#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 4:22 GMT TreeBASE (cc) 1994-2008 Study reference: Barnes I., Crous P.W., Wingfield B.D., & Wingfield M.J. 2004. Multigene phylogenies reveal that red band needle blight of Pinus is caused by two distinct species of Dothistroma, D. septosporum and D. pini. Studies in Mycology, 50(2): 551-565. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10199] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=35; TAXLABELS Botryosphaeria_ribis Dothistroma_pini_Michigan_USA_CMW10930 Dothistroma_pini_Michigan_USA_CMW10951 Dothistroma_pini_Michigan_USA_CMW14905 Dothistroma_pini_Michigan_USA_CMW6400 Dothistroma_pini_Minnesota_USA_CMW14820 Dothistroma_pini_Nebraska_USA_CMW14821 Dothistroma_rhabdoclinis Dothistroma_septosporum_AUSTRALIA_CMW6841 Dothistroma_septosporum_AUSTRALIA_CMW6845 Dothistroma_septosporum_AUSTRALIA_CMW6846 Dothistroma_septosporum_AUSTRIA_CMW14903 Dothistroma_septosporum_AUSTRIA_CMW14904 Dothistroma_septosporum_CANADA_CMW14823 Dothistroma_septosporum_CHILE_CMW10247 Dothistroma_septosporum_CHILE_CMW8611 Dothistroma_septosporum_CHILE_CMW9304 Dothistroma_septosporum_ECUADOR_CMW9920 Dothistroma_septosporum_FRANCE_CMW9992 Dothistroma_septosporum_GERMANY_CMW13122 Dothistroma_septosporum_KENYA_CMW10622 Dothistroma_septosporum_KENYA_CMW10722 Dothistroma_septosporum_NEW_ZEALAND_CMW9937 Dothistroma_septosporum_NEW_ZEALAND_CMW9939 Dothistroma_septosporum_NEW_ZEALAND_CMW9943 Dothistroma_septosporum_Oregon_USA_CMW14822 Dothistroma_septosporum_POLAND_CMW13004 Dothistroma_septosporum_POLAND_CMW13007 Dothistroma_septosporum_POLAND_CMW13010 Dothistroma_septosporum_RSA_CMW11356 Dothistroma_septosporum_RSA_CMW684 Dothistroma_septosporum_RSA_CMW8658 Dothistroma_septosporum_SLOVAKIA_CMW13123 Mycosphaerella_dearnessii_CMW13119 Mycosphaerella_dearnessii_CMW9985 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=36; TAXLABELS Botryosphaeria_ribis Dothistroma_pini_Michigan_USA_CMW10930 Dothistroma_pini_Michigan_USA_CMW10951 Dothistroma_pini_Michigan_USA_CMW14905 Dothistroma_pini_Michigan_USA_CMW6400 Dothistroma_pini_Minnesota_USA_CMW14820 Dothistroma_pini_Nebraska_USA_CMW14821 Dothistroma_rhabdoclinis Dothistroma_septosporum_AUSTRALIA_CMW6841 Dothistroma_septosporum_AUSTRALIA_CMW6845 Dothistroma_septosporum_AUSTRALIA_CMW6846 Dothistroma_septosporum_AUSTRIA_CMW14903 Dothistroma_septosporum_AUSTRIA_CMW14904 Dothistroma_septosporum_CANADA_CMW14823 Dothistroma_septosporum_CHILE_CMW10247 Dothistroma_septosporum_CHILE_CMW8611 Dothistroma_septosporum_CHILE_CMW9304 Dothistroma_septosporum_ECUADOR_CMW9920 Dothistroma_septosporum_FRANCE_CMW9992 Dothistroma_septosporum_GERMANY_CMW13122 Dothistroma_septosporum_Idaho_USA_CMW15077 Dothistroma_septosporum_KENYA_CMW10622 Dothistroma_septosporum_KENYA_CMW10722 Dothistroma_septosporum_NEW_ZEALAND_CMW9937 Dothistroma_septosporum_NEW_ZEALAND_CMW9939 Dothistroma_septosporum_NEW_ZEALAND_CMW9943 Dothistroma_septosporum_Oregon_USA_CMW14822 Dothistroma_septosporum_POLAND_CMW13004 Dothistroma_septosporum_POLAND_CMW13007 Dothistroma_septosporum_POLAND_CMW13010 Dothistroma_septosporum_RSA_CMW11372 Dothistroma_septosporum_RSA_CMW684 Dothistroma_septosporum_RSA_CMW8658 Dothistroma_septosporum_SLOVAKIA_CMW13123 Mycosphaerella_dearnessii_CMW13119 Mycosphaerella_dearnessii_CMW9985 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=36; TAXLABELS Botryosphaeria_ribis Dothistroma_pini_Michigan_USA_CMW10930 Dothistroma_pini_Michigan_USA_CMW10951 Dothistroma_pini_Michigan_USA_CMW14905 Dothistroma_pini_Michigan_USA_CMW6400 Dothistroma_pini_Minnesota_USA Dothistroma_pini_Nebraska_USA Dothistroma_rhabdoclinis Dothistroma_septosporum_AUSTRALIA_CMW6841 Dothistroma_septosporum_AUSTRALIA_CMW6845 Dothistroma_septosporum_AUSTRALIA_CMW6846 Dothistroma_septosporum_AUSTRIA_CMW14903 Dothistroma_septosporum_AUSTRIA_CMW14904 Dothistroma_septosporum_CANADA Dothistroma_septosporum_CHILE_CMW10247 Dothistroma_septosporum_CHILE_CMW8611 Dothistroma_septosporum_CHILE_CMW9304 Dothistroma_septosporum_ECUADOR Dothistroma_septosporum_FRANCE Dothistroma_septosporum_GERMANY Dothistroma_septosporum_Idaho_USA Dothistroma_septosporum_KENYA_CMW10622 Dothistroma_septosporum_KENYA_CMW10722 Dothistroma_septosporum_NEW_ZEALAND_CMW9937 Dothistroma_septosporum_NEW_ZEALAND_CMW9939 Dothistroma_septosporum_NEW_ZEALAND_CMW9943 Dothistroma_septosporum_Oregon_USA Dothistroma_septosporum_POLAND_CMW13004 Dothistroma_septosporum_POLAND_CMW13007 Dothistroma_septosporum_POLAND_CMW13010 Dothistroma_septosporum_RSA_CMW11356 Dothistroma_septosporum_RSA_CMW684 Dothistroma_septosporum_RSA_CMW8658 Dothistroma_septosporum_SLOVAKIA Mycosphaerella_dearnessii_CMW13119 Mycosphaerella_dearnessii_CMW9985 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4322] TITLE Beta_tubulin_1_with_primers_1a_and_1b; LINK TAXA = Taxa1; DIMENSIONS NCHAR=367; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Botryosphaeria_ribis GTTCCTGAGCTCACTCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCCTCGGACTTCCGCAACGGCCGCTACCTCACCTGCTCCGCTATCTTCCGCGGTAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCCAACAACGTCCAGACCGCTCTCTGCTCCATTCCTCCCCGTGGCCTTAAGATGTCCTCGACCTTCGTCGGTAACTCGACCTCGATCCAGGAGCTCTTCAAGCGTGTCGGTGACCAGTTCACTGCTATGTTCCGTCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGT Dothistroma_pini_Michigan_USA_CMW10930 GTTCCAGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCCAGCGACTTCCGCAACGGCCGTTACCTCACTTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTTGAGGATCAGATCCGCAACGTACAGAACAAGAACACTGCCTACTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGCCTCAAGATGTCGTCTACCTTCGTCGGCAACAGCACCTCCATCCAGGAGCTGTTCAAGCGTGTCGGTGACCAATTCACCGCTATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGTGAGGGTATGGACGAGATGGAGT Dothistroma_pini_Michigan_USA_CMW10951 GTTCCAGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCCAGCGACTTCCGCAACGGCCGTTACCTCACTTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTTGAGGATCAGATCCGCAACGTACAGAACAAGAACACTGCCTACTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGCCTCAAGATGTCGTCTACCTTCGTCGGCAACAGCACCTCCATCCAGGAGCTGTTCAAGCGTGTCGGTGACCAATTCACCGCTATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGTGAGGGTATGGACGAGATGGAGT Dothistroma_pini_Michigan_USA_CMW14905 GTTCCAGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCCAGCGACTTCCGCAACGGCCGTTACCTCACTTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTTGAGGATCAGATCCGCAACGTACAGAACAAGAACACTGCCTACTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGCCTCAAGATGTCGTCTACCTTCGTCGGCAACAGCACCTCCATCCAGGAGCTGTTCAAGCGTGTCGGTGACCAATTCACCGCTATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGTGAGGGTATGGACGAGATGGAGT Dothistroma_pini_Michigan_USA_CMW6400 GTTCCAGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCCAGCGACTTCCGCAACGGCCGTTACCTCACTTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTTGAGGATCAGATCCGCAACGTACAGAACAAGAACACTGCCTACTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGCCTCAAGATGTCGTCTACCTTCGTCGGCAACAGCACCTCCATCCAGGAGCTGTTCAAGCGTGTCGGTGACCAATTCACCGCTATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGTGAGGGTATGGACGAGATGGAGT Dothistroma_pini_Minnesota_USA_CMW14820 GTTCCAGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCCAGCGACTTCCGCAACGGCCGTTACCTCACTTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTTGAGGATCAGATCCGCAACGTACAGAACAAGAACACTGCCTACTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGCCTCAAGATGTCGTCTACCTTCGTCGGCAACAGCACCTCCATCCAGGAGCTGTTCAAGCGTGTCGGTGACCAATTCACCGCTATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGTGAGGGTATGGACGAGATGGAGT Dothistroma_pini_Nebraska_USA_CMW14821 GTTCCAGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCCAGCGACTTCCGCAACGGCCGTTACCTCACTTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTTGAGGATCAGATCCGCAACGTACAGAACAAGAACACTGCCTACTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGCCTCAAGATGTCGTCTACCTTCGTCGGCAACAGCACCTCCATCCAGGAGCTGTTCAAGCGTGTCGGTGACCAATTCACCGCTATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGTGAGGGTATGGACGAGATGGAGT Dothistroma_rhabdoclinis GTGCCAGAGCTCACTCAGCAAATTTTCGACCCAAAGAACATGATGGCCGCCAGCGACTTCCGCAACGGACGCTACCTCACCTGCTCTGCCATCTACCGTGGTAAGGTGTCGATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTACTTTGTCGAGTGGATTCCAAACAACGTTCAGACCGCCCTTTGCTCCATCCCACCACGCGGCCTCAAGATGTCCTCCACTTTCGTCGGGAACAGCACTTCGATCCAGGAGCTCTTCAAGCGTGTCGGCGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACTGGTGAGGGTATGGACGAGATGGAGT Dothistroma_septosporum_AUSTRALIA_CMW6841 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_AUSTRALIA_CMW6845 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_AUSTRALIA_CMW6846 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_AUSTRIA_CMW14903 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTTACGTGCTCGGCTATTTATCGAGGGAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_AUSTRIA_CMW14904 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTTACGTGCTCGGCTATTTATCGAGGGAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_CANADA_CMW14823 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATTTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_CHILE_CMW10247 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAACTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_CHILE_CMW8611 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAACTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_CHILE_CMW9304 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAACTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_ECUADOR_CMW9920 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAACTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_FRANCE_CMW9992 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_GERMANY_CMW13122 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTTACGTGCTCGGCTATTTATCGAGGGAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_KENYA_CMW10622 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTTACGTGCTCGGCTATTTATCGAGGGAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_KENYA_CMW10722 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_NEW_ZEALAND_CMW9937 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_NEW_ZEALAND_CMW9939 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_NEW_ZEALAND_CMW9943 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_Oregon_USA_CMW14822 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATTTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_POLAND_CMW13004 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_POLAND_CMW13007 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_POLAND_CMW13010 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTTACGTGCTCGGCTATTTATCGAGGGAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGTAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_RSA_CMW11356 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTTACGTGCTCGGCTATTTATCGAGGGAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_RSA_CMW684 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTTACGTGCTCGGCTATTTATCGAGGGAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_RSA_CMW8658 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Dothistroma_septosporum_SLOVAKIA_CMW13123 GTTCCCGAGCTCACCCAGCAAATCTTCGACCCTAAGAACATGATGGCCGCTAGCGACTTCCGCAACGGCCGTTACCTCACGTGCTCGGCTATCTATCGAGGAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTATTTCGTCGAGTGGATTCCAAACAACGTGCAGACTGCCCTTTGCTCGATCCCACCACGCGGTCTCAAGATGTCGTCTACCTTCGTTGGCAACAGCACCTCCATTCAGGAACTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCAGGCGCAAGGCTTTCTTGCATTGGTACACGGGCGAGGGTATGGACGAGATGGAAT Mycosphaerella_dearnessii_CMW13119 GTCCCAGAGCTCACCCAGCAGATCTTCGACCCGAAGAACATGATGGCCGCCAGCGACTTCCGCAACGGCCGCTACCTTACCTGCTCCGCCATCTACCGCGGCAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTACTTCGTCGAATGGATTCCAAACAACGTTCAGACCGCTCTCTGCTCGATCCCACCGCGCGGTTTGAAGATGTCTTCTACCTTCGTCGGCAACAGCACCTCCATCCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCCGTCGCAAGGCTTTCTTGCACTGGTACACCGGTGAGGGCATGGACGAGATGGAGT Mycosphaerella_dearnessii_CMW9985 GTCCCAGAGCTCACCCAGCAGATCTTCGACCCGAAGAACATGATGGCCGCCAGCGACTTCCGCAACGGCCGCTACCTTACCTGCTCCGCCATCTACCGCGGCAAGGTCTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACTGCCTACTTCGTCGAATGGATTCCAAACAACGTTCAGACCGCTCTCTGCTCGATCCCACCGCGCGGTTTGAAGATGTCTTCTACCTTCGTCGGCAACAGCACCTCCATCCAGGAGCTGTTCAAGCGTGTCGGTGACCAGTTCACTGCCATGTTCCGTCGCAAGGCTTTCTTGCACTGGTACACCGGTGAGGGCATGGACGAGATGGAGT ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = Beta_tubulin_1_with_primers_1a_and_1b) = N: 1-367; CODONPOSSET * CodonPositions (CHARACTERS = Beta_tubulin_1_with_primers_1a_and_1b) = N: 1-367; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4313] TITLE 'Dothistroma ITS, 5.8S, ITS2'; LINK TAXA = Taxa3; DIMENSIONS NCHAR=473; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Botryosphaeria_ribis CCGAGTTGATTCGAGCTCCGGCTCGACTCTCCCACCCAATGTGTACC-TACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCTTCGGGGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAACTCCAGTCAGTGAACTTCGCAGTCTGAAAAACAAGTTAATAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCTCCGTCCTCCACGGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGAAAACACC-TCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAA Dothistroma_pini_Michigan_USA_CMW10930 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCTGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTAT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_pini_Michigan_USA_CMW10951 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCTGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTAT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_pini_Michigan_USA_CMW14905 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCTGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTAT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_pini_Michigan_USA_CMW6400 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCTGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTAT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_pini_Minnesota_USA CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCTGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTAT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_pini_Nebraska_USA CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCTGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTAT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_rhabdoclinis CCGAGTGA--GGGCCTTCGGGCTCGAC-CTCCAACCCTTTGTGAAC--ACATCTTGTTGCTTCGG-GGGCGAC--CCTGCCGTTCCGACG------GCGAGCGCCC-CCGGAGGCCTTC----AAACACTGCAT--CTTT------GCGTCGGAGTTT--AAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGCCGCGGTGTTCCG-CGCGCCTCAAAGTCTCCGGCTGAGCTGTCCGTCTCCAAGCGTTGTGATTTCATTAATCGCTTCGGGGTGCGGGCG-GCCGCGGCCGTTAAA- Dothistroma_septosporum_AUSTRALIA_CMW6841 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_AUSTRALIA_CMW6845 ????GTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_AUSTRALIA_CMW6846 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_AUSTRIA_CMW14903 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_AUSTRIA_CMW14904 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_CANADA CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_CHILE_CMW10247 --??????--??????????????GAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_CHILE_CMW8611 ?TGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_CHILE_CMW9304 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_ECUADOR CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_FRANCE CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_GERMANY CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_Idaho_USA CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_KENYA_CMW10622 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_KENYA_CMW10722 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_NEW_ZEALAND_CMW9937 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_NEW_ZEALAND_CMW9939 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_NEW_ZEALAND_CMW9943 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_Oregon_USA CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_POLAND_CMW13004 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_POLAND_CMW13007 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_POLAND_CMW13010 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_RSA_CMW11356 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_RSA_CMW684 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_RSA_CMW8658 CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Dothistroma_septosporum_SLOVAKIA CTGAGTG----AGGGCGAAAGCCCGAC-CTCCAACCCTTTGTGAAC--CAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTTTCGGCG------ACG-GCGCCC-CCGGAGGTCATC----AAACACTGCAT--CTTT------GCGTCGGAGTCTTAAAGTAAATTT----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGT--TCCG-CGCGCCTTAAAGTCTCCGGCTGAGCAGTTCGTCTCTAAGCGTTGTGGCATATATT-TCGCTGAAGAGTTCGGACGGCTTTTGGCCGTTAAA- Mycosphaerella_dearnessii_CMW13119 CTGGCCCC--CGGGCCGGGGGAGTGAT-TTTCAAACCCTTGTGAACTACAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTCT-GGCG------GTG-GTGCTC-CCGGTGGCCATCTATCAAACTCTGCATTACCTT------GCGTCGGAGTCTTATAAAGAATT-----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGCC-TCCG-CGCGCCTCAAAGTCTCCGGCTGAGCAGTCCGTCTCCGAGCGTTGTGACAT---TT-TCGCTAGGGAGTTCGCGTCTGCCGCGGCCGTTAAA- Mycosphaerella_dearnessii_CMW9985 CTGGCCCC--CGGGCCGGGGGAGTGAT-TTTCAAACCCTTGTGAACTACAACTCTGTTGCTTCGG-GGGCGAC--CCCGCCGTCT-GGCG------GTG-GTGCTC-CCGGTGGCCATCTATCAAACTCTGCATTACCTT------GCGTCGGAGTCTTATAAAGAATT-----AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGCC-TCCG-CGCGCCTCAAAGTCTCCGGCTGAGCAGTCCGTCTCCGAGCGTTGTGACAT---TT-TCGCTAGGGAGTTCGCGTCTGCCGCGGCCGTTAAA- ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = 'Dothistroma ITS, 5.8S, ITS2') = N: 1-473; CODONPOSSET * CodonPositions (CHARACTERS = 'Dothistroma ITS, 5.8S, ITS2') = N: 1-473; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4209] TITLE 'Beta tubulin 2 - using primers 2a and 2b'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=418; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Botryosphaeria_ribis CACCACAGGCAGACCATTTCCGGCGAGCACGGCCTGGACGGCTCTGGCGTGTGAGTCT-----GCGCCGTTTCCCGCGCGAATGGCAATGGCTGACCCGTAGCAGCTACAATGGCACCTCCGACCTGCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA---------CTCTCTCACTAATTGCACAAA--------------CACGTAAAGTATGGCAATCTTCT-------------------GAA-CGCGCAG-----------CAGGCGTCCAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCTGGCGCCGGTAACAACTG? Dothistroma_pini_Michigan_USA_CMW10930 GCTTTCTGGCAGACGATTTCCGGGGAGCATGGCCTCTCTCCGGTTGGGATGTATGTGGT----GTTATCAGACTCGTGAAGAAAGCTTGTGCTGAAGACTCGCAGATACGAGGGCACCGCAGATGTCCAGCGCGAGCGGTTGAATGTTTACTTCGACGAGGTACGGACTTCACTTCACTTCCAGTGTGCTATGGCAATGTCGGCACGCTCGCAGCACAGCATCACTTTACTTCTTGGAGATGTC-GATGGAGCCCTTCTAACAGCACCTTCTAGGCAAACACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCCGGCACCATGGACGCCCTTCGAGAAGGC---TTCGGCTCGCTCTTTCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_pini_Michigan_USA_CMW10951 GCTTTCTGGCAGACGATTTCCGGGGAGCATGGCCTCTCTCCGGTTGGGATGTATGTGGT----GTTATCAGACTCGTGAAGAAAGCTTGTGCTGAAGACTCGCAGATACGAGGGCACCGCAGATGTCCAGCGCGAGCGGTTGAATGTTTACTTCGACGAGGTACGGACTTCACTTCACTTCCAGTGTGCTATGGCAATGTCGGCACGCTCGCAGCACAGCATCACTTTACTTCTTGGAGATGTC-GATGGAGCCCTTCTAACAGCACCTTCTAGGCAAACACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCCGGCACCATGGACGCCCTTCGAGAAGGC---TTCGGCTCGCTCTTTCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_pini_Michigan_USA_CMW14905 GCTTTCTGGCAGACGATTTCCGGGGAGCATGGCCTCTCTCCGGTTGGGATGTATGTGGT----GTTATCAGACTCGTGAAGAAAGCTTGTGCTGAAGACTCGCAGATACGAGGGCACCGCAGATGTCCAGCGCGAGCGGTTGAATGTTTACTTCGACGAGGTACGGACTTCACTTCACTTCCAGTGTGCTATGGCAATGTCGGCACGCTCGCAGCACAGCATCACTTTACTTCTTGGAGATGTC-GATGGAGCCCTTCTAACAGCACCTTCTAGGCAAACACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCCGGCACCATGGACGCCCTTCGAGAAGGC---TTCGGCTCGCTCTTTCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_pini_Michigan_USA_CMW6400 GCTTTCTGGCAGACGATTTCCGGGGAGCATGGCCTCTCTCCGGTTGGGATGTATGTGGT----GTTATCAGACTCGTGAAGAAAGCTTGTGCTGAAGACTCGCAGATACGAGGGCACCGCAGATGTCCAGCGCGAGCGGTTGAATGTTTACTTCGACGAGGTACGGACTTCACTTCACTTCCAGTGTGCTATGGCAATGTCGGCACGCTCGCAGCACAGCATCACTTTACTTCTTGGAGATGTC-GATGGAGCCCTTCTAACAGCACCTTCTAGGCAAACACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCCGGCACCATGGACGCCCTTCGAGAAGGC---TTCGGCTCGCTCTTTCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_pini_Minnesota_USA_CMW14820 GCTTTCTGGCAGACGATTTCCGGGGAGCATGGCCTCTCTCCGGTTGGGATGTATGTGGT----GTTATCAGACTCGTGAAGAAAGCTTGTGCTGAAGACTCGCAGATACGAGGGCACCGCAGATGTCCAGCGCGAGCGGTTGAATGTTTACTTCGACGAGGTACGGACTTCACTTCACTTCCAGTGTGCTATGGCAATGTCGGCACGCTCGCAGCACAGCATCACTTTACTTCTTGGAGATGTC-GATGGAGCCCTTCTAACAGCACCTTCTAGGCAAACACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCCGGCACCATGGACGCCCTTCGAGAAGGC---TTCGGCTCGCTCTTTCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_pini_Nebraska_USA_CMW14821 GCTTTCTGGCAGACGATTTCCGGGGAGCATGGCCTCTCTCCGGTTGGGATGTATGTGGT----GTTATCAGACTCGTGAAGAAAGCTTGTGCTGAAGACTCGCAGATACGAGGGCACCGCAGATGTCCAGCGCGAGCGGTTGAATGTTTACTTCGACGAGGTACGGACTTCACTTCACTTCCAGTGTGCTATGGCAATGTCGGCACGCTCGCAGCACAGCATCACTTTACTTCTTGGAGATGTC-GATGGAGCCCTTCTAACAGCACCTTCTAGGCAAACACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCCGGCACCATGGACGCCCTTCGAGAAGGC---TTCGGCTCGCTCTTTCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_rhabdoclinis GCTTTCTGGCAGACCATCTCCGGCGAGCATGGCCTCGATGGCTCTGGCGTGTACGTGGAA--GAAGCAGCAATGGATACTGAAGGACACAACTGACGAGGCACAGCTACAATGGCACGTCTGATCTCCAGCTCGAGCGCATGAACGTGTACTTCAACGAGGTATGAA-----CATTGGAGCTGCTGCCTAAGG--------------CACGATTGGCGCCGAAAGCTAAT-------------------GCGGTCTGTA------------CAGGCTTCCGGCAACAAGTATGTTCCTCGTGCTGTCCTCGTCGATCTGGAGCCAGGTACTATGGACGCCGTCCGTGCTGGTCCATTCGGTCAGCTCTTCCGTCCAGATAACTTCGTCTTCGGCCAGTCTGGTGCCGGTAACAACTGG Dothistroma_septosporum_AUSTRALIA_CMW6841 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_AUSTRALIA_CMW6845 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_AUSTRALIA_CMW6846 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_AUSTRIA_CMW14903 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCC-AAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGATGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_AUSTRIA_CMW14904 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCC-AAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGATGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_CANADA_CMW14823 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_CHILE_CMW10247 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_CHILE_CMW8611 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_CHILE_CMW9304 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_ECUADOR_CMW9920 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_FRANCE_CMW9992 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCC-AAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGATGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_GERMANY_CMW13122 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCC-AAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGATGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_Idaho_USA_CMW15077 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCC-AAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_KENYA_CMW10622 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_KENYA_CMW10722 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_NEW_ZEALAND_CMW9937 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_NEW_ZEALAND_CMW9939 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_NEW_ZEALAND_CMW9943 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_Oregon_USA_CMW14822 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_POLAND_CMW13004 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCC-AAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGATGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_POLAND_CMW13007 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCC-AAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGATGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_POLAND_CMW13010 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCC-AAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGATGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_RSA_CMW11372 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_RSA_CMW684 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_RSA_CMW8658 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCCGAAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGACGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Dothistroma_septosporum_SLOVAKIA_CMW13123 GCTTTCTGGCAGACCATTTCTGGCGAACATGGACTGAGCAAAACAGGACAGTATGTGGA----ATCCACAGACGCGTCATGCAGATTCGTACTGATGAAATGCAGATACGAAGGCACTGCAGACGTCCAGCGAGAGCGACTGAGTGTCTATTTCGATGAGGTAGGTGCTCCTCTCCGCCGCCAGTGCTTCAACACTATGCCGGCATCCACGCAGCACATCGTCATCCTGCCTCCC-AAGTCATTTGAAAGAGCCGTGCTGACGGCGTTATCTAGGCAAGCACCGACAAGTACGTGCCTCGAGCTGTCCTTGTCGATCTCGAGCCTGGCACCATGGATGCCCTTCGAGAGGGC---TTCGGCTCGCTCTTCCGACCTGACAACTATGTCTTCGGCCAGTCTGGAGCAGGCAACAACTGG Mycosphaerella_dearnessii_CMW13119 GCTTTCTGGCAGACCATCTCCGGTGAACATGGCCTCGACGGCGCCGGCGTGTAAGTGATGCGAGTGCGATTTTCCGCTTCGAGACGCGTTATTGACATTCTGCAGGTACAATGGCACGTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA---------TGTCTACCTTCCGCATCGAGC--------------TAGGCCGAGATCGCCCAAATGCT-------------------AACTCATGATG-----------CAGGCCTCGGGAAACAAGTATGTCCCACGTGCTGTGCTCGTCGACTTGGAGCCGGGCACCATGGATGCCGTCCGCGCTGGTCCATTCGGCCAGCTGTTCCGCCCGGACAACTTCGTCTTCGGCCAGTCTGGTGCCGGCAACAACTGG Mycosphaerella_dearnessii_CMW9985 ?????????CAGACCATCTCCGGCGAACATGGCCTCGACGGCGCCGGCGTGTAAGTGATGCGAGTGCGATTTTCCGCTTCGAGACGCGTTATTGACATTCTGCAGGTACAATGGCACGTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTA---------TGTCTACCTTCCGCATCGAGC--------------TAGGCCGAGATCGCCCAAATGCT-------------------AACTCATGATG-----------CAGGCCTCGGGAAACAAGTATGTCCCACGTGCTGTGCTCGTCGACTTGGAGCCGGGCACCATGGATGCCGTCCGCGCTGGTCCATTCGGCCAGCTGTTCCGCCCGGACAACTTCGTCTTCGGCCAGTCTGGTGCCGGCAACAACTGG ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = 'Beta tubulin 2 - using primers 2a and 2b') = N: 1-418; CODONPOSSET * CodonPositions (CHARACTERS = 'Beta tubulin 2 - using primers 2a and 2b') = N: 1-418; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4287] TITLE Elongation_Factor; LINK TAXA = Taxa2; DIMENSIONS NCHAR=346; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Botryosphaeria_ribis ??????GAAGTTCGAGAAGGTAAGAAAGTTTTTCCTTCCG----------CTGCACGCGCTGGG-TGCTGGGTGCTGGGTGCTGGGTGCTGGGTTCCCGCACTCAATTTGCCTTATCGCT----------------TCGGTGAGGGGCATTTTGGTGGTGGGGTTGGCCC------GCGCTA-AGCCTCGTTCGGGCTCGGCAAAATG---TCCGCATCTGGTTTTTTTGCGAC--CGGCGTGCGACCGAAGCGCACCC---CTCGCCAGACACGCCA-----CGCATGTGCGACCAGACGCTAACGG------CCATCCCAGGAAGCCGCCGAGCTCGGTAAGGG Dothistroma_pini_Michigan_USA_CMW10930 CATCGAGAAGTTCGAGAAGGTCAGTCGCACG-CGACACCC----------CTTATCGCACGCAT-TTTTCGCTGCTCGTCACTTC-TCGCGAGCTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTTCTGGGGTTCAAC-------GCCCT--GATCTCATCCATCACCACCAA-ATGCCTTCT-CACAGCAATCACACCCTTG--CGAAGCACCACGAAACCCCAGCCGATTACACGACGAACATCT-----CACATTGAGCACATGATTCTGACAA-----TCTGCCACAGGAAGCTGCCGAGTTGGGTAAGGG Dothistroma_pini_Michigan_USA_CMW10951 CATCGAGAAGTTCGAGAAGGTCAGTCGCACG-CGACACCC----------CTTATCGCACGCAT-TTTTCGCTGCTCGTCACTTC-TCGCGAGCTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTTCTGGGGTTCAAC-------GCCCT--GATCTCATCCATCACCACCAA-ATGCCTTCT-CACAGCAATCACACCCTTG--CGAAGCACCACGAAACCCCAGCCGATTACACGACGAACATCT-----CACATTGAGCACATGATTCTGACAA-----TCTGCCACAGGAAGCTGCCGAGTTGGGTAAGGG Dothistroma_pini_Michigan_USA_CMW14905 CATCGAGAAGTTCGAGAAGGTCAGTCGCACG-CGACACCC----------CTTATCGCACGCAT-TTTTCGCTGCTCGTCACTTC-TCGCGAGCTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTTCTGGGGTTCAAC-------GCCCT--GATCTCATCCATCACCACCAA-ATGCCTTCT-CACAGCAATCACACCCTTG--CGAAGCACCACGAAACCCCAGCCGATTACACGACGAACATCT-----CACATTGAGCACATGATTCTGACAA-----TCTGCCACAGGAAGCTGCCGAGTTGGGTAAGGG Dothistroma_pini_Michigan_USA_CMW6400 CATCGAGAAGTTCGAGAAGGTCAGTCGCACG-CGACACCC----------CTTATCGCACGCAT-TTTTCGCTGCTCGTCACTTC-TCGCGAGCTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTTCTGGGGTTCAAC-------GCCCT--GATCTCATCCATCACCACCAA-ATGCCTTCT-CACAGCAATCACACCCTTG--CGAAGCACCACGAAACCCCAGCCGATTACACGACGAACATCT-----CACATTGAGCACATGATTCTGACAA-----TCTGCCACAGGAAGCTGCCGAGTTGGGTAAGGG Dothistroma_pini_Minnesota_USA_CMW14820 CATCGAGAAGTTCGAGAAGGTCAGTCGCACG-CGACACCC----------CTTATCGCACGCAT-TTTTCGCTGCTCGTCACTTC-TCGCGAGCTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTTCTGGGGTTCAAC-------GCCCT--GATCTCATCCATCACCACCAA-ATGCCTTCT-CACAGCAATCACACCCTTG--CGAAGCACCACGAAACCCCAGCCGATTACACGACGAACATCT-----CACATTGAGCACATGATTCTGACAA-----TCTGCCACAGGAAGCTGCCGAGTTGGGTAAGGG Dothistroma_pini_Nebraska_USA_CMW14821 CATCGAGAAGTTCGAGAAGGTCAGTCGCACG-CGACACCC----------CTTATCGCACGCAT-TTTTCGCTGCTCGTCACTTC-TCGCGAGCTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTTCTGGGGTTCAAC-------GCCCT--GATCTCATCCATCACCACCAA-ATGCCTTCT-CACAGCAATCACACCCTTG--CGAAGCACCACGAAACCCCAGCCGATTACACGACGAACATCT-----CACATTGAGCACATGATTCTGACAA-----TCTGCCACAGGAAGCTGCCGAGTTGGGTAAGGG Dothistroma_rhabdoclinis ???????????????????????????GCCGCCATCACCCACACGCACACTCCATCGCACGAAT-TT-TCGCTGCTTATCGCCTC-TGCGCTGGTGCCCCTCCAGATTTGGTGGGGTGCG---------------AGAAATTCGGCGCTTGGGCAGCCATGATCTCATCC------GCGAT--GACTCTTCCTCCCACCGCCAG-ACGCTTTGGGTACACCGATAGCAGCGAAC--C-ACACTTTGCACAACATC--TCCTTCGTATGCAAGACATGC-----CTTACTGACCATGTTGCTT----------------CACAGGAAGCTGCCGAACTCGGCAAGGG Dothistroma_septosporum_AUSTRALIA_CMW6841 CATCGAGAAGTTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGTAAGGG Dothistroma_septosporum_AUSTRALIA_CMW6845 CATCGAGAAGTTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGTAAGGG Dothistroma_septosporum_AUSTRALIA_CMW6846 CATCGAGAAGTTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGTAAGGG Dothistroma_septosporum_AUSTRIA_CMW14903 CATCGAGAAATTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGCAAGGG Dothistroma_septosporum_AUSTRIA_CMW14904 CATCGAGAAATTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGCAAGGG Dothistroma_septosporum_CANADA_CMW14823 CATCGAGAAGTTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGTAAGGG Dothistroma_septosporum_CHILE_CMW10247 ??????????TTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGTAAGGG Dothistroma_septosporum_CHILE_CMW8611 CATCGAGAAGTTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGTAAGGG Dothistroma_septosporum_CHILE_CMW9304 CATCGAGAAGTTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGTAAGGG Dothistroma_septosporum_ECUADOR_CMW9920 CATCGAGAAATTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGCAAGGG Dothistroma_septosporum_FRANCE_CMW9992 CATCGAGAAGTTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGTAAGGG Dothistroma_septosporum_GERMANY_CMW13122 CATCGAGAAATTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGCAAGGG Dothistroma_septosporum_Idaho_USA_CMW15077 ??????????TTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGCAAGGG Dothistroma_septosporum_KENYA_CMW10622 CATCGAGAAGTTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGTAAGGG Dothistroma_septosporum_KENYA_CMW10722 CATCGAGAAATTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGCAAGGG Dothistroma_septosporum_NEW_ZEALAND_CMW9937 CATCGAGAAATTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGCAAGGG Dothistroma_septosporum_NEW_ZEALAND_CMW9939 CATCGAGAAGTTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGTAAGGG Dothistroma_septosporum_NEW_ZEALAND_CMW9943 CATCGAGAAATTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGCAAGGG Dothistroma_septosporum_Oregon_USA_CMW14822 CATCGAGAAGTTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGTAAGGG Dothistroma_septosporum_POLAND_CMW13004 CATCGAGAAATTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGCAAGGG Dothistroma_septosporum_POLAND_CMW13007 ??????????TTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGCAAGGG Dothistroma_septosporum_POLAND_CMW13010 CATCGAGAAATTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGCAAGGG Dothistroma_septosporum_RSA_CMW11372 CATCGAGAAGTTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGTAAGGG Dothistroma_septosporum_RSA_CMW684 CATCGAGAAGTTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGTAAGGG Dothistroma_septosporum_RSA_CMW8658 CATCGAGAAATTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGCAAGGG Dothistroma_septosporum_SLOVAKIA_CMW13123 CATCGAGAAATTCGAGAAGGTGAGTCATCTGGCAACACCG----------CTTATCGCACGCAT-TCCTCGATGCTCGTCAATTC-T-GTGAGTTGAGGGGCAAAATTTGGTGGGGTGCG---------------AGAATTTTGGCGCCCACTTTTCCTGGGGTTCAAC-------GCCAT--GATCTCATCCACCACCGCCAA-ATGCCTTCT-CACCGCAATCATGCCCTAC--TGAAGCACCACGAAACACTAGCCGATTACGTTGCAAACATTT-----CACATTGAGAACATGACTCTGACAA-----TCTGCCACAGGAAGCCGCCGAGTTGGGCAAGGG Mycosphaerella_dearnessii_CMW13119 ?????????????????????????TCCCCGCCTGTCCAGTTGTCCACACCGACGCGCACGCAAATTTTCGCCGTTTATCGCCTG-AGTGCGCTGGAGGGGCAAAATTTGGTGGGCTGCGGCTGGTGGGGGAGCGAGAACCTTGCCACTTTGCCGCTTTCGGCCTCAGGCACCTACACCATCCGACCTCACCCACCACCCCCAACACCCCTTCATCGACGCATTGGGCCTCCACGACAACACCCCTCCTTCATCTTCCCCTTCACTTCGTTGTCACATGCAAGCACTCTTGGAACACACCGCTGACAACGCTATCTCCCACAGGAAGCCGCCGAACTCGGCAAGGG Mycosphaerella_dearnessii_CMW9985 CATCGAGAAGTTCGAGAAGGTGAGTCCACCGCCTGTCCAGTTGTCCACACCGACGCGCACGCAAATTTTCGCCGTTTATCGCCTG-AGTGCGCTGGAGGGGCAAAATTTGGTGGGCTGCGGCTGGTGGGGGAGCGAGAACCTTGCCACTTTGCCGCTTTCGGCCTCAGGCACCCACACCATCCGACCTCACCCACCACCCCCAACACCCCTTCATCGACGCATTGGGCCTCCACGACAACACCCCTCCTTCATCTTCCCCTTCACTTCGTTGTCACATGCAAGCACTCTTGGAACACACCGCTGACAACGCTATCTCCCACAGGAAGCCGCCGAACTCGGTAAGGG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Elongation_Factor) = N: 1-346; CODONPOSSET CodonPositions (CHARACTERS = Elongation_Factor) = N: 1-346; END; BEGIN TREES; TITLE Tb10869; LINK TAXA = Taxa1; TRANSLATE 1 Botryosphaeria_ribis, 2 Dothistroma_pini_Michigan_USA_CMW10930, 3 Dothistroma_pini_Michigan_USA_CMW10951, 4 Dothistroma_pini_Michigan_USA_CMW14905, 5 Dothistroma_pini_Michigan_USA_CMW6400, 6 Dothistroma_pini_Minnesota_USA_CMW14820, 7 Dothistroma_pini_Nebraska_USA_CMW14821, 8 Dothistroma_rhabdoclinis, 9 Dothistroma_septosporum_AUSTRALIA_CMW6841, 10 Dothistroma_septosporum_AUSTRALIA_CMW6845, 11 Dothistroma_septosporum_AUSTRALIA_CMW6846, 12 Dothistroma_septosporum_AUSTRIA_CMW14903, 13 Dothistroma_septosporum_AUSTRIA_CMW14904, 14 Dothistroma_septosporum_CANADA_CMW14823, 15 Dothistroma_septosporum_CHILE_CMW10247, 16 Dothistroma_septosporum_CHILE_CMW8611, 17 Dothistroma_septosporum_CHILE_CMW9304, 18 Dothistroma_septosporum_ECUADOR_CMW9920, 19 Dothistroma_septosporum_FRANCE_CMW9992, 20 Dothistroma_septosporum_GERMANY_CMW13122, 21 Dothistroma_septosporum_KENYA_CMW10622, 22 Dothistroma_septosporum_KENYA_CMW10722, 23 Dothistroma_septosporum_NEW_ZEALAND_CMW9937, 24 Dothistroma_septosporum_NEW_ZEALAND_CMW9939, 25 Dothistroma_septosporum_NEW_ZEALAND_CMW9943, 26 Dothistroma_septosporum_Oregon_USA_CMW14822, 27 Dothistroma_septosporum_POLAND_CMW13004, 28 Dothistroma_septosporum_POLAND_CMW13007, 29 Dothistroma_septosporum_POLAND_CMW13010, 30 Dothistroma_septosporum_RSA_CMW11356, 31 Dothistroma_septosporum_RSA_CMW684, 32 Dothistroma_septosporum_RSA_CMW8658, 33 Dothistroma_septosporum_SLOVAKIA_CMW13123, 34 Mycosphaerella_dearnessii_CMW13119, 35 Mycosphaerella_dearnessii_CMW9985; TREE Fig._3 = [&R] ((((((15,17,16,18,33),28,27,19,11,10,9,25,24,23,22,32,((31,29,30,21,20,12,13),14,26)),(2,3,4,6,7,5)),8),(35,34)),1); END; BEGIN TREES; TITLE Tb10871; LINK TAXA = Taxa2; TRANSLATE 1 Botryosphaeria_ribis, 2 Dothistroma_pini_Michigan_USA_CMW10930, 3 Dothistroma_pini_Michigan_USA_CMW10951, 4 Dothistroma_pini_Michigan_USA_CMW14905, 5 Dothistroma_pini_Michigan_USA_CMW6400, 6 Dothistroma_pini_Minnesota_USA_CMW14820, 7 Dothistroma_pini_Nebraska_USA_CMW14821, 8 Dothistroma_rhabdoclinis, 9 Dothistroma_septosporum_AUSTRALIA_CMW6841, 10 Dothistroma_septosporum_AUSTRALIA_CMW6845, 11 Dothistroma_septosporum_AUSTRALIA_CMW6846, 12 Dothistroma_septosporum_AUSTRIA_CMW14903, 13 Dothistroma_septosporum_AUSTRIA_CMW14904, 14 Dothistroma_septosporum_CANADA_CMW14823, 15 Dothistroma_septosporum_CHILE_CMW10247, 16 Dothistroma_septosporum_CHILE_CMW8611, 17 Dothistroma_septosporum_CHILE_CMW9304, 18 Dothistroma_septosporum_ECUADOR_CMW9920, 19 Dothistroma_septosporum_FRANCE_CMW9992, 20 Dothistroma_septosporum_GERMANY_CMW13122, 21 Dothistroma_septosporum_Idaho_USA_CMW15077, 22 Dothistroma_septosporum_KENYA_CMW10622, 23 Dothistroma_septosporum_KENYA_CMW10722, 24 Dothistroma_septosporum_NEW_ZEALAND_CMW9937, 25 Dothistroma_septosporum_NEW_ZEALAND_CMW9939, 26 Dothistroma_septosporum_NEW_ZEALAND_CMW9943, 27 Dothistroma_septosporum_Oregon_USA_CMW14822, 28 Dothistroma_septosporum_POLAND_CMW13004, 29 Dothistroma_septosporum_POLAND_CMW13007, 30 Dothistroma_septosporum_POLAND_CMW13010, 31 Dothistroma_septosporum_RSA_CMW11372, 32 Dothistroma_septosporum_RSA_CMW684, 33 Dothistroma_septosporum_RSA_CMW8658, 34 Dothistroma_septosporum_SLOVAKIA_CMW13123, 35 Mycosphaerella_dearnessii_CMW13119, 36 Mycosphaerella_dearnessii_CMW9985; TREE Fig._5 = [&R] ((((2,3,4,6,7,5),(9,17,27,14,19,16,11,10,25,22,31,32,(33,23,24,26,18,28,30,34,20,12,13,29,21),15)),(8,(36,35))),1); END; BEGIN TREES; TITLE Tb10868; LINK TAXA = Taxa3; TRANSLATE 1 Botryosphaeria_ribis, 2 Dothistroma_pini_Michigan_USA_CMW10930, 3 Dothistroma_pini_Michigan_USA_CMW10951, 4 Dothistroma_pini_Michigan_USA_CMW14905, 5 Dothistroma_pini_Michigan_USA_CMW6400, 6 Dothistroma_pini_Minnesota_USA, 7 Dothistroma_pini_Nebraska_USA, 8 Dothistroma_rhabdoclinis, 9 Dothistroma_septosporum_AUSTRALIA_CMW6841, 10 Dothistroma_septosporum_AUSTRALIA_CMW6845, 11 Dothistroma_septosporum_AUSTRALIA_CMW6846, 12 Dothistroma_septosporum_AUSTRIA_CMW14903, 13 Dothistroma_septosporum_AUSTRIA_CMW14904, 14 Dothistroma_septosporum_CANADA, 15 Dothistroma_septosporum_CHILE_CMW10247, 16 Dothistroma_septosporum_CHILE_CMW8611, 17 Dothistroma_septosporum_CHILE_CMW9304, 18 Dothistroma_septosporum_ECUADOR, 19 Dothistroma_septosporum_FRANCE, 20 Dothistroma_septosporum_GERMANY, 21 Dothistroma_septosporum_Idaho_USA, 22 Dothistroma_septosporum_KENYA_CMW10622, 23 Dothistroma_septosporum_KENYA_CMW10722, 24 Dothistroma_septosporum_NEW_ZEALAND_CMW9937, 25 Dothistroma_septosporum_NEW_ZEALAND_CMW9939, 26 Dothistroma_septosporum_NEW_ZEALAND_CMW9943, 27 Dothistroma_septosporum_Oregon_USA, 28 Dothistroma_septosporum_POLAND_CMW13004, 29 Dothistroma_septosporum_POLAND_CMW13007, 30 Dothistroma_septosporum_POLAND_CMW13010, 31 Dothistroma_septosporum_RSA_CMW11356, 32 Dothistroma_septosporum_RSA_CMW684, 33 Dothistroma_septosporum_RSA_CMW8658, 34 Dothistroma_septosporum_SLOVAKIA, 35 Mycosphaerella_dearnessii_CMW13119, 36 Mycosphaerella_dearnessii_CMW9985; TREE Fig._2 = [&R] (((((21,27,12,13,14,19,28,29,30,34,20,33,31,22,23,24,25,26,9,11,17,18,32,16,10,15),(2,3,4,6,7,5)),8),(36,35)),1); END; BEGIN TREES; TITLE Tb10870; LINK TAXA = Taxa2; TRANSLATE 1 Botryosphaeria_ribis, 2 Dothistroma_pini_Michigan_USA_CMW10930, 3 Dothistroma_pini_Michigan_USA_CMW10951, 4 Dothistroma_pini_Michigan_USA_CMW14905, 5 Dothistroma_pini_Michigan_USA_CMW6400, 6 Dothistroma_pini_Minnesota_USA_CMW14820, 7 Dothistroma_pini_Nebraska_USA_CMW14821, 8 Dothistroma_rhabdoclinis, 9 Dothistroma_septosporum_AUSTRALIA_CMW6841, 10 Dothistroma_septosporum_AUSTRALIA_CMW6845, 11 Dothistroma_septosporum_AUSTRALIA_CMW6846, 12 Dothistroma_septosporum_AUSTRIA_CMW14903, 13 Dothistroma_septosporum_AUSTRIA_CMW14904, 14 Dothistroma_septosporum_CANADA_CMW14823, 15 Dothistroma_septosporum_CHILE_CMW10247, 16 Dothistroma_septosporum_CHILE_CMW8611, 17 Dothistroma_septosporum_CHILE_CMW9304, 18 Dothistroma_septosporum_ECUADOR_CMW9920, 19 Dothistroma_septosporum_FRANCE_CMW9992, 20 Dothistroma_septosporum_GERMANY_CMW13122, 21 Dothistroma_septosporum_Idaho_USA_CMW15077, 22 Dothistroma_septosporum_KENYA_CMW10622, 23 Dothistroma_septosporum_KENYA_CMW10722, 24 Dothistroma_septosporum_NEW_ZEALAND_CMW9937, 25 Dothistroma_septosporum_NEW_ZEALAND_CMW9939, 26 Dothistroma_septosporum_NEW_ZEALAND_CMW9943, 27 Dothistroma_septosporum_Oregon_USA_CMW14822, 28 Dothistroma_septosporum_POLAND_CMW13004, 29 Dothistroma_septosporum_POLAND_CMW13007, 30 Dothistroma_septosporum_POLAND_CMW13010, 31 Dothistroma_septosporum_RSA_CMW11372, 32 Dothistroma_septosporum_RSA_CMW684, 33 Dothistroma_septosporum_RSA_CMW8658, 34 Dothistroma_septosporum_SLOVAKIA_CMW13123, 35 Mycosphaerella_dearnessii_CMW13119, 36 Mycosphaerella_dearnessii_CMW9985; TREE Fig._4 = [&R] ((((14,27,18,16,17,15,11,10,9,26,25,24,23,22,31,33,32,21,(19,28,29,30,34,20,12,13)),(2,3,4,6,7,5)),((36,35),8)),1); END;