospora_barbareae, 16 Viennotia_oplismeni, 17 Phytophthora_insolita, 18 Phytophthora_boehmeriae, 19 Halophytophthora_avicenniae, 20 Halophytophthora_polymorphica, 21 Phytophthora_syringae, 22 Phytophthora_ramorum, 23 Phytophthora_europaea, 24 Phytophthora_gonapodyides, 25 Phytophthora_ilicis, 26 Ovatisporangium_boreale, 27 Ovatisporangium_ostracodes, 28 Ovatisporangium_sp_UZ230, 29 Ovatisporangium_oedichilum, 30 Ovatisporangium_sp_UZ612, 31 Ovatisporangium_helicoides, 32 Ovatisporangium_sp_UZ248, 33 Globisporangium_rostratifingens_UZ354, 34 Globisporangium_rostratifingens_OPU1440, 35 Globisporangium_sp_UZ416, 36 Globisporangium_rostratum_OPU1441, 37 Globisporangium_sp_UZ290, 38 Globisporangium_pleroticum, 39 Globisporangium_sp_UZ636, 40 Globisporangium_sp_UZ594, 41 Globisporangium_sp_UZ260, 42 Globisporangium_sp_UZ304, 43 Globisporangium_sp_UZ275, 44 Globisporangium_multisporum, 45 Globisporangium_spinosum_UZ405, 46 Globisporangium_spinosum_UZ150, 47 Globisporangium_paroecandrum_OPU466, 48 Globisporangium_cylindrosporum, 49 Globisporangium_sp_UZ382, 50 Globisporangium_sylvaticum_UZ307, 51 Globisporangium_acrogynum, 52 Globisporangium_echinulatum, 53 Globisporangium_sp_UZ182, 54 Globisporangium_nunn_UZ041, 55 Globisporangium_sp_UZ277, 56 Globisporangium_perplexum, 57 Globisporangium_sp_UZ253, 58 Globisporangium_sp_UZ285, 59 Globisporangium_sp_UZ252, 60 Globisporangium_uncinulatum_Py2, 61 Globisporangium_polymastum, 62 Globisporangium_mastophorum, 63 Globisporangium_sp_UZ213, 64 Globisporangium_intermedium, 65 Globisporangium_sp_UZ400, 66 Globisporangium_sp_UZ318, 67 Globisporangium_macrosporum_UZ233, 68 Globisporangium_irregulare_UZ370, 69 Globisporangium_irregulare_UZ067, 70 Globisporangium_sp_ZSF0030, 71 Globisporangium_sp_ZSF0069, 72 Globisporangium_sp_UZ164, 73 Globisporangium_paddicum_OPU1438, 74 Globisporangium_iwayamae_OPU1450, 75 Globisporangium_okanoganense_OPU1443, 76 Elongisporangium_dimorphum, 77 Elongisporangium_undulatum, 78 Elongisporangium_sp_ZSF0056, 79 Elongisporangium_helicandrum, 80 Elongisporangium_prolatum, 81 Elongisporangium_anandrum, 82 Globisporangium_ultimum_ult_UZ056, 83 Globisporangium_ultimum_spo_OPU465, 84 Globisporangium_splendens_UZ174, 85 Globisporangium_sp_UZ284, 86 Globisporangium_heterothallicum, 87 Globisporangium_sp_UZ263, 88 Globisporangium_sp_UZ249, 89 Pilasporangium_apinafurcum_UZ300, 90 Albugo_candida, 91 Albugo_evolvuli, 92 Saprolegnia_eccentrica, 93 Leptolegnia_caudata, 94 Saprolegnia_diclina, 95 Protoachlya_polyspora, 96 Saprolegnia_ferax, 97 Saprolegnia_hypogyna, 98 Saprolegnia_litoralis, 99 Saprolegnia_monilifera, 100 Scoliolegnia_asterophora, 101 Pythiopsis_cymosa, 102 Protoachlya_paradoxa, 103 Aphanomyces_stellatus, 104 Pachymetra_chaunorhiza, 105 Plectospira_myriandra, 106 Aphanomyces_laevis, 107 Achlya_americana, 108 Achlya_klebsiana, 109 Achlya_caroliniana, 110 Thraustotheca_clavata, 111 Achlya_dubia, 112 Isoachlya_toruloides, 113 Brevilegnia_bispora, 114 Dictyuchus_monosporus, 115 Brevilegnia_megasperma, 116 Leptomitus_lacteus, 117 Apodachlya_brachynema, 118 Sapromyces_elongatus, 119 Lagenidium_callinectes, 120 Lagenidium_chthamalophilum, 121 Lagenidium_thermophilum, 122 Pythium_adhaerens, 123 Pythium_monospermum, 124 Pythium_aphanidermatum_UZ051, 125 Pythium_aquatile_UZ216, 126 Pythium_dissotocum_UZ159, 127 Pythium_sp_UZ419, 128 Pythium_apleroticum, 129 Pythium_sp_UZ156, 130 Pythium_capillosum, 131 Pythium_angustatum, 132 Pythium_sp_OPU1449, 133 Pythium_sp_ZSF0011, 134 Pythium_torulosum_UZ006, 135 Pythium_catenulatum_UZ264, 136 Pythium_sp_UZ379, 137 Lagenidium_myophilum, 138 Pythium_sp_UZ190, 139 Pythium_arrhenomanes, 140 Pythium_volutum_OPU1446, 141 Pythium_inflatum, 142 Pythium_graminicola, 143 Pythium_vanterpoolii_OPU1445, 144 Pythium_sp_OPU1448, 145 Pythium_sp_ZSF0093, 146 Pythium_conidiophorum, 147 Pythium_acanthicum_UZ352, 148 Pythium_acanthicum_UZ364, 149 Pythium_sp_UZ655, 150 Pythium_oligandrum, 151 Pythium_insidiosum, 152 Pythium_sp_OPU797, 153 Ovatisporangium_sp_UZ392, 154 Ovatisporangium_vexans_UZ215, 155 Ovatisporangium_vexans_UZ309, 156 Ovatisporangium_sp_UZ287, 157 Ovatisporangium_cucurbitacearum, 158 Phytophthora_heveae, 159 Phytophthora_nicotianae, 160 Phytophthora_clandestina, 161 Phytophthora_erythroseptica, 162 Phytophthora_citrophthora, 163 Phytophthora_capsici, 164 Phytophthora_multivesiculata, 165 Peronospora_potentillae_sterilis, 166 Phytophthora_cinnamomi, 167 Phytophthora_cactorum, 168 Phytophthora_quercina, 169 Pseudoperonospora_cubensis, 170 Pseudoperonospora_humuli, 171 Peronospora_trifolii_alpestris, 172 Peronospora_trifolii_hybridi, 173 Peronospora_trifolii_minoris, 174 Peronospora_aestivalis, 175 Peronospora_myosotidis, 176 Peronospora_rumicis, 177 Peronospora_variabilis, 178 Peronospora_aparines, 179 Peronospora_calotheca, 180 Peronospora_sanguisobae, 181 Peronospora_alsinearum, 182 Peronospora_bulbocapni, 183 Peronospora_ficariae, 184 Peronospora_hiemalis, 185 Peronospora_pulveracea, 186 Peronospora_boni_henrici, 187 Peronospora_sparsa, 188 Basidiophora_entospora, 189 Bremia_lactucae, 190 Paraperonospora_leptosperma, 191 Plasmoverna_isopyri_thalictroidis, 192 Plasmoverna_pygmaea, 193 Plasmopara_baudysii, 194 Plasmopara_sii, 195 Plasmopara_pimpinellae, 196 Plasmopara_geranii, 197 Plasmopara_pusilla, 198 Plasmopara_halstedii, 199 Plasmopara_densa, 200 Plasmopara_viticola, 201 Plasmopara_obducens, 202 Plasmopara_megasperma, 203 Peronospora_arvensis, 204 Peronospora_conglomerata, 205 Peronospora_silvestris, 206 Peronospora_trivialis, 207 Peronospora_lamii, 208 Hyaloperonospora_brassicae; TREE Fig._1 = [&R] ((2,1),(((((106,(103,(105,104))),(92,(10,(99,(98,((97,94),(95,96))))))),(100,((102,101),(117,(116,(118,((121,(120,119)),(((81,(79,(80,(78,(77,76))))),((84,(82,83)),((((75,(74,73)),(72,(((66,(65,(63,64))),((50,(49,(47,48))),(46,45))),(67,((68,69),(71,70)))))),((53,((42,((43,44),(41,((40,39),(38,37))))),((51,52),(36,(35,(33,34)))))),(((56,(58,57)),(54,55)),(59,(60,(62,61)))))),(87,((88,(91,90)),(85,86)))))),(((152,151),((149,(150,(148,147))),(((142,((141,(131,(136,(135,134)))),(((140,(144,143)),(139,138)),(145,146)))),(133,((132,((126,125),(127,(129,128)))),(137,130)))),(124,(122,123))))),(89,(((155,((157,156),(154,153))),((32,(31,30)),(28,(27,(29,26))))),((19,20),(18,(17,((161,(22,21)),(((168,((((165,((179,178),((((177,(175,186)),((176,(180,187)),(185,(183,184)))),((207,206),(182,181))),(174,(171,(172,173)))))),(205,((((201,(197,196)),((200,(195,(194,193))),(202,(199,198)))),(190,((191,192),(189,188)))),((16,(15,((208,11),(12,(13,14))))),(203,204))))),(170,169)),(167,(160,159)))),((158,25),(166,(24,23)))),(164,(162,163)))))))))))))))))),(93,(9,(7,(8,(6,(4,5))))))),(3,((112,(111,(110,(107,(109,108))))),(115,(113,114)))))); END; BEGIN TREES; TITLE Tb10761; LINK TAXA = Taxa1; TRANSLATE 1 Plasmopara_viticola, 2 Plasmopara_densa, 3 Peronospora_aestivalis, 4 Peronospora_lamii, 5 Phytophthora_cinnamomi, 6 Peronospora_sanguisobae, 7 Phytophthora_ilicis, 8 Phytophthora_ramorum, 9 Phytophthora_cactorum, 10 Phytophthora_nicotianae, 11 Phytophthora_heveae, 12 Phytophthora_quercina, 13 Phytophthora_multivesiculata, 14 Phytophthora_palmivora, 15 Phytophthora_capsici, 16 Phytophthora_citricola, 17 Phytophthora_erythroseptica, 18 Phytophthora_syringae, 19 Phytophthora_boehmeriae, 20 Phytophthora_insolita, 21 Phytophthora_gonapodyides, 22 Elongisporangium_sp_ZSF0056, 23 Elongisporangium_undulatum, 24 Globisporangium_sp_UZ304, 25 Globisporangium_sp_UZ275, 26 Globisporangium_sp_UZ636, 27 Albugo_occidentalis, 28 Albugo_tragopogonis, 29 Pythium_aphanidermatum_UZ051, 30 Pythium_deliense, 31 Pythium_monospermum, 32 Pythium_dissotocum_UZ159, 33 Pythium_sp_UZ419, 34 Pythium_sp_UZ156, 35 Pythium_aquatile_UZ216, 36 Pythium_caudatum, 37 Pythium_sp_OPU1449, 38 Pythium_oligandrum, 39 Pythium_sp_UZ655, 40 Pythium_acanthicum_UZ352, 41 Pythium_sp_ZSF0011, 42 Pythium_graminicola, 43 Pythium_inflatum, 44 Pythium_vanterpoolii_OPU1445, 45 Pythium_catenulatum_UZ264, 46 Pythium_torulosum_UZ357, 47 Pythium_sp_UZ379, 48 Pythium_volutum_OPU1446, 49 Pythium_sp_UZ190, 50 Pythium_arrhenomanes, 51 Pythium_sp_OPU1448, 52 Pythium_myriotylum, 53 Pythium_sulcatum, 54 Pythium_insidiosum, 55 Peronospora_aparines, 56 Peronospora_calotheca, 57 Hyaloperonospora_erophilae, 58 Peronospora_arvensis, 59 Peronospora_conglomerata, 60 Peronospora_boni_henrici, 61 Peronospora_trivialis, 62 Peronospora_hiemalis, 63 Peronospora_variabilis, 64 Pseudoperonospora_humuli, 65 Pseudoperonospora_urticae, 66 Hyaloperonospora_parasitica, 67 Bremia_lactucae, 68 Paraperonospora_leptosperma, 69 Basidiophora_entospora, 70 Plasmopara_megasperma, 71 Plasmopara_pusilla, 72 Plasmopara_obducens, 73 Globisporangium_sp_UZ260, 74 Globisporangium_sp_UZ290, 75 Globisporangium_paddicum_OPU1438, 76 Globisporangium_iwayamae_OPU1450, 77 Globisporangium_okanoganense_OPU1443, 78 Globisporangium_sp_UZ213, 79 Globisporangium_sp_UZ400, 80 Globisporangium_macrosporum_UZ233, 81 Globisporangium_irregulare_UZ370, 82 Globisporangium_sylvaticum_UZ307, 83 Globisporangium_sp_UZ164, 84 Globisporangium_intermedium, 85 Globisporangium_sp_ZSF0030, 86 Globisporangium_sp_UZ318, 87 Globisporangium_spinosum_UZ150, 88 Globisporangium_sp_UZ382, 89 Globisporangium_paroecandrum, 90 Globisporangium_sp_ZSF0069, 91 Globisporangium_sp_UZ182, 92 Globisporangium_rostratifingens_UZ354, 93 Globisporangium_rostratifingens_OPU1440, 94 Globisporangium_sp_UZ416, 95 Globisporangium_rostratum_OPU1441, 96 Globisporangium_nunn_UZ041, 97 Globisporangium_sp_UZ277, 98 Globisporangium_sp_UZ253, 99 Globisporangium_nodosum, 100 Globisporangium_uncinulatum_Py2, 101 Globisporangium_sp_UZ284, 102 Globisporangium_sp_UZ249, 103 Globisporangium_heterothallicum, 104 Globisporangium_splendens_UZ174, 105 Globisporangium_ultimum_UZ056, 106 Ovatisporangium_boreale, 107 Ovatisporangium_ostracodes, 108 Ovatisporangium_sp_UZ230, 109 Ovatisporangium_oedichilum, 110 Ovatisporangium_helicoides, 111 Ovatisporangium_sp_UZ248, 112 Ovatisporangium_vexans_UZ215, 113 Ovatisporangium_sp_UZ287, 114 Ovatisporangium_vexans_UZ309, 115 Pilasporangium_apinafurcum_UZ300, 116 Pilasporangium_apinafurcum_UZ301, 117 Lagenidium_giganteum, 118 Lagenidium_humanum, 119 Sapromyces_elongatus, 120 Lagenidium_callinectes, 121 Lagenidium_thermophilum, 122 Apodachlya_pyrifera, 123 Leptomitus_lacteus, 124 Saprolegnia_ferax, 125 Saprolegnia_parasitica, 126 Pythiopsis_cymosa, 127 Dictyuchus_sterilis; TREE Fig._2 = [&R] ((28,27),(((((41,(40,(38,39))),((37,(36,(35,(34,(33,(31,32)))))),(((53,52),((((44,(51,48)),(49,50)),(43,42)),(47,(45,46)))),(54,(30,29))))),((((104,(105,(101,(102,103)))),(((91,(94,(95,(92,93)))),(100,((97,96),(99,98)))),((74,(26,(73,(25,24)))),((86,((82,(90,(85,84))),(83,81))),((79,(78,(80,(77,(75,76))))),(89,(87,88))))))),(((10,9),(((5,(15,16)),(17,18)),(((13,(14,12)),(57,((19,11),(20,21)))),((((((55,56),(59,(6,((60,61),(62,63))))),(58,(4,3))),(65,64)),(66,((69,(68,67)),((1,(70,71)),(72,2))))),(8,7))))),((((110,111),((109,(106,(107,108))),(113,(114,112)))),(119,((122,123),(127,(125,(124,126)))))),(116,115)))),(23,22))),(118,117)),(120,121))); END;