#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 17:31 GMT TreeBASE (cc) 1994-2008 Study reference: Uzuhashi S., Tojo M., Kakishima M., & Kobayashi S. 2009. Pythium apinafurcum sp. nov.: its morphology, molecular phylogeny, and infectivity for plants. Mycoscience, 50(4): 281-290. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10214] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=42; TAXLABELS Phytophthora_cactorum Pythium_acanthicum Pythium_adhaerens Pythium_anandrum Pythium_aphanidermatum Pythium_apinafurcum_UZ298 Pythium_apinafurcum_UZ299 Pythium_apinafurcum_UZ300 Pythium_apinafurcum_UZ301 Pythium_apinafurcum_UZ302 Pythium_apinafurcum_UZ303 Pythium_arrhenomanes Pythium_boreale Pythium_chamaehyphon Pythium_cucurbitacearum Pythium_dimorphum Pythium_dissotocum Pythium_echinulatum Pythium_graminicola Pythium_helicandrum Pythium_helicoides Pythium_heterothallicum Pythium_inflatum Pythium_insidiosum Pythium_intermedium Pythium_iwayamae Pythium_macrosporum Pythium_mastophorum Pythium_middletonii Pythium_monospermum Pythium_oedichilum Pythium_okanoganense Pythium_oligandrum Pythium_perplexum Pythium_pleroticum Pythium_polymastum Pythium_pyrilobum Pythium_salpingophorum Pythium_splendens Pythium_sylvaticum Pythium_torulosum Pythium_ultimum ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=58; TAXLABELS Phytophthora_cactorum Phytophthora_capsici Pythium_acanthicum Pythium_acrogynum Pythium_adhaerense Pythium_anandrum Pythium_angustatum Pythium_aphanidermatum Pythium_apinafurcum_UZ298 Pythium_apinafurcum_UZ299 Pythium_apinafurcum_UZ300 Pythium_apinafurcum_UZ301 Pythium_apinafurcum_UZ302 Pythium_apinafurcum_UZ303 Pythium_aquatile Pythium_arrhenomanes Pythium_boreale Pythium_capillosum Pythium_chamaehyphon Pythium_cucurbitacearum Pythium_dimorphum Pythium_dissimile Pythium_dissotocum Pythium_echinulatum Pythium_graminicola Pythium_grandisporangium Pythium_helicandrum Pythium_helicoides Pythium_heterothallicum Pythium_inflatum Pythium_insidiosum Pythium_intermedium Pythium_iwayamae Pythium_macrosporum Pythium_marsipium Pythium_mastophorum Pythium_middletonii Pythium_monospermum Pythium_nagaii Pythium_oedichilum Pythium_okanoganense Pythium_oligandrum Pythium_orthogonon Pythium_pachycaule Pythium_paroecandrum Pythium_perplexum Pythium_pleroticum Pythium_plurisporium Pythium_polymastum Pythium_pyrilobum Pythium_rostratum Pythium_salpingophorum Pythium_spinosum Pythium_splendens Pythium_sylvaticum Pythium_torulosum Pythium_ultimum Pythium_vanterpoolii ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4630] TITLE ITS_rDNA; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1346; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Phytophthora_cactorum CCACACCTAAAAA----CT--TTCCACGTGAACCGTTTCA-AACCAAATAGTTGGG---GGTCTT------GTCTG-GTG----GCGGCTGCT-------------GGCTTTATTGTTG-----GCGGCTGCT--------------------GCTGGGTGAGCCCTATCATGGCGAGCGTT-------------------------TGGGCTT---------CG-------------------------------------GCCT------------------------GAGCTAGT----AGCTTTT--CTTTT-AAACCC-ATTCC-----TT-AAT-ACTGAT-T---ATACTGTGGGGACGAAAGTCCTTGCTTTTAA--CTAGAT-AGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTT------------------------CCGTGTAGTC-GGTGGAGGAGA----TG---CCAGA-TGTGAAGT-GTCTTGCG------GCTGG----------------TT-----------TTCGGACC---------------GACTG-CGAGTCCTTTTAAATGTACTGAACTGTACTTCTCTTTGCTCGAAAAGCGTGGCGTTGCT----GGT-TGTGGAG------GCT---GCTATTGTAGCAAG--TT-GGCGACCGGTTTGTCTGCTGCGGCGTT-AATGGAAGAGTGT----TCGATT-CGCGGTATGGTTAGCT----------------------------------------------TCGGCTG-AACAA---TGC-GCTTATTGG----ATGTTTTTTCT--GCTG--------------------------------------------------TGG----CGTG--------------------------------------ATGGACCGG--------TGAACCAT-----AGCTCAGTTGCT--TGGCTTTTGAA------TCGGCTTT------GCTGTTGCGAAGTAGAG-------------TGGCGGC---------TTCG----------GCTGTCGAGG--GTCG-AT-CCATTTGGGAAATG----TGTG------------------TGTAC----------------------TTCGGTA---------------TGCATCTCAA- Phytophthora_capsici CCACACCTAAAAAA---CT--TTCCACGTGAACCGTATCA-ACCCTTTTAGTTGGG---GGTCTT------GT-----------------------------------------------------------------------------------------ACCCTATCATGGCGAATGTT-------------------------TGGACTT---------CG-------------------------------------GTCC------------------------GGGCGAGT----AGCTTTT-TGTTTT-AAACCC-ATTTC-----AC-AAT-TCTGAT-T---ATACTGTGGGGACGAAAGTCTCTGCTTTTAA--CTAGAT-AGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTT------------------------CCGTGTAGTC-GGTGGAGGATG----TG---CCAGA-TGTGAAGT-GTCTTGCGT-----GTTGT----------------CC-----------TTCGGGTC---------------GACTG-CGAGTCCTTTTAAATGTACTGAACTGTACTTCTCTTTGCTCGAAAAGCGTGGTGTTGCT----GGT-TGTGGAG------GCT---GCCTGCGTGGCCAG--TC-GGCGACCGGTTTGTCTGCTGCGGCGTTTAAAGGAGGAGTGT----TCGATT-CGCGGTATGGTTGGCT----------------------------------------------TCGGCTG-AACAG----GC-GCTTATTGA----ATGCTTTTCCT--GCTG--------------------------------------------------TGG----CGTG--------------------------------------ATGGGCTGG--------TGAACCGT-----AGCTGTGTTTGGCTTGGCTTTTGAA------TCGGCTTT------GCTGTTGCGAAGTAGGG-------------TGGCGGC---------TTCG----------GCTGTCGAGG--GTCG-AT-CCATTTTGGGAACTT---TGTG------------------TGCAC----------------------TTCGGTG---------------CGCATCTCAA- Pythium_acanthicum CCACACCT-AAA---AACT--TTCCACGTGAACCGTTA----------TAACTA-----TGTTCT------GTGCCTC-------------------------------GTCTTGTT------GAAAGAT--------------------------TTGAG-GC-TGAACGAAGGTGAGT---------------------------TGTGTCTT--------TTT---------------------------------GATGCGG----------------------ATTTGCTGA-------TGTTA--TTTTA-AACACCTATTA------CTTAAT-ACTGAACT---ATACTCCGAATACGAAAGTTTTTGGTTTTAA---CAATT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTT-------------------------TTGTGTAGTC-AAAATTGGAG----ATG---GCAGAATGTGAGGT-GTCTCGC--------GCTG--------------TCTT-----------TTTAA-----------------GATGGTTCGAGTCCCTTTAAATGTAC-GTTG-ATTCTTTCTTGT-GTCTG----CGAATTGCGACG-CTATGCTCTTTGTGA--TCGGTT-TAGATTGCTTTGCGCT-GGTGGGCGAC---TTCGGTTA---GGACA-TAT--GGAAGCAACC----TCAATT-GGCGGTATGTTCGGCT----------------------------------------------TTG-CCT-GACG---TTA-AGCTAAGCGA----GTGTGGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTATC--GTGTGTGAGGT------CGGTTTG--AGCTATATG-GTTGCT-----TGGTTGTA-----TGGTCTAGC----------GTTTTC----AGA-------------CGCCTGC---------TTCGGT---------AGGTAAAGGAGACAA-CACCGATTTGGGACAGAGA-GTTTA--------------------------------------------------CTCT--------------CTTTTTCACT Pythium_acrogynum CCACACCTTAA----AACT--ATCCACGTGAACCGTTT----------GTACCCA-----GATTT------GCGCCGAGATTTTCGTGCGTGTTT--------------GTTTGTATC-----ACTGTGTAT----------TCGTACGCGGTGTGTGGCAAATATGTATGGAGCTTGGC-----------------------------TGATCGA------AGGTCG------------------------------TATCGCACTTTAT----------TGTGTGTGTCGGCTGA-------CTTAT--TTTTC-AAACCC-ATTAC-----TT-ACT-ACTGATT----ATACTGTGAAGACGAAAGTCTTTGCTTTTA---CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATACCTGGAAGTATGTCTGTATCAGTGTCCGTACATCAAACTTGCCTCTCTTTAT-------------------------TGGTGTAGTC-CAATATCGAG----CAGA--GCAGA-TCTGAGGT-GTCTCGCGGCT---GTTGTGTATAGA-----AGGTTTG----------TATGAACTTTATAT-----ACCAAGC-TTCGAGTCCCTTTAAAACGAC---AC-GATCTTTCTATTTGCTTTCTA-CAGAGCGCAT-ATTTCGAA-CGCGGCGG--TC--CT-CGGATCACTCGCAGTC--GACAGCGAT---TTCGGCAG---AGACG-TAT--GGGAGAAACC----TCTATT-CGCGGTACGTTAGGCT----------------------------------------------TCGGCTC-GACAA--TGTTGCGATATAGT----GTGTGGCTCTCGTCTTT----------------------------------------------GTCTTGA----GGTG----TAC------------------------TGTT---GGTTGTG-----------GGT{CT}TG--AACCTTGTGTATTGTTTT---GTT-AGTA-----GAATTGTGTT-----GTTTTTTTCT----GTG----------GT?GGAT?CCATATGCA--CGCAAG-----TGTTTTGTGGG-TAGAGAGA-TTCTATTTGGGAAAT----TTGTACT-----------GCATGAGCCTTCTTGGCT---------------AGTGTATG---------------TATCTCAA- Pythium_adhaerense CCACACCAAAAA---A-CT--TTCCACGTGAACCGTTG----------AAAATG-----TGTTCT------GTGCT---------------------------------C-CT-CTC--------------------------------------GGGGA--GC-TGAACGAAGGTGAGCT---------------------------GCTGT----------TAT-----------------------------------GGTG-----------------------GCTTGCCGA-------TGTAC--ATTTC-AAACCC-ATTA-----CTTTAAT-ACTGAACT---ATACTCCAAAAACGAAAGTCTTTGGTTTTAA---TCAAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAGCGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATCTTGAACGCACATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACAACAAACTTGCCTCTTTTTTT-------------------------CTGTGTAGTC-AGGAAGAGAG----ATG---GCAGAA?GTGAGAT-GTCTCG---------TTGACTC-----------CCTC-----------TTCGGAGG-------------AGAAGACGCGAGTCTCTTTAAACGTAC-GTTC-GCTCTTTCTTGT-GTTCGAGT-AGAAGTGTGGCT-TGCGAA-CGCAGTGA--TCTGTT-CGGATCGCTTTGCGCT-TTCGGGCGAC---TTCGGTTA---GGACGTTAAAGGAA-GCAACC----TCTATT-GGCGGTATGTTAG{AG}CT----------------------------------------------TCGGTCC-GACT---TTGCAGCTGACGGA----GTGTGGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGAAAATAGTGTGAGGCAA----TGGTCTG--GGC-AAATG-GTTGCT-----GTGTAGTA-----GTAGGTCGC---------TGCTCTC----GAA-------------CGCTCTT-------GCTTCGGT-------GAGAGTAAAGGAGGCA-ACACCAATTTGGGACCGTG{AG}-TGCTGGG------------------TTTTAC-----------------TCAGTGTCACA--------------TTCTTTCAA- Pythium_anandrum CCACACCAAAAAA----CT--TTCCACGTGAACTGT----------CTTAGC---------ATGT---TTTGTGCC----------------------------------TTTT-------------------------------------------ATTAGGC-TAAACGAAGGTCGGA--------------------------------------------GTAAAAT--------------------------------------------------------CT--GGCTGA-------TCTAT--CTTTTTAAACCC-ATTA-----CTTTATT-ACTGATTT---ATACTGTGAGGACGAAAGTCTTTGCTTTTAA--CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGA?CTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATACCTGGAAGTATGTCTGTATCAGTGTCCGTACAATAAACTTGCCTT{GT}CTTTTT-------------------------CTGTGTAGTC-AGTGAGAGAG----ATG---GCCGA-TGTGAAGT-GTCTCG---------ATCTGTG------------CATA----------TTTATTT---ATG------ACACATTGATCGAGTCCTTTTAAATGTAC---AC-TGTTTTTTCTCTTGT-TTCTA--TGAG-GTACTG-CTCGAA-CGGAGTGA--TC--TT-TGGATTGCTTGCATGT?TGGTGGCAAC---TTCGGTTT---AGACGCTA---GGAGAAAATG---CTCGATT-CGCGGTATGTTAGGCT----------------------------------------------TCGGCTC-GACAA--TGTTGC-TTATTAG----GCGTTGACTCTGTTTTT----------------------------------------------ACCTTGA----GGTACCATTAT-------------------TTGTGTGAG---ATGTGTCTAA--------TAATTGCTTGCAAGTAAGG-TG-TT----GCTTGATAGT---TACGCTTTG------ATACTGCTTTTC--GGA--------------GTG-------------GTGTT-----GAGGTT--GAG-GATAG-CA---CAATTTGGGAAAA--TTTTGTA--------------------CACTGT-----------TATGTATG-TAACTGT---------------GTATCTCAA- Pythium_angustatum CCACACCA-AAA---AACT--TTCCACGTGAACCGTTA----------CAATTA-----TGTTCT------GTGCT---------------------------------CTCT-TTC--------------------------------------GG-GAGGGC-TGAACGAAGGTCGA-----------------------------GCTGCA---------TGT--------------------------------AT--GTGCGGC--------------------TTTGCCGA-------TGTAC--TTTC--AAACCC-ATTA-----AACTAAT-ACTGAACT---ATACTCCGAGAACGAAAGTTTTTGGTTTTAA---TCAAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTT-------------------------TTGTGTAGTC-AAGGAGAGAA----ATG---GCAGACTGTGAGGT-GTCTCG---------CTGGCTC-----------CCTC-----------TTCGGAGG-------------AGAAGACGCGAGTCCCTTTAAATGTAC-GTTC-GCTCTTTCTTGT-GTCTAAGA-TGAAGTGTGACT-TTCGAA-CGCGGTGA--TCTGTT-TGGATCGCTTTGCGCG-AGTGGGCGAC---TTCGGTTA---GGACATTAAA-GGAAGCAACC----TCTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACT---TTGCAGCTGACGGT----GTGTTGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGTC--TTGTGTGAGGCAA----TGGTCTA--GGC-AAATG-GTTATT-----GTGTAGTA-----GAATTTTGC---------TGCGCTT----GGA-------------CGCCCTA---------CTCG---------TAGGGTAAAGGAGGCAA-CACCAATTTGGGACTAGT--CTGTGGG--------------ATTTATTTCA--------------------CGGGCGC----------------TTTTTCAAT Pythium_aphanidermatum CCACACCATAAA---AACT--TTCCACGTGAACCGTTG----------AAATCA-----TGTTCT------GTGCT---------------------------------CTCT-TTC--------------------------------------GG-GAGGGC-TGAACGAAGGTGGGCT---------------------------GC--TT---------AAT-----------------------------------TGTA-----------------------GTCTGCCGA-------TGTAT--TTTTC-AAACCC-ATTT-----ACCTAAT-ACTGATCT---ATACTCCAAAAACGAAAGTTTATGGTTTTAA---TCTAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCGCATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTT-------------------------CTGTGTAGTC-AGGGAGAGAG----ATG---GCAGAATGTGAGGT-GTCTCG---------CTGGCTC-----------CCTT-----------TTCGGAGG-------------AGAAGACGCGAGTCCCTTTAAATGTAC-GTTC-GCTCTTTCTTGT-GTCTAAGA-TGAAGTGTGATT-CTCGAATCGCGGTGA--TCTGTT-TGGATCGCTTTGCGCA-TTTGGGCGAC---TTCGGTTA---GGACATTAAA-GGAAGCAACC----TCTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACG---TTGCAGCTGACAGA----GTGTGGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGAA--TTGTGTGAGGCAA----TGGTCTG--GGC-AAATG-GTTGCT-----GTGTAGTA-----GGGTTTTGC---------TGCTCTT----GGA-------------CGCCCTG-------TTTTCGGA-------TAGGGTAAAGGAGGCAA-CACCAATTTGGGAC-TGT--TTGCA--------------------ATTTATT------------------GTGAACAA----------------CTTTCTAA- Pythium_apinafurcum_UZ298 CCACACCTAAAA---ATCTCTTTCCACGTGAACCGTCA-----------AAGTA----TTGTTTT------GTGGCTTTGCTTGTAT-----------------------TTTGTAC------AAAATA-------------------------CAAAAAAGCC-TGAACGAAGGTTTCT---------------------------------------------T----------------------------------ACGTAAGAA-----------------------ACTGA-------TGCTT---TTTC-AAACCC-ATCTCTTACGTTAAATGACTGATTGTAAATACTGTGAGGACGAAAGTCCTTGCTTTGAAAACTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATACCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTCTCTTTGCTTT--------------------TTCTGTGTAGTCAGAGGGTAGAG----ATG---GCAGA-TGTGAAGT-GTCTTG-------------GTT-----------TTTC--------------------------------GTAA-GCGCAAGTCCTTTTAAAAG-------C-GATGTT---GTT-TTTTTCTCTTGTCTTCTTTTT-CTTAACTCCCGGT-------------TA-CAATTTGGT---GGGGGGCCAC---TTTGGTGGAAG--ACGTTTTATAGAGGAAACC----TCGATT-TGCGGTATGTTGGGCT----------------------------------------------TCGGCTG-GACA-CGTTGCATCTTG-AGT----GTTTTTTTTT-T--CTC------------------------------------------TGTTTTCTTAACCTTGGTG--------------------------------TGCT--TTTCAT-----------TTTCCTG-------ATTG-TGAA-------GGGT-GAA-----AAAGGTTTGT----------------------------------------------------------------ATGAGAGAAGAGGATA--GCTCCATTTGGGAATT----ATATAA-----------------------------------------------------------------------CTCAA- Pythium_apinafurcum_UZ299 CCACACCTAAAA---ATCTCTTTCCACGTGAACCGTCA-----------AAGTA----TTGTTTT------GTGGCTTC--------------------------------TTATAC------AAGATA-------------------------------AGCC-TGAACGAAGGTTTTTG------------------------------------------TTT----------------------------------CCATAGCAAAA---------------------ACTGA-------TGCTT---TTTC-AAACCC-ATCTCTTACGTTAAATGACTGATTGTAAATACTGTGAGGACGAAAGTCCTTGCTTTGAAAACTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATACCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTCTCTTTGCTTT------------------TTTTCTGTGTAGTCAGAGGGTAGAG----ATG---GCAGA-TGTGAAGT-GTCTTG-------------GTT-----------TTTC--------------------------------GTAA-GCGCAAGTCCTTTTAAAAG-------C-GATGTT---GTT-TTTTTCTCTTGTCTTCTTTTT-CTTAACTCCCGGT-------------TA-CAATTTGGT---GGGGGGCCAC---TTTGGTGGAAG--ACGTTTTATAGAGGAAACC----TCGATT-TGCGGTATGTTGGGCT----------------------------------------------TCGGCTG-GACA-CGTTGCATCTTG-AGT----GTTTTTTTTT-TTTCTC------------------------------------------TGTTTTCTTGACCTTGGTG--------------------------------TGC---TTTCATTTTC-------TTTCCTG-------GTTG-TGAA-------GGGT-GAA-----AAAGGTTTGT----------------------------------------------------------------ATAAGAGAA--GGATA--GCTCCATTTGGGAATT------CTAA-----------------------------------------------------------------------CTCAA- Pythium_apinafurcum_UZ300 CCACACCTAAAA---ATCTCTTTCCACGTGAACCGTCA-----------AAGTA----TTGTTTT------GTGGCTTC--------------------------------TTATAC------AAGATA-------------------------------AGCC-TGAACGAAGGTTTTTG------------------------------------------TTT----------------------------------CCATAGCAAAA---------------------ACTGA-------TGCTT---TTTC-AAACCC-ATCTCTTACGTTAAATGACTGATTGTAAATACTGTGAGGACGAAAGTCCTTGCTTTGAAAACTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATACCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTCTCTTTGCTTT------------------TTTTCTGTGTAGTCAGAGGGTAGAG----ATG---GCAGA-TGTGAAGT-GTCTTG-------------GTT-----------TTTC--------------------------------GTAA-GCGCAAGTCCTTTTAAAAG-------C-GATGTT---GTT-TTTTTCTCTTGTCTTCTTTTT-CTTAACTCCCGGT-------------TA-CAATTTGGT---GGGGGGCCAC---TTTGGTGGAAG--ACGTTTTATAGAGGAAACC----TCGATT-TGCGGTATGTTGGGCT----------------------------------------------TCGGCTG-GACA-CGTTGCATCTTG-AGT----GTTTTTTTTT-TTTCTC------------------------------------------TGTTTTCTTGACCTTGGTG--------------------------------TGC---TTTCATTTTC-------TTTCCTG-------GTTG-TGAA-------GGGT-GAA-----AAAGGTTTGT----------------------------------------------------------------ATAAGAGAA--GGATA--GCTCCATTTGGGAATT------CTAA-----------------------------------------------------------------------CTCAA- Pythium_apinafurcum_UZ301 CCACACCTAAAA---ATCTCTTTCCACGTGAACCGTCA-----------AAGTA----TTGTTTT------GTGGCTTTGCTTGTAT-----------------------TTTGTAC------AAAATA-------------------------CAAAAAAGCC-TGAACGAAGGTTTCT---------------------------------------------T----------------------------------ACGTAAGAA-----------------------ACTGA-------TGCTT---TTTC-AAACCC-ATCTCTTACGTTAAATGACTGATTGTAAATACTGTGAGGACGAAAGTCCTTGCTTTGAAAACTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATACCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTCTCTTTGCTTT--------------------TTCTGTGTAGTCAGAGGGTAGAG----ATG---GCAGA-TGTGAAGT-GTCTTG-------------GTT-----------TTTC--------------------------------GTAA-GCGCAAGTCCTTTTAAAAG-------C-GATGTT---GTT-TTTTTCTCTTGTCTTCTTTTT-CTTAACTCCCGGT-------------TA-CAATTTGGT---GGGGGGCCAC---TTTGGTGGAAG--ACGTTTTATAGAGGAAACC----TCGATT-TGCGGTATGTTGGGCT----------------------------------------------TCGGCTG-GACA-CGTTGCATCTTG-AGT----GTTTTTTTTT-T--CTC------------------------------------------TGTTTTCTTAACCTTGGTG--------------------------------TGCT--TTTCAT-----------TTTCCTG-------ATTG-TGAA-------GGGT-GAA-----AAAGGTTTGT----------------------------------------------------------------ATGAGAGAAGAGGATA--GCTCCATTTGGGAATT----ATATAA-----------------------------------------------------------------------CTCAA- Pythium_apinafurcum_UZ302 CCACACCTAAAA---ATCTCTTTCCACGTGAACCGTCA-----------AAGTA----TTGTTTT------GTGGCTTTGCTTGTAT-----------------------TTTGTAC------AAAATA-------------------------CAAAAAAGCC-TGAACGAAGGTTTCT---------------------------------------------T----------------------------------ACGTAAGAA-----------------------ACTGA-------TGCTT---TTTC-AAACCC-ATCTCTTACGTTAAATGACTGATTGTAAATACTGTGAGGACGAAAGTCCTTGCTTTGAAAACTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATACCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTCTCTTTGCTTT--------------------TTCTGTGTAGTCAGAGGGTAGAG----ATG---GCAGA-TGTGAAGT-GTCTTG-------------GTT-----------TTTC--------------------------------GTAA-GCGCAAGTCCTTTTAAAAG-------C-GATGTT---GTT-TTTTTCTCTTGTCTTCTTTTT-CTTAACTCCCGGT-------------TA-CAATTTGGT---GGGGGGCCAC---TTTGGTGGAAG--ACGTTTTATAGAGGAAACC----TCGATT-TGCGGTATGTTGGGCT----------------------------------------------TCGGCTG-GACA-CGTTGCATCTTG-AGT----GTTTTTTTTT-T--CTC------------------------------------------TGTTTTCTTAACCTTGGTG--------------------------------TGCT--TTTCAT-----------TTTCCTG-------ATTG-TGAA-------GGGT-GAA-----AAAGGTTTGT----------------------------------------------------------------ATGAGAGAAGAGGATA--GCTCCATTTGGGAATT----ATATAA-----------------------------------------------------------------------CTCAA- Pythium_apinafurcum_UZ303 CCACACCTAAAA---ATCTCTTTCCACGTGAACCGTCA-----------AAGTA----TTGTTTT------GTGGCTTC--------------------------------TTATAC------AAGATA-------------------------------AGCC-TGAACGAAGGTTTTTG------------------------------------------TTT----------------------------------CCATAGCAAAA---------------------ACTGA-------TGCTT---TTTC-AAACCC-ATCTCTTACGTTAAATGACTGATTGTAAATACTGTGAGGACGAAAGTCCTTGCTTTGAAAACTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATACCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTCTCTTTGCTTT------------------TTTTCTGTGTAGTCAGAGGGTAGAG----ATG---GCAGA-TGTGAAGT-GTCTTG-------------GTT-----------TTTC--------------------------------GTAA-GCGCAAGTCCTTTTAAAAG-------C-GATGTT---GTT-TTTTTCTCTTGTCTTCTTTTT-CTTAACTCCCGGT-------------TA-CAATTTGGT---GGGGGGCCAC---TTTGGTGGAAG--ACGTTTTATAGAGGAAACC----TCGATT-TGCGGTATGTTGGGCT----------------------------------------------TCGGCTG-GACA-CGTTGCATCTTG-AGT----GTTTTTTTTT-TTTCTC------------------------------------------TGTTTTCTTGACCTTGGTG--------------------------------TGC---TTTCATTTTC-------TTTCCTG-------GTTG-TGAA-------GGGT-GAA-----AAAGGTTTGT----------------------------------------------------------------ATAAGAGAA--GGATA--GCTCCATTTGGGAATT------CTAA-----------------------------------------------------------------------CTCAA- Pythium_aquatile CCACACCAAAAA---AACT--TTCCACGTGAACCGTTG----------TAACTA-----TGTTCT------GTGCG---------------------------------ATCTCCTC--------------------------------------GGAGAGAGC-TGAACGAAGGTGGGCT---------------------------GC--TT---------AAT-----------------------------------TGTA-----------------------GTCTGCCGA-------TGTAC--TTTT--AAACCC-ATTA-----CACTAAT-ACTGAACT---ATACTCCAAAAACGAAAGTATTTGGTTTTAA---TCAAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTT-------------------------TTGTGTAGTC-AAGAAAAGAG----ATG---GCAGACTGTGAGGT-GTCTCG---------CTGACTC-----------CCTC-----------CTCGGAGG-------------AGAAGACGCGAGTCCCTTTAAATGTAC-GTTC-GCTCTTTCTTGT-GTTTAAGA-TGAAGTGTGACT-TTCGAA-CGCAGTGA--TCTGTT-TGGATCGCTTTGCTCG-AGTGGGCGAC---TTCGGTTA---GGACATTAAA-GGAAGCAACC----TCTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACT---TTGCAGCTGACAGT----GTGTGGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGTC--TTGTGTGAGGCAA----TGGTCTG--GGC-AAATG-ATTATT-----GTGTAGTA-----GGAAGTTGC---------TGCTCTT----AAG-------------CGCTCT--------GTCTCGGC--------AGAGTAAAGAAGGCAA-CACCAATTTGGGAT-AGT----TTA--------------------CTTTACT------------------GTAAGCGC---------------TCTTTCTAA- Pythium_arrhenomanes CCACACCA-AAA---AACT--TTCCACGTGAACCGTTG----------TAATTT-----TGTTTT------GTGCC---------------------------------TTCT-TTC--------------------------------------GG-GAGGGC-TAAACGAAGGTTGTCC---------------------------GC-AAG---------TGTA-------------------------------GTTAATTCTGTACGCGTG------------GTCTTCCGA-------TGTCT--TTTT--AAACCC-ATTA------CTTAAT-ACTGATCT---ATACTCCGAGAACGAAAGTTTTTGGTTTTAA---TCCAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTT-------------------------TTGTGTAGTC-AAGGAGAGAG----ATG---GCAGA-TGTGAGGT-GTCTCG---------CTGACTC-----------CCTC-----------TTCGGAGG-------------AGAAGACGCGAGTCCCTTTAAATGTAC-GTTC-GCTCTTTCTTGT-GTCTGAGA--GAAGTGTGACC-TTCGAA-TGCGGTGA--TCTGTT-TGGATCGCTTTGCGCG-AGTGGGCGAC---TTCGGTTA---GGACGTTAAA-GGAAGCAACC----ATTTTT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACG---TTGCAGCTGAGAGT----GTGTGGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGT---TTGTGTGAGGCAA----TGGTCTG--AGC-AAATG-GTTATT-----GTGTGAGA-----GG--GTTAT---------TGCTCTT----GGA-------------CGCTCTA---------TTCG---------TAGAGTAAAGAAGGCAA-CACCAATTTGGGACTAGT--CTGTGGAATGAATG--------AATTTTTATTTCG----------------CGGGCGCTT-TTCAATGCGGGCGCTTTTCAAT Pythium_boreale CCACACCTAAAAA---TCT--TTCCACGTGAATTGTTTT-----GTTGTAA-GTTGG---GCTTC------GCTGG-CGT-----GTTCTGT------------------TTTCGGACG-----GAGCGCAA-----------------------CGGCTTGAGGCCATCAGGGCGT----TTA----------------------TTGTG--T---------CGT------------------------------------GCA-------------------------GTATT-------CGCTCTT--TTTGT-AAACCC-ATTTT---TGATGAA--ACTGAT-T---ATACTGTGGGGACGAAAGTCTCTGCTTTTAA--CTAGAT-AGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTTTGCCTGGAAGTATGTCTGTATCAGTGTCCGTACACTAAACTTGCCTTTCTT-GCG------------------------TCGTGTAGTC-GTCGCTTGGA----ACG--AGCAGA-TGTGAGGT-GTCTTGCGTG----GTCGTTTCTTTCTTCTTTTTTTT-----------TTTGGA-------------AGCAGACTTGCAAGTCCCTT-TAAAGT-CGG-AC-GT-GTTTCTCTA--TTGTGTGCTGTGGCAGCTTT-GGTGGCGTGCGGGAC-----GTT---GTCTGT-TGACGAG--TCTGGCGACC--TTTGGCGC-TTT-GCATT---GTGGGGATTCC----TCGATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCTTTGACAA---TGCAGCTTATTGT----GTGTTTCTTC----TAG--------------------------------------------------CT-----CGTG--------------------------------------CTGTATGGGG-------TGAACCG-------GATG-GTCTTT---GGGCGTGTT----------GTTTT------GCGTGTCTGTCTGGAGT-------------TGTGCTG---------G-CG----------TGCTTTGGGG--GCGG-TCACCATTTGGGAAC-TG---AATG------------------TTTGCAAA---------------------------AA------------AACATCTCAA- Pythium_capillosum CCACACCATAAA---A-CT--TTCCACGTGAACCGTTG----------TAAATA-----TGTTCT------GTGCT---------------------------------CTCT-TTC--------------------------------------GG-GAGAGC-TGAACGAAGGTGGCCT---------------------------GC--TT---------AAT-----------------------------------TGTA-----------------------GACTGCCGA-------TGTAC--TTTT--AAACCC-ATTA-----AACTAAT-ACTGAACT---ATACTCCGAAAACGAAAGTCTTTGGTTTTAA---TCAAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTT-------------------------TTGTGTAGTC-AAGATTAGAA----ACG---GCAGACTGTGAGGT-GTCTCG---------CTGACTC-----------CCTC-----------TTCGGAGG-------------AGAAGACGCGAGTCCCTTTAAATGTAC-GTTC-GCTCTTTCTTGT-GTTTAAGT-AGAAGTGTGACT-TTCGAA-CGCAGTGA--TCTGTT-TGGATCGCTTTGCTCG-AGTAGGCGAC---TTCGGTTA---GGACATTAAA-GGAAGCAACC-----CTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACT---TTGCAGCTGACGGT----GTGTTGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGTC--TTGTGTGAGGCAA----TGGTCTA--GGC-AAATG-GTTATT-----GTGTAGTA-----GGAAGTTGC---------TGCTCTT----GAA-------------CGCCCTG-------TTCTCGGA-------TAGGGTAAAGGAGGCAA-CACCAATTTGGGAT-AGT--CTTTG--------------------ATTTATC------------------ATTGGCGC---------------TCTTTCTAA- Pythium_chamaehyphon CCACACCTAAAAA-CATCT--TTCCACGTGAACCGTTT------------GT-GA------CATT------GTTGG-GCT---------TGT-------------------CTTTCTT----------------------------------------TCGGGGAGGAT--GAGCTA----------------------------------------------TCT------------------------------------------------------------------------------GTAAA--CTTGTCAAACCCCTTTCTTTTTTTATAAA-ACTGAAAC---ATACTGTGGGGACGAAAGTCTCTGCTTTAAA--CTAGAT-AGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTACACTAAACTTGCCTCCTTTCGCG------------------------TCGTGTAGTC-GGCGCGTGTGGGAATTG-CAGCAGA-TGTGAGGT-G-CTTG---------TGGT-CC-------------TT-----------CGCGGA-----------------CAG---CAAGTCCCTT-GAAAGT-CGG-AC-GC-GTATCTTTGCGT----GCGTTGGGTGCTGGT---GGGC-TGTGGGAC-----GC----GTCTGT-TGACGAG--TCTGGCGACC--TTTGGCGC-GT--GCATG--CTTGGGCACTGT----GT-ATT-GGCGGTATGTTAGGCT-----------------------------------GCGTTTCGTGCGCGGCTTTGGCAA---TGCAGCTGAT-GC----GTGTGTTTG---GGCGG--------------------------------------------------CG-----TGTG--------------------------------------TTGTATGGG--------TGAACCG-------GATG-GTCGAC---GGGTTTGACT------CGTGTTTC------GTTAGTCTGTAGCCGGT-------------GTTCTGT---------ATCG----------CGCGCGGAG--TGT-G-TCACCATTTGGGAATCTG---TGTG------------------GTCT-----------------------TTCGAGT-AT-----------CACATCCTCAT- Pythium_cucurbitacearum CCACACCTAAAAAACACCC--TTCCACGTGAACCGTTTT---GTTTTGCTTTCGAG---TGCTTT------GTTGC-GCT--CGGAGCATGTTTTG----------GGCTTCGCTGCTG-----GCGCTTGATT--------------GTGCTGGCGGCTCGAGGCCATCAAGTGGCGTTTTGA----------------------GTGTGCTT---------TGC------------------------------------GCAATTGAA-------------------ACGTCG------AAACCTT--TTTTT-AAACCC-ATTTG----ATTGAAA-ACTGAAGT---ATACTGTGGGGACGAAAGTCCTCGCTTTGAAA-CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAACTTTTGAACGCATATTGCACTTTCGGGTTACGCCTGGAAGTATGTCTGTATCAGTGTCCGTACACTAAACTTGCGTCTCTT-CCG------------------------TCGTGTAGTC-GTCGGTTGT----TTTGATTGCAGA-TGTGAGGTTGTCTCGCGATG--TACCATTTC-------------TT-----------T-TGGATA---------------GGTTG-CGAGTCCCTTTAAAAGT-CGG-AC-GCGTGTTTTTTCCGTTTTGT-GCTTGATGGGGGT--GCGGC-TGCGGC-C-----GT----GTCTGC-TGGCGGG--TCCGGTGACC--TTTGGCGA-TG--GCATG--AGAGTGGATTGC----TCGATT-TGCGGTATGTTAGGCT----------------------------------------------TCGGCTTTGACAA---TGCAGCTTATTGG----GTGTGTTCGCTTGGCTG----------------------------------------------------------TTG--------------------------------------CTGTATGGGG-------TGAGCTG-------GATG-GTCGGT-------GGAT---------GCGTTT-------GTT-GCGTGT---CGTT-------------TTTTCAT---------GGAG----------TGCGTTGCGGTTGTCG-TCGCCATTTGGGAATTT----CATG------------------TTTTGA-GT------------------CTCGATTCAA------------TACATCTCAT- Pythium_dimorphum CCACACCAAAAA-----CT--TTCCACGTGAACTGT----------CATTGC---------ATGT---TTTGTGCC----------------------------------TTTA-------------------------------------------ATT{AC}GGC-TAAACGAAGGTCGGA--------------------------------------------GTCAAAT--------------------------------------------------------CT--GGCTGA-------TCTAT---TTTTTAAACCC-ATT------CTTAAAC-ACTGATTT---ATACTGTGAGGACGAAAGTCTTTGCTTTTAA--CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCAC{AG}TCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTCTACCTGGAAGTATGTCTGTATCAGTGTCCGTACACTAAACTTGCCTTTCTTTTT-------------------------CTGTGTAGTC-AGAGGAGGAG----ATG---GCCGA-TGTGAAGT-GTCTCG---------ATCTGTG------------CTCA----------TTTT------GTG------CCACATTGATCGAGTCCTTTTAAATGTAC---TC-TGTTTTGTCTCTTGT-TTCTA--TGAT-GTACTG-CTGGAA-CGGAGTGA--TC--TT-TGGATTGCTTGCATGTTTGGTGGCAAC---TTCGGTTT---AGACGCTA---GGAGATAATG---CTCGATT-CGCGGTATGTTAGGCT----------------------------------------------TCGGCTG-GACAA--TGTTGC-TTATTGT----GCGTTGGCTCTGTTTTT----------------------------------------------ACCTTGA----GGTACCATTAT-------------------TTGTGTGAG---ATGTGTCTAA--------GGATTGCTTGCAAGTAAGG-TG-TT----GCAGCGTAGT---GACGCTTTG------GTGCTGTTTTTC--GGA--------------GCG-------------GTGTT-----GAGGTT--GAG-TGAAG-CA---CAATTTGGGAAAA--TTTTGTA--------------------CACTGC-----------TATTTTTGGTAGTTGT---------------GTATCTCAA- Pythium_dissimile CCACACCA-TAA---AACT--TTCCACGTGAACCGTTA----------CAATTA-----TGTTCT------GTGCC---------------------------------TTCT-CTC--------------------------------------GG-GAGGGC-TGAACGAAGGTGAGCC---------------------------GC--TT---------TAT-----------------------------------TGTG-----------------------GCTTGCCGA-------TGTAT--TTTTC-AAACCC-ATTT-----ACTAAAT-ACTGAACT---ATACTCCGAGAACGAAAGTTTTTGGTTTTAA---TCAAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGTTATGCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTT-------------------------TTGTGTAGTC-AAGATTAGAA----ACG---GCAGAATGTGAGGT-GTCTCG---------CTGGCTC-----------CCTC-----------TTCGGAGG-------------AGAAGACGCGAGTCCCTTTAAATGTAC-GTTC-GCTCTTTCTTGT-GTCTAAGA-TGAAGTGTGACT-TTCGAA-CGCAGTGA--TCTGTT-TAGATCGCTTTGCGCG-AGTGGGCGAC---TTCGGTTA---GGACATTAAA-GGAAGCAACC----TCTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACT---TTGCAGCTGACAGT----GTGTCGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGTC--TTGTGTGAGGCAA----TGGTCTA--GGC-AAATG-GTTATT-----GTGTAGTA-----GAATTTTGC---------TGCTCTT----GGG-------------CGCTCTGCA-----CTTTCGGGTG-----TGGAGTAAAGGAGGCAA-CACCAATTTGGGAC-AGT--TTGTGGAA--------------TTTATTCTG--------------------CAGGCGC---------------TTTTTTCAAT Pythium_dissotocum CCACACCAAAAA---AACT--TTCCACGTGAACCGTTG----------TAACTA-----TGTTCT------GTGCT---------------------------------CTCTTCTC--------------------------------------GGAGAGAGC-TGAACGAAGGTGGGCT---------------------------GC--TT---------AAT-----------------------------------TGTA-----------------------GTCTGCCGA-------TGTAC--TTTT--AAACCC-ATTA-----AACTAAT-ACTGAACT---ATACTCCGAAAACGAAAGTCTTTGGTTTTAA---TCAAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTT-------------------------TTGTGTAGTC-AAGAAGAGAG----ATG---GCAGACTGTGAGGT-GTCTCG---------CTGACTC-----------CCTC-----------TTCGGAGG-------------AGAAGACGCGAGTCCCTTTAAATGTAC-GTTC-GCTCTTTCTTGT-GTTTAAGA-TGAAGTGTGACT-TTCGAA-CGCAGTGA--TCTGTT-TGGATCGCTTTGCTCG-AGTGGGCGAC---TTCGGTTA---GGACATTAAA-GGAAGCAACC----TCTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACT---TTGCAGCTGACTG-----GAGTTGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGTC--TTGTGTGAGGCAA----TGGTCTG--GGC-AAATG-GTTATT-----GTGTAGTA-----GGAAGTTGC---------TGCTCTT----AAG-------------CGCTCTA-------GCTTCGGT-------TAGAGTAAAGGAGGCAA-CACCAATTTGGGAT-AGT--CGTTG--------------------ATTTATC------------------AATGGCGC---------------TCTTTCTAA- Pythium_echinulatum CCACACCTTAA----AACT--ATCCACGTGAACCGTTT----------GTACCAA-----GATTT------GCGTCAAGATGTTTGTGCATGTTT--------------GTT-GTATC-----ACTGTGTAT----------TCGTACGCGGTGTGTGGCAAGTATGTATGACGCTTGGC-----------------------------TGATCGA------AGGTCG------------------------------TGTCGCACTTGAT----------TGTGTGTATCGGCTGA-------CTTAT--TTTTC-AAACCC-ATTCT-----TT-AGT-ACTGATT----ATACTGTGAAGACGAAAGTCTTTGCTTTTA---CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATACCTGGAAGTATGTCTGTATCAGTGTCCGTACATCAAACTTGCCTCTCTTTAT-------------------------TGGTGTAGTC-CAGTATCGAG----CAGA--GCAGA-TGTGAGGT-GTCTCGCGGCT---ATTGTGTATATA-----AGATTTG----------TATGAACTTTGTAT-----GCCAAGC-TTCGAGTCCCTTTAAAACGAC---AC-GATCTTTCTATTTGCTTTCTA-CAGAGCGCAT-ATTTCGAA-CGCGGCGG--TC--CT-CGGATCACTCGCAGTC--GACAGCGAC---TTCGGCAG---AGAC-TTAT--GGGAGAAACC----TCTATT-CGCGGTACGTTAGGCT----------------------------------------------TCGGCTC-GACAA--TGTTGCGATCTAGT----GTGTGTCTCTCGTTTTT----------------------------------------------GCCTTGA----GGTG----TAC------------------------TGTT---GATTGTG-----------GGCTTG--AACCTTGTGTCTTGTTTC---GTT-AGTA-----GAGGTGTGTT-----GTATTTT-CT----GTG----------GTTGGATTCTGCATGCA--CGCAAG-----TGTATTGTAGG-TAGAGAGA-TTCTATTTGGGAAAT---ATTGTACT-----------GCATAGGCCTTGT-GGCT---------------AGTGTATG---------------TATCTCAA- Pythium_graminicola CCACACCA-TAA---AACT--TTCCACGTGAACCGTTA----------CAATTA-----TGTTCT------GTGCT---------------------------------GTCT-CTC--------------------------------------GG-GATGGC-TGAACGAAGGTGG------------------------------GCTGCA---------TGT--------------------------------ATGTGTA-----------------------GTCTGCCGA-------TGTAC--TTTTC-AAACCC-ATTA------CTAAAT-ACTGAACT---ATACTCCGAGAACGAAAGTTTTTGGTTTTAA---TCCAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTT-------------------------TTGTGTAGTC-AAGGAGAGAA----ATG---GCA-AATGTGAGGT-GTCTCG---------CTGGCTC-----------CCTC-----------TTCGGAGG-------------AGAAAACGCGAGTCCCTTTAAATGTAC-GTTC-GCTCTTTCTTGT-GTCGAAGT-AGAAGTGTGACT-ATCGAA-CGCAGTGG--TCTGTT-TGGATCGTTTTGCGCG-AGTTGGCGAC---TTCGGTTA---GGACATTAAA-GGAAGCAACC----TCTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACT---TTGCAGCTGACAGT----GTGTAGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGT---TTGTGTGAGGCAA----TGGTCTA--GGC-AAATG-GTTATT-----GTGTAGTA-----GGTGGTTGC---------TGCTCTT----TGG-------------CGCCCT----------CTCG----------AGGGTAAAGGAGGCAA-CACCAATTTGGGATTAGT--CTGTGGA---------------TTTATTCA---------------------TGGGCGC-----------------TTTTCAAT Pythium_grandisporangium CCACACCTAAAA---A-CT--TTCCACGTGAACCGTTT----------TAATTA-----TGTTCT------GTGCTTTGCTGCTGCTGAGCTG----------------TTTCTTTC------GGGAGACGGC------------ATGGCGGCGG--TGAA-GC-TGAACGAAGGTTAGCTT-------------------------AGTACGTC--------TGTGG--------------CTTC------------GGCTGTA--AGCGAAAAA------------GCTTTCCGA-------TGT----TTTTC-AAACCC-ATTT-----ACTAAAT-ACTGATCT---ATACTCCAAAGACGAAAGTTTTTGGTTTTAA---TTCAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACAACAAACTTGCCTTTCTTTTT-------------------------CTGTGTAGTC-AGGGATTGAG----ATG---GCAGAATGTGAGGT-GTCTCGA--------ACTGTCC-----------AATT-----------TTAATTGC--------------GATGGGGCGAGTCCCTTTAAATGTAC-GTTC-GCTCTCTCTTGT-GTTTAAGT-AGAAGTGTGATG-CTCGAA-CGCGGTAA--TCTATT-TGGATTGCTTTGCGCT-GGTGGGCGAC---TTCGGAAG---AAACATTAA--GGGGACAACC----TCTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACG---TTGCAGCTGACGGA----GTGGTGTTT--CCGTTT--------------------------------------------CTTCCTTGA----GGTG----TAC------------------------CTATC--GTGTG--AGGC------TTGATCT--GAT-G--TG-GGAGCT-----GTGTAGTA-----GAGTATTAC---------TGCTCTT----AGA-------------CGCCTGT--------TTTCGGA--------CAGGTAAAGGAGGCAA-CACCAATTTGGGAACGAACTATATGCC------------------TTTTGGCGT-----------------GTGGTTCA--------------CTTTTTCACT Pythium_helicandrum CCACACCAAAAAA----CT--TTCCACGTGAACTGT----------CTTAAC---------ATGT---TTTGTGCC----------------------------------TTTA-------------------------------------------ATTAGGC-TAAACGAAGGTCGGA--------------------------------------------GTAAAAT--------------------------------------------------------CT--GGCTGA-------TCTAT--CTTTTTAAACCC-CTTA-----CTTAATT-ACTGATTT---ATACTGTGAGGACGAAAGTCTTTGCTTTTAA--CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCA{AG}AATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATACCTGGAAGTATGTCTGTATCAGTGTCCGTACAATAAACTTGCCTTTCTTTTT-------------------------CTGTGTAGTC-AGTGAGAGAG----ATG---GCCGA-TGTGAAGT-GTCTCG---------ATCTGTG------------CATA----------TTTTTTTTT-ATG------ACACATTGATCGAGTCCTTTTAAATGTAC---AC-TGTTTTTTCTCTTGT-TTCTA--TGAG-GTACTG-CTCGAA-CGGAGTGA--TC--TT-GTGATTGCTTGCATGTTTGGTGGCAAC---TTCGGTTT---AGACGCTA---GGGGTTAATG---CTCGATT-CGCGGTATGTTAGGCT----------------------------------------------TCGGCTG-AACAA--TGTTGC-TTATTAG----GCGTTGACTCTGTTTTT----------------------------------------------ACCTTGA----GGTACCATTAT-------------------TTGTGTGAG---ATGTTTCTAT--------GGATTGCTTGCAAGTAAGG-TG-TT----GCTTGATAGT---TACGCTTTG------ATGCTGCTTTTC--GGA--------------GTG-------------GTATG-----AAGGTT--GAG-GATAG-CA---CAATTTGGGAAAA--TTTTGTA--------------------CACTGT-----------TATGTATG-TAACTGT---------------GTATCTCAA- Pythium_helicoides CCACACCTAAAAA-CATCT--TTCCACGTGAACCGTTT------------GT-GA------CATG------GTTGG-GCT---------TGTGCGT----------GTTCTCTCTGTT----------------------------------------TTGGGGGGAGGCGTGCGAGCTA-------------------------------------------TCT------------------------------------------------------------------------------GTAAA--CTTGTCAAACCCATT-CTC-TTTGATA---ACTGAAAC---ATACTGTGGGGACGAAAGTCTCTGCTTTGAA--CTAGAT-AGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTACACTAAACTTGCCTCCTT--GCG------------------------TCGT--AGTC-GGCGCGT-TGGAATTTG-TGGCAGA-TGTGAGGT-GTCTTG--AT---TGTTGTGTC-------------TT-----------TGTTGATG--------------CGTCGGTCAAGTCCCTT-GAAAGT-CGG-AC-GC-GTATCTTTGCGT----GCGTTGGGTGCCGGT---GGGC-TGTGGGAC-----GC----GTCTGT-TGACGAG--TCTGGCGACC--TTTGGCGC-GT--GCATG--CTTGGGCACTGT----GT-ATT-GGCGGTATGTTAGGCT-----------------------------------GCGTTC---GCGCGGCTTTGACAA---TGCAGCTGAT-GC----GTGTGTTTG---GGCTG--------------------------------------------------TG------GTG--------------------------------------CTGTATGGG--------TGAACCG-------GATG-GTCGAT---GGGTTTTATA------TGCGTTTCTCG--TGTCTGTTTTTATCCGGT-------------GTTCTGT---------ATCG----------TGCGTGGAG--TGT-G-TCATCATTTGGGAATTTG---TACG------------------TCTTCTTGT------------------TTTGAGG-G-------------CGTATCTCAT- Pythium_heterothallicum CCACACCTAAAA---AACT--TTCCACGTGAACTGTCA-----------AACCT------GTTCT------GTGCTTG-------TGCTGGGTC----TGCGTT------TTCGGAC------G-CGG----------------------AC{AG}C-GGCGGAGGC-TGAACGAAGGCTG--------------------------------GTTTCATT---TGTAT----------------------GAGA-----------------------------------TC--AGCTGA-------TATAT--TTTTTCAAACCCCTTTTT---TACAAAATGACTGATCA---ATACTGTGAGAACGAAAGTTCTTGCTTTAAA--CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTAGACCTGGAAGTATGTCTGTATCAGTGTCCGTACATCAAACTTGCCTCTCTTTTTT------------------------CTGTGTAGTC-AGGATTGGAG----ACGT--GCAGA-TGTGAAGT-GTCTCG--------CGCACTTG-----------CGTC-----------TTCGGACG---------ACAAGCTGT---CGAGTCCTTTTAAA{AG}CGAC---AC-GATCTTTCTATT-GT-TTCTGT-GAAGCGTATTG-CTCGAA-CGCGGTGA----TTTT-CGGATCGCTCGCAGTC--GTCGGCGAC---TTCGGT-GAGA--ACA-TAAA-GGAGGAAACC----TCAATT-CGCGGTATGTTCGGCT----------------------------------------------TCGGCTC-GACAATGTTGC---TTATTGT----GTGTGGAATCTGTTTTC----------------------------------------------GCCTTGA----GGTG----TAC------------------------TGAT-----GGTTGTG---------TGCTTG------AACTG-GGAGTT--GGTGTGTAGTA-----GAGTGGTGCA-------GCATGCAT----GG-----------TTACGCCT------------------------TTTATATAGAGAGATG----TCTATTTGGGAAA-GT---TGTACT---------------GTTTGGCAA--------GCATCTTGCCGACT-----G---------------TATCTCAA- Pythium_inflatum CCACACCA-TAA---AACT--TTCCACGTGAACCGTTA----------CAATTA-----TGTTCT------GTGCT---------------------------------CTCT-CTC--------------------------------------GG-GAGGGC-TGAACGAAGGTGG------------------------------GC-GCA---------TGT--------------------------------ATGTGT------------------------GTCTGCCGA-------TGTAC--TTTTC-AAACCC-ATTA------CTAAAT-ACTGAACT---ATACTCCGAGAACGAAAGTTTTTGGTTTTAA---TCAAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTT-------------------------TTGTGTAGTC-AAGGAGAGAA----ATG---GCAGAATGTGAGGT-GTCTCG---------CTGGCTC-----------CCTC-----------TTCGGAGG-------------AGAAGACGCGAGTCCCTTTAAATGTAC-GTTC-GCTCTTTCTTGT-GTCTAAGT-AGAAGTGTGACT-ATCGAA-CGCAGTGA--TCTGTT-TGGATCGCTTTGCGCG-AGTGGGCGAC---TTCGGTTA---GGACATTAAA-GGAAGCAACC----TCTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACT---TTGCAGCTGACAGT----GTGTTGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGT---TTGTGTGAGGCAA----TGGTCTG--GGC-AAATG-GTTAT------GTGTAGTA-----GATGGTTGC---------TGCTCTT----GGG-------------CGCCCTA---------CTCG---------TAG-GTAAAGAAGGCAA-CACCAATTTGGGAT-AGT--CTGTGGA---------------TTTATTCA---------------------TGGGCGC-----------------TTTTCAAT Pythium_insidiosum CCACACCTAAAA---AACT--TTCCACGTGAACCGTTC----------TAAATA-----TGTTCT------GTGCTTCGTCGAAGC-GGACTG----------------CTCTCTCC------GGAGAATGGT------------CTTGCGACGGCTTGAG-GC-TGAACGAAGGCTTGCTC-------------------------AGTGACTCG-------TATGA--------------CTCTC----------GGGTTGTAC-GGCGGAACT------------GCTGGCCGA-------TGTCT--TTTTC-AAACCC-ATTTT---TACTAAAC-ACTGATCT---ATACTCCGAGGACGAAAGTCTTTGGTTTTAA---TCCATTAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTT-------------------------CTGTGTAGTC-AGGAATCGAG----ATG---GCAGAATGTGAGGT-GTCTCGA--------GCCGTCC-----------CCTC-----------TTTTTGGG-------------AGATAGCACGAGTCCCTTTAAATGTAC-GTT--GATCTCTCTTGT-GTCTTAGT--GAAGTGTAATG-CTCGAA-CGCAGTGA--TCTGTT-CAGATTGCTTTGCGCT-GGTGGGCGAC---TTCGGAAA---GGACATTAA--GGAGATGACC----TCTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACG---TTGCAGCTGACGGG----GTGTTGTTT--CCGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGTC--GTGTGTGAGGT------CGAACTG--GAC-GC-TG-GTTATT-----GTGTAGTA-----GAGTATTGC---------TGCGCTT----TGA-------------CGCCT------------TCGG------------GTAAAGAGGACGA-CACTAATTTGGGAACGGA--AGAAC-----------------------------------------------TGCGGC-------------------TTC--- Pythium_intermedium CCACACCTAAAA---AACT--TTCCACGTGAACTGTCA---------TTATTTGTTGTGCGCTCT------CTGCGGT-GTCGGTG-GCGTCTGTTG-------GCTGTATTT-GATACTGCTGGCGGGTGCG-------------AGCCG--GATGCAGAGGC-TGAACGAAGGTCGAG---------TTG----------------------------CTTTGCTCT-------------------------------------------------------------CGGCTGA-------CTTA---TTTTTCAAACCCAATAC------CCAACTTACTGATT----ATACTGTGAGAACGAAAGTTCTTGCTTTTAA--CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAACCTTGCCTTTCTTCCTT------------------------CTGTGTAGTC-AGTGGAGGAT----GTG---GCAGA-CGTGAAGT-GTCTCGCT-------GTGGCTG----------GTTTTTGG-----TCGTTTCGGCTATGAAT-------ACAGTTTGCGAGTCCTTTTAAATGGAC---AC-GACTTTCTCTTTTTTGTTTCTGCGAGGTGCTGTG-CTCGAA-CGCGGTGG--TT--TT-CGGATCGCTCGCGGCT--GTTGGCGAC---TTCGGTGA---ATGCATTAT--GGAGTGGACC----TCGATT-CGCGGTATGTTGGGCT----------------------------------------------TCGGCTG-GACAA--TGTTGC-TTATTGT----GTGTTTGTTCCGCGTTC----------------------------------------------GCCTTGA----GGTG----TAC------------------------TTTC---TGCTGTGTGCT------TGAACTG----GGATCTGCTTTGTTA----GTAGTGCGCGG-TGATCGTTATT--------CGCGGGG----ACA-----------TCTGTTGTTG---GCAGCTCTTAGTGT--GTGCTTGAGCAGAAGAGAGGTTTGAATTTGGGAAA--GTAGTGTAC-----------------TGTGGCGTT-------------AATCGCTGTGTGTA---------------CATCTCAA- Pythium_iwayamae CCACACCTAAAA---AACT--TTCCACGTGAACTGTCT-----------TACTTA-----GTTTT------G-CGCTGCT--GTCGGGAGTGTTC---TGCGTGCG--CGCTTGCAC------GGAGA-------------------GCGTTTCTTGCAACGGC-TGAACGAAGGTTGG----------------------TGGCGTCTTGTCTTCTT---TGCGT---GCTTGATTGTATGCGG---GAGA---------CGTACGCC-----------------GCC--GGCTGA-------CTTAC--TCTTTCAA-CCCCATTA-----CGAAACAAACTGAAGT---ATACTGTGAGAACGAAAGTTCTCGCTTTGAA--CTAGAT-AACAACTTTCAGCAGTGGATGTCTAG?CTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAACCTTGCCTTTCTTTTCC------------------------CTGTGTAGTC-AGGGGAGGAG----ACG---GCCGA-TGTGAAGT-GTCTCG--------CGTGCGTC-----------GGTT-----------TTTGGATATGTGTCTAAAAGCACGATGGTCGAGTCCTTTGAAAACGAC---AC-GATCTTTCTTAT-GAGTT-TGC-GACGTGTGTTG-GTCGAA-CGCGGTGA----TCTT-CGGATCGCTCGTGGTC--GTCGGCGAC---TTCGGT-GAAT--GCATTATATGGAAGAAACC----TTGCTT-CGCGGTACGTTAGGCT----------------------------------------------TCGGCTG-GACAATGTTGCG--TATGTGG----GTGTGACTTTCGCGTTC----------------------------------------------GCCTTGA----GGTG----TAC------------------------TGGC-----GGTTGTG---------GGCTTG------ATCTG-TTGGTT--GTCGTGTAGTA-----GACTAGTGCATT-----GT-T-TGT----CGA----------TTGCTCTGCAA---------------------TTGCTTGCAGGAGAATG-ATTG-ATTTGGGACATTT---TGTGTTT--------------GT-TGTCCA---------CTTTGCGGTGGGCGACATA---------------CATCTCAA- Pythium_macrosporum CCACACCTAAAA---AACT--TTCCACGTGAACTGTCT---------GTATTTGTTTTGTG-TGT------GCGCGTT-GCTGGCGTGCGTCTGCT----------T-TGCATGAATGTGCGTTGCGGGTGCG-------------TGCTGGCGGTGCGCGGAC-TAAACGAAGGTTG-G---------TTGTCTGTGCGTCTGCGGATCTGCTGT---GCTGAGC-TTCATT-GTTTGG-CGTGGCGGGT----GTTGCGGGTGCTATTT---------------TGACCGGCTGA-------CTTAT--TTTTTCAAACCCCATAC------CTAAATGACTGATT----ATACTGTGAGAACGAAAGTTCTTGCTTTTAA--CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGC{AG}TATTGCACT{GT}CCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTCCTT------------------------CCGTGTAGTC-GGTGGAGGAGA---GTT---GCAGA-GATGAAGT-GTCTCGCT-------TTGGTTG----------GT{AG}T-----------ATTTTTAT---ACAC-------ACAGCTAGCGAGTCCTTTTAAATGGAC---AC-GACTTTCTCTTTTTTGTATCTGCGAGGTGCTGTG-CCTGAA-CGCGGTGA--TT--TT-CGGATCGCTCGCGGCT--GGTGGCGAC---TTCGGTGA---ATGCGTTAT--GGAGTGGACC----TCGATT-CGCGGTATGTTGGGCT----------------------------------------------TCGGCTG-GACAA--TGTTGC-TTATTGG----GTGTTTGTTCCGCGTTC----------------------------------------------GCCTTGA----GGTG----TAC------------------------TGTC---GGCTGTGGGA{AT}------{AT}GATTTG----TTAGTTG--TCGTTA----GTAGAGCGC---GATTCCTTGT---------CGTGGGT----GCA-----------TCTGTTGTGTA-TGTA--TTTA--------CATTT---CAGAAGAGGAGTTTCAATTTGGGAAA--TTAGTGTAC-----------------TGCGG-GTT-------------TATC-CTGCGTGTA---------------TATCTCAA- Pythium_marsipium CCACACCTAAA----AACT--TTCCACGTGAACTGTAG----------TTACCC------GATTA------GCGCCGTGACGCGTGTCTGCGAT---------------GCATGTAT-------GTGTGT-------------TGTGG-GCGTGTGGGCTCGGC-TGATCGAAGGTTGTCG----------------------------TGCCTGTT----TGTGTTG------------------------------CCTTGTGCGACGCGAGCG-----TGTGCGCGGCGGCTGA-------CTTA{AT}T-TTTTC-AAACCC-CTTAC-----CTAAACAACTGATGT---ATACTGTGAGGACGAAAGTCTTTGCTTTTAA--CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGC{AG}AACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAACTCAACCTTGCCTCTCTTTGT-------------------------CGGTGTAGTC-CGGTGGGGAG----ACGT--GCAGA-TGTGAAGT-GTCTCGCG-------CCG-------------GGTTTTA----------TTTGAT-----AGG-------ATTTGGCGCGAGTCCTTTGAAAGCGAC---AC-GATCTTTCTATTTGCCTTTTG-CGGAGCGCTTTGGATTGAA-CGCGGCGG--TC--TT-GGACTCGCTTGCAGTC--GACGGCGAC---TTTGGC{AG}G---AGACATTAT--GGAGGGCACC----TTACTT-CGCGGTATGTTAGGCTCATT------------------------------------------GTGGCTG-GACAA--ATTAGCGTTTGTGA----GTGTTGTTTTTCCGTCT-------------------------------------------TTTGCTTTGA----GGTG----TAC------------------------CGTTC--GGTTGTG-----------GGCTTG--AGACCTT-GTGCTGTTT----GTTTAGTATTTCGGAGGCGTTGTTTGCGATCGGATTCT----GCGC-----TGCTGTTTGTGTCCATTTATGGGCGTGGATG---GTATGTGTGGG-TAGAGAGA-TTCCATTTGGGAAATAC---TGTACCT---------CGTGTGTGTGTTGGCAATTTATTGTTGGCATGCGTGCGTGTG---------------TATCTCAA- Pythium_mastophorum CCACACCTAAAA---AACT--TTCCACGTGAACCGTCA----------AATGAAA--CTAGTTTT------GTGCCGGG-TTGT---GTGCGT-----------------TCTTAAC------GGAA---------------------CAAGCGCGGCCT-GGC-TAAACGAAGGTCGAGT--------------------------TGTTTTTC--------CTT----------------------------------TATTGGAGAGACGGC--------------GTGGCTGA-------TTTAT--TTTTC-AAACCC-ATTA----C-CTAAAT-ACTGATG----ATACTGTGAGGACGAAAGTCCTTGCTTTTA---CTAGAT-AGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAA-ACCACCTTGCCTCTCTTTGTTTTGTGTGTGTTGCTCTTTATTGGGCGATGCGTGCGGGGTATCGAG----ATG---GCAGA-TTTGAAGT-GTCTCGCCT-----GTTGGGTG-----------TTTT---TTTCATTTTT-GAATGAAA-----TGCCACAACTGGGCGAGTCCTTTTAAACGAAC---AC-GACTGTTCTGCT-GTTTTCTGCAAAAGTGCGGCG-CTCGAAAAGCGGTGG-TTCCATT-GGGATCGCTTGCAGTC-GGCCGGG-AC---CTTGG-CGGATGCGTGTGGGATGGAGAGAGACAGACTCGACT-CGCGGTACGTTAGGGTGAGTGCTTTATTCGTAAG------------------------GCGTTCGTTCG-AACAATGTTGCGTGTTG-GGTGTTTGTTTTTTTCT-TT-CTCGCGTGAAGCGCGTTTGCTTTGAGGTGTACTGTGCCATTGTACTGTGGGTTTGAACCTGGTG-TGTGACTGTTTAGCGAAGTAGCGTGCTGTT-TTTGTTTTGTGGAAATACGCTGTTTGTTTC-TGCC-AAGTG-TGGAGAC--GAGTGGAGTA-----AAGCGTT-CGGT-TGGAATATTTGG----GAAATAAATGTGCATGTGTATC--------ACTGCGGTAAT--CCTTGCG--GACTCTTTGA--TTTAATTAT-GAAAGGT--GTGCG------------------------A-----GTTTTGTTGCGGCGT-TGCG{CGT}GCG---------------CATCTCAA- Pythium_middletonii CCACACCAAAAAT--A-CT--TTCCACGTGAACTGTC-----------TTACGA------GATTC------GCGCCGTGACGTGTGTTGTCGCT---------------GTGTGTGCT------GTATTT---------ATATCGTGCGCATGGTGT---CGAC-TG--CGTGGGTCGGC-----------------------------TGATCGA------AGGTCG------------------------------CGTTGTGCTTTAT----------TGCGCATTGTGGCTGA-------CTTATT-CTTTC-AAACCC-ATTTC-----TT-TATTACTGATTC---ATACTGTGAGGACGAAAGTCTTTGCTTTTA---CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATACCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTCTCTTTGT-------------------------CGGTGTAGTC-CGGCTTGGAG-----TGC--GCAGA-TGTGAAGT-GTCTCGCG-------CTACGTC---------AGTCTT-----------TATTGT-------------ACTAGGCGCGCGAGTCCTTTTAAATGGAC---AC-GATCTTTCTATT-GCTTTCTG-CGGAGCGCATCA-TTTGAA-CGCGGCGG--TC--TT-GGGATCGCCTGCAGTC--GATAGCGAC---TTTGGTAG---AGACA-TAT--GGAAGAACCC----TCATTT-CGCGGTACGTTAGGCT----------------------------------------------TCGGCTC-GACAA--TGTTGCGTA-GTGA----GTGT-GTTGTTTCGTCT--------------------------------------------TTGCTTTGA----GGTG----TAC------------------------TGTC---GGTTGTG-----------GGCTTG--AACCCAA-GTATTGTGT----GTT-AGTA-----GAG---TGT------GTCGATTTCT----GTG----------GTTAGCGTCTATGTGTGGCTTTATG-----TCGTACGTAGG-TAGAAGGG-TATCATTTGGGAAAC---ATTGTAC---------------TGCGCGCTGCAAG----------------GCGTGTGTG---------------TATCTCAC- Pythium_monospermum CCACACCAAAAA---AACT--TTCCACGTGAACCGTTG----------TAATTA-----TGTTCTT-----GTGCT---------------------------------TTC--CTT--------------------------------------CGGGAAGGC-TGAACGAAGGTGAGCT---------------------------GCTTTATTTT---TGTAT-----------------------------------TGTG-----------------------GCTTGCCGA-------TGTAC--TTTTC-AAACCC-ATTT-----ACTTAAT-ACTGAACT---ATACTCCGAAAACGAAAGTCTTTGGTTTTAA---TCAAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACAACAAACTTGTCTTTCTTTTT-------------------------CTGTGTAGTC-AGGAAGAGAG----ATG---GCAGAATGTGAGGT-GTCTCG---------CTGGCTC-----------CCTC-----------TTCGGAGG-------------AGAAGATGCGAGTCCCTTTAAACGTAC-GTTC-GCTCTTTCTTGT-GTTTAAGA-TGAAGTGTGGTT-CTCGAA-CGCAGTGA--TCTGTT-TGGATCGCTTTGCGCT-AGTGGGCGAC---TTCGGTTA---GGACATTAAAAGAAAGCAACC----TCTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACT---TTGCAGCTGACGGT----GTGTGGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGTTT-TAGTGTGAGGCAA----TGGTCTG--AGC-AAATG-GTTATT-----GTGTAGTA-----GAGAGTCAC---------TGCTCTT----GAG-------------CGCTCTG-------TTTTACGA-------CAGGGTAAAGAAGGCTTACACCAATTTGGGACTGC---TGGTGGT------------------ATTCGTA----------------TCACTGGCGC----------------TTTTTCAA- Pythium_nagaii CCAGACCTAAAA---AACT--TTCCACGTGAACTGTCAT--------GTAAC--------GTTTC------GTACTTGCT--GTGTGTTGTGTCGATGTGCATTC----ATTTGCGT------GTCGGCT--------------------GCGCACTGGCAGGT-TGAACGAAGGTCGCATTGTGTACTTGCCTGTGTCGCTCTTTTTTTGTTTCCT{GT}---TGTGTTGTATTTCGGTACAAGAGAGAGGAGAGAGAGAGAGAGTGCGCGCGGTGTGTGTGTGCGGTGTC--GGCTGA-------CCTAT--TTTTTCAAACCCAATTA----CCTCAAAT-ACTGATCA---ATACTGTGAGAACGAAAGTTCTTGCTTTAAA--CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAACCTTGCCTTTCTTTTT-------------------------CTGTGTAGTC-AGTGAGAGAG----AGTT--GCAGA-TGTGAAGT-GTCTCGGCCGTTGGCGTGTGTG-----------TGTCGTGTGCTTTTGTTAGCACGTGGTGCGTCGCGCACTGTGGCCGAGTCCTTTTAAACGGAC---CC-GATCTTTCTTAT-GT-TTCTGC-GACGTGTGGCG-CTCGAA-CGCGGCGA----TTTT-CGGATCGCTCGCAGTT--GTCGGCGAC---TTCGGC-GAAG--ACATTAC--GGAGGAAACC----TCAATT-CGCGGTATGTTAGGCT----------------------------------------------TCGGTCG-GACAATGTTGC---TTATTGT----GTGTGGAATCTGTTTTC----------------------------------------------GCCTTGA----GGTG----TAC------------------------TGGC-----GGTTGTG---------GGCTTGTGTCTGTTGGTCGTTATTT-TCCGTGTAGTA-----GAGAGCTGCTT------GTGTGCGT----GGA----------TTCTGCCTGTCTCAGTCAGTTCGCTGGC--TGTGTGTGGTAAAAGATAG-ATTGCATTTGGGAAATGT---TGTACTCT-TGGTTGTTTGTGTCTCTGTAAT-------GGAGCGCGGCGGCTTTT-TG---------------TATCTCAA- Pythium_oedichilum CCACACCTAAAAA---TCT--TTCCACGTGAATTGTTT------GTTGCAATGTTGG---GCCTC------GCTGG-GCT-----AGGATTT------------------TCCTGGTT-------------------------------------CGGTTGGAGGTCATCAGGGCGTGTCGTTGC--------------------TTTGTGATT---------CGTTT---------------------------------TGCAT----G-------------------GTGTCGCG----CGCTCTT--TTTGT-AAACCC-ATTTA----ATTGAA--ACTGAT-T---ATACTGTGGGGACGAAAGTCTCTGCTTTTAA--CTAGAT-AGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTTTGCCTGGAAGTATGTCTGTATCAGTGTCCGTACACTAAACTTGCCTTTCTT-GCG------------------------TCGTGTAGTC-GTCGCTTGGA----ATG--CGCAGA-TGTGAGGT-GTCTTGCGGA----GCCGTTC---------TGTCTGT-----------TTCGGACA----------GGGTAGACGCGCAAGTCCCTT-TAAAGT-GTG-AC-GT-GTTTCTCTG--TAGTGCGCTGTGGCAGCTTTTGGTGGCGTGCGGGAC-----GTA---GTCTGT-GGACGAG--TCTGGCGACC--TTTGGCGC-TT--GCATT---GTGGGGATTCC----TTAATT-GGCGGTATGTTCGGCT----------------------------------------------TCGGCTTTGACAA---TGCAGCTTATTTT----G-GTTTCTCT----GCG--------------------------------------------------TG-----AGTG--------------------------------------TTGTATGGG--------TGAACCG-------GGTG-GTCTGT---GGGCGTTTTA------TTCGTTTT------GCGCGCGTGTCCTTAAT-------------TGTCTTT---------GTCG----------TGCTTTTGGG--AGCG-TCTCAATTTGGGAAAATT---AATA------------------CTTGTTCTT------------------TTTTGTAATG------------AGTATCTCAA- Pythium_okanoganense CCACACCTAAAA---AACT--TTCCACGTGAACTGTCT-----------TACTTA-----GTTTT------G-CGCTGCT--GCGAGGGGTGTTC---TGCG------CACATGTGC------GTAGG-------------------GCGTCTTTTGCGGCGGC-TAAACGAAGGTTGG----------------------TTGAGTGTTGT----TG---TGCGT---GCTTTATTGCGCGCC------GT---------CGTACGCTT----------------GCC--GGCTGA-------CTTAT--TTTTTCAA-CCCC-TTTT---AACTTAC-AACTGAATT---ATACTGTGAGAACGAAAGTTCTCGCTTTTAA--CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTCC-------------------------TGTGTAGTC-AGGGGAGGAG----ACG---GCCGA-TGTGAAGT-GTCTCG--------CGTGCGTC-----------GGTT-----------TTTGG---TGAAAC-AAAAGCACGACGGTCGAGTCCTTTTAAAACGAC---AC-GATCTTTCTTAT-GTGCTCTGC-AGCGTGTGGCG-CTCGAA-CGCGGTGA----TTTT-CGGATCGCTTGTGGTC--GTCGGCGAC---TTCGGT-GAAT--GCATT--ATGGAGGAAACC----TCGGTT-CGCGGTACGTTAGGCT----------------------------------------------TCGGCTG-GACAATGTTGCG--TTACTGG----GTGTGGATTCCGTGTTC----------------------------------------------TCCTTGA----GGTG----TAC------------------------TGGC-----GGTTGCG---------GGCTTG------AACCG-GGTGTT--GCTGTGTAGTA-----GAGAGTTGCATT-----TTGT-TGT----GGA----------CTCGTCCGTGGCCGGCTTCCTTGATTGG--TGTCGGTTGTGGGAGAAGG-ATTG-ATTTGGGAAATTT---TGTGTGC--------------ATGTGTC-A---------TTTC----TGGCTCGTGTA---------------CATCTCAA- Pythium_oligandrum CCACACCT-AAA---AACT--TTCCACGTGAACCGTTA----------TAACTA-----TGTTCT------GTGCTTC-------------------------------GTC-----------GCAAGAC--------------------------TTGAG-GC-TGAACGAAGGTGAGTC--------------------------TGCGTCTA--------TTTT-------------------------------GGATGCGG----------------------ATTTGCTGA-------TGTTA--TTTTA-AACACCTATTA------CTTAAT-ACTGAACT---ATACTCCGAATACGAAAGTTTTTGGTTTTAA---CAATT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTT-------------------------TTGTGTAGTC-AAAATTAGAG----ATG---GCAGAATGTGAGGT-GTCTCGC--------GCTG--------------TCTT-----------TTTAAA----------------GATGGTTCGAGTCCCTTTAAATGTAC-GTTG-ATTCTTTCTTGT-GTCTG----CGAATTGCGATG-CTATGCTCTTTGTGA--TCGGTT-TAGATTGCTTTGCGCT-GGTGGGCGAC---TTCGGTTA---GGACA-TAT--GGAAGCAACC----TCAATT-GGCGGTATGTTCGGCT----------------------------------------------TTG-CCT-GACG---TTA-AGCTAAGCGA----GTGTGGTTTT-CTGTCT--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGTC--GTGTGTGAGGT------TGATTTA--GGCTATATG-GTTGCT-----TGGTTGTG-----TGGTTTAGC----------GTTTTC----AGA-------------CGCCTGC---------TTCGGT---------AGGTAAAGGAGACAA-CACCAATTTGGGACTGAGA-GTTTA--------------------------------------------------CTCT--------------CTTTTTCACT Pythium_orthogonon CCACACCAAAAA---AACT--TTCCACGTGAACCGTTC----------TGTCCGT--TTTGTGCC------GTTGCTG--TTGT-------CTCGATTC------------GTCGAG-----------------------------------AAGAGCAGTGGC-TAAACGAAGGCTGTGA------------------------------------------GCT----------------------------------TCGTGCTTGCG---------------------GTCGA-------TTTATT-CTTTC-AAACCCCAT-A----CGTTAAGA-ACTGAAGT---ATACTGTGAGGACGAAAGTCCTTGCTTTGAA--CTAGAT-AGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTACCTCAACCTTGCCTTTCTTTTC-------------------------CGGTGTAGTC-CGGAGCGGAA----ACGT--GCAGA-CTTGAAGT-GTCTCGCTT-----GTTG-GTT-----------T-GCG--AAAGCAATTTTGCAAC------------ACAGCTGGGCGAGTCCTTTGAAATGGAC---AC-GATCTTTCTACT-GTTTTCTAC-GGAGTGTGGCG-CTCGAAAAGCGGCGGTTTCCTTC-GGGATCGCTCGCAGTTTGGACGGCGAC---TTTGG-CGAAT--GCA-TATG-GGAAGCAGAC----TCGACT-CGCGGTACGTTAGGCGTGTTGCTGT-TGCTTTGTTGCAACG-----------------GCGTCGTGCTG-AACAATGTTGCGTGTTGTGGT----GTTGTTTCCT-GTGTTC--------------------------------------------GCTTC--GA----GGTG----TAC------------------TGTCTATTGGC---TGTGAGAGTGA-------ACCTT-TGTG-GGATGTGTATGCC-GTCGTTCGGTA-----GAGCGCTGCGTGATACTGT-TGTGG----GAATGCCATG-------GCTTT-GT---T??CTG-----------TTGGTAAAGTAGTGAGA--CGGAATTTGGGAAGTATT-GTGCG-----------------------TAC----TCGCGCGTGCAGCGCGTGTATGAT---------------CATCTCAA- Pythium_pachycaule CCACACCAAAAA---A-CT--TTCC{AG}CGTGAACCGTTG----------TAACTA-----TGTTCT------GTGCT---------------------------------CTCT-CTC--------------------------------------GG-GAGGGC-TGAACGAAGGTGGGCT---------------------------GC--TT---------AAT-----------------------------------TGTA-----------------------GTCTGCCGA-------TGTAC--TTTT--AAACCC-ATTA-----AACTAAT-ACTGAACT---ATACTCCGAAAACGAAAGTCTTTGGTTTTAA---TCAAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTT-------------------------TTGTGTAGTC-AAGAAGAGAG----ATG---GCAGACTGTGAGGT-GTCTCG---------CTGACTC-----------CCTC-----------TTCGGAGG-------------AGAAGACGCGAGTCCCTTTAAATGTAC-GTTC-GCTCTTTCTTGT-GTTTAAGA-TGAAGTGTGACT-TTCGAA-CGCAGTGA--TCTGTT-TGGATCGCTTTGCTCG-AGTGGGCGAC---TTCGGTTA---GGACATTAAA-GGAAGCAACC----TCTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACT---TTGCAGCTGACTG-----GAGTTGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGTC--TTGTGTGAGGCAA----TGGTCTG--GGC-AAATG-GTTAT?-----GTGTAGTA-----GGAAGTTGC---------TGCTCTT----GAA-------------CGCTCT--------GTTTCGGC--------AGAGTAAAGGAGGCAA-CACCAATTTGGGAT-AGT--CATTG--------------------ATTTATC------------------AGTGGCGC---------------TCTTTCTAA- Pythium_paroecandrum CCACACCTAAAA---A-CT--TTCCACGTGAACTGTCG---------TTATTTGTTGTGTG-TGT------GCGCGTT-GCTGGCGTGCGTTTGCT----------TACGCTTCGGTGT---TTGCGAGTGCG-------------TGCTGTCGGTGCGCGGAC-TGAACGAAGGTCGTGTGT------TTG-CTGTGTGCCTGCTGCACCGCTG----ACTTTGCATTCATTTGCATGGTCTTGGCGGA-----GCGGCGGGTGCTGTGCG--------------TGCGCGGCTGA-------CTTATC-TTTTTCAAACCCCATAC------CTAAATGACTGATT----ATACTGTGAGAACGAAAGTTCTTGCTTTAAA--CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCGCATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCGTTTCTTCCTT------------------------CCGTGTAGTC-GGTGGAGGAGA---GTT---GCAGA-TGTGAAGT-GTCTCGCT-------GTGGTTG----------GCGTTCG------TTATTTGTAATGAATGC-------AGAGCTTGCGAGTCCTTTTAAATGGAC---AC-GACTTTCTCTTTTTTGTATCTGCGCGGTGCTGTG-CGTGAA-CGCGGTGG--TT--TT-CGGATCGCTCGCGGCT--GTCGGCGAC---TTCGGTGA---ATGCATGAT--GGAGTGGACC----TCGATT-CGCGGTATGTTGGGCT----------------------------------------------TCGGCTG-GACAA--TGTTGC-TTATTGT----GTGTCTGTTCCGCGTTC----------------------------------------------GCCTTGA----GGTG----TAC------------------------TGGT---GGCTGTGGGAT------TGAACTG---GTTAC-TG--TTGTTA----GTAGTGTGTGT-GGCGCGTTGT---------CGTGGA-----GCA-----------TCTGTGTTTT--TGCATACTTGTGTGTGTGCAATTGTACAGAAGAGGAGTCTCAATTTGGGAAAAATTTGTGTAC-----------------TCCGG-GTT-------------GATC-CTGCGTGTA---------------TATCTCAA- Pythium_perplexum CCACACCAAAAA---AACT--TTCCACGTGAACCGTTT----------TGTGCGT--TTTGTGCT------TTGTGTTTGCTTTTGTTTGTCTCGCTCTTCGG--GGTGTGGTGGAC------AAGAGG--------------------AAGCGCAA----GGC-TAAACGAAGGCTGCGA------------------------------------------GTC----------------------------------TCGTGCTTGCG---------------------GCCGA-------TTTATT-CTTTC-AAACCC-AT-A----CATTAAAC-ACTGAACT---ATACTGTGAGGACGAAAGTCCTTGCTTTAAA--CTAGAT-AGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTACCTCAACCTTGCCTTTCTTTTC-------------------------CTGTGTAGTCAGGAGA-GGAA----ATGT--GCAGA-CGTGAAGT-GTCTCGCCT-----GTTG-GTT-----------TAGCG--GCTTC{GT}GTTTCTAAGT------------ACGACTGGGCGAGTCCTTTTAAACGGAC---AC-GATCTTTCTGTT-GTTTTCTAC-GGAGTGTGGCG-CTCGAAAAGCGGCGGTTTCTTAC-GGGATCGCTCGCAGTC-GGACGGCGAC---TTTGG-CGAAT--ACA-TATA-GGAAGCAGAC----TCGACT-CGCGGTACGTTAGGCGTGCTGTTTTGTGTGTGGATTTTGTAATGAAATCTCGCGCATTGCGGCTTGCTG-AACAATGTTGCGTGTTGTGGT----CTGTTTTCCT-GTGTTC--------------------------------------------GCTTC--GA----GGTG----TAC-------------------------TGTC--TAATGGCTGTGAGTTTGA-ACCTG-TG----GATA-TCATGCT-GTCGTTCGGTA-----GAGTGCTGCGTTATACTCTCTG?GG----GAATACCACGA-----TGCTTTCGA-----GTGTTT---------TTGGTAAAACAA-AAGA--CGCAATTTGGGAAAAATT-GTGTG-----------------------TAC----TCGCGTGTACAGCGCGTGTATAA----------------CATCTCAA- Pythium_pleroticum CCACACCAAAAAC--AACT--TTCCACGTGAACTGTC-----------TTACGA------GATTC------GCGCCGTGACGCGTGTTGACGCT---------------GTGTGTGTTTGTGTCTTCTTTCGAGAGG--ATATTGTGATGCAAACAGTGTTGAC-CG--TGTGGGTCGGC-----------------------------TGATCGA------AGGTCG------------------------------CTTTGTGCATTAT----------TGTATGGAGCGGCTGA-------CTTATT-CTTTC-AAACCC-ATTAC----ACAATACTACTGATTC---ATACTGTGAGGACGAAAGTCTTTGCTTTTA---CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAACCTTGCCTCTCTTTGT-------------------------CGGTGTAGTC-CGGCTTGGAG-----TGT--GCAGA-TGTGAAGT-GTCTCGCG-------CTACGTC---------AGTTTGA----------TGCTATGCAATAAG-----ACTAGGCGCGCGAGTCCTTTGAAAACGAC---AC-GATCTTTCTATT-GCTTTCTG-TGGAGCGCGACA-ATTGAA-CGCGGCGG--TC--TT-GGGATCGCCTGCAGTC--GATAGCGAC---TTTGGCAG---AGACA-TAT--GGAGGATACC----TCATTT-CGCGGTACGTTAGGCT----------------------------------------------TCGGCTC-GACAA--TGTTGCGTA-GTGT----GTGT-GTTTTTCCGTCT--------------------------------------------TTGCTTTGA----GGTG----TAC------------------------TGTT---GATTGTG-----------GGCTTG--AACCTGG-GTTCTGTGT----GTT-AGTA-----GAG---TGT------GGCTGTCTCT----GTG----------GTTTGCGTCTGCGTGCTATTTCG-G-----TCGCACGTAGG-TAGGAGGG-TTCCATTTGGGAAAC---ATTGTAC---------------TGCGCACTGGAAA----------------GTGTGTGTG---------------TATCTCAC- Pythium_plurisporium CCACACCATAAA---AACT--TTCCACGTGAACCGTTG----------TAATCA-----TGTTCT------GTGCT---------------------------------CTCT-CTC--------------------------------------GG-GAGGGC-TGAACGAAGGTGGAGC----------------------------C-ATT---------TGT---------------------------------TTGGTTCTG-------------------------CCGA-------TGTCT--TTTTCAAACCCC-TTTA------CTAAAT-ACTGAACT---ATACTCCGAGAACGAAAGTTTTTGGTTTTAA---TCCAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTT-------------------------TTGTGTAGTC-AAGGAGAGAA----ATG---GCAGAATGTGAGGT-GTCTCG---------CTGGCTC-----------CCTC-----------TTCGGAGG-------------AGAAGACGCGAGTCCCTTTAAATGTAC-GTTC-GCTCTTTCTTGT-GTCTGAGA-AGACGTGTGACA-TTCGAA-CGCAGTGA--TCTGTT-TGGATCGCTTTGCGCG-AGTGGGCGAC---TTCGGTTA---GGACATTAAAAGGAAGCAACC----ACTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACT---TTGCAGCTGACAGT----GTGTGGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGTC--TTGTGTGAGGCAA----TGGTCTG--GGC-AAATG-GTTATT-----GTGTAGTA-----GGATGTTGC---------TGCTCTT----GGG-------------CGCCCTA---------TTCG---------TAGGGTAAAGAAGGCAA-CACCAATTTGGGA-TAGT--CC----------------------------TTTCG----------------GGGACGC----------------ATTTTCAAT Pythium_polymastum CCACACCTAATA---AACT--TTCCACGTGAACCGTCA----------ACCCAG---CCAGTTTA------GCGTCACT-TTGT---GTGCGTCTTTTCTCGATTGCCGTTTTTAAT------GAAATGGCGAGAGAGG----AGAAACAAGCGCAATTTAGAC-AGAACGAAGGTCGAGC--------------------------TGTTTTTC--------TAT----------------------------------TCGTAGTGAAACGGC--------------TTGGCTGA-------TTTATTCTTTTC-AAACCC-ATTA----C-CTAAAT-ACTGATT----ATACTGTGAGGACGAAAGTCCTTGCTTTTA---CTAGAT-AGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTGGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTATCACAACCTTGCCTCTCTTTGTTTTGTGTGTGTTGCTCTTTATTGGGCGGCGTGTGCGGAATGTCGAG----ATG---ACAGA-CTTGAAGT-GTCTCGCTT-----GTTGGGTG-----------TTTCA--TTTTATTCTTCGGAGTAAATAAAATGCTACGACTGAGCGAGTCCTTTTAAACGGAC---AC-GACTGTTCTGCT-GTTTTCTGTAAAAGTGTGTCG-CTCGAAAAGCGGTGG-TTCCATT-GGGATCGCTCGCAGTC-GGCCGGGGAC---TTTGG-CAGATGCGTGTGGGAAAGAGATAGATTTACTCGACT-CGCGGTACGTTAGGGTGAGTGCTTTATTCGTAAG------------------------GCGTTCGTTCG-AACAATGTTGCGTATTG-GGT--TTGTTTGTTTTT-TT-CTCGCGTGAAGCGCGTTTGCTTTGAGGTGTACCG-ACCATAGTGCTGTGAGCTTGAACCTGGTG-TGTGATTTACTGCTAAAGTAGAGTGGTGCTATTTCTTTTACGGGAGTACTCGGTTTGTTTC-TGCC-AAGTG-CGGAGGC--GAGTTGTGTA-----AAGCGTT-CGAT-CGGAATATTTGG----GAAGTCAATGTGCACGTGTATC--------ATTGCCGTCAA--TCTTGCTC-GACTCTTTAA--TTTACTAATTGAAAAGTT--TGTG-----------------------TGA----GTTT----GCAGTGT-TGCGTGCA---------------TATCTCAA- Pythium_pyrilobum CCACACCATAAA---AACT--TTCCACGTGAACCGTTA----------CAATTA-----TGTTCT------GTGCC---------------------------------TTCT-CTC--------------------------------------GG-GGAGGC-TGAACGAAGGTGGGCC---------------------------GC--TT---------TAT-----------------------------------TGTG-----------------------GTCTGCCGA-------TGTAT--TTTTC-AAACCC-ATTT-----TATTAAT-ACTGAACT---ATACTCCGAGAACGAAAGTTTTTGGTTTTAA---TCAAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCGCATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGTTATGCCTGGAA{GT}TATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTT-------------------------TTGTGTAGTC-AAGAGAAGAG----ATG---GCAGAATGTGAGGT-GTCTCG---------CTGACTC-----------CCTC-----------TTCGGAGG-------------AGAAGACGCGAGTCCCTTTAAATGTAC-GTTC-GCTCTTTCTTGT-GTCTAAGT-AGAAGTGTGACT-TTCGAA-CGCAGTGA--TCTGTT-TGGATCGCTTTGCGCG-AGTGGGCGAC---TTCGGTTA---GGACATTAAA-GGAAGCAACC----TCTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACT---TTGCAGCTGACAGT----GTGTTGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGTC--TTGTGTGAGGCAA----TGGTCTG--GGC-AAATG-GTTATT-----GTGTAGTA-----GGAGGTTGC---------TGCTCTT----GGA-------------CGCCCTA--------TTTTA---------TAGGGTAAAGAAGACAA-CACCAATTTGGGAC-AGT--CGGTG--------------------ATTTATC------------------ATCGGCGA----------------CTTTTCAA- Pythium_rostratum CCACACCAAAAAA--A-CT--ATCCACGTGAACCGTTAAGTAAAAGTCTAGTTGGCTTGTGTTGTTGGGGAGTGT----GTTGGGAAAAGCTTGGAGATGTCTTTGGATATTTCGATGC----GTAGTACTGGT--------CATTCTAACGAGCGAGTCGGGTAGCAACGAAGGTCGGGAG-------------------------TTCGCTTGCGGACTGATGTGCGCTT-------------------------GTCGCATGTCGGTCGAAAG----------GCTTGAGCAAACGGCTGATCTAT--TCTTTTAAACCA--TAC-----CATAAGT-ACTGATT----ATACTGTGGGGACGAAAGTCCTTGCTTTTA----TTGAC-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTACATTAAACTTGCCTCTCTTCGT-------------------------CGGTGTAGTC-CGGCTTGGAGA---AAGA--GCAGA-GGTGAAGT-GTCTCGCGC-----CATGTTTGTGAA-----GTATTTG-----------ATATTT---CGCG-------AG--TGCACGAGTCCTTTGAAATGGAC--TAC-GGTCTTT-CTATTGCGCTGTTCCAGGGCGTG-TGTTTTGAA-CGCGGTGG--TC--TCGTCGATTGCTTGCAGAT--GTTTAAGAC---CTTGGCGG---GGACA--AT--GGAAGAAACC----TCCTTTTCGCGGTACGTTCGGCT----------------------------------------------TCGGCTC-GACAA--TGTTGTGAGAGGGT----GTGTGTCTTTCGTCTCT--------------------------------------------TAGCTTTGA----GGTG--TATATTG---------------TACTGTGTGTG---GTTTGTCGAG--------TCTTTGC-CGGTAGTAGAAATGCGC----GTTT-GTGGCA--CGCACTTGCT-------GTGAGGTATA-----------------TTACTGT---GGCGTAATGTACT------TTGTA--G-A-TAGAGAGA--TTGATTTGGGAAA---TTCTGTGCTAC------ATGGCATGCTCATCGAGCTCTCCGCTGAGAGTTTG-TGTGTGTGTGTGTCGGTA----GTATCTCAA- Pythium_salpingophorum CCACACCATAAA---AACT--TTCCACGTGAACCGTTA----------AAATTA-----TGTTCT------GTGCC---------------------------------TTCT-CTC--------------------------------------GG-GAGGGC-TGAACGAAGGTGGCCT---------------------------GC{AG}ATG---------CTTT------------------------------ATTGCGTCCCG--------------------GACTGCCGA-------TG--C--TTTTTCAAACCC-ATTA------CCTAAT-ACTGATCT---ATACTCCTAAAACGAAAGTTTTTGGTTTTAA---TCCAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGTTATGCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTGTT-------------------------TTGTGTAGTC-AAGACGAGAG----ACG---GCAGAATGTGAGGT-GTCTCG---------CTGGCTC-----------CCTC-----------CTCGGAGG-------------AGAAGACGCGAGTCCCTTTAAATGTAC-GTTC-GCTCTTTCTTGT-GCCTGGGATTGAAGTGTGACT-TTCGAA-CGCGGTGA--TCTGTT-TGGATCGCTTTGCGCG-AGTGGGCGAC---TTCGGTTA---GGACATTAAA-GGAAGTGACC----TCTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACG---TTGCAGCTGACGGG----GTGTTGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGTC--TTGTGTGAGGCAA----TGGTCTG--AGC-TA{AT}-G-GTTCTC-----GTGTAGTA-----GAATTGTGC---------TGCTCCT----GCG-------------CGCCGTGTA-----ATTTTTA--------TATGGTAAAGAAGGCAAACACCAATTTGGGAC-AGC--TTGCGGA---------------TTTATTCG---------------------CGAGCGC---------------T-TTTTTAA- Pythium_spinosum CCACACCTAAAA---AACT--TTCCACGTGAACTGTCA---------TTATTTGTTGTGTG-TCT------GTGCGTT-GTTGGCGTGCATTTGCT----------TACACTTTGGTGT---TTGTGAGTGCG-------------TGTTGGCAGTGTGCGGAC-TGAACGAAGGTTGTGTG-------TTG-TTATGTGCCTGCTGCACTGCTG----ACTTTGCATTCATTTGTATGGTCTTGGCGGA-----GTGGCGGGTACTGTGCA--------------TGCGCAACTGA-------CTTAT--TTTTTCAAACCCCATAC------CTAAATGACTGATT----ATACTGTGAGAACGAAAGTTCTTGCTTTAAA--CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATACCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGGCTTTCTTCCTT------------------------CCGTGTAGTC-GGTGGAGGAGA---GTT---GCAGA-TGTGAAGT-GTCTCGCT-------ATGGTTG----------GCAT-------------TTGTAATGAATGC-------ACAGCTTGCGAGTCCTTTTAAATGGAC---AC-GACTTTCTCTTTTTTGTATCTGCGTGGTGCTGTG-TATGAA-CGCGGTGG--TT--TT-CGGATCGCTCGCGGCT--GTCGGCGAC---TTCGGTGA---ATGCATTAT--GGAGTGGACC----TCGATT-CGCGGTATGTTGGGCT----------------------------------------------TCGGCTG-GACAA--TGTTGC-TTATTGT----GTGTTTGTTCCGTGTTC----------------------------------------------GCCTTGA----GGTG----TAC------------------------TGGT---AGTTGTGGGAT------TGAACTG---GTTAC-TG--TTGTTA----GTAGTGTGT---AGTGCGTTGT---------CGTGGAT----GCA-----------TCTGTCTTTTG-TGCACTTTTGTGTGT--GCAGTTG-ATAGAAGAGGAGTTTGAATTTGGGAAA--TT?GTGTACA----------------TGTGG-GTT-------------AATC-CTGCGTGTA---------------TATCTCAA- Pythium_splendens CCACACTTTAAAA----CT--GTCCACGTGAACTGT-AAGCAA--GTCTAGC--------GCTGT----GACTGA----TCTGG--------------TGT---------TTTC----------GGATACTGG---------------ATCGGG--AGTCAG-CAG-GACGAAGGTTGG-----------------------------TCT--CG-----TAATGTAAATT-------------------------------ATG--GG-----------------ACT--AGCTGATGC---ATTCCT---TTTTCAAACCC--TTA-----CCTAAAT-ACTGATTG---ATACTGTGGGGACGAAAGTCCTTGCTTTTA---CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAA{AC}TTGCCTTTCTTTTT-------------------------CTGTGTAGTC-AG{AG}GAGAGAG----ACGT--GCAGA-TGTGAAGT-GTCTCGC--------ATGGTTG----------CGTT-------------TTCGGA---CGAC-------GATCTGT-CGAGTCCTTTTAAATGGAC---AG-GGTCTTT-CTAT-G-GTCTGTGTGAAGTGTGGTGCTCGAAA-GGCAGTGA--TT--TT-CGGATCGCTGGCGGCT--TTTGGCGAC---TTCGGCAT---GAACA-TAT--GGAGACTACC----TCGGTT-CGCGGTATGTTAGGCT----------------------------------------------TCGGCTG-AACAA--TGTTGCGTAATTGA----GTGTGGAATCCGTTTGT----------------------------------------------GCCTTGA----GGTG----TAC------------------------{CT}{AG}TA---GGTTGTCGG-----------CTTG--A{AG}CT-GTGGA--TC{AG}TT----GTTTAGTAGG----GTATTTTC--------ACGATGTACG--GAG--------------ACGC-----------TGCATT------TAGTT--GCG-TAGAGAGA--TTTATTTGGGAAA---TTCTGTA-------------------TCGTTGA-----TGATCGAATGATTG-TCGGTG----------------GTATCTCAA- Pythium_sylvaticum CCACACCTAAAA---AACT--TTCCACGTGAACTGTCG---------TTATTTGTTGTGTG-TCT------GCGCGTT-GCTGGCGTGCGTTTGCT----------TACGCTTCGGTGT---TTGCGAGTGCG-------------TGCTGGCGGTGCGCGGAC-TGAACGAAGGTCGTG---------TTG-CTGTGTGCCTGCTGCACTGCTG----ACTTTGCATTGATTTGCATGGTCTTGGCGGA-----GCGGCGGGTGCTGTGCG--------------TGCGCGGCTGA-------CTTAC--TTTTTCAAACCCCATAC------CTAACTTACTGATT----ATACTGTGAGAACGAAAGTTCTTGCTTTTAA--CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTCCTT------------------------CCGTGTAGTC-GGTGGAGGAGA---GTT---GCAGA-TGTGAAGT-GTCTCGCT-------GTGGTTG----------GTAT-----------ATTTGTTT---ATGC-------ACAACTTGCGAGTCCTTTTAAATGGAC---AC-GACTTTCTCTTTTTTGTATCTGCGCGGTGCTGTG-CGTGAA-CGCGGTGG--TT--TT-CGGATCGCTCGCGGCT--GTCGGCGAC---TTCGGTGA---ATGCATTAT--GGAGTGGACC----TCGATT-CGCGGTATGTTGGGCT----------------------------------------------TCGGCTG-GACAA--TGTTGC-TTATTGG----GTGTCTGTTCCGCGTTC----------------------------------------------GCCTTGA----GGTG----TAC------------------------TGGT---GGCTGTGGGAT------TGAACTG---GTTAC-TG--TTGTTA----GTAGTGTGC---GGCTCGTTGT---------CGTGGGT----GCA-----------TCTGTGTTTT--TGCA--CTTGTG------CAATTG-GCAGAAGAGGAGTCTCAATTTGGGAAA--TTAGTGTAC-----------------TCCGG-GTTT------------GATC-CTGCGTGTA---------------TATCTCAA- Pythium_torulosum CCACACCATAAA---AACT--TTCCACGTGAACCGTTA----------CAATTA-----TGTTCT------GTGCT---------------------------------CTCT-CTC--------------------------------------GG-GAGGGC-TGAACGAAGGTAGA-----------------------------GCTGCA---------TGT--------------------------------AAAAGTGCGGT--------------------TTTGCCGA-------TGTAC--TTTT--AAACCC-ATTA-----CACTAAT-ACTGAACT---ATACTCCGAGAACGAAAGTTTTTGGTTTTAA---TCAAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTT-------------------------TTGTGTAGTC-AAGGAGAGAA----ATG---GCAGAATGTGAGGT-GTCTCG---------CTGACTC-----------CCTC-----------TTCGGAGG-------------AGAAGACGCGAGTCCCTTTAAATGTAC-GTTC-GCTCTTTCTTGT-GTCTGAGA-TGAAGTGTGACT-TTCGAA-CGCAGTGA--TCTGTT-TGGATCGCTTTGCGCG-AGTGGGCGAC---TTCGGTTA---GAACATTAAA-GGAAGCAACC----TCTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACT---TTGCAGCTGACAGT----GTGTTGTTTT-CTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGTC--TTGTGTGAGGCAA----CGGTCTG--AGC-AAATG-GTTATT-----GTGTAGTA-----GAATTTTGC---------TGCTCTT----GGA-------------CGCCCTA---------CTCG---------TAGGGTAAAGGAGGCAA-CACCAATTTGGGACTAGT---TGT---------------------------TTCGG---------------CAGGCGC----------------ATTTTCAA- Pythium_ultimum CCACACTTTAAAA--AACT--GTCCACGTGAACTGT-AAGCAA--GTCTAGC--------GCTGT----GACTGA----GCTGG--------------TGT---------TTTCATTTT----TGGACACTGG---------------AACGGG--AGTCAG-CAG-GACGAAGGTTGG-----------------------------TCTGTTG-----TAATGCAAGTT-------------------------------ATGATGG-----------------ACT--AGCTGATGA---ACTTTT--GTTTTTAAACCC--TTA-----CCTAAAT-ACTGATTT---ATACTGTGGGGACGAAAGTCCTTGCTTTTA---CTAGAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCTTTCTTTTT-------------------------CTGTGTAGTC-AGGGATGGA-----ATGT--GCAGA-TGTGAAGT-GTCTCGC--------ATGGTTG----------CGTTCG-------TTTTTTCGAT---CGAG-------AATCTGT-CGAGTCCTTTTAAATGGAC---AC-GGTCTTTTCTAT-G-GTTTCTATGAAGTGTAATGGTTGGAA-GGCAGTGA--TT--TT-CGGATTGCTGGCGGCT--TTTGGCGAC---TTCGGTAT---GAACG-TAT--GGAGACTAGC----TCAATT-CGTGGTATGTTAGGCT----------------------------------------------TCGGCTC-GACAA--TGTTGCGTAATTGT----GTGTGGTCTTTGTTTGT----------------------------------------------GCCTTGA----GGTG----TAC------------------------TAGA---GGTTGTCGG-----------TTTG--AACC-GTAAG--TGATT----GTTTAGTAGA----GCATTTTC--------ACGATGTATG--GAG--------------ACGC-----------TGCATT------TAGTT--GCG-TAGAGAGA--TTGATTTGGGAAA---TTTTGTA-------------------TCATTGT-----CAATTGCAAGATTG-TGTATG----------------GTATCTCAA- Pythium_vanterpoolii CCACACCA-AAA---AACT--TTCCACGTGAACCGTAA----------TAATTA-----TGTTCT------GTGCC---------------------------------TTCT-TTC--------------------------------------GG-GAGGGC-TGAACGAAGGTGGATA---------------------------GTGGCG---------TATTT--------------AATTATTAATTTAGTTATTTGTGCTACA------------------GTCTGCCGA-------TG--C--TTTTT-AAACCC-ATTA------CTTAAT-ACTGATCT---ATACTCCGAGAACGAAAGTTTTTGGTTTTAA---TCCAT-AACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGTCTTTCTTTTT-------------------------TTGTGTAGTC-AAGGAGAGAA----ATG---GCCGACTGTGAGGT-GTCTCG---------CTGGCTC-----------CCTC-----------TTCGGAGG-------------AGAAGACGCGAGTCCCTTTAAATGTAC-GTTC-GCTCTTTCTTGT-GTCTATG--AGAAGTGTGACT-TGTGAA-CGCATTGA--TCTGTT-TGGATCGTTTTGCGCG-AGCGGGCGAC---TTCGGTTA---GGACG-TAAA-GGAAGCAACC----TCTATT-GGCGGTATGTTAGGCT----------------------------------------------TCGGCCC-GACG---TTGCAGCTGACTGT----G-GTTGTTTTTCTGTTC--------------------------------------------TTTCCTTGA----GGTG----TAC------------------------CTGT---TTGTGTGAGGCAT----TT-TCTA--AGC-AAATG-GTTATT-----GT-TAGTA-----TCTAGTTGC---------TGCTCAT----GGA-------------CGCTCTG---------TTCG---------CAGAGTAGAGAAGGCAA-CGCCAATTTGGGACTAGT--CTACGAA------------TGTGGTATTCAATT--------ACAATGTTTGTTGGCGC-----------------TTTTCAAT ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_rDNA) = N: 1-1346; CODONPOSSET CodonPositions (CHARACTERS = ITS_rDNA) = N: 1-1346; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4229] TITLE 28S_rDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=809; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Phytophthora_cactorum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCCAGTTTGGCATGGCGAATTGTAGTCTATGGAGGCGCTGTCAGTGCGATTGCGTGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTGTATGCCCGTGCAA-TTGTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGTGCGTGCATT-GTTTTGGAAGCAGTTTT-----CTGTTCCTGGCTGTGTTG--TGCATATGCTTGCTGGTGCCCTGTGTCATGGTGGGACGTCAGAGTCAATTCGTAAGTTGCGGGAGATGGCTATTGGGGAGGTAGGTC---GCTTCGG---TGGCTGTTATATCCTGATA-GCTAGTAGTCGTGGCTGGGATTGAGGTGCCT-ACAACGTGC-TTTCGAGTGTCTGGGTGTCTCGTTTGGTAAGTTATCTTGACAGCTTGCTGTGTTGGTGATA---TTATTGAGCGATTG-ATGTCTGGTCCAACTTGTTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGTCCCGTCTTGAAACACGGACC Pythium_acanthicum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCCAGTTTGGCATGGCGAATTGTAGTCTATGGAGGCGCTGTCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTCAG-TTGCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGCATATTTCATTGGCGCGTGAGTGCGTGCAGC-GTTTTGGAAGTGGTTT------CCGCTCCGGTCGCTGTTG--TGCATTTGCTTGCTGGTGCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTATGTTGCGGGAAATGGTTATTAGGGAGGTAGGTC---GCTTCGG---TGGCTGTTATATCCTGGTA-ACTAGTCGTCGTGGCTGAGACTGAGGTGCCT-ACAATGTGC-TTTCGAGTCTGCGGGCTTCTCGTGTGGCTGTTTGCTTTGATAGCTTGCTATGTTGGTGAAT---ACGTCGTGCGATTG-AGACCTGTAGTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGACCCGTCTTGAAACACGGACC Pythium_adhaerens GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCCAGTTTGGCATGGCGAATTGTAGTCTATGGAGGCGCTATCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTCAG-TCGCGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTTCATTGGTGTGTAAGTGCGTGCAGC-GTTTTGGAAGTAGTTTT-----CTGCTCCTGTCGTTGTTG--TGCATTTGCCTGCTGGTGCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTCGTGTGTTGCGGGAAATGGTTATTGGGGAGGTAGGTC---ACTTCGG---TGGCTGTTATATCCTGATA-ACTAGTCGTCGTGGCTGGGACTGAGGTGCCT-ACAACGTGC-TTTTGAGTCTGCGGGCTTCTCGTGTTGCTGTTTGCTTGGATAGCTTGCTATGTTTGTAAAT---AAGTCGTGCGATTG-AGACCTGTAGTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGACCCGTCTTGAAACACGGACC Pythium_anandrum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATAGAGGCGATGTCAGTGCAGCTATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGTAGCTTGTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCCATGGCATATTTCATTGGCGACTTGTTGCGTTCAGT-GCGTAGGAAGTAGTTTA---TTCTGCTCCTTGTATTGTTT--TGCGATGTGTTGCTGGTGCCCTGTGTTGTGGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGTTGAGCGCTTGCGTTTAATTGTTATATCTTGGTGTGCTAGTAGTCGTGGTTGGGACTGAGGTGCCT-ACAACGTGC-TTTAAAGTCTTGTGGGGTCTCATGTGATAACGTGCTTGGATAGCTTGCTATGTTTGTGTGT---TTATTGTGTGATTG-ATGCTGCTTGTAACTT-TTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC Pythium_aphanidermatum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCCAGTTTGGCATGGCGAATTGTAGTCTATGGAGGCGATGTCAGTGCGACTGTTCGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTCAG-TTGCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGA-CTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTAT-CCAGTGTCTATAATCCATGGCATATTTCATTGGCGAATGAGTGC-TGCGGC--TTTTGGAAGTGGTTC--------GCTCCTGTCGTTGT-G--TGCATTTTTTTGCTGGTGCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTATGCTGCGGGAAATGGTTATTGGGGAGGTAGGTC----CTTCGG---TGGCTGTTATATCCTGGTG-ACTAGTCGTCGTGGCTGAGACTGAGGTGCCT-ACAATG-GC-TTTCGAGTCTGCGGATTTCTCGTGTGGATGTTTGCTTGGATAGCTTGCTATGTTGGCGAAT---AAATCGTGCGATTG-AGATTTGTAGTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGACCCGTCTTGAAACACGGACC Pythium_apinafurcum_UZ298 GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATGGATGCGTTATCAGTGCAGCTATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGTAGCTTGTGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTTCCAGTGTCTATAATCCGCGACATATTTCATTGGCGAGTGTGTGCGTGCGAT-GTTTTGGAAGTAGCCTCG--CGTTGCTCCGGATGTTGTATTTTGCATGTATTTGCTGGTGCCCTGTGTTGTGGTGGGACGTCAGAGTGAGTTCGTATGCTGCGGGAAATGGCTGCCAAGGAGGTAGGTCAGGATTTCGGTCTTGGCTGTTATATCTTGGTGGACGAGTAGTCGTGGTTGGGACTGAGGTGCCTTACAACGTGC-TTTAAAGTGGTTGGTAGTCTCTTTTGATGCTCTGTTAGGACAGCTTGCTGTGTTGGTAGTA---GTGTTGAAGGATGG-ATTGCTGGTTGAACTT-TTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGACCCGTCTTGAAACACGGACC Pythium_apinafurcum_UZ299 GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATGGATGCGTTATCAGTGCAGCTATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGTAGCTTGTGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTTCCAGTGTCTATAATCCGCGACATATTTCATTGGCGAGTGTGTGCGTGCGAT-GTTTTGGAAGTAGCCTCG--CGTTGCTCCGGATGTTGTATTTTGCATGTATTTGCTGGTGCCCTGTGTTGTGGTGGGACGTCAGAGTGAGTTCGTATGCTGCGGGAAATGGCTGCCAAGGAGGTAGGTCAGGATTTCGGTCTTGGCTGTTATATCTTGGTGGACGAGTAGTCGTGGTTGGGACTGAGGTGCCTTACAACGTGC-TTTAAAGTGGTTGGTAGTCTCTTTTGATGCTCTGTTAGGACAGCTTGCTGTGTTGGTAGTA---GTGTTGAAGGATGG-ATTGCTGGTTGAACTT-TTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGACCCGTCTTGAAACACGGACC Pythium_apinafurcum_UZ300 GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATGGATGCGTTATCAGTGCAGCTATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGTAGCTTGTGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTTCCAGTGTCTATAATCCGCGACATATTTCATTGGCGAGTGTGTGCGTGCGAT-GTTTTGGAAGTAGCCTCG--CGTTGCTCCGGATGTTGTATTTTGCATGTATTTGCTGGTGCCCTGTGTTGTGGTGGGACGTCAGAGTGAGTTCGTATGCTGCGGGAAATGGCTGCCAAGGAGGTAGGTCAGGATTTCGGTCTTGGCTGTTATATCTTGGTGGACGAGTAGTCGTGGTTGGGACTGAGGTGCCTTACAACGTGC-TTTAAAGTGGTTGGTAGTCTCTTTTGATGCTCTGTTAGGACAGCTTGCTGTGTTGGTAGTA---GTGTTGAAGGATGG-ATTGCTGGTTGAACTT-TTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGACCCGTCTTGAAACACGGACC Pythium_apinafurcum_UZ301 GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATGGATGCGTTATCAGTGCAGCTATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGTAGCTTGTGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTTCCAGTGTCTATAATCCGCGACATATTTCATTGGCGAGTGTGTGCGTGCGAT-GTTTTGGAAGTAGCCTCG--CGTTGCTCCGGATGTTGTATTTTGCATGTATTTGCTGGTGCCCTGTGTTGTGGTGGGACGTCAGAGTGAGTTCGTATGCTGCGGGAAATGGCTGCCAAGGAGGTAGGTCAGGATTTCGGTCTTGGCTGTTATATCTTGGTGGACGAGTAGTCGTGGTTGGGACTGAGGTGCCTTACAACGTGC-TTTAAAGTGGTTGGTAGTCTCTTTTGATGCTCTGTTAGGACAGCTTGCTGTGTTGGTAGTA---GTGTTGAAGGATGG-ATTGCTGGTTGAACTT-TTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGACCCGTCTTGAAACACGGACC Pythium_apinafurcum_UZ302 GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATGGATGCGTTATCAGTGCAGCTATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGTAGCTTGTGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTTCCAGTGTCTATAATCCGCGACATATTTCATTGGCGAGTGTGTGCGTGCGAT-GTTTTGGAAGTAGCCTCG--CGTTGCTCCGGATGTTGTATTTTGCATGTATTTGCTGGTGCCCTGTGTTGTGGTGGGACGTCAGAGTGAGTTCGTATGCTGCGGGAAATGGCTGCCAAGGAGGTAGGTCAGGATTTCGGTCTTGGCTGTTATATCTTGGTGGACGAGTAGTCGTGGTTGGGACTGAGGTGCCTTACAACGTGC-TTTAAAGTGGTTGGTAGTCTCTTTTGATGCTCTGTTAGGACAGCTTGCTGTGTTGGTAGTA---GTGTTGAAGGATGG-ATTGCTGGTTGAACTT-TTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGACCCGTCTTGAAACACGGACC Pythium_apinafurcum_UZ303 GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATGGATGCGTTATCAGTGCAGCTATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGTAGCTTGTGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTTCCAGTGTCTATAATCCGCGACATATTTCATTGGCGAGTGTGTGCGTGCGAT-GTTTTGGAAGTAGCCTCG--CGTTGCTCCGGATGTTGTATTTTGCATGTATTTGCTGGTGCCCTGTGTTGTGGTGGGACGTCAGAGTGAGTTCGTATGCTGCGGGAAATGGCTGCCAAGGAGGTAGGTCAGGATTTCGGTCTTGGCTGTTATATCTTGGTGGACGAGTAGTCGTGGTTGGGACTGAGGTGCCTTACAACGTGC-TTTAAAGTGGTTGGTAGTCTCTTTTGATGCTCTGTTAGGACAGCTTGCTGTGTTGGTAGTA---GTGTTGAAGGATGG-ATTGCTGGTTGAACTT-TTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGACCCGTCTTGAAACACGGACC Pythium_arrhenomanes GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATGGATGCGCTATCAGTGCAGCCGCGCGGGCCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCCTGCCTGTGCGTGTTGTGCGTACGATGCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCTGCGGCATATTTCATTGTCGGATGCGGCCGTGCGGCGCGTTTGGTAGTGGGTTCG--TCCTGCACCGCGTGTTGC-T-GTGGTTGCGTTTGGTGGTGCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTCGTGTGCTGCGGGAAATGGCTGCTGGGGAGGTAGGTCGGGGGTTCGCCCTCGGCTGTTATATCCTGGCGGACTAGTCGTCGTGGTTGGGACTGAGGTGCCT-ACAACGTGCTTTT-GAGTGCGGAGGTTTCTTCGTTTGCGCGTCGGTTGGATAGCTTGCTATGCAGTTGGCGT--T-GTGTGCGGATGG-ATGTCTTTGCTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGCGCGATCCGACCCGTCTTGAAACACGGACC Pythium_boreale GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCCAGTTTGGCATGGCGAATTGTAGTCTATGGAGGCGCTGTCAGTGCGATTGCGTGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTGTATGCCTGTGCAA-TTGTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGTGCGTGCATT-GTTTTGGAAGCAGTTTT-----CTGTTCCTGGCTGTGTTG--TGCATATGCTTGCTGGTGCCCTGTGTCGCGGTGGGACGTCAGAGTCAATTCGTAAGTTGCGGGAAATGGCTATTGGGGAGGTAGGTC---ACTTCGG---TGGCTGTTATATCCTGATA-GCTAGTAGTCGTGGCTGGGATTGAGGTGCCT-ACAACGTGC-TTTCGAGTGTCTGGGTGTCTCGTTTGGTAAGTTATCTTGACAGCTTGCTGTGTTGGTGATA---TTATCGAGCGATTG-ATGTCTGGTCTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGTCCCGTCTTGAAACACGGACC Pythium_chamaehyphon GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGTCAGTTTGGCATGGCGAATTGTAGTCTATGGAGGCGCTGTCAGTGCGACTATTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTGTAG-TTGCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCTATGGCATATTTCATTGGCGCGTGGATGTGTGTAGC-GTTTTGGAAGTAGGTTT-----CTGCTCCTGGCGTTGCTT--TGCGTTCGCTTGCTGGTGCCCTGTGCTGTAGTGGGACGTCAGAGTCAGTTCGTATGTTGCGGGAAATGGTTATTGGGGAGGTAGGTC---GCTTCGG---TGGCTGTTATATCCTGGTA-ACTAGTCGTCGTGGCTGGGACTGAGGTGCCT-ACAATGTGC-TTTCGAGTCTGCGGGCCTCTCGTTTGGCTGTTTGCTTTGATAGCTTGCTATGTTAGTGAAC---GTGTCAGGCGATTG-AGACCTGTAGTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGACCCGTCTTGAAACACGGACC Pythium_cucurbitacearum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCCAGTTTGGCATGGCGAATTGTAGTCTATGGAGGCGCTGTCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTCAG-TCGCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTTCATTGGCGAGTGAGTGCGTGCAGC-GTTTTGGAAGCGGTCT------CCGCTCCTGTCGTTGTTG--TGCATTTGCTTGCTGGTGCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTATGTTGCGGGAAATGGTTATCAGGGAGGTAGGTC---GCTTCGG---TGGCTGTTATATCCTGGTA-ACTAGTCGTCGTGGCTGAGACTGAGGTGCCT-ACAACGCGC-TTTCGAGTCTGCGGGCTTCTCGTGTGGCTGTTTGCTTTGATAGCTTGCTATGTTGGTGAAT---AAGTCGTGCGATTG-AGACCTGTAGTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGACCCGTCTTGAAACACGGACC Pythium_dimorphum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATAGAGGCGATGTCAGTGCAGCTATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGTAGCTTGTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCCAATGCATATTTCATTGTGGACTTGTTGCGTGCAGT-GCGTAGGAAGTAGTTTA---TTCTGCTCCTTGTATTGTTG--TGCGATGTGTTGATGGTGCCCTGTGTGTTGGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAATGGCTGTCGAGGAGGTAGGCTGAGCGCTTGCGTTTAGCTGTTATATCTTGGCGTGCTAGTGGTCGTGGTTGGGACTGAGGTGCCT-ACAACGTGC-TTTAAAGTCTTGTGGGGTCTCATGTGATAACGTGCTAGGATAGCTTGCTATGTTGGTGTGT---TTATTGTGTGATTG-ATGCTGTTTGTAACTT-TTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC Pythium_dissotocum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTTAGGCTGCGCTCGGCGT-GTGTGCTGTGTGTGCTTGCTGGTGCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCT-ACAACGTGC-TTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGG---TTGTGTGTGGATTG-ATGCGGGCTTTAACTTGTTGCCGTTCGGGACGTTGACGAAATGGAGCGATTCGACCCGTCTTGAAACACGGACC Pythium_echinulatum GCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTATGCAAGTTTTGCATGGCGAATTGTAGTCTATAGAGGCGCTGTCAGTGCAGGCATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGTGCTTTGTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTTCATTGGCGTATGTGCGCGTGCTGT-GTATTGGAAGTGACGTT---CGTTGCTCCTTGTGCGGTTC--TGCGTGTGTCTGCTGGTGCCCTGTGTCATAGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAATGGCTATTGAGGAGGTAGGTTAGGAGTTCGCTCTTGGCTGTTATATCTTGATA-GCTAGTTGTCGTGGTTGGGACTGAGGTGCCT-ACAATGTGC-TTTGGGGTCATACGGGTTCTTGCTTGGCGCACTACTTGGATAGCTTGCTATGCTGGCGGTG--TTGTTA-GGTGATTG-AGTCTGTGTGTAACCT-GTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC Pythium_graminicola GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGGTCAGGTTCTGGTCGGCGAATTGTAGTCTATAGACGCGTTATCAGTGTGGCCGGTCGGGGTAAGTTCCTTGGAAGAGGACAGCAATGAGGGTGATACTCCCGTTTGTACCTGATTGTGTTGCGCGTACGATGCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCCTTGGCATATTTCATTGCCGTGTCTGTTTGTTCCGCGTGTTTG-TAGCAG-TTTG--TTCTGTGCATTGCGTGGT-T-GTGAGCGGTCGTGGCGGTGCCCTGTGCTTTGGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAATGGTCGTGCAGGAGGTAGGTCGGGGGCTTGCTCTCGGCTGTTATATCTGTGCGTGCCAGTAGTCGTGGTTGGGACTGAGGTGCCT-ACAACGTGCTTTT-GAGTCTTTGGGTCGCTCTGTGCGCGCGTGTGCGGGATAGCTTGCTATGCCGTGTGCGT--TTGTGTGTGGATGGCGTGCTCTCTGTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGCGCGATCCGACCCGTCTTGAAACACGGACC Pythium_helicandrum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATAGAGGCGATGTCAGTGCAGCTATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGTAGGTTGTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCCATGGCATATTTCATTGGCGACTTGTTGCGTACAGT-GCGTAGGAAGTAGTTTA---TTCTGCTCCTTGTATTGTTT--TGCGATGTGTTGCTGGTGCCCTGTGTCGTGGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGCTGAGCGCTTGCGTTTAGCTGTTATATCTTGGTGTGCTAGTTGTCGTGGTTGGGACTGAGGTGCCT-ACAACGTGC-TTTAAAGTCTTGTGGGGTCTCATGTGATAACGTGCTAGGATAGCTTGCTATGTTGGTGTGT---TTATTGTGTGATTG-ATGCTGTT-GTAACTT-TTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC Pythium_helicoides GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCCAGTTTGGCATGGCGAATTGTAGTCTATGGAGGCGCTGTCAGTGCGACTATGCGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTGTAG-TTGCGCGTACGACACGTTTTCTTTGAGTCGTGTTGTTTGGGAATGCAGCACAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCTATGGCATATTTCATTGGCGTGTGGATGTGTGCGGC-GTTTTGGAAGTAGTTTT-----CTGCTCCTGGCGTTGTTT--TGCGTTCGCCTGCTGGTGCCCTGTGCTGTAGTGGGACGTCAGAGTCAGTTCGTATACTGCGGGAAATGGTTACTGGGGAGGTAGGTC---ACTTCGG---TGGCTGTTATATCCTGGTG-ACTAGTCGTCGTGGTTGGGACTGAGGTGCCT-ACAATGTGC-TTTCGAGTCTATGGGACTCTCGTTTGGCTGTTTGCTTTGATAGCTTGCTATGTTAGTGAAC---GTGTTGAGCGATTG-AGATCTGTAGTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGACCCGTCTTGAAACACGGACC Pythium_heterothallicum GCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTC-ATGCAAGTTTTGCATGGCGAATTGTAGTCTATAGAGGCGCTGTCAGTGCAGCTATTTGGGATAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTGCCTGAGTAG-TTGTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTAGGTGCGTGCAGT-ATGTAGGAAGGGGTTT------CTGCTCCTTGTGCTGTTG--TGCGTTTGCTTGTTGGTGCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTATGCTGTGAGAAATGGCTACTGAGGAGGTAGGCTAGGAGCTTGCTCTTGGCTGTTATATCTTGGTA-GTTAGTTGTCGTGGTTGGGACTGAGGTGCCT-ACAACGTGC-TTTAAAGT-CTTGGGACTCTCGTTTGGTTACCTGTTTGGATAGCTTGCTATGCTGACGGTG---TGATTGTGCGATTG-AGGCCTTGGGTAACTT-TTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC Pythium_inflatum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAGGTTCTGCTCGGCGAATTGTAGTCTATGGATGCGTTATCAGTGTGGCCGGTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGACTGTGTTGCGCGTACGATGCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCCTTGGCATATTTCATTGGTGCGAGTGTCTGTTCCGCGTGCGTG-TATCAG-TTTG--TTCTGTGCTGCGCGTGGT-T-GTGGGTGCTTGTGCCGGTGCCCTGTGCTTTGGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAATGGTCGTGCAGGAGGTAGGTCGGGGGCTTGCTCTCGGCTGTTATATCTGTGCGTGCCAGTAGTCGTGGCTGGGACTGAGGTGCCT-ACAACGTGCTTTT-GAGTCTTTGGGTCGCTCTGTGCGCGCGCGTGCGGGATAGCTTGCTATGCCGTGTGCGT--TTTGGTGTGGATGGCGTGCTCTCTGCAACTTGTTGCCGTTCGGGACTTTGACGAAATGGCGCGATCCGACCCGTCTTGAAACACGGACC Pythium_insidiosum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCCAGTTTGGCATGGCGAATTGTAGTCTATGGAGGCGCTGTCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTCAG-TTGCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTTCATTGGCGAGTGAGTGCGTGCAGC-GTTTTGGAAGTGGTTT------CCGCTCCTGTCGTTGTTG--TGCATTTGCTTGCTGGTGCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTATGTTGCGGGAAATGGTTATTGGGGAGGTAGGTC---GCTTCGG---TGGCTGTTATATCCTGGTA-ACTAGTCGTCGTGGCTGAGACTGAGGTGCCT-ACAACGTGC-TTTCGAGTCTGCGGGTTTCTCGTGTGGCTGTTTGCTTTGATAGCTTGCTATGTTGGTGAAT---ATGTCGTGCGATTG-AGATTTGTAGTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGACCCGTCTTGAAACACGGACC Pythium_intermedium GCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCCAGTTTGGCATGGCGAATTGTAGTCTATAGAGGCGTTGTCAGTGCGGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGCGGCTTGCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTTCATTGGCGGCGGTGCGCGTGCTTTTGCGTCGGAAGCGGCTTT---TGTTGCTCTGTGCTTTTGCT-GTGCGTGTTGTTGCTGGTGCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTTGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGTCAGGATTTCGGTCTTGGCTGTTATATCTTGGTG-GTTTGTTGTCGTGGTTGAGACTGAGGTGCCT-ACAATGTGC-TTTTGAGTGTGCCGGGTTCTCATTTGGTGGACTGTTTGGATAGCTTGCTATGCTTGTGGTTTTTTCATCGGGTGATTG-AGTCTGGTGGTAACTTATTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC Pythium_iwayamae GCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATAGAGGCGCTGTCAGTGCGGCCGCTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGTGGTTTGCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCGTGGCATATTTCATTGGCGATTGTGTGCGTGCGGC-GCTTCGGAAGTGGCTTT---TGTCGCTCCGTGTGTTGTTTTCTGCGTGCGGTTGCTGGTGCCCTGTGTCGCGGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAATGGCTACTGAGGAGGTAGGACGGGGGCTTGCTCCTGTCTGTTATATCTTGGTA-GTTAGTGGTCGTGGTTGGGACTGAGGTGCCT-ACAACGTGC-TTTGGAGTGTTCCGGGTTCTCACGTGGTGTGCTGTTTGTATAGCTTGCTATGCTTGTGGTGT--TCACCGTTTGATGG-AGTCTGGTTTGTGCTTCTTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC Pythium_macrosporum GCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCCAGTTTGGCATGGCGAATTGTAGTCTATAGAGGCGTTGTCAGTG-AGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGCGGCTTGCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTTCATTGGCGGCGGTGTGCGTGCTATTGCGTCGGAAGCGGCTTT---TGTTGCTCTGTGCTTTGGTG-TTGCTTGTTGCTGCTGGTGCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGTCGGGATTTCGGTCCTGGCTGTTATATCTTGGTA-GTTTGTTGTCGTGGTTGGGACTGAGGTGCCT-ACAATGTGC-TTTTGAGTGTGCCGGGTTCTCATTTGGTGGACTGTTTGGATAGCTTGCTATGCTTGTGGTTTTTTCATCGGGTGATTG-AGTCTGGTGGTAACTTATTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC Pythium_mastophorum GCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCACGGCGAATTGTAGTCTATGGAGGCGTTGTCAGTGCGACCGCTTGGGATAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTGCCCGAGTGTGTTGCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCTTGGCATATTTCACTGGCGAGTGTGTGCGTACTGT-GTGTGGGAAGCGGCTTT---TGTTGCTCTCTATGCGGTTC--TGCGTGTGCTTGGTGGTGCCCTGTGTCTTGGTGGGACGTCAGAGTCAGTTTGTAAATTGCGGGAAATGGCTGTGGAGGAGGTAGGTC-GGGGTTCGC-CCTGGCTGTTATATCTCTGCG-GTTAGTTGTTGTGGTTGGGACTGAGGTGCCT-ATAACGTGCGTTTTGGGTCTAACGGGTTCTCGTTTCTCAGTCTGCGTGGATAGCTTGCTATGCTTGCGGGTGTTTGTGGAGGCGATTG-AGTCTGTTGGTAACTT-TTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC Pythium_middletonii GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATAGAGGCGCTGTCAGTGCAGGCATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGTGCTTTGTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTTCATTGGCGCATGTGCGCGTGCTGT-GTGTTGGAAGTGGC-TT---TGCTGCTCCGCGTATGGTTC--TGCGTGTGTGTGCTGGTGCCCTGTGTCATGGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAATGGCTATCGAGGAGGTAGGTCAGGAGCTTGCTCTTGGCTGTTATATCTTGGTA-GCTAGTGGTCGTGGTTGGGACTGAGGTGCCT-ACAACGTGC-TTTGAGGTCTTGCGGGTTCTTGCTTGGCGGTCTGTCTGGATAGCTTGCTATGCTGGTGGAT--TCGTTG-GGTGATTG-AGTCTGTTTGTAACCT-GTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC Pythium_monospermum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCCAGTTTGGCATGGCGAATTGTAGTCTATGGAGGCGATATCAGTGCGACTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTTCAG-TTGCGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTT-CCAGTGTCTATAATCCATGGTATATTTCATTGGTGAGTGAGTGCGTGCAGC-GTTTTGGAAGTGGTTT------CCGCTCCTGTCGTTGTTG--TGCATTTGCTTGCTGGTGCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTATGTTGCGGGAAATGATTATTGGGGAGGTAGGTC---ACTTCGG---TGGCTGTTATATCCTGATA-ATTAGTCGTCGTGGCTGAGACTGAGGTGCCT-ACAACGTGC-TTTCGAGTCTGCGGGTTTCTCGTGTTGCTGTTTGCTTTGATAGCTTGCTATGTTGGTGAAT---AAGTAGTGCGATTG-AGATTTGTAGTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGACCCGTCTTGAAACACGGACC Pythium_oedichilum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGTCGGTTCGGCATGGCGAATTGTAGTCTATGGAGGCGCTGTCAGTGCGACTATGTGGGTTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTGTAG-TTGCGCGTACGACACGTTTTCTTTGAGTCGTGTTGTTTGGGAATGCAGCACAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACCGCTGAAAGGGAACCGGATCGTTT-CCAGTGTCTATAATCTATGGCATATTTCATTGGCGTGTGGGTGCGTGCAGC-GTTTTGGAAGTAGTTTT-----CTGCTCCTGTCGTTGTTT--TGCGCTCGCCTGCTGGTGCCCTGTGCTGTAGTGGGACGTCAGAGTCAATTCGTATGCTGCGGGAAATGGTTACTGGGGAGGTAGGTC---ACTTCGG---TGGCTGTTATATCCTGGTG-ACTAGTCGTCGTGGTTGGGATTGAGGTGCCT-ACAATGTGC-TTTCGAGTCTGTGGGTCTCTCGTTTGGCCGTTTGCCTTGATAGCTTGCTATGTTGGTGAAT---GTGTCGGGCGATTG-GGATCTGTAGTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGACCCGTCTTGAAACACGGACC Pythium_okanoganense GCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATAGAGGCGCTGTCAGTGCGGCCGCTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGTGGTTTGCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCGTGGCATATTTCATTGGCGACTGTGTGCGTGCGAT-GCGTTGGAAGTGGCTTT---TGTCGCTCCATGTGTTGTTT-CTGCGTGCGGTTGCTGGTGCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAACGTCTGCTGAGGAGGTAGGTCGGGAGCTTGCTCTTGTCTGTTATATCTTGGTG-GATTGTGGTCGTGGTTGGGACTGAGGTGCCT-ACAACGTGC-TTTGGAGTGTTCCGGGTTCTCACGTGGTGTGCTGTTTGTATAGCTTGCTATGCTTGTGGTGT--TCACCGTTTGATTG-AGTCTGGTTTGTGCTTCTTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC Pythium_oligandrum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCCAGTTTGGCATGGCGAATTGTAGTCTATGGAGGCGCTGTCAGTGCGATTGTTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTACCTGTTCAG-TTGCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTAT-CCAGTGTCTATAATCCATGGCATATTTCATTGGCGAGTGAGTGCGTGCAGC-GTTTTGGAAGTGGTTTT-----CCGCTCCTGTCGTTGTTG--TGCATTTGCTTGCTGGTGCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTTGTATGTTGCGGGAAATGGTTATTGGGGAGGTAGGTC---ACTTCGG---TGGCTGTTATATCCTGGTA-ACTAGTCGTCGTGGCTGAGACTGAGGTGCCT-ACAATGTGC-TTTCGAGTGTGCGGGATTCTCGTGTGGCTGTTTGCTTTGATAGCTTGCTATGTTGGTGAAT---AAGTCGTGCGATTG-AGACTTGTATTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGAGCGATCCGACCCGTCTTGAAACACGGACC Pythium_perplexum GCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTATGCAAGTTTTGCATGGCGAATTGTAGTCTATGGAGGCGCTGTCAGTGCGGCCACTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGTGTGTTGCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCTTGGCATATTTCATTGGCGCGTGTGCGCGTGCTGT-GCGTTGGAAGCAACTT-----GTTGCTCCATGCTTGGCTC--TGCGTGTGCTTGCTGATGCCCTGTGTCTTGGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAATGGGTATCGAGGAGGTAGGTC-GGGGTTCGC-CTCGGCTGTTATATCTCGGTA-TCTAGTCGTCGTGGTTGGGACTGAGGTGCCT-ACAATGTGC-TTTAAGGTCTGTTGGGTTCTCGTTTCTCAGCCTGTCTGGATAGCTTGCTATGCTGGCGGGT--CTGTGGAGGCGATTG-AGTCTGGCAGTAACCT-TTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC Pythium_pleroticum GCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATAGAGGCGCTGTCAGTGCAGGCATTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGTGCTTTGTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTGGCATATTTCATTGGCGCATGTGCGCGTGCTGT-GTGTTGGAAGTGGC-TT---TGCTGCTCCGCGTATGGTTC--TGCGTGTGTGTGCTGGTGCCCTGTGTCATGGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAATGGCTATTGAGGAGGTAGGTCAGGAGCTTGCTCTTGGCTGTTATATCTTGGTA-GTTAGTGGTCGTGGTTGGGACTGAGGTGCCT-ACAACGTGC-TTTGGGGTCTTGCGGGTTCTTGCTTGGCGGTCTGTCTGGATAGCTTGCTATGCTGGTGGCG--TCGTTG-GGTGATTG-AGTCTGTTTGTAACCT-GTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC Pythium_polymastum GCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATGGAGGCGTTATCAGTGCGGCCACTTGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCCGAGTGTGTTGTGCGTACGATACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCTTGGCATATTTCATTGGCGAGTGTGTGCGTGCTGT-GTGTGGGAAGCGGCCTTG--TGTTGCTCTCTATGCGGTTC--TGCGTGTGCTTGCTGGTGCCCTGTGTCTTGGTGGGACGTCAGAGTCAGTTCGTATATTGCGGGAAATGGCTGTGGAGGAGGTAGGTC-GGGGTTCGC-CCTGGCTGTTATATCTCTGCG-GTTAGTTGTCGTGGTTGGGACTGAGGTGCCT-ACAACGTGCATTT-AGGTCTAATGGGTTCTCGTTTCTCAGTCTGCGTGGATAGCTTGCTATGCTTGCGGGTGTTTGTGGAGGCGATTG-AGTCTGTTAGTAACTT-AGGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC Pythium_pyrilobum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGACGCTAAATCAGTGCGGCTATTCGGGTTAAGTTCCTTGGAAGAGGACAGCAATGAGGGTGATACTCCCGTTTGTACCTGAGTATGTTGCACGTACGATTTGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCCTCGGCATATTTCATTGCTGTGCGGGGCTGTGTCGCGCGTTGG-TAGTAG-TTTG--TTCTGCGCTGCGTGTGTCGT-TCGGCTTTGCTCGGCGGTGCCCTGTGTCGTGGTGGGACGTCAGAGTCAGTTCGTGTGCTGCGGGAAATGGCTGTCGAGGAGGTAGGTCAGGAGCTTGCTTCTGGCTGTTATATCTTGGCGTGCTAGTTGTCGTGGTTGGGACTGAGGTGCCT-ACAACGTGCTTTTTGAGTGTTTGTGCGTCTCTGTGTGCGTCCGGATTGGATAGCTTGCTATGCAGTTTGTCA--C-GTGTGCGGATGG-ATGTGTATTCTTACTTGTTGCCGTTCGGGACTTTGACGAAATGGCGCGATCCGACCCGTCTTGAAACACGGACC Pythium_salpingophorum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCAGGTTCTGCATGGCGAATTGTAGTCTATGGAGGCGATGTCAGTGCGGTTGTGCGGGATAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTGCCTGTACAG-CTGCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTT-CCAGTGTCTATAATCCATGACATATTTCATTGGCGCGTGAATGCGTGCAGC-GTTTTGGAAGTGGGTTT-----CCTCTCCTGGCGTTGTTG--TGCGTTTGCTTGCTGGTGCCCTGTGTTGTGGTGGGACGTCAGAGTCAGTTCGTATGCCGCGGGAAATGGCTGTCAGGGAGGTAGGTC---GCTTCGG---TGATTGTTATAGCCTGGCA-GTTAGTAGTCGTGGTTGGGACTGAGGTGCCT-ACAACGCGC-TTTCGAGTCTGCGGGACTCTCGTCTGGTTGCCTGCTTGGACAGCTTGCTGTGCTAGTGGTC---ACATCGGGCGATTG-AGATCTGTAGTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGTCCCGTCTTGAAACACGGACC Pythium_splendens GCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTATGCAAGTTTTGCATGGCGAATTGTAGTCTATAGAGGCGCTGTCAGTGCAGCTATTTGGGATAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTGCCTGAGTAGCTTGTGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGTAGCATATTTCATTGGCGAGTAGGTGCGTGCAGT-ATGTAAGAAGTGGTTTT-----CTGCTCTTTGTGCTGTTC--TGCGTTTGCTTGTTGGTGCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTATGCTGTGAGAAATGGCTACTGAGGAGGTAGGTTAGGAGCTTGCTCTTGGCTGTTATATCTTGGTA-GTTAGTTGTCGTGGTTGGGACTGAGGTGCCT-ACAATGTGC-TTTAAAGTGTTTGGGACTCTCGTTTGGTTACCTGTTTGGATAGCTTGCTATGCTGACGGAG---TGATTGGTCGATTG-AGATCTAGAGTAACTT-TTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC Pythium_sylvaticum GCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCCAGTTTGGCATGGCGAATTGTAGTCTATAGAGGCGTTGTCAGTGCGGCTGTGCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGTGCGGCTTGCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCTGCGGCATATTTCATTGGCGGCAGTGTGCGTGCTTTTGCGTCGGAAGCGGCTTT---TGTTGCTCTGTGCTTTTGCT-GTGCGTGCTGTTGCTGGTGCCCTGTGTTGCGGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAATGGCCGCCGAGGAGGTAGGTCAGGACTTCGGTCTTGGCTGTTATATCTTGGTG-GTTTGTTGTCGTGGTTGGGACTGAGGTGCCT-ACAATGTGC-TTTTGAGTGTGCCGGGTTCTCATTTGGTGGACTGTTTGGATAGCTTGCTATGCTTGTGGTTTTTTCATCGAGTGATTG-AGTCTGGTGGTAACTTATTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC Pythium_torulosum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGTGGCGAATTGTAGTCTATAGACGCGTAATCAGTGCGGCTGCTCGGGATAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTTGTGCCTGAGCATGTTGCGCGTACGATTTGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTG-CCAGTGTCTATAATCGTCGGCATATTTCATTGCTGTGCGGGTCTGTGTCGCGCGTTGG-TAGTAG-TTTG--TTCTGCGCCGCGTGTGTCGT-TCAGGTTTGCTCGGCGGTGCCCTGTGTCGGTGTGGGACGTCAGAGTCAGTTCGTGTGCTGCGGGAAATGGCTGTCGAGGAGGTAGGTCAGGAGTTCGCTTTTGGCTGTTATATCTTGGCGTGCTAGTTGTCGTGGTTGGGACTGAGGTGCCT-ACAACGTGCTTTT-GAGTGCGTGTGCGTCTCTGTTTGCGTGCGAGTTGGATAGCTTGCTATGCAGTTTGCAT--T-GTGTGCGGATGG-ATGTATGCGTTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGCGCGATCCGACCCGTCTTGAAACACGGACC Pythium_ultimum GCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATAGAGGCGATGTCAGTGCAGCTATTCGGGGTAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTTTGTACCTGAGTAGCTTGCGCGTACGACACGTTTTCTTCGAGTCGCGTTGTTTGGGACTGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAAGCGAATCGTAT-CCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGAT-GCGTAAGAAGTAGCTTG-----CTGCTCTTTGTGTTGTTC--TGCGCTTGCTTGCTGGTGCCCTGTGTCGTGGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAATGGCTATCGAGGAGGTAGGTTAGGAGCTTGCTCTTGGCTGTTATATCTTGGTATGCTAGTGGTCGTGGTTGGGACTGAGGTGCCT-ACAACGTGC-TTTAAAGTCTTGCGGTGTCTTATTTGGTTAACTGTTTGGATAGCTTGCTATGCCTATGGCC---TAATCGAGTGATGG-ATACTGTAGGTAACTT-TTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGGCCCGTCTTGAAACACGGACC ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = 28S_rDNA) = N: 1-809; CODONPOSSET * CodonPositions (CHARACTERS = 28S_rDNA) = N: 1-809; END; BEGIN TREES; TITLE Tb10914; LINK TAXA = Taxa2; TRANSLATE 1 Phytophthora_cactorum, 2 Phytophthora_capsici, 3 Pythium_acanthicum, 4 Pythium_acrogynum, 5 Pythium_adhaerense, 6 Pythium_anandrum, 7 Pythium_angustatum, 8 Pythium_aphanidermatum, 9 Pythium_apinafurcum_UZ298, 10 Pythium_apinafurcum_UZ299, 11 Pythium_apinafurcum_UZ300, 12 Pythium_apinafurcum_UZ301, 13 Pythium_apinafurcum_UZ302, 14 Pythium_apinafurcum_UZ303, 15 Pythium_aquatile, 16 Pythium_arrhenomanes, 17 Pythium_boreale, 18 Pythium_capillosum, 19 Pythium_chamaehyphon, 20 Pythium_cucurbitacearum, 21 Pythium_dimorphum, 22 Pythium_dissimile, 23 Pythium_dissotocum, 24 Pythium_echinulatum, 25 Pythium_graminicola, 26 Pythium_grandisporangium, 27 Pythium_helicandrum, 28 Pythium_helicoides, 29 Pythium_heterothallicum, 30 Pythium_inflatum, 31 Pythium_insidiosum, 32 Pythium_intermedium, 33 Pythium_iwayamae, 34 Pythium_macrosporum, 35 Pythium_marsipium, 36 Pythium_mastophorum, 37 Pythium_middletonii, 38 Pythium_monospermum, 39 Pythium_nagaii, 40 Pythium_oedichilum, 41 Pythium_okanoganense, 42 Pythium_oligandrum, 43 Pythium_orthogonon, 44 Pythium_pachycaule, 45 Pythium_paroecandrum, 46 Pythium_perplexum, 47 Pythium_pleroticum, 48 Pythium_plurisporium, 49 Pythium_polymastum, 50 Pythium_pyrilobum, 51 Pythium_rostratum, 52 Pythium_salpingophorum, 53 Pythium_spinosum, 54 Pythium_splendens, 55 Pythium_sylvaticum, 56 Pythium_torulosum, 57 Pythium_ultimum, 58 Pythium_vanterpoolii; TREE Fig._4 = [&R] (((((10,(11,14)),(13,(12,9))),((2,1),((40,17),(20,(28,19))))),((8,(52,(22,((((56,7),(58,(25,30))),(16,48)),(50,((38,5),(18,(15,(23,44))))))))),((31,26),(42,3)))),((((((((53,45),55),34),32),((21,(6,27)),(51,(54,57)))),((24,4),(35,(47,37)))),((29,39),(33,41))),((49,36),(43,46)))); END; BEGIN TREES; TITLE Tb10913; LINK TAXA = Taxa1; TRANSLATE 1 Pythium_middletonii, 2 Pythium_pleroticum, 3 Pythium_echinulatum, 4 Pythium_polymastum, 5 Pythium_mastophorum, 6 Pythium_perplexum, 7 Pythium_sylvaticum, 8 Pythium_intermedium, 9 Pythium_macrosporum, 10 Pythium_iwayamae, 11 Pythium_okanoganense, 12 Pythium_helicandrum, 13 Pythium_dimorphum, 14 Pythium_anandrum, 15 Pythium_heterothallicum, 16 Pythium_splendens, 17 Pythium_ultimum, 18 Pythium_apinafurcum_UZ298, 19 Pythium_apinafurcum_UZ299, 20 Pythium_apinafurcum_UZ300, 21 Pythium_apinafurcum_UZ301, 22 Pythium_apinafurcum_UZ302, 23 Pythium_apinafurcum_UZ303, 24 Phytophthora_cactorum, 25 Pythium_boreale, 26 Pythium_oedichilum, 27 Pythium_helicoides, 28 Pythium_chamaehyphon, 29 Pythium_cucurbitacearum, 30 Pythium_acanthicum, 31 Pythium_oligandrum, 32 Pythium_insidiosum, 33 Pythium_adhaerens, 34 Pythium_monospermum, 35 Pythium_aphanidermatum, 36 Pythium_salpingophorum, 37 Pythium_dissotocum, 38 Pythium_pyrilobum, 39 Pythium_torulosum, 40 Pythium_graminicola, 41 Pythium_inflatum, 42 Pythium_arrhenomanes; TREE Fig._5 = [&R] (42,((36,((32,((((((3,(1,2)),(6,(4,5))),((9,(7,8)),(10,11))),((15,(14,(12,13))),(16,17))),((23,(22,(21,(20,(18,19))))),(24,(29,((25,26),(27,28)))))),(30,31))),(35,(33,34)))),(37,38)),(41,(39,40))); END;