#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 22:54 GMT TreeBASE (cc) 1994-2008 Study reference: Brokaw J., & Hufford L. 2010. Origins and introgression of polyploid species in Mentzelia section Trachyphytum (Loasaceae). American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10226] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=92; TAXLABELS Mentzelia_affinis_B211 Mentzelia_affinis_B423 Mentzelia_affinis_B467 Mentzelia_albicaulis_B337 Mentzelia_albicaulis_F4427 Mentzelia_albicaulis_H3243 Mentzelia_albicaulis_M2345 Mentzelia_arizonica_B424 Mentzelia_arizonica_B426 Mentzelia_arizonica_B431 Mentzelia_arizonica_F4542 Mentzelia_arizonica_T3038 Mentzelia_aspera_H4022 Mentzelia_californica_B056 Mentzelia_californica_B189 Mentzelia_californica_B476 Mentzelia_congesta_B084 Mentzelia_congesta_B285 Mentzelia_congesta_T1659 Mentzelia_crocea_B093 Mentzelia_crocea_B246 Mentzelia_crocea_B259 Mentzelia_desertorum_B061 Mentzelia_desertorum_B441 Mentzelia_desertorum_G91_85 Mentzelia_desertorum_T3014 Mentzelia_desertorum_Z2675 Mentzelia_dispersa_B096 Mentzelia_dispersa_B104 Mentzelia_eremophila_B049 Mentzelia_eremophila_B496 Mentzelia_eremophila_P1959 Mentzelia_goodrichii_H4144_1 Mentzelia_gracilenta_B069 Mentzelia_gracilenta_B214 Mentzelia_gracilenta_B215 Mentzelia_involucrata_H_M_sn Mentzelia_jonesii_B063 Mentzelia_jonesii_B193 Mentzelia_jonesii_B413 Mentzelia_jonesii_B433 Mentzelia_jonesii_B509 Mentzelia_laevicaulis_Hi21852 Mentzelia_lindleyi_B087 Mentzelia_lindleyi_B090 Mentzelia_lindleyi_B216 Mentzelia_micrantha_B260 Mentzelia_micrantha_B266 Mentzelia_mojavensis_B055 Mentzelia_mojavensis_B479 Mentzelia_mojavensis_P1935 Mentzelia_mojavensis_Z2520 Mentzelia_mollis_B235 Mentzelia_mollis_B236 Mentzelia_mollis_B240 Mentzelia_mollis_B343B Mentzelia_mollis_H4093 Mentzelia_mollis_T7777 Mentzelia_monoensis_B367 Mentzelia_monoensis_B520 Mentzelia_monoensis_Z2640 Mentzelia_montana_B085 Mentzelia_montana_B277 Mentzelia_montana_B370 Mentzelia_montana_B425 Mentzelia_nitens_B075 Mentzelia_nitens_B079 Mentzelia_nitens_B222 Mentzelia_nitens_B242 Mentzelia_nitens_B457 Mentzelia_obscura_B058 Mentzelia_obscura_B397 Mentzelia_obscura_B461 Mentzelia_packardiae_B335 Mentzelia_packardiae_B336 Mentzelia_packardiae_B338a Mentzelia_packardiae_Pa78_214 Mentzelia_pectinata_B053 Mentzelia_pectinata_B204 Mentzelia_pectinata_B213 Mentzelia_ravenii_B197 Mentzelia_ravenii_B507 Mentzelia_ravenii_G_sn Mentzelia_thompsonii_B225 Mentzelia_thompsonii_B234 Mentzelia_thompsonii_B345 Mentzelia_torreyi_H1923 Mentzelia_tricuspis_B065 Mentzelia_veatchiana_B105 Mentzelia_veatchiana_B187 Mentzelia_veatchiana_B210 Mentzelia_veatchiana_B384 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=188; TAXLABELS Mentzelia_affinis_B201 Mentzelia_affinis_B203 Mentzelia_affinis_B211_1 Mentzelia_affinis_B211_2 Mentzelia_affinis_B211_3 Mentzelia_affinis_B211_4 Mentzelia_affinis_B423 Mentzelia_affinis_B467_1 Mentzelia_affinis_B467_2 Mentzelia_albicaulis_B191B_1 Mentzelia_albicaulis_B191B_2 Mentzelia_albicaulis_B337_1 Mentzelia_albicaulis_B337_2 Mentzelia_albicaulis_B337_3 Mentzelia_albicaulis_B337_4 Mentzelia_argillosa_H4145 Mentzelia_arizonica_B424_1 Mentzelia_arizonica_B424_2 Mentzelia_arizonica_B424_3 Mentzelia_arizonica_B424_4 Mentzelia_arizonica_B431_1 Mentzelia_arizonica_B431_2 Mentzelia_arizonica_B431_3 Mentzelia_californica_B456_1 Mentzelia_californica_B456_2 Mentzelia_californica_B476_1 Mentzelia_californica_B476_2 Mentzelia_californica_B476_3 Mentzelia_congesta_B084_1_19 Mentzelia_congesta_B084_2 Mentzelia_congesta_B285 Mentzelia_congesta_B356_1 Mentzelia_congesta_B356_2 Mentzelia_congesta_B360_1 Mentzelia_congesta_B360_2 Mentzelia_crocea_B093_1 Mentzelia_crocea_B093_2 Mentzelia_crocea_B093_3 Mentzelia_crocea_B093_4 Mentzelia_crocea_B093_5 Mentzelia_crocea_B246_1 Mentzelia_crocea_B246_2 Mentzelia_crocea_B246_3 Mentzelia_decapetala_H3753 Mentzelia_desertorum_B061_1 Mentzelia_desertorum_B061_2 Mentzelia_desertorum_B061_3 Mentzelia_desertorum_B061_4 Mentzelia_desertorum_B061_5 Mentzelia_desertorum_Glenn91_85 Mentzelia_dispersa_B096_1 Mentzelia_dispersa_B096_2 Mentzelia_dispersa_B104_1 Mentzelia_dispersa_B104_2 Mentzelia_dispersa_B104_3 Mentzelia_dispersa_B104_4 Mentzelia_dispersa_B104_5 Mentzelia_dispersa_B104_6 Mentzelia_dispersa_B362 Mentzelia_dispersa_B388_1 Mentzelia_dispersa_B388_2 Mentzelia_dispersa_B388_3 Mentzelia_eremophila_B049_1 Mentzelia_eremophila_B049_2 Mentzelia_eremophila_B049_3 Mentzelia_eremophila_B049_4 Mentzelia_eremophila_B049_5 Mentzelia_eremophila_B049_6 Mentzelia_eremophila_B049_7 Mentzelia_eremophila_B496_1 Mentzelia_eremophila_B496_2 Mentzelia_eremophila_Provance1959 Mentzelia_goodrichii_H4144 Mentzelia_gracilenta_B069_1 Mentzelia_gracilenta_B069_2 Mentzelia_gracilenta_B069_3 Mentzelia_gracilenta_B214_1 Mentzelia_gracilenta_B214_2 Mentzelia_gracilenta_B214_3 Mentzelia_gracilenta_B214_4 Mentzelia_gracilenta_B215_1 Mentzelia_gracilenta_B215_2 Mentzelia_gracilenta_B215_3 Mentzelia_gracilenta_B215_4 Mentzelia_jonesii_B063_1 Mentzelia_jonesii_B063_2 Mentzelia_jonesii_B063_3 Mentzelia_jonesii_B193_1 Mentzelia_jonesii_B193_2 Mentzelia_jonesii_B193_3 Mentzelia_jonesii_B433 Mentzelia_lindleyi_B087_1 Mentzelia_lindleyi_B087_2 Mentzelia_lindleyi_B087_3 Mentzelia_lindleyi_B087_4 Mentzelia_lindleyi_B087_5 Mentzelia_lindleyi_B090_1 Mentzelia_lindleyi_B090_2 Mentzelia_lindleyi_B216_1 Mentzelia_lindleyi_B216_2 Mentzelia_lindleyi_B216_3 Mentzelia_lindleyi_B216_4 Mentzelia_memorabilis_H4153 Mentzelia_micrantha_B260_1 Mentzelia_micrantha_B260_2 Mentzelia_micrantha_B260_3 Mentzelia_micrantha_B266 Mentzelia_mojavensis_B479_1 Mentzelia_mojavensis_B479_2 Mentzelia_mollis_B235_1 Mentzelia_mollis_B235_2 Mentzelia_mollis_B235_3 Mentzelia_mollis_B235_4 Mentzelia_mollis_B236_1 Mentzelia_mollis_B236_2 Mentzelia_mollis_B236_3 Mentzelia_mollis_B236_4 Mentzelia_mollis_B236_5 Mentzelia_mollis_B343B Mentzelia_mollis_Tiehm7777 Mentzelia_monoensis_B367_1 Mentzelia_monoensis_B367_2 Mentzelia_monoensis_B367_3 Mentzelia_monoensis_B520_1 Mentzelia_monoensis_B520_2 Mentzelia_monoensis_B520_3 Mentzelia_monoensis_B520_4 Mentzelia_monoensis_B520_5 Mentzelia_montana_B085_1 Mentzelia_montana_B085_2 Mentzelia_montana_B095_1 Mentzelia_montana_B095_2 Mentzelia_montana_B277 Mentzelia_montana_B370_1 Mentzelia_montana_B370_2 Mentzelia_montana_B370_3 Mentzelia_montana_B425_1 Mentzelia_montana_B425_2 Mentzelia_multicaulis_H4137 Mentzelia_multicaulis_H4258 Mentzelia_nitens_B079_1 Mentzelia_nitens_B079_2 Mentzelia_nitens_B079_3 Mentzelia_nitens_B079_4 Mentzelia_nitens_B242_1 Mentzelia_nitens_B242_2 Mentzelia_obscura_B052_1 Mentzelia_obscura_B052_2 Mentzelia_obscura_B052_3 Mentzelia_obscura_B058_1 Mentzelia_obscura_B058_2 Mentzelia_obscura_B058_3 Mentzelia_packardiae_B239_1 Mentzelia_packardiae_B239_2 Mentzelia_packardiae_B239_3 Mentzelia_packardiae_B239_4 Mentzelia_packardiae_B304 Mentzelia_packardiae_B335_1 Mentzelia_packardiae_B335_2 Mentzelia_pectinata_B053_1 Mentzelia_pectinata_B053_2 Mentzelia_pectinata_B204 Mentzelia_pectinata_B213_1 Mentzelia_pectinata_B213_2 Mentzelia_pectinata_B213_3 Mentzelia_ravenii_B197_1 Mentzelia_ravenii_B197_2 Mentzelia_ravenii_B507_1 Mentzelia_ravenii_B507_2 Mentzelia_strictissima Mentzelia_thompsonii_B225 Mentzelia_thompsonii_B234_1 Mentzelia_thompsonii_B234_2 Mentzelia_thompsonii_B345 Mentzelia_tiehmii_H4157 Mentzelia_tricuspis_H553 Mentzelia_veatchiana_B105_1 Mentzelia_veatchiana_B105_2 Mentzelia_veatchiana_B105_3 Mentzelia_veatchiana_B105_4 Mentzelia_veatchiana_B105_5 Mentzelia_veatchiana_B187_1 Mentzelia_veatchiana_B187_2 Mentzelia_veatchiana_B187_3 Mentzelia_veatchiana_B210_1 Mentzelia_veatchiana_B210_2 Mentzelia_veatchiana_B210_3 Mentzelia_veatchiana_B210_4 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4802] TITLE Figure_1_Plastid; LINK TAXA = Taxa1; DIMENSIONS NCHAR=5181; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4210 4220 4230 4240 4250 4260 4270 4280 4290 4300 4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 4410 4420 4430 4440 4450 4460 4470 4480 4490 4500 4510 4520 4530 4540 4550 4560 4570 4580 4590 4600 4610 4620 4630 4640 4650 4660 4670 4680 4690 4700 4710 4720 4730 4740 4750 4760 4770 4780 4790 4800 4810 4820 4830 4840 4850 4860 4870 4880 4890 4900 4910 4920 4930 4940 4950 4960 4970 4980 4990 5000 5010 5020 5030 5040 5050 5060 5070 5080 5090 5100 5110 5120 5130 5140 5150 5160 5170 5180 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Mentzelia_affinis_B211 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTCTTTTACTTA-------CCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTACCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAAGTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT----------------------------------AATAGAATAATAAAATAAAGAAAAAAAAA--TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTACAAAATATAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATCAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-ATTTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCA------CTTTTTGGGTAGGAGGAAAAGAACAAGAAGGGGTGGATAGAACCCCT-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTCTTTTT----------------------------------------------------------------------------------------------------------GGGGACGTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACGTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATGGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATTAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATCATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTCATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATAAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAAACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAAAAAATG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAGAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAAATCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAATAAAAAATGAATATTTAGTAAGATATTTATGAAGATAGAG-AACTAAAAATTGTAATTATGAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAACTAACGAGTTCATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGAAAG---GG-GTATGATATCTAT-CATTACTTTGTCTAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTCCGATGGATTTAATTACATTTAAATTAAATTTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTA--------------------------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTTT-ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_affinis_B423 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTCTTTTACTTA-------CCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTACCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAAGTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT----------------------------------AATAGAATAATAAAATAAAGAAAAAAAAA--TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTACAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT--TTTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCA------CTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCT-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTCTTTTT----------------------------------------------------------------------------------------------------------GGGGACGTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACGTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATGGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATTTAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATCATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTCATTTTT-CTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATAAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAAACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAAAAAATG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAGAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTTTTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAAATCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAATAAAAAATGAATATTTAGTAAGATATTTATGAAGATAGAG-AACTAAAAATTGTAATTATGAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAACTAACGAGTTCATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGAAAG---GG-GTATGATATCTAT-CATTACTTTGTCTAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTCCGATGGATTTAATTACATTTAAATTAAATTTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTA--------------------------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_affinis_B467 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTCTTTTACTTA-------CCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTTTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTACCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAAGTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT----------------------------------AATAGAATAATAAAATAAAGAAAAAAAAA--TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTACAAAATATAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT--------------------------------------CA------CTTTTTGGGTAGGAGGAAAAGAACAAGAAGGGGTGGATAGAACCCCT-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCCCTCTAATTTTTTGATTTTCGTTCTTTTT----------------------------------------------------------------------------------------------------------GGGGACGTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACGTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGG-----------------------------------------------ATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATGGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATTAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATCATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTCATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATAAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAAACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAAAAAATG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAGAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAAATCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAATAAAAAATGAATATTTAGTAAGATATTTATGAAGATAGAG-AACTAAAAATTGTAATTATGAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAACTAACGAGTTCATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGAAAG---GG-GTATGATATCTAT-CATTACTTTGTCTAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTCCGATGGATTTAATTACATTTAAATTAAATTTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTA--------------------------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTTT-ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_albicaulis_B337 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT------ATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_albicaulis_F4427 TGGATAAGACTTTGGTCT-TAGTGTATATGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTATACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_albicaulis_H3243 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT------ATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_albicaulis_M2345 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_arizonica_B424 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT------------------------------------------------------GTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT--TTCTTTTAAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAA----------------AAGGGT--------------------AAAGAAAAGCTCTTTGGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATTAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTAAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTTAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGAACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_arizonica_B426 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAAGAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATATAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TAATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCGACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTATACCTATTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAAGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAATCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACCAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCTTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATTTTTAGTACTTCTATTCATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAATCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCTTATGAAGGGAATATTATCTAGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_arizonica_B431 -----------------T-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTATTATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATA---TGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_arizonica_F4542 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTCGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT--------------------------------------------------------------TAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_arizonica_T3038 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_aspera_H4022 TGGATAAGACTTTCGTCT-TAGTGAATACGAGGTCCTG------AAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTCTTTTACTTAA------ACTTACATATACCCTTTT-----TCTTTTTACAGAAAAAAG----AAAAAAAAGATTCTTATGGTTTAGTTGATGATTGAGTATCGTACTTT------------CGTTCTGTATTAATTTGTAATTTATACACC-----TTTTCCCGAATCTTTTCTATTGTAA-TTTTTTGCCTAATATTTGTATTTCACA------------------AATAAGATAAAAAAGAAATAATAA--------TGAAATGAATGGTTAAAATTGAATCTTTTCTAATCTAA-----------------GAAAAGAAGAGGAAAATAGTAGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTC--TTTATCTTTATTC-TATAGATAT--------------------------------------------------------------------ATAGAACTTTTATCAGTAATCCCATTTCGATAAAGTAAGGGCTCTAAAAATCG----AATA---T--------------------CTAATATAATAA-----TAAAGTAAAAAAAAAATACCGAAAAATAAAAAAAAAGAAGACCTCC-TTGCTTTGATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCC-TTTTTTGTTTCAACGAATCATAGA-----AAAAATGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAA-GGACTATTTCCATTTTTATT------ATATAAAA---------------------------TTCTTCTTTTTTCCTTTTT-ACTTTACTGAAATAAAATTACTGAAATAAAACGGAAATTGAAATAAAGAGAAAAAA----CGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTAGTTATTGAAATGAACCCTCTTTTCCTAATCCTCATTACGTCC-TCCCATGAAAAAAAAAGGCTAAGACTCTAATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAGGT-A-ATGAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTGGGGTAGGAGGAAAAGAA-----GGGGGTGGATAGAACCACT-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTTCACCATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTCATACGCAATATGTCCACACATATAATAT-ATGATATATA-------------TGCCTGGATCCTA-----------------------------TTTGTTTTTTGCAGTGTCAGGCCAGAGATTCTTTTCGGGGTGATTGCAA----TTATGTTATTAATTTTTTTT-CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTTATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTGAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGTATCTGAGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGGAAAGCAATAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCATGTAGGGATTTTACCATGAATCTATTAATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGGGTCGAGGGGAATGGAATTCAGTTTTTTACTTCACAAATGGGTATGCTGGATCATGCATCTATCTATATATATGGATAGATAGATCAACCTATAGATTCACGCCT------------------GAGATCTTTCTACAGATAAGATAGTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTAGAAAAAGGGAATTTGTTTATCCTGAGAATAATCGGAATCAACTTGACTCAAAAAATTGGTGAATTTCATTTCGAATTCGAATATTGAATTTTTAATATATAAAA--------TGAATAGAAAATTCATATTAATGTAATGAATAATTTCTATT-----ACCTA----TTGTTTTGGACTAATCAATATGAAATGGAACCCATCTCGTTCTTCTGATATGTAGAATA-CAAATTTTTCTGTTTACTGAATTCT------AAAAAGAATACAATCCTTT--TTGTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATCATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCACTTGTCACAATAAGAAAAGTTCTTCTTTTTTCTATATCTCGAG----------------AAGAGC--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATGAATGAGTCATTGAAACAAATTAAGTTTCAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATT-----A--------CTATATAGATTCCCTATGTACCTCGCGCTTTAAACCCAATCG-----ATAAAACAGAATATTTTTTTGTACGAAAAATGTGTCTGTCACTTTGGAGTGATTCAAAATAGATCCTAT-TTTGT---------------GTTCATTAATAAAATGCATTTTTTGTTTCAGATTTCTGAAATCAGATAAATGAAAAATGAATCATTCAAAAA----TG-AAAATGAGAAAAGACATTTTCTTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCAGGAGAGCATAAACTACGCGAAAATCTTAAA--TAAAACCGACACCCTAAACTCAAATACTGAACCTTCAAACCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-AATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT----------TTAATGAATTGTTTACGATTCGTCGGATCTGACCTCTTTTGAAAGGAGTCAATAAAAAAA--TGAAGATATGTACT----AAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCAAAAATACTTCAAATATTCAAATCAAGAAATTACAAATATTCAAATCAAGAAATTACAATTGGTCAAATGGTATGATCAAATTGCTAGTAAAAGGTGAATATTTAGTAAGATATTTATGAAGATAGAGAAAATTAAAATTGTAATTATTAGTACAATAATT---------TCTAGCCATAGAACAAGGATAAAGAATTACACCAAAACCGGTACTTTATTCTGATATCAATCATA-G-GAATAGAATAAAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACTAGTTCATTAT-GGAATT-GATTGATTGTTTTCCATTCCAATAAACTAAATTG-------CTGTTTATAGCAAG---GG-CTATAATATCTAT-CATTACTTTGTATAAGTATAAAACGAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAAAATTATTCAAAAA------TTACTACAGTATCTTTTATCATGTCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTCAAACAAATGAGTCCTACTCTTGCCTCGAGCTTGACCAATTAATAGTAAAGTTTTTTCATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGAGTTTATTACATTTAAATTCACTGTAGAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTTTGGATTTTTGATTTTCTCAATTTCATTTCTATGA-TATGATATATCGGATTCTATAGATATAGATTTGAATGAGAAAGAATGAGAAATAAA-----GGGACCAATCAGTAGAAATTATTCTTTCCTCTAGATATTGTA-------------------------------------------TGGAATAGAAAAAC-CATTTTTTTTTG--AAAAAATCACATAATCATATATCATATTCTTTTTTT--ATATTTAGCGATTTTTACATATCTTATTTTTTT---ATGAAGGGAATATTATCT-------------------AGAGAATAACTAGTATAGATAATG------------------------------------ACTAGT------AAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_californica_B056 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-----------TATGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_californica_B189 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAAGAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TAATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-------------------------------TAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCCCTCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCGACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACCAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATTCTTAGTACTTCTATTCATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAATCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_californica_B476 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGTTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_congesta_B084 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATAGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACACAATATGTCCACACATATAATATTAT-ATATATA-----------TATGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAA?-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TGAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTACGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_congesta_B285 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_congesta_T1659 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT---------------------------------------------------------------------------------------------------------------------------------------------CCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTTTTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATG-------------------------------------------------------- Mentzelia_crocea_B093 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGTCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATTACATTACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGAGAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGATAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTTATCATTTATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTT-------------------AACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTGCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTATCTATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGA-TAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_crocea_B246 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-ATTTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTTGGGGACTTATAAAGTTTGACCCCCCCTCTAATTTTTTGATTTTATTTATTTTT-----------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTTAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAA----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTATTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATGACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_crocea_B259 -----------------T-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAAATAAAGGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTCCATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_desertorum_B061 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ACTTTTTATTTTACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGGAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGAGAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAAAA-TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTATTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AACTAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATA---------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCAAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TTTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCATACCTGACTATAGATTCATACCTGAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAGAAGGGT------AAATAAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTGGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT------GTTCATTAAGTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAA--TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCCAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTGTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAACTGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTT-ATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAAACAATTAGTTTTC--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT---------AATATTATCTAGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAACGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_desertorum_B441 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ACTTTTTATTTTACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGGAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGAGAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAAAA-TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTATTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCAATTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AACTAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATA---------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCAAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TTTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCATACCTGACTATAGATTCATACCTGAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTT-GGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAGAAGGGTAAAGGTAAATAAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTGGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT------GTTCATTAAGTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT------ATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAA--TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCCAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTGTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAACTGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTT-ATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAAACAATTAGTTTTC--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT---------AATATTATCTAGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAACGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_desertorum_G91_85 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ACTTTTTATTTTACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGGAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGAGAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAAAA-TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTATTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCAATTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AACTAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATA---------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCAAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TTTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCATACCTGACTATAGATTCATACCTGAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATACTTAGGAGCA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAGAAGGGTAAAGGTAAATAAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTGGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT------GTTCATTAAGTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT------ATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAA--TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCCAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTGTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAACTGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTT-ATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAAACAATTAGTTTTC--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT---------AATATTATCTAGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAACGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_desertorum_T3014 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ACTTTTTATTTTACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGGAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGAGAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAAAA-TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTATTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAGAAGGGT------AAATAAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTGGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT------GTTCATTAAGTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT-------------------------------------------------------------------------------ATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCCAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTGTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAACTGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTT-ATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAAACAATTAGTTTTC--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT---------AATATTATCTAGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAACGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_desertorum_Z2675 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ACTTTTTATTTTACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGGAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGAGAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAAAA-TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTATTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAGAAGGGT------AAATAAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTGGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT------GTTCATTAAGTTCATTAATAAAATGCATTTTTGATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAA--TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCCAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTGTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAACTGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTT-ATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAAACAATTAGTTTTC--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT---------AATATTATCTAGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAACGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_dispersa_B096 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTCTTTTACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG------------AAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGAGAAAAGTCTTTCTCTCTC--TTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTT-----------ATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT----------------------------------AATAGAATAATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTT-----ATCTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAAAGAAAGGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-ATTTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCT-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCCCACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAAAGAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTAG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATCATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATTG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGGCTGTCACTTTGGGTTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAAAATAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATACCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT---------CTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAAATCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGAATATTTAGTAAGATATTTATGAAGATAGAG-AACTTACAATTGTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTCATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------GTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGCCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTA--------------------------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGT------AAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_dispersa_B104 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTCTTTTACTTA-------CCTTACATATACC----------TT-TTTTACAG------------AAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGAGAAAAGTCTTTCTCTCTC--TTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTT-----------ATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT----------------------------------AATAGAATAATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTT-----ATCTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-ATTTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTATGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCTT-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTG---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAAATTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAAAGAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATCATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATTG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGTTGATTCAAACTAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAA---------------------------TGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAAAATAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATACCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT------ATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAAATCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGAATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTGTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTCATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------GTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGCCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAA---------TGGATTTGATTACATTGAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTA--------------------------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_eremophila_B049 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG------------AAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAAGAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TAATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCGACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGGATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACCAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAATATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATTCTTAGTACTTCTATTCATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAATCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_eremophila_B496 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAAGAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TAATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGCCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCGACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAAGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACCAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGAGCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGA?ATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATTCTTAGTACTTCTATTCATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAATCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTT-AAATGGCAGT-CCAAAAAAACG Mentzelia_eremophila_P1959 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTTATTTTATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-ATTTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTTGGGGACTTATAAAGTTTGACCCCCCCTCTAATTTTTTGATTTTATTTATTTTT-----------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTTAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATA{AT}AA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAA----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTATTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_goodrichii_H4144_1 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTG------AAAGTAAAGGAGCAATAACCAATCTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTCTTTTACTTA-------CCTAACATATACT----------TT-TTTTACAGAAAAA-T-----AAAAAAGGATTCTTATGGCTTACGTAATGATTGAGTATCTTACTTT------------CCCTCTGTATTAATTTTTTATTTATATACCATACCTTTTCCCGAATCTTTTCTATTGTAAATTTTTT-CCTAATATTAGTATTTCACA------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTTAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTAGAGGGGCGGATGTAGCCAGGAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTATCTTTATTCTTATAGATAT--------------------------------------------------------------------ATATAACTTTTATCAGTAATCCCATTTCGATAAAGTAAGGGCTCTAAAAATCT----AATAAAATCTAATAGAATAATAAAATAACTAATAGAATAATAAAATAAAGAAAAAAAAA--TAACGAAAAATAAAAATAAAGAAGACCCCC-TTGCTTTGATTTT-----TTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCC-TTTTTTGTTTCAACGAATCATAGA-----TAAAATGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTTTTATTATATAAATATAAAATCTATAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTG-ACTTTACTGAAA-------------------------TTGAAATAAAGAGAAAAAA----GGAAACTATGGATGCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTAGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CTCATGAAATA----GGCTAAGACTCTAATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAGGT-ATTTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTGGGGTAGGAGGAAAAGAA------GGGGTGGATAGAACCACT-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTA---------AAATAAATTACTTCACCATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATAT-ATGATATATA-------------TGCCTATAATATATGATATATATGATATATGCCTGGATCATATTTGTTTTGTGCAGTGTCAGGCCAGAGATTATCTTCGGGGTGATTCCAA----TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTTATTTTCTTTATTTTG----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAATAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTAATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCACAAATGGGCATGCTGGATCATGCATCTATCTATATATACGGATAGATAGATCCACCTATAGATTCACACTT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCCAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATA------AAA--GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTAG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTGAATATAGAAAATGTAAAAATGAATATAAAA------TTAATGTAATGAATAATTTCTATT-----ACCTA--TTTTGTTTTGGACTAATCAATATGAAATGGAACCCGTCTCGCTCTTCTGATATGTAGAATC-AAAATTTTTCTGTTTACTTAATTCTAATTCTAAAAAGAATACAATACTTTGTTTGTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATCATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGAGC--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTA--------CTATATAGACTCCCTATGTACCTCGGGCTTTGAACCCAATCGATTCGATAAAAGGGAATATTTTTTTGTACGAAAACTGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTAT-TTTGT---------------GTTCATTAATAAAATGCATTTTTTGTTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGACATTTTCTTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAAGAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT----------------------TTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAACTTAAAGATAATTTTATATTCTTACTTATTTCTTATTTTGATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAGTGAATATTTAGTAAGATATTTATGAAGATAGAG-AAATGAAAATTGTAATTATTAGTACAACAATT---------TCTATCCATAGAGCAAGGATAAAGAATTACACCAAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGAATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACTAGTTCATTAT-GGAATT-GATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTGTTTATAGCAAG---GA-CTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCTAAAAAATAAAAAAATTAGTAAAAAA------TTACTACAATATCTTTTATCATAGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTA---AAA-TTAGTCCTACTCTTTCCTTGAGCTTGACCAATTAATATTAAAGTTTTTTCATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTAGAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTGATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATGGATATAGATTTGAATGAGAAAAA-TGATAAATAAA-----GGAATCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTA-------------------------------------------TGGAATAGAAAGAAACAATTAGTTTTG--AAAAAATCACATAATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTTT-CTGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGT------AAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTT-AAATGGCAGT-CCAAAAAAACG Mentzelia_gracilenta_B069 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-ATTTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTTGGGGACTTATAAAGTTTGACCCCCCCTCTAATTTTTTGATTTTATTTATTTTT-----------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTTAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAA----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT-------TTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_gracilenta_B214 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAAAAAGGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-------TTTTTATTTTACTTA-CCTTTCCCTTACATATACCTTCATATACCTT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTATTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAACGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTTTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTTGGGGACTTATAAAGTTTGACCCCCCCTCTAATTTTTTGATTTTATTTATTTTT-----------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGCGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAA----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTCAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTT--TTT----TTTATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATTGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_gracilenta_B215 -----------------T-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-----------------------------ATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_involucrata_H_M_sn ------------------------------------TG------AAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTCTTTTACTTA-------CCTAACATATATT----------TT-TTT-ACAGAAAAA-T-----AAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CCTTCTGTATTAATTTTTAATTTATATACCATACCCTTTCCC--------------------------------------------------------------------------------------------------------------------GAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTAGAGGGGCGGATGTAGCCAGGAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTATCTTTATTC-TATAGATAT--------------------------------------------------------------------ATATAACTTTTATCAGTAATCCCATTTCGATAAAGTAAGGGCTCTAAAAATCT----AATAAAAT--------------------CTAATAGAATAATAAAATAAAGAAAAAAAAAAATAACGAAAAATCAAAATAAAGAAGACCCCC-TTGCTTTGATTTT-----TTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCC-TTTTTTGTTTCAACGAATCATAGA-----TAAAATGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------ATATAAAATCTATAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACTGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTAGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTAATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAGGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTGGGGTAGGAGGAAAAGAA------GGGGTGGATAGAACCACT-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTA---------AAATAAATTACTTCACCATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATAT-ATGATATATA-------------TGCCTATAATATATGATATATAT-------GCCTGGATCATATTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAA----TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCGAATTTTTTTATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATAAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAATAATCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCACAAATGGGCATGCTGGATCATGCATCTATCTATATATACGGATAGATAGATCCACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCATTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTAG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTGAATATAGAAAATGAAAAAATGAATATAAAA------TGAATGTAATGAATAATTTCTATT-----ACCTA----TTGTTTTGGACTAATCAATATGAAATGGAACCCGTCTCGCTCTTCTGATATGTAGAATC-AAAATTTTTCTGTTTACTGAATTCTAATTCTAAAAAGAATACAATACTTT-TTTGTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATCATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGAAC--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTGTTTCTTTGAATTGAATTA--------CTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----ATAAAAGGGAATATTTTTTTGTACGAAAAATGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTAT-TTTGT---------------GTTCATTAATAAAATGCATTTTTTGTTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGACATTTTCTTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATGTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAACTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTTAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTACTAAAAAGTGAATATTTAGTAAGATATTTATGAAGATAGAG-AAATTAAAATTGTAATTATTAGTACAACAATT---------TCTATCCATAGAGCAAGGATAAAGAATTACACCAAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGAATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACTAGTTCATTAT-GGAATT-GATTGATTGTTTTCTATTCCAATAAAAGACAGTT-------CTGTTTATAGCAAG---GG-CTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAAAATTATTAAAAA-------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTAGTAGTCTCATTCGAGTTTGAAAATTA---AAA-TTAGTCCTACTCTTTCCTTGAGCTTGACCAATTAATATTAAAGTTTTTTCATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTAGAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTGATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTA-------------------------------------------TGGAATAGAAAAAAACAATTCGTTTTG--AAAAAATCACATAATCATATATCATATTCCTTTTTTTTTTATTTAGCGATTTTTACATATCTTATTTTTTT---ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGT------AAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_jonesii_B063 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ACTTTTTATTTTACTTA-CCTTTACCTTACATATACC----------CT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGGAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAAAAATAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTATTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AACTAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATA---------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCAAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TTTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCATACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAGAAGGGT------AAATAAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTGGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT------GTTCATTAAGTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAA--TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCGTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCCAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTGTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAACTGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTT-ATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT---------AATATTATCTAGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAACGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_jonesii_B193 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ACTTTTTATTTTACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAAAAATAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTATTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAACGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-----------TATGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCAAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TTTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATTATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCATACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------CTAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTGGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT------GTTCATTAAGTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTTTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCCAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAA--TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCCAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTGTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAACTGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTATTGTATAGATATTGTATGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT---------AATATTATCTAGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAACGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_jonesii_B413 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT---------------------------------------------TCTTTTTGGGTAGGAGGAAAAAAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGGCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCCCTCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCGAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGGTCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAAT--------------------------------------------ATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAA----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT---------CTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_jonesii_B433 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGACGGTATTGCTCCTTT-----ACTTTT------ACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTTATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGTCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGAGAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTT-----------ATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT----------------------------------AATAGAATAATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAAAGAAAGGATAACACTTGTTATTTCGTTATTGAAATGAACACTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCTAATTCCCCTGTTCGACAAAAAGC-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCT-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTATCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTGGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATAAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAA-----ATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTCTAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATCATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAATAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAATTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGTAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGTATTTGT---------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCTTTAAAAAA----TG-AAAATGAGAAAAGATAGTTTATTTTTAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCAGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAAATCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATTAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGAATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTATAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTCATTAT-GGAATTTGATTGATTGTTTTCTATTTCAATAAAATACATTT-------ATATTTATAGAAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTT-----------TTCT-------AAAAATATTATTCAAAAATTAAAATTACTACAATATCTTTTATCATGGCATGTATCTTTTAATAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCGTTGAGCTTGGCCAATTAATATTAAAGTGTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTA--------------------------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-CTATTTAGCGATTTTTACATATCTTATTTTTTTTT-ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGAAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTT-AAATGGCAGT-CCAAAAAAACG Mentzelia_jonesii_B509 ---------------------------ACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ACTTTTTATTTTACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------TATAAGATAAGAAAGAAAAAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAAAAATAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGAGTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTATTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-----------TATGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCAAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TTTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATTATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCATACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------CTAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTGGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT------GTTCATTAAGTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCCAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAA--TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCCAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATGAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTGTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTCCATTTAAATTAACTGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTATTGTATAGATATTGTATGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT---------AATATTATCTAGAGAATAACTAG-ATAGATAATGAATAGTATG---------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAACGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_laevicaulis_Hi21852 TGGATAAGACTTTGGTCT-TAGTGTATA-GAGGTCGTG------AAAGTAAAGGAGCAATAACCAATCTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTCTTTTACTTA-------CCTAACATATACT----------TT-TTTTACAGAAAAA-T-----AAAAAAGGATTCTTATGGCTTACTTAATGATTGAGTATCTTACTTTCCTTCTGTATTACCTTCTGTATTAATTTTTAATTTATATACCATACCTTTTCCCGAATCTTTTCTATTGTAAATTTTTT-CCTAATATTAGTATTTCACA------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTTAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTAGAGGGGCGGATGTAGCCAGGAAAGATTGAGAAAAGTCTTTCTCTCTCTCTTTATCTTTATTC-TATAGATAT--------------------------------------------------------------------ATATAACTTTTATCAGTAATCCCATTTCGATAAAGTAAGGGCTCTAAAAATCT----------------------------------AATAGAATAATAAAATAAAGAAAAAAAAA--TAACGAAAAATAAAAATAAAGAAGACCCCC-TTGCTTTGATTTT-----TTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCC-TTTTTTGTTTCAACGAATCATAGA-----TAAAATGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------ATATAAAATCTATAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA-------------------------TTGAAATAAAGAGAAAAAAAAAAGGAAACTATGGATGCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTAGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTAATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAGGT---------------------------------------------------GGGGTAGGAGGAAAAGAA------GGGGTGGATAGAACCACT-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTA---------AAATAAATTACTTCACCATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATAT-ATGATATATA-------------TGCCTATAATATATGATATATATGATATATGCCTGGATCATATTTGTTTTGTGCAGTGTCAGGCCAGAGATTATCTTCGGGGTGATTCCAA----TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCCCTCTAATTTTTTTATTTTCTTTATTTTG----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAATAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTAATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCACAAATGGGCATGCTGGATCATGCATCTATCTATATATACGGATAGATAGATCCACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCCAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATA-TTTGGAAAA-G-AGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACA-----------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTGAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATAATTTCTATT-----ACCTA--TTTTGTTTTGGACTAATCAATATGAAATGGAACCCGTCTCGCTCTTCTGATATGTAGAATC-AAAATTTTTCTGTTTACTGAATTCTAATTCTAAAAAGAATACAATACTTTGTTTGTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATCATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGAGC--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTA--------CTATATAGACTCCCTATGTACCTCGGGCTTTGAACCCAATCGATTCGATAAAAGGGAATATTTTTTTGTACGAAAACTGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTAT-TTTGT---------------GTTCATTAATAAAATGCATTTTTTGTTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGACATTTTCTTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAAGAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTAAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT--TTTTATTCTT-ATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAA--TCAAGATATGCACTAACTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAGTGAATATTTAGTAAGATATTTATGAAGATAGAG-AAATGAAAATTGTAATTATTAGTACAACAATT---------TCTATCCATAGAGCAAGGATAAAGAATTACACCAAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGAATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACTAGTTCATTAT-GGAATT-GATTGATTGTTTTCTATTCCAATAAAATACATTG-------CTGTTTATAGCAAG---GA-CTATGATATTTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAAAATTAGTAAAAAA------TTACTACAATATCTTTTATCATAGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---AAA-TTAGTCCTACTCTTTCCTTGAGCTTGACCAATTAATATTAAAGTTTTTTCATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTAGAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTGATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATGGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGAACCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTA-------------------------------------------TGGAATAGAAAGAAACAATTAGTTTTG--AAAAAATCACATAATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--CTGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGT------AAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_lindleyi_B087 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAGCCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TAATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACCAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCGAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAACTTTCTTTTGTATAAGTATAAAACTAACTTTCTTTTTTATTT-------ATAT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAATCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGAACAACGACGAAAATAGACAGACATAGAAATAGAGGCTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGT------AAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_lindleyi_B090 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAGCCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TAATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACCAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCGAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAACTTTCTTTTGTATAAGTATAAAACTAACTTTCTTTTTTATTT-------ATAT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAATCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGAACAACGACGAAAATAGACAGACATAGAAATAGAGGCTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGT------AAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_lindleyi_B216 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-ATTTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTTGGGGACTTATAAAGTTTGACCCCCCCTCTAATTTTTTGATTTTATTTATTTTT-----------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTTAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAA----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTATTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_micrantha_B260 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTCTTTTACTTA-CCTTTACCTTACATATACC----------TT-TTTGACAG------------AAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA-----------------TCTAAGAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT----------------------------------AATAGAATAATAAAATAAAGAAAAAAA----TAACGAAAAAGAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAAAGAAAGGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-ATTTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCT-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAATAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAATCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATCATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTCAATTATTATATAAACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAAATCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGAATATTTAGTAAGATATTTATGAAGATAGAG-AACTAAAAATTGTAATTCTTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTCATTAT-GGAATTTTATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTCTTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCGTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGATTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTA--------------------------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTTTTATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATTATAGATAGATAATT----------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_micrantha_B266 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTCTTTTACTTA-CCTTTACCTTACATATACC----------TT-TTTGACAG------------AAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA-----------------TCTAAGAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT----------------------------------AATAGAATAATAAAATAAAGAAAAAAA----TAACGAAAAAGAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAAAGAAAGGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-ATTTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCT-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAACAAGAGTCATGCTTCTAATCCTCCAAGCTACCAATAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAACTCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAATCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATCATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTCAATTATTATATAAACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAAATCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGAATATTTAGTAAGATATTTATGAAGATAGAG-AACTAAAAATTGTAATTCTTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTCATTAT-GGAATTTTATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTA--------------------------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTTT-ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATTATAGATAGATAATT----------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_mojavensis_B055 TGGATAAGACTTTGGTCT-TAGTGGATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_mojavensis_B479 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-----------TATGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_mojavensis_P1935 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAA---------------------------------------------TTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_mojavensis_Z2520 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCT?GTTCTATCAAGAGGGCGGTAT?GCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-----------TATGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_mollis_B235 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATCGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------TATATATGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTGAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTCAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT---------CTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCAAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAATATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTT---ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGT------AAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_mollis_B236 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTTTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGTCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAA-------------------------GTAAAGATTTATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCG------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCCTTTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATGATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAACAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCGAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA--TGCCTTATATATGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATAATAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCCCTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTTAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTAGAATTCTAAAAAGAATACAATACTTT--TTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTT-ATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATTTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTGAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TGACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATGAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGATGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAATACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAA-CAATTAGTTTTG--AAAAAATCACATGCTCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTTT-ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_mollis_B240 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTCTTTTACTTA-CCTTTACCTTACATATACCTTTTTT----TT-TTTTACAG-----------AAAAAAAGGATTTTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGTCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTTATAAAAGTCTTTTTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCG------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCCTTTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATGATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAACAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCGAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA--TGCCT?ATATATGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATAATAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCCCTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTTAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTAGAATTCTAAAAAGAATACAATACTTT--TTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT------ATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTGAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATGAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGATGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAA-CAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTTT-ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_mollis_B343B TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTTATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------GAAAACGGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATTAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGATGGATAGAACCCCT-ACACTATCACGGTCAACTATACCGCGTGCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGAAACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCAGA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTTATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATCTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTTATTTAGTATATTTTATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTTGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTCAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCCTAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTT-ATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTGGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGAATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATATGTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTTTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCAATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTTTATGATTATGATATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_mollis_H4093 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTCTTTTACTTA-CCTTTACCTTACATATACCTTTTT-----TT-TTTTACAG-----------AAAAAAAGGATTTTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGTCTACTATTAGTATTTCACTA-----------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTTATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCG------------------------------------------AATAAAATAAAGAAAAAAAAA--TAACGAAAAATAAAAAGAAAGAAGACCCCCTTTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATGATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAACAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCGAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAA-------------------------------------------------------GTGGATAGAACCCCGCACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTATTATATATA--TGCCTTA-ATATGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATAATAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGAGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATATATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCCCTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTTAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTAGAATTCTAAAAAGAATACAATACTTT--TTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------AAAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT------ATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATTTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTGAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAAGCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TGACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATGAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGATGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAATACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAA-CAATTAGTTTTG--AAAAAATCACATGCTCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTTT-ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_mollis_T7777 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTTATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------GAAAACGGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATTAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGATGGATAGAACCCCT-ACACTATCACGGTCAACTATACCGCGTGCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGAAACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCAGA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTTATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATCTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTTATTTAGTATATTTTATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTTGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTCAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCCTAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTT-ATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTGGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGAATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATATGTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTTTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCAATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTTTATGATTATGATATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_monoensis_B367 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTAGTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA----------ATATGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTGATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_monoensis_B520 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA----------ATATGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTGATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_monoensis_Z2640 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTAGTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA----------ATATGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTGATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_montana_B085 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTC--TTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_montana_B277 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_montana_B370 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_montana_B425 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATT--------ATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGATAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_nitens_B075 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAAGAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TAATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTGTTCGTTAGGGAAATCTCTTTCGACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAAGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACCAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TAT--------------------------------------TTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATTCTTAGTACTTCTATTCATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAATCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-TGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGAGAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCTTATGAAGGGAATATTATCTAGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_nitens_B079 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAAGAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TAATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGTAA-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCGACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAAGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACCAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATTCTTAGTACTTCTATTCATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTTATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAATCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCTTATGAAGGGAATATTATCTAGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_nitens_B222 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAAGAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TAATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCGACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAAGTTTTACCTTTCTTTTTAGTATATTTT--------------CTAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACCAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT---------CTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATTCTTAGTACTTCTATTCATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAATCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCTTATGAAGGGAATATTATCTAGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_nitens_B242 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTTATTTTATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-ATTTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTTGGGGACTTATAAAGTTTGACCCCCCCTCTAATTTTTTGATTTTATTTATTTTTGGGGACTTATAAAGTTTGACCCCCCCTCTAATTTTTTGATTTTATTTATTTTTGGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTTAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAA----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTATTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_nitens_B457 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTTCTG-----------TAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGGTAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TAATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGAAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCGACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACTTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACCAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATTCTTAGTACTTCTATTCATAGAGCAAGAATAAAGAATTACACCCAAACCGGGACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAATCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGATTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-CTATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_obscura_B058 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ACTTTTTATTTTACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGGAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGAGAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAAAA-TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTATTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGTGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AACTAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATA---------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCAAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TTTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCATACCTGACTATAGATTCATACCTGAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAGAAGGGT------AAATAAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTGGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT------GTTCATTAAGTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAA--TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCCAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTGTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAACTGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTT-ATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAAACAATTAGTTTTC--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT---------AATATTATCTAGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAACGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_obscura_B397 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ACTTTTTATTTTACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGGAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGAGAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAAAA-TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTATTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGTGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AACTAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATA---------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCAAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TTTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCATACCTGACTATAGATTCATACCTGAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAGAAGGGT------AAATAAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTGGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT------GTTCATTAAGTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAA--TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCCAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTGTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAACTGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTT-ATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAAACAATTAGTTTTC--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT---------AATATTATCTAGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAACGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_obscura_B461 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ACTTTTTATTTTACTTA-CCTTTACCTTACATATACC----------CT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGGAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAAAAATAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTATTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AACTAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATA---------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCAAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TTTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCATACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTGAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAGAAGGGT------AAATAAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTGGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT------GTTCATTAAGTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAA--TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCGTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCCAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTGTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAACTGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTT-ATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT---------AATATTATCTAGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAACGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_packardiae_B335 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTAAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATGTAGTTACAACAGTTCAATTCACGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGATAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTT---ATGAAGGGAATATTATCT-------------------AGAGAATATCTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_packardiae_B336 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGCCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAACCAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGTAA-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTTTTTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTAGATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTCATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_packardiae_B338a TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAACCAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTTTTTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTCATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_packardiae_Pa78_214 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAACCAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTTTTTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTAGATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTCATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_pectinata_B053 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTTGGGGACTTATAAAGTTTGACCCCCCCTCTAATTTTTTGATTTTATTTATTTTT-----------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTTAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAA----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATTCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTATTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_pectinata_B204 ----------------------------CGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATATTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATA---------------------GTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-ATTTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTTTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTAGTGAATTA{GT}AATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAA----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAC-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTAATTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTAAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_pectinata_B213 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGTGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-ATTTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTTGGGGACTTATAAAGTTTGACCCCCCCTCTAATTTTTTGATTTTATTTATTTTT-----------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTTAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAA----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTATTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_ravenii_B197 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG------------AAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAA----TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGTTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_ravenii_B507 ----------------------------CGAGGTCGTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ACTTTTTATTTTACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT-ACTATTAGTATTTCACTTATAAGATAAGAAAGAAAAAATAA-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATA---------------------GTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAAAA-TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGAGTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTATTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-----------TATGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCAAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TTTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATTATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCATACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------CTAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTGGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT------GTTCATTAAGTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCCAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAA--TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCCAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTGTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTT-------------------GGATTCTTAAACTTTGCGATGGATTTGATTCCATTTAAATTAACTGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT---------AATATTATCTAGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAACGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_ravenii_G_sn TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT------------------------------------------------------------------------------------CTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_thompsonii_B225 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCTTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGTTATTGCTCCTTT-----ATTTTTACTTTGACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG------------AAAAAAGGATTCTTATGGCTTAATTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCA------TTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAG-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCAAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGATATATATAATTCTATAGATATATATAATTCTATAGATATATATAATTCTATAGATAT--------------ATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---T------AAAGAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTG-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAAAGAAAGGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCT-ACACTATCACGGGCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTGAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTACTTTGAATCTATTGATTCTATATAACTTATTACTACTTTTTTACCACTTTATTCGTACATGGAATCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAAAGAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTATTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTCAATTATTCTATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCGATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAAATCAAGATATGCACTAAGTTAAAGATAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTCTGACCAAATTGCTAGTAAAAAATGAATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------TTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTCTCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGGTAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTTAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTTT-ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTGGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGTTCCAAAAAAACG Mentzelia_thompsonii_B234 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCTTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGTTATTGCTCCTTT-----ATTTTTACTTTGACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAATTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCA------TTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAG-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCAAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGATATATATAATTCTATAGATAT--------------------------------------------------ATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAAGAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTG-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAAAGAAAGGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGTAA-ATTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCT-ACACTATCACGGGCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTGAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTACTTTGAATCTATTGATTCTATATAACTTATTACTACTTTTTTACCACTTTATTCGTACATGGAATCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTT?GGAGAG?TGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTATTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTCAATTATTCTATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAAATCAAGATATGCGCTAAGTTAAAGATAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGAATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------TTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTCTCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCTAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTTAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-CTATTTAGCGATTTTTACATATCTTATTCTTTTTT-ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTGGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_thompsonii_B345 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCTTGAAAGTAAAAGTAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGTTATTGCTCCTTT-----ATTTTTACTTTGACTTA-CCTTTACCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAATTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCA------TTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAG-------------TGAATGGTAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCAAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCCTTTATTC-TATAGATATATATAATTCTATAGATATATATAATTCTATAGATATATAGAATTCTATAGATAT--------------ATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---T------AAAGAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTT-----GTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAAA---GGAAACTATGGATTCTTACACAATGCATTTTG-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAAAGAAAGGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCT-ACACTATCACGGGCAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTGAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTACTTTGAATCTATTGATTCTATATAACTTATTACTACTTTTTTACCACTTTATTCGTACATGGAATCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATGAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTATTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTATTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTCAATTATTCTATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCGATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAAATCAAGATATGCACTAAGTTAAAGATAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTCTGACCAAATTGCTAGTAAAAAATGAATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTTAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------TTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTCTCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGGTAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTTAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTGTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTTT-ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTGGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_torreyi_H1923 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGTAAG--AAAAGAAAGGAGCAATA-CCGCCCTCTTGATAGAACAAGAAATTGGTATTGCTCCTTT-----A------CTTTTAC------------TT-CATATATT----------TT-TTTTACAGAAAAA-T-----AAAAAACGATTCT-----------------------ATCGTA-------------------------------------------------------------------CTATTGTAA-TTTTTTGGCTAATATTTTTATTTCACA------------------AATAAGATAAGAAACAAATAATATTAATATAATGA--TGAATCGTTAAAATTGAATCTTTTCTAATCTAATTCTAATCTAATTCG--------------AATTAAGTAGAGGGGCGGATGTAGCCAGTAAAGATTGAGAAAAGTCTTTCTCTCGCTCTTTATCTTTATTC-TATAGATAT--------------------------------------------------------------------ATATAACTTTTATCAGTAATTCCATTTCAATAAAGTAAGGGTTCTAAAAATCTAATTAATAAAAT--------------------CTAATAGAATAATAAAATAAGGAAAAA----------------------TAAAGAAGACCTCC-TTGCTTTTATTTT-----GTCCGAAAGGCTTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGTTTCAACGAATCATAGA------AAAATGATTTATCTGATTTATGTCAAAACAAAAATGCTTGCTATTAAAGCAACAACAAAAATAAAAAGGACTATTTCCATTCTTATT------ATATAAAATATATAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTTTACTTTACTGAAA---------TAAAACAAAACTGAAATGGAAATAAAGAGAAAAAAA---GAAAACTATGGATTCTTACACAATCCGTTTTTATTTTATGTTAGGATTTCGGCGGTTTTGTAGAGCCGTATCTATCAAAATTATAACAGAAAAAAAAGCAAAACAAA-----GGATAACACTTGTTATTTAGTTATTGAAATGAACGCTCTTTT-----TC-TCATTAAGTCCCACCCATGAAAAA----GGCTAAGACTCTAATTTTCATGATTCTTTTATGTTATGATCCTATCTTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAGGTAA-TGTAGGCTTGACTCTGTTAACTAGTAATTAATTATC???????CTTTTTGGGTAGGCGGAAAAGAA-----GGGGGTGGATAGAACCACT-ACACTATCACGGTTAACTATACCGCGTCCTTTATCATTTT---------AAATAAATTACTTCACCATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGCCCACACATATAATAT-ATGATATATA-------------TGCCTGGATCATA-----------------------------TTTGT-----GCAGTGTCAGGACAGAGATTCTCTTCGGTGTGATTCCAATCAATCATGTTATTAATTTTTTTTTCATTCAAAAAGTTTGACCCCCCC-TCTCATTTTTTTATTTTCTTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGGAAAGCAATAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATGAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCACAAATGGGGATGCTGGATCATGCATCTATCTATATATACAGATAGATAGATCAACCTATCGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGAGGTATGCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCGAAA-TTGTCTTTCGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAAAGAAGGGATATTGGGCAGCACTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAAGAGTAG-------------------------AATAATCTGAATCAACTTGCCTCAAAAAATGGGCGCATTTCATTTCGAAT------ATTTAATTTTTAATAT-------------------ATAAAA------TTAATGGAATGAATGATTTCTATT-----ACCTA----TTGTTTTGGACTAATCAATAGGAAATGGAACCTGTCTCGCTCTTCTGATATGTAGAATC-AAAACTTTTCTGTTTACTGAATTCT------AAAAATAATAGAATACTTT--------------------------------AAGGTTTTACCTTTCTTTTTAGTATATTTT----ATCA--TTTTATCATTTCCGGGATGGGGATTATTATTTTCCCCATCGACCCACCTGTCACAATAAGACAAGTTTTTATTTTTTCTATATCTCCAG----------------AAGAGCATAAACTAGGCGAAAGTCTTAAATAAAAGCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACACCCTAAACTCAAATACTGCACCGTTAAATCCCTAGTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAAATATCGTATTGACTTTGACTCCTTTAATCTCGACGATTGAATGTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAA---TCAAGATATGCACTAACTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTGTGAGTTTTTCCAAAATACTTCAACTATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGAGCAAATGGATAGTAAAAAGTGAATATTTGGTTAGATATTTATGAAAATAGAGAAAATTAAAATTGTAATTATTAGTACAATAATT---------TATAGGCATAGAGCAAGGATAAAGAATTACACCAAAACCAGTACTTGATTCTGATATCAATCATA-------GGAATAGAATCAACTAAGGCGAAGTTATTGGCCTAATTAAGAGCTTCTTGCTTGTTA-TTTTAGTTAGTTTATTAAAATTAA-------TTTATTAAAAT--GA--ACTAGTT--CATTTCCAATAAAATTGATTTCGGTTTTCGGTTTATAGCAAGCAAGGTCTATAATATCCATTCATTACTTTGTATAAGTATAAAATTCA---------------------------CTTTTTTATTTATTT-------ATCT-------AAAAAAATTATTAAAAAA------TTACTACAATATCTTTTATCATGTGATG----TTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATT----CAAATTAGTCCTACTTTTTCCTTGAGCTTGCCCAATTAATAGTAAAGTTTTTTCATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTTATTACATTTAAATTAAATTTAGAACGGCGAAAATAGACCGACATAGGAATAGAGGGCTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATCAGAAAGAATGAGAAATAAA-----GGGGCCCATCAGTAGAAATTATTCTTTCTTCTAGATATTGTA-------------------------------------------TGGAATAGAAAAAAATAATTTTTTTTTTTAAACAATCACATAATCATATATCATATTCTTTTTTG--ATATTTACCGATTTTTACATA--TTGATTTTTT---ATGAAGAGAATATTATCT-------------------AGAGAAAAAATAG-ATAGATAATG------------------------------------AATAGT------AAAGAACAATTAGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_tricuspis_B065 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTATCTTTATTC-TATAGATAT--------------------------------------------------------------------ATATAACTTTTATCAGTAATCCCATTTCGATAAAGTAAGGGCTCTAAAAATCT----AATAAAAT--------------------CTAATAGAATAATAAAATAAAGAAAAAAAAAA-TAACGAAAAATAAAAATAAAGAAGACCCCC-TTGCTTTGATTTT-----TTCCGAAAGGCGTTTTTAGTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCC-TTTTTTGTTTCAACGAATCATAGA-----TAAAATGATTTATCTGATTTATTTCAAAACAAAAATGCTTGCTATTTAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------ATATAAAATCTATAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACTGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTAGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTAATTTTCATGATTCTTTTATG----------ATCCTATCTTAATTACGTCCAATTCCCGTGTTCGACAAAAGGTAA-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCATTTTTTCTTTTGGGGTAGGAGGAAAAGAA------GGGGTGGATAGAACCACT-ACACTATCACGGGCAACTATACCGCGTCCTTTATCATTTA---------AAATAAATTACTTCACCATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATAT-ATGATATATA-------------TGCCTATAATATATGATATATAT-------GCCTGGATCATATTTGTTTTGTGCAGTGTCAGGCCAGAGATTATCTTCGGGGTGATTCCAA----TTATGTTATTAATTTTTTT--CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTTATTTTCTTTCTTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATAAATTGGTTCAAGAGATGAGAGAATTAAGGATAGCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAATAATCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCACAAATGGGCATGCTGGATCATGCATCTATCTATATATACGGATAGATAGATCCACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCATTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTT{CT}GGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTAG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCTAATTCCAATATTGAATTTTGAATATAGAAAATGAAAAAATGAATATAAAA------TGAATGTAATGAATAATTTCTATT-----ACCTA----TTGTTTTGGACTAATCAATATGAAATGGAACCCGTCTCGCTCTTCTGATATGTAGAATC-AAAATTTTTCTGTTTACTGAATTCTAATTCTAAAAAGAATACAATACTTT-TTTGTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATCATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGGTTTTCTTTTTTCTATATCTCGAG----------------AAGAGC--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTA--------CTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----ATAAAAGGGAATATTTTTTTGTACGAAAAATGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTAT-TTTGT---------------GTTCATTAATAAAATGCATTTTTTGTTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGACATTTTCTTTTGAGTTCAATCCCTGGATTGAGGGTTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATGTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTTGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAACTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAGTGAATATTTAGTAAGATATTTATAAAGATAGAG-AAATTAAAATTGTAATTATTAGTACAACAATT---------TCTATCCATAGAGCAAGGATAAAGAATTACACCAAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGAATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACTAGTTCATTAT-GGAATT-GATTGATTGTTTTCTATTCCAATAAAAGACATTT-------CTGTTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAAAATTATTAAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTAATTACTAGTCTCATTCGAATTTGAAAATTA---AAA-TTAGTCCTACTCTTTCCTTGAGCTTGACCAATTAATATTAAAGTTTTTTCATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTAGAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTGATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCAGTACAAATTATTCTTTCTTCTAGATATTGTA-------------------------------------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATAATCATATATCATATTCCTTTTTTT-CTATTTAGCGATTTTTACATATCTTATTTTTTTTT-ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGT------AAAGAACAATTGGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_veatchiana_B105 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAAT------ATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_veatchiana_B187 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_veatchiana_B210 TGGATAAGACTTTGGTCT-TAGTGTATACGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATAGTCGAGGGGCGGATGTAGCCAGTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG Mentzelia_veatchiana_B384 ----------------------------CGAGGTCGTGAAAGTAAAAATAAAGGAGCAATAACCAATTTCTTGTTCTATCAAGAGGGCGGTATTGCTCCTTT-----ATTTTTTATTTTACTTA-CCTTTCCCTTACATATACC----------TT-TTTTACAG-----------AAAAAAAGGATTCTTATGGCTTAGTTAATGATTGAGTATCGTACTTT------------CTTTCTGTATTCATTTTGAATTTATATACCATATCTTTTCCCGAATCTTTTCTATTG-AACTTTTTTGCCTACTATTAGTATTTCACT------------------AATAAGATAAGAAAGAAATAATAA-------------TGAATGGAAAAAATGGAATCTTTTCTAATCTAA----------------------GAAGAGGAAAATA---------------------GTAAAGATTGATAAAAGTCTTTCTCTCTCTCTTTCCTTTTATTC-TATAGA---------------------------------------------------------TCTATATAACTTTTATATAACTTTTATCAGTAATCCCATTTTGATAAAGTAAGGGCTCTAAAAATCT------------------------------------------AATAAAATAAAGAAAAAAAA---TAACGAAAAATAAAAAGAAAGAAGACCCCC-TTGCTTTCATTTTATTTTGTCCGAAAGGCGTTTTTATTCCCATGGCCTGGCCTGGTCAGTACCTAGCCGGGCCCCTTTTTTGATTCAACGAATCATAGAAAAAATAAA-TGATTTATCTGATTTATTTCAAAACAAAAATACTTGCTATTAAAGCAACAACAAAAAGAAAAAGGACTATTTCCATTCTTATT------CTATAAAATCTAGAAAATCAAAGTGTCATTTCGTATTATTCTTTTTTCCTTTTT-ACTTTACTGAAA--------------TAAAACGGAAATTGAAATAAAGAGAAAAAA----GGAAACTATGGATTCTTACACAATGCATTTTT-----ATGTTAGGATTTCGGCGGTTTTGTGGAGCCGTATCTATCAAAATTCCGCCAGAAAAA-GAGCAAAAGAAA-----GGATAACACTTGTTATTTCGTTATTGAAATGAACCCTCTTTTCCTAATC-TCATTAAGTCC--CCCATGAAAAA----GGCTAAGACTCTCATTTTCATGATTCTTTTATG----------ATCCTATCTTGATTACGTCCAATTCCCCTGTTCGACAAAAAGT-A-TTTAGGCTTGACTCTGTTAACTAGTAATTAATTATCACTTTTTCTTTTTGGGTAGGAGGAAAAGAAAAAGAAGGGGTGGATAGAACCCCG-ACACTATCACGGTCAACTATACCGCGTCCTTTATCATTTTAATCATTTTAAATAAATTACTT----ATGGGCGGATAGCGGGAATCGAACCCGCGTCTTCTCCTTGGCAAAGAGAAATTTTACCATTCGACCATATCCGCAATTTTTCTTGATACGCAATATGTCCACACATATAATATTAT-ATATATA-------------TGCCTGGATCATA-----------------------------TTTGTTTTGTGCAGTGTCAGGCCAGAGATTCTCTTCGGGGTGATTCCAAA---TTATGTTATTAATTTTTT---CATTCAAAAAGTTTGACCCCCCC-TCTAATTTTTTGATTTTATTTATTTTT----------------------------------------------------------------------------------------------------------GGGGACTTATATTGAATTTTAATGTGTCTCACAACCGAAAAGAATTCGGGGGAGGGGTCATTTCGTTTTTGGATCTGGGATGAATTGGTTCAAGAGATGAGAGAATTAAGGATACCCACCAGAAAGACTAATCCAATCCATAATGATGTACCGGAAAATACAACATTTTTGTTACTTGACCAACCATCAGGAGAAGCAAATACAACGGGTACGCCAATCAATAAGATTGATGAAGTAGCAATTAATGCAAAAACAGCCAATTGAAAAGCAAGAGTCATGCTTCTAATCCTCCAAGCTACCAACAAATGAACTATACCATTTGATCCCTCTATCAGCTAAAAAATTGTAATAAAATACATCATGTAGGGATTTTACCA----------------TGAATCTATTGATTCTATA-TAACTTATTACTAC-----------------------------------TTTTTTACCACTTTATTCGTACATGGAGTCGAGGGGAATGGAATTTTGTTTTTTACTTCAGAAATGGGCATGCTGGATCATGGATCTATCTATATATACGGATAGATAGATCAACCTATAGATTCACACCT------------------GAGATCTTTCTACAGATA-----GTGGCGGTATCCACTCCTATGGCCATGTTCTACTCAGAGGAATAAAATCAAAA-TTGTCTTTTGGAGAGATGGCTGAGTGGTTGATAATTTGGAAAA-GAAGGGATATTGGGCAGCGCTAAAGGCCTTTTCGTTAGGGAAATCTCTTTCTACCGGGAATTCAAAAAGTTTTTTTATACGACAAACAAATAAATAATCAAACAGTCG-------------------------AATAATCGGAATGAACTTGACTCAAAAAATTGGCGAATTTCATTTCGAATTCCAATATTGAATTTTTAATATAGAAAATGAAAAAATAAATATAAAA------TTAATGGAATGAATCATTTCTATT-----ACCTA------TTTTTGGACTAATCAATATGAAATGGAACCCGTCTTGCTTTTCTGATATGTAGAATCCAAAATTTT-CTGTTTATTGAATTATAATTCTAAAAAGAATACAATACTTT-TTTCTTTTGAAAAAAGAATAAAGAAAGCTACAAGGTTTTACCTTTCTTTTTAGTATATTTT--------------ATAATTTCCGGGATGGGGATTATTATTTTCCCCATCGGCCCGCTTGTCACAATAAGAAAAGTTTTTCTTTTTTCTATATCTCGAG----------------AAGGGT--------------------AAATAAAAGCTCTTTAGTCAAAAGTAAAAATTTATGAGTCATTGAAACAAATTAAGTTGAAAACTTTTTTGTAACCTTCTGAATCATTATTTCTTTGAATTGAATTATTAAATTATTATATAGACTCCCTATGTACCTCGCGCTTTGAACCCAATCG-----AGAAAAGGGAATATTTTTTTGTACGAAAAAGGTGTCTGTCACTTTGGGGTGATTCAAAATAGACCCTATATTTGT---------------GTTCATTAATAAAATGCATTTTTTATTTCAGATTTATGAAATCAGATAAATGAAAAATGAATCATTAAAAAA----TG-AAAATGAGAAAAGATATTTTATTTTGAGTTCAATCCCTGGA-------TTGAGGGTAGAACTATCTAGTTACAACAGTTCAATTCCCGGAGAGCATAAACTACGCGAAAGTCTTAAA--TAAAACCGACACCCTAAACTAAAATACTGAACCTTCAAATCCCTATTTGAACAAATTTTTATTCATCAATTTGAATCTTTCCTAAAAAA-TATTGCATTGACTT-GACTCCTTTAATCTCGACGATTGAATTTTTTTATTCTTAATGAATTGTTTACGATTCGTCGGATCTTACCTCTTTGGAAAGGAGTCAATAAAAAAAA-TCAAGATATGCACTAAGTTAAAGAGAATTTTATATTCTTACTTATTTT-------GATTTTGAGTTTTTCCAAAATACTTCAAATATTCAAATCAAGAAATTACAA-----------------------TTGGTCAAATGGTATGACCAAATTGCTAGTAAAAAATGTATATTTAGTAAGATATTTATGAAGATAGAG-AACTTAAAATTTAAATTATTAGTACTTCTATT---------------CATAGAGCAAGAATAAAGAATTACACCCAAACCGGTACTTGATTCTGATATCAATCATA-GTTGATAGCATAGAATCAACTAAGGCCAAGTTATTGGCCTAATTAAGAACTTCTTGCTTCTTA-TTTTAGTTAGTTTATTAAAATTAACGAGTTGATTAT-GGAATTTGATTGATTGTTTTCTATTCCAATAAAATACATTT-------CTATTTATAGCAAG---GG-GTATGATATCTAT-CATTACTTTGTATAAGTATAAAACTAA---------------------------CTTTCTTTTTTATTT-------ATCT-------AAAAATATTATTCAAAAA------TTACTACAATATCTTTTATCATGGCATGTATCTTTTAACAGATTCATTACTAGTCTCATTCGAATTTGAAAATTT---CAA-TTAGTCCTACTCTTTCCTTGAGCTTGGCCAATTAATATTAAAGTTTTT-CATTAGTCAAAAGTTGGATTCTTAAACTTTGCGATGGATTTGATTACATTTAAATTAAATGTACAACGACGAAAATAGACAGACATAGAAATAGAGGGTTTTT-GGATTTTTTATTTTATCAATTTCATTTCTATGA------TATATCGGATTCTATAGATATAGATTTGAATGAGAAAAAATGATAAATAAA-----GGGACCAATCACTACAAATTATTCTTTCTTCTAGATATTGTATAGATATTGTATTGTATAGATATTCTA----------------TGGAATAGAAAAAAACAATTAGTTTTG--AAAAAATCACATGATCATATATCATATTCCTTTTTTT-ATATTTAGCGATTTTTACATATCTTATTTTTTTT--ATGAAGGGAATATTATCT-------------------AGAGAATAACTAG-ATAGATAATG------------------------------------AATAGTAATAGTAAAGAACAATTCGTTTTGAATAATAGATGTCTTTCACATACAACTATAACAATGAGTCACTTTAAATGGCAGT-CCAAAAAAACG ; END; BEGIN SETS; CHARSET rpL32trnL (CHARACTERS = Figure_1_Plastid) = 2619-3797; CHARSET trnSG (CHARACTERS = Figure_1_Plastid) = 468-1327; CHARSET trnHpsbA (CHARACTERS = Figure_1_Plastid) = 1-467; CHARSET ndhrpL32 (CHARACTERS = Figure_1_Plastid) = 3798-5181; CHARSET trnSfM (CHARACTERS = Figure_1_Plastid) = 1328-2618; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = Figure_1_Plastid) = N: 1-5181; CODONPOSSET * CodonPositions (CHARACTERS = Figure_1_Plastid) = N: 1-5181; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4729] TITLE 'Figures 2-4 idh'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1401; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Mentzelia_affinis_B201 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGACTCT--GACTTTT-ATAT--GCATCTATTAGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACTGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATATCTAGATTTGAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACTGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTACTAGGTTATGTCCG-----ATCTCCAGATTGCAGCTCGAAGCTCATTGATTTAATTCTTTAA--TTTTTGGTT-GTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_affinis_B203 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT-CGTCCTGTACTATTATTATATAT--CCGATTCTCCAA--GTCCTGATGTAAATTATTGTAATTGTAGGTACACCGTAGCTATCAGATGTGCAAGCATTA--TCCAGCTACAGTTGGTTGAGTTTGAT-GTAAAGAGTTAT-TATT-TAATTT-ATTAA-----------CTCTCTACAAATTTTACTAGTTTA{AG}CAGTACTAAGTTTTTGT--AAAATGTGATCTTGATGGTTTATGGTCATATTGTCTACAGATGAAGATCGTGCGAGA------------GAAACAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTT------------------AAGAATT{GT}CTGATTCTCTGACTTTT-ATAT--GCATCTATTGGTGAT----------------------------------------GACCATTGTGCTTGTCTCCC---GCAGCAAGTACCATCTTC-AGAGAACC-ACTTATCTGCAAAAA----------TGT-CCCCAGACTCGTTCCAGGTACTT-ATCTTTTGTCTTGATTACGCTGCTCGTCCAAC{CT}TTTTT-ACCATGTCCAGATATCATCTCTCACGCAGCTGGTGTTTTCAGAATGGACAAAGCCAATATGTATCGGAAGGCATGCTTTTGGTGATCGCTACCGAGCAACTGATG---CAGTTATTATGGGAG{CT}TGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGC{AT}TAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTTT---ATTGATCATTTTAAGGACCATTTGTTCTTTCT--ATTTCCGG-CCATGTTTATAC-T{GT}TCTTCATTT--TCTCAGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGGAAAGACAGAGTTGGAAGTGTATAGCTTCATAGGAGGAGGAGGAGTTGCTTTGTCTATGTACAATACCTATGAGGTTGGGCTTGTAAATTA--TAATGTATTAGGTTATGTCCG-----ATCTCCAGTTTGAAGCTCGAAGCTTATTGATCTAATCCTTTAA--TTTTTGGCTTGTGAGCATA--GTCCATTTGTG-CTTTTGCCGAGGCTTCTATGAACACT Mentzelia_affinis_B211_1 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTGTGATTATTATCCTTAAGAATTTTTGATACTTTGACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AACTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATCTGAGA-TTTTTT-CAATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTCATTAA-TTTCTTCATTT--TCATTGGATTTTGGTGCTCTAT----GCAGTTCCAGAAGGAGGAAAGGATGAAACTACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGATTATGCCCG-----ATATTCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG--------------------------- Mentzelia_affinis_B211_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTT{CT}CATTATACAT{CT}T---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAACACATTGC----------------------------------------------TTTTC{CT}TCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATGATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AATTTGAT-ATAAAGAATTAT-TAAT-TAA--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAGTTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCT--GACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACTGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATATCTAGATATGAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATCTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TATCTTCCTTTT-TCACTGGATTTTGGTGCTCTAT----GCAGTGCCTGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTCCG-----ATCTCCAGATTGCAGCTCGAAGCTCATTGATTTAATTCTTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGC{AT}GAGGCTTCAATGAACACT Mentzelia_affinis_B211_3 -------------------------------AAGCTACTCTTAAGTATGTACTTTTACTATTAGATACAATATCCTGTTGTTTTGT-GAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAACACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATGATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AATTTGAT-GTAAAGAATTAT-TAAT-TAA--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAGTTTTTGT--AAGATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCT--GACTTTT-ATAT--GCATCTATTCGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCAGCAGGTACTGTCTTC-AGAGAGCC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATATCTAGATATGAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATCTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGACG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTC-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TATCTTCCTTTT-TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGGCAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTCCG-----ATCTCCAGATTGCAGCTTGAAGCTCATTGATTTAATTCTTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_affinis_B211_4 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTT------------------AAGAATTTCTGATTCTCTGACTTTT-ATAT--GCATTTATTGGTGAT----------------------------------------GACCATTGTGCTTGTCTCCC---GCAGCAAGTACCATCTTC-TGAGAACC-ACTTATTTGCAAAAA---------TTGT-CCCCAGACTCGTTTCAGGTACTT-ATC-TTTGTCTTGATTACGTTGCTCGTCCCACTTTTTT-ACCTTGTCTAGATATCAACTCTCACGCATCTGGTATTTTCAGGATGGACAAAGCCAATATGTATCGGAAGGCATGCTTTTGGTGATCGCTACCGAGCAACTGATG---CAGTTATTATGGGAGTTGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTTT---ATTGATCATTTTAAGGACCATTTGTTCTTTCT--ATTTCCGA-CCATGTTTATAC-TTTCTTCATTT--TCTCCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACAGAGTTGGAAGTTTATAACTTCATAGGAGGAGGAGGATTTGCATTGTCTATGTACAATACCTATGAGGTTGGGCTTGTAAATTA--TAATGTATTAGGTTATGTCCG-----ATCTCTAGATTGCAGCTCGAAGCTAATTGATCTAATCC------------------------------------------------------------------ Mentzelia_affinis_B423 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGG{AT}---------TCA{AT}CAGTAGT---AATGAACACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATGATTGTAAT-GTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AATTTGAT-ATAAAGAATTAT-TAAT-TAA--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAGTTTTTGT--AAGATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAA{AG}-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCT--GACTTTT-ATAT--GCATCTATTCGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACTGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATATCTAGATATGAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATCTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTC-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TATCTTCCTTTT-TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTCCG-----ATCTCCAGATTGCAGCTTGAAGCTCATTGATTTAATTCTTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_affinis_B467_1 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGTCACTCTTAAGTATGTACTTTTACTATTAGATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAACACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATGATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AATTTGAT-ATAAAGAATTAT-TAAT-TAA--------------------C{CT}CTC-AG--TTTTTACTGGTTTAGCAGTACTCAGTTTTTGT--AAGATGTGATTTTGATGGTTTA{AG}GGTAATATTGTCTACAGATGAAG{AG}TCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCT--GACTTTT-ATAT--GCATCTATTCGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACTGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AACTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATATCTAGATATGAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAA{AG}CCAATCTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTC-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TATCTTCCTT{CT}T-TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCA{CT}GGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTCCG-----ATCTCCAGATTGCAGCTTGAAGCTCATTGATTTAATTCTTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_affinis_B467_2 TG-ATGATAAAGTTACAGTTGGTAGT-GCAAAAGCTACTCTTAAGTATGTAGTTTTTCCCA---------TTTGTTTTTGTCT-----------------------GGAAGTT-------CCTTTTTGTTTGCATTGCCCTTTTTTGTTATTTTCTTTTGTGATAGTAGGA---------TCTTCAATAGT---TATGAACAGATTACATTTCTT-------------------------------------ACTTT-CGTCCTGTACTATTATTATATAT--CCGATTCTCCAA--GTCCTGATGGAAATTATTGTAATTGTAGGTACACCGTAGCTATCAAATGTGCAAGCATTA--TCCAGCTACAGTTGGTTGAGTTTGAT-GTAATGAATTAT-TATT-TAGTTT-ATTAA-----------CTCTCTACAAATTTTACTGGTTTAGCAGTACTAAGTTTTCGT--AAAATGT---CTTGATGGTTTATGGTCATATTGTCTACAGATGAAGATCGTGCGAGA------------GAAAAAATTGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTC------------------AAGAATTTCTGATTCTCTGAATTTT-ATAT--GCATTTATTGGTGAT----------------------------------------GACCATTGTGCTTGTCTCCC---GCAGCAAGTACCATCTTC-TGAGAACC-ACTTATTTGCAAAAA---------TTGT-CCCCAGACTCGTTTCAGGTACTT-ATC-TTTGTCTTGATTACGTTGCTCGTCCCACTTTTTT-ACCTTGTCTAGATATCAACTCTCACGCATCTGGTGTTTTCAGGATGGACAAAGCCAATATGTATCGGAAGGCATGCTTTTGGTGATCGCTACCGAGCAACTGATG---CAGTTATTATGGGAGTTGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTTT---ATTGATCATTTTAAGGACCATTTGTTCTTTCT--ATTTCCGA-CCATGTTTATAC-TTTCTTCATTT--TCTCCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAATACAGAGTTGGAAGTTTATAACTTCATAGGAGGAGGAGGATTTGCATTGTCTATGTACAATACCTATGAGGTTGGGCTTGTAGATTA--TAATGTATTAGGTTATGTCCG-----ATCTCTAGATTGCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGCTTGTGAGCATA--GTCCATCTGTG--------------------------- Mentzelia_albicaulis_B191B_1 TG-ATGATAAAGTTACAGTTGAAAGT-GCTGAAGCTACTCTTAAGTATGTACTTTTT-TACTAGATACAGTATCTTGTTGTTTTGT-AAAAACAAGCTCTTTTTTTGGAAGTT-------CCTTTTCTTTTGCATTATCCTTTT---------------GTGATAGTA---------------TCAGTGGT---TATGAGCACATTGCATTTCTT-------------------------------------ACT{CT}T-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATTAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATCAA-----------CTGTCTAGGATTTTTACTGGTTTACCAGTACTAAGTTATTGT--AAAATGTGATTTTGATGGTTTATGGTAATACTGTCTACAGATGAAGATCGTGTGCGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTAGATACTCTGACTATT-ATATATGCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTG{CT}CTCCT---ACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAACTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCA{AG}CCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTCCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTTGTATTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACAACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_albicaulis_B191B_2 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTATTAA-TTTATTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGAAGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_albicaulis_B337_1 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATTATTTAAACAAACATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCGGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACTGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCCGAGGCTTCAATG------ Mentzelia_albicaulis_B337_2 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTCCTTG--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCAT?CGTG-CTTTTGCCGAGGCTTCAATG------ Mentzelia_albicaulis_B337_3 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGAATAATAGGATCATCAGTAGT---GATGAACACATTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--CCCATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTTT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTGTG-------ATTATCCTTCAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-GGC-TTTTCCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCGGGGAAACTAAAATTGGTCTTTGGTGAACTTT--TTCCCCTCCAAGATTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_albicaulis_B337_4 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGAATAATAGGATCATCAGTAGT---GATGAACACATTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--CCCATTCACCAA--GTCCTGATTGAGATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTTT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTGTG-------ATTATCCTTCAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_argillosa_H4145 -------------------------------------------------------------------------------------------------------CT-TT?AGTT-------TCTTTTCTTTTGCATTT-----------------CTTTTGTTATAGTAGGA---------TTATCAATGGT---TATGAACACATTGCACTTCTT-------------------------------------ACTTTGCTTCCCATACAACTACTATATTT--CTGATTCACTAA--GTTCTGATGAAAAT-ATTGTAATTGCAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTGAT-GTGAAGATTTAT-TAAT-TAATTT-ATTAC-----------CTCCTT--AACTTTCTGTGA--------------------------TATGTGATCTTGATGAATTATGGAAATATTGTCTACAGATGAAGAGCGTGTGAGAGAATTTAAG-TTGAAACAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----AATATCCTTGACAATTTCTGATTTCCCGAATTTTTATAT--GCATCTATTGATGAT----------------------------------------GACCATTGTGCTTGTCTCCT---GCTGCAGGCACAGTCTTC-AGAGAACC-AATTATTTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTTTAGCTTTTTTCTTGATACTGCTGCTCGTCTCA-TTTTTT-ATTATGACTAGATATCATCTTTCAAGTGGCTGCTGTTGTCAGGATGGACAAAGCCGATATGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACTGATG---CTGTTATTAAAGGAGCAGGGAAATTAAAATTGGTTTTTGGTGAACTTCTCTTCCCTTTCAAGCTTAACATGAATTTGAGATTTTTTT-CTTTTGTTTAGTTTTT--GTTGATCATTTAACAAACCATTTGTTCTTTCT--ATATCCGA-CCATGTTATTAT-TTTCTTCCTTT--TCACTGGGTATTGGTGCTTTAT----GCAGTGCCAGAAGGA---AAGGACGAAAAGACAGAATTGGAAGTTTTTAACTTTACAGGAGCTGGAGGAGTTGCCTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTATATTG--TATTGTATTAGCTTATGTTCA-----GTCTCCAGATTGCAGCTGGAAGCTGATTGATCTAATTCTTTAA--TTCTTGGTTTGGGAGCATA--GTCCATTCATG-CTTTTGCCGAGGCTTCAAT-AA---- Mentzelia_arizonica_B424_1 TGTATGATAAAGTTACAGTTGAAAGT-GCTGAAGCTACTCTTAAGTATGTACTTTTTCTACTAGATACAATATCTTGTTGTTTTGT-AAAAACCAGCTCTTTTTT-GGAAGTT-------CTTTTTCTTTTGCATTATCCTTTT---------------GTGATAGTA---------------TTCGTGGT---TATGAGCACATTGCATTTCTT-------------------------------------ACTTTTCTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATTAA-----------CTCTCTAGAATTTTTACTGGTTTACCAGTACTAAGTTATTGT--AAAATGTGATTTTGATGGTTTATGGTAATAATGTCTACAGATGAAGATCGTGT{GT}AGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTAGATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTATTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTATTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATATCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTTT-TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTATCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGTTAATGCCTG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_arizonica_B424_2 TG-ATGATAAAGTCACAGTTGAAGGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGCT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGC---AATGAGCACATTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--CCAATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCATTTTTTGTA-AAAATGTGATTTTGATGGTTTAAGGTAACATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACCTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTCCTTG--TCACTTGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_arizonica_B424_3 TG-ATGATAAAGTCACAGTTGAAAGC-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATATAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGCT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--CCAATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAACATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACCTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTCCTTG--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGTTTTTGAATTA--TATTGTATTA{AG}GTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_arizonica_B424_4 TGTATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTTTTT-ATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTCT-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---GATGAACACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCCACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTTAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGGCTCCTTCTGCTGCAGGCACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTAGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTGGACATCAACTTTCAAGCTGCTGGTGTTGTCAAGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATATCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTATTAA-TTTCTTCTTTT--TCACTGAATTTTGGTGCTCTAT----GCAGTGCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_arizonica_B431_1 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATACTT-----------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCATATTGC----------------------------------------------TTT-CTTCCCATATTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTAGTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGGGATGAGTCT-------------------------------GATGACCATTGTGCCTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGCGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTATTAA-TTTTTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGAAGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_arizonica_B431_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGCT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCAATTCACCAA--GTCCAGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAACATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACCTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAACTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTCCTTG--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCCGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_arizonica_B431_3 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTTTTT-ATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTCT-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---GATGAACACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTTAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTTCTGCTGCAGGCACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTAGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTGGACATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATATCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAGCCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTATTAA-TTTCTTCTTTT--TCACTGAATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACAACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTG--TATAGTATTAGGTTATGTCCG-----ATCTCCAGATTGCAGCTCGAAGCTGGTTGATCTAATTCCTTAT--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_californica_B456_1 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATACTT-----------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTT-CTTCCCATATTATTACTATATAT--CCGATTCACCAA--CTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTAGTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCGAACGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGGGATGAGTCT-------------------------------GATGACCATTGTGCCTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_californica_B456_2 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTGAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAACTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTACTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTATTAA-TTTCTTCCTTG--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCGTA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_californica_B476_1 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACGATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATACTT-----------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTTTCTTCCCATATTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTAGTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGGGATGAGTCT-------------------------------GATGACCATTGTGCCTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGCGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTACTAATTTTTTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGAAGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_californica_B476_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGCT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------CCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--CCAATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGCTTAAGGTAACATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACCTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGCCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAACTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTCCTTG--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_californica_B476_3 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATACTT-----------------GTGATAGTAGGA---------TCATCAGTAGT---AACGAGCACATTGC----------------------------------------------TTTTCTTCCCATATTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAACATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACCTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAACTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTCCTTG--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_congesta_B084_1_19 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATTATTTAAACAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTATAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCT---------------------------------- Mentzelia_congesta_B084_2 ---ATGATAAAGTCACAGTTGACAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTGGCATGATACTTTT---------------GTGATAGTAGGAATAATAGGATCATCAGTAGT---GATGAACACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCCATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAGT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTTT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTGTG-------ATTATCCTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-TGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCGGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTATTTT-GCTGATTATTTAAAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_congesta_B285 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCGTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTAATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATTCGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTA-ACTATGACTAGACATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACTGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TATTTT-CTATTGTTTAGTTTTTT-GCTGATTATTAAAAGGACCATTTGTTCTTTCT--ATTCCTGGCCCTTGTTACTAC-TTTTTCCTTTC--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAGGGA---AGGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TACTGTATTAGGTTATG----------------------------------------------------------------------------------------------------------------- Mentzelia_congesta_B356_1 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATG--GTCTATTCGTG--------------------------- Mentzelia_congesta_B356_2 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGTCCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-CTTTTCTTGATAACGCTGCTCATCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCGGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_congesta_B360_1 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATTATTTAAACAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_congesta_B360_2 TGTATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTTT-GGATGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---GATGAACACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCCATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTCTTTTTAAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTGTG-------ATTATCCTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGTCCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-CTTTTCTTGATAACGCTGCTCATCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCGGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_crocea_B093_1 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATTATTTAAACAACCATTTGTTCTTTCT--ATTTCTGT-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCTG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGTATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_crocea_B093_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAATATCCTGTTGTTTTGT-AAAAACCAGACCTTTTTT-GGATGATACAATATCCTGTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---GATGAACACATTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--CCCATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTTAT-ATAAAGAATTAT-TAAT-TAA--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTTT--CAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTGTG-------ATTATCCTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GTATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAAT{CT}TGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCGGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_crocea_B093_3 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATACAATATCCTGTTGTTTTGT--AAAACCAGCCCTTTTCT-GGAAGTT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAACACATTGC----------------------------------------------TTT-CTTCGCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTGTCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTGAAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--ATTTAACTGATTCAGCAGTACTCAGTTTTTTT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTTTCCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTTAGAATTTCTGATTCTCTAACTTTA-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGCCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CTGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTTAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTATTAT-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATAA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTTGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_crocea_B093_4 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTT------------------AAGAATTTCTG----------TTTT-ATAT--GCACCTATGGGTGAT---------------------------------------TGACCATTGTGCTTGTCTCCC---GCAGCAAGTACCATCTTC-AGAGAACC-ACTTATCTGCAAAAATTGCAAAAATTGT-CCCCAGACTCGTTTCAAGTACTT-ATCTTTTGTCTTGATGACGCTGCTCGTCCCACTTTTTT-ACCATGTCCAGATATCAACTCTCACACAGCTGGTGTTGTCAGGATGGACAAAGCCAATATGTACCGGAAGGCATGCTTTTGGGGATCGCTACCGAGCAACTGATGATGTAGTTATTTT-GGAGTTGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTTT---ATTGATCATTTTAAGGACCATTTGTTCTTTAT--ATTTCCGG-CCATGTTTATAC-TTTCTTCATTT--TCGCCAGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACTGAGTTGGAAGTTTATAACTTCATAGGCGGAGGAGGAGTTGCTTTGTCTATGTACAATACCTATGAGGTTGGGCTAGTAAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCACATTGCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_crocea_B093_5 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GTTT------------------AAGAATTTCTG----------TTTT-ATAT--GCACCTATGGGTGAT----------------------------------------GACCATTGTGCTTGCCTCCC---GCAGCAAGTATCATCTTC-AGAGAACC-ACTTATCTGCAAAAATTGCAAAAATTGT-CCCCAGACTCGTTTCAAGTACTT-ATCTTTTGTCTTGATTACGCTGCTCGTCCAACTTCTTT-ACCATGTCCAGATATCAACTCTCACACAGCTGGTGTTGTCAGGATGGACAAAGCCAATATGTACCGGAAGACATGCTTTTGGGGATCGCTACCGAGCAACTGATGATGTAGTTATTAT-GGAGTTGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCCTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTTT---ATTGATCATTTTAAGGACCATTTGTTCTTTAT--ATTTCCGG-CCATGTTTATAC-TTTCTTCATTT--TCGCCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACTGAGTTGGAAGTTTATAACTTCATAGGCGGAGG-GGAGTTGCTTTGTCTATGTACAATACCTATGAGGTTGGGCTTGTAGATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCACATCGCAGCTCGAAGCTGGTTGATCTAATCCTTTAA--ATTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_crocea_B246_1 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATTATTTATACAAACATTTGTTCTTTCT--ATTTCTGA-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACTGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG--------------------------- Mentzelia_crocea_B246_2 ?G-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGAATAATAGGATCATCAGTAGT---GATGAACACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTACATAT--CCCATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTACT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTTT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTGTG-------ATTATCCTTCAGAATTTTTGATTCTCTAACTTTT-ATAT--GCATCTATCGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTCTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCGGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCGGGGAAACTAAAATTGGTCTTTGGTGAACTTT--TTCCCCTCCAAGATTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_crocea_B246_3 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCCTTTGGAATTTCTGATTCTCTAATTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCCGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CTGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACGTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTATT-CTATTGTTTAGTTTTTT-GCTGATTATTTTAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTATTAT-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATAA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTTGTTTGTGAGCATA--GTCCATTCGTT--------------------------- Mentzelia_decapetala_H3753 TG-ATGATAAAGTTACTGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTTTTTACAATATCATGTTATTTTGT-ACAATCCAGCTCTTTTT--TGAAGTT-------TCTTTTCTTTTGCATTT-----------------CTTTTGTTATAGAAGGA---------TCATCAATGGT---TATGAACACATTGCACTTCTT-------------------------------------ACTTTTCTTCCCATACAATTAGTATATTT--CTGATTCACTAA--GTTCTGATGAAAAT-ATTGTAATTGCAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTGAT-GTGAAGATTTAT-TAAC-TAATTTTATTAC-----------CTCTTTTAAACTTTCTGTGA--------------------------TATGTGATCTTGATGAATTATGGAAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCGAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----AATATCCTTAACAATTTCTGATTTCCCGAATTTTTATAT--GCATCCATTGATGAT----------------------------------------GACCATTGTGCTTGTCTCCT---GCTGCAGGCACAGCCTTC-AGAGAACC-AATTATTTGCAAAAA----------TGT-CCCCAGGCTTGTTCCAGGTACTTTAGCTTTTTTCTTGATACTGCTGCTCGTCTCA-TTTTTT-ATTATGACTAGATATCATCTTTCAAGCGGCTGCTGTTGTCAGGATGGACAAAGCCGATATGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACTGATG---CTGTTATTAAAGGAGCAGGGAAATTAAAATTGGTTTTTGGTGAACTTCTCTTCCCTTTCAAGCTTAACAAGAATTTGAGA-CTTTTT-CTTTTGTTTAGTTTTT--GTTGATCATTTAAAGAACCATTTGTTCTTTTTTTATATCCGG-CCATGTTAT-------------------------------------------GCAGTGCCAGAAGGA---AAGGATGAAAAGACAGAGTTGGAAGTTTTTAACTTTACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTATATTA--TATTGTATTAACTTATGTTCA-----GTCTCCAGATTGCAGCTGGACGCTGAATGATCTAATTCTTTGA--TTCTTGGTTTGGGAGCATA--GTCCATTCATG-CTTTTGCCGAGGCTTCAATGAAA--- Mentzelia_desertorum_B061_1 TG-ATGATAAAGTTACAGTTGAAAGT-GCTGAAGCTACTCTTAAGTATGTACTTTTACTACTAGATACATTATCTTGTTGTTTTGT-AAAAACCAGCTCTTTCTT-GGAAGTT-------CCTTTTCTTTTGCATTATCCTTTT---------------GTGATAGTT-GA---------TCATCAGTGGT---TATGAGCACATTGCATTTCTT-------------------------------------ACTTTTTTTCTCATACTATTACTATATAT--CCGATTCACCAA--GTACTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAG-TAAT-TAATTT-ATTTA-----------CTCTCTACAATTTTTACTGGTTTACCGGTACTAAGCTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATACTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTGATTATTATCCTTAAGAATTTTTGATACTTTGACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AACTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACT-C----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_desertorum_B061_2 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTGTG---ATTATCCTTGAGAATTTTAGATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-TCCCAAGCTTGTTCCGGGTATTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAGCTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-CTTTTT-CTATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTATCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATCGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG--------------------------- Mentzelia_desertorum_B061_3 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGGGATGAGTCT-------------------------------GATGACCATTGTGCCTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGCGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTTTGCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTATTAA-TTTTTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGAAGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTGTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTT-GGTTTGTGAGCATATAGTCCATTCGTG--------------------------- Mentzelia_desertorum_B061_4 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTC------------------AAGAATTTCTGATTCTCTGACTTTT-ATAT--GCATTTATTGGTGAT----------------------------------------GACCATTGTGCTTGTCTCCC---GCAGCAAGTACCATCTTC-TGAGAACC-ACTTATTTGCAAAAA---------TTGT-CCCCAGACTCGTTTCAGGTACTT-ATC-TTTGTCTTGATTACGTTGCTCGTCCAACTTTTTT-ACCTTGTCTAGATATCAACTCTCACGCATCTGGTGTTTTCAGGATGGACAAAGCCAATATGTATCGGAAGGCATGCTTTTGGTGATCGCTACCGAGCAACTGATG---CAGTTATTATGGGAGTTGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTTT---ATTGATCATTTTAAGGACCATTTGTTCTTTCT--ATTTCCGA-CCATGTTTATAC-TTTCTTCATTT--TCTCCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACAGAGTTGGAAGTTTATAACTTCATAGGAGGAGGAGGATTTGCATTGTCTATGTACAATACCTATGAGGTTGGGCTTGTAAATTA--TAATGTATTAGGTTATGTCCG-----ATCTCTAGATTGCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGCTTGTGAGCATA--GTCCATTTGTG--------------------------- Mentzelia_desertorum_B061_5 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GTTT------------------AAGAATTTCTG----------TTTT-ATAT--GCACCTATGGGTGAT---------------------------------------TGACCATTGTGCTTGTCTCCC---GCAGCAAGTACCATCTTC-AGAGAACC-ACTTATTTGCAGAAA---------TTGT-CCCCAGACTCGTTTCAAGTACTT-ATCTTTTGTCTTGATTACGCTGCTCGTCCAACTTTTTT-ACCATGTCCAGATATCAACTCTCACACAGCTGGTGTTGTCAGGATGGACAAAGCCAATATGTACTGGAAGGCATGCTTTTGGGGATCGCTACCGAGCAACTGATGATGTAGTTATTAT-GGAGTTGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTTT---ATTGATCATTTTAAGGACCATTTGTTCTTTAT--ATTTCCGG-ACATGTTTATAC-TTTCTTCATTT--TCGCCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACTGAGTTGAAAGTTTATAACTTCATAGGCGGAGGAGGAGTTGCTTTGTCTATGTACAATACCTATGAGGTTGGGCTTGTAAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCACATTGCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_desertorum_Glenn91_85 TG-ATGATAAAGTTACAGTTGAAAGT-GCTGAAGCTACTCTTAAGTATGTACTTTTACTACTAGATACATTATCTTGTTGTTTTGT-AAAAACCAGCTCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATCCTTTT---------------GTGATAGTT-GA---------TCATCAGTGGT---TATGAGCACATTGCATTTCTT-------------------------------------ACTTTTCTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTACTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAGTTAG-TAAT-TAATTT-ATTTA-----------CTCTCTACAATTTTTACTGGTTTACCGGCACTAAGCTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATACTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTGATTATTATCCTTAAGAATTTTTGATACTTTGACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AACTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATCTGAGA-TTTTTT-CAATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTCATTAA-TTTCTTCATTT--TCATTGGATTTTGGTGCTCTAT----GCAGTTCCAGAAGGAGGAAAGGATGAAACTACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGATTATGCCCG-----ATATTCAGACTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_dispersa_B096_1 TG-ATGATAAAGTTACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATACGATATCC---AGTTTTGT-AAAAATCAGCTATTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATCCTTTTCTGCTATTTTCTTTTGTGATAGTAGGA---------TCATCAGTAGT---TATGAACACATTGCATTTTTT-------------------------------------ACTTTTCTTCCCATACTATTACTATGTAT--CCGATTCACCAA--ATCCTGATGGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTAAT-GTAAAGAATAAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTAATGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTTTGATTCTCTGACTTAT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGGTCGTCTAGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCGTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTGAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCAGGAGGAGTTGCTTTGTCCATGTACAATACTGATGAGGTTGGGCTTGTAAATGA--TCT-GTTTTAGGTTATGTCCA-----ATCTCCAGATTGCAGCTCGAAGTTGATTGATCTAATTCTTTCA--TTT---GTTT--GAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_dispersa_B096_2 CG?ATGATAAAGTTACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATACGATATCC---AGTTTTGT-AAAAATCAGCTATTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATCCTTTTCTGTTATTTTCTTTTGTGATAGTAGGA---------TCATCAGTAGT---TATGAACACATTGCATTTTTT-------------------------------------ACTTTTCTTCCCATACTATTACTATGTAT--CCGATTCACCAA--ATCCTGATGGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTAAT-GTAAAGAATAAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTAATGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTTTGATTCTCTGACTTAT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGGTCGTCTAGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCGTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTGAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCAGGAGGAGTTGCTTTGTCCATGTACAATACTGATGAGGTTGGGCTTGTAAATGA--TCT-GTTTTAGGTTATGTCCA-----ATCTCCAGATTGCAGCTCGAAGTTGATTGATCTAATTCTTTCA--TTT---GTTT--GAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_dispersa_B104_1 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCCTTAAGAATTTTTGATTCTCTGACTTAT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGGTCGTCTAGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCGTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTGAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCAGGAGGAGTTGCTTTGTCCATGTACAATACTGATGAGGTTGGGCTTGTAAATGA--TCT-GTTTTAGGTTATGTCCA-----ATCTCCAGATTGCAGCTCGAAGTTGATTGATCTAATTCTTTCA--TTT---GTTT--GAGCATA--GTCCATTCGTG--------------------------- Mentzelia_dispersa_B104_2 CG?ATGATAAAGTTACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATACGATATCC---AGTTTTGT-AAAAATCAGCTATTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATCCTTTTCTGTTATTTTCTTTTGTGATAGTAGGA---------TCTTCAGTAGT---TATGAACACATTGCATTTTTT-------------------------------------ACTTTTCTTCCCATACTATTACTATATAT--CCGATTCTCCAA--ATCCTGATGGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTAAT-GTAAAGAATAAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTAATGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTTTGATTCTCTGACTTAT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGGTCGTCTAGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GCTGGTGTTGTCGGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTGAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTGAAGAACCATTTGTTCATTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AATGACGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCAGGAGGAGTTGCTTTGTCCATGTACAATACAGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTTGGTCCA-----ATCTCC--ATTGCAGCTCGAAGTTGATTGATCTAATTCTTTCA--TTT---GTTT--GAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_dispersa_B104_3 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATTT-ATTAA-----------CTCTCTACAATTTTTAATGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTTTGATTCTCTGACTTAT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAGCC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTTTTTTCTCGATAACGCTGGTCGTCTAGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCGTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTGAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AATGACGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCAGGAGGAGTTGCTTTGTCCATGTACAATACAGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTTGGTCCA-----ATCTCC--ATTGCAGCTCGAAGTTGATTGATCTAATTCTTTCA--TTT---GTTT--GAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAGCACT Mentzelia_dispersa_B104_4 {CT}G-ATGATAAAGTTACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATGCGATATCC---AGTTTTGT-AAAAATCAGCTCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATCCTTTTCTGTTATTTTCTTTTGTGATAGTAGGA---------TCATCAGTAGT---TATGAACACATTGCATCTCTT-------------------------------------ACTTTTCTTCCCATACTATTACTATGTCT--CCGATTCACCAA--ATCCTGATGGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTGAT-GTAAAGAATAAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTACTGGTTTAGTAGTACTAAGTTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTATGAG-----ATTATCCTTAAGAATTTTTTATTCTCCGACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGATTATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGC-TTTTTTTTGATAACGCTGCTCGTCTCGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTGAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTGAAGAACCATTTGTTCATTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AATGACGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCAGGAGGAGTTGCTTTGTCCATGTACAATACAGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTTGGTCCA-----ATCTCC--ATTGCAGCTCGAAGTTGATTGATCTAATTCTTTCA--TTT---GTTT--GAGCATA--GTCCATTCGTG-CTTTTGCTGAGGTTTCAATGAACACT Mentzelia_dispersa_B104_5 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCATTGGATTTTGGTGCTCTAT----GCAGTTCCAGAAGGAGGAAAGGATGAAACTACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCCTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGATTATGCCCG-----ATATTCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_dispersa_B104_6 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATTAA-----------CTCTCTAGAATTTTTACTGGTTTACCAGTAGTAAGTTATTGT--AAAATGTGATTTTGATGGTTTATGGTAATAATGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTAGATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTATTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAGCTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGC-TTTTTT-CTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_dispersa_B362 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT-CTTCCCATACTATTACTATGTAT--CCGATTTACCAA--ATCCTGATGGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTAGAGTGGGCTGAGTTTGAT-GTAAAGAATAAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTAATGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGATTTTAATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCTAATGGCAC-AATAAGGAACATTTTAAAT-GGTCTGTG-----ATTATCCTTAAGAATT{CT}TTGATTCTCTGACTTTT-ATAT--GCATCTATTGG{CT}GATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTTCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTAGCCTTTTT-ACTATGACTAGATATTAACT{CT}TCAA---GCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTGAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-TTATTGTTAATTTTTTTTGTTGATTATTTAAAG{AG}ACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGGGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGTCCA-----ATCTCT-------AGCTCGAAGTTGATTGATCTAATTCTTTCA--TTT---GTTT--GAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_dispersa_B388_1 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCTCCAA--ATCCTGATGGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTAAT-GTAAAGAATAAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTAATGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTTTGATTCTCTGACTTAT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_dispersa_B388_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT-CTTCCCATACTATTACTATGTCT--CCGATTCACCAA--ATCCTGATGGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTGAT-GTAAAGAATAAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTACTGGTTTAGTAGTACTAAGTTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTATGAG-----ATTATCCTTAAGAATTTTTTATTCTCCGACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGATTATTGTGCTTGTC{CT}CCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGC-TTTT{CT}TTTGATAACGCTGCTCGTCTCGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTGAAATTGGTTTTTGGTG{AG}ACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTG{CT}TTAGTTTTTT-GTTGATTATTTGAAGAACCATTTGTTCATTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AATGACGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCAGGAGGAGTTGCTTTGTCCATGTACAATACAGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTTGGTCCA-----ATCTCC--ATTGCAGCTCGAAGTTGATTGATCTAATTCTTTCA--TTT---GTTT--GAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_dispersa_B388_3 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCTCCAA--ATCCTGATGGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTAAT-GTAAAGAATAAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTAATGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTTTG{AG}TTCTCTGACTTAT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGGTCGTCTAGCCTTTTT-ACTATGACTAGATATTAAC{CT}TTCAA---GCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCGTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTGAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCC{AG}AGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATT{AG}A-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCAGGAGGAGTTGCTTTGTCCATGTACAATACTGATGAGGTTGGGCTTGTAA-TGA--TCT-GTTTTAGGTTATGTCCA-----ATCTCCAGATTGCAGCTCGAAGTTGATTG-TCTAATTCTTTCA--TTT---GTTT--GAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_eremophila_B049_1 TG-ATGATAAAGTTACAGTTGAAAGT-GCTGAAGCTACTCTTAAGTATGTACTTTTTCTACTAGATACAATATCTTGTTGTTTTGT-AAAAACCAGCTCTATTTT-GGAAGTT-------CTTTTTCTTTTGCATTATCCTTTT---------------GTGATAGTA---------------TCAGTGGT---TATGAGCACATTGCATTTCTT-------------------------------------ACTTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATCAA-----------CTCTCTAGAATTTTTACTGGTTTACCAGTACTAAGTTATTGT--AAAATGTGATTTTGATGGTTTATGGTAATAATGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTGAGAATTTTAGATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTATTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAGCTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTATCCATGTACAATACCGATGAGGTTGGGCATGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_eremophila_B049_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATACTT-----------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTTTCTTCCCATATTATTACTATATAT--CCGATTCACCAA--GTCCTGAT{GT}GAAATTATTGTAAT{GT}GTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTAGTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCT{CT}AAGAATTTCTGATTCTC{CT}AACTTTT-ATAT--GCATCTATTGGGGATGAGTCT-------------------------------GATGACCATTGTGCCTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGCGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTTTGCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTATTAA-TTTTTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGAAGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATATAGTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_eremophila_B049_3 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCT--GACTTTT-ATAT--GCATCTATTCGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACTGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATATCTAGATATGAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATCTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTC-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCCGA-CC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_eremophila_B049_4 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTTTATAC-TTTCTTCATTT--TCTCCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACAGAGTTGGAAATTTATAACTTCATAGGAGGAGGAGGATTTGCATTGTCTATGTACAATACCTATGAGGTTGGGCTTGTAAATTA--TAATGTATTAGGTTATGTCCG-----ATCTCTAGATTGCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGCTTGTGAGCATA--GTCCATTTGTG--------------------------- Mentzelia_eremophila_B049_5 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTC------------------AAGAATTTCTGATTCTCTGACTTTT-ATAT--GCATTTATTGGTGAT----------------------------------------GACCATTGTGCTTGTCTCCC---GCAGCAAGTACCATCTTC-TGAGAACC-ACTTATTTGCAAAAA---------TTGT-CCCCAGACTCGTTTCAGGTACTT-ATC-TTTGTCTTGATTACGTTGCTCGTCCCACTTTTTT-ACCTTGTCTAGATATCAACTCTCACGCATCTGGTATTTTCAGGATGGACAAAGCCAATATGTATCGGAGGGCATGCTTTTGGTGATCGCTACCGAGCAACTGATG---CAGTTATTATGGGAGTTGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTTT---ATTGACCATTTTAAGGACCATTTGTTCTTTCT--ATTTCCGA-CCATGTTTATAC-TTTCTTCATTT--TCTCCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACAGAGTTGGAAGTTTATAACTTCA---------------------------------------------------------------------------TTATGTCCG-----ATCTCTAGATTGCAGCTCGAAGCTAATTGATCTAATCCTTTAA--ATTTTGGCTTGTGAGCATA--GTCCATTTGTG--------------------------- Mentzelia_eremophila_B049_6 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GTTT------------------AAGAATTTCTG----------TTTT-ATAT--GCACCTATGGGTGAT---------------------------------------TGACCATTGTGCTTGTCTCCC---GCAGCAAGTACCATCTTC-AGAGAACC-ACTTATTTGCAAAAA---------TTGT-CCCCAGACTCGTTTCAAGTACTT-ATCTTTTGTCTTGATTACGCTGCTCGTCCAACTTTTTT-ACCATGTCCAGATATCAACTCTCACACAGCTGGTGTTGTCAGGATGGACAAAGCCAATATGTACTGGAAGGCATGCTTTTGGGGATCGCTACCGAGCAACTGATGATGTAGTTATTAT-GGAGTTGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTTT---ATTGATCATTTTAAGGACCATTTGTTCTTTAT--ATTTCCGG-ACATGTTTATAC-TTTCTTCATTT--TCGCCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACTGAGTTGAAAGTTTATAACTTCATAGGCGGAGGAGGAGTTGCTTTGTCTATGTACAATACCTATGAGGTTGGGCTTGTAAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCACATTGCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGCTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_eremophila_B049_7 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTT------------------AAGAATTTCTG----------TTTT-ATAC--GCACCTATGGGTGAT---------------------------------------TGACCATTGTGCTTGTCTCCC---GCAGCAAGTACCATCTTC-AGAGAACC-ACTTATTTGCAAAAA---------TTGT-CCCCAGACTCGTTTCAAGTACTT-ATCTTTTGTTTTGATTACGCTGCTCGTCCAACTTTTTT-ACCATGTCCAGATATCAACTCTCACACAGCTGGTGTTGTCAGGATGGACAAAGCCAATATGTACTGGAAGGCATGCTTTTGGGGATCGCTACCGAGCAACTGGTGATGTAGTTATTAT-GGAGTTGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTTT---ATTGATCATTTTAAGGACCATTTGTTCTTTAT--ATTTCCGG-ACATGTTTATAC-TTTCTTCATTT--TCGCCGAATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACTGAGTTGAAAGTTTATAACTTCATAGGCGGAGGAGGAGTTGCTTTGTCTATGTACAATACCTATGAGGTTGGGCTTGTAAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCACATTGCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_eremophila_B496_1 TG-ATGATAAAGTTACAGTTGAAAGT-GCTGAAGCTACTCTTAAGTATGTACTTTTTCTACTAGATACAATATCTTGTTGTTTTGT-AAAAACCAGCTCTTCTTT-GGAAGTT-------CTTTTTCTTTTGCATTATCCTTTT---------------GTGATAGTA---------------TCAGTGGT---TATGAGCACATTGCATTTCTT-------------------------------------ACTTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATTAA-----------CTCTCTAGAATTTTTACTGGTTTACCAGTACTAAGTTATTGT--AAAATGTGATTTTGATGGTTTATGGTAATAATGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTAGATACTCTGACTATA-ATAT--GCATCT-TTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTATTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACAACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTATCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_eremophila_B496_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACT{CT}TTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGTT-------CCTTTTC{CT}T{CT}TGCATTATACTT-----------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTT-CTTCCCATATTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAA{AG}TTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTAGTCAATTTTTGT--AAAATGTGATTTTGATCGTTTAAGGTA{AG}TATTGTCTACAGATG{AG}AGATCGTGTGAGAGAATTTAAG-TTGAAGCA{AG}ATGTGG-AAGAGTCCAAACGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGGGATGAGT---------------------------------GATGACCATTGTGCCTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CG{CT}-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGCGTTGTCAGGATGGACAAAGCC{AG}ATTCGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTTTGCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTATTAA-TTTTTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGAAGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA---TTTTGGTTTGTGAGCATATAGTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_eremophila_Provance1959 TG-ATGATAAAGTTACAGTTGAAAGT-GCTGAAGCTACTCTTAAGTATGTACTTTTTCTACTAGATACAATATCTTGTTGTTTTGT-AAAAACCAGCTCTATTTT-GGAAGTT-------CTTTTTCTTTTGCATTATCCTTTT---------------GTGATAGCA---------------TCAGTGGT---TATGAGCACATTGCATTTCTT-------------------------------------ACTTTTCTTCCCATACTATTACTATATATATCCGATTCACCAA--GTCCTGATGGAAATTGTTGTAATGGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATTAATAATTTATTAACTCTCTAGAATTTTTACTGGTTTACCAGTACTAAGTTATTGT--AAAATGTGATTTTGATGGTTTATGGTAATAATGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATCTTAGATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTATTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TAATTT-CTATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTAG-CCATTTTATTAA-TTTCTTCATTT--TCACTGGATTT-GGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTATCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_goodrichii_H4144 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAGCTCCAGGTACAGGTGGC{CG}GAG{CG}T{AC}GAT-GTGAAGATTTATGTAATGTAATTT-ATTAC-----------CTCTTTAAAACTTTTTGGGA--------------------------TATGTGATCTTGATGAATTATGGAAATATTGTCTTCAG{AC}TGAAGATCGTGTGAGAGAA-TTAAGTTTGAAACAAATGTGGAAAGAGTCCGAATGGCACAAATTAGGAACATTTTGAATGGGTCTGTG-----AATATCCTTAACAATTTCTGATTTCCCGAATTTTTATAT--GCATCTATTGATGAT----------------------------------------GACCATTGTGCTTGTCTCCT---GCTGCAGGCACAGTCTTCCCGAGAACC-AATTATTTGCAATAA----------TGT-CCCCAGGCTTGTTCCAGGTACTTTAGCTTTTTTCTTGATACTGCTGCTCGTCTCA-TTTTTT-ATTATGACTAGATATCATCTTTCAAGCGGCTGCTGTTGTCAGGATGGACAAAGCCGATATGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACTGATG---CTGTTATTAAAGGAGCAGGGAAATTAAAATTGGTTTTTGGCGAACTTCTCTTCCCTTTCAAGCTTAACAAGAATTTGAGA-CTTTTT-CTTTTGTTTAGTTTTT--GTTGATCATTTAAAGAACCATTTGTTCTTTTT--ATATCCGG-CCATGTTAT-------------------------------------------GCAGCGCCAGAAGGA---AAGGACGAAAAGACAGAGTTGGAAGTTTTTAACTTTAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Mentzelia_gracilenta_B069_1 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATTATTTAAACAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TACTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_gracilenta_B069_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGAATAATAGGATCATCAGTAGT---GATGAACACATTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--CCCATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAA-TAT-TAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTTT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTGTG-------ATTATCCTTAAGAAATTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCATCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCGGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_gracilenta_B069_3 TG-ATGATAAAGTCACTGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAACATCCTGTTGTTTTGTAAAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAACACATTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--TCGATTCACCAA--GTCCTGATTGAAATAATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATGAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTTT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTGTG-----ATTATCGTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTAATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATTTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTA-ACTATGACTAGACATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTATAGTTTTTT-GCTGATTATTAAAAGAACCATTTGTTCTTTCT--ATTTCTGGCCCTTGTTATTAC-TTTTTCCTTTC--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAGGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TACTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTCAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_gracilenta_B214_1 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTTTCTTGATAACGCTGCTCGTCTCGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GCTGGTGTTGCCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTGAAATTGGTTTTTGGTGAACTCCTCTTCCCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTGAAGAACCATTTGTTCATTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_gracilenta_B214_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGAGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCT---------------------------------- Mentzelia_gracilenta_B214_3 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTAT----TACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGTT-------CATTTTCTTCTGCATTATACTGTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACTTTT-ATAT--GCATGTATTGCTGATGAGTCT-------------------------------GATGATCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCA{AG}GCTTGT{CT}CCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGAG-CCTTGTTATTAA-TTTCTTTCTTT--TCACTGGATTTTGGTGCTCTTT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTCCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_gracilenta_B214_4 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTAT----TACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGTT-------CATTTTCTTCTGCATTATACTGTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACTTTT-ATAT--GCATGTATTGCTGATGAGTCT-------------------------------GATGATCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATGGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGCTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTTCTTT--TCACTGGATTTTGGTGCTCTTT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTCCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_gracilenta_B215_1 TG-ATGATAAAGTCAC{AG}GTTGAAAGT-GCAGAAGCTACTCT{GT}AAGTATGTACTTTTACTAT----TACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGTT-------CATTTTCTTCTGCATTATAC{CT}GTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTT-CTTCCCATGCTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTT{AG}AT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACTTTT-ATAT--GCATGTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTTCTTT--TCACTGGATTTTGGTGCTCTTT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTCCG-----ATCTCCAGA{CT}TGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTG{AG}GGCTTCAATGAACACT Mentzelia_gracilenta_B215_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTAT----TACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGTT-------CATTTTCTTCTGCATTATACTGTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATCGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGGTGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACTTTT-ATAT--GCATGTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTT--ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCTAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTTCTTT--TCACTGGATTTTGGTGCTCTTT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTCCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCGTA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_gracilenta_B215_3 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTGCTGCAGGTACCGTCTTC-AGAGAACC-GATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAGGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTTCTTT--TCACTGGATTTTGGTGCTCTTT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTCCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_gracilenta_B215_4 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGAATAATAGGATCATCAGTAGT---GATGAACACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCCATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTAATTGGTTCAGCAGTACTCAGTTTTTTT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTGTG-------ATTATCCTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_jonesii_B063_1 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--ATCCTGATGTGAATCATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGGAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTGAT-GTAAAGAATAAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTACTGGTTTAGCATTACTAAGTTCTTGT--AAGATGTGATTTTGATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTCTG-----ATTATCCTTAAGAATTTTTTATTCTCTGACTTTT-ATAT--GCATCTATTAGTGATGAGTCT-------------------------------GATGACCATTGTGCTCGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTACTCGTCTCGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTGAAGAACCATTTGTTCT-------------G-CCATGTTATTAA-TTTCTT-------TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGT--TATTGTTTTAGGTTATATCCG-----ATCTCCAGATTGCAGCTCGAAGTCGATTGATCTAATTCCTTCA--TTT---GTTT--GAGCATA--GTCCATTTGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_jonesii_B063_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATCAAATGTGC{AT}ACCATTA-CTCCAGGT-----------AGTTTGAT-GTAA{AG}GAATTAT-TAAT-TAATTT-ATTAA-----------CTCTCTAGAATTTTTACTGGTTTACCAGTACTAAGTTATTGT--AAAATGTGATTTTGATGGTTTATGGTAATAATGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTAGATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTG-TCCAGGTATTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAGCTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTTTCTATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT---CACTGGATTTT{AG}GTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTATCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAA{CT}GAACACT Mentzelia_jonesii_B063_3 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACTTTT-ATAT--GCATGTATTGCTGATGAGTCT-------------------------------GATGATCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTTCTTT--TCACTGGATTTTGGTGCTCTTT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTCCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAGTTCCTTAA--TTTTTGGTTTGTGA--------------------------------------------- Mentzelia_jonesii_B193_1 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----AT-ATCCTTAAGAATTTCTGATTCTCTGACTTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-ATTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTAATGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATATCGGG-CCTTGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTT--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTG---------------------------------------------- Mentzelia_jonesii_B193_2 -------------------------------AAGCTACTCTTAAGTATGTATTTTTACTATTAGATACAATATCCTGTTGTTTTGT--AAAACCAGCCCTTTTCT-GGAAGTT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAACACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTGCTCAGTTTTTTT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCT--GACTTTT-ATAA--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGCCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAGCATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTATAGAACCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTTTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--AATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAATTTTTTTTTTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_jonesii_B193_3 -------------------------------AAGCTACTCTTAAGTATGTACTTTTACTTTTT-ATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTCT-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---GATGAACACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTTAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTTCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTAGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTGGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATATCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTT--GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTATTAA-TTTCTTCTTTT--TCACTGAATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCCGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTG--TATAGTATTAGGTTATGTCCG-----ATCTCCAGATTGCAGCTCGAAGCTGGTTGATCTAATTCCTTAT--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_jonesii_B433 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTAAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATACTT-----------------GTTATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTT-CTTCCCATATTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTAGTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGGGATGAGTCT-------------------------------GATGACCATTGTGCCTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGCGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTATTAA-TTTTTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTTCCAGAAGGA---AAGGAAGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_lindleyi_B087_1 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTGTG---ATTATCCTTAGGAATTTTAGATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTATTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGTTGGTGTTGTCAGGATGGACAAGGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAGCTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTTTCTATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTATCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTT-A--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_lindleyi_B087_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTAT----TACAATATCCTGATGTTTTGT-AAAAACCAGCCCTTTTTT-GGAAGTT-------CATTTTCTTCTGCATTATACTGTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCTGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACTTTT-ATAT--GCATGTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCTAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGGTGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_lindleyi_B087_3 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAACATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGCT-------CCTTTTCTTTTGCATTATACTTTT---------------GTG{AG}TAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTCTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAACATTGTCTACAGATGAGGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACTTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTAATGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATATCGGG-CCTTGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_lindleyi_B087_4 TG-ATGATAGAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGCT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTCTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAACATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTG{CT}G-----ATTATCCT{CT}AAGAATTTCTGATTCTCTGACTTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATA{AT}CAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTAATGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATATCGGG-CCTTGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_lindleyi_B087_5 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GTTT------------------AAGAATTTCTG----------TTTT-ATAT--GCACCTATGGGTGAT---------------------------------------GGACCATTGTGCTTGTCTCCC---GCAGCAAGTATCATCTTC-AGAGAACC-ACTTATCTGCAAAAATTGCAAAAATTGT-CCCCAGACTCGTTTCAAGTACTT-ATCTTTTGTCTTGATTACGCTGCTCGTCCAACTTTTT--ACCATGTCCAGATATCAACTCTCACACAGCTGGTGTTGTCAGGATGGACAAAGCCAATATGTACCGGAAGGCATGCTTTTGGGGATCGCTACCGAGCAACTGATGATGTAGTTATTAT-GGAGTTGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTTT---ATTGATCATTTTAAGGACCATTTGTTCTTTAT--ATTTCCGG-CCATGTTTATAC-TTTCTTCATTT--TCGCCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACTGAGTTGGAAGTTTATAACTTCATAGGCGGAGGAGGAGTTGCTTTGTCTATGTACAATACCTATGAGGTTGGGCTTGTAAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCACATTGCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGTTTCTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_lindleyi_B090_1 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACTTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-ATTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTAATGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATATCGGG-CCTTGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTT-ATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTT--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_lindleyi_B090_2 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACTTTT-ATAT--GCATGTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGACCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGCCTTTGGTGAACTTCTCCTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTTCTTT--TCACTGGATTTTGGTGCTCTTT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTCCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_lindleyi_B216_1 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTAATTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGCT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTTC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT----------AAGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAACATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACTTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGACG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATATCGGG-CCTTGTTATTAA-TCTCTTCCTTT--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTT--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_lindleyi_B216_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGCT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTCTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAACATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACTTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTATGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTAATGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATATCGGG-CCTTGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_lindleyi_B216_3 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTTACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACTTTT-ATAT--GTATCTATTGCTGACGAGTCT-------------------------------GATGACCAATTTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAAAGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGACATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACAACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----CTCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCAT-------------------------------- Mentzelia_lindleyi_B216_4 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---GATGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_memorabilis_H4153 TG-ATGATAAAGTTACTGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTTTTTACAGTATCCTGTTATTTTGT-AAAAACCAGCTCTTTTTT-TGAAGTT-------TCTTTTCTTTTGCATTT-----------------ATTTTGTTATAGTAGGA---------TTATCAATGGT---TATGAACACATTGCACTTCTT-------------------------------------ACTTTGCTTCCCATACAACTACTATATTT--CTGATTCACTAA--GTTCTGATGAAAAT-ATTGTAATTGCAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTGAT-GTGAAGATTTAT-TAAT-TAATTT-ATTAC-----------CTCCTT--AACGTTCTTTGA--------------------------TATGTGATCTTGATGAATTATGGAAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAACAAATGTGG-AAGAGTCCGAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----AATATCCTTAACAATTTCTGATTTCCCGAATGTTTATAT--GCATCTATTGATGAT----------------------------------------GACCATTGTGCTTGTCTCCT---GCTGCAGGCACAGTCTTC-AGAGAACC-AATTATTTGCCAAAA----------CGT-CCCCAGACTTGTTCCAGGTACTTTAGCTTTTTTCTTGATACTACAGCTCGTCTCA-TTTTTT-ATTATGGCTAGATATCATCTTTCAAGCGGCTGCTGTTGTCAGGATGGACAAAGCCGATATGTATTGGGAGGCATGCTTTTGGTGATCAATACCGAGCAACTGATG---CTGTTATTAAAGGAGCAGGGAAATTAAAATTAGTTTTTGGTGAACTTCTCTTCCCTTTCAAGCTTAACATGAATTTAAGATTTTTTT-CTTTTGTTTAGTTGTT--GTTGATCATTTAACAAACCATTTGTTCTTTCT--ATATCAGA-CCATGTTATTAT-TTTATTCCTTT--TCACTGGGTATTGGTGCTTTAT----GCAGTGCCAGAAGGA---AAGGACGAAAAGACAGAGTTGGAAGTTTTTAACTTTACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTATATTA--TATTGTATTAGCTTATGTTCA-----GTCTCCAGATTGCAGCCGGAAGCTGATTGATCTAATTCGTTAA--TTCTTGGTTTGGGAGCATA--GTCCATTCATG-CTTTTGCCGAGGCTTCAATGAAA--- Mentzelia_micrantha_B260_1 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--ATCCTGATGTGAATCATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTGAT-GTAAAGAATAAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTACTGGTTTAGCATTACTAAGTTCGTGT--AAAATGTGATTTTGATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCT{CG}TG-----ATTATCCTTAAGAATTTTTTATTCTCTGACTTTT-ATAT--GCATCTATTAGTGATGAGTCT-------------------------------GATGACCATTGTGCTCGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCG{AG}GCAACTGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTGAAGAACCATTTGTTCT-------------G-CCATGTTATTAA-TTTCTT-------TCACTGGATT{CT}TGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGT--TATTGTTTTAGGTTATATCCG-----ATCTCCA{AG}ATTGC{AG}GCTCGAAGTCGATTGATCTAATTCCTTCA--TTT---GTTT--GAGCATA--GTCCATTTGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_micrantha_B260_2 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTGTG---ATTATCCTTGAGAATTTTAGATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTATTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAGCTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_micrantha_B260_3 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTT-GGTTTGTGAGCATATAGTCCATTCGTG--------------------------- Mentzelia_micrantha_B266 TG-ATGATAAAGTTACAGTTGAAAGT-GCAGAAGCTACTCTCAAGTATGTA{CT}TTTTACTATTAGATACGATATCC---AGTTTTGT-AAAAAACAGCTCTTTTTT-GGAAGTT-------CCTTTTC------------------TGTTATTTTCTTTTGTGATAGTAGGA---------TCATCAGTAGT---TATGAACACATTGCATTTCTT-------------------------------------ACTTTTCTTCCCATACTATTACTATATAT--CCGATTCACCAA--ATCCTGATGTGAATCATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAG{CT}TTGAT-GTAAAGAATAAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTACTGGTTTAGCATTACTAAGTTCTTGT--AAAATGTGATTTTGATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTCTG-----ATTATCCTTA{AG}GAATT{CT}TTTATTCTCTGACTTTT-ATAT--GCATCTATTAGTGATGAGTCT-------------------------------GATGACCATTGTGCTCGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTACTCGTCTCGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGA{GT}CTGG{AT}AAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTT-ACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTGAAGAACCATTTGTTCT-------------G-CCATG{CT}TATTAA-TTTCTT-------TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACG{AG}CAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGT--TATTGTTTTAGGTTA{AT}ATCCG-----ATCTCCAGATTGCAGCTCGAAGTCGATTGATCTAATTCCTTCA--TTT---GTTT--GAGC{AG}TA--GTCCATTTGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_mojavensis_B479_1 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATTAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATCAA-----------CTGTCTAGGATTTTTACTGGTTTACCAGTACTAAGTTATCGT--AAAATGTGATTTTGATGGTTTATGGTAATACTGTCTACAGATGAAGATCGTGTGCGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTAGATACTCTGACTATT-ATATATGCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCT---ACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTCCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAACTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTCCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTTGTATTT--GTTGATTATTTAAAGAACCATTTGCTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACAACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_mojavensis_B479_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AGAAACCAGCCCCTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATACTT-----------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTTTCTTCCCATATTATTACTATATAT--CCGATTCACCAA--CTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTAGTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGCGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGGGATGAGTCT-------------------------------GATGACCATTGTGCCTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGCGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCCTTCT--ATTTCTGG-CCTTGTTATTAA-TTTTTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGAAGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGA----- Mentzelia_mollis_B235_1 TG-ATGATAAAGTTACAGTTGAAAGT-GCGGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATACAATATCCTGTTGTTTT--ACAAAACCAGCTCTTTTTTTGGAAGTT-------CCTTTTCTTCTGCATTATCCTTTTCTGTTATTTTCTTTTGTGATAATAGGA---------TCATTTGTAGT---TATGAACACATTGCATTTCTT-------------------------------------ACTTT-CTACCCTAACTGTTTCTATATTT--CTGATTCACCAA--ATCCTGAT-GAAAGTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTATAGTTGGCTGAGTTTGAT-GTAAAGAATTAT-TAAT-TGATTT-ATCAA-----------CTCTCTACAATTTT-ACTGGTTTAGCAGTACTAAATTTTTGT--AAAATGTGATCTTGATGGTTTATGGTAATATTCTCTACAGGTGAAGATCGTGTGAGAGAATTTAAG-TTGAAACAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTATGTGTG---ATTATCCTTAAGAATTTTTGATACTCTGACTTTT-ATAT--GCATCTATTGGTGATGAGACT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCCATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTCATTAAAGGAGCTGGGAAACTAAAATTGGTTTTCGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAA-TTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAT-TTTCTTCATTT--TCACTGAATTTTGGTGCTCTAT----GCAGTCCCAGAAGGA---AAGGATGAAACGACAGAATTGGGAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCGATCCGATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTAA--TTTGTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCATTGAAC?CT Mentzelia_mollis_B235_2 TG-ATGATAAAGTTACAGTTGAAAGT-GCTGAAGCTACTCTTAAGTATGTACTTTTACTACTAGAGACAATATCTTGTTGTTTTGT-AATAACCAGCTCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATCCTTTT---------------GTGATAGTA---------------TCAGTGGT---TATGAGCACATTGCATTTCTT-------------------------------------ACTTT-CTTCCCATACTATTGCTATATAT--CCGATTCACCAAAAGTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTACTGGTTTACCAGTACTAAGTTTTTGT--AAAATGTGATTTTGATGGTTTATGATAATACTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_mollis_B235_3 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATGATTGTAAT-GTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AATTTGAT-ATAAAGAATTAT-TAAT-TAA--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAGTTTTTGT--AAGATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGG{CT}AC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCT--GACTTTT-ATAT--GCATCTATTCGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGC{CT}GCTGCAGGTACTGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCC{AT}GGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTC{CT}C{AG}CCTTTTT-ACTATATCTAGATATGAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATCTGTATTGGAAGGCA{CT}GCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTC-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TATCTTCCTTTT-TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTCCG-----ATCTCCAGATTGCAGCTTGAAGCTCATTGATTTAATTCTTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_mollis_B235_4 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GTTC------------------AAGAATTTCTG----------TTTT-ATAT--GCATCTATTGGTGAT----------------------------------------GACCATTGTGCTTGTCTCCT---GCAGCAAGTACCATCTTC-AGAGAACC-ACTTATCTGCAAAAAATGCAAAAATTGTTCCCCAGACTCGTTCGAAGTACTT-ATCTTTTGTCTTGATTACGCTGCTCCTCCCACTTTTTT-ACCATGTCCAGATATCAACTCTCACACAGCTGGTGTTGTCAGGATGGACAAAGCCAATATGTACCGGAAGGCATGCTTTTGGGGATCGCTACCGAGCAACTGATGATGCAGTTATTAT-GGAGTTGGGAAATTATTATTGGTTTTGGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTTT---ATTGATCATTTTAAGGACCATTGGTTCTTTCT--ACTTGCGG-CCATGTTTATAC-TTTCTTCATTT--TCGTCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAACACTGAGTTGGAAGTTTATAACTTCATAGGCGGAGGAGGAGTTGCTTTATCTATGTACAATA---ATGAGGTTGGGCTTGTAAATTA--TATTGTATTAGGTTATCTCCG-----ATCTCCACATTGCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_mollis_B236_1 TG-ATGATAAAGTTACAGTTGAAAGT-GCGGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATACAATATCTTGTAGTTTTGTACAAAACCAGCTCTTTTTTTGGAAGTT-------CCTTTTCTTTTGCATTATCCTTTTTTGTTATTTTCTTTTGTGATAATAGGA---------TCATTTGTAGT---TATGAACACATTGCATTTCTT-------------------------------------ACTTTTCTTCCCTAACTGTTTCTATATTT--CTGATTCACCAA--ATCCTGAT-GAAAGTACTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTATAGTTGGCTGAGTTTGAT-GTAAAGAATTAT-TAAT-TGATTT-ATTAA-----------CTCTCTACAATTTT-ACTGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGATCTTGATGGTTTATGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAACAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTATGTGTG---ATTATCCTTAAGAATTTTTGATACTCTGACTTTT-ATAT--GCATCTATTGGTGATGAGACT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGAGAACGCTGCTCGTCTCATCGTTTT-ACTATGAGTAGATATCAACTT-AAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCCATTTGTATTGGAAGG{GT}ATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTCATTAAAGGAGCTGGGAAACTAAAAATGGTTTTCGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAA-TTGAGA-TTTTTT-CTATTGTT-AGTTTTTT-GTTGATTATTTAAAGAAACATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTCT-TTTCTTCATTT--TCACTGAATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGATGAAACGACAGAATTGGAAGTTTATAACTTTACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCGATCCGATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTAA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCCGAGGCTTCAATGAACACT Mentzelia_mollis_B236_2 TG-ATGATAAAGTTACAGTTGAAAGT-GCGGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATACAATATCTTGTAGTTTTGTACAAAACCAGCTCTTTTTTTGGAAGTT-------CCTTTTCTTTTGCATTATCCTTTTTTGTTATTTTCTTTTGTGATAATAGGA---------TCATTTGTAGT---TATGAACACATTGCATTTCTT-------------------------------------ACTTTTCTTCCCTAACTGTTTCTATATTT--CTGATTCACCAA--ATCCTGAT-GAAAGTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTATAGTTGGCTGAGTTTGAT-GTAAAGAATTAT-TAAT-TGATTT-ATTAA-----------CTCTCTACAATTTT-ACTGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGATCTTAATGGTTTATGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAACAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGT{AC}TGTG-----ATTATCCTTAAGAATTTT{CT}GATACTCTGACTTTT-ATAT--GCATCTATTGGTGATGAGACT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTAT{CT}TGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGAGAACGCTGCTCGTCTCATCGTTTT-ACTATGAGTAGATATCAACTT-AAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCCATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTCATTAAAGGAGCTGGGAAACTAAAATTGGTTTTCGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAA-TTGAGA-TTTTTT-CTATTGTT-AGTTTTTT-GTTGATTATTTAAAGAAACATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTCT-TTTCTTCATTT--TCACTGAATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGATGAAACGACAGAATTGGAAGTTTATAACTTTACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCGATCCGATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTAA--TTTTTGG{CT}TTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_mollis_B236_3 TG-ATGATAAAGTTACAGTTGAAAGT-GCGGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATACAATATCTTGTAGTTTTGTACAAAACCAGCTCTTTTTTTGGAAGTT-------CCTTTTCTTTTGCATTATCCTTTTTTGTTATTTTCTTTTGTGATAATAGGA---------TCATTTGTAGT---TATGAACACATTGCATTTCTT-------------------------------------ACTTTTCTTCCCTAACTGTTTCTATATTT--CTGATTCACCAA--ATCCTGAT-GAAAGTATTGTAATTGTAGGTACAATGCAGCTATCAAATGTGCAACCATTA-CTCCAGGTATAGTTGGCTGAGTTTGAT-GTAAAGAATTAT-TAAT-TGATTT-ATTAA-----------CTCTCTACGATTTT-ACTGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGATCTTGATGGTTTATGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAGTTTAAG-TTGAAACAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTATGTGTG---ATTATCCTTAAGAATTTTTGATACTCTGACTTTT-ATAT--GCATCTATTGGTGATGAGACT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGAGAACGCTGCTCGTCTCATCGTTTT-ACTATGAGTAGATATCAACTT-AAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCCATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCCATG---CAGTCATTAAAGGAGCTGGGAAACTAAAATTGGTTTTCGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAA-TTGAGA-TTCTTT-CTATTGTT-AGTTTTTT-GTTGATTATTTAAAGAAACATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTCT-TTTCTTCATTT--TCACTGAATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGATGAAACGACAGAATTGGAAGTTTATAACTTTACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCGATCCGATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTAA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_mollis_B236_4 TG-ATGATAAAGTTACAGTTGAAAGT-GCTGAAGCTACCCTTAAGTATGTACTTTTACTACTAGAGACAATATCTTGTTGTTTTGT-AATAACCAGCTCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATCCTTTT---------------GTGATAGTA---------------TCAGTGGT---TATGAGCACATTGCATTTCTT-------------------------------------ACTTTTCTTCCCATACTATTGCTATATAT--CCGATTGACCAA--GTCCTGATGGAAATTATTG-AATGGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTACTGATTTACCAGTACTAAGTTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATACTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTTTATACTCTGTCTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCCTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCTATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCTACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCGCCTCCAAGCTTAACATGAATTTGAGA-CTTTTT-TTATCGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTAG-CCATGTTATTAA-TTTCTTCATTT--ACACTGGATTTTGGTGCTATAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACCACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGCCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTCTAGGTTATGCTCG-----ATATCCGGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCCTCAATGAACACT Mentzelia_mollis_B236_5 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTT------------------AAGAATTTCTG----------TTTT-ATAT--GCATCTATTGGTGAT----------------------------------------GACCATTGTGTTTGTCTCCC-C-GCAGCAAGTACCATCTTC-AGAGAACCCAATTATCTGCAAAAAA--------TTGT-CCCCAGACTCGTTTGAAGTACTT-ATCTTTTGTCTTGATTACGCTGCTCGTCCCACTTTTTT-ACCATGTCCAGATATCAACTCTCACACAGCTGGTGTTGTCAGGATGGACAAAACCAATATGTACCGGAAGGCATGCTTTTGGGGATCGCTACCGAGCAACTGATGATACAGTTATTAT-GGAGTTGGGAAATTAGTGTTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTTT---ATTGATCATTTTAAGGACCATTGGTTCTTTCT--ATTTCCGG-CCATGTTTA-AC-TTTCTTCATTT--TCGCCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACTGAGTTGGAAGTTTATAACTTCATAGGCGGAGGAGGAGTTGCTTTGTCTATGTACAATA---ATGAGGTTGGGCTTGTAAATTA--TATTGTATTAGGTTATGTCCG-----ATATCCACATTGCAGCTCGAAGCTGATTGATCCAATCCTTTAA--ATCTTGGTTTGTGAGC------------------------------------------- Mentzelia_mollis_B343B TG-ATGATAAAGTTACAGTTGAAAGT-GCGGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATACAATATCCTGTTGTTTT--ATAAAACCAGCTCTTTTTTTGGAAGTT-------CCTTTTCTTTTGCATTATCCTTTTCTGTTATTTTCTTTTGTGATAATAGGA---------TCATTTGTAGT---TATGAACACATTGCATTTCTT-------------------------------------ACTTT-CTTCCCTAACTGTTTCTATATTT--CTGATTCACCAA--ATCCTGAT-GAAAGTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATAA-CTCCAGGTATAGTTGGCTGAGTTTGAT-GTAAAGAATTAT-TAAT-TGATTT-ATTAA-----------CTCTCTACAATTTT-ACTGGTTTAGCAGTACTAAATTTTTGT--AAAATGTGATCTTGATGGTTTATGGTAACATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAACAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTATGTGTG---ATTATCCTTATGAATTTTTGATACTCTGACTTTT-ATAT--TCATCTATTGGTGATGAGACT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCCATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTCATTAAAGGAGCTGGGAAACTAAAATTGGTTTTAGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAA-TTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTCT-TTTCTTCATTT--TCACTGAATTTTGGTGCTCTAT----GCAGTCCCAGAAGGA---AAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCGATCCGATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTAA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_mollis_Tiehm7777 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCCTTAAGAATTTTTGATACTCTGACTTTT-ATAT--GCATCTATTGGTGATGAGACT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGAGAACGCTGCTCGTCTCATCGTTTT-ACTATGAGTAGATATCAACTT-AAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCCATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTCATTAAAGGAGCTGGGAAACTAAAATTGGTTTTCGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAA-TTGAGA-TTTTTT-CTATTGTT-AGTTTTTT-GTTGATTATTTAAAGAAACATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTCT-TTTCTTCATTT--TCACTGAATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGATGAAACGACAGAATTGGAAGTTTATAACTTTACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCGATCCGATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTAA--TTTT-GGTT-GTGAGCATA--GTCTATTCGTG--------------------------- Mentzelia_monoensis_B367_1 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT-CTTCCCATACTATTACTATGTAT--CCGATTCAGCAA--ATCCTGATGGAAATTACTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTGAT-GTAAAGAACAAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTACTGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGACTTTGATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTGTG-----ATTGTCCTTAAGATTTTTCGATTCTCTGACTTTT-ATATATGCATCTATTTGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTATTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACACTGCTCATCTCGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GTTGGTGTTGTCGGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTACTAAAGGAGCTGGGAAACTGAAATTGGTTTTTGGTGAACTTCTCTTCTCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTGAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAT-TTTCTTCCTTT--TCACTAAATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCAGGAGGAGTTGCTTTGTCCATGTACAATACTGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAAGTTATGTCCA-----ATCTCCAGATTGCAGCTCGAAGTTGATTGATCTAATTCTTTCA--TTT---GTTT--GAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_monoensis_B367_2 TG-ATGATAAAGTTACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATATGATATCC---AGTTTTGT-AAAAATCAGCTCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCCTTATCCTTTTCTGTTATTTTCTTTTGTGATAGTAGGA---------TCATCAGTAGT---TATGAACACATTGCATTTCTT-------------------------------------ACTTTTCTTCCCATACTATTACTATGTAT--CCGATTCAGCAA--ATCCTGATGGAAATTATTGTAATTGTAGGTACAATATAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTGAT-GTAAAGAACAAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTACTGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGACTTTGATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTGTG-----ATTGTCCTTAAGATTTTTTGATTCTCTGACTTTT-ATATATGCATCTATTTGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTATTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTCTTTTCTTGATAACACTGCTCATCTCGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTGAAATTGGTTTTTGGTGAACTTCTCTTCTCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTGAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAT-TTTCTTCCTTT--TCACTAAATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCAGGAGGAGTTGCTTTGTCCATGTACAATACTGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGTCCA-----ATCTCCAGATTGCAGCTCGAAGTTGATTGATCTAATTCTTTCA--TTT---GTTT--GAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_monoensis_B367_3 TG-ATGATAAAGTTACAGTTGAAAGT-GCTGAAGCTACTCTTAAGTATGTACTTTTTCTACTAGATACAATATCTTGTTGTTTTGT-AAAAACAAGCTCTTTTTTTGGAAGTT-------CCTTTTCTTTTGCATTATCCTTTT---------------GTGATAGTA---------------TCAGTGGT---TATGAGCACATTGCATTTCTT-------------------------------------ACTTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATTAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-GTCAA-----------CTGTCTAGGATTTTTACTGGTTTACCAGTACTAAGTTATTGT--AAAATGTGATTTTGATGGTTTATGGTAATACTGTCTACAGATGAAGATCGTGTGCGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAA{CT}GGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTAGATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTTT-------------------------------GATGACCATTGTGCTTGTCTCCT---ACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTT{AT}GGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTCCCCCTCCAAGCTTAAAA{CT}GAATTTGAGA-TTTTTT-CTATTGTTTTGTATTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACAACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTT{CT}TGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_monoensis_B520_1 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT-CTTCCCATACTATTACTATGTAT--CCGATTCAGCAA--ATCCTGATGGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTGAT-GTAAAGAACAAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTACTGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGACTTTGATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTGTG-----ATTGTCCTTAAGATTTTTTGATTCTCTGACTTTT-ATATATGCATCTATTTGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTATTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCGGGTACTT-AGCTTTTTTCTTGATAACACTGCTCATCTCGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTGAAATTGGTTTTTGGTGAACTTCTCTTCTCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTGAAGAACCATTTGTTCTTTCT--ATTCCTGG-CCATGTTATTAT-TTTCTTCCTTT--TCACTAAATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGAAAGTTTATAACTTCACAGGAGCAGGAGGAGTTGCTTTGTTCATGTACAATACTGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGTCCA-----ATCTCCAGATTGCAGCTCGAAGTTGATTGATCTAATTCTTTCA--TTT---GTTT--GAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_monoensis_B520_2 TG-ATGATAAAGTTACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATATGATATCC---AGTTTTGT-AAAAATCAGCTCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCCTTATCCTTTTCTGTTATTTTCTTTTGTGATAGTAGGA---------TCATCAGTAGT---TATGAACACATTGCATTTCTT-------------------------------------ACTTT-CTTCCCATACTATTACTATGTAT--CCGATTCAGCAA--ATCCTGATGGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTGAT-GTAAAGAACAAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTACTGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGACTTTGATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTGTG-----ATTGTCCTTAAGATTTTTTGATTCTCTGACTTTT-ATATATGCATCTATTTGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTATTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACACTGCTCATCTCGCCTTTTTTACTATGACTAGATATTAACTTTCAA---GTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTGAAATTGGTTTTTGGTGAACTTCTCTTCTCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTGAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAT-TTTCTTCCTTT--TCACTAAATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCAGGAGGAGTTGCTTTGTCCATGTACAATACTGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGTCCA-----ATCTCCAGATTGCAGCTCGAAGTTGATTGATCTAATTCTTTCA--TTT---GTTT--GAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_monoensis_B520_3 TG-ATGATAAAGTTACAGTTGAAAGT-GCAGAAGCTACTCTCAAGTATGTACTTTTACCATTAGATACGATATCC---AGTTTTGTAAAAAAACAGCTCTTTTTT-GGAAGTT-------CCTTTTC------------------TGTTATTTTCTTTTGTGATAGTAGGA---------TCATCAGTAGT---T----ACACATTGCATTTCTT-------------------------------------ACTTT-CTTCCCATACTATAACTATGTAT--CCGATTCACCAA--ATCCTGATGGAAATCATTGTAACTGTAGGTACAATGTGGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTGAT-GTAAAGAATAAT-TGAT-TATTTT-ATCAA-----------CTCTCTACAATTTTTACTGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATATTGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AGGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTTTTATTCTCTGACTTTT--TATATGCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_monoensis_B520_4 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTATTT-AGCTTTTTTCTTGATAACGCTGCCCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCCAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTATCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_monoensis_B520_5 TG-ATGATAAAGTTACAGTTGAAAGT-GCTGAAGCTACTCTTAAGTATGTACTTTTTCTACTAGATACAATATCTTGTTGTTTTGT-AAAAACAAGCTCTTTTTTTGGAAGCT-------CCTTTTCTTTTGCATTATCCTTTT---------------GTGATAGTA---------------TCAGTGGT---TATGAGCACATTGCATTTCTT-------------------------------------ACTTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATTAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-GTCAA-----------CTGTCTAGGATTTTTACTGGTTTACCAGTACTAAGTT{AT}TTGT--AAAATGTGATTTTGATGGTTTATGGTAATACTGTCTACAGATGAAGATCGTGTGCGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTAGATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTTT-------------------------------GATGACCATTGTGCTTGTCTCCT---ACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGTTGGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCCAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTATCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_montana_B085_1 TG-ATGATAAAGTTACAGTTGAAAGT-GCTGAAGCTACTCTTAAGTATGTACTTTTTCTACTAGATACAGTATCTTGTTGTTTTGT-AAAAACAAGCTCTTTTTTTGGAAGTT-------CCTTTTCTTTTGCATTATCCTTTT---------------GTGATAGTA---------------TCAGTGGT---TATGAGCACATTGCATTTCTT-------------------------------------ACTTTTCTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATTAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATCAA-----------CTGTCTAGGATTTTTACTGGTTTACCAGTACTAAGTTATTGT--AAAATGTGATTTTGATGGTTTATGGTAATACTGTCTACAGATGAAGATCGTGTGCGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTAGATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCT---ACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTAGGACTAGATATCAACTT-AAAGCTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTCCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTTGCATTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--GTTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACAACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCGAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_montana_B085_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGCT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--CCAATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAACATTGTCTACAGATGAAG{AG}TCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACCTTT-ATA{CT}--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTG{AG}TAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTG{AG}TCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAACTTAAC{AG}TGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAG{AG}ACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATT{AG}A-TTTCTTCCTTG--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_montana_B095_1 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCCTTAAGAATTTTAGATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCT---ACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAAC{CT}AAAATTGGTTTTTGGTGAACTTCTCTCCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTTGCAT{CT}T--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--GTTTC{CT}GG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACAACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGA{AT}TGATCGAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG--------------------------- Mentzelia_montana_B095_2 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACCTTC-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_montana_B277 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGCT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCAATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTC---AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAACATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACCTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAACTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTCCTTG--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_montana_B370_1 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATTATTTAAACAAACATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACTGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_montana_B370_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTTG-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGAATAATAGGATCATCAGTAGT---GATGAACACATTGC----------------------------------------------TCT-CTTCCCATACTATTACTATATAT--CCCATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTTT--AAAATATGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTGTG-------ATTATCCTTCAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-GGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCGGGGAAACTAAAATTGGTCTTTGGTGAACTTT--TTCCCCTCCAAGATTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_montana_B370_3 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACCCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGCT-------CCTTTTCTTTTGCATTATATTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCAATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGCACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAACATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACCTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTTACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAACTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTCCTTG--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_montana_B425_1 ---------------CAGTTGAAAGTAGCTGAAGCTACTCTTAAGTATGTACTTTTTCTACTAGATACAGTATCTTGTTGTTTTGT-AAAAACAAGCTCTTTTTTTGGAAGTT-------CCTTTTCTTTTGCATTATCCTTTT---------------GTGATAGTA---------------TCAGTGGT---TATGAGCACATTGCATTTCTT-------------------------------------ACTTTTCTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATTAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATCAA-----------CTGTCTAGGATTTTTACTGGTTTACCAGTACTAAGTTATTGT--AAAATGTGATTTTGATGGTTTATGGTAATACTGTCTACAGATGAAGATCGTGTGCGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTAGATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCT---ACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTT--ACTATGACTAGATATCAACTT-AAAGCTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTCCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTTGCATTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--GTTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCTGTGCCAGAAGGAGGAAAGGATGAAACAACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCGAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_montana_B425_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTGT-GGAAGCT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCAATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAACATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACCTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTACTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATCAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCTAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTCCTTG--TCACTGGATTTTGGTGCTCGAC----GCAGTGCCCGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGTTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_multicaulis_H4137 TG-ATGATAAAGTTACTGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTTTTTTCAGTATCCTGTTATTTTGT-AAAAACCAGCTCTTTTTT-TGAAGTT-------TCTTTTCTTTTGCATTT-----------------CTTTTGTTGTAGTAAGA---------TCATCAATGGT---CATGAACACATTGCACTTCTT-------------------------------------ACTTTGCTTCCCATACAACTACTATATTT--CTGATCCACTAA--GTTCTGATGAAAAT-A---------CAGGTACAACGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCCGAGTTTGAT-GTGAAGATTTAT-TAAT-TAATTTTATTAC-----------CTCTTTAAAACTTTTTGTGA--------------------------TATGTGATCTTGATGAATTATGGAAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAACAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----AATATCCTTAACAATTTCTGATTTCCCGAATTTTTATAT--GCATCTATTGATGAT----------------------------------------GACCATTGTGCTTGTCTCCT---GCTGCAGGCACAGTCTTC-AGAGAACC-AATTATTTGCAAAAA----------TGT-CCCCAGGCTTGTTCCAGGTACTTTAGCTTTTTTCTTGATACTGCTGCTCGTCTCA-TTTTTT-ATTATGACTAGATATCATCTTTCAAGCGGTTGCTGTTGTCAGGATGGACAAAGCCGATATGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACTGATG---CTGTTATTAAAGGAGCAGGGAAATTAAAATTAGTTTTTGGTGAACTTCTCTTCCCTTTCAAGCTTAACAAGAATTTGAGA-CTTTTT-CTTTTGTTTAGTTTTT--GTTGATCATTTAAAGAACCATTTGTTCTTTTT--ATATCCGG-CCATGTTAT-------------------------------------------GCAGTGCCAGAAGGA---AGGGACGAAAAGACAGAGTTGGAAGTTTTTAACTTTACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTATATTA--TATTGTATTAGCTTATGTTCA-----GTCTCCAGATTGCAGCTGGACGCTGAATGATCTAATTCTTTGA--TTCTTGGTTTGGGAGCATA--GTCCATTCATG-CTTTTGCCGAGGCTTCAATGAAA--- Mentzelia_multicaulis_H4258 -------------------------------------------------------------------------------------------------------TT-TGAAGTT-------TCTTTTCTTTTGCATTT-----------------CTTTTGTTATAGTAGGA---------TTATCAATGGT---TATGAACACTCTGCACTTCTT-------------------------------------ACTTTGCTTCCCATACAACTACTATATTT--CTGATTCACTAA--GTTATGATGAAAAT-ATTGTAATTGCAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTGAT-GTGAAGATTTAT-TAAT-TAATTT-ATTAC-----------CTCCTT--AACTTTCTGTGA--------------------------TATGTGATCTTGATGAATTATGGAAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAACAAATGTGG-AAGAGTCCGAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----AATATCCTTGACAATTTCTGATTTCCCGAATTTTTATAT--GCATCTATTGATGAT----------------------------------------GACCATTGTGCTTGTCTCCT---GCTGCAGGCACAGTCTTC-AGAGAACC-AATTATTTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTTTAGCTTTTTTCTTGATACTGCTGCTCGTCTCA-TTTTTT-ATTATGACTAGATATCATCTTTCAAGTGGCTTCTGTTGTCAGGATGGACAAAGCCGATATGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACTGATG---CTGTTATTAAAGGAGCAGGCAAATTAAAATTGGTTTTTGGTGAACTTCTCTTCCCTTTCAAGCTTAACATGAATTTGAGATTTTTTT-CTTTTGTTTAGTTTTT--GTTGATCATTTAACAAACCATTTGTTCTTTCT--ATATCCGA-CCGTGTTATTAT-TTTCTTCCTTT--TCACTGGGTATTGGTGCTTTAT----GCAGTGCCAGAAGGA---AAGGACGAAAAGACAGAGTTGGAAGTTTTTAACTTTACAGGAGCTGGAGGAGTTGCCTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTATATTA--TATTGCATTAGCTTATGTTCA-----GTCTCCATATTGCAGCTGGAAGCTGATTGATCTAATTCTTTAA--TTCTTGGTTTGGGAGCATA--GTCCATTCATG-CTTTTGCCGAGGCTTCAAT-AA---- Mentzelia_nitens_B079_1 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCCTTAAGAATTTTAGATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTATTT-AGCTTT{CT}TTCTTGATAACGCTGC{CT}CGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTATCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG--------------------------- Mentzelia_nitens_B079_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGCACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATACTT-----------------GTGATAGTAGGA---------TCATCAATAGT---AATGAGCACATTGC----------------------------------------------TTTTCTTCCCATATTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGGTTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTAACTTT--ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGA-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGCGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTATTAA-TTTTTT-------TCACTGGATT---GTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_nitens_B079_3 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTT------------------AAGAATTTCTG----------TTTT-ATAT--GCACCTATGGGTGAT---------------------------------------TGACCATTGTGCTTGTCTCCC---GCAGCAAGTACCATCTTC-AGAGAACC-ACTTATCTGCAAAAATTGCAAAAATTGT-CCCCAGACTCGTTTCAAGTACTT-ATCTTTTGTCTTG{AG}TGACGCTGCTCGTCCCACTTTTTT-ACCATGTCCAGATA{CT}CAACTCTCACACAGCTGGTGTTGTCAGGATGGACAAAGCCAATATGTACCGGAAGGCATGCTTTTGGGGATCGCTACCGAGCAACTGATGATGTAGTTATTTT-GGAGTTGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTT{AG}GTTTT---ATTGATCATTTTAAGGACCATTTGTTCTTTAT--ATTTCCGG-CCATGTTTATAC-TTTCTTCATTT--TCGCC{AG}GATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACTGAGTTGGAAGTTTATAACTTCATAGGCGGAGGAGGAGTTGCTTTGTCTATGTACAATACCTATGAGGTTGGGCTTGTAAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCACAT{CT}GCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_nitens_B079_4 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GTTT------------------AAGAATTTCTG----------TTTT-ATAT--GCACCTATGGGTGAT---------------------------------------TGACCATTGTGCTTGTCTCCC---GCAGCAAGTATCATCTTC-AGAGAACC-ACTTATCTGCAAAAATTGCAAAAATTGT-CCCCAGACTCGTTTCAAGTACTT-ATCTTTTGTCTTGATTACGCTGCTCGTCCAACTTTTTT-ACCATGTCCAGATATCAACTCTCACACAGCTGGTGTTGTCAGGATGGACAAAGCCAATATGTACCGGAAGGCATGCTTTTGGGGATCGCTACCGAGCAACTGATGATGTAGTTATTAT-GGAGTTGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTTT---ATTGATCATTTTAAGGACCATTTGTTCTTTAT--ATTTCCGG-CCATGTTTATAC-TTTCTTCATTT--TCGCCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACTGAGTTGGAAGTTTATAACTTCATAGGCGGAGGAGGAGTTGCTTTGTCTATGTACAATACCTATGAGGTTGGGCTTGTAAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCACATCGCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_nitens_B242_1 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATACTT-----------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTT-CTTCCCATATTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACGATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGGTTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTAACTTT--ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGA-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGCGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTATTAA-TTTTTT-------TCACTGGATT---GTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_nitens_B242_2 TG-ATGATAAAGTTACAGTTGGTAGT-GCAGAAGC--TTCTTAAGTATGTACTTTTTCCCC--------ATTTGTTGTAGTCTTG--AAGTTCC---TTTACGGT-TGCAGTA-------CCATTTTCT--GTTATTTTCTTTT---------------GTGATAGTAGGA---------TCTTCAATAGT---TATGGACATATTGCATTTCTT-------------------------------------ACCCT-TGTCCTATACTATTACTATATAT--CCGATTCTCCAA--GTCATGATGGAAATTATTGTAATTGTAGGTACACCGT-GCTATCAAATGTGCAAGCCTTA--TCCAGCTACAGTTGTTTCAGTTTGAT-GTAAAGAATTAT-TATT-TAATTG-ATTAA-----------CTCTCTACAAATTTTACTGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGATCTTGATGGTTTATGGTCATATTGTCTACAGATGAAGATCGAGTGAGA------------GAAACAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTT------------------AAGAATTTCTG----------TTTT-ATAT--GCACCTATGGGTGAT---------------------------------------TGACCATTGTGCTTGTCTCCC---GCAGCAAGTACCATCTTC-AGAGAACC-ACTTATCTGCAAAAATTGCAAAAATTGT-CCCCAGACTCGTTTCAAGTACTT-ATCTTTTGTCTTGATGACGCTGCTCGTCCCACTTTTTT-ACCATGTCCAGATATCAACTCTCACACAACTGGTGTTGTCAGGATGGACAAAGCCAATATGTACCGGAAGGCATGCTTTTGGGGATCGCTACCGAGCAACTGATGATGTAGTTATTAT-GGAGTTGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTGT---ATTGATCATTTTAAGGACCATTTGTTCTTTAT--ATTTCCGG-ACATGTTTATAC-TTTCTTCATTT--TCGCCGGATATTGGTGTTCTAT----GCAGTTCCAGA-GGG---AAGGACGAAAAGACTGAGTTGGAAGTTTATAACTTCATAGGCGGAGGAGGAGTTGCTTTGTCTATGTACAATACCTATGAGGTTGGGCTTGTAAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCACATTGCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGTTTGTGAGCATA--GTCCATTCGTA--------------------------- Mentzelia_obscura_B052_1 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAAAA-----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AACTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTC-AAAGCTGCTGGTGGTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATCTGAGA-TTTTTT-CAATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTCATTAA-TTTCTTCATTT--TCATTGGATTTTGGTGCTCTAT----GCAGTTCCAGAAGGAGGAAAGGATGAAACTACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGATTATGCCCG-----ATATTCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG--------------------------- Mentzelia_obscura_B052_2 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAAAA-----------CGT-CCCCAAGCTTGTTCCAGGTATTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAGCTAAAATTGGTTTTTGGTAAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTATCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTT---TTTTTGGTTTGTGAGCATA--GTCTATTCGTG--------------------------- Mentzelia_obscura_B052_3 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTT-ATAT--GCACCTATGGGTGAT---------------------------------------TGACCATTGTGCTTGTCTCCC---GCAGCAAGTACCATCTTT-AGAGAACC-ACTTATCTGCAAAAA---------TTGT-CCCCAGACTCGTTTCAAGTACTT-ACCTTTTGTCTTGATTACGCTGCTCGTCCAACTTTTTT-ACCATGTCCAGATATCAACTCTCACACAGCTGGTGTTGTCAGGATGGACAAAGCCAATATGTACCGGAAGGCATGCTTTTGGGGATCGCTACCGAGCAACTGATGATGTAGTTATTAT-GGAGTTGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTGT---ATTGATCATTTTAAGGACCATTTGTTCTTTAT--ATTTCCGG-ACATGTTTATAC-TTTCTTCATTT--TCGCCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACTGAGTCGGAAGTTTATAACTTCATAGGCGGAGGAGGAGTTGCTTTGTCTATGTACAATACCTATGAGGTTGGGCTTGTAAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCACATCGCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGTTTGTGAGCATA--GTCCATACGTG--------------------------- Mentzelia_obscura_B058_1 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAG-TAAT-TAATTT-ATTTA-----------CTCTCTACAATTTTTACTGGTTTACCGGTACTAAGCTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATACTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTGATTATTATCCTTAAGAATTTTTGATACTTTGACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AACTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACCTCTCTTCCCCTCCAAGCTTAACATGAATCTGAGA-TTTTTT-CAATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTCATTAA-TTTCTTCATTT--TCATTGGATTTTGGTGCTCTAT----GCAGTTCCAGAAGGAGGAAAGGATGAAACTACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGATTATGCCCG-----ATATTCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTATGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_obscura_B058_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------???-CTTCCCATACTATTACTATATATATCCGATTCACCAA--GTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATTAATAATTTATTAACTCTCTAGAATTTTTACTGGTTTACCAGTACTAAGTTATTGT--AAAATGTGATTTTGATGGTTTATGGTAATAATGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTAGATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTATTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TAATTT-CTATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATTTTATTAA-TTTCTTCATTT--TCACTGGATTT-GGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTATCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_obscura_B058_3 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTT------------------AAGAATTTCTG----------TTTT-ATAT--GCACCTATGGGTGAT---------------------------------------TGACCATTGTGCTTGTCTCCC---GCAGCAAGTACCATCTTT-AGAGAACC-ACTTATCTGCAAAAA---------TTGT-CCCCAGACTCGTTTCAAGTACTT-ACCTTTTGCCTTGATTACGCTGCTCGTCCAACTTTTTT-ACCATGTCCAGATATCAACTCTCACACAGCTGGTGTTGTCAGGATGGACAAAGCCAATATGTACCGGAAGGCATGCTTTTGGGGATCGCTACCGAGCAACTGATGATGTAGTTATTAT-GGAGTTGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTCAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTGT---ATTGATCATTTTAAGGACCATTTGTTCCTTAT--ATTTCCGG-ACATGTTTATAC-TTTCTTCATTT--TCGCCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGTAAAGACTGAGTTGGAAGTTTATAACTTCATAGGCGGAGGAGGAGTTGCTTTGTCTATGTACAATACCTATGAGGTTGGGCTTGTAAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCACATTGCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_packardiae_B239_1 TG-ATGATAAAGTTACAGTTGAAAGT-GCGGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATACAATATCCCGTTGTTTTGTACAAAACCAGCTCTTTTTTTGGAAGTT-------CCTTTTCTTTTGCATTATCCTTTTCTGTTATTTTCTTTTGTGATAATAGGA---------TCATTTGTAGT---TATGAACACATTGCATTTCTT-------------------------------------ACTTTTCTTCCCTAACTGTTTCTATATTT--CTGATTCACCAA--ATCCTGAT-GAAAGTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTATAGTTGGCTGAGTTTGAT-GTAAAGAATTAT-TAAT-TGATTT-ATTAA-----------CTCTCTACAATTTT-ACTGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGATCTTGATGGTTTATGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAACAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTATGTGTG---ATTATCCTTAAGAATTTTTGATACTCTGACTTTT-ATAT--GCATCTATTGGTGATGAGACT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCCATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACTGATG---CAGTCATTAAAGGAGCTGGGAAACTAAAATTGGTTTTCGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAA-TTGAGA-TTTTTT-CTATTGTT-AGTTTTTT-GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCAGGTTATTCT-TTTCTTCATTT--TCACTGAATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---GAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAA--------TTGTTTTAGGTTATGCCCGATCCAATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTAA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_packardiae_B239_2 TG-ATGATAAAGTTACAGTTGAAAGT-GCTGAAGCTACTCTTAAGTATGTACTTTTACTACTAGAGACAATATCTTGTTGTTTTGT-AATAACCAGCTCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATTATCCTTTT---------------GTGATAGTA---------------TCAGTGGC---GATGAGCACATTGCATTTCTT-------------------------------------ACTTTTCTTCCCATACTATTGCTATATAT--CCAATTCACCAA--GTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTACTGGTTTACCAGTACTAAGTTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATACTGTCTACAGATGAAGATCGTGTGAGAGAATCTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTTTATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-CTTTTT-TTATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTCCTTCATTT--TCACTGGATTTTGGTGCTATAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACCACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGACGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCTCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCCTCAATGAACACT Mentzelia_packardiae_B239_3 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTCCTGATGGAAATTATTGTAATGGTAGGTACAGTGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTACTGGTTTACCAATACTAAGTTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATACTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTTTATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-CTTTTT-TTATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTATAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACCACAGAATTGGAAGTTTATAACTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_packardiae_B239_4 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTT------------------AAGAATTTCTG----------TTTT-ATAT--GCATCTATTGGTGAT----------------------------------------GACCATTGTGCTTGTCTCCC---GCAGCAAGTACCATCTTC-AGAGAACC-ACTTATCTGCAAAAAA--------TTGT-CCCCAGATTCGTTTGAAGCACTT-ATCTTTTGTCTTGATTACGCTGCTCGTCCCACTTTTTT-ACCATGTCCAGATATCAACTCTCACACAGCTGGTGTTGTCAGGATGGA-AAAGGCAATATGTACTGGAAGGCATGCTTTTGGGGATCGCTACCGAGCAACTGATGATGCAGTTATTAT-GGAGTTGGGAAATTAGTATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTTT---ATTGATCATTTTAAGGACCATTGGTTCTTTCT--ATTTCCGG-CCATGTTTATAC-TTTCTTCATTT--TCGTCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACTGAGTTGGAAGTTTATAACTTCATAGGCGGAGGAGGAGTTTCTTTGTCTATGTACAATA---ATGAGGTTGGGCTTGTAAATTA--TATTGTATTAGGTTATGTCCG-----ATCTCCACATTGCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGTTTGTGAGC------------------------------------------- Mentzelia_packardiae_B304 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTT------------------AAGAATTTCTG----------TTTT-ATAT--GCATCTATTGGTGAT----------------------------------------GACCATTGTGTTTGTCTCCC---GCAGCAAGTACCATCTTC-AGAGAACC-ACTTATCTGCAAAAATTGCAAAAATTGT-CCCCAGACTCGTTTGAAGTACTT-ATCTTTTGTCTTGATTACGCTGCTCGTCCCACTTTTTT-ACCATGTCCAGATATCAACTCTCACACAGCTGGTGTTGTCAGGATGGACAAAGCCAATATGTACCGGAAGGCATGCTTTTGGGGATCGCTACCGAGCAACTGATGATGCAGTTATTAT-GGAGTTGGGAAATTAGTATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTTT---ATTGATCATTTTAAGGACCATTGGTTCTTTCT--ATTTCCGG-CCATGTTTATAC-TTTCTTCATTT--TCGCCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACTGAGTTGGAAGTTTATAACTTCATAGGCGGAGGA---GTTGCTTTGTCTATGTACAATA---ATGAGGTTGGGCTTGTAAATTA--TATTGTATTAGGTTATGTCCG-----ATCTCCACATTGCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGTTT------------------------------------------------- Mentzelia_packardiae_B335_1 TG-ATGATAAAGTTACAGTTGAAAGT-GCGGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATACAATATCCTGTTGTTTTGTACAAAACCAGCTCTTTTTTTGGAAGTT-------CCTTTTCTTTTGCATTATCCTTTTCTGTTATTTTCTTTTGTGATAATAGGA---------TCATTTGTAGT---TATGAACACATTGCATTTATT-------------------------------------ACTTT-CTTCCCTAACTGTTTCTATATTT--CTGATTCACCAA--ATCCTGAT-GAAAGTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTATAGTTGGCTGAGTTTGAT-GTAAAGAATTATATATT-T-ATTT-AT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGATCCGATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTAA--TTTATGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_packardiae_B335_2 TG-ATGATAAAGTTACAGTTGAAAGT-GCTGAAGCTACTCTTAAGTATGTACTTTTACTACTAGAGATAATATCTTGTTGTTTTGT-AATAACCAGCTCTTTCTT-GGAAGTT-------CCTTTTCTTTTGCATTATCCTTTT---------------GTGATAGTA---------------TCAGTGGC---GATGAGCACATTGCATTTCTT-------------------------------------ACTTT-CTTCCCATACTATTGCTATATAT--CCAATTCACCAA--GTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATTAA-----------CTCTCTACAATTTTTACTGGTTTACCAGTACTAAGTTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATACTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTTTATACTCTGACTATT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AA{AG}GCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCA{AG}GCTTAACATGAATTTGAGA-CTTTTT-TTATTGTTTAGTTTTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTATAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACCACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCTCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCCTCAATGAACACT Mentzelia_pectinata_B053_1 TG-ATGATAAAGTCACTGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTT-ACTATTT-ATACAACATCCTGTTGTTTTGT-AAAAACCAGCCCTT{CT}TTT-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---GATG{AT}ACAC{AG}TTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATAATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAATGATAAAGAATTAT-TAGT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTTT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAAT{CT}TAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTGTG-----ATTATCGTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTAATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATTTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTA-ACTATGACTAGACATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAAC{CT}GATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-T{AT}TTTT-CTATTGTTTAGTTTTTT-GC{AT}GATTATTAAAAGA{AG}CCATTTGTTCTTTCT--ATTTCTGGCCCTTGTTA{CT}TAC-TTTTTCCTTTC--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAGGGA---A{AG}GGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TACTGTAT{GT}{AG}GGTTATGTT{CT}G-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTCAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_pectinata_B053_2 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTC------------------AAGAATTTCTG----------TTTT-ATAT--GCACCTATGGGTG-T---------------------------------------TGA{CT}CATTGTGCTTGTCTCCC---GCAGCAAGTACCATCTTT-AGAGAACC-A{CT}TTATCTGCAAAAA---------TTGT-CCCCAGACTCGTTTCAAGTACTT-ACCTTTTGTCTTGATTACGCTGCTCGTCCAACTTTTTT-ACCATGTCCAGATATCAACTCTCACACAGCTGGTGTTGTCAGGATGGACAAAGCCAATATGTACCGGAAGGCATGCTTTTGGGGATCGCTACCGAGCAACTGATGATGTAGTTATTAT-GGAGTTGGGAAATTAGAATTGGTTTTTGGTGAACTTCTCTTCCCCTTCAAGCTTAACATGAATTTGAGA-TGGTTA-CTATTGTTTAGTTGT---ATTGATCATTTTAAGGACCATTTGTTCTTTAT--ATTTCCGG-ACATGTTTATAC-TTTCTTCATTT--TCGCCGGATATTGGTGTTCTAT----GCAGTTCCAGAAGGG---AAGGACGAAAAGACTGAGTTGGAAGTTTATAACTTCATAGGCGGAGGAGGAGTTGCTTTGTCTATGTACAATACCTATGAGGTTGGGCTTGTAAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCACATTGCAGCTCGAAGCTGATTGATCTAATCCTTTAA--ATTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_pectinata_B204 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCGTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTAATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-CGAGAACC-AATTATTTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTA-ACTATGACTAGACATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTAAAAGAACCATTTGTTCTTTCT--ATTTCTGGCCCTTGTTATTAC-TTTTTCCTTTC--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAGGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TACTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTCAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_pectinata_B213_1 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAACTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGAGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG--------------------------- Mentzelia_pectinata_B213_2 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTGTG-------ATTATCCTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-GATTATCTGCAAAAA----------CGC-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACACTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCGGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_pectinata_B213_3 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCGTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTAATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATTTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTA-ACTATGACTAGACATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTCTT-CTATTGTTTAGTTTTTT-GCTGATTATTAAAAGAACCATTTGTTCTTTCT--ATTTCTGGCCCTTGTTATTAC-TTTTTCCTTTC--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAGGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TACTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTCAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG--------------------------- Mentzelia_ravenii_B197_1 TG-ATGATAAAGTTACAGTTGAAAGT-GCTGAAGCTACTCTTAAGTATGTACTTTTT-TACTAGATACAGTATCTTGTTGTTTTGT-AAAAACAAGCTCTTTTTTTGGAAGTT-------CCTTTTCTTTTGCATTATCCTTTT---------------GTGATAGTA---------------TCAGTGGT---TATGAGCACATTGCATTTCTT-------------------------------------ACTTTTCTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATTAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATCAA-----------CTGTCTAGGATTTTTACTGGTCTACCAGTACTAAGTTATTGT--AAAATGTGATTTTGATGGTTTATGGTAATACTGTCTACAGATGAAGATCGTGTGCGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAGCATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTAGATACTCTGACTATT-ATATATGCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCT---ACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAACTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTCCCCC-CCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTTGTATTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--{AG}TTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACAACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTT-A--TTTTTGGTTTGTGAGCATA--GTCTATTCGTGCCTTTTGCCGAGGCTTCAATGA----- Mentzelia_ravenii_B197_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAATATCCTGTTGTTTTGT-GAAAACCAGCCCTTTTTC-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGA---------CCATCAGTAGT---GATGAACACATTGC----------------------------------------------TTT-CTTCCCATACTATCATTATATAT--CCGATTTACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTCT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTGAAGAATTTCTGATTCTCTAACTTTT-ACAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTTCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCACGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAATATGAATTTGAGA-TATTTT-CTATTGTTTAGTTTTTTTGCTGATTATT-AAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCTTGTTATTAA-TATCTTCCTTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCGGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTG-----CGAAGCTGATTGATCTGATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_ravenii_B507_1 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGC{CT}CCTTTTT-GGAAGCT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--CCAATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAACATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACCTTT-A{CT}AT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TT{CT}TTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAACTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTT{CT}TTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTCCTTG--{CT}CACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACG{AG}CAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_ravenii_B507_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTGGCATGATACTTTT---------------GTGATAGTAGGAATAATAGGATCATCAGTAGT---GATGAACACATTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--CCCATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTTT--AGAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_strictissima TG-ATGATAAAGTTACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTTTTTACAGTATCCTGTTATTTTGT-AAAAACCAGCTCTTTTTT-TGAAGTT-------TCTTTTCTTTTGCATTT-----------------CTTTTATTATAGAAGGA---------TCATCAATGGTAATTATGAACACATTGCACTTCTTACTTTTCTTCCCATACAATTAGTATATTTCTGATCTTACTTTTCTTCCCATACAATTAGTATATTT--CTGATTTACTAA--GTTCTGATGAAAAT-ATTGTAATTGCAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTGAT-GTGAAGATTTAT-TAAT-TAATCTTATTAC-----------CTCTTTTAAACTTTCTGTGA--------------------------TATGTGATCTTGATGAATTATGCAAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAACAAATGTGG-AAGAGTCCGAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----AATATCCTTAACAATTTCTGATTTCCCGAATTTTTATAT--GCATCTATTGATGATGACCAGTGTACCTATCAAAAAAAAAAAAAAATTTGATGATGACCATTGTGCTGGTCCCCT---GCTGCAGGCACAGTTTTC-AGAGAACC-AATTATTTGCAAAAA----------TGT-CCCCAGGCTTGTTCCAGGTACTTTAGCTTTTTTCTTGATACTGCTGCTCATCTCA-TTTTTT-ATTATGACTAGATATCATCTTTCAAGCGGCTGCTGTTGTCAGGATGGACAAAGCCGATATGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACTGATG---CTGTTATTAAAGGAGCAGGGAAATTAAAATTGGTTTTTGGTGAACTTCTCTTCCCTTTCAAGCTTAACAAGAATTTGAGA-CTTTTT-CTTTTGTTTAGTTTTT--GTTGATCATTTAAAGAACCATTTGTTCTTTTT--ATATCCGG-CCATGTTAT-------------------------------------------GCAGTGCCAGAAGGA---AAGGACGAAAAGACAGAGTTGGAAGTTTTTAACTTTACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTATATTA--TATTGTATTAGCTTATGTTCA-----GTCTCCAGATTGCAGCTGGACGCTGAATGATCTAATTCTTTGA--TTCTTGGTTTGGGAGCATA--GTCCATTCATG-CTTTTGCCGAGGCTTCAATGAAA--- Mentzelia_thompsonii_B225 -----GATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTAGATGCAATATCC---AGTTTTGT-AAAAAACAGCTCTTTTTT-GGAAGTT-------CCTTTTC------------------TGTTATTTTCTTTTGTGATAGTAGGA---------TCATCAGTAGT---TATGAACACATAGCATTTCTT-------------------------------------ACTTTTCTTCCCATACTATTACTATATAT--CCGATTCACCAA--ATCTTGATGGGAATCATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGTTGGCTGAGTTTGAT-GTAAAGAATAAT-TAAT-CAATTT-ATTAA-----------CTCTCTACAATTTTTACTGGTTTAGCAGTACTAAGTTTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATATCGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTTTGTG-----ATTATCCTTCAGA-TTTTTTATTCTCTAACTTTT-ATAT--GCACCAATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTTTTCTCTTGATAACGCTGCTTGTCTCGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACATCTCTTCCCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTGAAGAACCATTTGTTCTTACT--ATTTCTGG-CCATGTCATTAG-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCTATGCGCGCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGAGATATTGTTTTAGTTTATGTCCG-----ATCTCCAAATTGCAGCTCGAAGTTGATTGATCTAATTCTTTCA--TTT---GTTT--GAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_thompsonii_B234_1 TG-ATGATAAAGTTACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTAT{CT}AGATGCAATATCC---AGTTTTGT-AAAAAACAGCTCTTTTTT-GGAAGTT-------CCTTTTC------------------TGTTATTTTCTTTTGTGATAGTAGGA---------TCATC{AG}GTAGT---TATGAACACATAGCATTTCTT-------------------------------------ACTTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--ATCTTGATGGGAATCATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAG{CT}TGGCTGAGTTTGAT-GTAAAGAATAAT-TAAT-CAATTT-ATTAA-----------CTCTCTACAATTTTTACTGGTTTAGCAGTACTAAG{CT}TTTTGT--AAAATGTGATTTTGATGGTTTATGGTAATATCGTCTGCAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTTTGTG-----ATTATCCTTCAGATTTTTTTATTCTCTAACTTTT-ATAT--{AG}CACCAATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGT{AG}CCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTTTTCTCTTGATAACGCTGCTTGTCTCGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACATCTCTTCCCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTGAAGAACCATTTGTTCTTACT--ATTTCTGG-CCATGTCATTAG-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCTATGCGCGCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGG{AT}AGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGAGATATTGTTTTAGTTTATGTCCG-----ATCTCCAAATTGCAGCTCGAAGTTGATTGATCTAATTCTTTCA--TTT---GTTT--GAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_thompsonii_B234_2 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTCCTGCTGCTGCAGGTACTGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATATCTAGATATGAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATCTGTATTGGAAGGCATGCTTTTGGTGGTCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTC-GCTGACTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TATCTTCCTTTT-TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTCCG-----ATCTCCAGATTGCAGCTTGAAGCTCATTGATTTAATTCTTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_thompsonii_B345 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-GGTCTGTG-----ATTATCCTTCAGATTTTTTTATTCTCTAACTTTT-ATAT--GCACCAATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTCCTACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTTTTCTCTTGATAACGCTGCTTGTCTCGCCTTTTT-ACTATGACTAGATATTAACTTTCAA---GCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACATCTCTTCCCCTCCAAGCTTAACATGAATTTGGG--TTTTTT-CTATTGTTTAGTTTTTT-GTTGATTATTTGAAGAACCATTTGTTCTTACT--ATTTCTGG-CCATGTCATTAG-TTTCTTCCTTT--TCACTGGATTTTGGTGCTCTATGCGCGCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGAGATATTGTTTTAGTTTATGTCCG-----ATCTCCAAATTGCAGCTCGAAGTTGATTGATCTAATTCTTTCA--TTT---GTTT--GAGCATA--GTCCATTCGTG--------------------------- Mentzelia_tiehmii_H4157 -------------------------------------------------------------------------------------------------------TT-TGAAGTT-------TCTTTTCTTTTGCATTT-----------------CTTTTGTTATAGTAGGA---------TCATCAATGGT---TATGAACACATTGCACTTCTT-------------------------------------ACTTTGCTTCCCATACAACTACTATATTT--CTGGTTCACTAA--GTTCTGATGAAAAT-ATTGTAATTGCAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGTACAGCTGGCTGAGCTTGAT-GTGAAGATTTAT-TAAT-TAATTT-ATTAC-----------CTCCTTATAACTTTCTGTGA--------------------------TATGTGATCTTGATGAATTATGGAAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAACAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----AATATCCTTAACAATTTCTGATCTCCCGAATTTTTATAT--GCATCTATTGATGAT----------------------------------------GACCATTGTGCTTGTCTCCT---GCTGCAGGCACAGTCTTC-AGAGAACC-AATTATTTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTTTAGCTTTTTTCTTGATACTACAGCTCGTCTCG-TTTTTT-ATTATGGCTAGATATCATCTTTCAAGCGGCTGCTGTTGTCAGGATGGACAAAGCCGATATGTATTGGGAGGCATGCTTTTGGTGATCGATACCGAGCAACTGATG---CTGTTATTAAAGGAGCAGGGAAATTAAAATTAGTTTTTGGTGAACTTCTCTTCCCTTTCAAGCTTAACATGAATTTAAGATTTTTTTTCTTTTGTTTAGTTGTT--GTTGATCATTTAACAAACCATTTGTTCTTTCT--ATATCCGA-CCATGTTATTAT-TTTCTTCCTTT--TCACTGGGTATTGGTGCTTTAT----GCAGTGCCAGAAGGA---AAGGACGAAAAGACAGAGTTGGAAGTTTTTAACTTTACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTATATTA--TATTGTATTAGCTTATGTTCA-----GTCTCCAGATTGCAGCCGGAAGCTGATTGATCTAATTCTTTAA--TTCTTGGTTTGGGAGCATA--GTCCATTCATG-CTTTTGCCGAGGCTTCAAT-AA---- Mentzelia_tricuspis_H553 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----AATATCCTAAACAATTTCTGATTTCCCGACTTTTTATAT--GCATCTATTGATAAT----------------------------------------GACCATTGTGCTTGTCTCCT---GCTGCAGGCACAGTCTTC-AGAGAACC-CATTATTTGCAAAAA----------CGT-CCCCAGGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATACTGCTGCTCGTCTCA-TTTTTC-ATTATGACTAGATATCATCTCTCAAGCGGCTGCTGTTTTCAGGGTGGACAAAACCGATATGCATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACTGATG---CTGTTATTAAAGGAGCTGGGAAATTAAAATTGGTTTTTGGTGAACCTCTCTTCCCTTTCAAGCTTAACAAGAATTTGAGA-TTTTTT-CTTTTGTTTAGTTTTT--GTTGATCATTTAAAGAACCATTTGTTCTTTCT--ATATCCAG-CCATGTTTT-------CTTCCTTTTCTCACTGGGTATTGGTGCTTTAT----GCAGTGCCAGAAGGA---AAGGATGAAAAGACAGAGTTGGAAGTTTTTAACTTTACAGGAGCTGGAGGAGTTGCTTTATCCATGTACAATACCGAGGAGGTTGGGCTTGTATATTA--TATCATATAGTATTAGGTT-A-----TGTTC-AATCTGCAGCTGGAAGCTGATTGATCTAATTCTGTAC--TTCTTGGTTTGCGAGCATA--GTCCATTCATG-CTTTTGCCGAGGCTTCAATGAA---- Mentzelia_veatchiana_B105_1 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATTATTTAAACAAACATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACTGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_veatchiana_B105_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGAATAATAGGATCATCAGTAGT---GATGAACACATTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--CCCATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAACGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTTT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTGTG-------ATTATCCTTCAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-GGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACCTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCGGGGAAACTAAAATTGGTCTTTGGTGAACTTT--TTCCCCTCCAAGATTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_veatchiana_B105_3 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATTATTTAAACAAACATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAGGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACTGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCCGAGGCTTCAA?GG----- Mentzelia_veatchiana_B105_4 -------------CACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGCT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTTCCTTCCCATACTATTACTATATAT--CCAATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGCACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAACATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACCTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCGACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCGGGGAAACTAAAATTGGTCTTTGGTGAACTTT--TTCCCCTCCAAGATTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_veatchiana_B105_5 TG-ATGATAAAGTCACTGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAACATCCTGTTGTTTTGTAAAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAACACATTGC----------------------------------------------TTTTCTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTG{AG}TTGAAATAATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAATTAT-AAAT-TAG--------------------CTCTC-AG--TTTTAACTG{AG}TTCAGCAGTACTCAGTTTTTTT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-{AG}AGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTGTG-----ATTATCGTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTAATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATTTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTA-ACTATCACTAGACATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTATAGTTTTTT-GCTGATTATTAAAAGGACCATTTGTTCTTTCT--ATTTCTGGCCCTTGTTATTAC-TTTTTCCTTTC--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAGGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTCGGCTTTTGAATTA--TACTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTCAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACAC{CT} Mentzelia_veatchiana_B187_1 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATGGAAATTATTGTAATGGTAGGTACAATGTAGCTATTAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-GTAAAGAATTAT-TAAT-TAATTT-ATCAA-----------CTGTCTAGGATTTTTACTGGTTTACCAGTACTAAGTTATTGT--AAAATGTGATTTTGATGGTTTATGGTAATACTGTCTACAGATGAAGATCGTGTGCGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTGTG---ATTATCCTTAAGAATTTTAGATACTCTGACTATT-ATATATGCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCT---ACTGTAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGCTTTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTT-AAAACTGTTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTTTTTGGTGAACTTCTCTCCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTTGTATTT--GTTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACAACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACCGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_veatchiana_B187_2 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGCT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCAATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAACATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACCTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAACTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CTTTGTTATTAA-TTTCTTCCTTG--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_veatchiana_B187_3 TG-ATGATAAAGTCACTGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAACATCCTGTTGTTTTGTAAAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAACACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATAATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAATTAT-AAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTTT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTGTG-----ATTATCGTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTAATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATTTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTA-ACTATCACTAGACATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTC--TTCCCCTCCAAGCTTAACATGAATTTGAGA-TTTTTT-CTATTGTAT{AG}GTTTTTT-GCTGATTATTAAAAGGACCATTTGTTCTTTCT--ATTTCTGGCCCTTGTTATTAC-TTTTTCCTTTC--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAGGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGAGGAGTTGCTTTGTCCATGTACAACACCGATGAGGTTCGGCTTTTGAATTA--TACTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTC--------------------------------------------------------------- Mentzelia_veatchiana_B210_1 -------------------------------AAGCTACTCTTAAGTATGTACTTTTACTATTT-ATACAATATCCTGTTGTTTTGT-AAAAACCAGCCCTTTTTT-GGAAGTC-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGAATAATAGGATCATCAGTAGT---GATGAACACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCCATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTCTTTTT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTGTG-------ATTATCCTTCAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-GGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCGGGGAAACTAAAATTGGTCTTTGGTGAACTTT--TTCCCCTCCAAGATTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Mentzelia_veatchiana_B210_2 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATTATTTAAACAAACATTTGTTCTTTCT--ATTTCTGG-CCATGTTATTAA-TTTCTTCATTT--TCACTGGATTTTGGTGCTCTAT----GCAGTGCCAGAAGGAGGAAAGGATGAAACGACAGAATTGGAAGTTTATAACTTCACAGGAGCTGGAGGAGTTGCTTTGTCCATGTACAATACTGATGAGGTTGGGCTTGTAAATGA--TATTGTTTTAGGTTATGCCCG-----ATATCCAGATTGCAGCCCGAAGCTGATTGATCTAATTCTTTTA--TTTTTGGTTTGTGAGCATA--GTCTATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_veatchiana_B210_3 TG-ATGATAAAGTCACAGTTGAAAGT-GCAGAAGCTACTCTGAAGTATGTACTTTTACTATTAGATACAATATCCTGATGTTTTGT-AAAAACCAGCCCCTTTTT-GGAAGCT-------CCTTTTCTTTTGCATTATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAGCACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCAATTCACCAA--GTCCTGATTGAAATTATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTGAT-ATAAAGAATTAT-TAAT-TAG--------------------CTCTC-AG--TTTTTACTGGTTTAGCAGTACTCAATTTTTGT--AAAATGTGATTTTGATGGTTTAAGGTAACATTGTCTACAGATGAAGACCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATTAGGAACATTTTGAAT-GGTCTGTG-----ATTATCCTTAAGAATTTCTGATTCTCTGACCTTT-ATAT--GCATCTATTGCTGATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATCTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCCCACCTTTTT-ACTATGACTAGATATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAAACTAAAATTGGTCTTTGGTGAACTTCTCTTCCCCTCCAAACTTAACATGAATTTGAGA-TTTTTT-CTATTGTTTAGTTTTTT-GCTGATTATTTAAAGAACCATTTGTTCTTTCT--ATTTCGGG-CCTTGTTATTAA-TTTCTTCCTTG--TCACTGGATTTTGGTGCTCGAT----GCAGTGCCAGAAGGA---AAGGACGAAACGACAGAATTGGAAGTTTATAACTTCACGGGAGCTGGGGGAGTTGCCTTGTCCATGTACAACACCGATGAGGTTGGGCTTTTGAATTA--TATTGTATTAGGTTATGTTCG-----ATCTCCAGATTGCAGCTCGAAGCTGATTGATCTAATTCCTTAA--TTTTTGGTTTGTGAGCATA--GTCCATTCGTG-CTTTTGCTGAGGCTTCAATGAACACT Mentzelia_veatchiana_B210_4 TG-ATGATAAAGTCACTGTTGAAAGT-GCAGAAGCTACTCTTAAGTATGTACTTT-ACTATTT-ATACAACATCCTGTTGTTTTGTAAAAAACCAGCCCTTTTTT-GGAAGTT-------CCTTTTCTTTTGCATGATACTTTT---------------GTGATAGTAGGA---------TCATCAGTAGT---AATGAACACATTGC----------------------------------------------TTT-CTTCCCATACTATTACTATATAT--CCGATTCACCAA--GTCCTGATTGAAATAATTGTAATTGTAGGTACAATGTAGCTATCAAATGTGCAACCATTA-CTCCAGGT-----------AGTTTAAT-ATAAAGAATTAT-AAAT-TAG--------------------CTCTC-AG--TTTTAACTGGTTCAGCAGTACTCAGTTTTTTT--AAAATGTGATTTTGATGGTTTAAGGTAATATTGTCTACAGATGAAGATCGTGTGAGAGAATTTAAG-TTGAAGCAAATGTGG-AAGAGTCCAAATGGCAC-AATAAGGAACATTTTGAAT-GGTCTGTG-----ATTATCGTTAAGAATTTCTGATTCTCTAACTTTT-ATAT--GCATCTATTGGTAATGAGTCT-------------------------------GATGACCATTGTGCTTGTCTCCTGCTGCTGCAGGTACCGTCTTC-AGAGAACC-AATTATTTGCAAAAA----------CGT-CCCCAAGCTTGTTCCAGGTACTT-AGC-TTTTTCTTGATAACGCTGCTCGTCTCACCTTTTA-ACTATCACTAGACATCAACTTTCAAGCTGCTGGTGTTGTCAGGATGGACAAAGCCAATTTGTATTGGAAGGCATGCTTTTGGTGATCAATACCGAGCAACCGATG---CAGTTATTAAAGGAGCTGGGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'Figures 2-4 idh') = N: 1-1401; CODONPOSSET CodonPositions (CHARACTERS = 'Figures 2-4 idh') = N: 1-1401; END; BEGIN TREES; TITLE Tb11189; LINK TAXA = Taxa1; TRANSLATE 1 Mentzelia_torreyi_H1923, 2 Mentzelia_aspera_H4022, 3 Mentzelia_goodrichii_H4144_1, 4 Mentzelia_laevicaulis_Hi21852, 5 Mentzelia_involucrata_H_M_sn, 6 Mentzelia_tricuspis_B065, 7 Mentzelia_affinis_B211, 8 Mentzelia_affinis_B423, 9 Mentzelia_affinis_B467, 10 Mentzelia_albicaulis_B337, 11 Mentzelia_albicaulis_F4427, 12 Mentzelia_albicaulis_H3243, 13 Mentzelia_albicaulis_M2345, 14 Mentzelia_arizonica_B424, 15 Mentzelia_arizonica_B426, 16 Mentzelia_arizonica_B431, 17 Mentzelia_arizonica_F4542, 18 Mentzelia_arizonica_T3038, 19 Mentzelia_californica_B056, 20 Mentzelia_californica_B189, 21 Mentzelia_californica_B476, 22 Mentzelia_congesta_B084, 23 Mentzelia_congesta_B285, 24 Mentzelia_congesta_T1659, 25 Mentzelia_crocea_B093, 26 Mentzelia_crocea_B246, 27 Mentzelia_crocea_B259, 28 Mentzelia_desertorum_B061, 29 Mentzelia_desertorum_B441, 30 Mentzelia_desertorum_G91_85, 31 Mentzelia_desertorum_T3014, 32 Mentzelia_desertorum_Z2675, 33 Mentzelia_dispersa_B096, 34 Mentzelia_dispersa_B104, 35 Mentzelia_eremophila_B049, 36 Mentzelia_eremophila_B496, 37 Mentzelia_eremophila_P1959, 38 Mentzelia_gracilenta_B069, 39 Mentzelia_gracilenta_B214, 40 Mentzelia_gracilenta_B215, 41 Mentzelia_jonesii_B063, 42 Mentzelia_jonesii_B193, 43 Mentzelia_jonesii_B413, 44 Mentzelia_jonesii_B433, 45 Mentzelia_jonesii_B509, 46 Mentzelia_lindleyi_B087, 47 Mentzelia_lindleyi_B090, 48 Mentzelia_lindleyi_B216, 49 Mentzelia_micrantha_B260, 50 Mentzelia_micrantha_B266, 51 Mentzelia_mojavensis_B055, 52 Mentzelia_mojavensis_B479, 53 Mentzelia_mojavensis_P1935, 54 Mentzelia_mojavensis_Z2520, 55 Mentzelia_mollis_B235, 56 Mentzelia_mollis_B236, 57 Mentzelia_mollis_B240, 58 Mentzelia_mollis_B343B, 59 Mentzelia_mollis_H4093, 60 Mentzelia_mollis_T7777, 61 Mentzelia_monoensis_B367, 62 Mentzelia_monoensis_B520, 63 Mentzelia_monoensis_Z2640, 64 Mentzelia_montana_B085, 65 Mentzelia_montana_B425, 66 Mentzelia_nitens_B075, 67 Mentzelia_nitens_B079, 68 Mentzelia_nitens_B222, 69 Mentzelia_nitens_B242, 70 Mentzelia_nitens_B457, 71 Mentzelia_obscura_B058, 72 Mentzelia_obscura_B397, 73 Mentzelia_obscura_B461, 74 Mentzelia_packardiae_B335, 75 Mentzelia_packardiae_B336, 76 Mentzelia_packardiae_B338a, 77 Mentzelia_packardiae_Pa78_214, 78 Mentzelia_pectinata_B053, 79 Mentzelia_pectinata_B204, 80 Mentzelia_pectinata_B213, 81 Mentzelia_ravenii_B197, 82 Mentzelia_ravenii_B507, 83 Mentzelia_ravenii_G_sn, 84 Mentzelia_montana_B277, 85 Mentzelia_montana_B370, 86 Mentzelia_thompsonii_B225, 87 Mentzelia_thompsonii_B234, 88 Mentzelia_thompsonii_B345, 89 Mentzelia_veatchiana_B105, 90 Mentzelia_veatchiana_B187, 91 Mentzelia_veatchiana_B210, 92 Mentzelia_veatchiana_B384; TREE Fig._1 = [&R] (((1,2),((3,4),(5,6))),((((((7,9),8),(49,50)),(((((((10,11,12,13,16,17,18,19,21,22,23,24,27,40,51,52,53,54,((61,63),62),64,65,81,83,84,85,89,90,91,92),55,74),(14,(26,37,38,48,69,78,80),39,43,79),25,((75,77),76)),((((15,36,66,(67,68)),20,35),70),(46,47))),(((28,(29,30),31,32,(71,72)),(41,73)),(42,(45,82)))),((56,59),57)),(58,60),((86,88),87))),(33,34)),44)); END; BEGIN TREES; TITLE Tb11190; LINK TAXA = Taxa2; TRANSLATE 1 Mentzelia_lindleyi_B216_2, 2 Mentzelia_lindleyi_B216_3, 3 Mentzelia_lindleyi_B216_4, 4 Mentzelia_micrantha_B260_1, 5 Mentzelia_micrantha_B260_2, 6 Mentzelia_micrantha_B260_3, 7 Mentzelia_micrantha_B266, 8 Mentzelia_mojavensis_B479_1, 9 Mentzelia_mojavensis_B479_2, 10 Mentzelia_mollis_B235_1, 11 Mentzelia_mollis_B235_2, 12 Mentzelia_mollis_B235_3, 13 Mentzelia_mollis_B235_4, 14 Mentzelia_mollis_B236_1, 15 Mentzelia_mollis_B236_2, 16 Mentzelia_mollis_B236_3, 17 Mentzelia_mollis_B236_4, 18 Mentzelia_mollis_B236_5, 19 Mentzelia_mollis_B343B, 20 Mentzelia_mollis_Tiehm7777, 21 Mentzelia_monoensis_B367_1, 22 Mentzelia_monoensis_B367_2, 23 Mentzelia_monoensis_B367_3, 24 Mentzelia_monoensis_B520_1, 25 Mentzelia_monoensis_B520_2, 26 Mentzelia_monoensis_B520_3, 27 Mentzelia_monoensis_B520_4, 28 Mentzelia_monoensis_B520_5, 29 Mentzelia_montana_B085_1, 30 Mentzelia_montana_B085_2, 31 Mentzelia_montana_B095_1, 32 Mentzelia_montana_B095_2, 33 Mentzelia_montana_B277, 34 Mentzelia_montana_B370_1, 35 Mentzelia_montana_B370_2, 36 Mentzelia_montana_B370_3, 37 Mentzelia_montana_B425_1, 38 Mentzelia_montana_B425_2, 39 Mentzelia_nitens_B079_1, 40 Mentzelia_nitens_B079_2, 41 Mentzelia_nitens_B079_3, 42 Mentzelia_nitens_B079_4, 43 Mentzelia_nitens_B242_1, 44 Mentzelia_nitens_B242_2, 45 Mentzelia_obscura_B052_1, 46 Mentzelia_obscura_B052_2, 47 Mentzelia_obscura_B052_3, 48 Mentzelia_obscura_B058_1, 49 Mentzelia_affinis_B201, 50 Mentzelia_affinis_B203, 51 Mentzelia_affinis_B211_1, 52 Mentzelia_affinis_B211_2, 53 Mentzelia_affinis_B211_3, 54 Mentzelia_affinis_B211_4, 55 Mentzelia_affinis_B423, 56 Mentzelia_affinis_B467_1, 57 Mentzelia_affinis_B467_2, 58 Mentzelia_albicaulis_B191B_1, 59 Mentzelia_albicaulis_B191B_2, 60 Mentzelia_albicaulis_B337_1, 61 Mentzelia_albicaulis_B337_2, 62 Mentzelia_albicaulis_B337_3, 63 Mentzelia_albicaulis_B337_4, 64 Mentzelia_arizonica_B424_1, 65 Mentzelia_arizonica_B424_2, 66 Mentzelia_arizonica_B424_3, 67 Mentzelia_arizonica_B424_4, 68 Mentzelia_arizonica_B431_1, 69 Mentzelia_arizonica_B431_2, 70 Mentzelia_arizonica_B431_3, 71 Mentzelia_californica_B456_1, 72 Mentzelia_californica_B456_2, 73 Mentzelia_californica_B476_1, 74 Mentzelia_californica_B476_2, 75 Mentzelia_californica_B476_3, 76 Mentzelia_congesta_B084_1_19, 77 Mentzelia_congesta_B084_2, 78 Mentzelia_congesta_B285, 79 Mentzelia_congesta_B356_1, 80 Mentzelia_congesta_B356_2, 81 Mentzelia_congesta_B360_1, 82 Mentzelia_congesta_B360_2, 83 Mentzelia_crocea_B093_1, 84 Mentzelia_crocea_B093_2, 85 Mentzelia_crocea_B093_3, 86 Mentzelia_crocea_B093_4, 87 Mentzelia_crocea_B093_5, 88 Mentzelia_crocea_B246_1, 89 Mentzelia_crocea_B246_2, 90 Mentzelia_crocea_B246_3, 91 Mentzelia_desertorum_B061_1, 92 Mentzelia_desertorum_B061_2, 93 Mentzelia_desertorum_B061_3, 94 Mentzelia_desertorum_B061_4, 95 Mentzelia_desertorum_B061_5, 96 Mentzelia_desertorum_Glenn91_85, 97 Mentzelia_dispersa_B096_1, 98 Mentzelia_dispersa_B096_2, 99 Mentzelia_dispersa_B104_1, 100 Mentzelia_dispersa_B104_2, 101 Mentzelia_dispersa_B104_3, 102 Mentzelia_dispersa_B104_4, 103 Mentzelia_dispersa_B104_5, 104 Mentzelia_dispersa_B104_6, 105 Mentzelia_dispersa_B362, 106 Mentzelia_dispersa_B388_1, 107 Mentzelia_dispersa_B388_2, 108 Mentzelia_dispersa_B388_3, 109 Mentzelia_eremophila_B049_1, 110 Mentzelia_eremophila_B049_2, 111 Mentzelia_eremophila_B049_3, 112 Mentzelia_eremophila_B049_4, 113 Mentzelia_eremophila_B049_5, 114 Mentzelia_eremophila_B049_6, 115 Mentzelia_eremophila_B049_7, 116 Mentzelia_obscura_B058_2, 117 Mentzelia_obscura_B058_3, 118 Mentzelia_packardiae_B239_1, 119 Mentzelia_packardiae_B239_2, 120 Mentzelia_packardiae_B239_3, 121 Mentzelia_packardiae_B239_4, 122 Mentzelia_packardiae_B304, 123 Mentzelia_packardiae_B335_1, 124 Mentzelia_packardiae_B335_2, 125 Mentzelia_pectinata_B053_1, 126 Mentzelia_pectinata_B053_2, 127 Mentzelia_pectinata_B204, 128 Mentzelia_pectinata_B213_1, 129 Mentzelia_pectinata_B213_2, 130 Mentzelia_pectinata_B213_3, 131 Mentzelia_ravenii_B197_1, 132 Mentzelia_ravenii_B197_2, 133 Mentzelia_ravenii_B507_1, 134 Mentzelia_ravenii_B507_2, 135 Mentzelia_thompsonii_B225, 136 Mentzelia_thompsonii_B234_1, 137 Mentzelia_thompsonii_B234_2, 138 Mentzelia_thompsonii_B345, 139 Mentzelia_veatchiana_B105_1, 140 Mentzelia_veatchiana_B105_2, 141 Mentzelia_veatchiana_B105_3, 142 Mentzelia_veatchiana_B105_4, 143 Mentzelia_veatchiana_B105_5, 144 Mentzelia_veatchiana_B187_1, 145 Mentzelia_veatchiana_B187_2, 146 Mentzelia_veatchiana_B187_3, 147 Mentzelia_veatchiana_B210_1, 148 Mentzelia_veatchiana_B210_2, 149 Mentzelia_veatchiana_B210_3, 150 Mentzelia_veatchiana_B210_4, 151 Mentzelia_argillosa_H4145, 152 Mentzelia_decapetala_H3753, 153 Mentzelia_goodrichii_H4144, 154 Mentzelia_memorabilis_H4153, 155 Mentzelia_multicaulis_H4137, 156 Mentzelia_multicaulis_H4258, 157 Mentzelia_strictissima, 158 Mentzelia_tiehmii_H4157, 159 Mentzelia_tricuspis_H553, 160 Mentzelia_eremophila_B496_1, 161 Mentzelia_eremophila_B496_2, 162 Mentzelia_eremophila_Provance1959, 163 Mentzelia_gracilenta_B069_1, 164 Mentzelia_gracilenta_B069_2, 165 Mentzelia_gracilenta_B069_3, 166 Mentzelia_gracilenta_B214_1, 167 Mentzelia_gracilenta_B214_2, 168 Mentzelia_gracilenta_B214_3, 169 Mentzelia_gracilenta_B214_4, 170 Mentzelia_gracilenta_B215_1, 171 Mentzelia_gracilenta_B215_2, 172 Mentzelia_gracilenta_B215_3, 173 Mentzelia_gracilenta_B215_4, 174 Mentzelia_jonesii_B063_1, 175 Mentzelia_jonesii_B063_2, 176 Mentzelia_jonesii_B063_3, 177 Mentzelia_jonesii_B193_1, 178 Mentzelia_jonesii_B193_2, 179 Mentzelia_jonesii_B193_3, 180 Mentzelia_jonesii_B433, 181 Mentzelia_lindleyi_B087_1, 182 Mentzelia_lindleyi_B087_2, 183 Mentzelia_lindleyi_B087_3, 184 Mentzelia_lindleyi_B087_4, 185 Mentzelia_lindleyi_B087_5, 186 Mentzelia_lindleyi_B090_1, 187 Mentzelia_lindleyi_B090_2, 188 Mentzelia_lindleyi_B216_1; TREE 'Figs. 2, 3, 4' = [&R] (((((((105,(97,(98,(108,106,(100,101)),99))),(166,(102,107)),(24,21,25,22)),(26,((138,(136,135)),((174,7),4)))),(((14,(20,15),16),((123,10),19),118),((103,(51,45,(48,91),96)),((79,(128,167),76,163,81,(139,34,88,148,(141,60)),83),((119,(120,124)),17,11),(((23,28),((29,37,31),(8,131,144,58))),(160,((((5,109),92),181,104,46,175),(162,116)),39,64,27)))))),((((178,(85,90)),((3,((80,82),164),(129,173),(134,77),84,(63,(89,(140,35,147,62)))),(((165,(143,145,150)),(78,130,127,125)),(179,(67,70))),132)),(((68,6,59,110,180,73,161,((93,71),9)),(43,40)),(((172,(168,169,176)),170,187,182,171),(2,((188,(183,1,184,(186,177))),((66,(32,38)),(69,74,72,146,133,30,33,75,(61,36),149),65,142)))))),(49,(52,(53,12,137,56,111,55))))),((((112,94),(54,113),57),50),(((13,121),(18,122)),((86,41),((((95,114),115),((117,(126,47)),44)),(185,(42,87))))))),(159,(((155,153),(152,157)),((151,156),(158,154))))); END;