#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 5:35 GMT TreeBASE (cc) 1994-2008 Study reference: Yaguchi T., Matsuzawa T., Tanaka R., Abliz P., Hui Y., & Horie Y. 2010. Two new species of Neosartorya isolated from soil in Xinjiang, China. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10230] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=43; TAXLABELS Aspergillus_brevipes Aspergillus_clavatus Aspergillus_duricaulis Aspergillus_fumigatiaffinis Aspergillus_fumigatus Aspergillus_fumisynnematus Aspergillus_lentulus Aspergillus_novofumigatus Aspergillus_turcosus Aspergillus_unilateralis Aspergillus_viridinutans Neosartorya_assulata Neosartorya_aurata Neosartorya_aureola Neosartorya_australensis Neosartorya_coreana Neosartorya_denticulata Neosartorya_fennelliae Neosartorya_ferenczii Neosartorya_fischeri Neosartorya_galapagensis Neosartorya_glabra Neosartorya_hiratsukae Neosartorya_indohii Neosartorya_laciniosa Neosartorya_multiplicata Neosartorya_nishimurae Neosartorya_papuensis Neosartorya_paulistensis Neosartorya_pseudofischeri Neosartorya_quadricincta Neosartorya_shendaweii_IFM57610 Neosartorya_shendaweii_IFM57611 Neosartorya_spathulata Neosartorya_spinosa Neosartorya_stramenia Neosartorya_sublevispora Neosartorya_tatenoi Neosartorya_tsunodae_IFM53603 Neosartorya_tsunodae_IFM57609 Neosartorya_tsurutae Neosartorya_udagawae Neosartorya_warcupii ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4765] TITLE 'b-tubulin'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=468; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aspergillus_brevipes TATGTCTCGACCTCAACGCTCGGATGATGGAAGATTAGGACCAGTC--AGCTCAGCAGGCGGTTCTCCAT-CGGTTCTGGTTTGCTGTCATGGGCATCAGCTGACAAAACTTATAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CAACCTTTATCC-TCCCAATTGAGAGAGCCGAGGA-ACCGCGAAA-GGCAAGCAGGAAGAGGACGCGTGTCTGATGGGGA-TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGCATGAAACTCTCGACCCTACACTACTTCG-GCAACA-TCTCACGATC-TGAATCGCCATTAGGCCAACGGCGACAAGTATGTTCCTCGTGCTGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Aspergillus_clavatus AATGCATTGATGTTGATG--TTGATGATGGAAGATTCAGAGCCATACAATCTCAATTGGCAATTCGCCTGGGGGTTGTGGTTCCAGTTCGTGGATATGGGCTGACAGA-TTTATAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTG-CAACCTTT---TATTCCGATCGATATGGCGGAAGGAAATATGAGGAGGATTACAACACTGAG-CATGGATCTGATGGAAA-TGATAGCTACAATGGCACCTCCGATCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGG-TGGGATTCCGTA--------TGCTTCG-ACAAAACCTTCACGATCCTAACTCCCTGCCAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCTGGTCCA-TTCGGCGAG Aspergillus_duricaulis TATGTCTCGACCTCAATGATTCGATGATGGAAAATCAGGACCAGTC--AGCTCAGCAGGCTGTTCTCCAT-CACTTCTGGCT-GCTGTCATGGTCATCAGCTGACAAA-CTTATAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CAACCTTTGTCC-TCCCAATTGAGAAACCGGGGGA-GCCACGAAA-GGCAAGCAGGAAGAGAACGCGTGTCTGATGGGGA-TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTCTCGACTCTACACTACTTCG-GCAACA-CCCAACAATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCTGTTCTGGTGGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Aspergillus_fumigatiaffinis TATGTCTCGACCTCAATGCTTGGATGATGGGAGATAGGAACCTGTC--ATCTTAGCAGGCTGTCCTCCAT-GGGTTCAGCTTCGCTGTCATGGGTATCAGCTAACAAA-TCTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACAC-AAA-GGCAAGGAAGAAGAGGACGCGTGTCTGATTGGCA-TAATAGCTACAATGGCTCCTCCGACCTTCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTTGATGAAACTTTCGACTCTACACTACTTCG-GCAATT-TCTCACGATC-TAACTCGCT-CTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Aspergillus_fumigatus TATGTCTTGACCTCAAAGCTTGGATGACGGGTGATTGGGATCTCTC--ATCTTAGCAGGCTA-CCTCCAT-GGGTTCAGCCTCACTGTCATGGGTATCAGCTAACAAA-TCTACAGGCAGACCATCTCTGGTGAGCATGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTATATCC-TCCCAATTGAGAAAGCGGCGGA-AACACGGAA-AACAAGGAAGAAGCGGACGCGTGTCTGATGGGAAATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGTGTGGATGAAACTCTTGATT-TATACTATTTCG-GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAATATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCTGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Aspergillus_fumisynnematus TATGTCTCGACCTCAATGCTAGGATGATGGGAGATTGGGACCTGTC--ATCTTAGCAGGCCGTCCTCCAT-GTGTTCAGCTTCGCTGTCATGAGTTTCAGCTAACAAT-GCTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTATATCC-TCCCAGTTGAGAAAGCGGCGGA-AACACGAAA-TGCAAGAAAGAAGAGGAGGCGTGTCTGATGGGGA-TAATAGCTACAATGGCTCCTCCGATCTGCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTCTCGACCCTACACTCCTTTG-ACAACA-TCCCACGGTC-TGACTCGCTACTAGGCCAACGGCGACAAGTATGTTCCTCGTGCCGTCCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Aspergillus_lentulus TATGTCTCCACCTCAATGCTAGGATGATGGGAGACTGGGACCTGTC--ATCTTAGCAGGCTGTCC-CCAT-GTGTTCAGCTTCGCTGTCATGAGTATCAGCTAACAAA-TCTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTATATCC-TCCCAATCGAGAAAGCGGCGGA-AACACGTAA-GGCAAGGAAGAAGAGGACGCGTGTCTGACGGGGA-TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTCTCGACTCTACACTCCTTTG-ACAACA-TCTCACGGTC-TGACTCGCTACTAGGCCAACGGCGACAAGTATGTTCCTCGTGCCGTCCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Aspergillus_novofumigatus TAAGTCTCGACCTCAATGCTTGGATGATGGGAGACTGGGACCTGTC--ATCTTAGCAGGCTGTCCTCCATTGGGATCAGCTTCGCTGTCATAGGTATCAGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACACGAAA-GGCAAGGAAGAAGAGGACGCGTGTCTGATTGGGA-TAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTTGATGAAACTCTCGACTCTGCACTACTTCG-GCAATT-TCTCACGATC-TAACTTGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCTGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Aspergillus_turcosus TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCGGTC--ATCTCAGCAGGCTGTCCTCCAT-GGGTTCTGGT-CGTCGTCATGGGTATCAGCTAACAAA-TATACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTGATCC-TCCCAATCGAGAAAGCGGGGGA-AACACGAATCGGCAAGCAGGAAGAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACGCTAA-CTACTGCC-GCAACA-TCTCACGATC-TGACCCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGCCCC-TTCGGCGAG Aspergillus_unilateralis TATGTCTCGACCTCAATGCTTGGATGATAGGACATTAGGACCGGTC--AGCTCAGCAGGCTGTCCTTCAT-GGATTCTGGT-CGCCGTCATGATTATCAGCTAACAAA-TTTACAGGCAGACTATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACACGAAA-CGCGAGCAGGAAGAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCAACTCT-TACTACTGGC-GCAACA-TCTCACGACC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Aspergillus_viridinutans TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGTC--ATCATAGCAGGC----CTCCAT-GGGTTCAGCTTCGCTGTCATGGGTATCAGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATTGTGAAAGCGGGGGA-AACACGAAA-GGCAAGCAGGAAGAGGACGCGTGTCTGATGGGGA-TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTCTCGACTCTACACCACTTTG-GCAACA-TCTCACGATC-TGACTCG?TACTAGGCCAACGGAGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGG?GAG Neosartorya_assulata TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCGGTC--ATCTCAGCAGGCTGTCCTCCAT-GGGTTCTGGT-CGCCGTCATGGGTATCAGCTAACAAA-TATACAGGCAGACCATCTCCGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCGATTGAGAAAGCGCGGGA-AACACGAAA-GGCAAGCAGGAAGAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGTTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACTCT-AACTACTGCC-GGAACA-TCTCAGAATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_aurata TATGTCTCGACCTCAATGCTTTGATGATGGAAGATTAGAACCAGTC--ATCTCAGCAGGCTGTC-TCCGT-GGGCTCTGGT-CGCCGCCATAGGTATCAGCTAACAAA-TTTACAGGCAGACAATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-CCTTGATTGAGAAAGCGGGGGGCAACACGAAA-GGCAAGCAGGAAGAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAGCTCTCGACCCT-AATTACTTCG-GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCCGG?CCC-TTCGGCGAG Neosartorya_aureola TATGC?TCAACCTCAATGCTTGGATGATGGGAGATTAGGACCTGTC--ATCCTAGCAGGCTGTCCTCTAT-GATTTCAGCGTCGCTGTAATGGGTATCAGCTAACAAG-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATCGAGAAAGCGGGGGA-AACACGAAA-GGCAAGCAGGAAGAGG-CGCGTGTCTGATGAGGA-TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTC--GACTCTACACTACTTCG-GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAATATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_australensis TATGTCTCGACCTCAAT---TGAATGATGGAAGATGAGGACCAGTC--AGCTCGGCAGGCTGTTCTCGAT-CGGTTCTA-GTTGCTGTCATGGGTA-TAGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCGCAAT---GAAAGCGGGGAAA--CACGAAA-GGCAAGCAGGAAGAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACTCT-AACTACTGCC-GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_coreana TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGTC--ATCTTAGCAGGCTGTCCTCCAT-GGGTTCAGCTTCGCTGTCATGGGTATCAGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCGATTGAGAAAGCGGCGGA-AACACGAAA-TGCAAGGAAGAAGAGGACGCGTGTCTGATCGGAA-TAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGTTAAAACTCTCGACTCTACACTACTTCG-GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_denticulata TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCAGTC--AGCTCAGCAGGCTATTCTCCAT-CGGTTTTTTGTCGCCGTCGTGTGTACTGGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCGCAATTGAGAAAGCGGGGGAAACATGAAAA-GGCAAGCGGGAAGAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGAATGAGACTCTCGACTCT-AA-TACTGCG-GCAACA-TCTCACGATC-TGACTCTCTATTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_fennelliae TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCAGTC--AGCTCAGCAGGCTATTTTCCAT-CGGTTTTTCGTCGCCGTCATGTGTACCAGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGAAAACACGAAA-GGCAAGCGGGAAGAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTTGATGAAACTCTCGACTTT-AA-TACTGCT-GCAACA-TCTCACAATC-TGACTCGCTGTTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_ferenczii TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCAGTC--AGCTCAGCAGGCTATTCTCCAT-CGGTTTTTTGTCGCCGTCGTGTGTACTGGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCATTATCC-TCGCAATTGAGAAAGCGGGGGAAACATGAAAA-GGCAAGCCTGAAGAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGAATGAGACTCTCGACTCT-AA-TACTGCG-GCAACA-TCTCACGATC-TGACTCTCTATTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_fischeri TATGTCT?GACCTCAATTCTTGGATGACGGGAGATTGGGACCT-----GTCTTAGCAGGCTGTCCTCCAT-GGGTTCAGCTTCGCTGTCATGGGTATCAGCTAACAAA-TCTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTATATCC-TCCCAATTGAGAAAGCGGCGGA-AACACGAAA-GG-AAGGAAGAAGAGGACGCGTGTCTGATGGGGT-TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGTGTGGATGAAACTCTCGACT-C-TACTATTTCG-GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCTGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_galapagensis TATGTCTCGACCTCAATGCTTAGATGATCGGAGATTAGGACCCGTC--ATCTCAGCAGGCTGTCCTCCAT-GGGTTCTGGT-CGCTGTCATGAGTATCAGCTAACAAA-TTTATAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATTGAGAACGCGGGGGA-AGCACGAAA-GGCAAGCAGGAAGAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGCATGAAACTCTCGACTCT-AACTACTGCG-GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_glabra TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCAGTC--AGCTCAGCTGGCTGTCCTCCAT-GGGTTCTGGT-CGTCGTCGTGGGTAT-AGCTAACAGA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTCTATCC-TCCCAATTGAGAAAGCGGGGAA--ACACAAAA-GGCAAGCAGGAAGAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACATTAAACTACTG---GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTTGGCGAG Neosartorya_hiratsukae TATGTCTCGACCTCAATGCTTGGATGATGGAATATTAGGACCAGCC--AGC----------ATCCTCGAT-CGGTTCTA-GTTGCTGTCATGGGTA-TAGCTAACAAA-TTTCCAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGAAA-CACGAAA-GGCAAGCAGGAAGAGAACGCGTCTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACTCTTAACTACTTCG-GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGCCCC-TTCGGCGAG Neosartorya_indohii TATGCCTCAACCTCAATGCTTGGATGATGGGAGATTAGGACCTGTC--ATCCTAGCAGGCTGTCCTCTAT-GATTTCAGCGTCGCTGTAATGGGTATCAGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATCGAGAAAGCGGGGGA-AACACGAAA-GGCAAGCAGGAAGAGG-CGCGTGTCTGATGAGGA-TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTC--GACTCTACACTACTTCG-GTAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAATATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_laciniosa TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGTC--ATCTTAGCAGGCTGTCCTCCAT-GGGTTCAGCTTCGCTGTCATGGGTATCAGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACCCGAAA-TGCAAGGAAGAAGAGGACGCGTGTCTGATGGGGA-TAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAATGAGGTGCGTGGATGACACTC--GACTCTACACTACTTCG-GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_multiplicata TATGTCTCGACCTCAATGCTTAGATGATGGAAGACTAGGACCTGTC--ATCTCAGCAGGCTGTCC-CCAT-GGGTTCTGGT-CGCCGTCATGGGTATCAGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATTGAGAAAGCCGGGGA-AACACGAAA-GGCAAGCAGGAAGAGGACGCGTGCCTGATGGGA--TAATAGCTACAATGGCACCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTACGTGAATGAAACTCT--------AACTACTGCC-GCAACA-TTTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTCGTTGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_nishimurae TATGTCTCGACCTCGATGCTTGGGTGATGGAATATTAGGACCGGGC--ATCTCAGCAGGCTGTCCTACAT-GGGTTCAGGT-CGCTGTCATGGGTATCAGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTGATCC-TCCCAATCGAGAAGGCGGGGGA-AACACGAAA-GGCAAGCAGGAAGAGGACGCGTGTCTGATGGCA--TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACGCTAA-CTACTGCC-GCAACA-TCTCACGATC-TGACTCGCTGCTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_papuensis TATGTCTCGACCTCAAT---TGGATGATGGAAGATTAGGACCAGTC--AGCTCAGCAGGCTGTCCTTCAT-GGGTTCTGGT-CGCCGTCATGAGTATCAGCTAACAAA-TCTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGATGGCTCTGGCCAGTAAGTTTCGACCTTTATCC-TCCCGATTGAGAAAGCGGGG-A-AACACGAAA-GGCAAGCAGGAAGAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACTCT-AACTACTGCC-GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTAGGCGAG Neosartorya_paulistensis TATGTCTCGACCTCAATGC?TGGATGATGGGAGTTTAGGACCTGTC--ATCTTAGCAGGCTGTCCTCCAT-GGGTTCAGCTTCGCTGTCATGGGTATCAGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACCCGAAA-TGCAAGGAAGAAGAGGACGCGTGTCTGATGGGGA-TAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGACACTC--GACTCTACACTACTTCG-GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_pseudofischeri TATGTCTTGATCTCAATGCTCGGATGATGGAAGATGAGGACCA--------------GGCTGTCCTCCAT-GGGCTCTGGTTCGCTGTCATGGGTATCAGCTGACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTCGACGGCTCTGGCCAGTAAGTT-CGACCTTTGTCC-TCCCAATTGAGAAAGCGGGGGA-AACACGAAA-GGCAAGCAGGAAGAGGACCCGTGTCTGATGGGGA-TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTCTCCGGTCGACGCTATTTCGGGCAACA-TCTCATGATC-TGACTTGCTACCAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTCCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_quadricincta TACGTCTCGACCTCAACGCTCGGATGATGGAAGTTTAAGACCGGCC--GTCTCAGCAGGCTGTTCTCCAT-CGGTTCTGGTTTGCTGTCATGGGTATCAGCTGACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CAACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-ACCACGAAA-GGCAAGCAGGAAGAGGACGCGTGTCTGATGGGTA-TAACAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGGGTGGATGAAACTCTCGACTCTACACTACTTCG-GCAACAATCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCTGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_shendaweii_IFM57610 TATGTCTCGACCTCAAT---TGGATGATGGAAGAATAGGATCTGTC--ATCTCAGCAGGCTGTCTTCCAT-GGGTTCTAGTTCGCCGTCATGAGTATCAGCTAATAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATTGAGAAAGCGGAGGA-AACACGAAA-GGCAAGCAGGAAGAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGGTGAAACTCTCGACTCT-AACTACGTTG-GCAACA-TCTCACGATC-TGACTCGCTATTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_shendaweii_IFM57611 TATGTCTCGACCTCAAT---TGGATGATGGAAGAATAGGATCTGTC--ATCTCAGCAGGCTGTCTTCCAT-GGGTTCTAGTTCGCCGTCATGAGTATCAGCTAATAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATTGAGAAAGCGGAGGA-AACACGAAA-GGCAAGCAGGAAGAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGGTGAAACTCTCGACTCT-AACTACGTTG-GCAACA-TCTCACGATC-TGACTCGCTATTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_spathulata TATGTCTCGACCTCGATGCTTGGATGATGGAAGATTAGGACCAGTC--AGTTCGGCAGGCTGTCCTCCAT-CGGTTACGCTTCGCTGTCATGGGCATCAGCTAACAGG-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCCATCCCAAACGAGACAGCGGGGAA-ACCCCGAAA-AGCAAGCAGGAAGAGGACGCGTGTCTGATGGGGA-TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGCATGAAACTCTCGACTCTACAATACTTGG-GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTCCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTTCGTGCCGGTCCC-TTCGGCGAG Neosartorya_spinosa TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGTC--ATCTTAGCAGGCTGTCCTCCAT-GGGTTCAGCTTCGCTGTCATGGGTATCAGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACACGAAA-TGCAAGGAAGAAGAGGACGCGTGTCTGATGGGGA-TAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGACACTCTCGACTCTACACTACTTCG-GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_stramenia TATGTCTCGACCTCAATGCTTTGATGATGGAAGATTAGAACCGGTC--ATCTCAGCAGGCTGTCCTCCGT-GGGTTCTGGT-CGCCGTCATAGGTATCAGCTAACATA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-CCCCGATTGAGAAAGCGGGGGGCAACACGAAA-GGCAAGCAGGAAGAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAGCTCTCGACCCT-AATTACTTCG-GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCCCTTCGGCGAG Neosartorya_sublevispora TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCAGTC--AGCTCAGCAGGCTATTCTCCAT-CGGTTTTTTGTCGCCGTCGTGTGTACTGGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCATTATCC-TCGCAATTGAGAAAGCGGGGGAAACATGAAAA-GGCAAGCCTGAAGAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGAATGAGACTCTCGACTCT-AA-TACTGCG-GCAACA-TCTCACGATC-TGACTCTCTATTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_tatenoi TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCGGTC--ATCTCAGCAGGCTGTCCTCCAT-GGGTTCTGGT-CGCCGTTATGGGTATCAGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTGATCT-TCCCAATTGAGAAAGCGGGGGA-AACACGAAA-GGCAAGCAGGAAGAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTCTCGACTCTAAACTACTTCG-GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCTGGTCCC-TTCGGCGAG Neosartorya_tsunodae_IFM53603 TATGTCTCAACCTCAATGCTTGGATGATGGAAGACTAGGACCTGTC--ATCTCAGCAGGCTGTCCTCCAT-GGGTTCTGGT-CGCCGTCACGGGTATCAGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGATCTTTATCC-TCCCAATTGAGAAAGCCGGGGA-AACACGAAA-GGCAAGCAGGAAGAGGACGCGTGCCTGACGGGA--TAATAGCTACAATGGCACCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGAATGCAACTCT--------AGCTACTGCC-GCAACA-TTTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_tsunodae_IFM57609 TATGTCTCAACCTCAATGCTTGGATGATGGAAGACTAGGACCTGTC--ATCTCAGCAGGCTGTCCTCCAT-GGGTTCTGGT-CGCCGTCACGGGTATCAGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGATCTTTATCC-TCCCAATTGAGAAAGCCGGGGA-AACACGAAA-GGCAAGCAGGAAGAGGACGCGTGCCTGACGGGA--TAATAGCTACAATGGCACCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGAATGCAACTCT--------AGCTACTGCC-GCAACA-TTTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_tsurutae TATGTCTT--CTACAACGCTCGGATGATGGAAGTTTAGGACGGGCC--ATCTCAGCAGGCTGTTCTCCAT-CGGTTCTGGTTTGCTGTCATGGGTATCGGCTGACAAC-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CAACCTT-ATCC-TCCCAATTGAGAAAGCGGGGGA-ACCACGAAA-GGCAAGCAGGAAGAGGACGCGTGTCTGATGGGGT-TAACAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGGGTGGATGAAACTCTCGACTCTACACTACTTCG-GCAACAATCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCTGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG Neosartorya_udagawae TATGTCTCGGACTCAATGCTTGAAGGATGGGAGATTAGGACCTGTC--ATCCTAGCAGGCTTTCCTCCAT-GGTTTCAGCGTCGCTTTGATGGGTATCAGCTAACAAA-TTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACGCGAAA-GGCAAGCAGGAAGAGGGCGCGTGTCTGATGAGGA-TAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAAC?AGGTGCGTGGATGAAACTC--GACTCTACACTACTTCG-GCAACA-TATCACGATC-TGACTCGCT?CTAGGCCAACGGCGACAAATATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGGCGGTCCC-TTCGGCGAG Neosartorya_warcupii TATGTCTCGACCTCAATGCTTGGATGATAGGAGAT-AGGACCAGTC--AGCTCAGCAGGCTCTCCTTCAT-GGGTTCTGGT-CGCCGTCATGGGTATCAGCTAACAAA-TCTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAGTT-CGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACACGAAG--ACAAGCGGGAACAGGACGCGTGTCTGATGGGA--TAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACTCT-AACTACTACC-GCAACA-TCTCACGATC-TGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCC-TTCGGCGAG ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = 'b-tubulin') = N: 1-468; CODONPOSSET * CodonPositions (CHARACTERS = 'b-tubulin') = N: 1-468; END; BEGIN TREES; TITLE Tb11195; LINK TAXA = Taxa1; TRANSLATE 1 Aspergillus_viridinutans, 2 Aspergillus_brevipes, 3 Aspergillus_duricaulis, 4 Neosartorya_quadricincta, 5 Neosartorya_tsurutae, 6 Neosartorya_pseudofischeri, 7 Neosartorya_spathulata, 8 Aspergillus_clavatus, 9 Neosartorya_aurata, 10 Neosartorya_stramenia, 11 Aspergillus_unilateralis, 12 Neosartorya_warcupii, 13 Neosartorya_papuensis, 14 Neosartorya_assulata, 15 Neosartorya_tsunodae_IFM57609, 16 Neosartorya_tsunodae_IFM53603, 17 Neosartorya_multiplicata, 18 Neosartorya_galapagensis, 19 Neosartorya_shendaweii_IFM57610, 20 Neosartorya_shendaweii_IFM57611, 21 Neosartorya_glabra, 22 Aspergillus_turcosus, 23 Neosartorya_nishimurae, 24 Neosartorya_australensis, 25 Neosartorya_hiratsukae, 26 Aspergillus_fumigatiaffinis, 27 Aspergillus_novofumigatus, 28 Aspergillus_fumigatus, 29 Neosartorya_fischeri, 30 Aspergillus_fumisynnematus, 31 Aspergillus_lentulus, 32 Neosartorya_laciniosa, 33 Neosartorya_paulistensis, 34 Neosartorya_spinosa, 35 Neosartorya_coreana, 36 Neosartorya_aureola, 37 Neosartorya_indohii, 38 Neosartorya_udagawae, 39 Neosartorya_tatenoi, 40 Neosartorya_ferenczii, 41 Neosartorya_sublevispora, 42 Neosartorya_denticulata, 43 Neosartorya_fennelliae; TREE Fig._11 = [&R] (((((((((9,10),(((11,12),13),14)),((((15,16),17),18),(19,20))),(21,((((40,41),42),43),(24,25)))),((22,23),39)),((((26,27),((28,29),(30,31))),(((32,33),34),35)),(((36,37),38),1))),(((2,3),(4,5)),7)),6),8); END;