#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 7:46 GMT TreeBASE (cc) 1994-2008 Study reference: Fiore-donno A., Kamono A., Chao E., Fukui M., & Cavalier-smith T. 2010. Invalidation of Hyperamoeba by transferring its species to other genera of Myxogastria. Journal of Eukaryotic Microbiology, 57(2): 189-196. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10169] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=54; TAXLABELS Amaurochaete_comata Badhamia_panicea_var_nivalis Comatricha_nigra Comatricha_nigricapillitia_1 Comatricha_nigricapillitia_2 Comatricha_sinuatocolumellata Diderma_globosum Diderma_niveum Didymium_anellus Didymium_dubium_K15 Didymium_iridis_CR19 Didymium_iridis_CR8 Didymium_iridis_CUR1 Didymium_iridis_HA4 Didymium_nigripes Didymium_sp_ECH1 Didymium_sp_ECH49 Didymium_sp_OX13PS Didymium_squamulosum Echinostelium_arboreum Echinostelium_coelocephalum Echinostelium_minutum Enerthenema_papillatum Fuligo_leviderma Fuligo_septica Hyperamoeba_dachnaya Hyperamoeba_flagellata Hyperamoeba_sp_A1K Hyperamoeba_sp_AH1 Hyperamoeba_sp_ATCC50750 Hyperamoeba_sp_B12 Hyperamoeba_sp_BuP Hyperamoeba_sp_E23 Hyperamoeba_sp_E3P Hyperamoeba_sp_G1a Hyperamoeba_sp_Hpl Hyperamoeba_sp_W2i Lamproderma_atrosporum_var_retisporum Lamproderma_fuscatum Lamproderma_ovoideum_s_str Lamproderma_sauteri Lepidoderma_carestianum Lepidoderma_tigrinum Macbrideola_oblonga Mucilago_crustacea Physarum_album Physarum_didermoides Physarum_polycephalum Protophysarum_phloiogenum Pseudodidymium_cryptomastigophorum Semimorula_liquescens Stemonitis_axifera Stemonitis_flavogenita Symphytocarpus_impexus ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=72; TAXLABELS Diderma_alpinum Diderma_aurantiacum Diderma_darjeelingense Diderma_deplanatum Diderma_effusum Diderma_floriforme_var_subfloriforme Diderma_globosum_var_europaeum Diderma_hemisphaericum Diderma_microsporum Diderma_niveum Diderma_radiatum Diderma_rugosum Diderma_saundersii_AB259379 Diderma_saundersii_AB259380 Diderma_simplex_var_applanatum Diderma_testaceum Diderma_umbilicatum Didymium_anellus Didymium_bahiense_AB259387 Didymium_bahiense_AB259388 Didymium_clavus_AB259389 Didymium_clavus_AB259390 Didymium_comatum Didymium_crustaceum Didymium_dictyopodium Didymium_dubium_AB259399A Didymium_dubium_K15 Didymium_flexuosum Didymium_floccoides Didymium_floccosum Didymium_iridis_AB259407 Didymium_iridis_AB259408 Didymium_iridis_AJ938153 Didymium_iridis_CR19 Didymium_iridis_CR8 Didymium_iridis_CUR1 Didymium_iridis_HA4 Didymium_laccatipes Didymium_leoninum Didymium_marineri Didymium_megalosporum Didymium_melanospermum Didymium_minus Didymium_nigripes_AB259424 Didymium_nigripes_AB259425 Didymium_nigripes_AB259426 Didymium_nigripes_AF239230 Didymium_panniforme Didymium_serpula Didymium_sp_ECH1 Didymium_sp_ECH49 Didymium_sp_OX13PS Didymium_squamulosum_AB259430 Didymium_squamulosum_AB259431 Didymium_squamulosum_AB259432 Didymium_squamulosum_AB259436 Didymium_squamulosum_AB259438 Didymium_squamulosum_AM231293 Didymium_verrucosporum_AB259439 Hyperamoeba_dachnaya Hyperamoeba_sp_E23 Hyperamoeba_sp_E3P Hyperamoeba_sp_Hpl Lepidoderma_carestianum_AB259440 Lepidoderma_carestianum_AM231296 Lepidoderma_granuliferum Lepidoderma_tigrinum_AB259445 Lepidoderma_tigrinum_DQ903678 Mucilago_crustacea_AB259447 Mucilago_crustacea_DQ903679 Protophysarum_phloiogenum Pseudodidymium_cryptomastigophorum ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=75; TAXLABELS Badhamia_affinis_AB259448 Badhamia_affinis_AB435341 Badhamia_alpina_AB259449 Badhamia_macrocarpa_AB259451 Badhamia_macrocarpa_AB259452 Badhamia_panicea_AB259454 Badhamia_panicea_var_nivalis Badhamia_utricularis_AB259456 Craterium_aureum_AB259459 Craterium_dictyosporum_AB259462 Craterium_dictyosporum_AB259463 Craterium_leucocephalum_var_cylindricum Craterium_leucocephalum_var_scyphoides Craterium_minutum_AB25947373 Craterium_reticulatum_AB259476 Diachea_leucopodia_AB259360 Diachea_radiata_AB259362 Diachea_subsessilis_AB259363 Fuligo_aurea_AB259478 Fuligo_candida_AB259480 Fuligo_candida_AB435344 Fuligo_leviderma_DQ903676 Fuligo_septica_AB259482 Fuligo_septica_AJ584697 Fuligo_septica_f_flava Hyperamoeba_flagellata_AF411289 Hyperamoeba_sp_G1a Hyperamoeba_sp_W2i Leocarpus_fragilis_var_bisporus Physarum_albescens_AB259487 Physarum_album_AB259531 Physarum_album_AB259532 Physarum_bivalve_AB259488 Physarum_bivalve_AB259490 Physarum_bogoriense_AB259495 Physarum_cinereum_AB259498 Physarum_confertum_AB259500 Physarum_conglomeratum_AB259501 Physarum_crateriforme_AB259503 Physarum_didermoides_AB259504 Physarum_didermoides_AB259505 Physarum_didermoides_AY183449 Physarum_digitatum_AB259506 Physarum_flavicomum_AB259507 Physarum_flavicomum_AB259508 Physarum_florigerum_AB259509 Physarum_hongkongense_AB259511 Physarum_lakhanpalii_AB259512 Physarum_lakhanpalii_AB259513 Physarum_lateritium_AB259514 Physarum_loratum_AB259515 Physarum_luteolum_AB259518 Physarum_melleum_AB259520 Physarum_melleum_AB259521 Physarum_melleum_AB259523 Physarum_melleum_AB435350 Physarum_mortonii_AB259524 Physarum_mutabile_AB259525 Physarum_nigropodum_AB259527 Physarum_nucleatum_AB259528 Physarum_plicatum_AB259533 Physarum_polycephalum_X13160 Physarum_psittacinum_f_fulvum Physarum_pulcherrimum_AB259536 Physarum_pusillum_AB259537 Physarum_reniforme_AB259538 Physarum_reniforme_AB259539 Physarum_rigidum_AB259541 Physarum_roseum_AB259543 Physarum_stellatum_AB259545 Physarum_sulphureum_AB259546 Physarum_superbum_AB259547 Physarum_tenerum_AB259550 Physarum_viride_AB259551 Physarum_viride_AB259552 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4316] TITLE Didymiaceae_Partial_18S; LINK TAXA = Taxa2; DIMENSIONS NCHAR=417; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=- GAP= #; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Diderma_alpinum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGG-GCGGCAGCCCGGCTTGCTTCACGGCTTGCTAGCAGCCGCTTAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACAGTAGAACGTGCCCGGGCTTCTCCGCGGCCTACTGGCCGCGGTAATCCTTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Diderma_aurantiacum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GCAACAGCCCGGCTCGCCTCACGGCTTGCTAGCAGTTGCTTTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA-TAGAAAGTGCCAGGGCGTATCCGGGGCCTAACGGCCTCGGTAACCCCTAATCCCTGCCTTGACTGGGATAGACTATTGCAATTATTGGTCTTCAACGAGGAATTTTTAGTAATCGC-AGGTCATTAACCTGCGATGA Diderma_darjeelingense ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGG-GTGGCAGCCCGGCTTGCCGCAAGGCTTGCTAGCAGCCACTCAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACA-TAGAACGTGCTCGGGCTTCTCCGCGACCTACTGGTCGTGGTAATCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Diderma_deplanatum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GCGGCAGCCCGGCTTGCCGCAAGGCTTGCTAGCAGCCGTTTTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTA-TAAAAAGTGCCAGGGCGTATCCGGGGCCTAACGGCCTCGGTAACCCCTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Diderma_effusum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTCCGTTCCTACTAGGG-GTGGCAGCCCGGCTCGCCTCACGGCTTGCTAGCAGCTATTTTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGAA-TAAAAAGTGCCAGGGCGTATCCGGGGCCTACAGGCTCTGGTAACCCCTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGT-AGGTCATTAACCTGCGACGA Diderma_floriforme_var_subfloriforme ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTCCGTTCCTAATAGGG-GCGACAGCCCGGCTTGCGCTTGCGCTTGCTAGCAGTTGTTGTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA-AACACAGTGCCAGGGCGTATCCGGGGCCTAAAGGCTCCGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGT-AGGTCATTAACCTGCGACGA Diderma_globosum_var_europaeum ACGCGTATGAAGGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GCGGTAGCCCAGCTTGCCTAACGGCTTGCTGCCTGCCGTTTGACTTCTTAGACGTATCAGGGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA-TACACAGTGCCAGGGCATATCCGGGGCCTAACGGCTTCGGTAACCCTTAATCCCTGCCTTGACTGGGATAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGT-AGGTCATTAACCTGTGACGA Diderma_hemisphaericum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GCGACAGCCCGGCTTGCCTCACGGCTTGCTAGCAGTCGCTTTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA-TAGAAAGTGCCAGGGCGTATCCGGGGCCTAACGGTCTCGGTAACCCATAATCCCTGCCTTGACTGGGATAGACTATTGCAATTATTGGTCTTCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Diderma_microsporum ACACGTATGAAAGACAAGCTAAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGG-GTGGCAGCCCGGCTTGTCCCAAAGCTTGTTAGCAGCCACTTTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATGTA-TAGAAAGCTCCAGG--ATATCCGGAGCCTAACGGTTTCGGTAACCCTTAGTCCCTACCCTGTCTGGGACAGACTCTTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC-GGGTCACTAACCCGCGACGA Diderma_niveum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GCGATAGCCCGGCTTGGCCTAAGACTTGCTAGCTGTCGTTTTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGAA-TAAAAAGTGCCAGGGCGTATCCGGGGCCTAACGGTCTCGGTAACCCCTAGTCCCTGCCTTGACTGGGACAGACTCTTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAGCCTGCGACGA Diderma_radiatum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GCGGCAGCCAAGTTGGCCTCACGGCTTGCTAGCAGTCGCTT-ACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA-TAGATAGTGCTAGGGCGTATCCGGGGCCTAACGGCTTCGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Diderma_rugosum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGG-GTGGCAGCCCGGCTTTCCTCACGGTCTGCTAGCAGCCGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATTAGAACGTGCT-GGGCTTTTCCGCGGCCTACTGGCCGCGGTAATCCCTAGTCTCTCCCTTGACTGGGCCAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Diderma_saundersii_AB259379 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GCGGCAGCCCGGCTTGCCTCACGGCTTGCTAGCAGCCGCTTTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATGTA-TAGAGAGTGCCAGGGCGTATCCGGGGCCTAACGGTCCCGGTAACCCCTAATCCCTGCCTTGACTGGGATAGACTATTGCAATTATTGGTCTTCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Diderma_saundersii_AB259380 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGG-GCAACAGCCCGGCTCGCCTCACGGCTTGCTAGCAGTAGCTTTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA-TAAAAAGTGCCCGGGCGTATCCGGGGCCTAACGGTCTCGGTAACCCCTAATCCCTGCCTTGACTGGGATAGACTATTGCAATTATTGGTCTTAAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Diderma_simplex_var_applanatum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GTGGCAGCCCGGCTCGCCTCACGGCTTGCTAGCAGCCATTGTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA-TACACAGTGCCAGGGCGTATCCGGGGCCTACAGGCCTCGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGT-AGGTCATTAACCTGCGACGA Diderma_testaceum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGG-GTGGAAGCCCGGCTCGACTTCGGTCTTGCTAGCAGCCATTGTACTTCTTAGACGGATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA-TAGATGGTGCCAGGGTGTCTCCGGGGCCTAACGGTTTTGGTAATCCCTAGTCCCTGCCTTGACTGGGACAGACTATTGTAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC-GGGTCATTAACCCGCGACGA Diderma_umbilicatum ACACGTATGAAAGACAAGCCGATAGACTTTTCTCAATAATGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGATTGATTCGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAGTAGGG-GCGGCAGCCAGACA--GCGAAAGCATCGTTAGCAGCCGCGCGACTTCTTAGACGTATCAGGACCGAAGAGGTCCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA-TAGAAAGTGCTAGGGCATCCCCGGGGCCTAACGGTCTCGGTAATCCCTAGTCCCTGCCTTGACTGGGACAGACTTTTGAAACTATTGGTCTCCAACGAGGAATTTTTAGTAGGCGC-GGGTCATTAACCCGTGCCGA Didymium_anellus ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGTGATCCTAATAGGG-GCGGCAGCCCGGCTTGTCGCAAGACTCGCTAGCAGCCGTGTTGCTTCTTAGACATATCTGGGCCGACAAGGTCCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGCA-AAGAAAGTGCTAGGGCGTATCCGCGGCCTACAGGCCGTGGTAACCCCTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_bahiense_AB259387 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGG-GTGGCAGCCCGGCTCGGCTTCGGTCTTGCTAGCAGCCGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATTAGAACGTGCTAGGGCGTTTCCGCGGCCGACGGGTCGCGGTAACCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_bahiense_AB259388 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGG-GCGGCAGCCCGACTCGTGCTTGCGCTTGTTAGCAGCCGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATTAGAACGTGCTAGGGCGTTTCCGCAGCCGACGGGTTGCGGTAACCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_clavus_AB259389 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGG-GCGGCAGCCCGGCTCGCCGCAAGGCTTGCTAGCAGCCGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACA-TAGAAAGTGCCAGGGCGTCTCCGCGGCCGACAGGTCGCGGTAACCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_clavus_AB259390 ACACGTATGAAGGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GTGGCAGCCCGGCTCGACGCAAGTCTTGCTAGCAGCCGCATAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACAGTAGATAGTGCTGTGGCGTTTCCGCGGCCGACGGGCTGCGGTAACCCTTAATCTCTCCCTTGACTGGGATAGACTATTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAGTCAC-AGGTCATTAACCTGTGACGA Didymium_comatum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GCGGCAGCCCGGCTCGGCCTCGGCCTTGCTAGCAGCCGCTT-GCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTAGGCT-TAAAGAGTGCCCGGGCGTTTCCGGGGCCGTCAGGTCCTGGTAACCCCTAGTCTCTCCCTTGACTGGGCCAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAGCCTGCGACGA Didymium_crustaceum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGTTAACGAGCGAGACCCCTCCGTTCCTACTAGGG-GCGGCAGCCAAGCTCTCCTCACGGCCTGCTAGCAGCCGCTCAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATTAGAACGTGCTGGGGCTTCTCCGCGGCCGACGGGTCGCGGTAACCCCTAGTCTCTTCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_dictyopodium ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGAG-GCAGCAGCCCGGCTTACCGCAAGGTCTGCTAGCAGCTGCAAAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATAAA-TAGAAAGTGCTCGGGCTTTTCCGCGGCCTAATGGTCGCGGTAATCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_dubium_AB259399A ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTCCTTAGTAGGG-GTGGCAGCCCGGCTCGCCTCACGGCTTGCTAGCAGCCACTAAGCTTCTTAGGCGAATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATTAGAACGTGCTAGGGCTTTTCCGCGGCCCACAGGTCGCGGTAACCCTTAGTCTCTTCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC-AAGTCATTAACTTGCGACGA Didymium_dubium_K15 ACACGTATGAAGGACAAGCTGAAAGACTTTTCCCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGG-GCAGCAGCCCGGCTTGCCGCAAGGCCTGCTAGCAGCTGCCTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTAGACATTAGAACGTGCTAGGGCGTCTCCGCGGCCTGCCGGTCGCGGTAACCCCTAGTCTCTCCCTTGACTGGGCCAGACTATTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_flexuosum ACACGTATGAAAGACACGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTCCGTTCCTAATAGGG-GCGGTAGCCCGGCTTGGCTCACGCCTCGCTAGCTGCCGTTGTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGCA-AACACAGTGCCAGGGCATTTCCGGGGTCTTCGGGCCCCGGTAATCCCTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGT-AGGTCATTAACCTGCGACGA Didymium_floccoides ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGG-GCAGCAGCCCGGCTTTCCGCAAGGTTCGCTAGCAGCTGCTATGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGCATTAGAAAGTGCTAGGGCGTATCCGCGGCCTACAGGTCGCGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_floccosum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTACTAGGG-GTAGCAGCCCGGCTCGAGTAACATCTTGCTAGCAGCTACCTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATTAGAACGTGCTGCGGCGTTTCCGCGGCCGAGAGGCTGCGGTAACCCATAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCAC-AGGTCATTAACCTGTGACGA Didymium_iridis_AB259407 ACACGTATGAAAGACAGGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGG-GCGGCAGCCCGGCTTGCCGCAAGGCTTGCTAGCAGCCGCTCAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACA-TAGAACGTGCTCGGGCTTCTCCGCA-CCTACTGGTCGTGGTAATCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_iridis_AB259408 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GCCGCAGCCCGGCTCGGCTTCGGCCTTGCTAGCAGCAGCCTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATTAAAAAGTGCTAGGGCGTCTCCGCGGCCTACGGGTCGCGGTAACCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGGCGC-AGGTCATTAGCCTGTGCCGA Didymium_iridis_AJ938153 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGG-GCGGCAGCCCGGCTTTCCCTCGGGTCTGCTAGCAGCCGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATTAGAACGTGCTAGGGCTTTTCCGCGGCCTACTGGTCGCGGTAATCCCTAGTCTCTCCCTTGACTGGGCCAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_iridis_CR19 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GTGGCAGCCAGGCTCGGCGCAAGCCTTGCTAGCAGCCACGATGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTAAACATTAGAAAGTGCTGCGGCGTTTCCGCAGCCGACGGGTTGCGGTAACCACTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_iridis_CR8 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGG-GTGGCAGCCCGGCTCGGCTTCGGTCTTGCTAGCAGCCGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATTAGAACGTGCTAGGGCGTTTCCGCGGCCGACGGGTCGCGGTAACCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_iridis_CUR1 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGATCCTAGCGTTCCTAATAGGT-TTTTTAGCCCAGCGACTATTAAAGACTGCTAGCTATAATATA-CTTCTTGGACGGATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTAAACA-CAGAAAGTGCCTAGAGCCTTCCGGTACCTAACGGCGTCGGTAAACATTAGTCTTTTCCCTGACTGGGATAGACTATTGTAATTATTGGTCTTCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_iridis_HA4 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGG-GCGGCAGCCCGGCTTACTCTCGGGTCTGCTAGCAGCCGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATTAGAACGTGCT-GGGCTTTTCCGCGGCCTACTGGCCGCGGTAATCCCTAGTCTCTCCCTTGACTGGGCCAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_laccatipes ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG-GCGGCAGCCCGGCTCGTGTTCGCACTTGCTAGCAGCCGCTTAGCTTCTTAGACGTATCAGAGCCGAAAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATTAGAACGTGCTGTGGCGTCTCCACGGCCGACGGGTCGTGGTAACCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_leoninum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGG-GCGGCAGCCAGGCTCGCCTCGCGGCTTGCTAGCAGTCGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACA-TAGAAAGTGCCAGGGCGTCTCCGCGGCCGACAGGTCGCGGTAACCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_marineri ACACGTATGAAAGACACGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTCCGTTCCTAATAGGG-GCAGTAGCCCGGCTTGACTCACGTCTCGCTAGCTGCTGTTGTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGCA-AACACAGTGCCAGGGCGTTTCCGGGGTCTTCGGGCCCCGGTAATCCCTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGT-AGGTCATTAACCTGCGACGA Didymium_megalosporum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GCAGCAGCCCGGCTTTCCGCAAGGTTCGCTAGCAGCTGCTATGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGCTTTAGAAAGTGCTAGGGCGTCTCCGCGGCCTACAGGCTGCGGTAACCCCTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_melanospermum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGG-GTAGCAGCCAGGCTCGACGCAAGTCTTGCTAGCAGCTACGATGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTAAACATTAGAAAGTGCTGCGGCGTTTCCGCAGCCGACGGGTTGTGGTAACCACTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_minus ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGG-GCAGCAGCCCGACTCGGCTTCGGTCTTGTTAGCAGCTGCTTTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATTAGAACGTGCTAGGGCGTCTCCGCGGCCTACAGGTCGCGGTAACCCTTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_nigripes_AB259424 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GCAGCAGCCCGGCTTTCCGCAAGGTTCGCTAGCAGCTGCTATGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGCTTTAGAAAGTGCTAGGGCGTCTCCGCGGCCTACAGGCTGCGGTAACCCCTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_nigripes_AB259425 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGG-GTGGCAGCCCGGCTCGGCCTCGGTCTTGCTAGCAGCCGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATTAGAACGTGCTAGGGCGTTTCCGCGGCCGACGGGTCGCGGTAACCCTTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_nigripes_AB259426 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GCCGCAGCCCGGCTCGGCTTCGGCCTTGCTAGCAGCAGCCTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATTAAAAAGTGCTAGGGCGTCTCCGCGGCCTACGGGTCGCGGTAACCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGGCGC-AGGTCATTAGCCTGTGCCGA Didymium_nigripes_AF239230 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGATCCTTTCGTTCCTAATAGAG-GTTTTAGCCAAGTTCTTCGCAAGATTTACTAGCTATAATATAACTTCTTAGACGAATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTACACG-CAGATAGTGCTCGAGCTTCTCCGTCATCTAACGATGACGGTAAACATTAGTCTTTTCCTTGACTGGGCTAGACTATTGTAATTATTGGTCTTTAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_panniforme ACGCGTATGAAAGACAAGCTGAGAGACTTTTCTCAATGACGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAATGGTTTGTCTGGTTTATTCCGATAACGAGCGAGACCCCAGTGTCCTTAATAGGA-GTGCCAGCCCGGCTCGCCTTCGGGCCTGCCAGCAGC-GCCTAGCTTCTTAGGCATATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTA-GCATCAGAAAGTGCCAGGGTTGCCCCGCGGCCGACGGGTCGCGGTAATCCCTAATCGTTCCCTTGACTGGGACAGACTCTTGCAATTATTGGTCTCGAACGAGGAATTTTTAGTATACGC-CGGTCATTAACCGGCGCGGA Didymium_serpula ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGG-GCGGCAGCCAGGCTCGCCTCACGGCTTGCTAGCAGTCGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACA-TAGAAAGTGCCAGGGCGTCTCCGCGGCCGACAGGTCGCGGTAACCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_sp_ECH1 ACACGTATGAAGAACAAGCTGAAAGACTTTTTCCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG-GTGTCAGCCCGGCTCGCTTCATTGCTTGCTAGCAGGCGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACC-TAGAACGTGCTACGGCATTTCCGCGGCCTACGGGTCGCGGTAACCCTTAGACTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_sp_ECH49 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGG-GCGGCAGCCCGGCTTGCCGCAAGGCTTGCTAGCAGCCGCTCAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACA-TAGAACGTGCTCGGGCTTCTCCGCGGCCTACTGGTCGTGGTAATCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_sp_OX13PS ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGATCCTATCGTTCCTAATAGAG-GTTTAAGCCAGGTTCTTCGCAAGATTTGCTAGCTTTAACATAACTTCTTGGACGAATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTACGC-GCAAAAAGTGCATATGCTTCTCCGCTGTCTAAAGACAGTGGTAAACATTAGTCCTTTCCTTGACTGGGATAGACTATTGTAATTATTGGTCTTAAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_squamulosum_AB259430 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTACTAGGG-GTGGCAGCCCGGCTTTCAGCAATGTCTGCTAGCAGCCACTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATTAGAACGTGCTCGGGCTTCTCCGCGGCCTACTGGTCGCGGTAATCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGGCGA Didymium_squamulosum_AB259431 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTC-TTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GCGGCAGCCCGGCTCGCCGCAAGGCTTGCTAGCAGCCGTTTTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTA-TAGAAAGTGCCAGGGCGTATCCGGGGCCTAACGGTCCCGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_squamulosum_AB259432 ACACGTATGAAAGACAAGCTGATAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTTCGTTCCTACTAGGG-GCGGCAGCCCGGCTTATCTCACGGTCTGCTAGCAGCCGCTTAACTTCTTAGACGTATCAGGGCCGATAAGGTCCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTAAACATTAGAACGTGCTGGGGCTTCTCCGCGGCCGACGGGTCGCGGTAACCCCTAGTCTCTTCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_squamulosum_AB259436 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTCCGTTCCTACTAGGG-GCGGCAGCCCGGCCTTCCTCACGGTCTGCTAGCAGCCGTATTACTTCTTAGACGTATCAGGGCCGATAAGGTCCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATAAA-TAGAACGTGCTGGGGCTTCTCCGCGGCCGACGGGTCGCGGTAACCCCTAGTCTCTTCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_squamulosum_AB259438 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGG-GCGGCAGCCCGGCTTGCCTTCGGGCTTGCTAGCAGCCGCTTAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACAGTAGAACGTGCCCGGGCTTCTCCGCGGCCTACTGGC----GTAATCCTTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_squamulosum_AM231293 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGG-GCGGCAGCCCGGCTTTCTTCACGGACTGCTAGCAGCCGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATTAGAACGTGCTAGGGCTTTTCCGCGGCCTACTGGCCGCGGTAATCCCTAGTCTCTCCCTTGACTGGGCCAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Didymium_verrucosporum_AB259439 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGATCCTAGCGTTCTTAATAGAG-TTTGAAGCCAAGTTTTGAGCAATCTCTACTAGCTTCATTTAAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTACACT-CAGAAAGTGCCAGGGTTTCTCCGGGACCTAACGGTTTCGGTAAACATTAGTCTTTTCCTTGACTGGGCTAGACTATTGTAATTATTGGTCTTCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Hyperamoeba_dachnaya ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGG-GCGGCAGCCCGGCTTGCCGCAAGGCTTGCTAGCAGCCGCTCAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACA-TAGAACGTGCTCGGGCTTCTCCGCGGCCTACTGGTCGTGGTAATCCCTAATCTCTCTCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Hyperamoeba_sp_E23 ACAAGTATGAAAGACAAGCTGATAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTCCGTTCCTACTAGGG-GCGGCAGCCCGGCTTTCCTCACGGCTTGCTAGCAGCCGTTTCACTTCTTAGACGTATCAGGGCCGATAAGGTCCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACA-AAGAACGTGCTGGGGCTTCTCCGCGGCCGACAGGCTGTGGTAACCCCTAGTCTCTCCCTTGACTGGGCCAGACTATTGTAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Hyperamoeba_sp_E3P ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTTCGTTCCTAATAGAG-GTAGTAGCCCGACTTTGAGCAATCTCTGTTAGCAACTACTTA-CTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTACACA-TAGAAAGTGCTCGAGCTTCTCCGCGGTCTAATGATCGTGGTAATCCTTAGTCTTTTCCTTGACTGGGCCAGACTATTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Hyperamoeba_sp_Hpl ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGATCCTTTCGTTCCTAATAGAG-GTTTTAGCCAAGTTCTTCGCAAGATTTACTAGCTATAATATAACTTCTTAGACGAATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTACAC-TTAGAAAGTGCTCGAGCTTCTCCGTCGTCTAACGACGACGGTAAACATTAGTCTTTTCCTTGACTGGGCTAGACTATTGTAATTATTGGTCTTTAACGAGGAATTTTTAGTAATCGC-AGGTCATTAACCTGCGATGA Lepidoderma_carestianum_AB259440 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTACTAGGG-GGGGCTGCCCGGCTCGCCGCAAGGCTTGTTAGCAGCTGC--TGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATACA-AAGAAAGTGCTAGGGCGTCTCCGGGGCCGAAAGGTTCTGGTAACCCTTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Lepidoderma_carestianum_AM231296 ACACGGATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATCTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG-GGAATTGCCCAGTTAGCCGCAAGGCCGACTAGCAGATCT--AACTTCTTAGACGTATCAGGGCCGAAAAGGTCCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACA-TAGAAAGTGCCAGGGTGTTTCCGGGGCCGAAAGGTCTTGGTAACCCCTAATCTGTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Lepidoderma_granuliferum ACGCGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGACGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTTTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGA-GCACCAGCCCGGCTCGGCTCCGGCCTTGCTAGCAGGTGCCTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTAGCCATCAGAAAGTGCCAGGGTGTCTCCGTGGCCGAAAGGCTGCGGTAACCCATAGTCGCTCCCTTGACTGGGCCAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTATACGC-AGGTCATTAACCTGCGCGGA Lepidoderma_tigrinum_AB259445 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GCGACAGCCCGGCTTG-CTTCGG-CTTGCTAGCAGTCGTTTTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA-TAGAAAGTGCCAGGGCGTATCCGGGGCCTAACGGTCCCGGTAACCCCTAATCCCTGCCTTGACTGGGATAGACTATTGCAATTATTGGTCTTCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Lepidoderma_tigrinum_DQ903678 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTACTAGGG-GCGACAGCCCGGCTTGCCTCACGGCTTGCTAGCAGTCGCTTTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGAA-TAGAAAGTGCCAGGGCGTATCCGGGGCCTAACGGTCTCGGTAACCCCTAATCCCTGCCTTGACTGGGATAGACTATTGCAATTATTGGTCTTCAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Mucilago_crustacea_AB259447 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGG-GCGGCAGCCCGGCTCGCCGCAAGGCCTGCTAGCAGCCGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTAGACATTAGAACGTGCTAGGGCGTCTCCGCGGCCTGCCGGTCGCGGTAACCCCTAGTCTCTCCCTTGACTGGGCCAGACTATTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Mucilago_crustacea_DQ903679 ACGCGTATGAAAGACAAGCTGAAAGACTTTTCTAAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGG-GTGATGGCCAA-CTCGCCTCACGGCTTG-TAGCCGTCACCCTGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATACAGGAGAAAGTGCT-GGGCGAC-CCGCGGCCTCACGGCTGCGGTAATCCCTAGACTCTGCCTTGACTGGGCCAGACTTTTGCAATTATCGGTCTCAAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA Protophysarum_phloiogenum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTTTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG-GTGGCAGCCCGGCTCGGCCTCGGCCTTGCTAGCAGCCACTT-GCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTAGGCT-TAAACAGTGCCCGGGCGT-TCCGGGGCCGACGGGTCCCGGTAACCCCTAGTCTCTCCCTTGACTGGGCCAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAATCGC-AGGTCATTAACCTGCGATGA Pseudodidymium_cryptomastigophorum ACACGTATGAAAGACAAGCTGAAAGACTTTTCTAAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGG-ATGGTAGCCCGGCTTGCCGCAAGGCTTGCTAGCTGCTGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATGAAAAAGTGCCAAGGCGTTTCCGCGGCCTCCGGGTCGTGGTAACCCTTAGTCTCTTCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC-AGGTCATTAACCTGCGACGA ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = Didymiaceae_Partial_18S) = N: 1-417; CODONPOSSET * CodonPositions (CHARACTERS = Didymiaceae_Partial_18S) = N: 1-417; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4379] TITLE Fig._4; LINK TAXA = Taxa3; DIMENSIONS NCHAR=417; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Badhamia_affinis_AB259448 ACGCGTATGAAGGTCACGCTGAAAGACTTTACCCAATGACGTAAGTGGTGGTGCATGGCCGTTCGTGGTTCGTGGATTGATTTGTCTGGTTAATTCCGATAACGAGCGAGACCCTATCGTTCTAAATAGGG?GGCACAGCCCGACCGGTCGAAAGGCCGGTTAGCTACGCCTATGCTTCTTAGACGTATCATGGCCGACAAGGTCATTGAAATGGGTTAATAACAGGTCAGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTA?AAGCGCGTGCTCGAGCATAACCGTGGTTTTGCGGCCACGGCAATCCATAAAACCTGCCTTGACTGGGGTAGGCAATTGGAACTATTGGTCTTAAACGAGGAATTTTTAGTGATAGCCAGGTCATTAACCTGCGCTGA Badhamia_affinis_AB435341 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTGGTTCGTGGATTGATTTGTCTGGTTTATTCCGATAACGAGCGAGACCCTAACGTTCCTAATAGGGGGCCATAGCCCGATCGGTCGAAAGGCTGGTCAGCTTTGGCTAAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTA?AAGCGAGCGCTTAGGCTTTACCTGGGTCGAAAGGCCCTGGTAATCCATAAACCCTGCCTTGACTGGGCTAGGTTGTTGTAACTATCAGTCTTAAACGAGGAATTTTTAGTAATAGCCAGGTCATTAACCTGCGCTGA Badhamia_alpina_AB259449 ACACGTATGAAAGCCAAGCTGAAAGACTTTGCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GTAACAGCCCGGCCAGCCGCAAGGCTGGCTAGCCGTTGCTTCGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCAAGTGCTAAGGCGTTACCGGGGCCGAAAGGCTCTGGTAACCCTTAATCCCTGCCTTGACTGGGATAGATCTTTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAGTCGT?AGGTCATTAACCTGCGACGA Badhamia_macrocarpa_AB259451 ACACGTATGAAGGTCAAGCTGAAAGACTTTACCCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTGGTTCGTGGATTGATTCGTCTGGTTAATTCCGATAACGAGCGAGACCCTATCGTTCCTAATAGGGGGCTATAGCCCAACCGGTCGAAAGGCCGGTTAGCTAAAGCTTGGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCAAGTGCTTGAG?TTTACCGTTGTCGAGAGGCAATGGCAATCCATAATCCCTGCCTTGACTGGGATAGATCATTGCAATTATTGGTCTTAAACGAGGAATTTTTAGTAATAGCCAGGTCATTAACCTGCGCTGA Badhamia_macrocarpa_AB259452 ACACGTATGAAGGTCAAGCTGAAAGACTTTACCCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTGGTTCGTGGATTGATTCGTCTGGTTAATTCCGATAACGAGCGAGACCCTATCGTTCCTAATAGGGGGCTATAGCCCAACCGGTCGAAAGGCCGGTTAGCTAAAGCTTGGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCGAGTGCTTGAG?TTTACCGATGTTGAGAGGCACCGGCAATCCATAATCCCTGCCTTGACTGGGATAGATCATTGCAATTATTGGTCTTAAACGAGGAATTTTTAGTAATAGCCAGGTCATTAACCTGCGCTGA Badhamia_panicea_AB259454 ACACGGATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTGGTTCGTGGATTGATTTGTCTGGTTAATTCCGATAACGAGCGAGACCCTATCGTTCCTAATAGGGGGCAGTAGCCCGACTAGCCGAAAGGCCGGTCAGCTACCGCTGAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTA?AAGCGAGTGCTTAGGCTTTACCTGGGTCGAAGGGCCCTGGTAATCCATAAACCCTGCCTTGACTGGGATAGATTATTGCAACTATTGGTCTTAAACGAGGAATTTTTAGTAATAGCCAGGTCATTAACCTGCGCTGA Badhamia_panicea_var_nivalis ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATCTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGATGCTCCTAGTAGGG?GCAGCAGCCAAGCCGGACGCAAGTCTGGTTAGCCGCTGTGAAGCTTCTTAGACATATCGGGGCTGATAAAGTCCGTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGCCTTAGAAAGTGCTATGGCATATCCGCGATCTAACGGTCGTGGTAATCCATAAAACTTGCCCTGACTGGGATAGACTATTGTAATTATTGGTCTTGAACGAGGAATTTTTAGTAGGCAC?GGGTCATTAGCCCGTGCCGA Badhamia_utricularis_AB259456 ACAAGTATGAAAGACAAGCTGAAAGACTTTTCTCAATAATGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGGTTCGTCTGGTCTATTCCGATAACGAGCGAGACCTCAATGTTCTAAATAGGG?GAGGTTGCCCGGCCTGCCGCAAGGCTTGCTAGCAGCCTCAAAGCTTCTTAGACAGATTAGGGCTGATAAAGTCCTTGAAATGGGTTAATAACAGGTCAGT?ATGCCCTTAGATGTTCTGGGCTGCACGCGCGTTACATTGGCAAGTCCTAGAAAGCGCTAGAGCATCCCCACGGCCTAGCGGCTTGGGTAATCCCTAATACTTGCCCTGGCTGGGATAGTCCATTGTAATTATTGGTCTTGAACCAGGAATTTTTAGTAGGCGC?GGGTCATTAGCCTGCGCCAA Craterium_aureum_AB259459 ACACGCATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTGGTTCGTGGATTGATTTGTCTGGTTAATTCCGATAACGAGCGAGACCCTAGCGTTCTAAATAGGG?GGCTTAGCCAAACCAGTCGCAAGATTGGTTAGCTTCGCCCAAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCAAGTGCTAGAGTTTTCCCATGGTCGAAAGGCTAGGGTAATCCATAAGACTTCCCTTGACTGGGCTAGATCTTTGGAATTATTGGTCTTAAACGAGGAATTTTTAGTAATAGCCAGGTCATTAGCCTGCGCTGA Craterium_dictyosporum_AB259462 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTCCCTAATAGGG?GTGGCAGCCCGGCTTGCCGCAAGGCTTGCTAGCAGCCATCTTGCTTCTTAGGCGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGT??GAGCGAGTGCCAGGGCATATCCGCGGCCTACAGGTCGCGGTAACCCCTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC?AGGTCATTAACCTGCGACGA Craterium_dictyosporum_AB259463 ACACGTACGAAAGTCAAGCTAAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGCCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAGCGTTCCTAATAGGG?GCGGTAGCCCAGCTGGCCGCAAGGCCAGCTAGCTGCCTCTTAGCTTCTTGGACGGATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGACACGTA?AAGCAAGTGCT?CAGTATTCCCGTGGTTGAGAGGTTGTGGTAACCCCTACGCCATGTCAAAACAGGGATAGACCCCTGCAATTATTGGTCTTTAACGAGGAATTTTTAGTAATCAC?CGGTCATTAACCGGTGATGA Craterium_leucocephalum_var_cylindricum ACACGCATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCGATTCCGATAACGAGCGAGACCCCGGTGTTCCTAATAGGG?GCGGCAGCCCGTCCGGTCGCAAGGCCGGTCAGCTACCGCTGTACTTCTTAGACACATCAAGGCCGATAAGGTCTTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTA?TAAACAGTGCTCAGGCGTTTCCCGGGCCTAACGGTCCGGGTAACCCTTAATCCCTGCTTTGACTGGGATAGATCCTTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAAGCGC?AGGTCATTAACCTGTGCTGA Craterium_leucocephalum_var_scyphoides ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTTTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG?GTGGCAGCCAGACCGGTCGCAAGACAGGTTAGCCGCCACTATGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAACGAGTGCTAAGGCGTC?CCACGGCCGAAAGGTCGTGGTAACCCTTAGTCCCTGCTTTGACTGGGACAGATCTTTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAATCGC?AGGTCATTAACCTGCGTTGA Craterium_minutum_AB25947373 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCTGGCGTTCCTAATAGGG?GCAGCAGCCCAGCCAGCCGCAAGGTTGGCTAGCAGCTACTCTGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCAAGTGCTACGGCTTCTCCGGGGCCGACAGGCTTTGGTAATCATTAATCCCTGCCTTGACTGGGACAGATCATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAATCGT?AGGTCATTACCCTGCGATGA Craterium_reticulatum_AB259476 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCATCGTTCCTAATAGGG?GCAGCAGCCCG?CTAGCCGCAAGGCCTG?CAGCTGCAGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCAAGTGCTAAGGCGTCTCCGGGGCCGAAAGGCCTCGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGATCTTTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC?AGGTCATTAACCTGCGACGA Diachea_leucopodia_AB259360 ACTAGTATGAAAGCCAAGCTGAAAGACTTTGCTCAATTATGTAAGTGGTGGTGCATGGCCGTTCGTGGTTCGTGAATTGATTTGTCTGGTTTATTCCGATAACGAGCGAGACCCTATCGTTCCTAATAGGG?GTCGCAGCCAAGCTAACCGCAAGGTCAGCTAGCTGCGATATAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAG?CATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGAACGTA?AAGCGAGTGCTT?AGTGATCCCGGGGCCGAAAGGCTTTGGTAACCACCAAAACGTTCCCTGCCTGGGACAGATCATTGAAATTATTGGTCTCTAACGAGGAATTTTTAGTAGTCGT?AGGTCATTAACCTGCGACGA Diachea_radiata_AB259362 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAGCGTTCCTAGTAGGG?CCAACAGCCCGACTAGCCGCAAGGCTGGTTAGCTGGCGCTAAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCGAGTGCCACATGGCAACCGGGGCCGAAAGGTTCTGGTAACCATTAGTCCCTGCTTAGACTGGGACAGATCATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAAGCAT?AGGTCATTAACCTTTGCTGA Diachea_subsessilis_AB259363 ACACGCATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGCCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCTGACGTTCCTAATAGGG?GCAGCAGCCCGGCTGGCCGCAAGGCCAGTTAGCTGCTGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACACTGGCATGTA?AAGCGAGTGCTTCAGTGTTACCGGGGTCGAAAGGCCCTGGTAACCCTTAATCCCTGCCTAGACTGGGATAGATCTTTGCAATTATTGGTCTTAAACGAGGAATTTTTAGTAATCGC?CGGTCATTAACCTGCGATGA Fuligo_aurea_AB259478 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GCAACAGCCCGGCTGGCCGCAAGGTCAGCTAGCAGTTGCTTATCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAACAAGTGCTAAGGTGTCCCCGGGGCTGAAAAGTCCTGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGATCATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAATCGT?AGGTCATTAACCTACGATGA Fuligo_candida_AB259480 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGG?GCGTCAGCCCGGCTTGCCGCAAGGCCTGCCAGCCGATGCCTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGAAAGTGCTAGGGCATATCCGCGGCCTAACGGTCGCGGTAACCCTTAATCCCTGCCTTGACTGGGATAGACTATTGCAATTATTGGTCTTAAACGAGGAATTTTTAGTAGTCGC?AGGTCATTAACCTGCGACGA Fuligo_candida_AB435344 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGG?GCAGTAGCCCGGCTTGGCCTCGGTCTTGCTAGCTGCTGCTAGGCTTCTTAGACGTATCAGAGCCGACAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCGAGTGCTAGGGCGTATCCGCGGCCTACGGGTCGCGGTAATCCCTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC?AGGTCATTAGCCTGCGACGA Fuligo_leviderma_DQ903676 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCGATTCCGATAACGAGCGAGACCCCGGTGTTCCTAATAGGG?GTACCAGCCCGTCCGGTCGCAAGGCTGGTCAGCTGGTACTGAACTTCTTAGACACATCAGGGCCGACAAGGTCCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTA?AAGCGAGTGCTAAGGCGTTTCCCGGGCCTAAAGGTCCGGGTAACCCATAATCCCTGCTTTGACTGGGATAGATCTTTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAAGCAC?GGGTCATTAACCCGTGCTTA Fuligo_septica_AB259482 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GTCGCAGCCCGGCTGGCCGCAAGGTCAGTTAGCAGCGACTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?TAAAACGTGCTAAGGTGTCCCCGGGGCTGAAAAGCCCTGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGATCATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAATCGC?AGGTCATTAACCTGCGATGA Fuligo_septica_AJ584697 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GGGGCAGCCCGGCCGGCCGCAAGGCTGGTCAGCGGCCCCTCTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGAAGGTGCTAAGGCGTATCCGGGGTCGAAAGGCCCTGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGATCTTTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAAGCAC?AGGTCATTAACCTGTGCTGA Fuligo_septica_f_flava ACGCGTATGAAGGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG?GCCGCAGCCCAGCCGGCCGCAAGGTCGGCTAGCAGCGGCTTAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?TAGCGAGTGCTAAGGCGATACCGGGGCCGAAAGGCCCTGGTAATCCCTAATCCCTGCCTTGACTGGGATAGATCCTTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAATCGC?GGGTCATTAACCCGCGTTGA Hyperamoeba_flagellata_AF411289 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GCTTCAGCCCGGCCGGTCGCAAGATTGGTTAGCTGTTGCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGAA?AAGAAAGTGCTAAGGCGTTTCCGGGGCCGAAAGGTCCTGGTAACCCTTAATCCCTGCCTTGACTGGGATAGATCTTTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAATCGT?AGGTCATTAACCTGCGATGA Hyperamoeba_sp_G1a ACACGCATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCGATTCCGATAACGAGCGAGACCCCGGTGTTCCTAATAGGG?GCGGTAGCCCGTCCGGATTAAGCCCGGGTCAGCTGCCGCTGTACTTCTTAGACACATCAAGGCCGATAAGGTCTTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTA?AAAAGAGTGCTAAGGCGTCTCCCGGGCCTAAAGGTCCGGGTAACCCTTAATCCCTGCTTTGACTGGGATAGATCCTTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAAGCGC?AGATCATTAATCTGTGCTGA Hyperamoeba_sp_W2i ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAGTAGGG?GCCACTGCCCGGCTTGCCGCAAGGCTTGCTAGCAGTGGCTTAGCTTCTTAGACGCATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCGAGTGCCAAGGCGTC?CCGCAGTCTACAGGCCCGGGTAATCCATAGAACCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGC?AGGTCATTAACCTGCGACGA Leocarpus_fragilis_var_bisporus ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAGTAGGG?GCGTTAGCCAAACCGGCCGCAAGGTTGGTTAGCTACCGCCAT?CTTCTTAGACGTATCAGAGCCGAAAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGAA?AAACGAGTGCTAAGGCGTCCCCTCGGCCGAAAGGTCGAGGTAACCCTTAGTCCTTGCTTTGACTGGGACAGATCTTTGAAATTATTGGTCTCTAACGAGGAATTTTTAGTAATCGC?ATGTCATTAACCTGCGTTGA Physarum_albescens_AB259487 ACGCGTATGAAGGTCAAGCTGAAAGACTTTACCCAATGACGTAAGTGGTGGTGCATGGCCGTTCGTGGTTCGTGGATTGATTCGTCTGGTTAATTCCGATAACGAGCGAGACCCTATCGTTCTAAATAGGA?GTTGCAGCCCGATTAGCCGAAAGGTTGATTAGCCGTAGCTCAGCTTCTTAGACGTATCAGGGCCGATAAGGTCCTTGAAATGGGTTAATAACAGGTCAGT?ATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTA?AAGCGAGTGCTTGGGCCCCGCGTTGGTTGAAAGGTCAGCGGAATCCATAGAGCCTGCCTTGACTGGGCTAGGTCATTGTAACTATTGGTCTTAAACGAGGAATTTTTAGTGATCGCCAGGTCATTAATCTGCGCTGA Physarum_album_AB259531 ACACGGATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGATCCTAATAGGG?GTAGCAGCCCGGCTGCCCGCGAGGGCTGCTAGCCGCTACACAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGCA?AAGAGAGTGCCAGGGCAATTCCGCGGCCTACAGGTCGCGGTAACCCCTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC?AGGTCATTAGCCTGCGACGA Physarum_album_AB259532 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGCCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GGAGCAGCCCGGCCGGCCGCAAGGTCGGTTAGCAGCTTCTTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAACGAGTGCTAAGGTGTCCCCGGGGCTGAAAAGTCCCGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGATCATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAATCGT?AGGTCATTAACCTACGATGA Physarum_bivalve_AB259488 ACACGTATGAAGGTCAAGCTGAAAGACTTTACCCAATGATGTAAGTGGTGGTGCATGGCCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GGGGCAGCCCGGGTGGCCGCGAGGTCACCTAGCAGCCCCGTAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?TAGAAAGTGCTAAGGTGTCCCCGGGGCTGAAAAGCCCCGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGATCTTTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAATCGC?AGGTCATTAACCTGCGATGA Physarum_bivalve_AB259490 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATAATGTAAGTGGTGGTGCATGGCCGTTCGTGGTTCGTGGAATGATCTGTCTGGTTTATTCCGATAACGAGCGAGACCCCAGCGTTCTAAATAGGG?GGTCCTGCCCGATTTGCTGCCAGGCAAATCAGCAGGACCCATACTTCTTAGACGGATGAGGGCTGACAAAGTCCTTGAAATGGGTTAATAACAGGTCAGGTATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGAAGGTGCTGGAGTGGCCCCGTG?CTGAGAAGCTTCGGTAATCCGTAGACCCTGCCTTGACTGGGATAGTCCATTGTAATTATTGGTCTTGAACGAGGAATTTTTATTAGGCGC?AGGTCATTAATCTGCGCCGA Physarum_bogoriense_AB259495 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCGATTCCGATAACGAGCGAGACCCCGGTGTTCCTAATAGGG?GGTCCAGCCCGTCCAGGCGCAAGCTTGGTCAGCTGGTCCTGAACTTCTTAGACACATCAGGGCCGATAAGGTCCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTA?AAGCGAGTGCTAAGGCGTTTCCCGGACCTAAAGGCCCGGGTAACCCTTAGTCCCTGCTTTGACTGGGACAGATCTTTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAAGCAC?GGGTCATTAACCCGTGCTTA Physarum_cinereum_AB259498 ACGCGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGACGTAAGTGGTGGTGCATGGCCGTTCGTGGTTCGTGGATTGATTTGTCTGGTTAATTCCGATAACGAGCGAGACCCCAACGCTCTAACTAGGG?GATGTGGCCCGACCGGTTAACTCTAGGCCCAGCCTCATCATCGCTTCTTAGACGTTGCTGGGCCGATAAGGTCCT?ATAACGGGTTAATAACAGGTCAGTGATGCCCTTAGATGTTCTTGGCCGCACGCGCGTTACAATGGCAAGTA?AAGCGAGTGCTTGAGCCCCGCGTTGGTCGAAATGCCAAAGAAATCCCTAGTCCTTGCCAAGACTGGGATAGTCCATTGTAACTATTGGTCTTAAACGAGGAATTTTTAGTGAGCGCCAGGTCATTAACCTGCGCTGA Physarum_confertum_AB259500 ACAAGCACGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGCCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAGCGTTCCTAATAGGG?GCGGCAGCCCAGCAGGCCGCAAGGCCCGCTAGCTGCCTCTTAGCTTCTTGGACGGATCAGGGCCGATAAGGTCCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCTGCACGCGCGTTACAGTGGCATGTA?AAGCGAGTGCT?CAGTGTTCCCGTGGTCGAGAGGTCGTGGTAATCCCTAGTCCTTGCCAAGACTGGGCTAGACCTCTGTAATTATTGGTCTTAAACGAGGAATTTTTAGTAATCGC?CGGTCACCAACCAGCGATGA Physarum_conglomeratum_AB259501 ACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGTGATCCTAGTAGGA?GTGGCAGCCCGGCTCGCCGCAAGGCTTGCTAGCAGCCATAAAGCTTCTTAGACATATCGGGGCTGATAAAGTCCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTCTCAGAAAGTGCTAGGGCGTCTCCGCGATCTACCGGTCGTGGTAACCCTTAATTCTTGCCTTGACTGGGATAGACTATTGCAATTATTGGTCTTCAACGAGGAATTTTTAGTAAGCAC?GGGTCATTAGCCCGTGCTGA Physarum_crateriforme_AB259503 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GCAATGGCCCGACTGGTCGCAAGACCGGTCAGCCGTCGCTTAACTTCTTAGACGTATCGAAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTTTGTA?AAGAGAGTGCTAAGGCGTAACCGAGACCGAAAGGTCTCGGTAACCCTTAAACCCAGCCTTGACTGGGACAGATCATTGTAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCA??CGGTCATTAACCTGCGA??? Physarum_didermoides_AB259504 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GGGGCAGCCCGGCCATTCGTAAGTTTGGTTAGCCGCCTCTTTGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGAAAGTGCTAAGGCGTTACCGGGGCTGAAGGGTCCTGGTAACCCTTAATCCCTGCCTTGACTGGGATAGATCATTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAATCGC?AGGTCATTAACCTGCGATGA Physarum_didermoides_AB259505 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GGAGCAGCCCGGCCAGCAGCAATGTTGGCTAGCCGCGCCTTCGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGAAAGTGCTAAGGCGTTACCGGGGCTGAAGAGTTCTGGTAACCCTTAATCCCTGCCTTGACTGGGATAGATCATTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAATCGC?AGGTCATTAACCTGCGATGA Physarum_didermoides_AY183449 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG?GTAGTAGCCAGACCGGTCGCAAGGCCGTTTAGCCACTACTATACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?TAACGAGTGCTAAGGCGTCTCCGAGGTCGAAAGGTCTCGGTAACCCTTAGTCCCTGCTTTGACTGGGACAGATCTTTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAATCGT?AGGTCATTAACCTGCGTTGA Physarum_digitatum_AB259506 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCATCGTTCCTAATAGGG?GCGGTAGCCCG?CTGACCGCAAGGCTAG?CAGCTGCCGCTTTGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCC?TTAGATGTTCTGGGCCGCACGCGCGTTAAAATGGC?TGTA?AAGCAAGTGCTAAGGCGTCTCCGCGCGCGAAAGGCTCCGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGATCTTTGCA?TTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGT?AGGTCATTAACCTACGACGA Physarum_flavicomum_AB259507 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCATCGTTCCTAATAGGG?GCGGTAGCCCG?CCGATCGAAAGGTCGG?CAGCCTCCGCTTAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?TAGCGCGTGCTAAGGCGTCTCCGGGGCCGAAAGGTCCTGGTAACCCTTAATCCCTGCCTTGACTGGGATAGATCTTTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGT?AGGTCATTAACCTACGACGA Physarum_flavicomum_AB259508 ACACGAATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTGGTTCGTGGATTGATTTGTCTGGTTAATTCCGATAACGAGCGAGACCCTATCGTTCCTAATAGGAGGCTACAGCCCGATCGGTCGAAAGACTGGTTAGCCGTAGCTTAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCGAGTGCTTAGGCTATACCTGGATCGAAAGGTCTTGGTAATCCATAATCCCTGCCTTGACTGGGATAGATCATTGCAATTATTGGTCTTAAACGAGGAATTTTTAGTAATAGCCAGGTCATTAACCTGCGCTGA Physarum_florigerum_AB259509 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCATCGTTCCTAATAGGG?GCGGCAGCCCG?CCGGCCGAAAGGTCGG?TAGCTTCCGCTTTGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCAAGTGCTAAGGCGTCTCCGGGGCCGAAAGGTCCTGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGATCATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGT?AGGTCATTAACCTACGACGA Physarum_hongkongense_AB259511 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTGGTTCGTGGATTGATTTGTCTGGTTAATTCCGATAACGAGCGAGACCCTAGCGTTCTAAATAGGG?TGCTTAGCCAAATCTGCCGCAAGGCAGGTTAGCTTCGCGCAAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATGTA?AAGCAAGTGCTTGAGTTTCCCCGTGGCTGAAAAGCTATGGTAATCCTTAAGACTTCCCTTGACTGGGCTAGATCTTTGGAATTATTGGTCTTAAACGAGGAATTTTTAGTAATAGCCAGGTCATTAGCCTGCGCTGA Physarum_lakhanpalii_AB259512 ACACGTATGAAGGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCGATTCCGATAACGAGCGAGACCCCGGTGTTCCTAATAGGG?GTGGTAGCCAGTCTGGTCGAAAGGCCGGTCAGCTGCCGCTGTACTTCTTAGACACATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCAAGAA?AAGAGAGTGCTAAGGCGTTTCCCGGGCCTAACGGTCCGGGTAACCCTTAGTCCCTGCTTTGACTGGGACAGATCATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAAGCAC?AGGTCATTAACCTGTGCTTA Physarum_lakhanpalii_AB259513 ACGCGTATGAAAGTCAAGCTGAAAGACTTTACTTAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTCGTCTGGTCGATTCCGATAACGAGCGAGACCCCGGTGTTCCTAATAGGG?GCGTTAGCCCGCTGGGCTTAACGGCTTGGCAGCTTCCGCTTAACTTCTTAGACACATCAGGGCCGATAAGGTCCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGAA?TAAAAAGTGCTAAGGCGTTTACCGGGCCTAACGGTCTGGGTAACCCTTAATCCCTGCTTTGACTGGGATAGATTTTTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTCAGCGC?AGGTCATTAACCTGCGTTGA Physarum_lateritium_AB259514 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGCCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GTGGCAGCCCGGCTGGCCGCAAGGTCAGCTAGCTGCTGCTTAGCTTCTTGGACGGATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAGTGGCATGTA?AAGCAAGTGCTTCAGTGTTCCCGGAGTCGAAAGGCTGTGGTAATCCCTAGTCCTTGCCAAGACTGGGATAGACCATTGCAATTATTGGTCTTAAACGAGGAATTTTTAGTAATCGC?AGGTCATTAATCTGCGATGA Physarum_loratum_AB259515 ACACGCATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCGATTCCGATAACGAGCGAGACCCCGGTGTTCCTAATAGGA?GCCGAAGCCCGTTCACTGTAACAGGTGGACAGCTAAGGCTGTACTTCTTAGACACATCATGGCTGATAAAGTCATTGAAATGGGTTAATAACAGGTCAGTAATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?TAACAAGTGCTAAGGCGTTTCCTGGACCTAACGGTTCAGGTAACCCTTAATCCTTGCTTTGACTGGGATAGATCATTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAAGCAT?AGGTCATTAACCTATGCTTA Physarum_luteolum_AB259518 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGCCGTTCGTGGTTCGTGGATTGATTCGTCTGGTTAATTCCGTTAACGAGCGAGACCCTAACGTTCTAAATAGGG?GGTACAGCCCACCCGGTCGAAAGGCCGGGTAGCCGTAGCTAAACTTCTTAGACGTATCAGGGCCGATAAGGTCCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTA?AAGCGAGTGCTTGAG?TTGACCGTGGCCGAAAGGCTTCGGGAATCCATAATCCCTGCCTTGTCTGGGATAGACTCTTGAAATTATCGGTCTTGAACGAGGAATTTTTAGTAATAGCCAGGTCACTAGCCTGCGCTGA Physarum_melleum_AB259520 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GTAGCAGCCCGGCCGGTCGCAAGATCGGCTAGCCGCTACTTCACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCGAGTGCTAAGGCGTTACCGGGGCCGAAAGGTTCTGGTAACCCTTAATCCCTGCCTTGACTGGGATAGATCATTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAATCGC?AGGTCATTAACCTGCGATGA Physarum_melleum_AB259521 ACACGCATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGG?GCAGCAGCCCGGCCG?CCGCAAGG?CGGCCAGCCGCAGCTATGCTTCTTAGACGTATCAGGGCCGACAAGGTCCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCTCGTA?TAAACAGTGCCAAGGTGTTCCCGGGGCCGAAAGGTCCTGGTAACCCTTAGTCCCTGCCCTGACTGGGACAGATCATTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAATCGC?GGGTCATTAACCCGCGATGA Physarum_melleum_AB259523 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCGATTCCGATAACGAGCGAGACCCCGGTGTTCCTAATAGGA?GCGGAAGCCCGGCCGGCCGCAAGGTTGGTCAGCTACTGCTGTACTTCTTAGACACATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCAAGTA?AAGAGAGTGCTAAGGCGTTTCCCGGGCCTAACGGTCTGGGTAACCCTTAGTCCCTGCTTTGACTGGGACAGATCATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAAGCAC?GGGTCATTAACCCGTGCTTA Physarum_melleum_AB435350 ACACGAATGAAGGTCAAGCTGA?TGACTTTACTAAATGATGTAAGTGGTGGTGCATGGTCGTTCGTGGTTCGTGGATTGATTTGTCTGGTTAATTCCGATAACGAGCGAGACCCTCTCGTTCCTAATAGGG?GTTACAGCCAAACTGGTCGAAAGACTGGTTAGCCGTAGCATTGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCAAGTGCTTAGGCTTTACCAGGGTCGAAAGGCCCAGGTAATCCTTAAACCCTGCCTTGACTGGGATAGGTCATTGCAACTATTGGTCTTAAACGAGGAATTTTTAGTAATAGCCAGGTCATTAACCTGCGCTGA Physarum_mortonii_AB259524 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCGATTCCGATAACGAGCGAGACCCCGGTGTTCCTAATAGGG?GCGGGAGCCCG?CTGGCCGCAAGGCCAG?CAGCTACCGCTGTACTTCTTAGACACATCAGGGCCGATAAGGTCCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTA?TAGAAAGTGCCAAGGCGTATCCCGGGCCTAACGGCTCGGGTAACCCTTAGTCCCTGCTTTGACTGGGATAGATCCTTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAAGCGC?GGGTCATTAACCCGTGCTGA Physarum_mutabile_AB259525 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCGATTCCGATAACGAGCGAGACCCCGGTGTTCCTAATAGGG?GCGGGAGCCCGTCTAGCCGAAAGGTTGGTCAGCTCCCGCTGTACTTCTTAGACACATCAAGGCCGATAAGGTCTTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGAA?AAGAAAGTGCTAAGGCGTATCCCGGGCCTGATGGTCCGGGTAACCCTTAATCCCTGCTTTGACTGGGATAGATCATTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAAGCGT?AGGTCATTAACCTGCGTTGA Physarum_nigropodum_AB259527 ACACGTATGAAGGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGCCGTTCCTAATAGGG?GCGGTAGCCCG?CTGGCCGAAAGGCCTG?CAGCTGCCGCTTAACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?TAGCGCGTGCTAAGGCGTCTCCGGGGCCGAAAGGTCCTGGTAACCCTTAATCCCTGCCTTGACTGGGATAGATCTTTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGT?AGGTCATTAACCTACGACGA Physarum_nucleatum_AB259528 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCATCGTTCCTAATAGGG?GCGGCAGCCCG?CTGACCGAAAGGTTAG?TAGCTTCCGCTTTGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCAAGTGCTAAGGCGTCTCCGGGGCCGAAAGGTCCTGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGATCTTTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGT?AGGTCATTAACCTACGACGA Physarum_plicatum_AB259533 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GCAGCAGCCCGGCTGGTCGCAAGGCCAGTTAGCCGCTGCTTCACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCGAGTGCTAAGGCGTTACCGGGGCCGAAGGGCTCTGGTAACCCTTAATCCCTGCCTTGACTGGGATAGATCATTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAATCGC?AGGTCATTAACCTGCGATGA Physarum_polycephalum_X13160 ACGCGTATGAAGATCAAGCTGAAAGACTTTATCCGATGACGTAAGTGGTGGTGCATGGCCGTTCGTGGTTCGTGGATTGATTTGTCTGGTTAATTCCGATAACGAGCGAGACCCCGACGTTCTTAATAGGG?GCCACAGCCAAAGCGGTCGAAAGGCCGCTTAGCTAAGGCCCAGCTTCTTAGACGTTTCTGGGCCGATAAGGTCCATTAAATGGGTTAATAACAGGTCAGAGATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTA?AAGCAAGTGCTTGGGCCCCGCGTTGGTCGAGCGGCTAATGGAATCCATAAACCTTGCCTTGACTGGGCTAGGTCTTTGTAACTATTGGTCTTAAACGAGGAATTTTTGGTATTCGCCAGGTCATTAACCTGCGCCGA Physarum_psittacinum_f_fulvum ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GTGGCAGCCCG?CTGGCCGAAAGGTTAG?TAGCCGCCGCTTTGCTTCTTAGACGTATCAGAATCGATAAGGTTCTTGAAATGGGTCAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?TAGAACGTGCTAAGGCGTTTCCGGGGCCGAAAGGCTCTGGTAACCCTTAGTCCCTGCTTTGACTGGGACAGATCTTTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAATCGT?AGGTCATTAACCTGCGATGA Physarum_pulcherrimum_AB259536 ACACGTATGAAAGTCAAGCTGAAAGACTT?ACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATT?GTCTGGTTTATTCCGATAACGAGCGAGACCC?AACGTTCCTAATAGGG?GCACTAGCCCGGCTTACCGCAAGGTAGGTTAGCTAGAGCTTTGCTTCTTAGACGTATCAGAGCCGATAAGGCGCTTGAAATGGGTTAATAACAGGTCAGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTA?AAGCGAGTGCTAAGGCTTTGCCGGGGCTGAAAGGCTTCGGTAATCCTTAATCCCTGCCTTGACTGGGATAGATCATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGGCGC?AGGTCATTAACCTGCGTCGA Physarum_pusillum_AB259537 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTTTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGA?GCTTTAGCCCGGCGTGTCGCAAGACGTGCTAGCTATCGCTTTGCTTCTTAGACGTATCAGAGCCGATAAGGCGCTTGAAATGGGTTAATAACAGGTCAGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCAAGTGCTAAGGCTTTGCCGGGGCCGAAAGGTCTCGGTAATCCCTAATCCCTGCCTTGACTGGGATAGATCATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTATGCGC?AGGTCATTAACCTGCGTCGA Physarum_reniforme_AB259538 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTTTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GCTTTAGCCCAGTGCGTCGCAAGGCGTACTAGCTATCGCTTTGCTTCTTAGACGTATCAGAGCCGATAAGGCGCTTGAAATGGGTTAATAACAGGTCAGTGATGCCCTTAGATGTTCTGGGCCGCACGCACGTTACAATGGCATGTA?AAGCGAGTGCTAAGGCTTTGCCGGGGCTGAAAGGTCTCGGTAATCCTTAATCCCTGCCTTGACTGGGATAGATCATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGGCGC?AGGTCATTAACCTGCGTCGA Physarum_reniforme_AB259539 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTTTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGA?GCTTTAGCCCGGTGCGTCGCAAGGCGTACTAGCTATCGCTTTGCTTCTTAGACGTATCAGAGCCGATAAGGCGCTTGAAATGGGTTAATAACAGGTCAGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCGAGTGCTAAGGCTTTGCCGGGGCTGAAAGGTCTCGGTAATCCCTAATCCCTGCCTTGACTGGGATAGATCATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGGCGC?AGGTCATTAACCTGCGTCGA Physarum_rigidum_AB259541 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GCCGCAGCCAAGCCCGCCGCAAGGTGGGCTAGCCGCAGCTTAGCTTCTTAGACGTATCGTAGCCGATAAGGTTACTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGAA?AAGATAGTGCTAAGGCGTTCCCGGGGCCGAAAGGTCTTGGTAACCCTTAGTCCCTGCCCTGACTGGGACAGATCTTTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAATCGC?GGGTCATTAACCCGCGATGA Physarum_roseum_AB259543 ACACGAATGAAAGACAAGCTGAAAGACTTTTCTAAATGATGTAAGTGGTGGTGCATGGCCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCGATTCCGATAACGAGCGAGACCCCTATGATCTCAATAGGA?GAGGTAGCCAAGCTTGCCGCAAGGCTTGCTAGCAACCGCGAAGCTTCTTAGACATATCAGGGCTGAAAAAGTCCTTGAAATGGGTCAATAACAGGTCAGTCATGCCCTTAGATGTTCCGGGCCGCACGCGCGTTACAATGGCACGTCTCAGAAAGCGCTAGGGCTTCCCCGCGACCTAACGGTTGTGGTAACCCATAAGTCTTGCCTTGACTGGGATAGACTATTGTAATTATTGGTCTTTAACGAGGAATTTTTAGTAGGCAC?GGGTCATTAGCCCGTGCCGA Physarum_stellatum_AB259545 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCATCGTTCCTAATAGGG?GCGGTAGCCCG?CCGGCCGCAAGGCTGG?TAGCTTCCGCATTGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCAAGTGCTAAGGCGTCTCCGGGGCCGAAAGGTCCTGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGATCTTTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGT?AGGTCATTAACCTACGACGA Physarum_sulphureum_AB259546 ACACGTATGAAAGCCAAGCTGAAAGACTTTGCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GTGACAGCCCGGCCGGCCGCAAGGCCGGCTAGCCGTCACTCTACTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCGAGTGCTAAGGCGTTACCGGGGCCGAAAGGCTCTGGTAACCCTTAATCCCTGCCTTGACTGGGATAGATCATTGCAATTATTGGTCTCTAACGAGGAATTTTTAGTAGTCGT?AGGTCATTAACCTACGACGA Physarum_superbum_AB259547 ACGCGTATGAAGGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTCGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGTGTTCCTAATAGGG?GCGGAAGCCCG?CCGGTCGCAAGATCGG?TAGCGGCCGCTGTACTTCTTAGACACATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCAAGAA?AAGAGAGTGCTAAGGCGTTTCCTGGGCCTAACGGTCTGGGTAACCCTTAGTCCCTGCTTTGACTGGGACAGATCATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAAGCGC?GGGTCATTAACCCGTGCTTA Physarum_tenerum_AB259550 ACACGTATGAAGGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGG?GTGGCAGCCAAGCCGGTCGCAAGATCGGTTAGCCGTCGCTTAACTTCTTAGACGTATCAGAGCCGACAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?TACCGAGTGCTAAGGCGTCCCCGGGGCCGAAAGGTCTCGGTAACCCTTAGTCCCTGCTTTGACTGGGACAGATCTTTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAATCGT?AGGTCATTAACCTGCGTTGA Physarum_viride_AB259551 ACACGTATGAAAGACAAGCTGCAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTACTAGGG?GCAGCAGCCCGGCTGGTCGCAAGGCCCGTTAGCCGCTGCCAAGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTA?AAAAGAGTGCTAGGGCGTATCTGCGGCTTACGGGTCGCGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGACTATTGTAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGC?AGGTCATTAGCCTGCGACGA Physarum_viride_AB259552 ACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGG?GTAACAGCCCGG?TGGCCGCAAGGTCA?CTAGCAGTTGCTTTGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTA?AAGCAAGTGCTAAGGTGTCCCCGGGGCCGAAAGGTCCTGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGATCTTTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAATCGC?AGGTCATTAACCTGCGATGA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Fig._4) = N: 1-417; CODONPOSSET CodonPositions (CHARACTERS = Fig._4) = N: 1-417; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4474] TITLE Fig._2; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1451; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=- GAP= #; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Amaurochaete_comata TAAAGATTAAGCCATGCATGTCTAAGACAATGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCTGCAAACCAGTTGTAAACCTAAGCAAGTTATATGGATAACCGTGGTAATTCTGAGGCTAATACATGATCCGGGCGGCAAGGGACGCGCGATTATCGTGAAAGAACGCGCGCCTGGTGGCGCTT-GCATCGTGCTTCTGACCTATCCACTAGACGGCAGCGTAACGGACATGCTATGGTAACAACGAGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTTATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGTCAATGACTGAGGGCATTAGGGGACATATGAATGGCTGCCTTTAAGGTGGCCAATTCAAATGGGTTTGTCGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGACTGGTGCCAGCACCCGCGGTAAGTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCCGGGCGCGCCGGTGGCCGTGGGCGCCATTTACCGTGATTAAACTGGCGTGATCAAGGCAGGCCGTTCCTGCACAGCTCAGCACGGGATAAAAGAGCAGCAAAAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCTAAGGCGAAAGCAGTCATCAAGGGCACGCCCATTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGGCTAGAGATAGGGCAATGTCCATCTCGACTCCCCCTGGATCTTAGGGAAACCAAAGCCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCAAGATACACGTATGAAAGACAAGCTGATAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGGGTGGCCTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGCTCTAACTAGGGGCGGCAGCCCGGCTAGCAGCCGCCTCTTCTTAGACGGATCGAGGCCGAAAAGGTCTCTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGCAAAACAAGTGTTCCATGGCCTACAGTTCGTGGTAAACCGTAAGGCCTGCCTTGACTGGGATAGACTATTGCAATTATTGGTCTTCAACGAGGAATTTTTAGTAGTCGCGCGTCATTAGCGCGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGCGTTCGGAGGCCGGGACAAC Badhamia_panicea_var_nivalis -------------------------------GAAGAAGCAA-TCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACCATAGCAAGCTACAAGGATAACCCCGGTAATTCTGAGGCTAATACATGACTG--AGGCTGGGGACCGTGCGAGTTATCGGAAAAGTCGCATTCTGGGCGGCTCTT-GCAAGGTGCTTCTGACCTATCAACTAGATGGCAGCGTAAGGGACATGCTATGGTGACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCACACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGGCAATGCCCGAGGGCGTTAGGGGACATATGAATGCCTGCCATTT-GGTGGGCAATTCAAATGGGTCTGTTCTAAACAGCCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGCGCGCCAACCGGCCCGGGTGCCTATCACCATGATTAAACTGGAGTGATCAAAGCATGTCTTTTACGCACAGCGCAGCATGGTATCCTTGAAAGGCGAAAGGGATGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCATGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATGCAAACCAGGGATAGGACACTGTCCATCTCGACTCCTCCCGAACCTTATAGAAATTACAGTCTTTAGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCGGATACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCATCGTTCCTAATAGGGGCGGTAGCCCGCCCAGCCTCCGCTTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTATAGCGCGTGCTCCGGGGCCGAAAGGTCCTGGTAACCCTTAATCCCTGCCTTGACTGGGATAGATCTTTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGTAGGTCATTAACCTACGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGAGTTTTACAGTTACGTGTTTGGAGGTACTGGTGCT Comatricha_nigra TAAAGATTAAGCCATGCATGCCTTCGAATAAGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACAGAGGCAAGTTATATGGATACCCGTGGTAATTCTGAGGCTAATACATGA-TT-GGTGGCGGGGGACGCGCGACGCTCGGGAAAGAACGCGCGCCTGGTGGCTCTT-GCTGCGTGCTTCTGACCTATCAACTAGATGGCAGCATAAGGGACATGCCATGGTGACAACGGGTACAGAGGATCAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCAATGGACAACGTCTGAGGGCGTTAGGGGACATATGAATGGCTGCACTAGTTGTGGCCAATTCAAATGGGTTTGTCGTAAACAGACTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCAGTTAAAACGCTCGTAGTCGGCGGAACGCGCCGGTGGCGGCGGGTGCCATTTGCCATGATTAAACTGGGGTGATTAAAGCAGGCCATTATTGAACAGATCAGCATGGCATAAGGGTGCTGCAAAAGGAGTGTTCGGGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAAGCGAAGGCAGTCATCAAGGGCACATCCATTGATCAAGAGCGAAAGTTAAGGGTTCGAAAACGATCAGATACCGTTGTAGTCTTAACTATAAATGATACTGGCCAGGGATAGGGCAGTGTCCATCTCGACTCCCTCCGGACTTTAGGGAAACCAAAGCCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGGAAACTTACCAGGTCAAGATACACGGATGAAGGACAAGCTGATAGACTTTTCCCAATGATGTAAGTGGTGGTGCATGGCCGTTCTTAGTGCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGCGCGAGACCCCGACGCTTTAAGTAGGTGCGGTAGCCCGGTCAGCAGCCGCCCCTTCTTAGACGGATCGAGGCCGACAAGGTCTCTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGCAAAACGAGTGTTCCAGGGCCGACAGGGTCTGGCAAACCCTAAGGCATGCCTCGACTGGGCTAGACTCTTGCAATTATGGGTCTTAAACGAGGAATTTTTAGTATTCGCGGGTCATCAACCCGCGGGTAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTACGGTTACGCGTTCGGAGGTCGAGTTGAC Comatricha_nigricapillitia_1 TAAAGATTAAGCCATGCATGTCTTCGAATATGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACCAAAGCAAGCTATATGGATAACCGTGGTAATTCTGAGGCTAATACATGACCTCGGCAGCCGGGGACGCGCGAGAATCGGGAAGGAACGCGCGCCTGGTGGCTCTT-GAGCTGTGCTTCTGACCTATCAACTAGATGGCAGCATAAGCGACATGCAATGGTAACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGACAATGTCCGAGGGCGTTAGGGGAAATATGAATGGCTGCCCTCGTGGTGGCCAATTCAAATGGGTTTGTCGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCAGTTAAAACGCTCGTAGTCGGCGGGGTGCGCCGGTGGGGCCGGGTGCCATTGGTCGTGATTAAACTGGGGTGCTTAAGGCAGGCCGTTCTTGCACAGCACAGCACGACATTAAAGGTTAGCAAAAGGGGTGTTCGGGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCACACCCATTGATCAAGAGCGAAAGTTAAGGGTTCGAAAGCGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGGCCAGGGATAGGGCAATGTCCATCTCGACTCCCCCTGAACTTTAGGGAAACCAAAGCCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGGAAACTCACCAGGTCAAGATACGCGAATGAAAGACAAGCTGAGAGACTTTTCTCAATGACGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAGCGTTCTAACTAGGGGTGGTGGCTATGCAAGCTGCCGCTTCTTCTTAGACGGATCGGGGCCAAAAAGGTCCCTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCAGGGAAAACAAGTGTTCCGGGCCCTAACGGGTCCGGTAATCACTAGGCCCTGCCTCGACTGGGATAGTCTCTTGCAATTATGGGTCTTAAACGAGGAATTTTTAGTAGGCGCGGGTCATCAGCCCGCGCCGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGCCTGGCGGTTACGCGTTCAGAGGCTGCGG-AGC Comatricha_nigricapillitia_2 TAAGGATTAAGCCATGCATGTCTTCGAATATGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACAAAAGCAAGCTATATGGATACCCGTGGTAATTCTGAGGCTAATACATGACTCCGGTGGTCGGGGACGCGCGAAAATCGGGAAAGAACGCGCGCCTGGTGGCTCTT-GCGATGTGCTTCTGACCTATCAACTAGACGGCAGCGTAACGGACATGCTATGGTAACAACGGGTACAGAGGATCAGGGTTTGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCATGGACAATGTCCGAGGGCGCTAGGGGAAATATGGATGGCTGCCCTCGTGGTGGCCAATCCAAATGGGTTTGTCGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCAGTTAAAACGCTCGTAGTCGGCGGGGTGCGCCGGTGGGGCCAGGTGCCATTGGTCGTGATTAAACTGGGGTGCTCAATGCAGGCCTAATATGTACAGCACAGCACGACATTAAAGTTGGGCAAAAGGGGTGTTCGTGGGTGACCGAACTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGTCCAAATGCGAAAGCAGTCATCAAGGGCACACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGGCCAGGGATAGGGCAATGTCCATCTCGACTCCCCCCGGACCTTTGGGAAACCAAAGCTTATGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGGAAACTCACCAGGTCAGGATACGCGGATGAAGGACAAGCTGAGAGACTTTTCTCAATGACGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAGCGTTCTAACTAGGGGTGGTGGCTATGCAAGCTGCCGCTTCTTCTTAGACGGATCGGGGCCAAAAAGGTCCCTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCAGGGAAAACAAGTGTTCCGGGCCCTAACGGGTCCGGTAATCACTAGGCCCTGCCTCGACTGGGATAGTCTCTTGCAATTATGGGTCTTAAACGAGGAATTTTTAGTAGGCGCGGGTCATCAGCCCGCGCCGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGCCTGGCGGTTACGCGTTCAGAGGCTGCGG-AGC Comatricha_sinuatocolumellata TAAAGACTAAGCCATGCATGTCTTCGAATAAGAGG-TGCAATTCTCTCTGAATCTGCGAACGGCTCCGAAAAACAGTTGTAAGATCTAGCAGGTTATATGGATAACCGTGGTAATTCTGAGGCTAATACACGA-CTGGGCGGTGGGGGCTGTGCACCATCCGGAAAGATGCACGCCCCCGGTGGCGCCT-GGACATCGCTTCTGACCTATCAATTAGACGGCAGCTTATGGGACATGCTATGGTGGCAACGGGTACAGAGGATAAGGGTTTGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGCCAATGGCCGAGGGCGTTAGGGGACATATGAATGGCTGCCTTAACGGTGGCCAATTCAAATGGGTCTGTTGTAAATAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGGGGGGCGCGCCAGGACTGCTGGGTGCCGATTGCCGTGATTAAACTGGCGTGCTCAAGGCAAGTCGAAGCTGCACAGCTCAGCACGGCATAAGAGATACGCGAAAGGGATGTTCGGGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAAGCGAAAGCAGTCATCAAGGGCATGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGGCCAGGGATAGGGCAATGTCCATCTCGACTCCCCCCGGATCTTTAGGAAACTAAAGCCTATGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCAGGATACACGGATGAAGGACAAGCTGATAGCCTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCTAACTAGGGGTGGCAGCCCGGCTAGCAGCCGCTTCTTCTTAGACGGATCAGGGCCGATAAGGTCCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTACGCAAAACAAGTGTTCCAGGGCCGACAGGGCTTGGTAAACCCTAAGGCCTACCCCGACTGGGATAGACTATTGCAATTATTGGTCTTTAACGAGGAATTTTTAGTAGTCATGGGTCATTACCCCGTGGCGAATGAGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGAGTTCAGAGGCTGGGGTAGC Diderma_globosum TAAAGACTACGCCATGCATGCCTTCGAACACGAGGAAGCAATTCTCTCTGAATCTGCCAACGGCTCCGCAAACCAGTTGTAAACCAAAGCAAGCGATACGGATAACCCTGGTAATTCTGAGGCTAATACGAGACTGGTAGGCTGGGGGGCGTGTGATTTCCAGGAAGGGGTGCACTCTGAGCGGCTCTT-GCGATGTGCTTCTGACCTATCAACTAGATGGCAGCGTAACGGACATGCCATGGTTACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGGCAATGCCCGAGGGCGTTAGGGGACATATGAATGGTTGCCTTTTAGGTGGCCAATTCAAATGGGTCTGTTCTAAACAGCCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCAAGGCGCTCCGGCGGCTTGGGGTGCCACTTACCATGACTAAACCGGCTCGATCAAGAAAGGTCACGCTTGCACGGCACAGCATGGCATAAGTGAGAAGCAAAAGGGGTGTTCGAGGGTGACCGAATTGCTGGGCGAGTGGTGAAATACGTTGACCCTAGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCATTCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGAGATAGGATTCTGTCCATCTCGACTTCTCCTGGATCTTTGAGAAATTATAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCGGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGGGTGGCAGCCCGGCTAGCAGCCACTTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGGTTACACAGTGCCCCGGGGCCTACAGGCCTCGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGTAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGAGTTCAGAGGATGTGGCTCC Diderma_niveum TAAGGACTAAGCCATGCATGCCTTCGAATACGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCACACCAGTTGTAAACCAAAGCAAGCGATACGGATAACCCTGGTAATTCTGAGGCTAATACGAGA--GGAAGGCTGGGGGGCGTGTAAAAACCGGGAAGGGGTACACTCTGAGTGGCTCTT-GCGAGGTGCTTCTGACCTATCAACTAGATAGCAGCGTAACGGACATGCCATGGTTACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGACAATGTCCGAGGGCGTTAGGGGACATATGAATGGTTGCCTTTTAGGTGGCCAATTCAAATGGGTCTGTTCTAAACAGTCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCATGGTGCTCTGGCGGCTTGGGGTGCCACTTACCATGATCAAACCGGCTCGATCAAGAAAGGTCACGCTTGCACGGCTTAGCATGGAATAAGCGAGAAGCAAAAGGGGTGTTCGAGGGTGACCGAATTGCTGGGCGAGTGGTGAAATACGTTGACCCTAGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCATTCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGAGATAGGATTCTGTCCATCTCGACTTCTCCTGGATCTTAGGGAAACTATAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTCCGTTCCTACTAGGGGTGGCAGCCCGGCTAGCAGCTACTTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGAATAAAAAGTGCCCCGGGGCCTACAGGCTCTGGTAACCCCTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGTAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGAGTTCGGAAGATGTGGCTCC Didymium_anellus ---------AGCCATGCATGCTTTCGAATAAGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCACACCAGTTGTAAACTATAGCAAGCGATAAGGATAACCCTGGTAATTCTGAGGCTAATACAAGACTGGGAGGCTGGGGGACGTGTGGTGACCGGGAAAGGATGCACCCCGAGCGGCTCTT-GCGATGTGCTTCTGACCTATCAACTAGATGGCAGCGTAACGGACATGCTATGGTTGCAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGACAATGTTCGAGGGCGTTAGGGGACATATGAATGCTTGCC-ATT-GGTAGGCAATTCAAATGGGTCTGTTCTAAACAGCCTCTCGAGTAACAATTAGAGGACAAGTTTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCGTACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCAAGGCGCGCCGGCGGCTTGGGGTGCCACTTACCATGACTAAACCGGACCGATTAAGAGAGGTCTCTCTTGTACGGCTCAGCATGGGATAATTGAAAAGCAAAAGGGGTGTTCGAGGGGGACCGAATTTCCGGGCGAGTGGTGAAATACGTTGACCCTGGAAAGTCGACCAAAGGCGAAAGCAGTCCTCAAGGGCATTCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGAGATAGGATTCTGTCCATCTCGACTTCTCCTGGATCTTAGGGAAACTAGAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTC-TTCGTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGGGCGGCAGCCCGGCTAGCAGCCGCTTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTATAGAAAGTGCCCCGGGGCCTAACGGTCCCGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGCGTTCCGAGACTAGGCGTCC Didymium_dubium_K15 TAAAGACTAAGCCATGCATGTCTTCGAATAAGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGCAATAGGGATAACCCTGGTAATTCTGAGGCTAATACCACCCTGGAAGGCTGGGGGGCGTGCAATTACCGGGAAGGGACGCACTTCTAGCGGCTCTT-GCTGTGTGCTTCTGACCTATCAACTAGATGGCAGCGTAAGGGACATGCTATGGTGACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTTATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCATTGGACATCGTCCGAGGGCGTTAGGGGACATATGAATGTCTGCCCATTGGGTGGACAATTCAAATGGGTCTGTTCTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGAGGTGCGCTGGCGGCTTGCGGTACCACTTACCATAATCAAACTGGGGTGATCAAAGCAGGTCGTCCTTGCACAGCACAGTATGGCATAAGTGAGAAGCGATAGGGACGTTCGAGGGTGACCGAATTGCTGGGCGAGTGGTGAAATACGTTGACCCTAGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCATACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACTAGGGATAGGACACCGTCCATCTCGACTCCTCCTGAACCTTAGAGAAATCAAAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCGGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTTTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGGGTGGCAGCCCGGCTAGCACCCACCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTAGGCTTAAACAGTGCCCCGGGGCCGACGGGTCCCGGTAACCCCTAGTCTCTCCCTTGACTGGGCCAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAATCGCAGGTCATTAACCTGCGATGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGAGTTCCGAGGTCGCGGCCGT Didymium_iridis_CR19 ----GACTAAGCC-TGCATGCCTTCGAATAAGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCACACCAGTTGTAAACTATAGCAAGCCACATGGATAACCCTGGTAATTCTGAGGCTAATACGAGACTGGAAGGCTGGGAGGTGTGTGATTGCTGGGAATAGACACACCCTGAGCGGCTCTT-GCTTTGTGCTTCTGACCTATCAACTAGATGGCAGCGTAACGGACATGCTATGGTTACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGTGCAATGCATGAGGGCGTTAGGGGACATATGAATGTCTGCCCTATGGGTGGACAATTCAAATGGGTCTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGAAGTCGGCGGGGCGCACTGGCGGCTGGGGGTACCAATTACCATGACTAAACTGGGTTGATCAAGTAAGGCCATTCTTGCACAGCACAGCATGGTATAAACGAAAAGCGATAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTTATCAAGGGCACACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGGGATTGGACCCTGTCCATCTCGACTCCTTCAAGACCTTGGAGAAATTACAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTACTAGGGGTGGCAGCCCGGCTAGCAGCCACCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATAGAACGTGCTCCGCGGCCTACTGGTCGCGGTAATCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGGCGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGAGTTCGGACGTGCTGGTTAC Didymium_iridis_CR8 TAAAGACTAAGCCATGCATGCCTTCGAATACGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAG-AAGCAACACGGATAACCCTGGTAATTCTGAGGCTAATACGAGACTGGAAGGCTGGGAGGTGTGTGATTGCTGGGAATAGACACACCCCGAGCGGCTCTT-GCTTTGTGCTTCTGACCTATCAACTAGATGGCAGCGTAACGGACATGCTATGGTTACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGTACAATGTATGAGGGCGTTAGGGGACATATGAATGTCTGCCCTATGGGTGGACAATTCAAATGGGTCTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGCGCGCTGGCGGCTGGGGGTGCCACTTACCATGATTAAACTGGGTTGATCAAGTAAGGTCGTTCTTGCACAGCACAGCATGGTATAAACGAGAAGCGATAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCACACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGGGATAG-ACTCTGTCCATCTCGACTTCTTCTGGACCTTGGAGAAATTACAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGGGCGGCAGCCCGGCTAGCAGCCGCCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATAGAACGTGCCCCGCGGCCTACTGGC----GTAATCCTTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGAGTTCGGAGGCAGCGGTTAC Didymium_iridis_CUR1 --------------TGCATGCCTTCGAATAAGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCACACCAGTTGTAAACTATAGCAAGCCACATGGATAACCCTGGTAATTCTGAGGCTAATACGAGACTGGAAGGCTGGGAGGTGTGTGATTGCTGGGAATAGACACACCCTGAGCGGCTCTT-GCTTTGTGCTTCTGACCTATCAACTAGATGGCAGCGTAACGGACATGCTATGGTTACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGTGCAATGCATGAGGGCGTTAGGGGACATATGAATGCCTGCCCTTTGGGTGGGCAATTCAAATGGGTCTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGCGCGCTGGCGGCTGGGGGTGCCACTTACCATGATTAAACTGGGTTGATCAAGTAAGGTCTTTCTTGCACAGCACAGCATGGTATAAGCTAGAAGCGATAGGGATGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCATACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGGGATAGGACTCTGTCCATCTCGACTCCTTCTGGACCTTGGAGAAATTACAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGGGCGGCAGCCCGGCTAGCAGCCGCCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATAGAACGTGCTCCGCGGCCTACTGGCCGCGGTAATCCCTAGTCTCTCCCTTGACTGGGCCAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGAGTTCGCAGGTCGTGGTCAC Didymium_iridis_HA4 --------------TGCATGCCTTCGAATACGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGCAACATGGATAACCCTGGTAATTCTGAGGCTAATACAAGACTGGAAGGCTGGGAGACGTGTAGATGCTGGGAATAGATGCACCCCGAGCGGCTCTT-GCTTTGTGCTTCTGACCTATCAACTAGACGGCAGCGTAATGGACATGCTATGGTTACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGTGCAATGCATGAGGGCGTTAGGGGACATATGAATGCCTGCCCAATGGGTGGGCAATTCAAATGGGTCTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGCGCGCTGGCGGCTGGGGGTACCACTTACCATGACCAAACTGGGTTGATCAAGTAAGGTCGTTCTTGCACAGCACAGCATGGCATAAACTAAAAGCGAAAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCACGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGGGATAGGACTCTGTCCATCTCGACTCCTCCTGAACCTTGGAGAAATTACAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGGGTGGCAGCCCGGCTAGCAGCCGCCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATAGAACGTGCTCCGCGGCCGACGGGTCGCGGTAACCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGAGTTCA-AGGCCGTGGTTAT Didymium_nigripes TAAAGACTAAGCCATGCATGCCTTCGAATACGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGCGACATGGATAACCCTGGTAATTCTGAGGCTAATACAAGACTGGAAGGTCGGGAGGTGTGTGATTGCTGGGAATGGACACACCCTGAGCGGCTCTT-GCTTTGTGCTTCTGACCTATCAACTAGATGGCAGCGTAACGGACATGCTATGGTTACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAAAGTGGGCCTGA{AG}A{AG}ATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGTGCAATGCATGAGGGC-TTAGGGGACATATGAATGCCTGCCCTTTGGGTGGGCAATTCAAATGGGTCTGTTGTAAACAGGCT{CT}TCGAGTACCAATTAGAGG-CAAGTTTGGTGCCAG{CT}AC-CGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGCGCGCTGGCGGCTGGGGGTACCACTTACCATGATTAAACTGGGTTGATCAAGTAAGGTCATTCTTGCACAGCACAGCATGGGATAAACTAGAAGCGATAGGGATGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCATACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGGGATAGGACTCTGTCCATCTCGACTCCTTCTGGACCTTGGAGAAATTACAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGGGCGGCAGCCCGGCTAGCAGCCGCCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATAGAACGTGCTCCGCGGCCTACTGGTCGCGGTAATCCCTAGTCTCTCCCTTGACTGGGCCAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGAGTTCGGAGGTCGTGGTCAC Didymium_sp_ECH1 TAAAGACTAAGCCATGCATGCCTTCGAATAAGAGGAAGCAATTCTCTCTGGATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGCAACATGGATAACCCTGGTAATTCTGAGGCTAATACAAGACTGGAAGGCTGGGAGGTGTGTGATTGCTGGGAATAGACACACCCTGAGCGGCTCTT-GCTTTGTGCTTCTGACCTATCAACTAGATGGCAGCGTAACGGACATGCTATGGTGACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGAGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGTACAATGTATGAGGGCGTTAGGGGACATATGAATGTCTGCCCTATGGGTGGACAATTCAAATGGGTCTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGCGCGCTGGTGGCTGGGGGTGCCAATTACCATGATTAAACTGGGTTGATCAAGTAAGGTCGTTCTTGCACAGCACAGCATGGTATAAACTAGAAGCGATAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCACGCCCGT-GATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGGGATAGGACTCTGTCCATCTCGACTTCTTCTGGACCTTGGAGAAATTACAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGGGCGGCAGCCCGGCTAGCAGCCGCCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATAGAACGTGCTCCGCGGCCTACTGGTCGTGGTAATCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTCGCGGTTACGAGTTCGGAGGTCGCGGTTAC Didymium_sp_ECH49 TAAAGACTAAGCCATGCATGCCTTCGAATAAGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGCAACATGGATAACCCTGGTAATTCTGAGGCTAATACAAGACTGGAAGGCTGGGAGGTGTGTGATTGCTGGGAATAGACACACCCTGAGCGGCTCTT-GCTTTGTGCTTCTGACCTATCAACTAGATGGCAGCGTAACGGACATGCTATGGTGACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGTACAATGTATGAGGGCGTTAGGGGACATATGAATGTCTGCCCTATGGGTGGACAATTCAAATGGGTCTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGCGCGCTGGTGGCTGGGGGTGCCAATTACCATGATTAAACTGGGTTGATCAAGTAAGGTCGTTCTTGCACAGCACAGCATGGTATAAACTAGAAGCGATAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCACGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGGGATAGGACTCTGTCCATCTCGACTTCTTCTGGACCTTGGAGAAATTACAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGGGCGGCAGCCCGGCTAGCAGCCGCCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATAGAACGTGCTCCGCGGCCTACTGGTCGTGGTAATCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGACGAATGCGTCCCCGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTCGCGGTTACGAGTTCGGAGGTCGCGGTTAC Didymium_sp_OX13PS TAAAGACTAAGCCATGCATGCCTTCGAATACGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGCAACATGGATAACCCTGGTAATTCTGAGGCTAATACAAGACTGGAAAGCTGGGAGACGTGTGGATCCTGGGAATAGATGCACCCCGAGCGGCTCTT-GCTTTGTGCTTCTGACCTATCAACTAGACGGCAGCGTAATGGACATGCTATGGTTACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGTGCAATGCATGAGGGCGTTAGGGGACATATGAATGCCTACCCAATGGGTGGGCAATTCAAATGGGTCTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGCGCGCTGGCGGCTGGGGGTACCACTTACCATGACCAAACTGGGTTGATCAAGTAAGGTCGTTCTTGCACAGCACAGCATGGCATAAACGAAAAGCGAAAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCACGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGGGATAGGACTCTGTCCATCTCGACTCCTCCTGAACCTTGGAGAAATTACAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGGGTGGCAGCCCGGCTAGCAGCCGCCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATAGAACGTGCTCCGCGGCCGACGGGTCGCGGTAACCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGAGTTCAGAGGCCGTGGCTGT Didymium_squamulosum --------------TGCATGCCTCCGAATAAGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGCAACACGGATAACCCTGGTAATTCTGAGGCTAATACGAGACTGGAAGGCTGGGAGACGTGCGAGTATCGGGAATGAACGCACCCCGAGCGGCTCTT-GCTGTGTGCTTCTGACCTATCAACTAGACGGCAGCGTAATGGACATGCTATGGTTACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGTGCAATGCATGAGGGCGTTAGGGGACATATGGATGCCTGCCCAATGGGTGGGCAATTCAAATGGGTCTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGCGCGCTGGTGGCTGGGGGTGCCACTTACCATGACCAAACTGGGTTGATCAAGTAAGGTCGTTCTTGCACAGCACAGCATGGCATAAACGAAAAGCGATAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCACGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGGGATAGGACTCTGTCCATCTCGACTTCTCCTGGACCTTAGAGAAATTACAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGGGCGGCAGCCCGGCTAGCAGCCGCCTCTTCTTAGACGTATCAGAGCCGAAAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATAGAACGTGCTCCACGGCCGACGGGTCGTGGTAACCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGAGTTCGGAGACCGTGGCTCT Echinostelium_arboreum -GAAGATTAAGCCATGCATGCCTACG-ATTAGAACGTATTAGAAGCATCGAATCTGCGAACGGCTCCGCATATCAGCTGCGATTCATGGCAAAATAGATGGATACCCCCGGTAATTCTGAGGCTAATACAAGGTTCAAAAGGGGATACCCGCACGGAAACCGGCTC-GACTCGATATCAGTCGGTTCCTATCTGTGGGCTTCTGACCTATCAACTCGATGACGGTCTCAGTTACAA-ACATGGTCGCAACGGGTACAGAGGATAAGGGTTTGATTCTGGAGAGTGGGCCTTAAAAATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGTAACGTTCCCAATGGATAAAGTCTGAGGGCGTGAAGGAAAATAGGAATGTCCCCCTATTGGG-GGACAATTCCAATGTGGTCGGCGTAAAAAACCGGCTGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGTGTACCTTAAAGTTGCTGCAGTTAAAACGCTCGTAGTCGGAGGGGGGAGAATTGGGGGACTGGCCTTAATTACCATGAGAAAAATAGCGCGATCCAGGCAGGTCACTTCTGAATAATTTAGCATGGGATGACCTTGGATCTATAGGGGTACTCGGGGGCAGCCGAATTGCGGGGCTAGGGGTGAAATCCGTTGACCCCCGCAAGTCGACCTAACGCGAAAGCAGCTGTCAAGGGTTCACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTGACTATAAATGATACCGACCAGGGATGGGGGTCCCTTATTTCAGACTCCCCCCGAATCTTAGCGAAAGTACAGTCTATGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAACTCACCGGGTCCGGATACAGTGACGAAGGACAAGCTGATAGACTTTTCTAGATTCAGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGAAGCGATTTGTCTGGTCGATTCCGATAACGAGCGAGATCCGATCCGTTTAAATAGGGCGCCTCCGTTTCG------------CTTCTTAGAGGTATCATGGCTAACAAAGCCTTTGAAATCGGGCAATAACAGGTCTGTAATGCCCTTAGATGTTCCGGGCCGCACGCGCGCGACAATG-CAAAAGGAGAGAGTTTTCCCGGCCCAGAGGCCGCGGGAAATCA-TAAATTTTTACACATCAGGGATAGACCCTTGTAATTATTGGTCTTGAACTCGGAATTTCTAGTAGTCGCGGGTCATCAACCCGCGACGATTTTGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGAGCTGAGTGATTACGGTTCTGGATCTGGGTCGGAA Echinostelium_coelocephalum --AAGATTAAGCCATGCATGCCTATG-ATTAGAACGTGTTTGAAGCATTGAATCTGCGAACGGCTCCGCACAAAAGTCGTAATGAAAGACA-GTTAAATGGATATCCCTGGTAATTCTAGGGTTAATACAAGAGCATTTACTTGCTGGACGCACCTCCACCGGATCT-AATCAACTTATAGCGGCGCCGGGTCATTGGCCTCTCACCTATCAACTCGATGAAAGCGCC-ACGTCCATTCATGGTCACTACGGGTACAGAGGATCAGGGTTCGATCCTGGAGAGTGGGCCTTAAAAATTGCTCACACTTCTAAGGAAGGCAGCAGGCGCGTAACGTTCCCATTGCACAATGTGCGAGGGCGTGAAAGGATATATCGCATCCTGCTCATTGGGTGGGTTAGCGGAATGAATCTAAGTTAAACATATAGCAGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGATAAAGTTGCTGCAGTTGAAACGCTCGTAGTCGGACCCGCGTCACGGGCTATATCCCTTCGTATTACCATGAGAAAAGTAGAGTGATCCAAGCAGGCAGGTTGTGCATATTACAGCATGGTATAACCTTTGGTCAACAGGGTTGTTGGGGGGTAGCAGAATCGCTGGGCGAGGGGTGAAATCCGTTGACCCTAGCGAGTCTACCAAGTGCGAAAGCAGCTGCCAACGGCACTCCCATTGATCAAGAGCGAAAGTTAAGGGTTCGAAAACGATCAGATACCGTTGTAGTCTTAACTATAAATGTTGCCATCTAGGGATGGGGACTAGTCCCTCTTGACATTCCCTGCCCCTTCGTGAAAACAAAGTATTTGGGTTCCGGGGGGAGTATGGTCGCAAGAACGAAACTTAAAGGAATTGACGGAACGGCACACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACTAGGTCAAGATACTTGAATGAAGGACAAGCTGATAGACTTTTCCCAATACAGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATTTGTCTGGTCGATTCCGCTAACGAGCGAGACACATACGATCTAAATAGGATGTTCCCTTGTAA------------CTTCTTAGAGGTATCGGGGCTGATAAAGCCCCATAAAATGTGCAATAACAGGTCAGTAATGCCCTTAGATGTCCTAGGCCGCACGCGCGCTACAATGTAGTGCGGAACGAGCACTCCTAAGCCGACAGGGTTGGGTAATCTCTAAACAAATACTCGTCTGGGCCTG-CTTTTGTAATTATTGGACACCAACGAGGAATTTCTAGTAGGCATCGGTCATCAGCCGGTGCCGACTCTGTCCCTGCCGTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTGTTTTGATTAAGTCTACGGAGCTGTGCATGCT Echinostelium_minutum -GAAGATTAAGCCATGCATGCCTATG-ATTAGAAAGTGTTTGTAGCATCGAATCTGCGAACGGCTCCGCATACCAGTTGCAACTTAAGACAATTTAAACGGATATCCATGGTAATTCTGTGGCAAATACGAGATTCCCCGATTCAGGTACTCGCAAGGTCCGG-----AGAGCA-TTATGGCGGCTCTTGGCCTAAGGCTTCTGACCTATCAACTCGATGA-AGCGCTTCCGTCC-GCTATGGTCGCAACGGGTACAGAGGATTAGGGTTTGATCCTGGAGAGTGGGCCTTAAAAATTGCTCACACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCAGTGGGCAAAGCCCGAGGGCGTGAAGGGATATATCGGATCCTGCCTTTTAGGTGGGTTACCGGAATGAATCTAAGTTAAATACATAGCCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGATAAAGTTGCTGCAGTTGAAACGCTCGTAGTCGTATTATAGCGAGGATGATTTTAGCCCGGACTTACCATGAATAAACTAGAGTGATCTAAGCAAGTCAGACATGAATATTCCAGCATGGTATAACCTTAGGTCAACAGGGGTGTTCGGGGCTGGCAGAATCGCTGGGCGAGGGGTGAAATCCGTTGACCCTAGCGAGTCTACCAAGTGCGAAAGCAGCTGGCAAGGGCACTTTCATTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTTGTAGTCTTAACCATAAACGATACCGGCCAGAGATGGGGAAAAGTCCTTCTTGACACCCCCCGCCTCCCGGCGAAAGTTAAGCGTTTGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGAGCACACAAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAGCTCACTAGGTCAAGATGCTTGAATGAAGGACCAGCTGATAGACTTTTCCCAATATAGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCGATTCCGCTAACGAGCGAGACGTAAACGTTCTAAATAGGTTGTCCCCTTGACT------------CTTCTTAGAGGTATCGGGGCTGAAAAAGTCCCATAAACTACGCAATAACAGGTCTGTAATGCCCTTAGATGTCCTAGGCCGCACGCGCGCTACAATGGTGCGTTTGACGGGTCCTCCCCACCCTACAGGTCTGGGCAATCCCTATACCAAACCTCGTCTGGGCCTG-CCTTTGTAATTATAGGACACCAACGAGGAATTTCTAGTAGGCACGGGTCATCAGCCCGTGCCGACTCTGTCCCTGCTCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGATTGTCCGACTACGCCTGTGGAGTTGCTTGAAGG Enerthenema_papillatum -----------------------------------------TTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACCAAAGCAAGCTATATGGATACCCGTGGTAATTCTGAGGCTAATACATGATTCTGGTGGCCGGGGACGCGCGAGTATCGGGAAGGAACGCGCGCCTGGTGGCTCTT-GCGATGTGCTTCTGACCTATCAACTAGACGGCAGCGTAACGGACATGCTATGGTAACAACGGGTACAGAGGATCAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGACAATGTCCGAGGGCGCTAGGGGAAATATGGATGGCTGCCCTCGTGGTGGCTAATCCAAATGGGTTTGTCGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCAGTTAAAACGCTCGTAGTCGGCGGGGCGCGCCGGTGGGGCCGGATGCCATTGGTCGTGATTAAACTGGGGTGCTCAATGCAGGCCTAATATGTACAGCACAGCACGACATTAAAGTTGGGCAAAAGGGGTGTTCGTGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGTCCAAATGCGAAAGCAGTCATCAAGGGCACACCCATTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGGCCAGGGATAGGGCAATGTCCATCTCGACTCCCCCCGGACCTTTGGGAAACCAAAGCTTCTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGGAAACTCACCAGGTCAGGATACGCGGATGAAGGACAAGCTGAGAGACTTTTCTCAATGACGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAGCGTTCTAACTAGGGGTGGTGGCTATGCAAGCTGCCGCTTCTTCTTAGACGGATCAGGGCCAAAAAGGTCCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCAGGGAAAACAAGTGTTCCGGGCCCTAACGGGTCCGGTAATCACTAGGCCCTGCCTCGACTGGGATAGTCTCTTGCAATTCTGGGTCTTAAACGAGGAATTTTTAGTAGGCGCGGGTCATCAGCCCGCGCCGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGCCTGGCGGTTACGCGTTCGGAGGCTGCGG-AGC Fuligo_leviderma T-AAGACTAAGCCATGCATGCCTTCGAATA-GAAGA-GCT-TTCTCTCTGAATCTGCGTACGGCTCCGCAAACCAGTTGTAAACCATAGCAAGCCATAGGGATAACCCTGGTAATTCTGAGGCTAATACAAGACTGGTGAGCTGGGGTACGTGTGGAAG-TGGGAGAAGTCACACTGCAGGTGGCTCTT-GCAACGTGCTTCTGACCTATCAACTAGATGGCAGCGTAAGGGACATGCTATGGTGACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATCGCTCACACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCAGTGGACATCGTCCGAGGGCGTTAGGGGAAATATGAATGTCTGCCATAT-GGTGGACAATTCAAATGGGTTCGTTCTAAACAACCCTTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGAGCACGCCGATCGGCCTGGGTCTCAATTACCATGACCAAACTGGCGTGATCAAAGCATGTCTTTCACGTACAGCGCAGCATGGTATAAATGAGCAGCGAAAGGGATGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCATACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACAGACCAGGGATTGGACACTGTCCATCTCGACTCCTTCTGGACCTCAGAGAAATTACAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCGGATACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGGGCAATGGCCCGACCAGCCGTCGCTTCTTCTTAGACGTATCGAAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTTTGTAAAGAGAGTGCTCCGAGACCGAAAGGTCTCGGTAACCCTTAAACCCAGCCTTGACTGGGACAGATCATTGTAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCACGGTTCATTAAACCCTGTCGAATGGGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGATTTTACAGTTACGCGTTCGGAGGGCGTGGCCTT Fuligo_septica TAAAGACTAAGCCATGCATGCCTTCGAATA-GAAGA-GCAAGTCTCTCTGAATCTGCGTACGGCTCCGCAAACCAGTTGTAAACCATAGCTAGCCAAAAGGATATCCATGGTAATTCTGAGGCTAATACTTGACTGGTAGGCTGGGGGACGTGTACGATTAAGGAATGAATGCACCCTGAGCGGCTCTA-GCACGGTGCTTCTGACCTATCAACTAGATGGCAGCGTAACGGACATGCTATGGTGACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCACACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCATTGGACAATGTCCGAGGGCGTTAGGGGACATATGAATGTCTGCCTTAT-GGTGGACAATTCAAATGGGTTTGTTCTAAACAACCTTTCGAGTAACAATTGGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCTGCAGGGCACACCTGCTGGTCTGGGTACCATCTACCATGACTAAACTGGAGTGATCAAAGCATGTCTTTCACGTACAGCGCAGCATGGAATAAGCGAGCAGAAATAGGGATGTTCGAGGGTGACCGAATTGCTGGGCGAGTGGTGAAATACGTTGACCCTAGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCATACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACAGACTAGGGATAGGACACTGTCCATCTCGACTCCTCCTGAATCTTTGAGAAATTACAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCGGATACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAGCGTTCCTAGTAGGGCCAACAGCCCGACTAGCTGGCGGCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTAAAGCGAGTGCCCCGGGGCCGAAAGGTTCTGGTAACCATTAGTCCCTGCTTAGACTGGGACAGATCATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAAGCATAGGTCATTAACCTTTGCTGAATGAGTCCCTGCCTTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTACAGTTACGCGTTCGGAGGTTGTGGTTAC Hyperamoeba_dachnaya CAAGGGCTAACCCATGCATGTCTTCGAATAAGAGGAAGCCCTTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGCAACACGGATAACCCTGGTAATTCTGAGGCTAATACGAGACTGGAAGGCTGGGAGGTGTGTGATTGCTGGGAATAGACACATCCTGAGCGGCTCTT-GCTTTGTGCTTCTGACCTATCAACTAGATGGCAGCGTAACGGACATGCTATGGTGACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGTACAATGTATGAGGGCGTTAGGGGACATATGAGTGTCTGCCCTATGGGTGGACAATTCAAATGGGTCTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGCGCGCTGGTGGCTGGTGGTACCACTTACCATGATTAAACTGGGTTGATCAAGTAAGGTCGTTCTTGCACAGCACAGCATGGTATAAACTAGAAGCGATAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCACGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGGGATAGGACTCTGTCCATCTCGACTTCTTCTGGACCTTGGAGAAATTACAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACAGGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGGGCGGCAGCCCGGCTAGCAGCCGCCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATAGAACGTGCTCCGCA-CCTACTGGTCGTGGTAATCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTCGCGGTTACGAGTTCGGAGGTCGTGGTAAC Hyperamoeba_flagellata TAAAGACTAAGCCATGCATGCCTTCGAATA-GAAGA-GCT-TTCTCTCTGAATCTGCGAACGGCTCCGCACACCAGTTGTAAACTATAGCAAGTAACAGGGATAACCCTGGTAATCCTGAGGCTAATACAAGACGGGAAGGCTGAGGGTCGTGTGAGTGACATGAATGGATGCACTTCGGGTGGGCCTT-GCTGTGTGCTTCTGACCTATCAACTAGATGGCAGCGTAAAGGACATGCTATGGTTGACACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCACACTTCTAAGGAAGGCAGCAGGCGCGTGAC-TTCCCATTGGGCAA-GCCTGAGGGCGTTAGGG-ACTTATGAATGCTTGCCATATTGGTAGGCAATTCATATGGTTTTGGTTTCCAACAGCCTTCAATTAACAATTAGAGGACAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCATACGT-AAAGT-GTGGCGGTTAAAACGCTCGTAGTCGGCAGGGCGCGTCGTTGGATCGAGTCCCCATTCACTATGATTAAACTATAGTGATCAAAGCGGGTCATTCACGCATAGCACAGCATAATATGA-AGAGTCGCGAAAGGGATGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCATACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACAAACCAGGGATGAGACACTGTCCATCTCGACTCCTTTCGGACCTTCGAGAAATCAGAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCGGATACACGTATGAAAGTCAAGCTGAAAGACTT-ACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATT-GTCTGGTTTATTCCGATAACGAGCGAGACCC-AACGTTCCTAATAGGGGCACTAGCCCGGCTAGCTAGAGCCTCTTCTTAGACGTATCAGAGCCGATAAGGCGCTTGAAATGGGTTAATAACAGGTCAGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACGTAAAGCGAGTGCTCCGGGGCTGAAAGGCTTCGGTAATCCTTAATCCCTGCCTTGACTGGGATAGATCATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGGCGCAGGTCATTAACCTGCGTCGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGAATTTTCCAGTTACGCATTCGGAGCATGAGGTTAT Hyperamoeba_sp_A1K TAAAGATTAAGCCATGCATGCCTAAGACTATGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACCATAGCA-GCTATATGGATAACCGTGGTAATTCTGAGGCTAATACATGACCGGCTAGGTGGGGGACGTGCAAAAACCACGAATGAATGCACACCGGGCGGCCCCT-GCAACGGGCTTCTGACCTATCAACTAGACGGCAGCGTAAGGGACATGCTATGGTAACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGGCAAAGCTCGAGGGCGTTATGGGAAATATGAATGCTTGCCTATACGGTGGGCAATTCAAATGGGTTTGTCGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGTGCGCCTCTGGTCCTGGGTACCATTTACCATGATTAAACCGGCGTGATCAAGGCAGACCGCTACTGCACGGCTCAGCATGGCATAAGAGATACGCGAAAGGGGTGTTCGGGGGCAGCCGAATTGCCGGGCTAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCGAAAGCGAAAGCAGCTGTCAAGGGCACACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGGCCAGGGATAGGGCAATGTCCATCTCGACTCCCCCCGGACTTTTGGGAAACCAAAGCCTATGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCGGGTCCAGATACATGCATGAAAGACAAGCTGACAGACTTTTCTCAATTATGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGGTCTAAATAGGGGTCACAGCCCGGCCAGCAGGTGCCTCTTCTTAGACGGATCGGGGCCGATAAGGTCTCTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCCGGGCCGCACGCGCGTTACAATGGGAGGCAAAGCGAGTGTCCCGCCCCCGACAGGGGGTGGTAACCCGTAGCGCCTCCCTTGACTGGGCTAGTCTATTGCAATTATTGGTCTTCAACGAGGAATTTTTAGTAGGCACGGGTCATTAACCCGTGCCGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTCGCGGTTACGCGTTCGGAGGTCCTTTCAAC Hyperamoeba_sp_AH1 TAAAGATTAAGCCATGCATGCCTAAGACTATGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACCATAGCA-GCTATATGGATAACCGTGGTAATTCTGAGGCTAATACATGACCGGCTAGGTGGGGGACGTGCAAAAACCACGAATGAATGCACACCGGGCGGCCCCT-GCAACGGGCTTCTGACCTATCAACTAGACGGCAGCGTAAGGGACATGCTATGGTAACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGGCAAAGCTCGAGGGCGTTATGGGAAATATGAATGCTTGCCTATACGGTGGGCAATTCAAATGGGTTTGTCGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGTGCGCCTCTGGTCCTGGGTACCATTTACCATGATTAAACCGGCGTGATCAAGGCAGACCGCTACTGCACGGCTCAGCATGGCATAAGAGATACGCGAAAGGGGTGTTCGGGGGCAGCCGAATTGCCGGGCTAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCGAAAGCGAAAGCAGCTGTCAAGGGCACACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGAAGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGGCCAGGGATAGGGCAATGTCCATCTCGACTCCCCCCGGACTTTTGGGAAACCAAAGCCTATGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCGGGTCCAGATACATGCATGAAAGACAAGCTGACAGACTTTTCTCAATTATGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGGTCTAAATAGGGGTCACAGCCCGGCCAGCAGGTGCCTCTTCTTAGACGGATCGGGGCCGATAAGGTCTCTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCCGGGCCGCACGCGCGTTACAATGGGAGGCAAAGCGAGTGTCCCGCCCCCGACAGG-GGTGGTAACCCGTAGCGCCTCCCTTGACTGGGCTAGTCTATAGCAATTATTGGTCTTCAACGAGGAATTTTTAGTAGGCACGGGTCATTAACCCGTGCCGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTCGCGGTTACGCGTTCGGAGGTCCTTTCAAC Hyperamoeba_sp_ATCC50750 TAAAGATTAAGCCATGCATGCCTAAGACTATGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACCATAGCA-GCTATATGGATAACCGTGGTAATTCTGAGGCTAATACATGATCGGCTTGGTGGGGGACGTGCGATTACCGCGAAAGGACGCACCCCGGGCGGCCCCT-GCAACGGGCTTCTGACCTATCAACTAGACGGCAGCGTAAGGGACATGCTATGGTAACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGGCAAAGCTCGAGGGCGTTATGGGAAATATGAATGCTTGCCTTTACGGTGGGCAATTCAAATGGGTTTGTCGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGTGCGCCTTTGGCTCTGGGTACCAATTACCATGATTAAACCGGAGTGATCAAAGCAAACCGCTACTGCACGGATTAGCATGGCATAAGAGTTCCGCGAAAGGGGTGTTCGGGGGCAGCCGAATTGCCGGGCTAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCGAAAGCGAAAGCAGCTGTCAAGGGCACACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGGCCAGGGATAGGGCAATGTCCATCTCGACTCCCCCCGGACTTTTGGGAAACCAAAGCCTATGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCGGGTCCAGATACATGGATGAAAGACAAGCTGATAGACTTTTCTCAATTATGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGGTCTAAATAGGGGCCGCAGCCCGGCTAGCAGGCGCTTCTTCTTAGACGGATCGGGGCCGATAAGGTCTCTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCCGGGCCGCACGCGCGTTACAATGGGGGGCAAAACGAGTGTCCCGCCGCCTACCGGTGGTGGTAACCCGTAGGGCCCCCCTTGACTGGGCTAGTCTCTTGCAATTATTGGTCTTCAACGAGGAATTTTTAGTAGGCGCGGGTCATTAACCCGTGCCGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTCGCGGTTACGTATTCGGAGATTCTTTCAAC Hyperamoeba_sp_B12 TAAAGATTAAGCCATGCATGCCTAAGACTATGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACCCTAGCA-GCTATATGGATAACCGTGGTAATTCTGAGGCTAATACATGATCGGCTTGGTGGGGGACGTGCGATTACCGCGAAAGGACGCACCCCGGGCGGCCCCT-GCAACGGGCTTCTGACCTATCAACTAGACGGCAGCGTAAGGGACATGCTATGGTAACAACGGGTACAGAGGATTAGGCTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGGCAAAGCTCGAGGGCGTTATGGGAAATATGAATGCTTGCCTTTACGGTGGGCAATTCAAATGGGTTTGTCGTAAACAGGCTCTCGAGTAACAATTAGAGGACCAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGTGCGCCTTTGGCTCTGGGTACCAATTACCATGATTAAACCGGAGTGATCAAAGCAAACCGCTACTGCACGGATTAGCATGGCATAAGAGTTCCGCGAAAGGGGTGTTCGGGGGCAGCCGAATTGCCGGGCTAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCGAAAGCGAAAGCAGCTGTCAAGGGCACACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACAATCAGATAC-GTCGTAGTCTTAACTATAAATGATACTGGCCAGGGATAGGGCAATGTCCATCTCGACTCCCCC-GGACTTTTCGGAAACCAAAGCCTATGAGTTCAGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCGGGTCCAGATACATGGATGAAAGACAAGCTGATAGACTTTTCTCAATTATGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGGTCTAAATAGGGGCCGCAGCCCGGCTAGCAGGCGCTTCTTCTTAGACGGATCGGGGCCGATAAGGTCTCTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCCGGGCCGCACGCGCGTTACAATGGGGGGCAAAACGAGTGTCCCGCCGCCTACCGGCAGTGGTAACCCGTAGGGACCCCCTTGACTGGGCTAGTCTCTTGCAATTATTGGTCTTCAACGAGGAATTTTTAGTAGGCGCGGGTCATTAACCCGTGCCGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTCGCGGTTACGTATTCGGAGATTCTTTCAAC Hyperamoeba_sp_BuP TAAAGATTAAGCCATGCATGCCTAAGACTATGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACCATAGCA-GCTATATGGATAACCGTGGTAATTCTGAGGCTAATACATGACCGGCTAGGTGGGGGACGTGCAAAAACCACGAATGAATGCACACCGGGCGGCCCCT-GCAACGGGCTTCTGACCTATCAACTAGACGGCAGCGTAAGGGACATGCTATGGTAACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGGCAAAGCTCGAGGGCGTTATGGGAAATATGAATGCTTGCCTATACGGTGGGCAATTCAAATGGGTTTGTCGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCG-TTAAAACGCTCGTAGTCGGCGGGGTGCGCCTCTGGTCCTGGGTACCATTTACCATGATTAAACCGGCGTGATCAAGGCAGACCGCTACTGCACGGCTCAGCATGGCATAAGAGATACGCGAAAGGGGTGTTCGGGGGCAGCCGAATTGCCGGGCTAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCGAAAGCGAAAGCAGCTGTCAAGGGCACACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCTTAGTTTTAACTATAAATGATACTGGCCAGGGATAGGGCAATGTCCATCTCGACTCCCCCCGGACTTTTGGGAAACCAAAGCCTATGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCGGGTCCAGATACATGCATGAAAGACAAGCTGACAGACTTTTCTCAATTATGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGGTCTAAATAGGGGTCACAGCCCGGCCAGCAGGTGCCTCTTCTTAGACGGATCGGGGCCGATAAGGTCTCTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCCGGGCCGCACGCGCGTTACAATGGGAGGCAAAGCGAGTGTCCCGCCCCCGACAGGTGGTGGTAACCCGTAGCGCCTCCCTTGACTGGGCTAGTCTATTGCAATTATTGGTCTTCAACGAGGAATTTTTAGTAGGCACGGGTCATTAACCCGTGCCGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTCGCGGTTACGCGTTCGGAGGTCCTTTCAAC Hyperamoeba_sp_E23 TAAAGACTAAGCCATGCATGCCTTCGAATAAGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGCAACACGGATAACCCTGGTAATTCTGAGGCTAATACGAGACTGACTGGCTGGGGAGCGTGTGATTTCCGGGAACGGGTACACCCCGAGCGGCTCTT-GCTGTGTGCTTCTGACCTATCAACTAGATGGCAGCGTAATGGACATGCTATGGTTACAACGGGTACAGAGGATTAGAGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGTAACGTTCCCCTTGTACAATGTATGAGGGCGTTAGGGGACATATGAATGCCTGCCCATAGGGTGGGCAATTCAAATGGGTCTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGCGCGCTGGCGGCGGGGGGTACCACTTACCATGACTAAACTGGACTGATCAAGTGAGGCCGTTCTTGCACAGCACAGCATGGCATAAAAGAAAAGCGAAAGGGGTGTTCGAGGGTGACCGAATTGCTAGGCGAGTGGTGAAATACGTTGACCCCAGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCACGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGGGATAGGACACTGTCCATCTCGACTCCTTCTGAACCTTAGAGAAATTACAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGGGCCGCAGCCCGGCTAGCAGCAGCCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATAAAAAGTGCTCCGCGGCCTACGGGTCGCGGTAACCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGGCGCAGGTCATTAGCCTGTGCCGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTACAGTTACGTATTCGGAGGCAGCGCTTTT Hyperamoeba_sp_E3P TAAAGACTAAGCCATGCATGCCTTCGAATAAGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGCAACACGGATAACCCTGGTAATTCTGAGGCTAATACGAGACTGACTGGCTGGGGAGCGTGTGATTTCCGGGAACGGGTACACCCCGAGCGGCTCTT-GCTGTGTGCTTCTGACCTATCAACTAGATGGCAGCGTAATGGACATGCTATGGTTACAACGGGTACAGAGGATTAGAGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGTAACGTTCCCCTTGTACAATGTATGAGGGCGTTAGGGGACATATGAATGCCTGCCCATAGGGTGGGCAATTCAAATGGGTCTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGCGCGCTGGCGGCGGGGGGTACCACTTACCATGACTAAACTGGACTGATCAAGTGAGGCCGTTCTTGCACAGCACAGCATGGCATAAAAGAAAAGCGAAAGGGGTGTTCGAGGGTGACCGAATTGCTAGGCGAGTGGTGAAATACGTTGACCCCAGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCACGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGGGATAGGACACTGTCCATCTCGACTCCTTCTGAACCTTAGAGAAATTACAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGGGCCGCAGCCCGGCTAGCAGCAGCCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATAAAAAGTGCTCCGCGGCCTACGGGTCGCGGTAACCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGGCGCAGGTCATTAGCCTGTGCCGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTACAGTTACGTATTCGGAGGCAGCGCTTTT Hyperamoeba_sp_G1a TAAAGATTAAGCCATGCATGCCTCCGACTA-GAAGA-GCAATTCTCTCCGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACCATAGCGAGCAATAAGGATAACCCTGGTAATTCTGAGGCTAATACATGACTGGAAGGCTGGGGGACGTGTGACTGCTGGGAGTAGACGCACTCTGGGTGGCTCTC-GCTTTGTGCTTCTGACCTATCAACTAGATGGCAGCGTAAGGGACATGCTATGGTGACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCACACTTCTAAGGAAGGCAGCAGGCGCGTAACGTTCCCCTTGGGCAATGCTCGAGGGCGTTAGGGGACATATGAATGCCTGCCTTTT-GGTGGGCAATTCAAATGGGTCTGTTCTAAACAGCCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCAGGGCACGCCGGCGGC-CTGGATGCCATTTACCATGATTAAACCGGAGTGATCAAAGCAGGTCTTTCACGTACGGCGCAGCATGGTATACTTGAGAAGCGAAAGGGATGTTCGAGGGTGACCGAATTGCTGGGCGAGTGGTGAAATACGTTGACCCTAGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCATACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATGCAAACCAGGGATAGGACCCTGTCCATCTCGACTCCTTCTGGACCTTGGAGAAATTAGAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCATCGTTCCTAATAGGGGCGGTAGCCCG-CTAGCAGCTGCCGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCC-TTAGATGTTCTGGGCCGCACGCGCGTTAAAATGGC-TGTAAAGCAAGTGCTCCGCGCCCGAAAGGCTCCGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGATCTTTGC-ATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGTAGGTCATTAACCTACGACGAATGCGTCCCTGCCCTTTGTAC-CACCGCCCGTCGCTGCTACCGATTGGGTTTTACAGTTACGTGCTTGGAGGCCGTGGTTCC Hyperamoeba_sp_Hpl TAAAGACTAAGCCATGCATGCCTTCGAATACGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGCAACATGGATAACCCTGGTAATTCTGAGGCTAATACAAGACTGGAAGGCTGGGAGACGTGTAGATGCTGGGAATAGATGCACCCCGAGCGGCTCTT-GCTTTGTGCTTCTGACCTATCAACTAGACGGCAGCGTAATGGACATGCTATGGTTACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGTGCAATGCATGAGGGCGTTAGGGGACATATGAATGCCTGCCCAATGGGTGGGCAATTCAAATGGGTCTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGCGCGCTGGCGGCTGGGGGTACCACTTACCATGACCAAACTGGGTTGATCAAGTAAGGTCGTTCTTGCACAGCACAGCATGGCATAAACGAAAAGCGAAAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCACGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGGGATAGGACTCTGTCCATCTCGACTCCTCCTGAACCTTGGAGAAATTACAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGGGTGGCAGCCCGGCTAGCAGCCGCCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATAGAACGTGCTCCGCGGCCGACGGGTCGCGGTAACCCTTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGAGTTCAGAGGCCGTGGTTAT Hyperamoeba_sp_W2i TAAAGACTAAGCCATGCATGCCTCCGAATA-GAAGA-GCAAATCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACCATAGCAAGCTATAGGGATAACCCTGGTAATTCTGAGGCTAATACATGACCGG-ACGCTGGGGACCGTGCGGGTATTGGGAATAGTCGCACTCCGGGTGGCTCTT-GCAAGGTGCTTCTGACCTATCAACTAGATGGCAGCGTAAGGGACATGCTATGGTGACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCACACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGGCAATGCTCGAGGGCGTTAGGGGACATATGAATGCCTGCCTTTT-GGTGGGCAATTCAAATGGGTCTGTTCTAAACAGCCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCAGGGCACGCCGGCGGCCC-GGGTGCCTTGTACCATGACCAAACCGGGGTGATCAAAGCATGTCTTTCACGTACGGCGCAGCATGGTATAGCTGAAAGGCGAAAGGGATGTTCGAGGGTGACCGAATTGCTGGGCGAGTGGTGAAATACGTTGACCCTAGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCATACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATGCAA-CCAGGGATAGGACACTGTCCATCTCGACTCCTCCTGAAC-TTCGAGAAATTACAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCA-CACGGGAAAACTCACCAGGTCCGGATACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCATCGTTCCTAATAGGGGCGGTAGCCCGCCTGGTAGCTTCCGCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTAAAGCAAGTGCTCCGGGGCCGAAAGGTCCTGGTAACCCTTAGTCCCTGCCTTGACTGGGACAGATCTTTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGTAGGTCATTAACCTACGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTACAGTTACGTGTTTGGAGGTGCTGGCGTC Lamproderma_atrosporum_var_retisporum TAAAGACTAAGCCATGCATGTCTTCGAATAAGAGGAAGCAATTCTCTCTGAATCTGCGTACGGCTCCGCACACCAGTTGTAAACCAAAGCAAGCTACAAGGATAACCCTGGTAATTCTGAGGCTAATACTTGATTCGGGAAGCGGGGGATGTGCGACAACCGGAAA-GAGCGCACGGGTTGTGGCTCTT-GCAGCGTGCTTCTGACCTATCAACTAGACGGCAGCCTAAGGGACATGCTTTGGTGACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCATTGGACATCGTCTGAGGGCGTTAGGGGAAATATTAATACCTGCCCAATGGGTGGGTAATTAAAATGGGTCTGTTCTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCAGTTAAAACGCTCGTAGTCGGCAGGGTGCGCCGGCGGTTGCAGGTGCCAATTACCATGAATAAACCAGAGTGCTCCAAGCAGGCCAATCTTGCATGGCACAGCATGGTATAAGCTCTAAGCAAAAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCTATGGCGAAAGCTGTCATCAAGGGCACGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAACGATACTGACTAGGGATAGGGCAATGTCCATTCCGACTCCCCCTGAACTTCGGAGAAATTAAAGTCTTTGAGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCAGGATACATGTATGAAAGACAAGCTGATAGACTTTTCTCAATAACGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATTCGTCTGGTCTATTCCGATAACGAGCGAGACAGCAGCGAACTAAATAGGACCAGGTGCTTCAACGGCAGCTGGTCCTACTTAGTCGGATTGGAGCCGATAAGGCTTCTGAAATGCGTCAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATAAAGAGCGAGTATTCCGCAGCCTTCGGGCTGTGGTAATCAGTAAACTCCGCCTTGACTGGGATAGACTATTGTAATTATTGGTCTTGAACGAGGAATTTTTAGTAGTCGTGCGTCATCAGCGCGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTACGGTTACGTGTTCGGAGGCTATGGGAAC Lamproderma_fuscatum TGAAGACTAAGCCATGCATGCCTTCGAATAAGAGGAAGCAATTCTCTCTGAATCTGCGTACGGCTCCGCACACCAGTTGTAAAACACAGCGAGCCATATGGATAACCCTGGTAATTCTGAGGCTAATACACGATTCGGGAAGCGGGGGATGTGCGACAACCGGAAA-GAGCGCACGACCTGTGGCTCTT-GCAAGGTGCTTCTGACCTATCAACTAGACGGCAGCCTAAGGGACATGCTACGGTGACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCATTGGACATCGTCTGAGGGCGTTAGGGGAAATATTAATACCTGCCCAATGGGTGGGTAATTAAAATGGGTTTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCAGTTAAAACGCTCGTAGTCGGCAGAGCGCGCCGGTGGTTAGGGATGCCAATTACCATGAATAAACCAGAGTGCTCCAAGCAGTCCAATCTTGCATGGCACAGCATGGCATAAGCTCTAAGCAAAAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCTATGGCGAAAGCTGTCATCAAGGGCACGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAACGATACTGACCAGGGATAGGGCAATGTCCATCTCGACTCCCCCTGAACTTCAGAGAAATTACAGTCTTTGAGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCAGGATACATGTATGAAAGACAAGCTGATAGACTTTTCTCAATAACGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATTCGTCTGGTCTATTCCGATAACGAGCGAGACAGCAGCGAACTAAATAGGATCAGAGGCTTCAACGGCAACTGGTCCTACTTAGTCGGATTGGGGCCGAAAAGGCCTCTGAAATGCGTCAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCACAAAAAACGAGTATTCCGCGGCCTCCGGGTCGTGGTAATCAGTAAACTTCGCCTTGACTGGGATAGACTATTGTAATTATTGGTCTTGAACGAGGAATTTTTAGTAGTCGCGCGTCATCAGCGCGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTACAGTTACGCGTTCAGAGGCTATGGGAAC Lamproderma_ovoideum_s_str TAAAGACTAAGCCATGCATGCCTTCGAATACGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGCGATATGGATAACCCTGGTAATTCTGAGGCTAATACATGATAGGGATGCTGGGGGATGTGCGATCTCCGGGAAAGGGCGCACCCCCAGCGGCTCTT-GCTGTGTGCTTCTGACCTATCAACTAGACGGCAGCGTAAGGGACATGCTATGGTGACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGGCAATGCCCGAGGGCGTTAGGGGACATATGAATGCCTGCCCATTGGGTGGGCAATTCAAATGGGTCTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGCGCGCCGGCGGCTTGGGGCACCACTTACCATGATCAAACTGGGGTGATTAAAGCAGGTCTTTCTTGCACAGCGCAGCATGGCATAAAAGAGTAGCGAAAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCACGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGGCCAGGGATGGGATAATGTCCATCTCGACTCTTCCTGGACCTTGGAGAAATCAGAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCGGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGGGCAGCAGCCCGGCTAGCAGCTGCCTCTTCTTAGACGTATCAGAGCCGACAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGCTTAGAGAGTGCTCCGCGGCCTACAGGCCGCGGTAACCCCTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCGAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGAGTTCGGAGGCTGTGGCTAC Lamproderma_sauteri TAAAGACTAAGCCATGCATGCCTTCGAATAAGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGCGATATGGATAACCCTGGTAATTCTGAGGCTAATACATGACTGGGAATCTGGGGGATGTGCGATCACCGGGAAAGGGCGCACCCCCAGTGACTCTT-GCTGTGTGCTTCTGACCTATCAACTAGACGGCAGCGTAAGGGACATGCTATGGTGACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGGCAATGCCCGAGGGCGTTAGGGGACATATGAATGCCTGCCCATTGGGTGGGCAATTCAAATGGGTCTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGCGCGCCGGCGGCGGGGCGCCCCATTCCCCATTCTCAAAGGGGGGAGATCAA--CACATCTTTCTGACACAGCACCGC--GGCATATAAGAGTAGCAAAAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCACGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGGCCAGGGATGGGATAATGTCCATCTCGACTCTTCCTGGACCTTGGAGAAATCAGAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCGGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGGGCAGCAGCCCGGCTAGCAGCTGCCTCTTCTTAGACGTATCC-AGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGCTTAGAGAGTGCTCCGCGGCCTACAGGCCGCGGTAACCCCTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCGAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGCGTTCGGAGGCCGTGGCTAC Lepidoderma_carestianum TAAAGACTAAGCCATGCATGCCTTCGAATACGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGCAACATGGATAACCCTGGTAATTCTGAGGCTAATACAAGAACGGAAGGCTGGGGAGCGTGCAACAACCGGGGAAGGGTGCACCCTGAGCGGCTCTT-GCTGTGTGCTTCTGACCTATCAACTAGACGGCAGCGTAAGGGACATGCTATGGTTACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGGCAATGCCCGAGGGCGTTAGGGGACATATGAATGCCTGCCATATTGGTGGGCAATTCAAATGGGTCTGTTCTAAACAGCCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGAGCGCGCTGGCGGCCTGAGGTGCCAGTTACCATGATTAAACTGGGGTGATCAAAGCAGGTCGTCCTTGCACAGCACAGCATGGCACAAGTAAGTAGCGAAAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCATTCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGGGATAGGATACTGTCCATCTCGACTCTTCCCGGACCTTAGAGAAATCAGAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCGGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGGGCAGCAGCCCGGCTAGCACCTGCCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGCTTAGAAAGTGCTCCGCGGCCTACAGGCTGCGGTAACCCCTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTCCTGCGGTTACGAGTTCGGAGGCCGTCGGTGC Lepidoderma_tigrinum T-AAGACTAAGCCATGCATGCCTTCGATTACGAGGAAGCTATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCTTTTGTAATCCTTAGCAAGCGATACGGATAACCCTGGTAATTCTGAGGCTAATACTATACTGGAAGGCCGGGGGGCGTGTGATATCCAGGAAGGGGCGCACCCTGAGTGGCTCTT-GCGAAGTGCTTCTGACCTATCAACTAGATGGCAGCGTAGCGGACATGCCATGGTTACCACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCATTGGGCAATGCCCGAGGGCGTTAGGGGACATATGAATGGTTGCCTTTTTGGTGGCCAATTCAAATGGGTCTGTTCTAAACAGTCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCCAATAGCGTACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCAAGGCGCTCCGGCGGCTTGGGGTGCCACTTACCATGACTAAACCGGCTCGATCAAGAATGGTCACGTCGGTACGGCGCAGCATGGCATAAGTGAGAAGCAAAAGGGGTGTTCGAGGGTGACCGAATTGCTGGGCGAGTGGTGAAATACGTTGACCCTAGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCATTCCCGTTGATCAAGAGCGAAAGTTGAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTCAACTATAAATGATACTGACCAGAGATAGGATTCTGTCCATCTCGACTTCTCCCGGATCTTAGAGAAATTACAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACACGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTCCGTTCCTAATAGGGGCAGTAGCCCGGCTAGCTGCTGCTTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGCAAACACAGTGCCCCGGGGTCTTCGGGCCCCGGTAATCCCTAGTCCCTGCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAGTCGTAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGCGTTCAGAGGAAGTAGATCG Macbrideola_oblonga TAAAGATTAAGCCATGCATGTCTTCGAATAAGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACCATAGCAGGGTATATGGATAACCGTGGTAATTCTGAGGCTAATACATGAACTGGGGCGCGGGGAATGTGCGCGGAGCATGAATGAGCGCACTCCTGGTGGCCCCT-GCAACGGGCTTCTGACCTATCAACTAGACGGCAGCGTAAGGGACATGCTATGGTGACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGGCATCGCTCGAGGGCGTTAGGGGAAATATGAATGGCTGCCTCTAAGGTGGCCAATTCAAATGGGTTTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCAGGGCGCGCTGGCGGCCGTGGGCACCATTTACCATGATCAAACCGGCGTGATCAAAGCAGGCCGTTCCTGCACGGCATAGCATGGCATAAGAGAGCCGCGAAAGGGGTGTTCGGGGGCAGCCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTAGCAAGTCGACCGAAAGCGAAAGCAGCTGTCAAGGGCACACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGGCCAGGGATAGGGCAATGTCCATCTCGACTCCCCCCGGACCTTAGGGAAACTCAAGCCTATGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAAGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCGGGTCCGGATACATGCATGAAAGACAAGCTGACAGACTTTTCTCAATTATGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAGCGTTCTAACTAGGGGCCGCAGCCCGGCTAGCAGCGGCTTCTTCTTAGACGGATCAGGGCCGATAAGGTCTTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCCGGGCCGCACGCGCGTTACAATGGGAGGCAAAATGAGTTCTCCGTGTCCGACAGGACACGGTAAACCCTAAGTTCTCCCTTGACTGGGCTAGACTCTTGCAATTATTGGTCTTCAACGAGGAATTTTTAGTAGTCGTGGGTCATTAACCCGCGACGAATGCGTCCCTGCCTTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTACAGCGGTTACGCGTTCGGAGGCCGGGTTGAC Mucilago_crustacea ---------------------------------GGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGCAATAAGGATAACCATGGTAATTCTGAGGCTAATACAAGAAGGGAAAGCCGGGAGACGTACGAGTATCGGGAAAGAACGTACCCCGAGCGGCTCTT-GCAATGTGCTTCTGACCTATCAACTAGATGGCAGCGTAAGGGACATGCTATGGTGACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGGCAATGCTTGAGGGCGTTAGGGGACATATGAATGCCTGCCTTATAGGTGGGCAATTCAAATGGGTCTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAACATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAATCGGCGGGGCGCGCCGGCGGCAGGGAGTGCCACTCACCATGACCAAACTGGGTTGATCAAACAAGGTCGCTCTTGCACAGCACAGCATGGCATGAACGAGAAGCGATAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCACGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGGCCAGGGATTGGACACTGTCCATCTCGACTCCTCCTGCACCTTAGAGAAATTAGAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCGGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCGACGTTCCTAATAGGGGCGGCAGCCAGGCTAGCAGTCGCCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATAGAAAGTGCCCCGCGGCCGACAGGTCGCGGTAACCCCTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGCTTTGCGGTTACGCGTTCGGAGACATCGGTTCG Physarum_album TAAAGACTAAGCCATGCATGCCTTCGAATA-GAAGACGCAA-TCTCTCTGAATCTGCGAACGGCTCCGCATACCAGTTGTAAACCATAGCAAGCAATAAGGATACCCATGGTAATTCTGAGGCTAATACAAGTCTGGAAGGCTGGGGGTCGTGTGAAACCTAGGAAACGATGCACACTGGGTGGCTCTT-GCTTTGTGCTTCTGACCTATCAACTCGATGGCAGCGTAAGGGACATGCTATGGTTACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCACACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCAATGGGTAACACCTGAGGGCGTTAGGGGACATATGAATGCCTGCCATTA-GGTGGGCAATTCAAATGGGACTGATGCAAACAGCCCATCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGCCCGGGCGCGCCACTGGCTGACTGTACCGTTTACTATGACCAAACTGGAGTGCTCAAAGCCGGTCACTTCACTACAGCGCAGCATAGTATAACTGAAAAGATTAAGGGATGTTCGAGGGTGACCGAATTACTGGGCGAGTGGTGAAATACGTTGACCCTAGTAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCATACCCGATGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Physarum_didermoides TAAAGACTAAGCCATGCATGCCTTCGAATA-GAAGA-GCT-TTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGTCACAGGGATAACCCTGGTAATCCTGAGGCTAATACAAGACCGGAAGGTCGAGGGTCGTGTGATCGACATGAAAGGGTGCACCTCGGGTGGGTCTT-GCTGTGTGCTTCTGACCTATCAACTAGATGGCAGCGTAAAGGACATGCTATGGTGACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCACACTTCTAAGGAAGGCAGCAGGCGCGTAACGTTCCCATTGGGCAAAGCCTGAGGGCGTTGGGGGACATATGAATGCTTGCCTTAT-GGTAGGCAATTCAAATGGGTTTGTTCTAAACAACCTATCGAGTAACAATTGGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCAGGGCGCGTCGTTGGACTAGGTCGCCAATCACTATGATCAAACTATAGTGATCAAAGCGGGTCATTCACGCATAGCATAGCATAGTATGAATGAGTCGCGAAAGGGATGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCATGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACAAACCAGGGATGAGACACTGTCCATCTCGACTCCTTTCGAACCTTAGAGAGATCAGAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCGGATACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCGTAGTTCGTGGATTGATTTGTCTGGTTTATTCCGATAACGAGCGAGACCCCAACGTTCCTAATAGGGGCTTTAGCCCAGTTAGCTATCGCTTCTTCTTAGACGTATCAGAGCCGATAAGGCGCTTGAAATGGGTTAATAACAGGTCAGTGATGCCCTTAGATGTTCTGGGCCGCACGCACGTTACAATGGCATGTAAAGCGAGTGCTCCGGGGCTGAAAGGTCTCGGTAATCCTTAATCCCTGCCTTGACTGGGATAGATCATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGGCGCAGGTCATTAACCTGCGTCGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGAATTTTCCAGCTACGCGTTCAGAGCTGATGGTATC Physarum_polycephalum TAAAGACTAAGCCATGCATGTCTCCGAATA-GAAGA-GCAAGTCTCTCTGAATCTGCGAACGGCTCCGCATACCAGTTGTAAACCATAGCAAGCCACAGGGATAACCCTGGTAATTCTGAGGCTAATACAAGAAGGGGAGGGCGGGGGTTGTGTGACAACTGGGAGTGGCCACACTCTGGGTGGCTCTC-GCTGTGTGCTTCTGACCTATCAACTAGATGGCAGCGTAACGGACATGCCATGGTAACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCACACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCATTGGGCAAAGCTCGAGGGCGTTAGGGGACATATGAATGCCTGCCTTAT-GGTGGGCAATTCAAATGGGACTGTTTTAAACATCCTATCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCAGAGCGCGCCAACGGCTCGGGGTACCAATCACCATGATTAAACCGTAGTGACCAAAGCACGTCTTTCGGGCACGGCACAGCATGGGACGAATGAAAAGCGAAAGGGATGTTCGAGGGTGACCGAATTGCTGGGCGAGTGGTGAAATACGTTGACCCTAGCAAGTCGACCAAAGGCGTAAGCAGTCATCAAGGGCATTCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATGCAGACCAGGGATAGGACAGTGTCCATCTCGACTC-TTCCGGACCTTGGAGAAATCAGAGTCTATGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCGGATACACGTATGAAAGTCAAGCTGAAAGACTTTACTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTTTATTCCGATAACGAGCGAGACCCCGGCGTTCCTAATAGGGGTGGCAGCCAGACTAGCTCCCACCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGCATGTAAAACGAGTGCTCCACGGCCGAAAGGTCGTGGTAACCCTTAGTCCCTGCTTTGACTGGGACAGATCTTTGCAATTATTGGTCTCAAACGAGGAATTTTTAGTAATCGCAGGTCATTAACCTGCGTTGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTACAGTTACGCGTTCGGAGGCGATGTTTCG Protophysarum_phloiogenum TAAAGATTAAGCCATGCATGCCTTCGAATAAGGGTAAGCTATTCTCTCTGAATCTGCGAACGGCTCCGCACACCAGTTGTAAACCAAAGCAAGCTCGATGGATACCCCCGGTAATTCTAAGGCTAATACACGACTGGGAGGCGGGGGGACGTGCCCGGACCGGGAGTGGGGGTGCCTCTAGCGGCACTT-GCTACGTGCTTCTGACCTATCAACTTGATGGCAGCCTAAAGGACATGCCATGGTGACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCACTGGTCAACGACCGAGGGCGTTAGGGGACATATGAATGCCCGCCCTATGGGTGGACAATTCAAATGGATCTGTTTTAAACAGACTCTTGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGTGCGCCGGCGGAGGGGGGGGCCACTTACCATGATCAAACTGGAGTGCTCAAAGCAGGCCGCATCTGCACAGACTAGCATGGCATAACTGAGGAGCGATAGGGGTGTTCGAGGGTGACCGAATTGTCGGGCGAGCGGTGAAATGCGTTGACCCTGGCAAGTCGTCCAAAGGCGAAAGCAGTCATCAAGGGCATTCCCATTGATCAAGAGCGAAAGTTAAGGGTTCGAATACGATCAGATACCGTAGTAGTCTTAACTATAAATGATACTGACCAGGGATAGGACAGTGTCCTTCTCGACTCCTCCCGGACCTTAGAGAAATCAAAGTCTTTGAGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAAGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCTGATACGCGTATGAAAGACAAGCTGAGAGACTTTTCTCAATGACGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGAATGGTTTGTCTGGTTTATTCCGATAACGAGCGAGACCCCAGTGTCCTTAATAGGAGTGCCAGCCCGGCCAGCAGGCGTCTCTTCTTAGGCATATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTAGCCACAGAAAGTGCCCCGCGGCCGACGGGTCGCGGTAATCCCTAATCGTTCCCTTGACTGGGACAGACTCTTGCAATTATTGGTCTCGAACGAGGAATTTTTAGTATACGCCGGTCATTAACCGGCGCGGAATGCGTCCCTGCCTTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTCACAGTTACGAGTTCAGAGGACGGGGCCGA Pseudodidymium_cryptomastigophorum TAAAGACTAAGCCATGCATGCCTTCGAATACGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACTATAGCAAGCAACACGGATAACCCTGGTAATTCTGAGGCTAATACGAGACTGGAAGGCTGGGAGGTGTGTGATTGCTGGGAATAGACACACCCCGAGCGGCTCTT-GCTTTGTGCTTCTGACCTATCAACTAGATGGCAGCGTAACGGACATGCTATGGTTACAACGGGTACAGAGGATAAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGTACAATGTATGAGGGCGTTAGGGGACATATGAATGTCTGCCCTATGGGTGGACAATTCAAATGGGTCTGTTGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGCGCGCTGGCGGCTGGGGGTGCCACTTACCATGATTAAACTGGGTTGATCAAGTAAGGTCGTTCTTGCACAGCACAGCATGGTATAAACGAGAAGCGATAGGGGTGTTCGAGGGTGACCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAGGCGAAAGCAGTCATCAAGGGCACACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGACCAGGGATAGGACTCTGTCCATCTCGACTTCTTCTGGACCTTGGAGAAATTACAGTCTTTGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCAGGTCCAGATACACGTATGAAAGACAAGCTGAAAGACTTTTCTCAATGATGTAAGTGGTGGTGCATGGTCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCTACGTTCCTAATAGGGGCGGCAGCCCGGCTAGCAGCCGCCTCTTCTTAGACGTATCAGAGCCGATAAGGTTCTTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCTGGGCCGCACGCGCGTTACAATGGTATACATAGAACGTGCCCCGCGGCCTACTGGCCGCGGTAATCCTTAATCTCTCCCTTGACTGGGACAGACTATTGCAATTATTGGTCTCCAACGAGGAATTTTTAGTAGTCGCAGGTCATTAACCTGCGACGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTTGCGGTTACGAGTTCGGAGGCAGCGGTTAC Semimorula_liquescens -AAAGATTAAGCCATGCATGCCCATG-ATTAGAACGTGTTTGTAGCATCGAATCTGCGAACGGCTCCACATAACAATTGTAACCCAAGGCAAGGAAGACGGATATCCCCGGTAATTCTAAGGTTAATACGACATCGGTTGAGCACCC-TGGCGCAAGCACCGGACGGGCTTCAT-GCTTAGCGGCACTTTGCCCCGGACTTTTGACCTATCAACTCGATGAAAGCGCCCACGTCCGCACATGGTAACAACGGGTACAGAGGATCAGGGTTCGATCCTGGAGAGTGGGCCTTAAAAATTGCTCACACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCATTGGGCCAAGCTCGAGGGCGTTACAGGAAGCATTGGAGCCTGCCCATTGGGCGGGCTACCAGAATGGGGCCACCGTAAATATACGGCCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATGGCGTAAATTAAAGTTGCTGCAGTTGAAACGCTCGTAGTCGGGGAAACGGAGCTCAGCACCCTGCCCCGGATTACCATGAATAAAGTAGAGTGATCGAGGCGAGCCAGTCGTGTATATCGCAGCATGGTATAACCTTTGGTCAAAAGGGGTGTTCGGGGGTTGCAGAATCGCTGGGCGAGGGGTGAAATCCGTTGACCCTAGCGAGTCTACCAAGTGCGAAAGCAGCAGCCAAGGGCACTTTCATTGATCAAGAGCGAAAGTTGAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTCAACTATAAATGATACCGACCAGGGATGTGGATTAGTCCGTCTCGACGCCCCCCGACCCTCGGCGAAAGCAAAGTCTTTGGGTTCCGGGGGGAGTATGGTCGCAAGACTGAAACTTAAAGGAATTGACGGAAGGGCACACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAGCTCACTAGGTCAAGATGCGTGAATGAAGGACCAGCTGATAGACTTTTCCCAATACCGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGATTGATTTGTCTGGTCGATTCCGATAACGAGCGAGACACTAACGATCTAAATAGGGTATCCCCTTTTG-------------CTTCTTAGAGGTATCGGGTGCGACAAAGCCCCAAAAACAGTGCAATAACAGGTCTGTAATGCCCTTAGATGTCCTAGGCCGCACGCGCGCTACAATGACGCGGATAGCGAGCCACCCGAAACCCCCGGGACTGGGAAATCTCCGAACGGATACTCGTCTGGGCCTG-CGCTTGTAACTATAGGACACCAACGAGGAATTTCTAGTAGGCGCGGGTCATCAGCCCGCGCCGACTCTGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGAGTGGTTTGGTTACGTTCGTGGAGTCCCTGGTAAA Stemonitis_axifera TAAAGATTAAGCCATGCATGCCTAAGACTATGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACCATAGCA-GTTATATGGATAACCGTGGTAATTCTGAGGCTAATACATGACCGGCTTGCTGGGGGACGTGCGATAA-CGGGAATGAGCGCACCTCGGGCGGCCTCT-GCAACGGGCTTCTGACCTATCAACTAGACGGCAGCGTAAGGGACATGCTATGGCAACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCTTGGGCAAAGCTCGAGGGCGTTATGGGAAATATGAATGCTTGCCTATACGGTGGGCAATTCAAATGGGTTTGTCGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCAGAGTGCGCCCGTGGCTCTGGGTACCATTTACCATGATTAAACCGGCGTGATCAAGGCAAACCGTTACTGCACGGCTTAGCATGGCATAAAAGATTCGCGAAAGGGGTGTTCGGGGGCAGCCGAATTGCCGGGCTAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCGAAAGCGAAAGCAGCTGTCAAGGGCACACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGGCCAGGGATAGGGCAATGTCCATCTCGACTCCCCCCGGACCTTTGGGAAACCAAAGCCTATGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Stemonitis_flavogenita TAAAGATTAAGCCATGCATGCCTAAGACTATGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACCATAGCA-GCTATATGGATAACCGTGGTAATTCTGAGGCTAATACATGATCGGCTTGGTGGGGGACGTGCGATTACCGCGAAAGGACGCACCCCGGGCGGCCCCT-GCAACGGGCTTCTGACCTATCAACTAGACGGCAGCGTAAGGGACATGCTATGGTAACAACGGGTACAGAGGATTAAGGTTC-ATTCTGGAGAATGGGCCTGAAAAATTGCTCATACTTCTAAGGAAAGCAACAAGCGCGCAACGTTCCCCTTGGGCAAAACTCCAAGGCGTTATGGGAAATATGAATGCTTGCCTTTACGGTGGGCAATTCAAATGGGTTTGTCGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGTGCGCCTTTGGCTCTGGGTACCAATTACCATGATTAAACCGGAGTGATCAAAGCAAACCGCCACTGCACGGATTAGCATGGCATAAGAGTTCCGCGAAAGGGGTGTTCGGGGGCAGCCGAATTGCCGGGCTAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCGAAAGCGAAAGCAGCTGTCAAGGGCACACCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGGCCAGGGATAGGGCAATGTCCATCTCGACTCCCCCCGGACTTTTGGGAAACCAAAGCCTATGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCGGGTCCAGATACATGGATGAAAGACAAGCTGATAGACTTTTCTCAATTATGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGGTTTGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGGTCTAAATAGGGGCCGCAACCCGGCTAGCAGGCGCTTCTTCTTAGACGGATCGGGGCCGATAAGGTCTCTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCCGGGCCGCACGCGCGTTACAATGGGGGGCAAAACGAGTGTCCCGCCGCCTACCGGTGGTGGTAACCCGTAGGGCCCCCCTTGACTGGGCTAGTCTCTTGCAATTATTGGTCTTCAACGAGGAATTTTTAGTAGGCGCGGGTCATTAACCCGTGCCGAATGCGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGTTTCGCGGTTACGTATTCGGAGATTCTTTCAAC Symphytocarpus_impexus CAAAGACTAAGCCATGCATG--TCCGACTAAGAGGAAGCAATTCTCTCTGAATCTGCGAACGGCTCCGCAAACCAGTTGTAAACCCAAGCA-CATATATGGATAACCGTGGTAATTCTGAGGCTAATACATGACTGGCGAAGCGGGGGACGCGCGGCCA-CACGAAAGAACGCACCCCTAGCGGCCTAT-GCATCGGGCTTCTGACCTATCAACTAGACGGCAGCATAAGGGACATGCTATGGTGACAACGGGTACAGAGGATTAGGGTTCGATCCTGGAGAGTGGGCCTGAGAGATTGCTCATACTTCTAAGGAAGGCAGCAGGCGCGCAACGTTCCCCATGGGCATTGCTCGAGGGCGTTAGGGGAAATATGAATGCCTGCCTATACGGTGGGCAATTCAAATGGGTTTGTCGTAAACAGGCTCTCGAGTAACAATTAGAGGACAAGTCTGGTGCCAGCACCCGCGGTAATTCCAGCTCTAATAGCATACGTTAAAGTTGTTGCGGTTAAAACGCTCGTAGTCGGCGGGGTGCGCCTTTGGCTCCGGGTACCATTTACCATGATTAAACCGGCGTGATCAAAGCAGGACACTACTGCACGGCTTAGCATGGCATAAGAGGCCAGCGAAAGGGGTGTTCGGGGGCAGCCGAATTGCCGGGCGAGTGGTGAAATACGTTGACCCTGGCAAGTCGACCAAAAGCGAAAGCAGCTGTCAAGGGCACGCCCGTTGATCAAGAGCGAAAGTTAAGGGTTCGAAGACGATCAGATACCGTCGTAGTCTTAACTATAAATGATACTGGCCAGGGATAGGGCAATGTCCATCTCGACTCCCCCCGCACCTTAGGGAAACCAAAGCCTATGAGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAAGGCACACAAAGAGTGGAACCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCGGGTCCAGATACATGCATGAAAGACAAGCTGATAGACTTTTCTCAATTATGTAAGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGGTTCGTCTGGTCTATTCCGATAACGAGCGAGACCCCAACGGTCTAAATAGGGGCAGCGGCTGGGATAACAGTCGCATCTTCTTAGACGGATCGGGGCCGACAAGGTCCCTGAAATGGGTTAATAACAGGTCAGTCATGCCCTTAGATGTTCCGGGCCGCACGCGCGTTACAATGGGAGGCATAAAGAGTGTTCCATGCCCTACAGGGCACGGTAAACATTAGGGCCTCCCTTGACTGGGATCGGCTATTGCAATTATTGGTCGTAAACGAGGAATTTTTAGTAGGCGCGGGTCATTAGCCCGTGCCGAATGCGTCCCTGCCTTTTGTACACACCGCCCGTCGCTGCTACCGATTGGGCATCGCGGTTACGCGTTCGGAGGGCCCTGCAAC ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = Fig._2) = N: 1-1451; CODONPOSSET * CodonPositions (CHARACTERS = Fig._2) = N: 1-1451; END; BEGIN TREES; TITLE Tb10810; LINK TAXA = Taxa3; TRANSLATE 1 Badhamia_affinis_AB435341, 2 Badhamia_panicea_AB259454, 3 Physarum_nigropodum_AB259527, 4 Badhamia_macrocarpa_AB259451, 5 Badhamia_macrocarpa_AB259452, 6 Physarum_flavicomum_AB259507, 7 Physarum_flavicomum_AB259508, 8 Physarum_tenerum_AB259550, 9 Physarum_viride_AB259552, 10 Physarum_viride_AB259551, 11 Physarum_album_AB259531, 12 Physarum_album_AB259532, 13 Fuligo_aurea_AB259478, 14 Fuligo_septica_AB259482, 15 Fuligo_septica_f_flava, 16 Fuligo_candida_AB435344, 17 Fuligo_candida_AB259480, 18 Craterium_dictyosporum_AB259462, 19 Craterium_dictyosporum_AB259463, 20 Diachea_subsessilis_AB259363, 21 Diachea_leucopodia_AB259360, 22 Diachea_radiata_AB259362, 23 Physarum_crateriforme_AB259503, 24 Physarum_confertum_AB259500, 25 Physarum_lateritium_AB259514, 26 Physarum_pulcherrimum_AB259536, 27 Physarum_digitatum_AB259506, 28 Physarum_stellatum_AB259545, 29 Hyperamoeba_flagellata_AF411289, 30 Physarum_didermoides_AY183449, 31 Physarum_didermoides_AB259505, 32 Physarum_didermoides_AB259504, 33 Physarum_psittacinum_f_fulvum, 34 Badhamia_alpina_AB259449, 35 Badhamia_panicea_var_nivalis, 36 Hyperamoeba_sp_G1a, 37 Hyperamoeba_sp_W2i, 38 Physarum_reniforme_AB259538, 39 Physarum_reniforme_AB259539, 40 Physarum_pusillum_AB259537, 41 Badhamia_utricularis_AB259456, 42 Physarum_albescens_AB259487, 43 Physarum_polycephalum_X13160, 44 Physarum_rigidum_AB259541, 45 Fuligo_septica_AJ584697, 46 Fuligo_leviderma_DQ903676, 47 Physarum_bogoriense_AB259495, 48 Physarum_conglomeratum_AB259501, 49 Physarum_plicatum_AB259533, 50 Physarum_sulphureum_AB259546, 51 Physarum_superbum_AB259547, 52 Physarum_mortonii_AB259524, 53 Physarum_melleum_AB259523, 54 Physarum_lakhanpalii_AB259512, 55 Physarum_lakhanpalii_AB259513, 56 Physarum_melleum_AB259520, 57 Physarum_melleum_AB435350, 58 Physarum_melleum_AB259521, 59 Physarum_hongkongense_AB259511, 60 Craterium_aureum_AB259459, 61 Craterium_leucocephalum_var_cylindricum, 62 Craterium_leucocephalum_var_scyphoides, 63 Craterium_minutum_AB25947373, 64 Physarum_roseum_AB259543, 65 Craterium_reticulatum_AB259476, 66 Physarum_florigerum_AB259509, 67 Physarum_nucleatum_AB259528, 68 Leocarpus_fragilis_var_bisporus, 69 Physarum_bivalve_AB259488, 70 Physarum_bivalve_AB259490, 71 Physarum_loratum_AB259515, 72 Physarum_mutabile_AB259525, 73 Physarum_cinereum_AB259498, 74 Physarum_luteolum_AB259518, 75 Badhamia_affinis_AB259448; TREE Fig._4 = [&R] (75,(1,((2,3),((((4,5),(10,(9,(8,(6,7))))),(11,12)),((17,(16,(15,(13,14)))),(((23,(22,(21,(18,(19,20))))),(28,(27,(24,(25,26))))),((29,(32,(30,31))),(33,(((40,((34,35),(36,(37,(38,39))))),(((44,(41,(42,43))),(45,46)),(47,(59,((53,(52,(51,(50,(48,49))))),((54,55),(58,(56,57)))))))),((60,((61,62),(63,64))),((65,(66,67)),(68,(((69,70),(71,72)),(73,74)))))))))))))); END; BEGIN TREES; TITLE Tb10809; LINK TAXA = Taxa1; TRANSLATE 1 Echinostelium_coelocephalum, 2 Echinostelium_minutum, 3 Semimorula_liquescens, 4 Echinostelium_arboreum, 5 Lamproderma_atrosporum_var_retisporum, 6 Lamproderma_fuscatum, 7 Comatricha_sinuatocolumellata, 8 Comatricha_nigricapillitia_1, 9 Comatricha_nigricapillitia_2, 10 Enerthenema_papillatum, 11 Amaurochaete_comata, 12 Comatricha_nigra, 13 Macbrideola_oblonga, 14 Hyperamoeba_sp_A1K, 15 Hyperamoeba_sp_AH1, 16 Hyperamoeba_sp_BuP, 17 Hyperamoeba_sp_E23, 18 Hyperamoeba_sp_E3P, 19 Hyperamoeba_sp_Hpl, 20 Pseudodidymium_cryptomastigophorum, 21 Hyperamoeba_flagellata, 22 Symphytocarpus_impexus, 23 Hyperamoeba_sp_B12, 24 Hyperamoeba_sp_ATCC50750, 25 Stemonitis_flavogenita, 26 Stemonitis_axifera, 27 Lamproderma_ovoideum_s_str, 28 Lamproderma_sauteri, 29 Didymium_dubium_K15, 30 Lepidoderma_carestianum, 31 Diderma_globosum, 32 Protophysarum_phloiogenum, 33 Lepidoderma_tigrinum, 34 Didymium_anellus, 35 Diderma_niveum, 36 Didymium_squamulosum, 37 Mucilago_crustacea, 38 Didymium_iridis_CR19, 39 Didymium_iridis_CR8, 40 Didymium_iridis_CUR1, 41 Didymium_sp_ECH1, 42 Didymium_sp_ECH49, 43 Didymium_iridis_HA4, 44 Didymium_nigripes, 45 Hyperamoeba_dachnaya, 46 Didymium_sp_OX13PS, 47 Fuligo_leviderma, 48 Hyperamoeba_sp_W2i, 49 Hyperamoeba_sp_G1a, 50 Fuligo_septica, 51 Physarum_didermoides, 52 Physarum_polycephalum, 53 Badhamia_panicea_var_nivalis, 54 Physarum_album; TREE Fig._2 = [&R] ((((1,2),3),4),((5,6),((((7,((8,(9,10)),12)),11),(13,(((14,15,16),(23,24,25),26),22))),(((((((17,18),((((19,43),46),((((20,39),((41,42),45)),38),(40,44))),36)),37),((((((21,51),52),(47,50)),54),((48,53),49)),((31,(33,35)),34))),(29,32)),30),(27,28))))); END; BEGIN TREES; TITLE Tb10811; LINK TAXA = Taxa2; TRANSLATE 1 Diderma_darjeelingense, 2 Lepidoderma_carestianum_AM231296, 3 Lepidoderma_carestianum_AB259440, 4 Lepidoderma_granuliferum, 5 Didymium_clavus_AB259389, 6 Didymium_clavus_AB259390, 7 Didymium_comatum, 8 Protophysarum_phloiogenum, 9 Didymium_dubium_AB259399A, 10 Didymium_dubium_K15, 11 Hyperamoeba_sp_E23, 12 Hyperamoeba_sp_E3P, 13 Didymium_iridis_CR8, 14 Didymium_sp_OX13PS, 15 Hyperamoeba_sp_Hpl, 16 Didymium_squamulosum_AB259430, 17 Didymium_squamulosum_AM231293, 18 Didymium_squamulosum_AB259438, 19 Didymium_crustaceum, 20 Mucilago_crustacea_DQ903679, 21 Mucilago_crustacea_AB259447, 22 Didymium_dictyopodium, 23 Didymium_squamulosum_AB259436, 24 Didymium_squamulosum_AB259432, 25 Didymium_squamulosum_AB259431, 26 Didymium_bahiense_AB259387, 27 Didymium_iridis_CUR1, 28 Didymium_nigripes_AF239230, 29 Didymium_verrucosporum_AB259439, 30 Didymium_iridis_AJ938153, 31 Pseudodidymium_cryptomastigophorum, 32 Didymium_bahiense_AB259388, 33 Didymium_sp_ECH1, 34 Hyperamoeba_dachnaya, 35 Didymium_sp_ECH49, 36 Didymium_iridis_CR19, 37 Didymium_floccosum, 38 Didymium_melanospermum, 39 Didymium_minus, 40 Didymium_laccatipes, 41 Didymium_iridis_HA4, 42 Didymium_iridis_AB259407, 43 Didymium_iridis_AB259408, 44 Didymium_nigripes_AB259426, 45 Didymium_nigripes_AB259425, 46 Didymium_nigripes_AB259424, 47 Didymium_megalosporum, 48 Didymium_floccoides, 49 Didymium_marineri, 50 Didymium_flexuosum, 51 Didymium_serpula, 52 Didymium_leoninum, 53 Didymium_panniforme, 54 Diderma_alpinum, 55 Diderma_radiatum, 56 Diderma_hemisphaericum, 57 Diderma_microsporum, 58 Didymium_anellus, 59 Diderma_saundersii_AB259379, 60 Diderma_saundersii_AB259380, 61 Diderma_effusum, 62 Diderma_testaceum, 63 Diderma_simplex_var_applanatum, 64 Diderma_deplanatum, 65 Diderma_niveum, 66 Diderma_globosum_var_europaeum, 67 Diderma_umbilicatum, 68 Lepidoderma_tigrinum_DQ903678, 69 Lepidoderma_tigrinum_AB259445, 70 Diderma_aurantiacum, 71 Diderma_floriforme_var_subfloriforme, 72 Diderma_rugosum; TREE Fig._3 = [&R] (55,54,((58,(56,57)),((64,(63,((59,60),(61,62)))),(((65,66),(67,(68,69))),((72,(70,71)),((1,(4,(2,3))),((5,6),(((((((7,8),(9,10)),(11,12)),(18,((15,(13,14)),(16,17)))),(19,(20,21))),((22,23),(24,25))),((((((((26,27),(28,29)),(30,31)),(36,(32,(35,(33,34))))),(40,(37,(38,39)))),(47,(41,((42,(43,44)),(45,46))))),(48,49)),((50,51),(52,53))))))))))); END;