#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 12:09 GMT TreeBASE (cc) 1994-2008 Study reference: Tanaka K., Hirayama K., Yonezawa H., Hatakeyama S., Harada Y., Sano T., Shirouzu T., & Hosoya T. 2009. Molecular taxonomy of bambusicolous fungi: Tetraplosphaeriaceae, a new pleosporalean family with Tetraploa-like anamorphs. Studies in Mycology, 64: 175-209. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10161] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=31; TAXLABELS Massarina_arundinariae_KT2200 Massarina_arundinariae_KT856 Polyplosphaeria_fusca_KT1043 Polyplosphaeria_fusca_KT1616 Polyplosphaeria_fusca_KT1640 Polyplosphaeria_fusca_KT2124 Pseudotetraploa_curvi_HC4930 Pseudotetraploa_curvi_HC4932 Pseudotetraploa_curvi_KT2558 Pseudotetraploa_javanica_HC4934 Pseudotetraploa_longi_HC4933 Quadricrura_bicornis_yone153 Quadricrura_meridionalis_KT2607 Quadricrura_septentrio_HC4983 Quadricrura_septentrio_HC4984 Quadricrura_septentrio_KT920 Quadricrura_septentrio_yone176 Quadricrura_septentrio_yone179 Quadricrura_septentrio_yone44 Tetraploa_aristata_CBS996_70 Tetraplosphaeria_nagasaki_KT1682 Tetraplosphaeria_sasicola_KT563 Tetraplosphaeria_yakushi_KT1906 Triplosphaeria_acuta_KT1170 Triplosphaeria_cylindrica_KT1800 Triplosphaeria_cylindrica_KT2550 Triplosphaeria_maxima_KT870 Triplosphaeria_sp_HC4665 Triplosphaeria_sp_KT2546 Triplosphaeria_yezoensis_KT1715 Triplosphaeria_yezoensis_KT1732 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=92; TAXLABELS Arthopyrenia_salicis Astrosphaeriella_aggregata_KT767 Astrosphaeriella_aggregata_KT984 Astrosphaeriella_stellata_KT998 Bimuria_novae_zelandiae Botryosphaeria_dothidea Byssothecium_circinans Cochliobolus_heterostrophus Cucurbitaria_elongata Curreya_pityophila Delitschia_didyma Delitschia_winteri Didymella_cucurbitacearum Didymella_exigua Dothidea_insculpta Herpotrichia_juniperi Kalmusia_scabrispora_KT1023 Kalmusia_scabrispora_KT2202 Katumotoa_bambisicola_KT1517 Lepidosphaeria_nicotiae Leptosphaeria_maculans Letendraea_helminthicola Lophiostoma_macrostomum_KT635 Lophiostoma_macrostomum_KT709 Lophostoma_heterosporum Massaria_platani Massarina_arundinariae_KT1034 Massarina_arundinariae_KT2200 Massarina_arundinariae_KT856 Massarina_eburnea_HC3953 Montagnula_opulenta Neotestudina_rosatii Neottiosporina_paspali Ophiosphaerella_herpotricha Ophiosphaerella_sasicola_KT1706 Phaeodothis_winteri Phaeosphaeria_avenaria Phaeosphaeria_brevispora_KT1466 Phaeosphaeria_brevispora_KT2313 Phaeosphaeria_sp_KT2564 Phoma_herbarum Pleomassaria_siparia Pleospora_herbarum Polyplosphaeria_fusca_KT1043 Polyplosphaeria_fusca_KT1616 Polyplosphaeria_fusca_KT1640 Polyplosphaeria_fusca_KT1686 Polyplosphaeria_fusca_KT2124 Preussia_terricola Pseudotetraploa_curvi_HC4930 Pseudotetraploa_curvi_HC4932 Pseudotetraploa_curvi_KT2558 Pseudotetraploa_javanica_HC4934 Pseudotetraploa_longi_HC4933 Quadricrura_bicornis_yone153 Quadricrura_meridionalis_KT2607 Quadricrura_septentrio_HC4983 Quadricrura_septentrio_HC4984 Quadricrura_septentrio_KT920 Quadricrura_septentrio_yone176 Quadricrura_septentrio_yone179 Quadricrura_septentrio_yone44 Roussoella_hysterioides_HH26988 Roussoella_hysterioides_KT1651 Roussoella_pustulans_KT1709 Roussoella_sp_KT2303 Roussoellopsis_sp_KT1710 Roussoellopsis_tosaensis_KT1659 Setomelanomma_holmii Setosphaeria_monoceras Spencermartinsia_viticola Sporornia_lignicola Tetraploa_aristata_CBS996_70 Tetraploa_sp_KT1684 Tetraploa_sp_KT2578 Tetraplosphaeria_nagasaki_KT1682 Tetraplosphaeria_sasicola_KT563 Tetraplosphaeria_yakushi_KT1906 Trematosphaeria_pertusa Triplosphaeria_acuta_KT1170 Triplosphaeria_cylindrica_KT1256 Triplosphaeria_cylindrica_KT1800 Triplosphaeria_cylindrica_KT2550 Triplosphaeria_maxima_KT870 Triplosphaeria_sp_HC4665 Triplosphaeria_sp_KT2546 Triplosphaeria_yezoensis_KT1715 Triplosphaeria_yezoensis_KT1732 Ulospora_bilgramii Verruculina_enalia Versicolorisporium_trisept_SH130 Zopfia_rhizophila ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4269] TITLE Order; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1878; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arthopyrenia_salicis GATAGTACCTTACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCCTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGTGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGGCTCTCGCCCGGGGCATTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGGATAAAGGCCTCCATCACGTATCTTCCTTCGGGTGACTTATAGGGGAGGCCAACACGACCAGCCTGAACTGAGGACCGCGCATAGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Astrosphaeriella_aggregata_KT767 GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTCCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGGATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACTGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGCACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCCCATGCCCTTCACTGGGCGTGTGGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCAGAGCTTAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGGAGAGGGTGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTACGTGGCTGCAGGCCCTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGCAGCCAGACGTGCCTGCAGTTGCTCACCCGGGCCAACGCCCGGGGCACTCTTCTGCAGGCAGGCCAGCATCGGTCCGGGCGGCCGGATAAAGGTCCTGGGAACGTGGCTCCCCCCGGGAGTGTATAGCCCAGGGCCAATGCGGCCAGCCGGGACCGAGGTCCGCGCGTTGCTAGGATGCTGGCGTAAAGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCGTTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Astrosphaeriella_aggregata_KT984 GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTCCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGAGATCAGGGTTTGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGCACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCCCATGCCCTTCACTGGGTGTGCGGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGGAGAGGGTGCTTTGGCGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTACGTGGCCGCAGGCCCCCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGGCCAACGCCCGGGGCACTCTTCTGCAGGCAGGCCAGCATCGGTCCGGGCGGTCGGATAAAGGCCCTGGGAACGTGGCTCCCCCCGGGAGTGTATAGCCCAGGGCCAATGCGGCCAGCCGGGACCGAGGTCCGCGCGCTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Astrosphaeriella_stellata_KT998 GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTCCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGAGATTAGGGTTTGACTCCGGAGAGGGGGCCTGAGAAATGGCCACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTCGGGTCTGTAATTGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGCACTGGTTCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGCCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGTGCCCGAGTTGTAATTTGTAGAGGGTGCTTCGGCGTCGGCCCGGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCCCCGGCCTTCACCAAGTGAGGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCAGGCTTACGCCTGGTGCACTCTTCTGCGGGCAGGCCAGCATCGGTTCGGGCGGTCGGATAAAGGCCCCGGGAATGTGGCCCCTCTCGGGGGTGTATAGCCCGGGGTCAATGCGGCCAGCCCGGACCGAGGACCGCGCTCGGCTAGGATGCTGGCGTAATGGCCGCAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGAATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAGTTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Bimuria_novae_zelandiae GATAATACCTTACTACATGGATACCTGTGGAAAATCTAGAGCTAATACATGCTAAAAGCCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGCTCCTTGGTGATTCATGATAACTTCTCGGATCGCATGGCCCTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTAGTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATTCGACTGGAGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTTGGCCTGGTGCGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTTCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGCTCAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCGTTGGCGGCGGTCTAAGTTCCCTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGCGCCTGCCTTCGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAATTGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCAGGCTCCGGCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCGGTTCGGGCGGTCGGATAAAGGTCTCTGTCACGTACCTCCCTTCGGGTGGCTTATAGGGGAGACCAATGCGACCAGCCCGGACCGAGGTCCGCGCATTGCCAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Botryosphaeria_dothidea GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCTTTGGTGATTCATGATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATTAACTTTCGATGGTAGGATAGAGGCCTACCATGGTATCAATGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGGGATCCGCATGGCCTTCACTGGCTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAAGCTGGTGAGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCAAGGGCTCCCGCCTAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTAAGCCATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGTGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGAGTGTATAGCCCGGGGTGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTGGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGCACTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Byssothecium_circinans GATAGTACCTTACCACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGCTCTTTGGTGATTCATGATAACCTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCATGGTTTTAGAGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGTCTGGTGCGTCCGCCTCACCGCGTGCACTTGTCCGGCTGGACCTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGATCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGTGTTGGTGGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTTTGTGGTCGCATGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCGGGCGTATGCCCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTCGGATAAAGGCCTCTGTCACGTATCTTCCTTCGGGTGACTTATAGGGGAGGCACATGCGACCAGCCCGGACTGAGGTCCGCGCTTTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Cochliobolus_heterostrophus GATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGTCTGGTGCGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTTACTGGGCGTGTTGGGGATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGAGGCTTATAGGGGAGACACATACCACCAGCCTAGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGAAGTTTACGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCAGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGCGGCATTTGAATGAAACGTTTTAGTGGGCCATTTTTGGT Cucurbitaria_elongata GATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGTCTGGTGCGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGAGGCTTATAGGGGAGACTCATACAACCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGACCCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCACTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Curreya_pityophila GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCCTTGGTGATTCATGATAACTTCTCAGATCGCATGGCTTTACGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGATAGGAGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTTGGCCTGGTGCGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTTTCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTCGCCTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGGCTTTGGCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCACGTATCTCCCTTCGGGTGACTTATAGGGGAGGCCAATGCAACCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCAGGGGGCTGAAACAGCCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Delitschia_didyma GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCCTTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGATTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAATTTAGGGGATCGAAAACAATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGAGTCCGAGTTGTAATTTGTAGAGGGTGTTTCGGCGTCGACCCTTGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACGAGCGGTCTTCGCCATGTGAAACCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTATATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCTGCCGTCGTTCATCCGGGCTTCTGCCCGGTGCATTCGTCGGCAGACAGGCCAGCATCAGTTTGGGCGGTCGGACAAAGGCCCTGGGAATGTAGCTCTCTTCGGGAGTGTATAGCCCAGGGCTCATGCGGCCAGCCTGGACTGAGGTCCGCGCTTGGCTAGGATGCTGGCGTAATGGTCGCAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGAATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Delitschia_winteri GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGTCTTGGGCCTGGTGCGTCCGCCTCACCGCGTGCACTGGTTCGGTCGGGCCTTCCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATCAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGCCCGAGTTGTAATTTGCAGAGGGTGTTTCGGCGAGGGCCTGGGTCTAAGTTCCTTGGAACGGGACGTCATAGAGGGTGAGAACCCCGTACGTGGCCCCTGGTCTTCGCCATGTGAAACCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTATATTTCTTCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCTGCAGTCGTTCATCCGGGCCCGCGCCCGGTGCACTCGTCTGCAGGCAGGCCAGCATCGGTTGGGGCGGCCGGACAAAGGCCTTGGGAATGTGGCTCTCTTCGGGAGTGTATAGCCCAGGGCCAATACGGCCAGCCCCGACCGAGGACCGCGCTTGGCTAGGATGCTGGCATAATGGTCGCAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGGAATGAAAGTGAACGGAGGTGGGACCCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Didymella_cucurbitacearum GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGAGATTTATAGGGGAGACACATGCAACCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCTGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCAGTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Didymella_exigua GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCAGGTTTTTACCTGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGAGAATTATAGGGGAGACACATGCAACCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCTGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCAGTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Dothidea_insculpta GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAGCGCCCTTCGGGCTCCTTGGTGATTCATAATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTAGGGTCTGTAATTGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGGGAGCCGTATGCCCTTCACTGGGCGTATTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGCATAGCTCAAATTGAAAGCTGGTTGGCCCGCATTGTAATTTGTAGAGGATGCTTTTAGGCAGCCGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGGCTCTGCACCTTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGACTTGGCTGTTCAACAGGTCTTCTGACCTGCCTATTCAGTCTTGTCCAGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGCCCTGGGAATGTGGCTTCTCCTGGGAGTGTATAGCCCAGGGTTAATACGGCCAGCTGGGACTGAGGTCCGCGCTTGGCTAGGATGCTGGCGTAATGGTTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTAGGGTGTCAAACCCTTACGCGTAATGAAAGTGAACGGAGGTGAGAACCCGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCTGGGGATGAAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTTCTTAGTTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Herpotrichia_juniperi GATAGTACCTTACCACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGCTCTTTGGTGATTCATGATAACCTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATTAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGTCTGGTGCGTCCGCCTCACCGCGTGCACTTGTCCGGCTGGACCTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGATCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCATAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCAGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGCTGCTTGTCTTCACCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGTAGTTGCTCATCTGGGGTTTTCCCCAGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTCGGGCGGTTGGAGAAAGACCTGTGTCACGTAGCTCTCTTCGGGAGTGTTATAGGGCAGGTGAATGCAACCAGCCTGAACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTTCTTAATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Kalmusia_scabrispora_KT1023 GAAAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGCTCCTTGGTGATTCACAATAACTTCTCGGATCGCATGGCTTTACGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTAGTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACACAATTCGACTGGAGATGTAGTGACAATACATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTTGGCCTGGTGCGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTTTCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATGGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGCTCAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCCTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGCGCCTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTCCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGGCTCCCGCCCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTCGGATAAAGGTCTCTGTCATGTACCACCCTTCGGGTGGCTTATAGGGGAGGCCATTGCGATCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Kalmusia_scabrispora_KT2202 GAAAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGCTCCTTGGTGAATCACAATAACTTCTCGGATCGCATGGCTTTACGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTAGTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACACAATTCGACTGGAGATGTAGTGACAATACATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTTGGCCTGGTGCGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTTTCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATGGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGCTCAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCCTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGCGCCTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTCCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGGCTCCCGCCCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTCGGATAAAGGCCTCTGTCATGTACCACCCTTCGGGTGGCTTATAGGGGAGGCCATTGCGATCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Katumotoa_bambisicola_KT1517 GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAGCCAATGCCCTCCGGGCTCCTTGGTGATTCACAATAACTTCTCAGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCGGAGGAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTTGGCCTGGTGCGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTCTCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATGGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTCGGCAGCGGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTCGCCTGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTCGCAGTTGCTCATCCGGGCTTTTGCCCGGAGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGGCGACCGGATAATGGCCTCTGTCATGTATCTTCCTTCGGGTGACTTATAGGGGAGGCTCATGCGGTCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Lepidosphaeria_nicotiae GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTCGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGATCCGCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGTAGAGGGCGCTTTGGCGTTGGCCCTGGCCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAACCCCGTACGTGGCCGGTGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTCCGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCCAGGCGGCCGGATAAAGGCCTTGGGAATGTGGCTCCCTTCGGGAGTGTATAGCCCAGGGCCAATGCGGCCAGCTTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCAGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Leptosphaeria_maculans GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGTCTGGTGCGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTATCACGTACCTCTCTTCGGGAGGCTTATAGGGGAGACACATGCAACCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCACTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Letendraea_helminthicola GATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCCTTGGTGATTCATAATAACTTCTCAGATCGCACGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATTCGACTGGAGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTTGGCCTGGTGCGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTTTCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCATTGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGCGCCTGCCTTTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGGCTTTCGCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCACGTATCTCCCTTCGGGTGACTTATAGGGGAGGCCAATGCAACCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCGAGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCAGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Lophiostoma_macrostomum_KT635 GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCTGACTTCGGAAAGGGTGTATTTATTAGATAAAAAACCAATGCCCTTTGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCTGGCCGGGCCTTCCTTCTGGAGAACCTCATGCCCTTCAGTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGTTGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCAGCCTCCGCCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCTAGACGTGCCTTGGGTTGATCAGCCGGGCTTTTGCCCGGTGCACTCTTCCCTTGGCAGGCCAGCATCAGTTTGGGCGGCTGGATAAAGGTCTGTTAAACGTGACTTCCTTCGGGAGAGTTATAGGGCAGACACATGCAGCCAGCCTGAACTGAGGTCCGCGCATTGCTAGGATGCTGGCATAATAGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTAAACGGAGGTGGGAACCTAGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Lophiostoma_macrostomum_KT709 GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCTGACTTCGGAAAGGGTGTATTTATTAGATAAAAAACCAATGCCCTTTGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCTGGCCGGGCCTTCCTTCTGGAGAACCTCATGCCCTTCAGTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGTTGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCAGCCTCCGCCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCTAGACGTGCCTTGGGTTGATCAGCCGGGCTTTTGCCCGGTGCACTCTTCCCTTGGCAGGCCAGCATCAGTTTGGGCGGCTGGATAAAGGTCTGTTAAACGTGACTTCCTTCGGGAGAGTTATAGGGCAGACACATGCAGCCAGCCTGAACTGAGGTCCGCGCATTGCTAGGATGCTGGCATAATAGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTAAACGGAGGTGGGAACCTAGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Lophostoma_heterosporum GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCTGACTTCGGAAAGGGTGTATTTATTAGATAAAAAACCAATGCCCTTTGGGCTCTTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCTGGCCGGGCCTTCCTTCTGGAGAACCTCATGCCCTTCAGTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCTGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCAGCCTCCGCCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCTAGACGTGCCTTGGGTTGATCAGCCGGGCTTTTGCCCGGTGCACTCTTCCTTTGGCAGGCCAGCATCAGTTTGGGCGGCTGGATAAAGGTCTGTTAAACGTGACTCCCTTCGGGAGAGTTATAGGGCAGACACATGCAGCCAGTCCGAACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATAGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTAAACGGAGGTGGGAACCCGGGTGCACCACCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Massaria_platani GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCTTTGGTGATTCATGATAACTTCTCAGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTTGGCCTGGTGCGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTCTCTTCTGGGGAACCGCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGCATAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTTGACGGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTTTGTGGTCGCCAGTCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGACTTTTGCCCGGAGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGCTGGATAAAGACCTCTGTCATGTATCTTCCTTCGGGTGACTTATAGGGGAGGTTAATGCAGTCAGCCTGGACTGAGGTCCGCGCATCGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Massarina_arundinariae_KT1034 GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGCTCTTTGGTGATTCATAGTAACTCAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACTGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACAAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGCACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGCCGGGGACCAGGACCGTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATATCGAAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCAGAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGTAGAGGGCGCTTTGGCGTCGGCCCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAACCCCGTACGTGGCCGCCGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGCAGTTGCTCACCCGAGCTCTTGCTCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTCCGGGCGGTCGGATAAAGGTCCCGGGAACGTAGCTCCCTCCGGGAGTGTATAGCCCGGGGTCCATGCGACCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGAAGGGGGTCGAAACGACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Massarina_arundinariae_KT2200 GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGCTCTTTGGTGATTCATAGTAACTCAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACTGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACAAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGCACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGCCGGGGACCAGGACCGTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATATCGAAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCAGAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGTAGAGGGCGCTTTGGCGTCGGCCCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAACCCCGTACGTGGCCGCCGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGCAGTTGCTCACCCGAGCTCTTGCTCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTCCGGGCGGTCGGATAAAGGTCCCGGGAACGTAGCTCCCTCCGGGAGTGTATAGCCCGGGGTCCATGCGACCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGAAGGGGGTCGAAACGACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Massarina_arundinariae_KT856 GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGCTCTTTGGTGATTCATAGTAACTCAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACTGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACAAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGCACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGCCGGGGACCAGGACCGTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATATCGAAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCAGAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGTAGAGGGCGCTTTGGCGTCGGCCCCGGCCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAACCCCGTACGTGGCCGCCGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGCAGTTGCTCACCCGAGCTCTTGCTCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTCCGGGCGGTCGGATAAAGGTCCCGGGAACGTAGCTCCCTCCGGGAGTGTATAGCCCGGGGTCCATGCGACCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGAAGGGGGTCGAAACGACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Massarina_eburnea_HC3953 GATAGTACCTTACTACATGGATACCTGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGCTCCTTGGTGATTCATAATAACCTCTCAGATCGCATAGCCTTGAGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCTACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGTTAGCCTGAGAAACGGCTAACACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGATAAGGGAGGTAGTGACAATAAATACTGATGGGAGTTTTTGGGTTTCTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTTGGCCTGGTGCGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTTTTTTCTGGAGAACCGCATGCTCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATATTACAGCATGGAATAATAGAATAGGACGTCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATTAGTATTCAATGGTCAGAGGTGAAATTCTTGGATTCTTTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATCAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTAGGCGGCGGTCTAAGTTCCTTGGAACAGGGCATCGCAGAGGGTGAGAATCCCGTATGTGGTCGCCTGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATAAGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGGCTTTTGCCTGGGGCATTCTTCTGCGGGCAGGCCAGCATCAGTTTCGGCGGTCGGATAAAGGTCTCTCTCACGTACCTGCCTACGGGTAGCTTATAGGGGAGACACATGCGACCAGCTGGGACTGAGGTCCGCGCTTGGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCTGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Montagnula_opulenta GATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGTTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCCTTGGTGATTCATAATAACTTCTCAGATCGCATAGCCTTGAGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTAGTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATTCGATAGGAGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGAGTTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGATTTTGGCCTGGCGCGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTTTCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCATGGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTATGTGGGCGCCTGCCTTTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCCGGCTCTTGCCTGGGGCACTCTTCTGTGGGCAGGCCAGCATCAGTTTGGGCGGTCGGATAAAGGCCTCTGTCAAGTATCTTCCTTCGGGTGACTTATAGGGGAGGCTAATGCGGCCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGATCCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Neotestudina_rosatii GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCCCCGACCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAACCCCGTACGTGGTCGTCGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCCAGGCGGTCGGATAAAGGCCTTGGGAATGTGGCTCTCTTCGGGAGTGTATAGCCCAGGGTCAATGCGGCCAGCTTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCAGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Neottiosporina_paspali GATAGTACCTTACTACTTGGATACCTGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCCTTGGTGATTCATAATAACTTCTCAGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTGGCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGTCAGCCTGAGAAACGGCTGACACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGATAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTTGGCCTGGTGCGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTTTCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATATTACAGCATGGAATAATAAAATAGGACGTCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGCATAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTTGGTAGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTTTGTGGTCGCATGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCACCTAGGCTTTTGCCTGGGGCATTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTCGGATAAAGGTCTCTGTCATGTAGCTTTCTTCGGAAGAATTATAGGGGAGACAAATGCGACCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCAGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Ophiosphaerella_herpotricha GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGTCTGGTGCGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCCGGACTTTTGTCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTAGGCGGTTGGATAAAGGTCTCTATCACGTACCTCCCTTCGGGTGGCTTATAGGGGAGACACATGCAACCAGCCTGAACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGACGCGTAATGAAAGTGAACGGAGGTGGGAACCTAGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCACTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Ophiosphaerella_sasicola_KT1706 GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAGCCAATGCCCTTCGGGCTCCTTGGTGATTCACAATAACTTCTCAGATCGCACGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGCGAGCCTGAGAGACGGCTAGCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTTGGCCTGGTGCGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTCTCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTCGGCAGCGGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTCGCCTGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCACCCGGACTTTTGCCCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGACCGGATAATAGCCTCTGTCACGTATCTTCCTTCGGGTGACTTATAGGGGAGGCTAATGCGGCCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Phaeodothis_winteri GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCCTTGGTGATTCATGATAACTTCTCAGATCGCATGGCTTTACGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTAGTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCGGAGGAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATTCGATAGGAGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTTGGCCTGGTGCGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTTTCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGCTCAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCCTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGCGCCTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTCCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCAGGCTCTCGCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTCGGACAAAGGCCTCTGTCATGTACCACCCTTCGGGTGGCTTATAGGGGAGGCTAATGCGACCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCTGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Phaeosphaeria_avenaria GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGTCTGGTGCGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGGAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTATCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCTGGACTTTTGTCCAGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGAGGCTTATAGGGGAGACACATGCAACCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGACGCGTAATGAAAGTGAACGGAGGTGGGAACCTAGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCACTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Phaeosphaeria_brevispora_KT1466 GATAATACCTTGCTACTCGGATATCCGTGGTAATTCTAGAGCTAATACGTGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGCTCCTTGGTGATTCATGATAACTTCTCAGATCGCATGGCTATACGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTAGTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATTCGATGGGAGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTTGGCCTGGTGCGTCCGCCTCACCGCGTGCACTTGACCGGCCGGGCCTTTCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGCTCAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCCTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGCGCCTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTCCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTAAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCAGGCTCCCGCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTCGGATAAAGGCCTCTGTCACGTACCACCCCTCGGGTGGCTTATAGGGGAGGCCAATGCGACCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Phaeosphaeria_brevispora_KT2313 GATAATACCTTGCTACTCGGATATCCGTGGTAATTCTAGAGCTAATACGTGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGCTCCTTGGTGATTCATGATAACTTCTCAGATCGCATGGCTATACGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTAGTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATTCGATGGGAGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTTGGCCTGGTGCGTCCGCCTCACCGCGTGCACTTGACCGGCCGGGCCTTTCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGCTCAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCCTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGCGCCTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTCCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTAAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCAGGCTCCCGCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTCGGATAAAGGCCTCTGTCACGTACCACCCCTCGGGTGGCTTATAGGGGAGGCCAATGCGACCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Phaeosphaeria_sp_KT2564 GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCCTAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGTCTGGTGCGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTTCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTCGATAAAGGTCTCTGTCACGTACCTTCCTTCGGGAGGCTTATAGGGGAGACACATGTAACCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCACTTGAATGTACCGTCCTAGTGGGCCATTTTTGGT Phoma_herbarum GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGAGAATTATAGGGGAGACACATGCAACCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCTGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCAGTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Pleomassaria_siparia GATAGTACCTTACCACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGCTCTTTGGTGATTCATGATAACCTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCATGGTTTTAGAGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGTCTGGTGCGTCCGCCTCACCGCGTGCACTTGTCCGGCTGGACCTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGATCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCATAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGAGTTGGCTGCAGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGTTGCATGCCTTCGCCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCATCCGGGGTTCTCCCCGGTGCACTCTTCTGTGGGCAGGCCAGCATCAGTTCGGGCGGTTGGAGAAAGACCTGTGTCATGTAGCTGTTCTCGGGAGTGTTATAGGGCAGGTGAATGCAACCAGCTCGAACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTTCTTAATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Pleospora_herbarum GATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGAGGCTTATAGGGGAGACACATACCACCAGCCTAGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGAAGTTTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCAGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTGATTGAACGCGGCATTTGAATGAAACGTTTTAGTGGGCCATTTTTGGT Polyplosphaeria_fusca_KT1043 GATAGTACCTTACTACATGGATATCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTTTGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTCAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGTAGAGGGTGCATTGGTGTTGGCCCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGGTCGCCTTCGCCTTGTAATGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCTTGCCTGGTGCACTCTTCTACTGGCAGGCCAGCATCAGTTTGGGCGGCCGGACAAAGGCCCTAGGAACGTAGCTCCCCCCGGGAGTGTATAGCCTAGGGTTCATGCGGCCAGCCTGGACTGAGGTCCGCGCTTGGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Polyplosphaeria_fusca_KT1616 GATAGTACCTTACTACATGGATATCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTTTGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTCAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGTAGAGGGTGCATTGGTGTTGGCCCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGGTCGCCTTCGCCTTGTAATGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCTTGCCTGGTGCACTCTTCTACTGGCAGGCCAGCATCAGTTTGGGCGGCCGGACAAAGGCCCTAGGAACGTAGCTCCCCCCGGGAGTGTATAGCCTAGGGCTCATGCGGCCAGCCTGGACTGAGGTCCGCGCTTGGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Polyplosphaeria_fusca_KT1640 GATAGTACCTTACTACATGGATATCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTTTGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTCAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGTAGAGGGTGCATTGGTGTTGGCCCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGGTCGCCTTCGCCTTGTAATGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCTTGCCTGGTGCACTCTTCTACTGGCAGGCCAGCATCAGTTTGGGCGGCCGGACAAAGGCCCTAGGAACGTAGCTCCCCCCGGGAGTGTATAGCCTAGGGTTCATGCGGCCAGCCTGGACTGAGGTCCGCGCTTGGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Polyplosphaeria_fusca_KT1686 GATAGTACCTTACTACATGGATATCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTTTGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTCAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGTAGAGGGTGCATTGGTGTTGGCCCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGGTCGCCTTCGCCTTGTAATGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTATTGCCTGGTGCACTCTTCTACTGGCAGGCCAGCATCAGTTTGGGCGGCCGGACAAAGGCCCTAGGAACGTAGCTCCCCCCGGGAGTGTATAGCCTAGGGTTCATGCGGCCAGCCTGGACTGAGGTCCGCGCTTGGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Polyplosphaeria_fusca_KT2124 GATAGTACCTTACTACATGGATATCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTTTGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTCAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGTAGAGGGTGCATTGGTGTTGGCCCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGGTCGCCTTCGCCTTGTAATGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCTTGCCTGGTGCACTCTTCTACTGGCAGGCCAGCATCAGTTTGGGCGGCCGGACAAAGGCCCTAGGAACGTAGCTCCCCCCGGGAGTGTATAGCCTAGGGCTCATGCGGCCAGCCTGGACTGAGGTCCGCGCTTGGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Preussia_terricola GATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCCCATGCCCTTCACTGGGCGTGTGGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCAAAGGTTGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCAACCCGCGCTATGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCGGGCTCTTGCCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTCTTGGCGGTCGGATAAATGCGTGCTAAACGTACCTCTCTTCGGGAGGATTATAGGGCACGCGCATACGACCAGCCGGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Pseudotetraploa_curvi_HC4930 GATAGTACCTAACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTCAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCACCGGCCTAAGTTCCTTGGAACAAGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGGCTGCCTACGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGGCTCTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGTCCCGGGAACGTAGCTCTCTTCGGGAGTGTATAGCCCGGGGCCCATGCGGCCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Pseudotetraploa_curvi_HC4932 GATAGTACCTAACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTCAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCACCGGCCTAAGTTCCTTGGAACAAGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGGCTGCCTACGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGGCTCTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGTCCCGGGAACGTAGCTCTCTTCGGGAGTGTATAGCCCGGGGCCCATGCGGCCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Pseudotetraploa_curvi_KT2558 GATAGTACCTAACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTCAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCACCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGGCTGCCTACGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGGCTCTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGTCCCGGGAACGTAGCTCTCTTCGGGAGTGTATAGCCCGGGGCCCATGCGGCCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Pseudotetraploa_javanica_HC4934 GATAGTACCTAACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTCAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACCATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCACCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGGCCGCCTCCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGGCTCTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGCCTCGGGAACGTAGCTCTCCTCGGGAGTGTATAGCCCGGGGCCCATGCGGCCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Pseudotetraploa_longi_HC4933 GATAGTACCTAACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACTGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTGGGCGCTGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGGCCGCCTTAGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGGCTCTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGCCCCGGGAACGTAGCTCTCTTCGGGAGTGTATAGCCCGGGGTTCATGCGGCCAGTCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Quadricrura_bicornis_yone153 GATAGTACCTCACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTAGCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACTGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCTCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGGCTGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGCCTCGGGAACGTAGCTCTCTTCGGGAGTGTATAGCCCGGGGCTCATGCGGCCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Quadricrura_meridionalis_KT2607 GATAGTACCTCACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTAGCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACTGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCTCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGGCTGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGCCTCGGGAACGTAGCTCTCTTCGGGAGTGTATAGCCCGGGGCTCATGCGGCCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Quadricrura_septentrio_HC4983 GATAGTACCTCACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCTCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGACCGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTATTGGCAGGCCAGCATCAGTTTGGGCGGTCGGATAAAGGCCTCGGGAATGTAGCTCTCTTCGGGAGTGTATAGCCCGGGGTTCATGCGACCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Quadricrura_septentrio_HC4984 GATAGTACCTCACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCTCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGACCGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTATTGGCAGGCCAGCATCAGTTTGGGCGGTCGGATAAAGGCCTCGGGAACGTAGCTCTCTTCGGGAGTGTATAGCCCGGGGTTCATGCGACCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Quadricrura_septentrio_KT920 GATAGTACCTCACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCTCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGACCGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTATTGGCAGGCCAGCATCAGTTTGGGCGGTCGGATAAAGGCCTCGGGAATGTAGCTCTCTTCGGGAGTGTATAGCCCGGGGTTCATGCGACCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Quadricrura_septentrio_yone176 GATAGTACCTCACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCTCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGACCGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTATTGGCAGGCCAGCATCAGTTTGGGCGGTCGGATAAAGGCCTCGGGAATGTAGCTCTCTTCGGGAGTGTATAGCCCGGGGTTCATGCGACCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Quadricrura_septentrio_yone179 GATAGTACCTCACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCTCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGACCGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTATTGGCAGGCCAGCATCAGTTTGGGCGGTCGGATAAAGGCCTCGGGAATGTAGCTCTCTTCGGGAGTGTATAGCCCGGGGTTCATGCGACCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Quadricrura_septentrio_yone44 GATAGTACCTCACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCTCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGACCGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTATTGGCAGGCCAGCATCAGTTTGGGCGGTCGGATAAAGGCCTCGGGAATGTAGCTCTCTTCGGGAGTGTATAGCCCGGGGTTCATGCGACCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Roussoella_hysterioides_HH26988 GATAGTACCTTACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTACTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAAGGAGCCTGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGCTGGGGACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGGCTCTCGCCCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGGATAAAGGCCTCTATCACGTATCTTCCTTCGGGTGACTTATAGGGGAGGCCAACACGGCCAGCCCGAACTGAGGACCGCGCATCGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Roussoella_hysterioides_KT1651 GATAGTACCTTACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCCTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAAGGAGCCTGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGCTGGGGACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGGCTCTCGCCCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGGATAAAGGCCTCTGTCACGTATCTTCCTTCGGGTGACTTATAGGGGAGGCCAACACGACCAGCCCGAACTGAGGACCGCGCATCGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Roussoella_pustulans_KT1709 GATAGTACCTTACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCCTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGGCTCTCGCCCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGGATAAAGGCCTCTATCACGTATCTTCCTTCGGGTGACTTATAGGGGAGGCCAACACGGCCAGCCCGAACTGAGGACCGCGCATCGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Roussoella_sp_KT2303 GATAGTACCTTACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAAATAAAAAACCAATGCCCTTCGGGCTCCTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGGCTTTTGCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGGATAAAGGCCTCTATCACGTATCTTCCTTCGGGTGACTTATAGGGGAGGCCAACACGGCCAGCCCGAACTGAGGACCGCGCATCGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACTCGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Roussoellopsis_sp_KT1710 GATAGTACCTTACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCTTTGGTGATTCATAATAACTTATCGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAGGGAGCCTGAGAGACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCTGGGCTCTCGCCCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGGATAAAGGCCTCTGTCATGTATCTTCCTTCGGGTGACTTATAGGGGAGGCCAACACGGCCAGCCCGAACTGAGGACCGCGCATCGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Roussoellopsis_tosaensis_KT1659 GATAGTACCTTACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTGCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAGTGCGCCTGAGAAACGGCGAACACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCACACCCGGGCTCTCGCCCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGGATAAAGGCCTCTATCACGTATCTTCCTTCGGGAGACTTATAGGGGAGGCCAACACGGCCAGCCCGAACTGAGGACCGCGCATCGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Setomelanomma_holmii GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGTCTGGTGCGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTTCCTTCTGGAGAACCTCATGCTCTTCACTGGGCGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCCGGACTTTTGTCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGAGGCTTATAGGGGAGACACATGCAACCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAAGGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGACGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCACTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Setosphaeria_monoceras GATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGAGGCTTATAGGGGAGGCACATACCACCAGCCTAGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGAAGTTTACGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCAGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGCGGCATTTGAATGAAACGTTTTAGTGGGCCATTTTTGGT Spencermartinsia_viticola GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCCTTGGTGATTCATGATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGGGATCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCATAGCTCAAATTGAAAGCTGGCGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGTTGCCTTAGCCATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCCTAGGAATGTAGCTCCTCTCGGGAGTGTATAGCCTGGGGTGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTGGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGAATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGCACTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Sporornia_lignicola GATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCCTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCCCATGCCCTTCACTGGGCGTGCGGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGAGTTGACTGTGGTCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGGCCGCCAGTCTTCTCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTCGCGGCGGTTGGATAAATGTCTGCACAATGTACCTCTCTTCGGGAGGATTATAGGGCAGGCGCATACAACCAGCTGCGATTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Tetraploa_aristata_CBS996_70 GATAGTACCTAACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACGGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGCCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGCAGAGGGTGCTTCGGCGTTGGCGCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACGTGGCAGGCCGCCTCCGCCGTGTGAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCCCCGGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCAGGGCGGCCGGATAAAGGCCCCGGGAACGTAGCTCCCTCCGGGAGTGTATAGCCCGGGGCCAATGCGGCCAGCCCCGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGAAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Tetraploa_sp_KT1684 GATAGTACCTAACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTTCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGCCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCTCCTGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACGTGGCAGGCCGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGCAGTTGTTCATCCGGGCTCCCGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGCCCCAGGAACGTAACTCTCTCCGGGAGTGTATAGCCCGGGGCCAATGCGGCCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Tetraploa_sp_KT2578 GATAGTACCTAACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATAATAACTCAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGAGTGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCGCCAGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGGCTGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCAGCCAGGCTCTCGCCCGGTGTACTCTTCTGTGGGTAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGTCTCGGGAACGTAGCTCCCTCCGGGAGTGTATAGCCCGGGGCCAATGCGGCCAGTCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Tetraplosphaeria_nagasaki_KT1682 GATAGTACCTAACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAGTCCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGAATCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTCGGCGCCAGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGGCTGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCCCCGGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGCCGGACAAAGGCCCCGGGAACGTAGCTCTCTCCGGGAGTGTATAGCCCGGGGCGAATGCGGCCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGCAGGTGGGACACCGGCTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCAATTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Tetraplosphaeria_sasicola_KT563 GATAGTACCTAACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTTCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGTAGAGGGCGCTTTGGCGTTGGCTCCTGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACGTGGCAGGCCGCCTCCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGCAGTTGTTCATCCGGGCTCCCGCCCGGTGCACTCCTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGTCCTGGGAACGTAGCTCTCTCCGGGAGTGTATAGCCCAGGGCCAATGCGGCCAGCCCGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Tetraplosphaeria_yakushi_KT1906 GATAGTACCTAACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTTCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGCCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGCCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTCGGCGCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACGTGGCAGGCCGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCCCCGGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTGGGCGGCCGGATAAAGGCCTCGGGAACGTAGCTCCCTCCGGGAGTGTATAGCCCGGGGCCAATGCGGCCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGAAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Trematosphaeria_pertusa GATAGTACCTTACCACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGCTCTTTGGTGATTCATGATAACCTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATTAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGTCTGGTGCGTCCGCCTCACCGCGTGCACTTGTCCGGCTGGACCTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGATCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCATAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGCTGCTTGTCTTCACCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGTAGTTGCTCATCTGGGGATTTCCCCAGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTCGGGCGGTTGGAGAAAGACCTGTGTCACGTAGCTCTCTTCGGGAGTGTTATAGGGCAGGTGAATGCAACCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTTCTTAATTGAACGTGGCATTTGAATGTATCGTTCTAGTGGGCCATTTTTGGT Triplosphaeria_acuta_KT1170 GATAGTACCTAACTACTTGGATATCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCCCCGGCCTAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTACGTGGCCGACCGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTGCTGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGCCTCGGGAACGTAGCTCCCCTCGGGAGTGTATAGCCCGGGGCTCATGCGGCCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Triplosphaeria_cylindrica_KT1256 GATAGTACCTAACTACTTGGATATCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCCCCGGCCTAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTACGTGGCCGACCGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTGCTGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGCCTCGGGAACGTAGCTCCCCTCGGGAGTGTATAGCCCGGGGCTCATGCGGCCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Triplosphaeria_cylindrica_KT1800 GATAGTACCTAACTACTTGGATATCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCCCCGGCCTAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTACGTGGCCGACCGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTGCTGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGCCTCGGGAACGTAGCTCCCCTCGGGAGTGTATAGCCCGGGGCTCATGCGGCCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Triplosphaeria_cylindrica_KT2550 GATAGTACCTAACTACTTGGATATCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCCCCGGCCTAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTACGTGGCCGACCGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTGCTGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGCCTCGGGAACGTAGCTCCCCTCGGGAGTGTATAGCCCGGGGCTCATGCGGCCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Triplosphaeria_maxima_KT870 GATAGTACCTAACTACTTGGATATCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGGGAACCGCATGTCCTTCACTGGGCGTGTCGGGGGCCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCCCCGGCCTAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTACGTGGCCGACCGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTGCTGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGTCCCGGGAACGTAGCTCCCCTCGGGAGTGTATAGCCCGGGGCTCATGCGGCCAGCCTGGACTGAGGTCCGCGCGTTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Triplosphaeria_sp_HC4665 GATAGTACCTAACTACTTGGATATCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCACCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGGCTGCCTCCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTGCTGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGCCTCGGGAACGTAGCTCCCCTCGGGAGTGTATAGCCCGGGGCTCATGCGGCCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Triplosphaeria_sp_KT2546 GATAGTACCTAACTACTTGGATATCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCACCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGGCTGCCTCCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTGCTGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGGCTCGGGAACGTACCTCCCCTCGGGAGTGTATAGCCCGGGGCTCATGCGGCCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Triplosphaeria_yezoensis_KT1715 GATAGTACCTAACTACTTGGATATCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCCCCGGCCTAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTACGTGGCCGACCGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTGCTGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGCCTCGGGAACGTAGCTCCCCTCGGGAGTGTATAGCCCGGGGCTCATGCGGCCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Triplosphaeria_yezoensis_KT1732 GATAGTACCTAACTACTTGGATATCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCCTCGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCCCCGGCCTAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTACGTGGCCGACCGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCCTGCCCGGTGCACTCTTCTGCTGGCAGGCCAGCATCAGTTTGGGCGGCCGGATAAAGGCCTCGGGAACGTAGCTCCCCTCGGGAGTGTATAGCCCGGGGCTCATGCGGCCAGCCTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGCACCGTTCTAGTGGGCCATTTTTGGT Ulospora_bilgramii GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGTGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACGTGGCCGGCGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCCAGGCGGTCGGATAAAGGCCTTGGGAATGTGGCTCTCTTCGGGAGTGTATAGCCCAGGGTCAATGCGGCCAGCTTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCAGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Verruculina_enalia GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGCACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCTCATGCCCTTTACTGGGTGTGTAGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGTAGAGGGCGCTTTGGTGTTGGCCCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAACCCCGTACGTGGCCGGCGGCCTTCGCTGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCTGGGCTCTTGCCCAGCGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCAAGCGGTCGGACAAAAGCCCTAGGAATGTGGCTCCTTCCGGGAGTGTATAGCCTAGGGCTAATGCGGCCAGCTTGGACTGAGGTCCGCGCATTGCTAGGATGCTGGCGTAATGGTTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGAAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCAGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Versicolorisporium_trisept_SH130 GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGAGATTAGGGTTTGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATCGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGTGAGCCTCATGCCCTTCACTGGGTGTGTTGGGGACCAGGACTTTTACTGTGAACAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGACTCCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCTAGCCACGGCTCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCAGGCGGCCGGACAAAGACCTCTATCACGTATCTTCCTTCGGGTGACTTATAGGGGAGGTTAATGCGGCCAGCCTGGATTGAGGTCCGCGCATAGCTAGGATGCTGGCGTAATGGCTGTAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGTTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTTTTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT Zopfia_rhizophila GATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTTGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGGCAAATTACCCAATCCGACAGGGGAGGTAGTGACAATAAATACTGATCAGGGTTTTTGGGTCTGTAATTGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAGCTCGTAGTTGACTTGGGCCTGGTGCGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTCCTTCTGGAGAGCCGCATGCCCTTTACTGGGCGTGTTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGCACAGCTCAAATTGAAATCTGGCGGGTCCGAGTTGTAATTTGCAGAGGGAGCTTCGGCGTCGGCGTCGGCCTAAGTTCTTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACGTGGCCGTCAGCCTTTGCCGTGTGAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATAGCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCTGCGGTTGTTCATCCGGGCCCACGCCCGGTGCACTCGTCCGCAGGCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCCGGGAATGTAGCTCTCTTCGGGAGTGTATAGCCCGGGGTCAATGCGGCCAGCCTGGACTGAGGTCCGCGCTTGGCTAGGATGCTGGCGTAATGGCCGCAGCGGCCGTCTTGAAACACGGACCGTTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCCGAAGTTTCCCTCAGGATGCAGTACGTATTCAGTTTTATGAGGAAAGCGAATGATAGAGGCCGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTTGTTGAACGTGGCATTTGAATGTACCGTTCTAGTGGGCCATTTTTGGT ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = Order) = N: 1-1878; CODONPOSSET * CodonPositions (CHARACTERS = Order) = N: 1-1878; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4492] TITLE family; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1293; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Massarina_arundinariae_KT2200 TGTAAGACCCCCATGTTTACGCAGGCTTTTGCGCGCGTCTTGCCCCGCGTTTGCCTCAGGGTCAAAACACCGTTGAGGAACAACAGCTAACGTCTGCCAATAGGTTCATCTCCAGACCGGTCAATGCGTAAGTAGCCGCCCTCATCATATTCGCGCATGATGCTGATAAGTGTTAGGGTAACCAAATCGGTGCTGCCTTCTGGCAAACCATCTCTGGCGAGCATGGTCTCGACGGCTCTGGTGTGTAAGTAGTCCCTCACAGCACCCTACGATGTAGTGTGCTAACTCTGCGCAGCTACAACGGCACCTCCGACCTCCAACTCGAGCGCATGAATGTCTACTTCAACGAGGTTCGCGAGCAATCAGGACCCCTTTGGGAGGCTAATACTTTACAGGCGTCCGGCAACAAATTCGTCCCCCGTGCTGTCCTCGTCGACTTGGAGCCAGGTACCATGGACGCCGTCCGCGCTGGACCGTTCGGGCAGCTCTTCCGTCCCGACAACTTCGTCTTTGGGCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGTCACTAGAAGGATCATTACCGTGGGGCCACGTGGCCCCTCAAGATGCTACCCCTGCCTTTTGAGTACCCCTGTTTCCTCGGCGGGCTCGCCCGCCAGTGGGGACCATACCAAAACCTATGCGGTTGCAGTGAACGTACAAAACAACAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGCAATCCTTAGGGCATGCCTGTTCGAGCGTCATCTAAACCCCCAAGCACCGCTTGATGTTGGGCGCTTGTCCCCCGGACTCGCCTCAAAAGCATTGGCGGCCCGTGTATTGGCCTCGAGCGCAGCAGAAACGCGCCTCGGACCTCTGGCGCGGGCGACCAAGACGCACCCAGTTTGACCTCGGATCAGGGAGAAGGTGAGCGCACCTTTTGGAACAGGCTGTGCGCGCCCATCCGGCGCCTCCTCTGCTGCAGCCATTATTTTGGCTTATCGCACTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTACGCGCCAGCCGCATTCGGCTGCTCGCCAACCCCTATGACGCACAGTGGGCAATATTGCGTCTCGCCTGCCTGTGCAGTGTCGACTCGGGCTCGCGCGCATTTTCCGCTTGGGCGCCATGCTAACTCCCTCGCAGGAAGCCGCCGAACTTGGTAAGGG Massarina_arundinariae_KT856 TGTAAGACCCCCATGTTTACGCAGGCTTTTGCGCGCGTCTTGCCCCGCGTTTGCCTCAGGGTCAAAACACAGTTGAGGAACAACAGCTAACGTCTGCCAATAGGTTCATCTCCAGACCGGTCAATGCGTAAGTAGCCGCCCTCATCATATTCGCGCATGATGCTGATAAGTGTTAGGGTAACCAAATCGGTGCTGCCTTCTGGCAAACCATCTCTGGCGAGCATGGTCTCGACGGCTCTGGTGTGTAAGTAGTCCCTCACAGCACCCTACGATGTAGTGTGCTAACTCTGCGCAGCTACAACGGCACCTCCGACCTCCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTTCGCGAGCAATCAGGACCCCTTTGGGAGGCTAATACTTTACAGGCGTCCGGCAACAAATTTGTTCCCCGTGCTGTCCTCGTCGACTTGGAGCCAGGTACCATGGACGCCGTCCGCGCTGGACCGTTCGGGCAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGTCACTAGAAGGATCATTACCGTGGGGCCACGTGGCCCCTCAAGATGCCACCCCTGCCTTTTGAGTACCTCTGTTTCCTCGGCGGGCTCGCCCGCCAGTGGGGACCATACCAAAACCTATGCGGTTGCAGTGAACGTACAAAACAACAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGCAATCCTTAGGGCATGCCTGTTCGAGCGTCATCTAAACCCCCAAGCACCGCTTGATGTTGGGCGCTTGTCCCCCGGACTCGCCTCAAAAGCATTGGCGGCCCGTGTATTGGCCTCGAGCGCAGCAGAAACGCGCCTCGGACCTCTGGCGCGGGCGACCAAGACGCACCCAGTTTGACCTCGGATCAGGGAGAAGGTGAGCGCACCTTTTGGAACAGGCTGTGCGCGCCCATCCGGCGCCTCCTCTGCTGCAGCCATTATTTTGGCTTATCGCACTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTACGCGCCAGCCGCATTCGGCTGCTCGCCAACCCCTATGACGCACAGTGGGCAATATTGCGTCTCGCCTGCCTGTGCAGTGTCGACTCGGGCTCGCGCGCATTTCCCGCTTGGGCGCCATGCTAACTCCCTCGCAGGAAGCCGCCGAACTTGGTAAGGG Polyplosphaeria_fusca_KT1043 TGTAAGTATCCCCTGTTCTCGCAATTTTCTCCGCGCGTCTTGCCCCGCGTTTGCCTCAGGGACAACACAACATTAGGGAACCAAAGCTAACAGCCGCACACAGGTTCACCTTCAGACCGGCCAATGCGTAAGAAAATATGGCGACAACTTTTGGGCAGACTTCTAACCATATTTAGGGTAACCAAATCGGTGCTGCCTTCTGGCAACAGATCTCTGGCGAGCATGGTCTCGACGGCTCTGGCGTGTAAGAGACGCTCGATTACTCGCTTTGGCACGAGAGACTGATTTGGCCTAGCTACAATGGCACCTCCGATCTCCAGCTCGAGCGTATGAATGTCTACTTCAACGAGGTACGCGCTCACACTCATAACGTCGAGCAAACTGACGCTTGAAAGGCATCTGGCAACAAGTTCGTTCCCCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGATGCTGTTCGCGCTGGCCCTTTCGGACAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTATCGTGGGGCCTCACAGCCCCCCGAGATAGCACCCTTGTCTTCTGAGCACCTCTGTTTCCTCGGCAGGCTCGCCTGCCAATGGGGACCACACAAAACCTACTGCAGTTGTAGTAAACGTATCAAACAAAACAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATTAAACCCCTCAAGCTCTGCTTGGTGTTGGGCGCTTGTCCCCTGGACTCGCCTAGAATGCATTGGCGGCCTTCATTTTGGGCTCGAGCGCAGCAGACTCGCGCCTCGGGCTCAGTGCGTTGGCATCCAGGAAGCACTCAACTTGACCTCGGATCAGGGAGAAGGTACGCATTTTCTTGCACCCCGGCTGCGCTCGCCCGTCTGGTGTTGCCAACGGCGCAGCTAGAATTTTGGCTTATCGCATTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCCTGACTCGGCTACTCGCCAACGGCGATGACGCACAGCCGCCAAAATTACCCGCCGATGGCTTGCCGGACCATGCATCGTGCCGGCGCCTGGCTGACCGTTTGGCAAGATGCTAACTCTCTCGCAGGAAGCTGCCGAACTCGGTAAGGG Polyplosphaeria_fusca_KT1616 TGTAAGTATCCCCTGTTCTCGCAATTTTCTCCGCGCGTCTTGCCCCGCGTTTGCCTCAGGGACAACACAACATTGGGGAACCAAAGCTAACAGCCACACACAGGTTCACCTTCAGACCGGCCAATGCGTAAGAAAATATGGCGACAACTTTTGGGCAGACTTCTAACCATATATAGGGTAACCAAATCGGTGCTGCCTTCTGGCAACAGATCTCTGGCGAGCATGGTCTCGACGGCTCTGGCGTGTAAGAGACGCTCGATTATTCGCTTTAGCACGAGAGACTGATTTGGCCTAGCTACAATGGCACCTCCGATCTCCAGCTCGAGCGTATGAATGTCTACTTCAACGAGGTACGCGCTCACACTCATAACGTCGAGCAAACTGACGCTTGAAAGGCATCTGGCAACAAGTTCGTTCCCCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGATGCTGTTCGAGCTGGCCCTTTCGGACAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTATCGTGGGGCCTCACAGTCCCCCGAGATAGCACCCTTGTCTTCTCAGCACCTCTGTTTCCTCGGCAGGCTCGCCTGCCAATGGGGACCACACAAAACCTACTGCAGTTGTAGTAAATGTATCAAACAAAACAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATTAAACCCCTCAAGCTCTGCTTGGTGTTGGGCGCTTGTCCCTTGGACTCGCCTAGAATACATTGGCGGCCTTCATTTTGGGCTCGAGCGCAGCAGACTCGCGCCTCGGGCTCAGTGCGTTGGCATCCAGGAAGCACTCAACTTGACCTCGGATCAGGGAGAAGGTACGCATTTTCTTGCACCCCGGCCGCGCTCGCCCGTCTGGTGTTGCCAACGGCGCAGCTAGAATTTTGGCTTATCGCATTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCCCGACTCGGCTACTCGCCAACGGCGATGACGCACAGCCGCCAAAATTACCCGCCGATGGCTTGCCGGACCATGCATCGTGCCGGCGCCTAGCTGACCGTTTGGCAAGATGCTAACTCTCTCGCAGGAAGCTGCCGAACTCGGTAAGGG Polyplosphaeria_fusca_KT1640 TGTAAGTATCCCCTGTTCTCGCAATTTTCTCCGCGCGTCTTGCCCCGCGTTTGCCTCAGGGACAACACAACATTACGGAACCAAAGCTAACAGCCGCACACAGGTTCACCTTCAGACCGGCCAATGCGTAAGAAAATATGGCGACAACTTTTGGGCAGACTTCTAACCATATTTAGGGTAACCAAATCGGTGCTGCCTTCTGGCAACAGATCTCTGGCGAGCATGGTCTCGACGGCTCTGGCGTGTAAGAGACGCTCGATTACTCGCTTTGGCACGAGAGACTGATTTGGCCTAGCTACAATGGCACCTCCGATCTCCAGCTCGAGCGTATGAATGTCTACTTCAACGAGGTACGCGCTCACACTCATAACGTCGAGCAAACTGACGCTTGAAAGGCATCTGGCAACAAGTTCGTTCCCCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGATGCTGTTCGCGCTGGCCCTTTCGGACAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTATCGTGGGGCCTCACAGCCCCCCGAGATAGCACCCTTGTCTTCTGAGCACCTCTGTTTCCTCGGCAGGCTCGCCTGCCAATGGGGACCACACAAAACCTACTGCAGTTGTAGTAAACGTATCAAACAAAACAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATTAAACCCCTCAAGCTCTGCTTGGTGTTGGGCGCTTGTCCCTTGGACTCGCCTAGAATGCATTGGCGGCCTTCATTTTGGGCTCGAGCGCAGCAGACTCGCGCCTCGGGCTCAGTGCGTTGGCATCCAGGAAGCACTCAACTTGACCTCGGATCAGGGAGAAGGTACGCATTTTCTTGCACCCCGGCTGCGCTCGCCCGTCTGGTGTTGCCAACGGCGCAGCTAGAATTTTGGCTTATCGCATTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCCTGACTCGGCTACTCGCCAACGGCGATGACGCACAGCCGCCAAAATTACCCGCCGATGGCTTGCCGGACCATGCATCGTGCCGGCGCCTGGCTGACCGTTTGGCAAGATGCTAACTCTCTCGCAGGAAGCTGCCGAACTCGGTAAGGG Polyplosphaeria_fusca_KT2124 TGTAAGTATCCCCTGTTCTCGCAATTTTCTCCGCGCGTCTTGCCCCGCGTTTGCCTCAGGGACAACACAACATTGGGGAACCAAAGCTAACAGCCACACACAGGTTCACCTTCAGACCGGCCAATGCGTAAGAAAATATGGCGACAACTTTTGGGCAGACTTCTAACCATATTTAGGGTAACCAAATCGGTGCTGCCTTCTGGCAACAGATCTCTGGCGAGCATGGTCTCGACGGCTCTGGCGTGTAAGAGACGCTCGATTATTCGCTTTAGCACGAGAGACTGATTTGGCCTAGCTACAATGGCACCTCCGATCTCCAGCTCGAGCGTATGAATGTCTACTTCAACGAGGTACGCGCTCACACTCATAACGTCGAGCAAACTGACGCTTGAAAGGCATCTGGCAACAAGTTCGTTCCCCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGATGCTGTTCGAGCTGGCCCTTTCGGACAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTATCGTGGGGCCTCACAGTCCCCCGAGATAGCACCCTTGTCTTCTCAGCACCTCTGTTTCCTCGGCAGGCTCGCCTGCCAATGGGGACCACACAAAACCTACTGCAGTTGTAGTAAATGTATCAAACAAAACAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATTAAACCCCTCAAGCTCTGCTTGGTGTTGGGCGCTTGTCCCTTGGACTCGCCTAGAATACATTGGCGGCCTTCATTTTGGGCTCGAGCGCAGCAGACTCGCGCCTCGGGCTCAGTGCGTTGGCATCCAGGAAGCACTCAACTTGACCTCGGATCAGGGAGAAGGTACGCATTTTCTTGCACCCCGGCCGCGCTCGCCCGTCTGGTGTTGCCAACGGCGCAGCTAGAATTTTGGCTTATCGCATTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCCCGACTCGGCTACTCGCCAACGGCGATGACGCACAGCCGCCAAAATTACCCGCCGATGGCTTGCCGGACCATGCATCGTGCCGGCGCCTAGCTGACCGTTTGGCAAGATGCTAACTCTCTCGCAGGAAGCTGCCGAACTCGGTAAGGG Pseudotetraploa_curvi_HC4930 TGTAAGATGCCCCTGTTTACGCAATTTTCTCCGCGCGTCTTGCCCCGCGTTTGTCTCAGGGACAACACAACATTGAGGCATCCATGTTAACTTCGGCGAACAGGTTCACCTTCAGACCGGCCAATGCGTAAGTAAACATCCAGCCGGCTTTTGGGTGCCTTTCTGACAAAACGCAGGGTAACCAAATTGGTGCTGCCTTCTGGCAACAAATCTCAGGCGAGCACGGTCTCGATGGATCCGGAGTGTAAGCACACACAAACAAATCGCTCTCGTGGATGGAACTAACATGGTACAGCTACAATGGTACTTCCGATCTCCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTACGCGCTGAAGCTTACTGCAATCTCCAGACTGATACTCTATAGGCATCCGGCAACAAGTTCGTCCCCCGCGCCGTCCTCGTCGACTTGGAGCCCGGTACCATGGATGCTGTCCGTGCTGGACCATTTGGACAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTACCGTGGGGCCGCAAGGCCCCCCGAGATAGCACCCTTGTCTTTTGAGCACCACTGTTTCCTCGGCGGGCCCGCCCGCCAATGGGGACCAACCAAACCCTTTTGCAGTCGAAGTAAACGTACAAAACAATATAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATCAAACCCCTCAAGCCCCGCTTGGTGTTGGGCGCTTGTCCCCCGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATCGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCCCAGCGCGCGGGCGACCAGCAAGCACTCGTTTTGACCTCGGATCAGGGAGAAGGTACGCACTTTTCTGCATTCTGGCCGCAGTCGCAATCCAGGGCCTCTCCTTGCGGCAGCCATATTTTTGGCTTATCGCACCGAGGGGCAATTTGGATGGTGGGGTGTGCGGACTTTTTCGCGCTAGCCCGACTCGGCGGCTCGCCAACGTCGATGACGCACATTCGCCAAAATTACCCATCGACACCCTCTGCAACCATGCATCGCGCTGGTGCCAACGCTGATCGTTCATATGATGCTAATCTTCTCACAGGAAGCCGCCGAACTTGGTAAGGG Pseudotetraploa_curvi_HC4932 TGTAAGATGCCCCTGTTTACGCAATTTTCTCCGCGCGTCTTGCCCCGCGTTTGTCTCAGGGACAACACAACATTGAGGCATCCATGTTAACTTCGGCGAACAGGTTCACCTTCAGACCGGCCAATGCGTAAGTAAACATCCAGCCGGCTTTTGGGTGCCTTTCTGACAAAACGCAGGGTAACCAAATTGGTGCTGCCTTCTGGCAACAAATCTCAGGCGAGCACGGTCTCGATGGATCCGGAGTGTAAGCACACACAAAGAAATCGCTCTCGTGGATGGAACTAACATGGTACAGCTACAATGGTACTTCCGATCTCCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTACGCGCTGAAGCTTACTGCAATCTCCAGACTGATACTCTATAGGCATCCGGCAACAAGTTCGTCCCCCGCGCCGTCCTCGTCGACTTGGAGCCCGGTACCATGGATGCTGTCCGTGCTGGACCATTTGGACAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTACCGTGGGGCCGCAAGGCCCCCCGAGATAGCACCCTTGTCTTTTGAGCACCACTGTTTCCTCGGCGGGCCCGCCCGCCAATGGGGACCAACCAAACCCTTTTGCAGTCGAAGTAAACGTACAAAACAATATAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATCAAACCCCTCAAGCCCCGCTTGGTGTTGGGCGCTTGTCCCCCGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATTGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCCCAGCGCGCGGGCGACCAGCAAGCACTCGTTTTGACCTCGGATCAGGGAGAAGGTACGCACTTTTCTGCATTCTGGCCGCAGTCGCAATCCAGGGCCTCTCCTTGCGGCAGCCATATTTTTGGCTTATCGCACCGAGGGGCAATTTGGATGGTGGGGTGTGCGGACTTTTTCGCGCTAGCCCGACTCGGCGGCTCGCCAACGTCGATGACGCACATTCGCCAAAATTACCCATCGACAGCCTCTGCAACCATGCATCGCGCTGGTGCCAACGCTGATCGTTCATATGATGCTAATCTTCTCACAGGAAGCCGCCGAACTTGGTAAGGG Pseudotetraploa_curvi_KT2558 TGTAAGATGCCCCTGTTTACGCAATTTTCTCCGCGCGTCTTGCCCCGCGTTTGTCTCAGGGACAACACAACATTGAGGCATCCATGTTAACTTCGGCGAACAGGTTCACCTTCAGACCGGCCAATGCGTAAGTAAACATCCAGCCGGCTTTTGGGTGCCTTTCTGACAAAACGCAGGGTAACCAAATTGGTGCTGCCTTCTGGCAACAAATCTCAGGCGAGCACGGTCTCGATGGATCCGGAGTGTAAGCACACACAAAGAAATCGCTCTCGTGGATGGAACTAACATGGTACAGCTACAATGGTACTTCCGATCTCCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTACGCGCTGAAGCTTACTGCAATCTCCAGACTGATACTCTATAGGCATCCGGCAACAAGTTCGTCCCCCGCGCCGTCCTCGTCGACTTGGAGCCCGGTACCATGGATGCTGTCCGTGCTGGACCATTTGGACAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTACCGTGGGGCCGCAAGGCCCCCCGAGATAGCACCCTTGTCTTTTGAGCACCACTGTTTCCTCGGCGGGCCCGCCCGCCAATGGGGACCAACCAAACCCTTTTGCAGTCGAAGTAAACGTACAAAACAATATAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATCAAACCCCTCAAGCCCCGCTTGGTGTTGGGCGCTTGTCCCCCGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATCGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCCCAGCGCGCGGGCGACCAGCAAGCACTCGTTTTGACCTCGGATCAGGGAGAAGGTACGCACTTTTCTGCATTCTAGCCGCAGTCGCAATCCAGGGCCTCTCCTTGCGGCAGCCATATTTTTGGCTTATCGCACCGAGGGGCAATTTGGATGGTGGGGTGTGCGGACTTTTTCGCGCTAGCCCGACTCGGCGGCTCGCCAACGTCGATGACGCACATTCGCCAAAATTACCCATCGACAGCCTCTGCAACCATGCATCGCGCTGGTGCCAACGCTGATCGTTCATATGATGCTAATCTTCTCACAGGAAGCCGCCGAACTTGGTAAGGG Pseudotetraploa_javanica_HC4934 TGTAAGATGCCCCTGTTTACGCAATTTTCTCCGCGCGTCTTGCCCCGCGTTTGCCTCAGGGACAGCACAACATTGAGGCATCCATGCTAACTTGGGCGAACAGGTTCACCTTCAGACCGGCCAATGCGTAAGTAACCGTCCAGGCAGCTTTTGAGTGCCTTGCTGACAATACTCAGGGTAACCAAATTGGTGCTGCCTTCTGGCAACAAATCTCTGGCGAGCATGGTCTCGATGGATCCGGAGTGTAAGCACCCACAAACAAGTTGCTCTCGTGGGTGGAGTTGACCTGGTATAGCTACAATGGAACCTCCGATCTCCAGCTCGAGCGCATGAATGTCTACTTCAACGAGGTGCGCACTTAGGCTCGCCCCATTCTCCAGACTGACACTCTATAGGCATCTGGCAACAAGTTCGTTCCCCGCGCCGTCCTCGTCGACTTGGAACCCGGTACCATGGATGCTGTCCGTGCTGGACCATTTGGACAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTATCGTGGGGTCGCGAGGCCCCCCGAGATAGCACCCTTGTCTTCTGAGCACCACTGTTTCCTCGGCGGGCCCGCCCGCCAATGGGGACCAACCAAACCCTTCTGCAGTCGAAGTAAACGTACAAAACAATATTATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATCAAAACCCTCAAGCCCGGCTTGGTGTTGGGCGCTTGTCCCCTGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATTGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCCCAGCGCGTGGGCGACCAGCAAGCACTCGTTTTGACCTCGGATCAGGGAGAAGGTACGCACTTCTCTGCATTCTGGTCGCAGCCGCAATCCCGTGCCTCTCGTTGCACCAGCCATATTTTTGGCTTATCGCACTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCCCGACTCGGCAGCTCGCCAACGGCGATGACGCACATTCGCCAAAATTATCCATCGCTAGGCTCCGCAACCATGCATCGCGCTGGCGCTTCGCTGATCGTTCCATATGATGCTAATCTTCTCACAGGAAGCCGCCGAACTTGGTAAGGG Pseudotetraploa_longi_HC4933 TGTAAGATCCCCCTGTTTACGCAATTTTCTCCGCGCGTCTTGCCCCGCGTTTGCCTCAGGGACAACACAACATTAAGACATCCATGCTAACTTTGGCGAATAGGTTCACCTTCAGACCGGCCAATGCGTAAGTATATATCCAGACAGCCTTTGGGTGCATTTCTGACGATACTCAGGGTAACCAAATCGGTGCTGCCTTCTGGCAACAAATCTCTGGCGAGCACGGTCTCGATGGATCTGGAGTGTAAGCATCCACAAACATTATGCTCTTGTGGGCAAAATTGACCTGTCATAGCTACAATGGTACCTCCGATCTCCAGCTAGAGCGCATGAATGTCTACTTCAACGAGGTACGCGACCAGACCCACCGCATTCTCCAGACTGACACTCCATAGGCATCCGGCAACAAGTTCGTACCCCGCGCCGTCCTCGTCGACTTGGAGCCTGGTACCATGGATGCTGTCCGTGCTGGACCATTTGGACAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAATTGGGCCAAGGGTCACTAGAAGGATCATTACCGTGGGGCCTCGCGGCCCCCCGAGATAGCACCCTTGTCTTTTGAGCACCACTGTTTCCTCGGCGGGCCCGCCCGTCAATGGGGACCAACCAAAACCTCCTGCAGTTGAAGTAAACGTACAAAACATCATTATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATACAACCCCTCAAGCACCGCTTGGTGTTGGGCGCTTGTCCCCAGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATCGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCCCCACGCGTTGGCGTCCAGCAAGCATTCGTTTTGACCTCGGATCAGGGAGAAGGTACGCACTTCTCTGCATTCTGGCCGCACTCGAATTCCGGTGCCTCTCCCTGCGGCAGCCATATTTTTGGCTTATCGCACTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCCCGATTCGGCAGCTCGCCAACGGCGATGACGCACATTCGCCAAAATTATCCAACGACAGGTTCCGCAGCCATGCATTGTGCTGGCGCTTCGCTGATCGCTCCATATGATGCTAATCTTCGCATAGGAAGCCGCCGAACTTGGTAAGGG Quadricrura_bicornis_yone153 TGTAAGTATGCCCTGATTACGCATTTTTCTCCGCGCGTCTTGCCCCGCGTTTGCTTCAGGGACAACACAACATTGGAGAACGCCAGCTAACAGACACCAACAGGTCCATCTTCAGACCGGCCAATGCGTAAGAAGCCATCGCCTCGACAGTTTGGCGCAATACTAACCATGCCTAGGGTAACCAAATCGGTGCTGCCTTCTGGCAACAGATCTCGGGCGAGCATGGTCTCGACGGCTCTGGCGTGTAAGATCCTTCCGGTAGCTCGCTCTGGCGCGAAATACTGACTTGGAATAGCTACAATGGCACTTCCGATCTCCAGCTCGAGCGTATGAATGTCTACTTCAACGAGGTATGCGCTCAGACTTGTCGCACCTTGCAAGCTGACACGGCACAGGCATCTGGCAACAAGTTTGTCCCTCGTGCCGTTCTCGTCGATTTGGAGCCGGGTACCATGGATGCTGTCCGTGCTGGACCCTTTGGACAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCCGGTAACAATTGGGCCAAGGGTCACTAGAAGGATCATTATCGTGGGGCCTCACGGCCCCCCGAGATAGCGCCCTTGTCTTCTGAGCACCTCTGTTTCCTCGGCGGGTTCGCCCGCCAATGGGGACCACACAAAACCTCCTGCAGTTGTAGTAAACGTACAAAACGAAATTATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATCTAACCCCTCAAGCACTGCTTGGTGTTGGGCGCTTGTCCCCTGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATTGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCTCGACGCGTGGGCGTCCAGGAAGCACTCATTTTGACCTCGGATCAGGGAGAAGGTACGCACTTTGTTGCATCCCGGCAGCCGTCGTCCGTCCGGTGCCTCCTCTGGCGCAGCCATATTTTTGGCTTATCGCGTTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCCCGACTCGGCTACTCGCCAACCACGATGACGCACATCCGCCAAAATTGCCGGCCGACAGCTCCCTGGACCATGCACGGCATCGGCGCCTCCCTGATGGTTCCGCCAGATGCTAACTCCCTCGCAGGAAGCCGCCGAACTCGGTAAGGG Quadricrura_meridionalis_KT2607 TGTAAGTATGCCCTGATTACGCATTTTTCTCCGCGCGTCTTGCCCCGCGTTTGCTTCAGGGACAACACAACATTGGAGAACGCTAGCTAACAGACACACACAGGTCCATCTCCAGACCGGTCAATGCGTAAGAAATCGTTGCCTCGATTCTTTGGCGCAATACTAACATCGCCCAGGGTAACCAAATCGGTGCTGCTTTCTGGCAACAGATCTCGGGCGAGCATGGTCTCGACGGCTCTGGCGTGTAAGATCTTTTCGATAGCCCACTCCAGCACGCAAGACTGACTTGGGTTAGCTACAATGGCACCTCGGATCTCCAGCTCGAGCGTATGAATGTCTACTTCAATGAGGTATGCGCTGAGACTTGTCGCACCTCGTAAACTGACACGGCACAGGCATCTGGCAACAAGTTTGTCCCACGTGCCGTTCTCGTCGATTTGGAGCCTGGTACTATGGACGCTGTCCGTGCTGGACCCTTTGGACAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAGTCCGGTGCCGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTACCGTGGGGCCTCACGGCCCCCCGAGATAGCACCCTTGTCTCTCAAGCACCTCTGTTTCCTCGGCGGGCTCGCCCGCCAACGGGGACCACACAAAACCTCCTGCAGTTGTAGTAAACGTACAAAACGAAATTATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATCTAACCCCTCAAGCACTGCTTGGTGTTGGGCGCTTGTCCCCCGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATTGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCTCAGCGCGTGGGCGTCCAGGAAGCACTCATTTTGACCTCGGATCAGGGAGAAGGTACGCATTTTCCTGCATCCTGGTGGCGGCCACCCATCCGGTGCTTCCTCTGGCGCAGTCATATTTTCGGCTTATCGCGTTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCCCGATTGGGCTACTCGCCAACCACGATGACGCACATCCGCCAAAATTGCCGGCCGACAGCTCCCTGGAATATGCACGGCATCGGCGCCTCCTTGACTGTTGCGTCAGATGCTAACTCCCTCGCAGGAAGCTGCCGAACTCGGTAAGGG Quadricrura_septentrio_HC4983 TGTAAGTATGCCCCGTTTACGCATTTTTCTCCGCGTCTCCTGCCCCGCGTTTGCCTCAAGGACAACACAACATTGCAGAGCGACAGCTAACAGGCTCAAACAGGTTCATCTTCAGACCGGCCAATGCGTAAGACACCATCCCTACTGCTCGTGGGCGCAACTCTAACAATACCTAGGGTAACCAAATTGGTGCTGCCTTCTGGCAACAGATTTCTGGCGAGCACGGTCTCGACGGCTCTGGCGTGTAGGTTCCTCTGAACAGCTCGCTCCAGCACAGAAAACTAATTCGGCTTAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGTATGAATGTCTACTTCAACGAGGTATGCGCCTGGACCTGTCGGATCTTGCAAACTGACACCTCACAGGCATCTGGCAACAAGTTCGTCCCCCGCGCTGTTCTCGTCGATTTGGAGCCTGGTACCATGGATGCTGTCCGCGCTGGACCATTTGGACAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTATCGTGGGGCCCCACGGCCCCCCGAGATAGCACCCTTGCCTTCTGAGTACCTCTGTTTCCTCGGCGGGTTCGCCCGTCAATGGGGACCACACAAACCCTCTTGCAGTTGTAGTAAACGTATCAAACAAAATTATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATCTAAACCCTCAAGCACTGCTTGGTGTTGGGCGTTTGTCTCCTGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATTGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCTTGACGCGTGGGTGTCCAGGAAGCACTCATTTTGACCTCGGATCAGGGAGAAGGTACGCACTTCCTTGCATCCTGGCAGCCGCCGCACATCTGGCGCTTCCTCTGGCGCGGCCATATTTTTGGCTTATCGCGTTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCCGCACTCGGCTGCTCGCCAACCACGATGACGCACATGCGCCAAAATTGCCGGTGGACAGCTCCCCGGACCATGCACGGCGCCGGCGCCTCGTTGACCGTTCTGGACGATGCTAACCCCCTTGCAGGAAGCTGCCGAACTCGGTAAGGG Quadricrura_septentrio_HC4984 TGTAAGTATGCCCCGTTTACGCATTTTTCTCCGCGTCTCCTGCCCCGCGTTTGCCTCAGGGACAACACAACATTGCAGAGCGACAGCTAACAGGCTCAAACAGGTTCATCTTCAGACCGGCCAATGCGTAAGACACCATCCCTACTGCTCGTGGGCGCAACTCTAACAATACCTAGGGTAACCAAATTGGTGCTGCCTTCTGGCAACAGATTTCTGGCGAGCACGGTCTCGACGGCTCTGGCGTGTAGGTTCCTCTGAACAGCTCGCTCCAGCACAGAAAACTAATTCGGCTTAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGTATGAATGTCTACTTCAACGAGGTATGCGCCTGGACCTGTCGGATCTTGCAAACTGACACCTCACAGGCATCTGGCAACAAGTTCGTCCCCCGCGCTGTTCTCGTCGATTTGGAGCCTGGTACCATGGATGCTGTCCGCGCTGGACCATTTGGACAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTATCGTGGGGCCCCACGGCCCCCCGAGATAGCACCCTTGCCTTCTGAGTACCTCTGTTTCCTCGGCGGGTTCGCCCGTCAATGGGGACCACACAAACCCTCTTGCAGTTGTAGTAAACGTATCAAACAACATTATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATCTAAACCCTCAAGCACTGCTTGGTGTTGGGCGTTTGTCTCCTGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATTGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCTTGACGCGTGGGTGTCCAGGAAGCACTCATTTTGACCTCGGATCAGGGAGAAGGTACGCACTTCCTTGCATCCTGGCAGCCGCCGCACATCTGGCGCTTCCTCTGGCGCGGCCATATTTTTGGCTTATCGCGTTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCCGCACTCGGCTGCTCGCCAACCACGATGACGCACATGCGCCAAAATTGCCGGTGGACAGCTCCCCGGACCATGCACGGCGCCGGCGCCTCGTTGACCGTTCTGGACGATGCTAACCCCCTTGCAGGAAGCTGCCGAACTCGGTAAGGG Quadricrura_septentrio_KT920 TGTAAGTATGCCCCGTTTACGCATTTTTCTCCGCGTCTCCTGCCCCGCGTTTGCCTCAGGGACAACACAACATTGCAGAGCGACAGCTAACAGGCTCAAACAGGTTCATCTTCAGACCGGCCAATGCGTAAGACACCATCCCTACTGCTCGTGGGCGCAACTCTAACAATACCTAGGGTAACCAAATTGGTGCTGCCTTCTGGCAACAGATTTCTGGCGAGCACGGTCTCGACGGCTCTGGCGTGTAGGTTCCTCTGAACAGCTCGCTCCAGCACAGAAAACTAATTCGGCTTAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGTATGAATGTCTACTTCAACGAGGTATGCGCCTGGACCTGTCGGATCTTGCAAACTGACACCTCACAGGCATCTGGCAACAAGTTCGTCCCCCGCGCTGTTCTCGTCGATTTGGAGCCTGGTACCATGGATGCTGTCCGCGCTGGACCATTTGGACAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTATCGTGGGGCCCCACGGCCCCCCGAGATAGCACCCTTGCCTTCTGAGTACCTCTGTTTCCTCGGCGGGTTCGCCCGTCAATGGGGACCACACAAACCCTCTTGCAGTTGTAGTAAACGTATCAAACAAAATTATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATCTAAACCCTCAAGCACTGCTTGGTGTTGGGCGTTTGTCTCCTGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATTGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCTTGACGCGTGGGTGTCCAGGAAGCACTCATTTTGACCTCGGATCAGGGAGAAGGTACGCACTTCCTTGCATCCTGGCAGCCGCCGCACATCTGGCGCTTCCTCTGGCGCGGCCATATTTTTGGCTTATCGCGTTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCCGCACTCGGCTGCTCGCCAACCACGATGACGCACATGCGCCAAAATTGCCGGTGGACAGCTCCCCGGACCATGCACGGCGCCGGCGCCTCGTTGACCGTTCTGGACGATGCTAACCCCCTTGCAGGAAGCTGCCGAACTCGGTAAGGG Quadricrura_septentrio_yone176 TGTAAGTATGCCCCGTTTACGCATTTTTCTCCGCGTCTCCTGCCCCGCGTTTGCCTCAGGGACAACACAACATTGCAGAGCGACAGCTAACAGGCTCAAACAGGTTCATCTTCAGACCGGCCAATGCGTAAGACACCATCCCTACTGCTCGTGGGCGCAACTCTAACAATACCTAGGGTAACCAAATTGGTGCTGCCTTCTGGCAACAGATTTCTGGCGAGCACGGTCTCGACGGCTCTGGCGTGTAGGTTCCTCTGAACAGCTCGCTCCAGCACAGAAAACTAATTCGGCTTAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGTATGAATGTCTACTTCAACGAGGTATGCGCCTGGACCTGTCGGATCTTGCAAACTGACACCTCACAGGCATCTGGCAACAAGTTCGTCCCCCGCGCTGTTCTCGTCGATTTGGAGCCTGGTACCATGGATGCTGTCCGCGCTGGACCATTTGGACAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTATCGTGGGGCCCCACGGCCCCCCGAGATAGCACCCTTGCCTTCTGAGTACCTCTGTTTCCTCGGCGGGTTCGCCCGTCAATGGGGACCACACAAACCCTCTTGCAGTTGTAGTAAACGTATCAAACAAAATTATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATCTAAACCCTCAAGCACTGCTTGGTGTTGGGCGTTTGTCTCCTGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATTGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCTTGACGCGTGGGTGTCCAGGAAGCACTCATTTTGACCTCGGATCAGGGAGAAGGTACGCACTTCCTTGCATCCTGGTAGCCGCCGCACATCTGGCGCTTCCTCTGGCGCGGCCATATTTTTGGCTTATCGCGTTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCCGCACTCGGCTGCTCGCCAACCACGATGACGCACATGCGCCAAAATTGCCGGTGGACAGCTCCCCGGACCATGCACGGCGCCGGCGCCTCGTTGACCGTTCTGGACGATGCTAACCCCCTTGCAGGAAGCTGCCGAACTCGGTAAGGG Quadricrura_septentrio_yone179 TGTAAGTATGCCCCGTTTACGCATTTTTCTCCGCGTCTCCTGCCCCGCGTTTGCCTCAGGGACAACACAACATTGCAGAGCGACAGCTAACAGGCTCAAACAGGTTCATCTTCAGACCGGCCAATGCGTAAGACACCATCCCTACTGCTCGTGGGCGCAACTCTAACAATACCTAGGGTAACCAAATTGGTGCTGCCTTCTGGCAACAGATTTCTGGCGAGCACGGTCTCGACGGCTCTGGCGTGTAGGTTCCTCTGAACAGCTCGCTCCAGCACAGAAAACTAATTCGGCTTAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGTATGAATGTCTACTTCAACGAGGTATGCGCCTGGACCTGTCGGATCTTGCAAACTGACACCTCACAGGCATCTGGCAACAAGTTCGTCCCCCGCGCTGTTCTCGTCGATTTGGAGCCTGGTACCATGGATGCTGTCCGCGCTGGACCATTTGGACAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTATCGTGGGGCCCCACGGCCCCCCGAGATAGCACCCTTGCCTTCTGAGTACCTCTGTTTCCTCGGCGGGTTCGCCCGTCAATGGGGACCACACAAACCCTCTTGCAGTTGTAGTAAACGTATCAAACAAAATTATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATCTAAACCCTCAAGCACTGCTTGGTGTTGGGCGTTTGTCTCCTGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATTGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCTTGACGCGTGGGTGTCCAGGAAGCACTCATTTTGACCTCGGATCAGGGAGAAGGTACGCACTTCCTTGCATCCTGGTAGCCGCCGCACATCTGGCGCTTCCTCTGGCGCGGCCATATTTTTGGCTTATCGCGTTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCCGCACTCGGCTGCTCGCCAACCACGATGACGCACATGCGCCAAAATTGCCGGTGGACAGCTCCCCGGACCATGCACGGCGCCGGCGCCTCGTTGACCGTTCTGGACGATGCTAACCCCCTTGCAGGAAGCTGCCGAACTCGGTAAGGG Quadricrura_septentrio_yone44 TGTAAGTATGCCCCGTTTACGCATTTTTCTCCGCGTCTCCTGCCCCGCGTTTGCCTCAGGGACAACACAACATTGCAGAGCGACAGCTAACAGGCTCAAACAGGTTCATCTTCAGACCGGCCAATGCGTAAGATACCATCCCTACTGCTCGTGGGCGCAACTCTAACAATACCTAGGGTAACCAAATTGGTGCTGCCTTCTGGCAACAGATTTCTGGCGAGCACGGTCTCGACGGCTCTGGCGTGTAGGTTCCTCTGAACAGCTCGCTCCAGCACAGAAAACTAATTCGGCTTAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGTATGAATGTCTACTTCAACGAGGTATGCGCCTGGACCTGTCGGATCTTGCAAACTGACACCTCACAGGCATCTGGCAACAAGTTCGTCCCCCGCGCTGTTCTCGTCGATTTGGAGCCTGGTACCATGGATGCTGTCCGCGCTGGACCATTTGGACAGCTCTTCCGTCCCGACAACTTCGTCTTTGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTATCGTGGGGCCCCACGGCCCCCCGAGATAGCACCCTTGCCTTCTGAGTACCTCTGTTTCCTCGGCGGGTTCGCCCGTCAATGGGGACCACACAAACCCTCTTGCAGTTGTAGTAAACGTATCAAACAAAATTATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATCTAAACCCTCAAGCACTGCTTGGTGTTGGGCGTTTGTCTCCTGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATTGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCTTGACGCGTGGGTGTCCAGGAAGCACTCATTTTGACCTCGGATCAGGGAGAAGGTACGCACTTCCTTGCATCCTGGTAGCCGCCGCACATCTGGCGCTTCCTCTGGCGCGGCCATATTTTTGGCTTATCGCGTTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCCGCACTCGGCTGCTCGCCAACCACGATGACGCACATGCGCCAAAATTGCCGGTGGACAGCTCCCCGGACCATGCACGGCGCCGGCGCCTCGTTGACCGTTCTGGACGATGCTAACCCCCTTGCAGGAAGCTGCCGAACTCGGTAAGGG Tetraploa_aristata_CBS996_70 TGTAAGGTACCCCTGTTTACGCATTTTTCTCTGCGCGTCTTGCCCCGCGTTTGCCTCAGGGACAACACAACATCGGACCACCCATGCTAACAGCTTGCAATAGGTTCACCTCCAGACCGGCCAATGCGTAAGTACTGCCCAACTCAGCTTTTGGACGCAGTTCTGACAAAGTTCAGGGTAACCAAATTGGTGCTGCCTTCTGGCAAACTATCTCCGGCGAGCACGGTCTCGATGGCTCTGGAGTGTAAGTAACCTTGCATAATGTATTTCATTGCAATGTACTAACTCGGCTTAGCTACAATGGTACCTCCGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACGACACCCGAACCCACGCTTTCTTCAAACTCACAGAATGTAGGGAGCCGGCAACAAGTATGTTCCTCGCGCCGTCCTTGTCGACTTGGAGCCCGGTACCATGGATGCTGTCCGTGCTGGACCATTTGGACAGCTCTTCCGTCCCGACAACTTCGTTTTCGGCCAGTCTGGTGCCGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTACTGTCAGGCCCCCCGGCCCTCAGAGATAGCACCCCTGTCTTTCGAGCACCACCGTTTCCTCGGCGGGCCCGCCCGCCAACGGGGACCAAACAAACCTTACCGCAGTTGCAGTAACCGTACAAAACCAAAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATATCAACCCTCAAGCACCGCTTGGTGTTGGGCGCTTGTCCCCGGGACTCGCCCCGAATCCATTGGCAGCCACCGCACCGGGCACGAGCGCAGCAGATTCGCGCCTCGGGCAAGGAGCGTGGGCGACCACTGAGCAACCATTTTGACCTCGGATCAGGGAGAAGGTACGCACTCTCCTTCGCTCTGGCATGAGGCGCCCGTCCAGCGCTTCCTCTGGCATAGCCATATTTTTGGCTTATCGCACTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCCCCATTCGGCTGTTCGCCAACCACTATGACGCACATTCGCCAAAATTGCCCGTCGACGGCGTCTGCAGTCACGCGTGGCGCCGGCGTCTCGCCGTTGTTTCCATTCGATGCTAACTCTCCCACAGGAAGCCGCCGAACTCGGTAAGGG Tetraplosphaeria_nagasaki_KT1682 TGTAAGATCCCCCTGTTTACGCAATTTTCTCCACGCGTCTTGCCCCGCGTTTGCCTCAGGGACAACACAACATTGGAGCACACATGCTAACACCTGCGAACAGGTTCACCTTCAGACCGGCCAATGCGTAAGTTACCTCTCGCTCTGTTTCTGAAAGCAACACTGACAACGTGCAGGGTAACCAAATCGGTGCTGCCTTCTGGCAAACCATTTCTCGCGAGCACGGTCTCGATGGATCCGGAGTGTCAGTATCCTCCACCAATTCCTCTCGGTACCCAGGGCTAACCTGACTCAGCTACAATGGCACCTCCGATCTCCAGCTCGAGCGCATGAACGTTTATTTCAACGAGGTACGGACCCGACACCCGAGGGTCTTCTTGACTGACACAGCGCAGGCATCTGGCAACAAGTTCGTTCCCCGCGCCGTCCTAGTCGATTTGGAGCCAGGTACTATGGATGCTGTCCGTGCTGGTCCATTTGGACAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCCGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTAACGTGGGGCCCCTTGGCCCCCCGAGATTAGAACCCTGATTTTTGAGCACCACAGTTTCCTCGGCGGGCACGCCCGCCAACGGGGACCAAAAGAAACCCACCGCAGTCGTAGTAAACGTACTAAACAAAACAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATTAAACCCCCCTGGCACTGCCTGGTATTGGGCGCCTGTCCCCGGGACTCGCCTCGAATCCATTGGCGGCCGCCGCGTCGGGCACGAGCGCAGCAGAAGCGCGCATCGGCCCCGCCGCGACGGCGACCAGCGAGAACGCTCTTTGACCTCGGATCAGGGAGAAGGTACGTGCTTCTCTGAGATTCAGTTTCCACTGCCATTCAATATCCTTCTTCGCAGCAGCCAAATTTTCGGCTTATCGCGTTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCTGGTTTTGGCCCCTCGCCAACGGCTATGACGCACAGTCCCCAAAATTGCCCCTCGATAGCCTCTGCAGCAATGCAGCGCGCCGGCGTCTCGCAGGACGTTTCATACGATGCTTACTTCTTCATAGGAAGCCGCCGAACTCGGTAAGGG Tetraplosphaeria_sasicola_KT563 TGTAAGACCCCCCTGTTTACGCAATTTTCTGCGCGCGTCTTGCCCCGCGTTTGCCTCAGGGACAACACAACAGTGGAGCACGCATGCTAACATCTGCAACTAGGTCCACCTCCAGACCGGCCAATGCGTAAGTACAGTCTTTCTCAGCTTTTGAACCCAATTCTGACAAAGTCTAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGATGGTTCCGGAGTGTAAGGAACCCTCGACCTTCAATCTCTGTGCAATCGACTAACTCGGCTTAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAGCGTCTACTTCAATGAGGTACGGCACCAAAACTTCCACTTTCTGCACGCTCACAATGTATAGGCTTCCGGCAACAAGTTCGTTCCCCGCGCCGTCCTCGTCGACTTGGAGCCCGGTACCATGGATGCTGTCCGTGCTGGTCCATTTGGACAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCTGGTGCCGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTACCGTGGGGCCCCCCGGCCCCCCGAGATAGCACCCCTGTCTTTCGAGCACCACCGTTTCCTCGGCGGGCACGCCCGCCAACGGGGACCAAACAAACCCTACCGCAGTTGAAGTAAACGTATCAAAACAAAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATAAAACCCCTCAAGCGTAGCTTGTTGTTGGGCGTTTGTCCTCCGGACTCGCCCCGAATCCATTGGCGGCCCCCGCATTGGGCTCGAGCGCAGCAGATTTGCGCATCGGGCACAGCGCGTGGGCGACCATTGAGCAACCACTTTGACCTCGGATCAGGGAGAAGGTACGCACTCTCCTTCACTCTGGCAGTGGTCGCCCATCCGGTGCTCCCTTCGCGACAGCCATATTTTTGGCTTATCGCATTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCACGCTAGCCTACTTCGGCCGTTCGCCAACCACTATGACGCACATTCGCCAAAATTGCCGGTCAACAGCGTCTGCAGTCACGCATTGCGCCGGCGTCTTGCCGTTGTTTTCGTTCGATACTGACTCCGCCACAGGAAGCCGCCGAACTCGGTAAGGG Tetraplosphaeria_yakushi_KT1906 TGTAAGACGCCCCTGTTTACGCATTTTTCTCCGCGCGTTTTGCCCCGCGTTTGCCTCAGGGACAACACAACATCGGACCACACATGCTAATAGCTCGCAATAGGTTCACCTCCAGACCGGTCAATGCGTAAGTACACCCCTCTGAAGCTTTTGGACGCTGTTCTGACAAAGTCTAGGGTAACCAAATTGGTGCTGCCTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGATGGCTCTGGAGTGTAAGGAATCCTGAATCATCTGTTCCATGGCAATGTACTAACTGGGCTTAGCTACAATGGTACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTATGGACTCTTTACCCCCGCTTACTATAAGCTCACAACATTCAGGGAGCTGGCAACAAATATGTTCCTCGCGCCGTCCTCGTCGACTTGGAGCCTGGTACCATGGATGCTGTCCGTGCTGGACCATTTGGACAGCTCTTCCGTCCCGACAACTTCGTTTTCGGCCAGTCTGGTGCCGGTAACAATTGGGCCAAGGGTCACTAGAAGGATCATTACAGTGGGGCCCCCCGGCCCCCCGAGATAGCACCCCTGTCTTTCGAGCACCAACGTTTCCTCGGCGGGCCCGCCCGCCAACGGGGACCACACAAACCTTACCGCAGTTGCAGTAACCGTATACAACAAAAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATAACAACCCTCAAGCGCAGCTTGGTGTTGGGCGTTTGTCCCCGGGACTCGCCCCGAATCCATTGGCAGCCCCCCCACCGGGCACGAGCGCAGCAGATTTGCGCCTCGGGCACGGTGAGCGGGCGACCACAGAGCCACCACTTTGACCTCGGATCAGGGAGAAGGTACGCACTCTTTTTCACTCCGGCATGAGTCGCCCGTCCGGCGCTTCCTCTGGCATAGCCATATTTTTGGCTTATCGCACTGAGGGGCAATTTGGATGGTGGGGTGTGCGAACTTTTTCGCGCTAGCCCCATGCGGCTGTTCGCCAACCACTATGACGCACATTCGCCAAAATTGCCCGTCGACGGCATCTGCATTCACGCATAGCGCCGGCGTCTCGCCGCTCTTTCCATTCGATGCTAACTCTCCCACAGGAAGCCGCCGAACTCGGTAAGGG Triplosphaeria_acuta_KT1170 TGTAAGTATCGCCTGTTTACGCAATTTTCTCCGCGCGTCTTGCCCCGCGTTTGGCTCAGGGACAACACAACATTGGAGAACGCAGGCTAACAGGCACACACAGGTCCACCTTCAGACTGGCCAATGCGTAAGAAACCACCTGCTCCAATCCTAACTGCAATCCTAACATTACTCAGGGTAACCAAATCGGTGCTGCCTTCTGGCAACAGATCTCTGGCGAGCACGGTCTCGACGGCTCTGGAGTGTAAGATCTCCTAAACTGCGTCGCTCAGCACGGAAGACTGACTTGGCTTAGCTACAATGGCACCTCTGATCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTACGCGCTTACCCCCATCCCATCTGGCACACTGACACTGCGCAGGCGTCTGGCAACAAGTTCGTTCCCCGTGCAGTTCTCGTCGACTTGGAACCCGGTACCATGGATGCTGTCCGCGCTGGGCCGTTTGGACAGCTCTTCCGCCCCGACAACTTTGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGTCACTAGAAGGATCATTACCGTGGGGCCTCGCGGCCCCCCGAGGTAGCACCCTTGTCTATTGAGCACCTCTGTTTCCTCGGCGGGCCCGCCCGTCAATGGGGACCACATAAAACCCCATGCAGTTGTAGTAAACGTACCAATCGAAATTATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATTAAACCCCTCAAGCACCGCTTGGTGTTGGGCGCTTGTCCCCCGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATTGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGTCCACCGCGGCGGCGTCCAGGAAGCACTCTTTTTGACCTCGGATCAGGGAGAAGGTATGCACTTCTCTGCATTCTGGCCGCGTTCGCTCATCCGGGGCTTCCTTTGGCGCCGCCATATTTTTGGCTTATCGCACTGAGGGGCAATTTGGATGGTGGGGTGTGCGGACTTTTTCGCGCTAGCCCGACTTGGCGACTCGCCAACGGCGATGACGCACATCCGCCAAAATTGCCCATCGACAGCGCCCGGAACCATGCATCGCGCCAGCGCCTCGTTGAATGTGTCGTACGATGCTGATTTTATCACAGGAAGCCGCCGAACTCGGTAAGGG Triplosphaeria_cylindrica_KT1800 TGTAAGTATCGCCTGTTTACGCAATTTTCTCCGCGCGTCTTGCCCCGCGTTTGGCTCAGGGACAACACAACATTGGAGAACGCAGGCTAACTGGCACACACAGGTCCACCTTCAGACTGGCCAATGCGTAAGAAACCACCTGCTCCAGTCTCCACTGCAATCCTAACATTACTCAGGGTAACCAAATCGGTGCTGCCTTCTGGCAACAGATCTCTGGCGAGCACGGTCTCGACGGCTCTGGAGTGTAAGATCTCCTAAATTGCGTCGCTCAGCACGGAAGACTGACTTGACCTAGCTACAATGGCACCTCCGATCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTACGCGCTTACCCCCATCCCATCTGGCACACTGACACTGCGCAGGCGTCTGGCAACAAGTTCGTTCCCCGTGCAGTTCTCGTCGATCTGGAACCCGGTACCATGGATGCTGTCCGCGCTGGGCCGTTTGGACAGCTCTTCCGCCCCGACAACTTTGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGTCACTAGAAGGATCATTACCGTGGGGCCTCGCGGCCCCCCGAGATAGCACCCTTGTCTATTGAGCACCTCTGTTTCCTCGGCGGGCCCGCCCGTCAATGGGGACCACACAAAACCCCATGCAGTTGTAGTAAACGTACCAATAGAAATTATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATTAAACCCCTCAAGCACCGCTTGGTGTTGGGCGCTTGTCCCCCGGACTCGCCTTGAATCCATTGGCGGCCTCCGTATTGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCCCACCGCGGCGGCGTCCAGGAAGCACTCTTTTTGACCTCGGATCAGGGAGAAGGTATGCACTTTTCTGCATTCTGACCGCGTTCGCCCATCCGGGGCTTCCTCTGGCGCCGCCATATTTTTGGCTTATCGCACTGAGGGGCAATTTACATGGTGGGGTGTGCGGACTTTTTCGCGCTAGCCCGACTTGGCGGCTCGCCAACGGCGATGACGCACATCCGCCAAAATTGCCTATCGACAGCGCCCGCAACCATGCATCGCGCCAGCGCCTCGTCGAACGTGCCGCACGATGCTAATGTTCTCACAGGAAGCCGCCGAACTCGGTAAGGG Triplosphaeria_cylindrica_KT2550 TGTAAGTATCGCCTGTTTACGCAATTTTCTCCGCGCGTCTTGCCCCGCGTTTGGCTCAGGGACAACACAACATTGGAGAACGCAGGCTAACTGGCACACACAGGTCCACCTTCAGACTGGCCAATGCGTAAGAAACCACCTGCTCCAGTCTCCACTGCAATCCTAACATTACTCAGGGTAACCAAATCGGTGCTGCCTTCTGGCAACAGATCTCTGGCGAGCACGGTCTCGACGGCTCTGGAGTGTAAGATCTCCTAAATTGCGTCGCTCAGCACGGAAGACTGACTTGGCCTAGCTACAATGGCACCTCCGATCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTACGCGCTTACCCCCATCCCATCTGGCACACTGACACTGCGCAGGCGTCTGGCAACAAGTTCGTTCCCCGTGCAGTTCTCGTCGATCTGGAACCCGGTACCATGGATGCTGTCCGCGCTGGGCCGTTTGGACAGCTCTTCCGCCCCGACAACTTTGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGTCACTAGAAGGATCATTACCGTGGGGCCTCGCGGCCCCCCGAGATAGCACCCTTGTCTATTGAGCACCTCTGTTTCCTCGGCGGGCCCGCCCGTCAATGGGGACCACACAAAACCCCATGCAGTTGTAGTAAACGTACCAATAGAAATTATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATTAAACCCCTCAAGCACCGCTTGGTGTTGGGCGCTTGTCCCCCGGACTCGCCTTGAATCCATTGGCGGCCTCCGTATTGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCCCACCGCGGCGGCGTCCAGGAAGCACTCTTTTTGACCTCGGATCAGGGAGAAGGTATGCACTTTTCTGCATTCTGACCGCGTTCGCCCATCCGGGGCTTCCTCTGGCGCCGCCATATTTTTGGCTTATCGCACTGAGGGGCAATTTACATGGTGGGGTGTGCGGACTTTTTCGCGCTAGCCCGACTTGGCGGCTCGCCAACGGCGATGACGCACATCCGCCAAAATTGCCTATCGACAGCGCCCGCAACCATGCATCGCGCCAGCGCCTCGTCGAACGTGCCGCACGATGCTAATGTTCTCACAGGAAGCCGCCGAACTCGGTAAGGG Triplosphaeria_maxima_KT870 TGTAAGTATCCCCTGTTTACGCAATTTTCTCCGCGCGTCTTGCCCCGCGTTTCGCTCAGGGACAACACAACATTCGAGAGCGCAAGCTAACAGACACACACAGGTCCACCTTCAGACCGGCCAATGCGTAAGAAACCACCTGCTCAACTCTGAAGCGCAATTCTAACAGTACTAAGGGTAACCAAATTGGTGCTGCCTTCTGGCAACAGATCTCCGGCGAGCACGGTCTCGACGGCTCTGGAGTGTAAAATCTCCCTAATCGCTCGCTCCATCACGAAAGACTGACTTGGCTTAGCTACAATGGCACCTCCGATCTCCAGCTCGAGCGTATGAATGTCTACTTCAACGAGGTACGCGCTTACGCCTTTCACATGTTGCACGCTCACACCGCACAGGCATCTGGCAACAAGTTCGTTCCCCGTGCCGTTCTCGTCGATTTGGAGCCTGGTACCATGGATGCCGTCCGCGCTGGACCGTTTGGACTGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAGAAGGATCATTACCGTGGGGCCTCACAGCCCCCCGAGATAGCACCCTTGTCTTCTGAGCACCTCTGTTTCCTCGGCGGGTCCGCCCGCCAACGGGGACCACACAAAACCTCCTGCAGTTGTAGTAAACGTACCAAGCAAAATTATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATCCAACCCCTCAAGCACCGCTTGGTGTTGGGCGCTTGTCCCCTGGACTCGCCCCGAATCCATTGGCGGCCTCCGTATTGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCCCACCGCGTTGGCGTCCAGGAAGCACTCACTTTGACCTCGGATCAGGGAGAAGGTATGCATTTCTGCATTTTCTGGCCGCGTTCGCCCATCCGGCGCTTCCTCTGGCGCAGCCATATTTTTGGCTTATCGCATTGAGGGGCAATTTGCATGGTGGGGTGTGCGGACTTTTTTGCGCTAGCCCGATTCGGCGACTCGCCAACCGCGATGACGCACATCCGCCAAAATTGCCTATTCACAGCTTCCGCAACCATGCGTCGCGCCAGCGCCACGTCAATCGTCCCGAACGATGCTGACTCCATCACAGGAAGCCGCTGAGCTGGGTAAGGG Triplosphaeria_sp_HC4665 TGTAAGTCCCCCCTGTTTACGCACTTTTCTCCGCGCGTCTTGCCCCGCGTTTCGCTCAGGGACAACACAACATTGGAGAACGCAAGCTGACAGCCACAAACAGGTCCACCTTCAGACCGGCCAATGCGTAAGAATCCATCTGCTTCAACTCTAGGCGCAATCCTAACAATACCCAGGGTAACCAAATTGGTGCTGCCTTCTGGCAGCAGATCTCTGGCGAGCACGGTCTCGATGGCTCTGGAGTGTGAGTTCTCTTCAATCGGTCGCTCTAGCACGAAAGACTGACTTGGCTTAGCTACACTGGTACCTCCGATCTCCAGCTTGAGCGTATGAATGTCTACTTCAACGAGGTACGCGCTTACCCCCATCGCATCTTGCACGCTAACATTGCACAGGCATCTGGCAACAAGTTCGTTCCCCGTGCAGTTCTCGTCGACTTGGAGCCCGGTACTATGGATGCTGTCCGCGCTGGACCGTTTGGACAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGTCACTAGAAGGATCATTACCGTGGGGCCTCGCGGCCCCCCGAGATAGCACCCTTGTCTTTAGAGCACCTCTGTTTCCTCGGCGGGCCCGCCCGCCAATGGGGACCACACAAAACCTCCTGCAGTTGTAGTAAACGTAACAAGCAAAATTATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATCTAACCCCTCAAGCACTGCTTGGTGTTGGGCGCTTGTCCCCCGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATCGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCCCGGAGCGTGGGTGTCCAGGAAGCACTCATTTTGACCTCGGATCAGGGAGAAGGTATGCACTTCTCTGCATTCTGGCCGCGTTCGCCCATCCGGCGCTTCCTCTGGCGCCGCCATATTTTTGGCTTATCGCACTGAGGGGCAATTTGCATGGTGGGGTGTGCGGACTTTTTCGCGCTAGCCCGACTTGGCCACTCGCCAACGGCGATGACGCACATCCGCCAAAATTGCCCGTCGACAGCTTCCGCAACCACGCATCGCGCCAGTGCCTTGCCGATCGTGCCACACGATGCTAACTTCCTCACAGGAAGCAGCAGAGCTTGGTAAGGG Triplosphaeria_sp_KT2546 TGTAAGTCCCCCCTGTTTACGCACTTTTCTCCGCGCGTCTTGCCCCGCGTTTCGCTCAGGGACAACACAACATTGGAGAACGCAAGCTGACAGCCACAAACAGGTCCACCTTCAGACCGGCCAATGCGTAAGAATCCATCTGCTTCAACTCTAGGCGCAATCCTAACAATACCCAGGGTAACCAAATTGGTGCTGCCTTCTGGCAGCAGATCTCTGGCGAGCACGGTCTCGATGGCTCTGGAGTGTGAGTTCTCTTCAATCGGTCGCTCTAGCACGAAAGACTGACTTGGCTTAGCTACACTGGTACCTCCGATCTCCAGCTTGAGCGTATGAATGTCTACTTCAACGAGGTACGCGCTTACCCCCATCGCATCTTGCACGCTAACATTGCACAGGCATCTGGCAACAAGTTCGTTCCCCGTGCAGTTCTCGTCGACTTGGAGCCCGGTACTATGGATGCTGTCCGCGCTGGACCGTTTGGACAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGTCACTAGAAGGATCATTACCGTGGGGCCTCGCGGCCCCCCGAGATAGCACCCCTGTCTTTAGAGCACCTCTGTTTCCTCGGCGGGCCCGCCCGCCAATGGGGACCACACAAAACCTCCTGCAGTTGTAGTAAACGTAACAAGCAAAATTATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATCTAACCCCTCAAGCACTGCTTGGTGTTGGGCGCTTGTCCCCCGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATCGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCCCGGAGCGTGGGTGTCCAGGAAGCACTCATTTTGACCTCGGATCAGGGAGAAGGTATGCACTTCTCTGCATTCTGGCCGCGTTCGCCCATCCGGCGCTTCCTCTGGCGCCGCCATATTTTTGGCTTATCGCACTGAGGGGCAATTTGCATGGTGGGGTGTGCGGACTTTTTCGCGCTAGCCCGACTTGGCCACTCGCCAACCGCGATGACGCACATCCGCCAAAATTGCCCGTCGACAGCTTCCGCAACCACGCATCGCGCCAGTGCCTTGCCGATCGTGCCACACGATGCTAACTTCCTCACAGGAAGCAGCAGAGCTTGGTAAGGG Triplosphaeria_yezoensis_KT1715 TGTAAGTATCGCCTGTTTACGCAATTTTCTCCGCGCGTCTTGCCCCGCGTTTGGCTCAGGGACAACACAACATTGGAGAACGCAGGCTAACAGGCACACACAGGTCCACCTTCAGACTGGCCAATGCGTAAGAAACCACCTGCTCCAATCCTAACTGCAATCCTAACATTACTCAGGGTAACCAAATCGGTGCTGCCTTCTGGCAACAGATCTCTGGCGAGCACGGTCTCGACGGCTCTGGAGTGTAAGATCTCCTAAACTGCGTCGCTCAGCACGGAAGACTGACTTGGCCTAGCTACAATGGCACCTCTGATCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTACGCGCTTACCCCCATCCCATCTGGCACACTGACACTGCGCAGGCGTCTGGCAACAAGTTCGTTCCCCGTGCAGTTCTCGTCGACTTGGAACCCGGTACCATGGATGCTGTCCGCGCTGGGCCGTTTGGACAGCTCTTCCGCCCCGACAACTTTGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGTCACTAGAAGGATCATTACCGTGGGGCCTCGCGGCCCCCCGAGGTAGCACCCTTGTCTATTGAGCACCTCTGTTTCCTCGGCGGGCCCGCCCGTCAATGGGGACCACACAAAACCCCATGCAGTTGTAGTAAACGTACCAATCGAAATTATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATTAAACCCCTCAAGCACCGCTTGGTGTTGGGCGCTTGTCCCCCGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATTGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCCCACCGCGGCGGCGTCCAGGAAGCACTCTTTTTGACCTCGGATCAGGGAGAAGGTATGCACTTCTCTGCATTCTGGCCGCGTTCGCTCATCCGGGGCTTCCTTTGGCGCCGCCATATTTTTGGCTTATCGCACTGAGGGGCAATTTACATGGTGGGGTGTGCGGACTTTTTCGCGCTAGCCCGACTTGGCGACTCGCCAACGGCGATGACGCACATCCGCCAAAATTGCCTGTCGACAGCGCCCGCAACCATGCATCGCGCCAGCGCCTCGTCGAATGTGCCGCACGATGCTAACTTTCTCACAGGAAGCCGCCGAACTCGGTAAGGG Triplosphaeria_yezoensis_KT1732 TGTAAGTATCGCCTGTTTACGCAATTTTCTCCGCGCGTCTTGCCCCGCGTTTGGCTCAGGGACAACACAACATTGGAGAACGCAGGCTAACAGGCACACACAGGTCCACCTTCAGACTGGCCAATGCGTAAGAAACCACCTGCTCCAATCCTAACTGCAATCCTAACATTACTCAGGGTAACCAAATCGGTGCTGCCTTCTGGCAACAGATCTCTGGCGAGCACGGTCTCGACGGCTCTGGAGTGTAAGATCTCCTAAACTGCGTCGCTCAGCACGGAAGACTGACTTGGCCTAGCTACAATGGCACCTCTGATCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTACGCGCTTACCCCCATCCCATCTGGCACACTGACACTGCGCAGGCGTCTGGCAACAAGTTCGTTCCCCGTGCAGTTCTCGTCGACTTGGAACCCGGTACCATGGATGCTGTCCGCGCTGGGCCGTTTGGACAGCTCTTCCGCCCCGACAACTTTGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGTCACTAGAAGGATCATTACCGTGGGGCCTCGCGGCCCCCCGAGGTAGCACCCTTGTCTATTGAGCACCTCTGTTTCCTCGGCGGGCCCGCCCGTCAATGGGGACCACACAAAACCCCATGCAGTTGTAGTAAACGTACCAATCGAAATTATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATTAAACCCCTCAAGCACCGCTTGGTGTTGGGCGCTTGTCCCCCGGACTCGCCTCGAATCCATTGGCGGCCTCCGTATTGGGCTCGAGCGCAGCAGACCAGCGCCTCGGGCCCACCGCGGCGGCGTCCAGGAAGCACTCTTTTTGACCTCGGATCAGGGAGAAGGTATGCACTTCTCTGCATTCTGGCCGCGTTCGCTCATCCGGGGCTTCCTTTGGCGCCGCCATATTTTTGGCTTATCGCACTGAGGGGCAATTTACATGGTGGGGTGTGCGGACTTTTTCGCGCTAGCCCGACTTGGCGACTCGCCAACGGCGATGACGCACATCCGCCAAAATTGCCTGTCGACAGCGCCCGCAACCATGCATCGCGCCAGCGCCTCGTCGAATGTGCCGCACGATGCTAACTTTCTCACAGGAAGCCGCCGAACTCGGTAAGGG ; END; BEGIN SETS; CHARSET bt (CHARACTERS = family) = 1-553; CHARSET tef (CHARACTERS = family) = 1013-1293; CHARSET its (CHARACTERS = family) = 554-1012; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = family) = N: 1-1293; CODONPOSSET CodonPositions (CHARACTERS = family) = N: 1-1293; END; BEGIN TREES; TITLE Tb10782; LINK TAXA = Taxa1; TRANSLATE 1 Massarina_arundinariae_KT856, 2 Massarina_arundinariae_KT2200, 3 Polyplosphaeria_fusca_KT1043, 4 Polyplosphaeria_fusca_KT1640, 5 Polyplosphaeria_fusca_KT1616, 6 Polyplosphaeria_fusca_KT2124, 7 Quadricrura_bicornis_yone153, 8 Quadricrura_meridionalis_KT2607, 9 Quadricrura_septentrio_HC4983, 10 Quadricrura_septentrio_HC4984, 11 Quadricrura_septentrio_KT920, 12 Quadricrura_septentrio_yone176, 13 Quadricrura_septentrio_yone179, 14 Quadricrura_septentrio_yone44, 15 Triplosphaeria_acuta_KT1170, 16 Triplosphaeria_yezoensis_KT1715, 17 Triplosphaeria_yezoensis_KT1732, 18 Triplosphaeria_cylindrica_KT1800, 19 Triplosphaeria_cylindrica_KT2550, 20 Triplosphaeria_maxima_KT870, 21 Triplosphaeria_sp_HC4665, 22 Triplosphaeria_sp_KT2546, 23 Pseudotetraploa_curvi_HC4930, 24 Pseudotetraploa_curvi_HC4932, 25 Pseudotetraploa_curvi_KT2558, 26 Pseudotetraploa_javanica_HC4934, 27 Pseudotetraploa_longi_HC4933, 28 Tetraploa_aristata_CBS996_70, 29 Tetraplosphaeria_yakushi_KT1906, 30 Tetraplosphaeria_sasicola_KT563, 31 Tetraplosphaeria_nagasaki_KT1682; TREE maj_rule = [&R] ((1,2),((((((3,4),(5,6)),((7,8),(9,11,(12,13,14),10))),((((15,(16,17)),(18,19)),(21,22)),20)),(((23,(24,25)),26),27)),(((28,29),30),31))); END; BEGIN TREES; TITLE Tb10783; LINK TAXA = Taxa2; TRANSLATE 1 Curreya_pityophila, 2 Delitschia_didyma, 3 Delitschia_winteri, 4 Didymella_cucurbitacearum, 5 Didymella_exigua, 6 Herpotrichia_juniperi, 7 Lepidosphaeria_nicotiae, 8 Leptosphaeria_maculans, 9 Letendraea_helminthicola, 10 Lophostoma_heterosporum, 11 Massaria_platani, 12 Montagnula_opulenta, 13 Neotestudina_rosatii, 14 Neottiosporina_paspali, 15 Ophiosphaerella_herpotricha, 16 Phaeodothis_winteri, 17 Phaeosphaeria_avenaria, 18 Phoma_herbarum, 19 Pleomassaria_siparia, 20 Pleospora_herbarum, 21 Preussia_terricola, 22 Setomelanomma_holmii, 23 Setosphaeria_monoceras, 24 Sporornia_lignicola, 25 Trematosphaeria_pertusa, 26 Ulospora_bilgramii, 27 Verruculina_enalia, 28 Zopfia_rhizophila, 29 Botryosphaeria_dothidea, 30 Spencermartinsia_viticola, 31 Dothidea_insculpta, 32 Astrosphaeriella_aggregata_KT767, 33 Astrosphaeriella_aggregata_KT984, 34 Astrosphaeriella_stellata_KT998, 35 Kalmusia_scabrispora_KT1023, 36 Kalmusia_scabrispora_KT2202, 37 Katumotoa_bambisicola_KT1517, 38 Massarina_arundinariae_KT856, 39 Massarina_arundinariae_KT2200, 40 Massarina_arundinariae_KT1034, 41 Ophiosphaerella_sasicola_KT1706, 42 Phaeosphaeria_brevispora_KT1466, 43 Phaeosphaeria_brevispora_KT2313, 44 Phaeosphaeria_sp_KT2564, 45 Polyplosphaeria_fusca_KT1043, 46 Polyplosphaeria_fusca_KT1616, 47 Polyplosphaeria_fusca_KT1640, 48 Polyplosphaeria_fusca_KT1686, 49 Polyplosphaeria_fusca_KT2124, 50 Pseudotetraploa_curvi_HC4930, 51 Pseudotetraploa_curvi_HC4932, 52 Pseudotetraploa_curvi_KT2558, 53 Pseudotetraploa_javanica_HC4934, 54 Pseudotetraploa_longi_HC4933, 55 Quadricrura_bicornis_yone153, 56 Quadricrura_meridionalis_KT2607, 57 Quadricrura_septentrio_HC4983, 58 Quadricrura_septentrio_HC4984, 59 Quadricrura_septentrio_KT920, 60 Quadricrura_septentrio_yone44, 61 Quadricrura_septentrio_yone176, 62 Quadricrura_septentrio_yone179, 63 Roussoella_hysterioides_KT1651, 64 Roussoella_hysterioides_HH26988, 65 Roussoella_pustulans_KT1709, 66 Roussoella_sp_KT2303, 67 Roussoellopsis_tosaensis_KT1659, 68 Roussoellopsis_sp_KT1710, 69 Tetraploa_aristata_CBS996_70, 70 Tetraploa_sp_KT1684, 71 Tetraploa_sp_KT2578, 72 Tetraplosphaeria_nagasaki_KT1682, 73 Tetraplosphaeria_sasicola_KT563, 74 Tetraplosphaeria_yakushi_KT1906, 75 Triplosphaeria_acuta_KT1170, 76 Triplosphaeria_cylindrica_KT1256, 77 Triplosphaeria_cylindrica_KT1800, 78 Triplosphaeria_cylindrica_KT2550, 79 Triplosphaeria_maxima_KT870, 80 Triplosphaeria_yezoensis_KT1715, 81 Triplosphaeria_yezoensis_KT1732, 82 Triplosphaeria_sp_HC4665, 83 Triplosphaeria_sp_KT2546, 84 Versicolorisporium_trisept_SH130, 85 Massarina_eburnea_HC3953, 86 Lophiostoma_macrostomum_KT635, 87 Lophiostoma_macrostomum_KT709, 88 Arthopyrenia_salicis, 89 Bimuria_novae_zelandiae, 90 Byssothecium_circinans, 91 Cochliobolus_heterostrophus, 92 Cucurbitaria_elongata; TREE strict = [&R] (31,(((((((90,(((1,(9,(12,(16,((42,43),(89,(35,36))))))),(85,14)),(11,(37,41)))),((44,(8,((5,(4,18)),(92,(22,(15,17)))))),(20,(91,23)))),((21,24),(10,(86,87)))),(19,(6,25))),(84,(88,(68,((65,(66,67)),(63,64)))))),(((34,(33,32)),(39,(40,38))),((27,(7,(26,13))),((((54,(53,(52,(51,50)))),(72,71)),((73,70),(74,69))),((46,(49,(48,(47,45)))),(((58,(57,(61,(62,(60,59))))),(56,55)),((83,82),(79,(78,(81,(77,(80,(76,75))))))))))))),(28,(2,3))),(29,30)); END;