#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 20:13 GMT TreeBASE (cc) 1994-2008 Study reference: Rossman A., Schoch C.L., Farr D., Nishijima K., Keith L., & Goenaga R. 2010. Dolabra nepheliae on rambutan and lychee represents a novel lineage of phytopathogenic Eurotiomycetes. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10234] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=46; TAXLABELS Agonimia_sp_AFTOL_684 Ahracothecium_nanum_AFTOL_1649 Aspergillus_fumigatus_AFTOL_1079 Aspergillus_nidulans_AFTOL_1080 Caliciopsis_orientalis_AFTOL_1911 Caliciopsis_pinea_AFTOL_1869 Ceramothyrium_carniolicum_AFTOL_1063 Coccidioides_immitis_AFTOL_1084 Cyphellophora_laciniata_AFTOL_1033 Dactylospora_haliotrepha_AFTOL_186 Dactylospora_mangrovei_AFTOL_832 Dermatocarpon_miniatum_AFTOL_91 Dolabra_nepheliae_CBS_122119 Dolabra_nepheliae_CBS_122120 Dolabra_nepheliae_CBS_123297 Endocarpon_pallidulum_AFTOL_661 Endophyte_4466 Eupenicillium_javanicum_AFTOL_429 Eupenicillium_limosum_AFTOL_564 Exophiala_dermatitidis_AFTOL_668 Exophiala_pisciphila_AFTOL_669 Exophiala_salmonis_AFTOL_671 Geoglossum_nigritum_AFTOL_56 Histoplasma_capsulatum_AFTOL_1083 Lithothelium_septemseptatum_AFTOL_12 Monascus_purpureus_AFTOL_426 Penicillium_freii_AFTOL_378 Phaeoacremonium_chlamydosporum_CBS_229_95 Polyblastia_melaspora_AFTOL_1356 Pyrenula_aspistea_AFTOL_623 Pyrenula_pseudobufonia_AFTOL_387 Pyrgillus_javanicus_AFTOL_342 Ramichloridium_anceps_AFTOL_659 Sarcinomyces_petricola_AFTOL_825 Sphinctrina_turbinata_AFTOL_1721 Spiromastix_warcupii_AFTOL_430 Staurothele_frustulenta_AFTOL_697 Wahlenbergiella_mucosa_AFTOL_2264 rock_isolate_A14 rock_isolate_A95 rock_isolate_TRN107 rock_isolate_TRN214 rock_isolate_TRN242 rock_isolate_TRN475 rock_isolate_TRN488 rock_isolate_TRN508 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=21; TAXLABELS Agonimia_sp_AFTOL_684 Capronia_munkii_AFTOL_656 Capronia_pilosella_AFTOL_657 Ceramothyrium_carniolicum_AFTOL_1063 Cyphellophora_laciniata_AFTOL_1033 Dermatocarpon_miniatum_AFTOL_91 Dolabra_nepheliae_CBS_122119 Dolabra_nepheliae_CBS_122120 Dolabra_nepheliae_CBS_123297 Endocarpon_pallidulum_AFTOL_661 Endophyte_422 Endophyte_4466 Exophiala_dermatitidis_AFTOL_668 Granulopyrenis_seawardi_AFTOL_612 Phaeoacremonium_chlamydosporum_CBS_229_95 Pyrenula_aspistea_AFTOL_623 Pyrenula_pseudobufonia_AFTOL_387 Ramichloridium_anceps_AFTOL_659 Sarcinomyces_petricola_AFTOL_825 Sphinctrina_turbinata_AFTOL_1721 Staurothele_frustulenta_AFTOL_697 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4833] TITLE Eurotiomycetes_Fig._11; LINK TAXA = Taxa1; DIMENSIONS NCHAR=5610; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4210 4220 4230 4240 4250 4260 4270 4280 4290 4300 4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 4410 4420 4430 4440 4450 4460 4470 4480 4490 4500 4510 4520 4530 4540 4550 4560 4570 4580 4590 4600 4610 4620 4630 4640 4650 4660 4670 4680 4690 4700 4710 4720 4730 4740 4750 4760 4770 4780 4790 4800 4810 4820 4830 4840 4850 4860 4870 4880 4890 4900 4910 4920 4930 4940 4950 4960 4970 4980 4990 5000 5010 5020 5030 5040 5050 5060 5070 5080 5090 5100 5110 5120 5130 5140 5150 5160 5170 5180 5190 5200 5210 5220 5230 5240 5250 5260 5270 5280 5290 5300 5310 5320 5330 5340 5350 5360 5370 5380 5390 5400 5410 5420 5430 5440 5450 5460 5470 5480 5490 5500 5510 5520 5530 5540 5550 5560 5570 5580 5590 5600 5610 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Agonimia_sp_AFTOL_684 ACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-TCCTC--TG-GG-GTCCGAGTTGTAATTTGTAGAGGATGC-TTCGGGCAAGGCTGC-AGTCTAATTTGCTTGGAACAGCAAGTCACAGAGGGTGAGAGTCCCGTCT-AGGACC-GCGAGTCGCGTCCATGTG--AAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGAGCGACGGTTCCCCCGGCCCTCGGG-CCGGG-CTAC--T-CTGTCGTCT-C-CAGGCCAGCATCGGTTTGGGTGGTCGGTCAAAGACTCCGG-GAATGTATCTACC-TT---C-GGG--T-CG-ACTTATAGCCC-GGGGTGCAATGCGGCCCACC-CAGACCGAGG-AACGCG-CTT-CGGCCCGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGT-CAAACCC-CTACGCGTAATGAAAGTGAACGGAGGT-AAGAGCCCCCTTTTGG------AGGCGCATTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCGTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGTCGAAGTTTCCCTCAGGATA-GCAGTAA-CGAA--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTTGGGGTTGAAATGATGCCCCAACGAGTAGGCAGGCGTGGGGATTGGTGACGAAGCCTTGGGGGTGACCCCGGGTCGAACAATCTCTAGTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACCATCAAGCTGGCGGTGCCTGTCTACCATTATGGTTTCCTTGGAAAGGTCAAGAAGATCCTGGAGACGGTCTGCCACAATTGTGGAAAGATCAAAGCAGTTGAT---------------------------------------------------------------------------------------------TCCGAAGAACTGCGATAC---GCTCTCTCCATCCGCGACCGCAAGAAGCGCTTTGAACTCATCTGGCGCCTGAGCCAAAAACAGAATATTTGTCAAGCCGATTCTGCCGACGAGGAAGACGATCCGTTT------GGTAAAGACAAAGGTGGCAAAATCAAA---CATGGTGGATGTGGCAACGCGCAACCAGCGATTCGCAAAACAGGTCTTGAGCTCTGGGCACAATACAAACCTCGGAAG------------GGCGATGACGACGAAGAGACTGTTCCT---GAGAAATCACAGATCTGGCCTGCGCAGGCTCTACAGGTCTTCCAGCATCTCACCGATGACACCCTTGAGACGTTGGGTCTCAACCTCGATTTTGCCAGACCCGAA------------------------------------------------------TGGATGATTCTGCAAAGCCTCCCCGTACCACCCCCTCCTGTTCGACCTAGTATCAGCGTAGATGGAAGTGGGCAAGGCTCGCGCGGCGAAGATGATCTGACCTTCAAATTGGGAGACATCATCCGTGCCAACCAGAACTTGATCCGGGTTAACGCGGAAGGCGCCCCCGAGCACATTGCCAAAGAACTCCAGGCCCTGCTGCAATACCATGTCGCCACCTATATGGACAACGATATCGCCAACCTT------GACAAAGCACAACATAAGAGTGGCAGACCGATCAAGTCGATCCGTGCCCGCCTAAAGGGAAAGGAAGGCCGCCTTCGCCAGAATCTGATGGGAAAACGTGTCGATTTTTCTGCCCGCACGGTCATCACAGGCGACCCTAATCTCTCACTTGATGAAGTTGGTGTACCAATCAGCATTGCTAGGACATTGACATATCCCGAAACTGTAACTCAGTACAACATCAATAAGCTAGCACGACTGGTTGCCAGTGGACCGGAGCAGCATCCTGGCGCGCGGTACATCATTCGCCCACAAGGAGAGCGCATAGATCTTCGTTTTCATAAGAACACCTCG---CAGATCATTCTCCAAAACGGATGGAAGGTTGAACGACATATCATGGACGGCGATGTCATTCTTTTCAATCGTCAACCTTCGCTTAAGAACATGATCACTGGTACCTCTCAAGCTGACTGCGCTATTCTCATCATTGCCGCTGGTACTGGTGAATTCGAAGCTGGTATTTCCAAGGATGGCCAGACTCGCGAGCACGCTCTTCTTGCCTACACCCTTGGTGTCAAGCAGCTCATCGTCGCTGTCAACAAGATG------------------------------------------------------GACACCACCAAATGGTCTGAGGAACGATTCAACGAAATCGTCAAGGAAGTCTCCACCTTTATCAAGAAGGTTGGCTACAACCCCAAGACCGTCCCATTCGTTCCCATCTCCGGCTTCAATGGTGATAACATGATTGATGTCTCTGCCAATGCACCATGGTACAAAGGCTGGGAGAAGGAAACCAAG---------------ACC---AAGACGTCTGGCAAGACCCTCCTTGAAGCCATTGACAGCATCGATCCTCCCTCTCGTCCGACTGACAGGCCCCTCCGTCTCCCACTTCAGGATGTTTACAAGATCTCCGGTATTGGCACAGTTCCTGTTGGCCGTGTTGAGACTGGTATTATCAAGGCCGGTATGGTTGTCACTTTCGCTCCCGCCAACGTCACCACTGAAGTCAAGTCTGTCGAAATGCACCACGAACAACTTGTCGAAGGTCTTCCAGGCGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTCAAGGAAGTTCGCCGAGGCAACGTTGCTGGTGACTCCAAGAACGACCCTCCCCGGGGTGCTGATTCTTTCAACGCCCAAGTCATCGTTCTCAACCACCCAGGTCAAGTTGGCGCTGGTTATGCTCCCGTCCTTGATTGCCACACCGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATCGACCGCCGAACTGGCAAGTCCATCGAAAACGCTCCTAAATTCGTCAAGTCTGGTGATGCTGCCATCGTCAAGATGGTCCCCTCTAAGCCAATGTGTGTCGAGGCTTTCACTGACTATCCCCCTCTTGGTCGGTTTGCCGTCCGTGACATGAGACAAACCGTCGCCGTTGGTGTCATAAGGGCGAATTCC- Ahracothecium_nanum_AFTOL_1649 -----------------ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC--CCCG-GC-GGG-GTCCGAGTTGTAATTTGTAGAGGATGC-TTCGGGCAAGACTGC-GGTCTAAATCTCTTGGAACAGGGTATCAAAGAGGGTGAGAGTCCCGTCT-TTGACC-GTCTGTCGCGCCCATGTG--AAGCTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGGGCGGCGGTTCAGCCGTTATTCTTA-ATGGT-GTACTCTGCCGT--T-T-C-CAGGCCAGCATCGGTTTCGGTAGCCAGTTAAAGGC-TTGGTGAATGTATCTACCCTC---CGGG---GAAG-ACTTATAGCCC-CAGGTGACATCTGGCTTATC-GAGACCGAGG-TACGCG-CTT-CGGCACGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTGAAACCC-CAGCGCGTAATGAAAGTGAACGGAGGT-AGGAGCCCTC------------GGGCGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTC--TTCAGTTTTATGAGGTAAAGC-AATGATTAGCGGCCTTGGGGAAGTAACTTCCTTAACCGATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACCCCACAAAAGGTGTTAGTTCATCTTGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGCTACCCATACCTCGCCGTTAAAGTTGAAATGATGCTTTAACGAGTAGGCAGGCGTGGAGGTTTGTGACGAAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTTTAGATGGAGGTAC?AGTCTCTATCCAAATATTGAAAGATGCTAACAATGT------------------------------------------------TTAGAGGAATTACGATTA---GCTAAAGCATCTACCTCGAAGAGGCAGCGTTTCGAGAAAATATGGCAGTTGAGCAGAAAGCAGAGAGTATGCGAAGCGGACGTGAGCGAGGACGGCGAT---------------CAGGAATTCTCAAAGGAAAAAAAACCAAGACACGGTGGTTGCGGGAATGCGCAGCCTGATATTCGTATGAGCGGTCTCAATCTTATGACATCGTGGAAACCGACAAAA------------GATGAGGATAATGAGCCAACGCAGGCT---GAGACGAGACCACTATCGCCGCAGACCGCTCTGAATATTCTTCGGCTTATGAGTGACGAAGAAATGGAGGATCTTGGCCTTGATGTTAGGAACGCCCGACCAGAA--TGTTAGTTACACGACCTTTTCTTCTCCATCCCAGTAATGTTAACACTACACAGACATGATATTGAGCTGTCTCTTGGTTCCTCCGCCACCCGTGCGACCTAGCATCTCCATGGACGGCAGCGGTCAGGGTACAAGAAGTGAAGATGATCTCACATTCAAGCTCGGAGACATCATTCGCGCCAATCAGAACGTTCGAAGAGTGCAGCAAGAGGGTTCGCCGGAACACATCTTGAATGAGCATGTCCAACTTCTTCAGTGGCACGTTGCGACGTACATGAACAATGACATCGCTGGAATGGACGGGCTGAAAGCACAACATAAGACGGGCCGCCCAATTAAATCTATCCGCGCCAGACTCAAAGGCAAAGATGGTCGTCTTCGACAAAATCTCATGGGAAAGCGGGTAGATTTCTCCGCGCGTACTGTCATTACAGGGGATCCTAATCTTTCTCTGGACGAGGTCGGTGTTCCAAGGAGTATTGCCCGAACTCTCACCTATCCAGAAGTTGTCACTCCTTTCAATGTGGATAAATTGAAGAGGCTCGTTGCCAACGGTCCAACTGAACACCCAGGGGCTCGGTTTGTCGTTCGAGACGATGGCACTCGGATCGATTTGCGTCATCACAAACG{CT}ACAAGC---GAGCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Aspergillus_fumigatus_AFTOL_1079 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACATCGAGCTGGCGACACCAGTCTTTCACATCGGTTTCTTGACCAAAGTCAAGAAGCTCCTTGAGACTGTCTGCCACAACTGTGGCAAGATCAAAGCCGACACG---------------------------------------------------------------------------------------------TCCGACTCCAAATTCTTAGAAGCCCTACGCATGAGAGATCCCAAGCGACGTTTCGACCATATCTGGAGACTCTCTAAGGATGTGTTGATCTGCGAAGCGGACCCTCCACCGGACGAGGACGAGCCTTTT------TCGAAAGAGAGCTCCAAGCCACTCCGGAGGCATGGTGGTTGCGGTAACGCCCAGCCCACGATTCGTAAAGAGGGTATCACTTTGGTTGGAACATGGAAGCCCAACAAG------AGCATGATGGATGAGGATGAGATGCAGCAGCCA---GAAAAGAAAGTCATTACTCCTCAGATGGCCTTGAATGTCTTCCGCAACATTTCCCATGAAGATGTTCGGATAATGGGCTTAAGTAATGACTACGCTCGTCCTGAA------------------------------------------------------TGGATGATCATCACTGTTCTGCCTGTCCCCCCTCCTCCTGTCCGTCCTAGTGTTCTCGTCGGTGGTAGCACCAGCGGCCAGCGCGGTGAGGATGATCTGACTTACAAGTTGGCTGAGATTATCCGAGCGAATCAGAATGTCCAGCGATGCGAACAGGAAGGCGCTCCTGAACACGTCGTACGCGAGTTTGAGTCGCTTTTGCAGTACCACGTTGCCACCTACATGGACAATGATATCGCTGGTCAG------CCGAAGGCTATGCAGAAATCGAACCGACCGGTCAAGGCTATCCGAAGCCGTTTGAAGGGTAAGGAGGGTCGTCTTAGACAGAACTTGATGGGCAAGCGTGTCGATTTCTCCGCTCGTACTGTCATTACTGGCGATCCGAACCTGTCTCTAGACGAGGTCGGTGTTCCAAGGAGTATCGCTCGGACTCTGACCTACCCCGAAGTTGTTACTCCGTACAACATCGAGAAGCTGCAGCAGCTTGTTGCCAATGGCCCAAACGAACATCCTGGAGCTAGGTATATCGTGCGGGACAACGGGGAGCGTATTGACTTACGCCATGCCCGAAGAGCTGGA---GGCCAACAACTGCTGTATGGCTGGAAAGTCGAGCGGCATCTTATGGATGGCGATATCATTCTGTTCAATCGTCAACCTTCCCTGAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATCCTCATCATTGCCTCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCTTTCACCCTCGGTGTCAAGCAGCTCATCGTCGCCCTCAACAAGATG------------------------------------------------------GACACCTGCAAGTGGTCCGAGGATCGTTACAACGAAATTGTCAAGGAAACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTCCCTTCGTCCCCATCTCTGGCTTCAACGGTGACAACATGCTTGAGCCCTCCTCCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGACCAAG---------------GCCGGCAAGGTCACTGGTAAGACCCTCATCGAGGCCATCGACGCCATTGAGCCCCCTGTCCGTCCCTCCAACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCTCTGGTATCGGAACGGTCCCTGTCGGCCGTGTCGAGACCGGTATCATCAAGCCCGGCATGGTCGTCACCTTCGCCCCCGCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACCAGCAGCTCCAGGAGGGTGTCCCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTTTCCGTCAAGGAAGTCCGCCGTGGTAACGTCTGCGGTGACTCCAAGAACGATCCCCCTCAGGGTGCTGCCTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGCGCTGGTTACGCCCCCGTCCTCGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTGCTTGAGAAGATTGACCGCCGTACCGGCAAGTCTGTTGAGAACAACCCCAAGTTCATCAAGTCCGGTGATGCCGCCATCGTGAAGATGGTTCCTTCCAAGCCCATGTGTGTCGAGTCCTTCACTGACTACCCCCCTCTGGGTCGTTTCGCCGTCCGTGACATGCGCCAGACTGTTGCTGTA---------------------- Aspergillus_nidulans_AFTOL_1080 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACATCGAGCTTGCGACTCCGGTCTTTCATATCGGATTCTTGACGAAAATCAAGAAGTTGCTTGAGACGGTCTGCCACAACTGTGGAAAGATCAAAGCCAACACG---------------------------------------------------------------------------------------------TCTGATCCGAAGTTCTTAGATGCCCTGCGGATTCGGGACCCGAAGCGCCGGTTTGACCATATCTGGCGACTCTCGAAGGATATTCTGATTTGCGAGGCTGACCCACCACCGGAAGACGACGAGTAC---------GGGAAAGAAAGTTCGAAGCCTGTCAGATTGCACGGCGGATGCGGCAATGCGCAGCCCACTGTTCGAAAGGAAGGGATAACGCTTGTGGGAACGTGGAAGCCATCGAAG------AGCATGATGGATGAGATGGACATGCAACAACCC---GAGAAGAAGATAATCACTCCGCAAATGGCGCTGAATATCTTCCGCAACATCTCTCACGAGGATGTTCGCATCATGGGCTTGAGTAACGACTATGCGCGTCCCGAG------------------------------------------------------TGGATGATTCTCACCGTCTTGCCGGTTCCACCTCCTCCCGTTCGCCCAAGTGTAGTTGTTGGAGGTAGCACTTCTGGTCAGCGTGGTGAGGACGATTTGACCTATAAACTGGCTGAAATCGTCCGAGCAAACCAAAATGTCCAGCGTTGCGAACAAGAAGGCGCGCCTGAACACGTTGTGCGCGAGTTTGAGTCTTTGCTACAGTACCACATTGCTACTTACATGGACAACGATATCGCTGGTCAG------CCAAAGGCTATGCAGAAGTCAAACAGACCTGTCAAAGCGATTCGGAGCCGTCTAAAGGGTAAGGAGGGCCGTTTGCGGCAGAACTTGATGGGGAAGCGTGTAGACTTCTCTGCTCGTACTGTGATTACTGGTGATCCAAATCTGTCGCTCGATGAAGTCGGCGTTCCGAAGAGTATTGCCAGAACACTGACCTACCCTGAAGTTGTTACTCCTTATAACATCGAGAAACTGCAGCAGCTAGTCATGAACGGTCCGAACGAGCATCCTGGGGCACGATACATTGTCCGAGATAATGGCGAGCGCATCGATCTTCGGCATGCAAAGCGTGCAGGC---GGGCAACAACTCTTGTACGGCTGGAAAGTTGAGCGTCATCTCATGGATGGGGACGTGATTCTGTTTAACCGACAGCCCTCCCTTAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATCCTTATCATCGCTTCCGGTACTGGTGAATTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCTTTCACCCTCGGTGTCCGTCAGCTCATTGTTGCCCTCAACAAGATG------------------------------------------------------GACACCTGCCAGTGGTCTGAGGCCCGTTACAACGAAATCGTCAAGGAGACTTCCGGTTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCCTTCGTTCCCATCTCCGGTTTCCACGGTGACAACATGCTCGAACCCTCCGCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---------------GCCGGCAAGGTCACTGGTAAGACCCTCCTTGAGGCCATCGACGCTATTGAGCCTCCTGTTCGTCCCTCCAACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCTCTGGTATCGGAACTGTCCCTGTCGGCCGTGTCGAGACTGGTGTTATCACCCCCGGTATGGTCGTCACCTTCGCTCCCGCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACCAGCAGCTCAAGGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTCGCTGGTGACTCCAAGAACGACCCCCCTGCCGGTGCCGCCTCTTTCACCGCCCAGGTCATCGTCCTTAACCACCCTGGTCAGGTTGGCGCTGGTTACGCCCCCGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCTGAGCTCCAGGAGAAGATCGACCGCCGTACCGGAAAGTCTGTCGAGTCCAGCCCCAAGTTCATCAAGTCTGGTGATGCTGCTATCGTCAAGATGATTCCTTCCAAGCCCATGTGTGTCGAGTCTTTCACCGACTACCCTCCCCTTGGTCGTTTCGCCGTCCGTGACATGCGCCAGACCGTTGCTGTCGGTGTCGTCAAGAGC------- Caliciopsis_orientalis_AFTOL_1911 ----------------------------------------------CAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-TCCGT-TAG-GG-GTCCGAGTTGTAATTTGTAGAGGATGC-TTTGGGCACGGCCAC-GGTCTAAGTTCTCTGGAACGAGACGTCATAGAGGGTGAGAATCCCGTAT-GGGACC-GCCGGCCACGCCCGTGTA--AAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGTTGGCGACCAGACTCACCCGTGGCGGCTCACCAGGCGTTCTCG-CCTGG-GCAC--T-CCACCACGG-T-TGGGCCAGCATCGGTTTGGGCGGTCGGTCAAAGGCCCCTG-GAATGTATCATCC-CC---C-GGG--A-TG-CCTTATAGCCA-GGGGTGCAATGCGGCCTGCC-CGGATCGAGG-AACGCG-CTT-CGGCACGGATGCTGGCGTAATGGTCGTCAACGACCCGTCTTGAAACACGGACCAAGGAGTCAACCAACTATGCGAGTGTTTGGGTGT-CAAACCC-CGGCGCGGAATGAAAGTGAACGGAGGT-GGGAACCCCTCACG--------GGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGGTTGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTCGAAACGACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTGGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACTACCCATACCTCGCCGTCAGGGTAGAAATGATGCCCTGACGAGTAGGCAGGCGTGGAGGTCCGTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGTTTAAAGTTTTAGGTAGAATTA---TGATAATGACAATTAACTATCTATAAGTCTTGACCAA-ATTACGTGCCAGCAGTCGCGGTAAGACGTAAAAGACTAGTGTTATTCATCTTTAATAGGTTTAAAGGGTACCTAGACGGAAAATATAGCC-AAGTTA---AGGTACTTATTTTCTAGAGTTTTATGTGAAAAGGAGGGAACTTTTGGAGTAGAGATGATATTTTATTATACCAAAAAGACCGGT-AACGGCGAAGGCAACCTTTTATGTAAA-AACTGACGTTGAGGGACGAAGGCTT--GGGTAATGAGTAGGATTAGATACCCTAGTAGTCCAGGCAGACAATTATGAATGTCATAGATTAGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTTAGTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATGTGGCAACGCAGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTACGTTATTTAATTCGATAATCCGCGAAA-AACCTTACCACAATTTGAATATTATTAATTTATT-------------------------------------------------------------------------------------------------------------------------------------------------ACAAGTGCTGCATGGCTGTTTTCAGTTAATGTCGTGAGACTCTGGTTCGTTCCTTAAATTAACGAAAACCCTTGCTTTATTTG---------------------------------------------TTTAAATAAAGTAGT-TCTCCGTTA-TA-TTGGA--TAAG-AT--G-ATAGGGATTAAGACAAGTCATT-ATGGCCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAATCCTCCACGGAGGCTGTGGCAATGCGCAACCGCAGATTCGCAAAGAAGGTCTCAATCTGGTGGGAACTTGGAAGCCTGCTAAA---------------TCGGACGATGAACCGCAGCACCCC---GAGAAGCGAACTATTACACCACAGATGGCCTTGAACATCTTCAGGAATATTTCAAGCGACGACATCAGACTCATGGGCTTGAGTAATGATTATGCCCGTCCAGAA------------------------------------------------------TGGATGATCATTACCGTCCTTCCAGTTCCGCCACCTCCAGTCCGTCCTAGCGTTTTGATCGGTGGCAATACTGATGGTCAGCGTGGCGAGGATGATCTGACATACAAGCTGGCTGAAATTATTCGAGCCAATCAGAGTGTTATGAAAGCGGAACAAGAGGGGTCTCCAGAGCATTTGGTCAAAGACTATGAGGCTCTACTGCAGTTTCACGTCGCCACGTATATGGACAATGACATTGCTGGTCAA------CCCCAGGCTGTACAAAAGACTGGAAGGCCGGTCAAAGCTATTCGTGGTCGTCTCAAGGGCAAGGAGGGCCGTCTTCGTCAAAACTTGATGGGCAAGCGTGTTGATTTCTCGGCACGTACCGTCATTACTGGTGATCCTAATCTTTCGCTGGACGAAGTTGGAGTTCCGAGAACTATTGCTCGAACTCTGACCTACCCAGAAGTGGTTACCCCGTACAACATTCACAAACTCCAACAGCTCGTACGTAACGGTCCGAATGAACATCCTGGCGCTCGATATGTCATTCGCGACACTGGTGAGCGTATCGATCTGCGTCATTCCAAGCGTGCTGGA---GAAATGTCTCTTGGATATGGTTGGCGGGTTGAGCGTCATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTTCCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGTCTGTTCCTTTCGTCCCCATCTC-GGATTCAACGGCGACAACATGATTGAGGTTTCCACCAACGCCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---------------GCCGGCAAGTCCTCTGGCAAGACCCTCCTCGAGGCCATCGATGCCATCGACCCTCCTTCCCGTCCTACCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTCTACAAGATCTCCGGTATTGGAACTGTTCCTGTCGGCCGTGTCGAGACTGGTCTTATCAAGCCCGGCATGGTCGTCACCTTTGCTCCCGCCAACGTGACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCGCGCCCAGGGCGAGCCCGGTGACAACGTCGGATTCAACGTCAAGAACGTCTCCGTCAAGGAGGTTCGCCGTGGTAACGTCTGCGGTGACTCCAAGAACGACCCCCCTGCCGCGGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGCCAGGTCGGTGCTGGTTACGCCCCAGTTCTCGACTGCCACACCGCCCACATTGCCTGCAAGTTCGCTGAGCTCCTCGAGAAGATCGACCGTCGTTCCGGCAAGTCCATTGAGAACAACCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATGATTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGATTACCCCCCTCT----------------------------------------------------------------- Caliciopsis_pinea_AFTOL_1869 -----------------------------------------------------------------GGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-TCCTT-TCG-GG-GTCCGAGTTGTAATTTGTAGAGGATGC-TTTGGGCACGGCCAC-GGTCTAAGTTCTCTGGAACGAGACGTCATAGAGGGTGAGAATCCCGTCT-GGGACC-GCCGGCCACGCCCGTGTA--AAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCACCCGTGGCGGCTCACCCGGCGTTTTCG-CCGGG-GCAC--T-CCACCGCGG-T-TGGGCCAGCATCGGTTTGGGCGGTCGGTCAAAGGCCTCTG-GAATGTATCATCC-CC---C-GGG--A-TG-CCTTATAGCCA-GAGGTGCAATGCGGCCTGCC-TGGATCGAGG-AACGCG-CTT-CGGCACGGATGCTGGCGTAATGGTCGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCAACCAACTATGCGAGTGTTTGGGTGT-CAAACCC-CGGCGCGGAATGAAAGTGAACGGAGGT-GGGAACCCCTTG----------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGGTTGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATTGGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTACTACCCATACCTCGCCGTCAGGGTAGAAATGATGCCCTGACGAGTAGGCAGGCGTGGAGGTCCGTGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGTTTAAAGTTTTAGGTAGAATTA---TGATAATGACAAGTATCTATCTATAAGTCTTGACCAA-ACTACGTGCCAGCAGTCGCGGTAAGACGTAAAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGAAAATATAGCC-AATATA---AGGTACTTATTTTCTAGAGTTTAATGCGAAAAGGAGGGAATTTTTGGAGTAGAGATGATATTTTATAATACCAAAAAGACCGGT-AACGGCGAAGGCAACCTTTTATGTAAA-AACTGACGTTGAGGGACGAAGGCTT--GGGTAACGAGTAGGATTAGATACCCTAGTAGTCCAAGCAGACAATTATGAATGCCATAGGTTAGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTTAGTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATGTGGCAACGCAGGAACTGAAATCATTAGACCGTCTCTGAAACCAGTAGTGAAGTACGTTATTTAATTCGATAATCCGCGAAA-AACCTTACCACAATTTGAATATTATTAATTTATT-------------------------------------------------------------------------------------------------------------------------------------------------ACAAGTGCTGCATGGCTGTTTTCAGTTAATGTCGTGAGGCTCTGGTTCGTTCCTTAAATTAACTAAAACCCTTGCTTTATTTG---------------------------------------------TTTAAATAAAGTAGT-TCTCCGTTA-TA-TAGGA--TAAG-AT--G-AGAGGGATTAAGACAAGTCATT-ATGGCCT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTGACTGCGCCATTCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTCGCGTTCACCCTCGGTGTTAGGCAGCTCATTGTCGCCATCAACAAGATG------------------------------------------------------GACACCACCAAGTGGTCCGAGGATCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTTGGCTACAACCCCAAGTCCGTTCCTTTCGTCCCCATCTCTGGCTTCAACGGAGACAACATGATTGAGGCCTCTCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAG---------------GCTGGCAAGTCCACTGGCAAGACCCTCCTTGAGGCTATTGACAGCATCGACCCTCCTTCCCGTCCTACCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTCTACAAGATCTCCGGTATTGGAACTGTTCCTGTCGGCCGTGTCGAGACTGGTCTTATCAAGCCCGGCATGGTCGTCACCTTCGCTCCTGCCAACGTGACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCGCCCCCAGGGTGAGCCCGGTGACAACGTCGGATTCAACGTCAAGAACGTCTCCGTCAAGGAAGTCCGTCGTGGTAACGTCTGCGGTGACTCCAAGAACGACCCCCCTGCTGGCTGCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGCCAGGTCGGTGCTGGTTACGCCCCAGTTTTGGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGTCGTTCCGGCAAGTCCATTGAGAACAACCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGATTCCTTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCTCCCCT----------------------------------------------------------------- Ceramothyrium_carniolicum_AFTOL_1063 -----------------ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-GCTTT--CA-GC-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGCCACGACCCC-GGGTTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAACCCCGTCT-TGACCC-GGGCGTACGAGCCGTGTG--GAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTGAGCGCGACGGTTCCCCCTTGCTTCTGC-CTGGG-TTAT--T-CCGTCGTGT-C-CAGGCCAACATCGGTTTCGGGGGTTGGTTAAAGGCTTAGG-GAATGTATCTACC-CCT--C-GGG--G-TCGACTTATAGCCC-TAGGTGTCATGCGACCTCCC-GGGACCGAGG-AACGCG-CTT-CGGCTCGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGT-CAAACCC-TTACGCGGAATGAAAGTGAACGG-GGT-AGGAAGCCTTAA----------GGCTGCACTATCGACCGATCCTGAAGTTTACAGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGCGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTCAGGGTTGAAATGATGCCCTGACGAGTAGGCAGGCGTGGAGGTCCGTGACGAAGCCTCGGGGGTGACCCCGGGTCGAACGGCCTCTAGTG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTCATCAAGCTTGCTACACCGGTCTACCACTACGGTTTTATGGCCAAGGTCAAAAAGATCCTGGAGACTGTTTGTCACAATTGTGGCAAGATAAAGGCGCTTGAT---------------------------------------------------------------------------------------------AACGAAGAGTTGCGTCAA---GCATTAGCGATTCGAGACCGAAAGCGACGTTTCGATGCTGTTTGGCGTTTGAGTAAACCTCGTTTGATTTGTGAAGCTGATCCACCCGAAGATGAAGAA------------------GTCCCAAAAGGTGCCACAGTCGTCCGACATGGTGGCTGCGGTAACGCACAACCCGATATCCGACGAACAGGTCTACAATTGTGGGCATCTTGGAAGGCAAGAAAA------------GGTGAAGACGACGAGGATGTTACACCA---GAGCGAAAGAGAATCTTCCCTCAAGATACCCTGGATACCTTCAAAAACTTGACCGATGACACGCTGGAAAAGATGGGTCTCAATCTTGATTATGCTCGACCGGAA------------------------------------------------------TGGATGATTCTACAAGCACTACCTGTTCCACCACCACCCGTCAGACCATCCATCTCTGTTGATGGTTCAGGCCAAGGTCAACGCGGTGAAGATGATCTCACTTTCAAGCTTTCAGACATCATTCGAGCTAACCAGGCTGTTCTCCGTACAGAAGTTGATGGTACACCCGATCATATCAAGATTGATCTTTGGGACCTACTTCAATATCATATTGCAACTTACATGGACAATGACATTGCAGGTCTC------GACAAGGCACAGCACAAGAGTGGTCGACCCATCAAGTCCATCAGAGCTCGTCTTAAGGGCAAAGAAGGTCGTCTCCGTCAAAACCTTATGGGCAAACGTGTCGACTTCTCTGCTCGTACTGTTATTACAGGTGATCCAAATTTGTCCCTCGATGAAGTCGGTGTACCTCGCAGTATTGCTCGTACTCTTACGTACCCAGAGACTGTCACACCTTTCAACATTGAAAGACTCAAGCGCTTCGTCGCAAACGGTCCAACTGAGCATCCTGGTGCCAGATATGTCATTCGCAGCACTGGTGAAAGAGTCGATCTGCGTCATCACAAACGAGCTGGA---GAAATGAACCTCGAATACGGATGGAAAGTTGAGCGTCATCTTATGACTGGCGATGTGATTCTGTTCAACCGTCAACCATCACTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Coccidioides_immitis_AFTOL_1084 ------------------------TAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAAT-CTGGC-TCCAT-GCG-GA-GCCCGAGTTGTAATTTGGAGAGGACAC-TTCGGGTGCGGCCAC-GGCATAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCT-TTGGCTGCTGGACCGCGCCCATGCG--AAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGGTCGTGGGGGCTCAGCGGGCATGAGTG-CCCGT-GTAC--T-CCCCCATGCTC-CGGGCCAGCATCAGTTCTGGCGGTTGGTTAAAGGCCTCTG-GAATGTATCGTCC-TC---C-GGG--A-CG-TCTTATAGCCA-GGGGCGCAATGCGGCCAGCC-GGGACTGAGG-AACGCG-CTT-CGGCACGGATGCTGGCATAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCCACGCGAGTGTTCGGGTGT-CAAACCC-GTGCGCGCAGTGAAAGCGAACGGAGGT-GGGAGCCCGCAA----------GGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCGTGGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAAGTGAACGTGGGCATTAGAATGGATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGCTACCCATACCTCGCCGTCGGGGTAGAAACGAAGCCCCGACGAGTAGGCAGGCGTGGAGGTTTGTGACGAAGCCTTGGGAGTGATCCCGGGTCGAACAGCCTCTAGTG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATTGAACTGTCCACACCGGTCTTCCATATTGGTTTCTTGACCAAGATCAAGAAGCTCTTGGAGACTGTTTGCCACAACTGTGGAAAGATCAAGGCCAACACG---------------------------------------------------------------------------------------------AGTGACCAGAAATACTTAGATGCTCTCCGTTTCCGCGACCCCAAGAGGCGCTTTGATGCAATCTGGCGGCTCTCGAAAGACGTCCTTATCTGCGAAGCTGATCCTCCTCCCGATGACGACGACCCATTC------GGCAAAGAAAGTTCAAAGATCGTCAAGGGCCACGGTGGATGCGGAAATGCGCAACCCCAGATCCGAAAGGAAGGTATCAGCCTTGTTGGAACTTGGAAGCCGAACAAAATGCGAGACATGATGGATGACACGGATATTCAGCAGCCT---GAGAAGAAGCAAATCACTCCGCAGATGGCTCTAAATATATTCAGGAATGTCTCGGAGGAGGATGTTCGAATCTTGGGTCTAAGTAACGACTATGCGAGACCCGAG------------------------------------------------------TGGATGGTCATCACTGTTCTTCCAGTACCTCCACCTCCAGTTCGCCCAAGCGTCCTTGTTGGTGGAAGCTCTGGAGGGCAGCGCGGCGAAGACGACCTGACCTACAAGCTGGCAGAAATAATTCGCGCTAACCAAAACGTCACTCGTTGCGAGCAAGAAGGATCTCCTGAGCATGTCGTTCGCGAATTTGAGTCGCTGCTACAGTACCACGTCGCAACATACATGGATAACGATATTGCTGGGCAA------CCGCAAGCTATGCAAAAATCAAACAGGCCAGTCAAGGCTATACGCGGTCGTCTAAAGGGGAAAGAAGGACGACTTCGTCAAAACTTAATGGGTAAACGTGTCGACTTTTCAGCACGTACCGTTATCACTGGTGACCCTAATCTGTCTTTGGATGAAGTCGGTGTTCCTGTCAGCATTGCACAGACTTTGACTTATCCGGAAGTTGTCACCCCCTACAATATTAATAAACTAGGCCAGCTAGTTGATAATGGGCCTGATGTTCATCCCGGAGCGCGTTATGTGATTCGCAGTTCCGGGGAGCGCATTGATCTACGGCACCACAAGGGCGGCGGTGGGCGGAATTTCTTGCAATGGGGCTGGAGAGTTGAGCGCCATCTCATGGACGGAGATGTCATCTTGTTCAATCGACAGCCCTCTCTAAAGAACATGATTACTGGTACCTCCCAGGCTGATTGCGCTATCCTTATCATTGCTGCCGGTACTGGTGAGTTCGAAGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTTGCCTTCACTCTCGGTGTGAAGCAGCTCATCGTCGCTATCAACAAGATG------------------------------------------------------GACAGCACCAACTGGTCCGAGCCTCGTTTCAACGAAATCGTCAAGGAAGTCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGGCTGTTCCATTCGTCCCCATCTCTGGTTTCGAAGGTGACAACATGATTCAACCCTCCACCAACGCTCCTTGGTACAAGGGCTGGAACAAGGAGACCGCC---------------TCTGGCAAGCACTCTGGCAAGACCCTCCTCGACGCCATTGATGCCATCGACCCCCCAACCCGCCCCACCGAGAAGCCCCTCCGTCTCCCACTTCAGGATGTGTACAAGATCTCTGGTATCGGAACAGTCCCAGTCGGCCGTGTCGAAACCGGTGTTATCAAGCCTGGTATGGTTGTGACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACCAGCAGCTCACCCAGGGTAACCCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTCTCTGTCAAGGAAGTCCGCCGCGGTAACGTCGCTGGTGACTCCAAGAACGACCCACCAAAGGGCTGCGACTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAAGTCGGTGCTGGTTATGCCCCAGTCCTTGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGTAAATCCGTTGAGAACAACCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATGGTTCCATCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCACCTCTCGGTCGTTTCGCCGTCCGTGACATGAGACAGACT------------------------------- Cyphellophora_laciniata_AFTOL_1033 -----------------ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-CTCTT--TG-GG-GTCCGAGTTGTAATTTGGAGAGGATGT-TTCGGGTACGGTCCG-GGCTTATATTTCTTGGAACAGAATGTCATAGAGGGTGAGAATCCCGTCT-GGAG-C-TCGGACACGGCCTATGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGCATGTCGGGGTTCCCCCTTGCTTTTGC-CTGGG-TTAC--T-CCCCGGCGT-T-CAGGCCAACATCGGTTTCGGGGGTTGGTTAAAGGCCCTAG-GAATGTACTTACC-CTC--C-GGG--G-TAAACTTATAGCCT-AGGGTGTCATGCGACCTCCC-GGGACCGAGG-AACGCG-CTT-CGGCTCGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGT-CAAACCC-TTACGCGGAATGAAAGTGAACGGAGGT-AGGAAGCCGTTA----------GGCTGCACTATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTCACTTAATTGGACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGAGAGGTTAAGGTGCCGGAGTGCACGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGTCACCTATACCTCTCCGTCATTGTTGACTTGAAGCGATGACGAGTAGGCAGGCGTGGAGGTGCGTGACGAAGCCTTGGGGGTGACCCCGGGTCGAACCACCTCTAGTG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dactylospora_haliotrepha_AFTOL_186 ------------------------------------------------------------------------GAAGCGGCAAGAGCTCAAATTTGAAAT-CTGAC-CTTTC-----GG-GTCCGAGTTGTAATTTGGAGAGGATGT-TTCGGGTAAGACCCG-GGCCTAAGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTAC-GTGGCC-CAGGGTTGCATCCATGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGAAGCCAGACTCGTTCGCGG-GGTTCAACCGTCGTTCTCG-GCGGT-GCAT--T-TCCCCGCTG-T-CGGGCCAGCATCGGTTCGGGTGGAAGGTCAAAGGCCCTGG-GAACGTGACATCT-TC---C-GGG--A-TG-TTTTATAGCCC-TCGGCGTAATGCTTCCCACC-TGGACTGAGG-CACGCG-TTC---GCTAGGATGCTGGCGTAATGGCTTTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTATTCGGGCGT-CAAACCC-ATATGCGCAATGAAAGTGAACGGAGGT-GGGAACCCTTG-----------CGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTTATCGAACTATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTTCTTCCGAAGTTTCCCTCAGGATA-GCAGTAG-CGTC--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTCGGTGAACGTGGGCATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAAGTTAAGGTGCCGGAATACACGCTCATCAGACACCAAAAAATGCGTTAATTCATCTGGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAAAAACTCACCGGCCGAATGAATTAGCCATGAAAATGGATGGCGCTCAAGCGTGTTACCTATACTTCGCCGTTAAGGTAGAAATGAGGCCTTAACGAGTAGGAAGACGTGGAGGTCGGTG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dactylospora_mangrovei_AFTOL_832 ------------------------------------------------------------------------------------------ATTTGAAAT-CTGAC-CTTTT-----AG-GTCCGAGTTGTAATTTGTAGAGGAAGT-TTCGGGTAA-GATCCAGGCCTAAGTTTCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCC--ATGATCGCACCCATGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCATGTGAAATTGTTGAAAGGGAAGCGCTTCCAGCCAGACTTGTTTGTAG-GGTTCAGCCGTCGTTCTCG-TCGGT-GTAT--T-TCCCTACTA-T-CAGGCCAGCATCAGTTTGGGTGGAAGGTCAAAGGCCTTGG-GAATGTGACTTCC-TC---C-GGG--A-TG-TTTTATAGCCC-TCGGTGTAATGCTTCCTACC-CAGACTGAGG-CACGCG-TTC---GCTAGGATGCTGGCGTAATGGCTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATTTATGCGAGTATTTGGGTGT-CAAACCC-ATATGCGCAATGAAAGTGAACGGAGGT-GGGAACCTTTT-----------AGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTGGGACCCGAAAGATGATGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAATCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTTCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCTCTTGTTACTTAGTTGAACGTGAGCATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAAGTTAAGGTGCCGGAATATACGCTCATCAGACACCACAAAATGCGTTAGTTCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCGGCCGAATGAACTAGCCATGAAAATGGATGGCGCTCAAGCGTGTTACCTATACTTCGCCGTTAGAGTAGAAATGATGCTCTAACGAGTAGGCAGGCGTGGAGGTCAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAAGATG------------------------------------------------------GACACCACCAAGTGGTCCGAGGAGCGCTACAACGAAATCATTAAGGAGACATCCAACTTCATCAAGAAGGTTGGCTACAACCCCAAGCATGTCCCCTTTGTTCCCATCTCTGGCTTCAACGGCGACAACATGATTGAGCCCTCCACCAACTGTCCCTGGTACAAGGGATGGGAGAAGGAGACCAAG---------------GC---CAAGGTTACCGGTAAGACTCTTCTCGAGGCCATTGACGCCATCGACCCCCCTACCCGCCCGACCGACAAGCCTCTTCGTCTTCCCCTCCAGGATGTCTACAAGATCTCTGGTATTGGAACTGTGCCCGTCGGCCGTGTTGAGACTGGTACCATCAAGGCCGGTATGGTCGTCACCTTTGCTCCTGCCAACGTGACCACCGAAGTCAAGTCCGTCGAGATGCACCATGAACAGCTCGCCGAGGGTCTTCCCGGAGACAATGTCGGGTTCAACGTCAAGAACGTTTCCGTCAAGGAAGTTCGACGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGATTCCTTCAACGCCCAGGTTATCGTCCTCAACCACCCTGGTCAAGTCGGTGCCGGCTATGCGCCCGTCCTTGATTGCCACACTGCTCACATTGCCTGCAAATTCTCTGAGCTCTTGGA?A?TATCGACCGTCGTACCGGTAAATCCATTGAGAACAACCCCCAGTTCATCAAGTCTGGTGATGCCGCTTTCGTGAAAATGGTTCCTTCCAA-------------------------------------------------------------------------------------------------------- Dermatocarpon_miniatum_AFTOL_91 ACCCGCCGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-CCCCT--CG-GG-GTCCGAGTTGTAATTTGTAGAGGATGC-TTCGGGCAAGGCCGC-GGTCTAATTTGCTTGGAACAGCAAGTCACAGAGGGTGAGAGTCCCGTCT-AGGGCC-GTGGGCCGCGCCCGTGTG--AAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGTGGGTGACGGTTCCCCCGGTCTTCTGA-CCGGG-CTAT--T-CCGTCACGT-C-CAGGCCAGCATCGGTTTGGGTGGCCGGTGAAAGACCCCGG-GAATGTATCTACC-TC---C-GGG--T-CG-ACTTATAGCCC-GGGGTGCAATGCGGCCCACC-CGGACCGAGG-AACGCG-CTT-CGGCCCGGATGCTGGCGTAATGGTCCCAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCCATGCGAGTGTTTGGGCGT-CAAACCC-CGACGCGCAATGAAAGTGAAGGGAGGT-AAGAACCCCGCCCG--------GGGCGCATTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGTCGAAGTTTCCCTCAGGATAAGCAGTAAACGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTACAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTTCTTGACTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTCGGGGTTGAAATGATGCCCCGACGAGTAGGCAGGCGTGGGGGTTGGTGACGAGGCCTCGGGGGTGACCCTGGGTCGAACAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------CGTATAAAATTCTAGATAGAAAAC---AGATACTGACAACTATTTATCTATTAGTCTTGACCAA-ATTACGTGCCAGCAGTCGCGGCAATACGCAGAAGACAAGTGTTATTCATCTTTATTTGGTTTAAAGGGTACCTAGACGGGAAATAAAGCC-TTAGT----TGGGACTAATTTTCTAGAGTTTTATGGGAGAAAG-TCGAATGTCAGGAGGAGAGATTATATACTGTGATACTAGACGGACGGAC-AACGGCGTAGGCAGCTTTCTATGTAAA-AACTGACGTTGAGGGACGAAGCCCT--GGGTAGCAAGAAGGATTAGATACCCTAGTAGTCCAGGGAGACAATGATGAGTGCCATAGGCTAGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATTAGTTTATAAATGAAAGTGTAAGCATTCCACCTTGAGACTAACGCGGCAACGCCCAAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTATTTAATTCGATGATCCGCGAAT-AACCTTACCACCTTTTGAATACTTTTTGTAAAAGCAGGAGTGCTTTTATCACCACAAATTGT---------------------------------------------------------------------------------------------------------------------ACAAGTGCTGCACGGCTGTCTTTAGTTAATGTCGTGAGACTTTGGTTAACCCCTTTAATTAACGAAAACCCTTGTTTTATTTG---------------------------------------------TTTATATAAAACAGT-TCTCCGCTA-TA-TTGGA--TAAG-AT--A-ACAGGGATTAAGGCAAGTCATC-ATGGCCT-----------------------------------------------------------------TTGAGCTGGCAGTGCCTGTCTACCATTATGGTTTCCTCGGAAAGGTCAAGAAGCTTCTGGAGACAGTCTGCCATAATTGTGGGAAGATCAAAGCAGTTGAC---------------------------------------------------------------------------------------------TCTGAAGAGCTGCGATAT---GCTCTTTCTGTTCGCGACCGCAAGAAACGTTTTGAACTCATCTGGCGTCTCAGCCAAAAACAGAATGTCTGTCAAGCCGACAGTCCCGACGACGAAGACGATGCGATT------GCAAAGGAAAAGAGTAGCAAGATTAGA---CACGGTGGATGCGGCAATGCGCAGCCACAAATTCGCAAAAGTGGTCTTGAACTCTGGGCACAATACAAACCTCGAAAA------------GGTGATGATGAAGAGGAGACTGTCCCC---GAGAAGTCGCAAATCTGGCCTGCGCAAGCACTGCAGGTGTTTCAGCACCTCACTGATGAGACCCTTGAGACACTTGGCTTGAGTCTTGATTTCGCTCGGCCCGAA------------------------------------------------------TGGATGATCTTGCAGAGTCTGCCGGTGCCGCCTCCTCCTGTGCGACCTAGCATTAGCGTTGATGGAAGTGGACAAGGTCAGCGAGGCGAGGACGATCTGACATTCAAGTTGGGAGACATCATCCGTGCCAACCAGAACCTGATCCGCATCAACGCGGAAGGCGCACCTGACCATATCGCCAAGGAACTTCAAGCTTTGCTGCAATACCATGTTGCTACATATATGGATAACGATATAGCCAATCTC------GACAAAGCACAGCACAAGAGCGGAAGACCAATCAAATCGATACGTGCTCGCCTGAAGGGAAAAGAGGGTCGTCTCCGCCAGAACCTGATGGGCAAGCGAGTTGATTTCTCGGCACGCACCGTCATCACTGGCGATCCCAACCTCTCGCTCGATGAAGTGGGCGTTCCAAGGAGCATAGCCCGGACTTTGACTTATCCTGAGACCGTGACTCGATTTAATATTTCCAAGTTAAAACAACTTGTCACGAATGGTCCTGAGATGCATCCTGGTGCCAGATATATTATTCGCGAACATAATGAGCGCATCGATCTCCGCTATCACAAGGACACCAGT---CAGATAGCTCTCAAGGTGGGATGGAAAGTTGAGCGCCAC---------------------------------------------AAGAACATGATCACTGGCACCTCCCAAGCAGATTGTGCCATTCTCATCATTGCCGCTGGTGTTGGTGAGTTCGAAGCTGGTATCTCCAAGGATGGTCAGACGCGCGAGCACGCTCTTCTTGCATACACTCTCGGTGTCAAGCAACTCATTGTCGCCATCAACAAGATG------------------------------------------------------GACATGACCAAGTGGTCCGAGGACAGATTTCGCGAAATCGTCAAGGAGACTTCCAACTTTATCAAGAAGGTCGGGTACAACCCCAAGACCGTTCCTTTCGTCCCCATCTCCGGCTTTAATGGCGACAACATGATCGATGTCTCGCCCAACGCTCCGTGGTTCAAGGGCTGGGAGAAGGAGACCAAG---------------ACC---AAGACTACTGGCAAGACCCTTCTTGAGGCCATCGACGCCATCGAGCCTCCCAGCCGACCAACCGACAAGCCACTCCGTCTCCCGCTTCAGGATGTGTACAAGATCTCCGGTATTGGCACGGTTCCAGTTGGCCGTGTAGAGACTGGTATCATCAAGGCTAATATGGTCATCACCTTCGCTCCCGCCAACGTTACTACTGAAGTCAAGTCCGTTGAAATGCACCACGAACAGCTTGTCGAAGGTGTGCCAGGTGACAACGTTGGTTTCAATGTCAAGAACGTCTCTGTGAAGGAAGTCCGCCGAGGCAACGTCGCTGGTGATTCCAAGAACGATCCACCCAAGGGTGCCGACTCCTTCAATGCTCAGGTCATCGTCCTTAACCACCCTGGTCAAGTTGGCGCCGGTTACGCACCCGTCCTTGATTGCCACACCGCTCACATTGCTTGCAAGTTCTCTGAGCTTCTTGAGAAGATTGATCGCCGAACGGGCAAATCTGTCGAGAATGCTCCCAAGTTCATCAAGTCTGGTGATGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCAATGTGTGTTGAGGCATTCACCGACTACCCACCTCTTGGTCGATTCGCCGTCCGTGACATGAGACAGACCGTTGCTGTCGGTGTCATAAGGGCGAATTCCA Dolabra_nepheliae_CBS_122119 ------------------------------------------------------------------------------------------ATTTGAAAT-CTGGC-TCTTT--TT-GG-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGCAATGCGGG-GATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCT-TGGGTC-CTTTGCAGCGCCTATGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGTTGGGCGCGGTTCTCCCGCGGTTCTCC-GTGGT-GTAT--T-CCGT-GTCC-A-CAGGCCAGCATCAGTTTTGGCGGTTAGTTAAAGACCTGGG-GAATGTACCTACG-CCTT-CGGGGG-T-AG-ACTTATAGCCC-CGGGTGCAATGTGACCCGCC-GAGACTGAGG-TACGCG-CAT-CTGCTCGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGT-TAAACCC-TTACGCGGAATGAAAGTGAACGGAGGT-AGGATCCCGCAA----------GGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGAA--ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACTCGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGTCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGACCGAATGCATTGGCCCTGAAAATGGATGGCGCTCAAGCGAGTTACCTATACCTCACCGTTAAGGTTATAATGACGCCTTAACGAGTAGGCAGGCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTCTTGTCTAA-ATTACGTGCCAGCAGACGCGGTAATACGTAGAAGACTAGTGTTATTCATTGTTAATGGGTTTAAAGGGTACATAGACGGAAAGTTAAGCC-TTATT----CGGAACTAATTTTCTAGAGTTTTATATGAGGAGG-TAGAACATATGGAGTAAAGTTGATATTTAGTTATACTGTAGAGACAGGT-ATCGGCGAAGGCGGCCTTTTATGTGAA-AACTGACGTTGAGGGACGAAGCCCT--TGGTAACGATAAGGATTAGACACCCTAATAGTCTTGGGAGAAAATGATGAATGTCATAAATTAGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATTTAGTTTATAAACGAAAGTGCAAGCATTCCACCTCATGAGTAAAGCGGCAACGCTCAAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTATTTAATTCGATGATCCGCGAAT-AATCTTACCACGATTTGTATATTAT----------------------------------------------------------------------------------------------------------------------------------------------------------ACAAGTGCTGCACGGCTGTCTTTAGCTAATGTCGTGAGATT-TGGTTAACTCCTTTAATTAGCGCAAGCCCTTACTTTATTTA----------------------------------------AATATTTTTTATAAAGTAGT-TCGCCATTA-TA-ACGG---TTAG-AT--A-ATA--------------------------------------------------------------------------------------GACATATCGAGTTGGCAGTTCCAGTGTTTCATTATGGTTTTTTGAACAAGGTGAAAAAGATTCTCGAATGTGTTTGCCATAACTGCGGAAAAATTAAAGCTCTTGAT---------------------------------------------------------------------------------------------TCAGAAGAGTTTAGACAA---GCCTTAACAATCAGGGATAAGAAGCGCAGATTCGAGACAATATGGCGACTTTGCAAGCCTCGTCTGATCTGCGAAGCTGATGCAGAAGACGAGGAAGATCCTATT---------GCAAAAGAAAAAGGACAATTCAAAGCAAAGCATGGTGGGTGTGGGAACGCACAACCAGAGATTCGGAAGCAAGCCCTCACTTTGACCGGCTCGTGGAAAGCGCGCAAA------------GGAGACGAGGAAGAGGAAGATGCGCCGCCGGAGAGAAAACCAATCTCACCACAGCAAGTTTTGAATATCTTTAGGAATATCTCAGATGAAGATCTTGAAACTCTTGGTCTCAGCATTGACAACGCTCGTCCGGAA------------------------------------------------------TGGATGATATTGACAGTACTGCCCGTGCCACCGCCGCCGGTGCGACCTAGTATCTCCATGGATGGGACAGCCCAAGGGTCGAGAAGTGAGGATGACATGACATTCAAGCTTTCTGACATCCTGCGCGCAAACCAGAACGTCCGTCGTGTGCAGCAGGAGGGCTCTCCCGAACACGTTCTTAATGAGCATGTTAGCCTGTTGCAGTGGCACGTGGCAACTTACATGGACAAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCCGAGGCTCGTTTCTCTGAAATCATCAAGGAAACATCCTCCTTCATCAAGAAGGTTGGCTACAACCCCAAGAGCGTTGCTTTCGTCCCCATCTC-GGTTTCCACGGTGACAACATGATCGAAGCCTCCAGCAACGCCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---------------GCTGGCAAGTCCAGCGGAAAGACCCTTCTCGACGCCATCGATGCCATCGAGCCACCTGCCCGCCCAACTGACAAGCCCCTCCGTCTTCCCCTCCAAGATGTTTACAAGATCGGTGGTATCGGAACTGTACCTGTCGGTCGTGTTGAGACCGGTGTCATCAAGGCTGGTATGATCGTCACATTCGCCCCCGCCAACGTCACCACTGAAGTCAAGTCCGTTGAAATGCACCACGAACAACTCGTTGAGGGTGTCCCCGGTGACAACGTTGGCTTCAACGTGAAGAACGTCTCGGTCAAGGAAATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTTGCGACTCTTTCAACGCCCAAGTCATCGTGCTCAACCACCCCGGTCAAGTCGGTGCTGGTTACGCTCCTGTTTTGGACTGCCACACCGGGCACATTGCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dolabra_nepheliae_CBS_122120 -------------------------------------------------------------------------AAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-TC---------G-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGCAATGCGGG-GATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCT-TGGGTC-CTTTGCAGCGCCTATGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGTTGGGCGCGGTTCTCCCACGGTTCT---CTGGT-GTAT--T-CCGT-GTCC-A-CAGGCCAGCATCAGTTTGGGCGGTTAGTTAAAGACCTGGG-GAATGTACCTACG-CC----GGGG--T-AG-ACTTATAGCCC-CGGGTGCAATGTGACCCGCC-GAGACTGAGG-TACGCG-CAT-CTGCTCGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGT-TAAACCC-TTACGCGGAATGAAAGTGAACGGAGGT-AGGATCCCGCA-----------GGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGAA--ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACTCGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGTCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGACCGAATGCATTGGCCCTGAAAATGGATGGCGCTCAAGCGAGTTACCTATACCTCACCGTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGTATAAAATTCTATATAAAAAAAAATTGATAATGACAAATTTTTATATATAAGTCTTGTCTAA-ATTACGTGCCAGCAGACGCGGTAATACGTAGAAGACTAGTGTTATTCATTGTTAATGGGTTTAAAGGGTACATAGACGGAAAGTTAAGCC-TTATT----CGGAACTAATTTTCTAGAGTTTTATATGAGGAGG-TAGAACATATGGAGTAAAGTTGATATTTAGTTATACTGTAGAGACAGGT-ATCGGCGAAGGCGGCCTTTTATGTGAA-AACTGACGTTGAGGGACGAAGCCCT--TGGTAACGATAAGGATTAGACACCCTAATAGTCTTGGGAGAAAATGATGAATGTCATAAATTAGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATTTAGTTTATAAACGAAAGTGCAAGCATTCCACCTCATGAGTAAAGCGGCAACGCTCAAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTATTTAATTCGATGATCCGCGAAT-AATCTTACCACGATTTGTATATTAT----------------------------------------------------------------------------------------------------------------------------------------------------------ACAAGTGCTGCACGGCTGTCTTTAGCTAATGTCGTGAGATT-TGGTTAACTCCTTTAATTAGCGCAAGCCCTTACTTTATTTA----------------------------------------AATATTTTTTATAAAGTAGT-TCGCCATTA-TA-ACGG---TTAG-AT--A-ATAGGGATCAAGACAAGTCATC-ATGGCCT----------------------------------------------------------GGACATATCGAGTTGGCAGTTCCAGTGTTTCATTATGGTTTTTTGAACAAGGTGAAAAAGATTCTCGAATGTGTTTGCCATAACTGCGGAAAAATTAAAGCTCTTGAT---------------------------------------------------------------------------------------------TCAGAAGAGTTTAGACAA---GCCTTAACAATCAGGGACAAGAAGCGCAGATTCGAGACAATATGGCGACTTTGCAAGCCTCGTCTGATCTGCGAAGCTGATGCAGAAGACGAGGAAGATCCTATT---------GCAAAAGAAAAAGGACAATTCAAAGCAAAGCATGGTGGGTGTGGGAACGCACAACCAGAGATTCGGAAGCAAGCCCTCACTTTGACCGGCTCGTGGAAAGCGCACAAA------------GGAGACGAGGAAGAGGAAGATGCGCCGCCGGAGAGAAAACCAATCTCACCACAGCAAGTTTTGAATATCTTTAGGAATATCTCAGATGAAGATCTTGAAACTCTTGGTCTCAGCATTGACAACGCTCGTCCGGAA------------------------------------------------------TGGATGATATTGACAGTACTGCCCGTGCCACCGCCGCCGGTGCGACCTAGTATCTCCATGGATGGGACAGCCCAAGGGTCGAGAAGTGAGGATGACATGACATTCAAGCTTTCTGACATCCTGCGCGCAAACCAGAACGTCCGTCGTGTGCAGCAGGAGGGCTCTCCCGAACACGTTCTTAATGAGCATGTTAGCCTGTTGCAGTGGCACGTGGCAACTTACATGGACAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTCGTTTCTCTGAAATCATCAAGGAAACATCCTCCTTCATCAAGAAGGTTGGCTACAACCCCAAGAGCGTTGCTTTCGTCCCCATCTC-GGTTTCCACGGTGACAACATGATCGAAGCCTCCAGCAACGCCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---------------GCTGGCAAGTCCAGCGGAAAGACCCTTCTCGACGCCATCGATGCCATCGAGCCACCTGCCCGCCCAACTGACAAGCCCCTCCGTCTTCCCCTCCAAGATGTTTACAAGATCGGTGGTATCGGAACTGTACCTGTCGGTCGTGTTGAGACCGGTGTCATCAAGGCTGGTATGATCGTCACATTCGCCCCCGCCAACGTCACCACTGAAGTCAAGTCCGTTGAAATGCACCACGAACAACTCGTTGAGGGTGTCCCCGGTGACAACGTTGGCTTCAACGTGAAGAACGTCTCGGTCAAGGAAATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTTGCGACTCTTTTAACGCGCAAGTCATCGTGCTCAACCACCCCGGTCATGTCGGTGCTGGTTACGCTCCAGTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Dolabra_nepheliae_CBS_123297 -------------------------------------------------------------------------AAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-TC---------G-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGCAATGCGGG-GATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCT-TGGGTC-CTTTGCAGCGCCTATGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGTTGGGCGCGGTTCTCCCACGGTTCT---CTGGT-GTAT--T-CCGT-GTCC-A-CAGGCCAGCATCAGTTTGGGCGGTTAGTTAAAGACCTGGG-GAATGTACCTACG-CC----GGGG--T-AG-ACTTATAGCCC-CGGGTGCAATGTGACCCGCC-GAGACTGAGG-TACGCG-CAT-CTGCTCGGATGCTGGCGTAATGGTTGTCAGCGACCCGT?????????????????????????????????????????????????-???????-?????????????????????GGAGGT-AGGATCCCGCA-----------GGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGAA--ATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACTCGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGTCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGACCGAATGCATTGGCCCTGAAAATGGATGGCGCTCAAGCGAGTTACCTATACCTCACCGTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Endocarpon_pallidulum_AFTOL_661 -----------------ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-CCCGC-TGG-GG-GCCTGAGTTGTAATTTGCAGAGGATGC-TTCGGGCAAGGCGGT-GGTCTAATCTGCTTGGAACAGCAAGTCGAAGAGGGTGAGAATCCCGTCT-AGGATC-GTCAGCCGCGTCCGTGTG--AAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGACGGACGGTTCCCCCGACCTTCTGG-CCGGG-TTAC--T-CCGTCACGT-C-CAGGCCAACATCGGTTTGGGTGGTCGGTTAAAGACCCCGG-GAATGTATCTACC-TT---C-GGG--T-CG-ACTTATAGCCC-GGGGTGCAATGCGGCCCACC-CGGACCGAGG-AACGCG-CTC-CGGCTCGGATGTTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTGTGCGAGTGTTTGGGTGT-GAAACCC-CTACGCGGAATGAAAGTGAACGGAGGT-AAGAACCCCGTCAG--------GGGCGCATTATCGACCGATCCTGGTGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCATGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGTGCATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGTCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGCAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGACATTTGAATGCATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTTGGGGTTGAAATGATGCCCCAACGAGTAGGCAGGCGTGGGGGTTGGTGACGAAGCCTCGGGGGTGACCCCGGGTCGAACAACCTCTAGTG----------------------------------------------------------------------------------------------------------------------------------------------------------ACGTATAAAATTCTAGATAGAAAAC---TGATAATGACAACTATCTATCTATTAGTCTTGACCAA-ATTACGTGCCAGCAGTCGCGGTAATACGCAGAAGACAAGTGTTATTCATCTTTAATCGGTTTAAAGGGTACCTAGACGGGAAATCAAGCC-ATAGT----AGGGACTAATTTTCTAGAGTTTTATGGATGAAAG-TCGAATGTCTGGAGTAGAGATAAAATATTATAATACTAGATGGACGGGC-AACGGCGTAGGCAACTTTCTATGTAAA-AACTGACGTTGAGGGACGAAGCCCT--AGGTAGCAATAAGGATTAGATACCCTAGTAGTCCAGGGAGACAATGATGAGTGCCATAAGCTAGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATTAGCATATAAATGAAAGTGTAAGCATTCCACCTCAAGACTAAAGCGGCAACGCCCAAATTGAAATCATTAGACCGATACTGAAACCAGTAGTGAAGTATGTTATTTAATTCGATGATCCGCGAAT-AACCTTACCACGTTTTGAATACTTTTTGTACGTGCTTTTATCACCACAAATTGT-----------------------------------------------------------------------------------------------------------------------------ACAAGCGCTGCACGGCTGTCTTTAGTTAATGTCGTGAGACTTTGGTTAACTCCTCTAATTAACGAAAACCCTTGTTTTATTTG-----------------------------------------------TTTATAAAACAGT-TCTCTGGTA-CA-ACGGA--TAAG-AT--A-ATAGGGATTAAGGCAAGTCATC-ATGGCCA------------------------------------------------------------AGCCATCAAGTTGGCGGTGCCTGTCTATCATTATGGTTTCCTCGGCAAAGTCAAGAAGCTCCTCGAGACAGTCTGTCATAATTGTGGGAAAATAAAAGCAGTGGAC---------------------------------------------------------------------------------------------TCTGAGGATCTGCGATAT---GCCCTTACTGTTCGCAACCCCAAGAAGCGCTTCGAGCCCATTTGGCGCCTTAGTCAGAAGCAGAACATTTGTCAAGCCGATAGCCCCGAAGACGAAGAAGACCCGACG------GCGAGAGAGAGGAGCGGCAAAGTAGGA---CACGGTGGGTGTGGCAATGCTCAGCCACAAATTCGCAGAAGTGGGCTTGAGCTTTGGGCACAATACAAACCTCGAAAA------------GGAGATGACGATGAGGAGACTGTTCCT---GAGAAATCGCAGATCTGGCCTGCACAAGCGCTGGAGGTATTTCAGCATCTCACTGACGAAACGCTCGATACCCTGGGCTTGAACCTTGATTTTGCTCGGCCAGAG------------------------------------------------------TGGATGATATTGCAGAGCCTGCCTGTACCACCTCCTCCTGTTCGACCTAGCATCAGCGTCGATGGAAGTGGACAAGGTTCCCGTGGAGAGGATGATCTGACCTTCAAGCTGGGAGACATCATCCGTGCCAACCAAAACCTGATTCGCATCAACGCGGAAGGTGCGCCTGACCACATTGCGAAAGAGTTGCAAGCCTTGCTGCAATATCATGTCGCGACCTACATGGATAATGACATTGCCAACCTC------GATAAAGCGCAGCACAAGAGCGGTAGACCAATCAAATCCATACGTGCTCGTCTGAAGGGAAAAGAAGGTCGCCTTCGCCAGAACCTGATGGGCAAACGAGTTGATTTTTCAGCACGCACAGTCATCACCGGCGATCCAAATTTGTCTCTTGACGAAGTCGGTGTCCCTCGAAGCATAGCTCGGACGTTGACGTACCCTGAGACCGTAACCCGGTTCAATATCTCCAAGCTCAAACAGCTTGTCACGAACGGCCCGGAAGCGCATCCCGGTGCTAGATATATCATTCGAGAAAATAACGAGCGCATTGATCTCCGCTACCACAAGGATACCAGC---CAGATTGCTCTCAAAACAGGATGGAAGGTTGAGCGACACATCATGGATGGAGACGTCATTCTCTTCAATCGACAGCCATCACTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Endophyte_4466 -------------------------------------------------------------------------------------------TTTGAAAT-CTGGC-TCTTT--CA-GG-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGCAACGTTTC-GGTTTAAATTCCTTGGAACAGGATGTCATAGAGGGTGAGAGTCCCGTCT-TGAACC-GTATACCGCGTCCATGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGTTTAACGGTTCCATCACTGTTCT---CAGTG-GTCTATT-CCGTTATAT-C-CAGGCCAGCATCGGTTCGGGTGGTTAGTTAAAGGCCTTGG-GAATGTATCTACCCTT---CGGGG--T-CG-ACTTATAGCCC-TTGGTGTAATGTGACCTACC-TGGACCGAGG-CACGCG-CAT-CTGCTCGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGT-CAAACCC-CTACGCGTAATGAAAGTGAACGGAGGT-AAGAACCCGCAA----------GGGTGCATTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGTCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGACCGAATGCATTGGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCTATACCTCGCCGTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Eupenicillium_javanicum_AFTOL_429 --------------------------------------GAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAG-CTGGC-TCCTT--CG-GG-GTCCGCATTGTAATTTGCAGAGGATGC-TTCGGGAGCGGCCCC-CATCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCT-GGGATGGGGTGCCCGCGCCCGTGTG--AAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGG-GGTTCAGCCGGCCTTCGGG-CCGGT-GTAC--T-TCCCCGCGG-G-CGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCTCG-GAATGTAACGCCC-CC---C-GGG--G-CG-TCTTATAGCCG-AGGGTGCCATGCGGCCAGCC-CGGACCGAGG-AACGCG-CTT-CGGCTCGGACGCTGGCATAATGGTCGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTACGCGAGTGTTCGGGTGT-CAAACCC-GTGCGCGCAGTGAAAGCGAACGGAGGT-GGGAACCCCTCG----------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCGTAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGCGAATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTGCTTAATTGAACGTGGGCATTAGAATGATGCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCGGGGTAGAAACGATGCCCCGACGAGTAGGCAGGCGTGGGGGTCCGTGACGAAGCCT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCATAAAATTCTAAATAGGTTGT---ATATAATGACA-TAATCTATTTATAAGTCTTGACCAA-ACTACGTGCCAGCAGTCGCGGTAATACGTAGAAGGCTAGTGTTAGTTATCTTTATTGGGTTTAAAGGGTATGTAGACGGTAAATTAAACT-CTAAAA---GAGTACTTTTTTACTAGAGTTATATATGAGAAGG-AAGAATTTCTGGAGTAGAGATAAAATTTTTTGATACCAGGAGGACTGTC-AACGGCGAAGGCGTCCTTCTATGTAAT-AACTGACGTTGAGAGACGAAGGCTT--GGGTAGCAAACAGGATTAGATACCCTAATAGTCCAAGCAGACAATGATGAATGTCATACATTAGAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGATTTAATGTATAAACGAAAGTGTAAGCATTCCACCTCAAGAGTACTATGGCAACATATAAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTATTTAT?????????????????-??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-????????????-?????--????-??--?-??????????????????????????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Eupenicillium_limosum_AFTOL_564 ---------ACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAG-CTGGC-TCCTT--CG-GG-GTCCGCATTGTAATTTGCAGAGGATGC-TTCGGGAGCGGCCCC-CATCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCT-GGGATGGGGTGCCCGCGCCCGTGTG--AAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGG-GGTTCAGCCGGCCTTCGGG-CCGGT-GTAC--T-TCCCCGCGG-G-CGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCTCG-GAATGTAACGCCC-CC---C-GGG--G-CG-TCTTATAGCCG-AGGGTGCCATGCGGCCAGCC-CGGACCGAGG-AACGCG-CTT-CGGCTCGGACGCTGGCATAATGGTCGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTACGCGAGTGTTCGGGTGT-CAAACCC-GTGCGCGCAGTGAAAGCGAACGGAGGT-GGGAACCCCTCG----------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCGTAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGCGAATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTGCTTAATTGAACGTGGGCATTAGAATGATGCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCGGGGTAGAAACGATGCCCCGACGAGTAGGCAGGCGTGGGGGT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGACTCGTGAGCACGCTCTGCTCGCCTTCACCCTCGGTGTCCGTCAGCTCATTGTTGCCCTCAACAAGATG------------------------------------------------------GACACCTGCAAGTGGTCCGAGGACCGCTACAACGAGATTGTCAAGGAGACCTCCAACTTCATCAAGAAGGT-GGCTACAACCCCAAGAGCGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCGAGCCCTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAG---------------GCCGGCAAGACCACTGGCAAGACCCTCCTCGAGGCCATCGACGCCATTGAGCCCCCCGTCCGTCCCTCCAACAAGCCCCTGCGCCTGCCCCTCCAGGATGTCTACAAGATCTCCGGTATTGGCACAGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCACTCCCGGCATGGTTGTCACCTTCGCTCCCGCCAACGTCACTACTGAAGTCAAGTCCGTTGAGATGCACCACCAGCAGCTCAAGGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGGTTCGCCGTGGTAACGTCGCTTCCGACTCCAAGAACGACCCCGCCGCTGCTGCCGCTTCCTTCAACGCTCAGGTCATCGTCCTGAACCACCCCGGCCAGGTCGGCGCTGGTTACGCTCCCGTTCTCGACTGCCACACCGCTCACATTGCTTGCAAGTTCTCTGA-CTCCTCGAGAAGATCGACCGCCGTACCGGTAAGTCCGTTGAGGA-CACCCCAAGTTCATCAAGTCCGGTGATGCCGCC-TCGTCAAGATGA-TCCCTCCAAGCCCATGTGTGTTGAGGCCTTCACCGACTACCCCCCTCTCG--------------------------------------------------------------- Exophiala_dermatitidis_AFTOL_668 -----------------ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-CTCTT--TG-GG-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGCACCGCTCC-GGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAACCCCGTCT-TGGACC-GGCAGTAGGGCCCATGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCGGCGGTTCCCCCTTCCTTTTGG-TTGGG-TTAT--T-CCGCCGTGT-C-CAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGGCCTGGG-GAATGTATCTACC-CTT--CGGGCG-T-AG-ACTTATAGCCC-CGGGTGTCATGCGACCTCCC-GGGACCGAGG-AACGCG-CTT-CGGCTCGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGT-CAAACCCGGAACGCGGAATGAAAGTGAACGGAGGT-AGGAAGCTTC------------GGCTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTA--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTCACGGTTGACATGATGCCGTGACGAGTAGGCAGGCGTGGAGGTCAGTGACGAAGCCTTGGGGGTGACCCCGGGTCGAACGACCTCTAGTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCAAGCTTGCAACTCCAGTCTATCACTATGGCTTCATGGGGAAAGTCAAGAAGATTTTGGAGACGGTCTGCCTCAACTGTGGCAAGATCAAAGCACTTGAT---------------------------------------------------------------------------------------------AATGAAGAATTTCGCCAC---GCCATCTCTCTCCGTGATCGAAAGCGGCGGTTCGATGCCGTTTGGCGGTTGAGCAAGCCTCGTAACGTCTGTGAAGCAGATCCTCCCGAAGACCCCGATCAG---------------CCACTCAAGGGACCTGCGCCACCCAAACATGGTGGTTGTGGTAACATGCAGCCAGAGATTCGACGTAGCGGGTTGCAACTATGGGCGACCTGGAAAGCCCGAAAG------------GGTGAAGATGAGGAAGACACCACGCCG---GACAAGAAACGTATCTTCCCACAAGATGCACTCAACACCTTCCGCACTCTGACTGACGAAACCCTGGAAATGATGGGTCTCAGTCTGGACTATGCTCGGCCGGAG------------------------------------------------------TGGATGATCCTCTCGGCGCTTCCTGTTCCTCCTCCACCAGTCCGCCCTAGTATAAGCGTGGACGGTAGTGGTCAAGGACAACGCGGCGAAGACGATCTGACTTTCAAACTTGGAGATATCATTCGAGCCAACCAAGCGGTCTTGCGGACGGAAGTCGATGGCACACCAGACCATATCAAGGTGGATCTGTGCGATTTGCTTCAATATCATATCGCCACATACATGGACAACGAAATCGCTGGGTTG------GAGCGGGCGCAACACAAGAGTGGGCGTCCCATCAAGTCGATCCGTGCTCGGTTGAAGGGCAAAGAAGGCAGACTGCGCCAGAACCTGATGGGCAAGCGTGTTGATTTCTCTGCTCGTACTGTCATCACAGGTGACCCTAATCTGTCATTGGACGAGGTCGGTGTCCCTCGCAGCATTGCTCGCACCCTGACTTAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGAACATGATCACTGGTACCTCGCAGGCCGACTGCGCCATCTTGATCATTGCCGCCGGTACCGGTGAATTCGAAGCCGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTCGCCTACACCTTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATG------------------------------------------------------GACACCACCAAGTGGTCCGAGGAGCGTTTCAACGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTCCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGAGGTCTCCACCAACTGCCCGTGGTACAAGGGATGGGAGAAGGAGTCCAAG---------------GCTGGCAAGGCCACCGGCAAGACCCTCCTCGAGGCCATTGACGCCATCGACCCACCCACCCGTCCCACCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAGATCTCTGGTATCGGAACGGTTCCTGTCGGTCGTGTCGAGACCGGTACCATCAAGGCCGGTATGGTCGTCACCTTCGCTCCGGC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Exophiala_pisciphila_AFTOL_669 -----------------ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-CTCTT--TG-GG-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGTACCGCCTC-GGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCT-TGGACC-GGCGGTAGGGCCCATGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTGCGCGCGGCGGTTCCCCCTTCCTTTTGG-TTGGG-CTAC--T-CCGTCGTGT-C-CAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGACCCTGG-GAATGTATCTACC-CTT--CGGGCG-T-AG-ACTTATAGCCC-AGGGTGTCATGCGGCCTCCC-GGGACCGAGG-AACGCG-CTT-CGGCTCGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGT-CAAACCCGGAACGCGAAATGAAAGTGAACGGAGGT-AGGAAGCCTTGA----------GGCTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTCAGGGTTGACATGATGCCCTGACGAGTAGGCAGGCGTGGAGGTCCGTGACGAAGCCTTGGGGGTGACCCTGGGTCGAACGACCTCTAGTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTTTTATGGGTAAGGTCAAGAAGATCTTGGAGACCGTCTGCCACAATTGTGGCAAAATCAAGGCTACTGAG---------------------------------------------------------------------------------------------TCCGAAGAGCTCAAACAC---GCGTATAAGATCCGTGACCGAAAGCGACGATTTGATGCAGTTTGGCGATTGAGCAAACCTCGATTGATCTGTGAAGCCGATCCCCCCGAAGATGCTGACCAGCAA------------CCCTTGAAAGGACCGCCTCCACCCAAACACGGTGGCTGTGGAAACGCTCAGCCTGAGATTCGGAGAACTGGTCTCCAGCTTTGGGCAACCTGGAAAGCTCGAAAA------------GGTGAAGATGAGGAAGACACAACACCT---GACAAGAAACGAATCTTCCCGGCGGACGTTCTGCGTACATTCCGTACCCTAACCGATGAGACACTCGAGTTGATGGGCCTCAATCTGGATTATGCACGACCAGAG------------------------------------------------------TGGATGATCTTGTCTGCACTCCCCGTTCCTCCACCTCCAGTCCGCCCCAGCATCAGCGTCGACGGCAGTGGTCAAGGCCAACGTGGCGAAGATGACCTGACATTCAAGCTTGGTGATATCATCCGTGCCAACCAAGCTGTTCTTCGAACTGAAGTTGATGGAACTCCTGACCATATCAAGGTTGATCTACAAGACCTTCTTCAATACCACATCGCCACTTACATGGACAACGAAATCGCCGGGTTG------GACAAGGCTCAGCATAAGAGTGGCCGGCCCATCAAATCAATTCGTGCCCGACTGAAGGGTAAAGAAGGAAGACTGCGTCAGAATCTCATGGGAAAGCGTGTCGATTTCTCTGCGCGTACCGTCATCACTGGTGATCCCAATTTGTCGCTTGATGAAGTTGGTGTCCCACGAAGCATCGCACGCACCCTGACCTGCCCAGAAACGGTCACACCCTTCAACCTTGATAAACTCAAGCGCCTTGTCGCAAATGGTCCGACAGAACATCCCGGTGCTCGATATGTTATTCGAGACTCTGGAGAGCGTATCGATCTTCGCCATCACAAACGTGCTGGA---GAAATGACCTTGCAATACGGCTGGAAGGTTGAAAGACATATCCAAGAC------------------------------------AAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAATTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTTCTTGCCTTCACCCTCGGTGTCCGACAGCTCATTGTCGCCATCAACAAGATG------------------------------------------------------GACACCACCAAGTGGTCTGAGGATCGTTTCAACGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGTCTGTTCCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGATGTTTCCACCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGTCCAAG---------------GCCGGCAAGGCTTCCGGCAAGACCCTCCTCGAGGCCATTGACGCCATCGACCCCCCATCCCGTCCCACCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATCTCTGGTATCGGAACGGTTCCCGTCGGTCGTGTTGAAACCGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCTGCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Exophiala_salmonis_AFTOL_671 -----------------ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-CTCTT--TG-GG-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGTACCGCCTC-GGTTTAAATTTCTTGGAACAGAATGTCAGAGAGGGTGAGAATCCCGTCT-TGGACC-GGCGGTAGGGCCCATGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTGCGCGCGGCGGTTCCCCCTTCCTTTTGG-TTGGG-CTAC--T-CCGTCGTGT-C-CAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGACCCTGG-GAATGTATCTACC-CTT--CGGGCG-T-AG-ACTTATAGCTC-AGGGTGTCATGCGACCTCCC-GGGACCGAGG-AACGCG-CTT-CGGCTCGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGT-CAAACCCGGAACGCGAAATGAAAGTGAACGGAGGT-AGGAAGCCTTGA----------GGCTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTCAGGGTTGACATGATGCCCTGACGAGTAGGCAGGCGTGGAGGTCCGTGACGAAGCCTTGGGGGTGACCCTGGGTCGAACGACCTCTAGTG-----------------------------------------------------------------------------------------------------------------------------------------------------------CTCATGTAGTTCTAGGTAAAATAC---AGAGTATGACTATTTTTTATCTATGAGTCTTGACCAA-ATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACGAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACAGAAAACCAAGCC-TCTTTA----GGTACTAGTTTTCTAGAGTTTTATGTGTGAATA-GCGAATTATCAGAGCAGGGTCGGAATCCTCTAATCCTGGTAGGACGGGT-AACGGCAAATGTTCTATTCTATGTATT-AACTGACGTTGAGGGACGAAGCCTT--GGGTAGCGATTAGGATTCGAAACCCTAGTAGTCCAAGGAGACAATGATGAGTGCCATAAGCTAGAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTATTTAGTTTATAAATGAAAGTGTAAGCATTCCACCTTAAGACTAAAGCGGCAACGCCCAAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTATTTAATTCGATGATCCGCGAAT-AACCTTACCACGTTTTGAATACTAATGCAAATTAAT-----------------------------------------------------------------------------------------------------------------------------------------------ACAAGTGCTGCACGGCTGTCTTCAGTTAATGTCGTGAGATTTTGGTTAATTCCTTTAATTAACGAAAGCCCTTACTTTAGTTA-----------------------------------------TCTTTATTTCTAAAGTTGT-TAACCAATA-TA-TTGGA--TATC-AT--A-AAAGGGACTAAGACAAGTCATC-ATGGCCT----------------------------------------------------------------------------------------------GGCTTTATGGGTAAGGTCAAGAAGATATTGGAGACTGTCTGCCACAACTGTGGCAAAATCAAGGCTCTTGAT---------------------------------------------------------------------------------------------TCCGAAGAGTTAAAGCAC---GCGTTCAAGATACGCGACCGAAAGCGACGTTTCGATGCAGTCTGGCGATTGAGTAAGCCTCGATTGATTTGTGAAGCTGATCCTCCCGAAGACGCCGAACAGCAA------------CCTTTGAAAGGACCTGCTCCAATTAAGCATGGTGGTTGCGGAAATGCCCAACCTGAGATTCGAAGAACTGGTCTCCAACTTTGGGCAACATGGAAGGCCCGAAAA------------GGTGAAGATGAGGAAGACACAACACCT---GACAAGAAACGAATCTTTCCAACTGAAGTTCTGCGCACATTCCGTACCTTGAGTGACGACACACTCGAGTTGATGGGTCTTAACCTTGATTACGCACGACCAGAG------------------------------------------------------TGGATGATCCTGTCTGCACTACCTGTTCCTCCTCCTCCCGTCCGTCCCAGTATTAGTGTGGACGGTAGTGGTCAAGGACAACGTGGTGAAGATGATCTGACTTTTAAACTTGGTGATATTATTCGTGCCAACCAAGCTGTTCTACGAACTGAAGTTGATGGAACCCCCGATCATATCAAGGTTGATCTTCAAGATCTTCTTCAATATCATATCGCCACTTACATGGACAATGAAATTGCTGGCTTG------GACAAGGCTCAGCATAAGAGTGGACGACCCATCAAATCGATTCGTGCTCGTTTAAAGGGCAAAGAGGGAAGACTGCGTCAGAATCTCATGGGAAAGCGTGTGGATTTCTCTGCACGTACAGTCATCACTGGTGATCCTAATTTATCACTCGATGAAGTTGGCGTTCCTCGCAGCATTGCTCGTACTCTGACCTACCCGGAAACGGTCACGCCTTTCAATCTCGATAAACTCAAACGCCTTGTCGCCAATGGTCCAACTGAACATCCTGGTGCACGATATGTCATTCGAGATTCTGGAGAGCGTATTGATCTTCGTCATCACAAGCGTTCTGGT---GAAATGACTCTACAATATGGCTGGAAAGTCGAAAGACATATTCAAGAT------------------------------------AAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCCATTCTCATCATTGCTGCCGGTACTGGAGAATTCGAAGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTTGCCTTCACCCTCGGTGTCCGACAACTCATTGTCGCCATCAACAAGATG------------------------------------------------------GACACCACCAAGTGGTCTGAGGATCGATTCAACGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGTCCGTTCCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGATGTCTCCTCCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGTCCAAA---------------GCTAGCAAGGCCTCTGGCAAGACCCTTCTCGAGGCCATTGATGCCATCGACCCTCCTTCTCGTCCCACCGATAAGCCTCTCCGTCTTCCCCTTCAGGATGTGTACAAGATCTCTGGTATTGGAACGGTTCCCGTCGGTCGTGTTGAGACTGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Geoglossum_nigritum_AFTOL_56 ------------TAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGT-TCCT---C-TGGAGCCCGAGTTGTAATTTGTAGAGGATGTCTTCGGGTTTGGCCCC-GGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTAT-GTGGCTGGAGGTCTATGCCCATGTG--AAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAGTTTCATCTAAAGCTAAATACTGGCGGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGCCCTCAGTTGATCAACCGGTGTTCTTCACCGGT-GCAC--T-CGGCTGAGG-T-CAGGCCAGCATCGGTTTAGACGGTTGGAGAAAGACCATGG-GAATGTGGCTCCC-TT---CGGG---G-AG-TGTTATAGCCT-GTGGTGCCATGCAGCCAGTT-TAGACCGAGG-ACCGCGCCTT-GTGCTAGGATGCTGGCGTAATGGTCGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGT-CAAACCC-ATGCGCGTAATGAAAGTGAACGGAGGT-GGGAACCCTTAA----------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTA--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATTCGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGCTACCCATACCTCGCCGCCAGGGTAGAAACGATGCCCTGGCGAGTAGGCAGGCGTGGAGGTCAGTGACGAAGCC----------------------------------------------------CCATTAATTTGGAGGAATGTA--TAGCATTTGCT-AGTTATATTAACTATAAGT--T--A-A----------------------------------------------------------TATAGCATCGATTTATTCGAATAAAGTTCTAGATAAAATAA---TGATAATGACAATTTTTTATCTATATGTCTTGACCAA-ATCATGTGCCAGCAGTCGCGGTAAGACATGGAAGACTAGTGTTATTCATCTTTAATAGGTTTAAAGGGTACTTAGACGGTATTTCTAGCC-AAAA----AAGGTACGGATTTACTAGAGTTTTATATGAGAGGGTGAGTATTTTAGGTGTAGAGATGAAATTTTTTAATACCTTAAGGACTGAT-AACGGCGAAAGCAACCTTCTATGTAAT-AACTGACGTTGAGGGACGAAGGCTT--GGGTAGCAAACAGGATTAGATACCCTAATAGTCCAAGCAGAAAATTATGAATGCCATAGATTAGAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATATTTAGTTTATAAATAAAAGTGTAAGCATTCCACCTCAAGAGTAATGTGGCAACGCAGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTATTTAATTCGACGACCCACGAAA-AACCTTACCACAATTTGAATGTTAAATTTATTTAAC-----------------------------------------------------------------------------------------------------------------------------------------------ACAAGCGTTGCATGGCTGTCTTCAGTTAATGTCGTGAGA-TTTGGTTAGTTCCATTAATTAACGTAAACCCTTGCTTTATTTATA---------------------------------------TATTTTTGTATAAAGCAGT-TCACCATTA-TA-TTGGA-T-ATG-AT--A-AAAGGGACTAAGACAAGTCAAC-ATGACCTTAAT-ATTGT-AATGAGCTCGCAACGCCAGTCTTTCACGTCGGTATGTATTAAGTATATAGGACACTACGTAGAATGGCATACTAACGACAATAGGTTTCATGACAAAGATCAAGAAGCTTCTTGAGACCGTCTGCTTCAACTGCGGAAAGATTTTGCTAGATGAGGTCAGCCATCCTTGATAGGGTGGCGTCTCTTCCATCACTGTATCTTGCTGACATTTCTAACTCCCAGAGC-----------------------AATCCTCAATTCAAAGAG---GCT?TACGTCACCGCGACCCTAAGGCCCGCTTTAATGCGATATGGAGAGCATGCAAGCCTAAGATGATCTGCGAGAGCGACGCGGCCATGGAAGATGATTTTGAC---CCAAACGTTAGCAAGGAACAGCCGAAAAAACACAATCATGGGGGGTGTGGAAACCACCAACCTGAGATCCGGCGTGAAGGTCTAAAACTATTTGGCACTTGGAAGATCCCAAAG------------GACGATGAAAACGATACACAACAGCCA---GAAAAGAAGCAGCTAACTCCACAGCAAGTTCTCAATATATTCCGACGCATTTCTGCTGAAGACGCTAGAAAGATGGGCTTAAGTAATGACTATGCTCGACCTGAA------------------------------------------------------TGGATGATCATCACTGTACTCCCTGTTCCTCCTCCACCAGTTAGACCGAGCATATCTATGGACGGTACGAGTCAGGGAATGCGCGGAGAGGATGACTTGACCTACAAGCTTGGTGATATCATTCGGGCTAATGGCAATGTACGGCGCTGTGAGCAAGAGGGCTCGCCAGCTCATGTCGTCAGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGCTGACTGCGCTATTCTTATCATCGCTGCCGGCACTGGCGAGTTCGAGGCTGGTATCTCCAAAGATGGTCAAACCCGTGAACATGCCCTTCTCGCCTATACTTTAGGTGTGAAGCAACTCATCGTCGCCATTAACAAAATG--GTAAGTCCTACTCTTCAAACCCTTCCCGATTACCTAGTCTAAAATTCCTTAGGATAACGCCAAATGGTCCGAAGCTCGATTCAATGAAATTATCAAGGAAGTCTCCAACTTTATCAAGAAGGTTGGATATAACCCCAAGACTGTTGCTTTCGTACCCATCTCCGGTTTCGACGGAGACAACATGATAGATGTCTCGCCTAATTGCCCTTGGTATAAGGGATGGGAAAAGGAAGGCAAGAATGATGCGGGCGCCAAGGTGACGAAGAACGGCAAGACCCTTCTTGAAGCAATCGACTCTATCGACATCCCCACCCGTCCCACCGACAAGCCTCTTCGCCTTCCGCTCCAGGATGTATACAAAATTGGCGGTATCGGAACTGTTCCTGTTGGCCGTGTTGAAACTGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCTCCCGCCGGCGTCACCACTGAAGTAAAGTCTGTCGAAATGCACCACGAGCAACTGGTTGAGGGTGTCCCAGGTGACAATGTTGGTTTCAACGTCAAGAACGTGTCTGTTAAGGAAATTCGCCGTGGTAACGTTGCGGGAGACTCCAAGAACGACCCCCCTAAGGGCGCCGAGTCCTTCAATGCCCAGGTTATCGTTCTCAACCATCCCGGCCAAGTTGGTGCAGGTTACGCACCTGTCCTTGACTGTCACACTGCGCACATTGCCTGCAAGTTTAGCGAACTTCTGGAGAAAATTGACCGCCGAACTGGCAAGTCTATTGAGAACAACCCCAAATTCGTCAAGTT-------------------------------------------------------------------------------------------------------------------------------------------- Histoplasma_capsulatum_AFTOL_1083 ------------------------TAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAT-CCGGC-CCCCC-TGG-GG-GCCTGAGTTGTAATTTGCAGAGGATGC-TTCGGGCGCGACCGC-GGTCCAAGTCCCCTGGAACGGGGCGTCGTAGAGGGTGAGAATCCCGTCT-CCGGCCGGCCGGTCTCGCCCGTGTG--AAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGTGGGGGTTCAGCGGGCATTCGTTGCCCGT-GCAA--T-CCCCCGCGG-C-CGGGCCAGCGTCGGTTTCGACGGCCGGTCAAAGGCCCCCG-GAATGTGTCGCCT-CT---C-GGG--G-CG-TCTTATAGCCG-GGGGTGCAATGCGGCCAGTC-GGGACCGAGG-AACGCG-CTC-CGGCACGGACGCTGGCTTAATGGTCGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCCACGCGAGTGTTCGGGTGT-CAAACCC-GTCCGCGCAGTGAAAGCGAACGGAGGT-GGGAACCCCTGA----------GGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAGGAGCGTGGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTCGTTGAACGTGGGCACTGGAATGGATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGCTACCCATACCTCGCCGTCGGGGTAGGATCGATGCCCCGACGAGTAGGCAGGCGTGGAGGTCCGTGACGAAGCCCGGGGAGTGATCCCGGGTCGAACGGCCTCTAGTG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATCGAGCTATCTACTCCTGTGTTCCATATTGGTTTCCTGACTAAGATCAAGAAACTGTTGGAAACTGTTTGCCACAACTGTGGAAAGATCAAGGCAAATACG---------------------------------------------------------------------------------------------ACCGATCAAAAGTATTTGGAAGCGCTCCGTTTCCGCGATCCAAAGAGACGCTTTGATGCGATTTGGCGTTTGTCAAAAGATGTCTTGATTTGCGAAGCTGACCCCAGTCCGGATGATGACGAACCGTTC------GCCAAAGAACCTTCCAAGCCTGTGCGCTCCCATGGCGGTTGCGGAAATATACAACCTCAAATCCGCAAAGAGGGAATTAGTTTGGTTGGGACCTGGAAACCTAGCAAGAATCGTGATATGATGGATGATATGGATGTACAACAACCA---GAGAAAAGACAGATTACTCCACAGATGGCCCTCAACATATTCAAGACCATCTCGGAAGAAGATGTTCGTTTGATGGGGTTGAGCAATGATTATGCAAGGCCCGAA------------------------------------------------------TGGATGATTATCACAGTTCTTCCCGTACCTCCACCTCCAGTCCGTCCCAGTGTTCTAATCGGCGGGAGTGGAAGCGGTCAGCGTGGAGAAGACGACTTGACATATAAACTGGCAGAGATTGTGCGCGCGAATCAGAATGTCACCCGATGCGAACAGGAAGGATCTCCTGAGCACGTGGTCCGTGAATTTGAGTCTCTTTTGCAGTATCATGTTGCAACCTACATGGACAATGATATTGCCGGACAG------CCACAAGCTATGCAAAAGTCTAACCGACCTGTCAAAGCTATCCGTGGCCGCTTAAAGGGTAAAGAAGGTCGCCTGCGTCAGAACTTGATGGGCAAACGTGTCGATTTTTCCGCTCGTACGGTTATTACTGGTGACCCGAATTTGTCTTTGGATGAAGTTGGAGTTCCAATCAGCATTGCACAGACTTTAACTTATCCCGAGGTCGTCACTCCTTTCAATATCGCCAAGCTAGGTGAGCTTGTGGATAACGGCCCTGATATTCACCCTGGGGCCCGTTATGTTATTCGCAACACTGGTGAACGCATTGACTTGCGCCATCATAAGGGTGGAGGTGGGAGAAACTTCCTACAGTATGGATGGAGAGTGGAGCGTCATATCGTGGATGGCGATGTGATCCTATTCAATCGACAGCCGTCCTTGAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATCCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTTGCTTTCACCCTTGGTGTGAGGCAACTCATCGTTGCCATCAACAAGATG------------------------------------------------------GACACCACCAAGTGGTCCGAGTCCCGTTTCAACGAAATCATCAAGGAGGTTTCCAACTTCATCAAGAAGGTCGGATATAACCCCAAGGCTGTTCCCTTCGTGCCAATCTCTGGTTTCGAGGGTGACAACATGATTGAACCCTCCCCCAACTGCACCTGGTACAAGGGCTGGAACAAGGAGACTGCC---------------TCTGGCAAGTCTTCTGGTAAAACCCTTCTCGATGCCATTGACGCCATTGAACCCCCAACCCGTCCTACCGATAAGCCTCTCCGTCTTCCCCTCCAGGATGTTTACAAAATCTCTGGTATTGGCACTGTTCCCGTCGGACGTGTTGAGACTGGTGTCATCAAGCCCGGTATGGTCGTGACTTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACCAACAACTCCAGGCTGGTTACCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTTTCAGTCAAGGAAGTCCGCCGTGGCAACGTTGCTGGCGACTCCAAAAATGATCCCCCCAAGGGCTGCGAATCCTTCAATGCCCAGGTCATCGTCCTTAACCACCCCGGCCAGGTTGGCGCTGGTTATGCCCCAGTCCTCGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAACTCATTGAGAAGATCGACCGCCGTACTGGAAAGTCTGTTGAGAACAACCCCAAGTTCATCAAGTCTGGTGATGCTGCTATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTGGAGCCCTTCACTGACTATCCCCCTCTTGGACGTTTCGCTGTCCGTGACATGAGACAAACC------------------------------- Lithothelium_septemseptatum_AFTOL_12 -----------------------------------AAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-CCTCC--TG-GG-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGCCAGGCTGC-GGGATAAATCCCTTGGAACAGGGTGTCAGAGAGGGTGAGAGTCCCGTCT-TTAACC-GCGTGCTGCGCCCATGTG--AAACTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGGGCAGCGGTTCAGCCGTTATTCTTA-ACGGT-GCAC--T-CTGCCTGCTTC-CAGGCCAGCATCAGTTTAGACAGTCAGTTAAAGGCCTCGG-GAATGTATCGTCC-CTC--TGGGG--A-AG-ACTTATAGCCCTTGGTGACATCTGGCTCAGCC-TGGACTGAGGGACCGCG-CTT-CCGCACCGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCCGCTCG-TTAACCCCTTGCGCGCAATGAAAGCGAACGGAGGCCGGGAGCCCCTC-----------GGGCGCACCATCCACCGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGCCT-AACGGCTGAACCAGTAACTTAGAGGAATGTA--------------------------------------------------------------------------------------------------------TAATGATTAACTTATATAAAATTCTAGGCATAATAA---TAATGATGACTATTTTTTGTCTATAAGTATTGACCAA-ATTACGTGCCAGCCGTCGCGGTAATACGTAGAATACAAGTGTTATTCGTCTTTATTAGGTTTAAAGGGTACCTAGACAGAAAATAAAGCC-ATAAT----AGGGACTAATTTTCTAGAGTTTTATAAAAGAAAA-AAGAATTATTAGAAGAGAGATGAAATTTAATGAAACTAATAGGACTGGT-AACAGCGAAGGCATTTTTCTATGTAAA-AACTGACGTTGAGGGACGAAGCCTA--GGGTAACGATAAGGATTAGATACCCTAATAGTCCTAGGAGAAAATTATGAATGCCATAGGCTAGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATTGGTCTATAAATGAAAGTGCAAGCATTCCACCTTACAAGTAAAGCGGCAACGCCGAAACTGAAATCATTAGACCGTTACTGAAAACAGTAGTGAAGTATGTTATTTAATTCGATGATCCGCGAAT-AACCTTACCACAATTTGAATATTATT---------------------------------------------------------------------------------------------------------------------------------------------------------ACAAGTGCTGCACGGCTGTCTTCAGCTTATGTCGTGAGATTATGGTTAGATCCATTAATAAGCGTAAACCCTTGCTTTATTTAAACTAATTTATAAAAAATAAAGGAAAAGGTTCTTTTTTTTATTAAGTTTCATATAGCAGT-TAGCCACTA-TA-TTGG--T-ATT-AT--A-AAAGGGATTAAGACAAGTCATC-ATGGCCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Monascus_purpureus_AFTOL_426 ------------------------------------------------------------GTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAG-CTGGC-CCCTC--CG-GG-GTCCGCGTTGTAATTTGCAGAGGATGC-TTCGGGCTCAGCCCC-CGTCTAAGTGCCCTGGAACGGGCCGTCGGAGAGGGTGAGAATCCCGTCT-GGGACGGGGTGCCTGGGTCCATGTG--AAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGATCAGACTCGCCTG-CGGGGTTCAGCCGGCATTCGTG-CCGGT-GTACT-T-CCCC-GTGG-G-CGGGCCAGCGTCGGTTCGGGTGGCCGGTCAAAGGCCCCGG-GAATGTGTCGCCC-TC---CGGG---G-CG-TCTTATAGCCC-GGGGTGCCATGCGGCCTACC-TGGACCGAGG-AACGCG-CTT-CGGCTCGGACGCTGGCGTAATGGTCGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTACGCGAGTGTTTGGGTGG-CAAACCC-ATACGCGCAGTGAAAGCGAACGGAGGT-GGGAACCCTTCG----------GGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCGTAGCTGTGGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGCAATTTCAGTTTTATGGGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAATTGAACGTGGGCGTTAGAATGTCGCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCTATACCTCGCCGCCGGGGTAGAAACGACGCCCCGGCGAGTAGGCAGGCGTGGGGGTCCGTGACGAAGCC----------------------------------ATGGCCGAAA-GGCTGAACCAGTAACTTGGAAGAATGAA-----------------------------------------------------------------------------------TAAGTATTATAATAATAATACTAACGATTAATTCGTATAAAATTCTAAATAGGATAA---TGATAATGACAATTTCCTATTTATAAGTCTTGACCAA-ATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTAGTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGTAAATTAAACT-CTAAA---TGAGTACTTTTTTACTAGAGTTTTATGTGAGAAGG-AAGAATTTCTGGAGTAGTGATGAAATACTTTGATACCAGAAGGACTGTT-AACGGCGAAGGCATCCTTCTATGTAAA-AACTGACGTTGAGGGACGAAGGCTT--GGGTAGCAAGAAGGATTAGATACCCTAGTAGTCCAAGCAGAAAATGATGAATGTCATAGGCTAGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACATTTAGTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATATGGCAACATATAAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTATTTAATTCGATAATCCGCGAAA-AACCTTACCACAGTTTGAATAACATTAAATTGTT-------------------------------------------------------------------------------------------------------------------------------------------------ACAAGCGCTGCACGGCTGTCTTTAGTTAATGTCGTGAGA-TTTGGTTAACTCCTATAATTAACGAAAACCCTCACTTTATTTTTATAC---------------------------------------------ATAAAGTGGT-TCGCCAATA-CA-TCGGA-C-CAG-AT--A-ATAGGGATTAAGACAAGTCATC-ATGGCCT-AAT------ACTCCAGTCTACCATATTGGTACGTTGAAAATCCTTTGCGCAGCGATGTACCTGTCTGTGGGCACAGCTAACTCTTATCTTCTAGGCTTCTTGGCGAAAATCAAGAAGCTGTTGGAGACCGTTTGCCACAACTGTGGAAAGATCAAAGCCAACACGGTTAGTCATCCCTTAATGGGATGGCATATCCTAATACTGGCAAATTATGCTGACATTAAAGCAG-----------------------------TCCGATCCCAAGTTCTTAGAAGCCATCCGTATGAGAGATCCGAAGAGGCGCTTTGATCATATCTGGCGACTTTCAAAAGATGTGTCAGTCTGCGACGCTGATCCCCCTGCCGATGAAGACGAGCCA------TATACGAAAGAAGGCGCTAAGCCCGTGAGAGGGCATGGCGGATGTGGTAACTCCCAGCCTACGATCCGAAAAGAGGGAATAACGTTGGTCGGGACGTGGAAACCCAACAAG---AACATGGTGGATGACGATATGGACATGCCGCAGCCG---GAAAAGAAAGTCATCACGCCTCAGATGGCTTTGAATGTTTTCAAGGCTATTTCTTCGGAAGATGTCCGTATTATGGGTTTGAGCAATGATTATGCCCGTCCCGAA------------------------------------------------------TGGATGATAATTACTGTGCTACCCGTTCCTCCTCCTCCTGTTCGCCCTAGCGTCCTCGTCGGTGGCAGCACTAGTG{CG}TCAGCGCGGTGAGGACGATCTAACGTACAAGCTTGCAGAAATCGTTCGTGCCAACCAAAACGTTCAGCGTTGCGAGCAAGAAGGTGCGCCAGAACACGTCGTCCGCGAGTTCGAGTCCTTGTTGCAGTATCATGTCGCTACATACATGGACAACGACATCGCTGGTCAG------CCGAAGGCTATGCAGAAATCAAACAGACCTGTCAAAGCCATTCGCAGTCGTCTAAAGGGTAAAGAGGGCCGCTTGCGACAGAACTTAATGGGAAAGCGTGTCGACTTCTCAGCTCGTACTGTTATCACTGGCGACCCTAATTTGTCACTTGATGAAGTTGGCGTCCCGAAGAGCATTGCAAAGACGCTAACCTACCCGGAAGTTGTTACCCCGTACAACATTGACAAATTGCAACAGCTCGTCATGAATGGCCCCAACGAGCACCCTGGAGCAAGGTACATTATTCGGGACACTGGTGAACGCATTGATCTCCGTCACGCGAAGAGAGCCGGC---GGCCAGCAGCTCCTTTATGGTTGGAAGGTTGAACGGCATCTGATGGATGGTGACGTTATCTTGTTCAATCGGCAACCTTCAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Penicillium_freii_AFTOL_378 --------------------------------------------------------------------------------AAGAGCTCAAATTTGAAAG-CTGGC-TCCTT--CG-GG-GTCCGCATTGTAATTTGCAGAGGATGC-TTCGGGAGCGGTCCC-CATCTAAGTGCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTAT-GGGATGGGGTGTCCGCGCCCGTGTG--AAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGG-GGTTCAGCCGGCATTCGTG-CCGGT-GTAC--T-TCCCCGCGG-G-CGGGCCAGCGTCGGTTTGGGCGGTCGGTCAAAGGCCCTCG-GAAGGTAACGCCC-CT---A-GGG--G-CG-TCTTATAGCCG-AGGGTGCAATGCGACCTGCC-TAGACCGAGG-AACGCG-CTT-CGGCTCGGACGCTGGCATAATGGTCGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTACGCGAGTGTTCGGGTGT-CAAACCC-GTGCGCGAAGTGAAAGCGAACGGAGGT-GGGAACCCTTAC----------GGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCGTAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGCGAATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTGCTTAATTGAACGTGGGCATTAGAATGATGCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCGCCGTCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCATAAAATTCTAAATAGATTAG---ATATAATGACA-TAATCTATTTATAAGTCTTGACCAA-ACTACGTGCCAGCAGTCGCGGTAATACGTAGGAGGCTAGTGTTAGTTATCTTTATTGGGTTTAAAGGGTAAGTAGACGGTAAATTAAACT-CTAAAC---GAGTACTTTTTTACTAGAGTTATATGAGAGAAGG-AAGAATTTCTGGAGTAGAGATAAAATTTGATGATACCAGGAGGACTGTC-AACGGCGAAGGCGTCCTTCTATGTAAT-AACTGACGTTGAGAGACGAAGGCTT--GGGTAGCAAACAGGATTAGATACCCTAATAGTCCAAGCAGACAATGATGAATGTCATACATTAGAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATATTTAATGTATAAACGAAAGTGTAAGCATTCCACCTCAAGAGTACTATGGCAACATATAAACTGAAATCATTAGACCGTTTCTAAAACCAGTAGTGAAGTATGTTATTTAATTCGATGATCCGCGAAA-AACCTTACCACAGCTTGTATAGCATATTATAAAAAATTGTT------------------------------------------------------------------------------------------------------------------------------------------ACAAGCGCTGCATGGCTGTCTTTAGTTAATGTCGTGAGATTT-GGTTAATTCCTTTAATTAACGAAAACCCTCACTTTATTTG---------------------------------------------TTTATATAAAGTGGT-TCGCTACTA-CA-TCGGA--CCAG-AT--A-AAAGGGATTAAGACAAGTCATT-ATGGCCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Phaeoacremonium_chlamydosporum_CBS_229_95 ----------------------------------------------------ATGCCTCAGTAACGGCGAG-{GT}AAGCGGCAAAAGCTCAAATTTGAAAT-CTGGC-TCTTTT-CA-GG-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGCAAGACTTC-GGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCT-TGAACC-GTCTGTCGCGTCCGTGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCTCTTGCAACCAGACTTGTTTCCAACGGTTCAACCGCTGTTTTCA-GTGGC-CTAT--T-CCGTTGGTT---CAGGCCAGCATCGGTTCGAGTGGTTAGTTAAAGACTTTGG-GAATGTATCTACCCCTC-CGGGGG--T-AG-ACTTATAGCCC-TTTGTGTAATGTGACCTACC-TGGACCGAGG-GACGCG-CTTTTTGCTCGGATGCTGGCGTA-TGGTTGTA-GCGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Polyblastia_melaspora_AFTOL_1356 -----------------ATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-CCCCC-TGG-GG-GTCCGAGTTGTAATTTGTAGAGGATGC-TTCGGGCAAGGCTGT-GGTCTAATTTGCTTGGAACAGCGAGTCAGAGAGGGTGAGAGTCCCGTCT-AGGATC-GCAAGCCGCGTCCATGTG--AAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGAGCGTGACGGTTCCCCCGGCCCCCTGG-CCGGG-CTAC--T-CCGTCATGT-C-CAGGCCAGCATCGGTTCGGGTGGTTGGTTAAAGACCCCGG-GAATGTATCTACC-TC---C-GGG--T-CG-ACTTATAGCCC-GGGGTGCAATGCGGCCTACC-CGGACCGAGG-AACGCG-CTC-CGGCTCGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGT-CAAACCC-CTACGCGTAATGAAAGTGAACGGAGGT-AAGAACCCCTCACG--------GGGCGCATTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGTCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTTGGGGTTGAAATGATGCCCCAACGAGTAGGCAGGCGTGGGGGTTTGTGACGAAGCCTCGGGGGTGACCCTGGGTCGAACAACCTCTAGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCGATCAAGCTGGCGGTACCTGTCTACCATTATGGTGATGATTCTCAGCCTTACTCTGCTCAATCACGCTCACTCTGAAACAGGGTTCCTTGGAAAGGTCAAGAAACTTCTGGAGACCGTCTGCCACAATTGCGGGAAGATCAAGGCCGTTGATGTAAGTCTGGACATTCGGTGCAAAAGCTCGTCGCACAATGCTAACGCCTCGTTTGTCAG----------------------------------TCCGAGGAGCTACGATATGCCCACACCGTCCGTAACGGCAAGAAGCGCTTCGAGCTCATCTGGCGGATGAGTCAGAAACAAAACGTCTGTCAAGCCGACAGCCCAGAAGATGAAGATGATCCTATG------------GGAAAGGACAAGAGTGGCAAGATTAGGCATGGTGGTTGTGGGAACGCGCAGCCAGTGATTCGGAAAAGTGGTCTTGAACTTTGGGCACAATACAAACCCCGGAAG------------GGCGATGAGGAGGAGGAGGCTGTGCCT---GAAAAATCGCAGATCTGGCCTGCTCAAGCATTGCAGATATTTCAGCATCTCACCGATGAGACACTCGAGACATTGGGCATGAACCTAGATTTTGCGCGACCGGAA------------------------------------------------------TGGATGATCTTGCAGAGTTTGCCCGTGCCGCCACCCCCTGTCCGACCTAGCATCAGTGTTGATGGCAGTGGACAAGGTTCGCGCGGCGAAGATGATCTGACATTCAAGTTGGGCGATATCATCCGTGCCAACCAGGACCTGATCCGGATCAATGCGGAAGGCGCACCCGATCACATCGCCAAAGAACTCCAAGCATTGCTGCAATACCATGTCGCGACATACATGGATAATGATATTGCCAATCTC------GACAAAGCACAGCACAAGAGCGGCAGACCAATCAAATCGATTCGTGCTCGCTCGAAGGGAAAAGAAGGTCGTCTCCGCCAGAATCTGATGGGCAAGCGAGTCGACTTCTCTGCACGCACCGTCATTACGGGTGACCCAAATCTTTCCCTCGATGAGGTGGGAGTTCCACGAAGCATAGCACGGACTCTGACCTATCCGGAGACCGTCACTCGATTCAACATCTCCAGACTGAAAGAGTTAGTCACTCGAGGGCCTGAAATGCATCCTGGTGCCAGGTACATCATTCGGGAAAACAATGAGCGCATCGACCTTCGCTACCACAAGGACACTGCA---GGAATTGCTCTCAAAGTGGGTTGGAAAGTCGAGCGTCATATCATGGATGGGGATGTCATCCTCTTTAACCGACAGCCGTCGCTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pyrenula_aspistea_AFTOL_623 -----------TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-CCTTC--CG-GG-GTCCGAGTTGTAATTTGTAGAGGATGC-TTCGGGCAACGCTGC-GGTACAAGTCTCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCC-TCAACC-GTGAGCCGCGTCCATGTG--AAGCTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTGGGCGGTGATTCAGCCGTTCTTCTGA-TCGGT-GCAC--T-TTGCCGTCT-C-CAGGCCAGCATCGGTTTGGGCAGCCAGTTAAAGGCCTCGG-GAATGTATCGACC-CTC--CGGGG--T-TG-ACTTATAGCCC-GGGGTGCCATGTGGCTTGCC-TAGACCGAGG-TACGCG-CTC--TGCACGGATGCTGGCGTAATGGCTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGT-CAAACCC-TTGCGCGTAATGAAAGTGAACGGAGGT-AGGAACCCCTTG----------GGGCGCACTATCGACCGATCCTGATGTTCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATACGCGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGATACCACAAAAGGTGTTAGTTCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCTATACCTCGCCGTTAAGGTTTAATGGATA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGAACATGATTACTGGCACCTCTCAAGCTGACTGCGCCATTCTCATTATTGCTGCTGGTACCGGTGAATTTGAAGCTGGTATTTCTAAGGATGGCCAGACCCGCGAGCACGCCCTCCTGGCCTACACTCTCGGTGTCAAGCAGCTCATTGTCGCGATCAACAAGATG------------------------------------------------------GACACTACCAAGTGGTCTGAGGAGCGTTTCAATGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCTTTCGTCCCCATCTCCGGCTTCAATGGTGACAACATGATTGACGTCTCTTCCAACTGCCCATGGTACAAGGGTTGGGAGAAGGAGTCCAAG---------------GCTGGCAAGGCCAGCGGCAAGACCCTGCTTGAGGCCATTGACAACATTGACCCCCCAACTCGTCCTACTGACAAGCCCCTCCGTCTCCCTCTCCAAGATGTCTACAAGATCGGTGGTATCGGCACGGTCCCTGTCGGTCGTGTTGAAACCGGTGTCATCAAGGCTGGTATGGTCGTGACCTTTGCTCCCGCCAACGTCACCACTGAAGTCAAGTCTGTCGAAATGCACCACGAGCAACTTACCGAGGGTGTCCCGGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGCCGGGGGAACGTTGCTGGTGACTCCAAGAACGACCCACCGAAGGGTTGCGACTCGTTCAACGCCCAGGTCATCGTTCTTAACCACCCTGGCCAGGTCGGTGCCGGCTATGCTCCCGTCCTTGACTGCCATACCGCCCACATTGCCTGCAAATTCTCAGAGATCCTTGAGAAGATTGACCGCCGAACCGGCAAGTCCATCGAAAACAACCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCTATGTGTGTTGAA-CCTTCACCGACTACCCACCTCTTGGACGTTTCGCTGTCCGTGACATGCGTCA----------------------------------- Pyrenula_pseudobufonia_AFTOL_387 --------------------------------------------------------------------------------AACAGCTCAAATTTGAAAT-CTGGC-TCCTA--CG-GA-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGCAAGACTGC-GGTTTAAGTCCCTTGGAACAGGGTGTCAGAGAGGGTGAGAATCCCGTCT-TTAACC-GTCCGTCGCGTCTATGTG--AAACTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGGGCAGCAGTTCAGCCGTTATTCTTA-ACGGT-GCAC--T-CTGTTGTTT-C-CAGGCCAGCATCGGTTTAGGTAGCTAGTTAAAGGCTTAGG-GAATGTATCTATC-CTC--CGGGG--T-AG-ACTTATAGCCC-TAGGTGGCATCTGGCTTACC-TGGACCGAGG-AACGCG-CTT-CGGCACGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGT-CAAACCC-CTGCGCGTAATGAAAGTGAACGGAGGT-AGGAGCCCTT------------GGGCGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGC-AATGATTAGCGGCCTTGGGGAAGTAACTTCCTTAACCGATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACCCCACAAAAGGTGTTAGTTCATCCAGACAGCCTGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACAGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGCTACCCATACCTCGCCGTTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCATATAAAGTTCTAGGTATAAAAG---GAATGATGACTAATTTATGTCTATAAGTATTGACCAA-ATTACGTGCCAGCCGTCGCGGTAATACGTAAAATACAAGTGTTATTCATCTTTAATGGGTTTAAAGGGTACCTAGACGGAAGATCAAGCC-ATAAA----AGGGACTAATTTTCTAGAGTTTTATAAGAGAAAG-AAGAACTGTTAGAGGAGAGATGAAATTCTTTGATACTAACAAGACTGGG-AACAGCGAAGGCGTTTTTCTATGTAAA-AACTGACGTTGAGGGACGAAGCCTA--GGGTAACGATAAGGATTAGATACCCTAATAGTCCTAGGAGAAAATTATGAATGCCATAGGCTAGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTTTTGGCCTATAAATGAAAGTGGAAGCATTTCACCTTACAAGTAAAGCGGCAACGCCGAAACTGAAATCATTAGACCGTTACTGAAAACAGTAGTGAAGTATGTTGTATAATTCGATGGTCCGCGAAT-AACCTTACCACAATTTGAATATTATTAAATTATT-------------------------------------------------------------------------------------------------------------------------------------------------ACAAGTGCTGCACGGCTGTCTTCAGCTTATGTCGTGAGATTATGGTTAGATCCATTAATAAGCGAAAACCCTTACTTTAATTAATATTTAAGAGTAATAAAAATATAGATAATATATATCTTATTGTTCGTTAATAGAGTAGT-TCACCGTTA-TA-TTGGT---AAG-AT--A-AGAGGGATTAAGACAAGTCATC-ATGGCCT------------------------------------------------------------TCATATTGAGCTCGCGGTGCCGGTCTACCATCATGGTTTCTTGAAGATGGTGAAGAAAATCCTGGAGACAGTGTGCCATAATTGTGGCAAAGTCAAGGCCATCGAC---------------------------------------------------------------------------------------------GGCGAAGAGCTTCGACTC---GCGAAAGCGATCCCGAACAAGCGGACCCGTTTCGAGAAAGTCTGGCAGCTCAGTAAGAAGCATAGAATCTGTGAAGCTGAT---ATAAGCGAGGAAGGTGATCAAGAGTTT---TCCAAAGAGAAGGGGCCTCCTCGACCGAAACATGGCGGATGTGGCAATGCACAACCTGAGATTCGTCTGAGCGGTCTCAATCTTATGACCTCATGGAAACCAACTAAA------------GATGGGGACAACGAGCCTGTCCAGGCT---GAGACGAGACCTTTGACGCCGCCAACGGCATTGAATATCCTCAGACTTATGAACGACGAGGAGATGGAGGAGATCGGCTTAGACACCAAGAATGCACGACCAGAG------------------------------------------------------TGGATGATCCTGTCGGTTCTGCCTGTGCCACCCCCACCTGTTCGGCCCAGCATCTCAATGGATGGCAGTGGCCAAGGTGCTCGAGGCGAAGATGATCTTACTTTCAAGCTTGGAGATATCGTTCGAGCCAATCAAAATGTTCGCCGAGTACAACAAGAGGGCTCGCCAGAGCACATTCTGAACGAGCATGTTCAACTCTTGCAGTGGCATGTCGCTACATACATGAACAATGACATTGCTGGAATGGATGGTTTGAAGGCACAACACAAGACCGGTCGTCCAATCAAATCCATCCGAGCACGACTAAAGGGTAAGGATGGCCGTTTACGACAAAACCTGATGGGGAAGCGTGTTGACTTCTCTGCACGCACTGTTATCACTGGGGATCCTAATCTTTCTCTCGATGAGGTTGGCGTTCCACGAAGTATCGCCCGAAACCTTACCTATCCAGAAGTTGTCACGCCCTTCAACGTTGACAAGCTCAAGCGGCTTGTCGCCAATGGTCCGACTGAACATCCAGGTGCTCGATTCGTCGTCCGAGACGATGGGACTCGCATTGATTTGCGACATCACAAACGTACGAGT---GAGTTGACACTACAATTTGGTTGGAAAGTTGAGCGACACATCAGCCATGGCGACATCATTCTTTTCAACCGACAGCCATCCTTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pyrgillus_javanicus_AFTOL_342 -----------------ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-CCTTG--CA-GG-GTCCGAGTTGTAATTTGTAGAGGATGC-TTCGGGCAAGGCTGC-GGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAGTCCCGTCT-TTGACC-GTACGCCGCGTCCGTGTG--AAGCTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACCTGTGGGCGGTGATTCAGCCGTTATTTTTA-ACGGT-GCAC--T-TTGCCGTCT-C-CAGGCCAGCATCGGTTCTGGTAGCCAGTTAAAGGCCCCGG-GAATGTATCAACC-CTC--CGGGG--T-TG-ACTTATAGCCC-AGGGTGCCATCTGGCTCACC-GGGACCGAGG-GACGCG-CTC--TGCACGGATGCTGGCGTAATGGCTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGT-GAAACCC-CTGCGCGTAATGAAAGTGAACGGAGGT-AGGAGCCCGTAC----------GGGCGCACTATCGACCGATCCTGATGTTCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGCGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGATACCACAAAAGGTGTTAGTTCATCTAGACAGCCTGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACAGGCCGAATGAACTAGCCCTGAAAATG-AT--CGCTCAAGCGTGTTACCTATACCTCGCCGTTAAAGTTTTAAGGATGCTTTAACGAGTAGGCAGGCGTGGAGGTTTGTGACGAAGCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATAAAGTTCTAGGCATAAAG----GAATGATGACTATTTATTGTCTATAAGTATTGACCAA-ATTACGTGCCAGCAGTCGCGGTAATACGTAGAATACAAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGGAAGTCAAACC-ATAGA----AGGTACTAATTTCCTTGAGTTTTATGTGAGAAAA-AAGAATTATTAGAGGAAAGATAAAATTTTTTGATACTAATAGGACTGGT-AACGGCGAAGGCATTTTTCTGTGTAAA-AACTGACGTTGAGGGACGAAGCCTG--GGGTAACGATAAGGATTAGATACCCTAATAGTCCCAGGAGACAATTATGAATGCCATAGGCTCGTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTTAGCTTATAAATGAAAGTGTAAGCATTTCACCTTACAAGTACAGCGGCAACGCCGAAACTGAAATCATTAGACCGTTACTGAAAACAGTAGTGAAGTATGTTATTTAATTCGATGATCCGCGAAT-AACCTTACCACAATTTGAATAATATGAATATATT-------------------------------------------------------------------------------------------------------------------------------------------------ACAAGTGCTGCACGGCTGTCTTTAGTTAATGTCGTGAGATTTAGGTTAGATCCTATAATTAGCGCAAACCCTTACTATATTTG-----------------------------------------TATATATATATATAGTAGA-TCTCCGTTA-TA-TTGG---AAAG-AT--A-ATAGGGATTAAGACAAGTCATC-ATGGCCT-------------------------------------------------------------------------------------------------TTTATCGGCAAAATCAAGAAACTTCTTGAAATTTGCTGCCACCATTGTGGCAAGATCCTCATGGATGAA---------------------------------------------------------------------------------------------ACCAATCCTGCATTCATTGAAGCTCTAAAGACTAGAGATCGCAAGCGTCGCTTTGACAAGATTTGGACCCTTTGCAAGACGAAAAAGAAATGCGAACGAGACCCTCAGGATGATTCCAACGCTGATGAGAAC---CCCGATCACCCTCTGAAGCCCTCTTCCACTCGAGGCGGGTGCGGAAATGTTGCACCAGACATTAGAAAGGATGGCCTGAAACTTCTTGGTACTTGGAAATATGACAAA---------TCCGAAGAGGAAGACGAAGAACGTCGAATT---GAGAAGAAGTACATAACGCCTCATCAGGCTTTGGAGGCTTTCAATCACATTTCCAGCGAGGATCTTGAGAAGATTGGTCTTGGTAGTGACTATGCCAAACCGACA------------------------------------------------------TGGATGATTCTCACTGTACTTCCTGTTCCACCTCCTCCAGTACGTCCAAGTATCTCCGTCGATGGAACTGGCCAAGGCATGCGTGGTGAAGACGACTTGACATACAAGCTTAGCGACATCATTCGTGCAAACGCCAACGTGAAGAAATGCAAAGGAGAGGGCTCTCCAGGTCACATTGTCGCAGAGTTTGAGACGCTTTTGCAATATCACGTTGCAACTTATATGGACAACGACATTGCAGGCCAG------CCACAGGCGATGCAAAAGTCTGGTCGCCCCATCAAATCCATTCGCTCTCGTCTAAAAGGAAAAGAAGGTCGCTTGCGAGGTAATCTCATGGGAAAGCGTGTCGACTTTTCTGCACGTACTGTCATTACTGGAGATCCCTATCTTGATCTTGATCAAGTCGGCGTGCCTCGAACTATTTGCAAAACTTTGACCTATCCAGAAACGGTGACACCGTACAACATTTCCAAATTGCACGAACTTGTGAGGAACGGACCGAATGAGCATCCAGGTGCCAAGTACGTCATTCGAGACACGGGCGAGAGAATCGATTTACGCCATCATAAACGTGCCTCG---GAGATTACACTGCAATATGGGTGGAAAGTTGAACGCCACCTTATGGATGGAGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Ramichloridium_anceps_AFTOL_659 -----------------ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAT-CTGGC-CTCTT--TG-GG-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGTACCGCCTC-GGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCT-TGGACC-GGTGGTAGGGCCCGTGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGCGCGGTGGTTCCCCTATCCTTTTGG-ATGGG-TTAC--T-CCGCCGCGT-C-CAGGCCAACATCGGTTCTGGGGGTCGGTCAAAGGCCTTGG-GAATGTATCTACC-CTC--CGGGCG-T-AG-ACTTATAGCCC-TTGGTGTCATGCGACCTCCC-GGGACCGAGG-AACGCG-CTT-CGGCTCGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGT-CAAACCCGGAACGCGGAATGAAAGTGAACGGAGGT-AGGAAGCTTC------------GGCTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTCAGGGTTGACATGATGCCCTGACGAGTAGGCAGGCGTGGAGGTCCGTGACGAAGCCTTGGGGGTGACCCTGGGTCGAACGGCCTCTAGTG-----------------------------------------------------------------------------------------------------------------------------------------------------------TGTATAAAATTCTAGATAAAATAA---AGAGTATGACAATTTTTTATCTATAAGTCTTGACCAA-ATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATCTTTAATCGGTTTATAGGGTACCTAGACAGAATACTAAGCC-AAAAT----AGGAACTAGTATTCTAGAGTTTTATGTGGGAATATACGAATTACCGGTGGAAAGATAAAATTTAATTATACTGGTAGGACGGGT-AACGGCAAAGGCGATATTCTATGTAAA-AACTGACGTTGAGGGACGAAGCCTT--GGGTAGCGATAAGGATTTGATACCCTAGTAGTCCAAGGAGACAATTCTGAGTGCCATAAGCTAGAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A-AATTTAGTTTATAAATGAAAGTGTAAGCACTCCACCTCATGACTAAGGCGGAAATGCACAAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTATTTAATTCGATGATCCGCGAAT-AACCTTACCACGCTTTGAATATTAATGCAAATTAAT-----------------------------------------------------------------------------------------------------------------------------------------------ACAAGTGTTGCACGGCTGTCTTCAGTTAATGTCGTGAGATTTTGATTAGCTTCTTTAATTAACGAAAACCCTTTCTTTATTTG-----------------------------------------------TCTTTAAAGAATT-T-TCCTTTA-TT-TAAGG--TTTA-AT--A-ACGGGGACTAAGACAAGTCATC-ATGGCCT----------------------------------------------------------------ATCAAGCTTGCCACCCCCGTCTACCACTACGGGTTCATGACAAAAGTCAAGAAGATTCTGGAGACTGTCTGTCACAACTGTGGCAAGATCAAAGCTCTGGAT---------------------------------------------------------------------------------------------TCTGAAGAACTGCGACAT---GCACTTTCCCTTCGTGACCGAAAGCGACGCTTTGATGCAGTTTGGCGACTCAGCAAACCCCGACTTATTTGCGAGGCAGACCCAGCTGAAGACCAGGAATCC------------GATCCCAAGAAGGGTCCAGTCCAGGTGAAGCATGGCGGCTGTGGTAATGCGCAACCAGAGATTAGGAGACAAGGGCTGCAATTATGGGCCTCGTGGAAACCACGAAAA------------GGCGAAGACGAGGAAGATGCGGCACCT---GAGAAGAGACGGATCTTTCCACAAGACGCCCTCAATACCTTCCGCACCTTGACTGACGAGACTCTTGACATGATGGGCCTTAGCTTGGACTATGCACGACCAGAG------------------------------------------------------TGGATGATTCTCTCCGCTCTTCCTGTACCCCCGCCACCGGTCCGACCTAGCATCAGTGTCGACGGCAGTGGCCAAGGTCAACGTGGTGAAGACGATCTCACTTTCAAACTTGGTGACATTATCCGAGCAAACCAAGCAGTCCTACGAACCGAAGTGGATGGGACTCCCGACCACATCAAGGTTGATCTATGCGATCTTCTTCAGTATCACATCGCCACTTACATGGATAATGAAATTGCAGGCTTG------GACAAAGCACAACACAAGAGCGGTCGACCAATCAAGTCCATTCGAGCTCGACTGAAGGGCAAAGAGGGCAGACTGCGTCAAAATCTCATGGGCAAACGTGTCGACTTCTCGGCCCGTACTGTCATCACTGGGGATCCCAATCTGTCTCTTGATGAAGTTGGTGTACCCCGAAGCATTGCAAGAACGTTGACCTTCCCTGAGACGGTCACACCATTCAACCTCGATAAGCTCAAGCGACTAGTCGCCAATGGCCCTACCGAACATCCTGGTGCACGTTACATCATTCGTGACACTGGTGAACGGATCGATTTGCGACATCATAAACGCACTGGA---GATGTTGTCTTGCAATATGGTTGGAAAGTCGAGCGACACATTCAGGACAGGGATGTCATCCTTTTCAATCGGCAG---------AAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCTATTCTCATCATCGCAGCCGGCACTGGTGAGTTCGAAGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTTCTCGCTTACACCCTTGGTGTGAAGCAACTCATCGTTGCCATCAACAAGATG------------------------------------------------------GACACCACCAAGTGGTCTGAGGATCGTTACAACGAAATCATCAAGGAGACATCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACTGTCCCATTCGTGCCTATCTCTGGCTTCAATGGCGACAACATGATCGACGTCTCCACCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGTCCAAG---------------GCTGGCAAGGCCACTGGCAAGACCCTCCTCGAGGCCATTGACGCCATTGATCCTCCCAGCCGTCCTACCGACAAGGCTCTGCGTCTCCCTCTCCAGGATGTCTACAAGATCTCTGGTATCGGAACGGTTCCCGTTGGCCGTGTTGAGACCGGTGTCATCAAGGCCGGTATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sarcinomyces_petricola_AFTOL_825 ----------------------------------------------------------------CGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-CTTTAC-----G-GTCCGAGTTGTAATTTGGAGAGGATGT-TTTGGGTACCGCCAC-GGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAGTCCCGTCT-TGGACC--GCGGTAGGGCCTGTGTA--AAACTCCTTCGAAGAGTCGACTTGTTTGGGAATGCAGGTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTCGTGCGCGG-GGTTCCCCCTTGC-TTCTGCTTGGG-TCAC--T-TCCCCGTGT-C-CGGGCCATCATCAGTTTCGGGGGCCGGTTAAAGGCCCTGG-GAATGTACCCACG-CCTTCGGGGG--T-GG-ACTTATAGCCC-AGGGTGTCATGCGGCCACCC-GGGACTGAGG-AACGCG-CTT-CGGCGAGGATGATGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGT-CAAACCC-TTGCGCGGAATGAAAGTGAACGGAGGT-AGGAAGGCTTAA----------GCCTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGCGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGAAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCGCCGTCAGGGTTGACATGATGCCCTGACGAGTAGGCAGGCGTGGAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sphinctrina_turbinata_AFTOL_1721 ------------------------------------------CCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGAC-CTCCG-CCG-GG-GTCCGAGTTGTAATTTGTAGAGGCTGT-TTCGGGTACGGTCCC-GGTCTAAGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTGT-GTGACC-GGGGACCACGCCCATGTG--AAACACCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCATGTGAAATTGTTGAAAGGGAAGCGGAAGCAACCAGACTCGCTGCCGGGTGCTCAACCGGGGTTCTCC-CCGGG-GCAC--T-CACCCGGTC-T-CGGGCCAGCATCGGTTCGGACGGCCAGACAAAGGCTCCGG-GAATGTAGCTCCC-TCT--CGGGG--G-AG-TGTTATAGCCC-GGGGTGGCATGTGGCCAGCC-CGGACCGAGG-AACGCG-CGTTTTGCACGGATGCTGGCGTAATGGTTGTTCCCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTATTTGGGTGT-CAAACCC-ACATGCGGAATGAAAGTGAACGGAGGT-GAGAGCTCGCAC----------GGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAACTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAGTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGTAGCTGGTTCCTGTCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCTCTTGTTGCTTAGTTGAACGTGAGCATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGATCGTGTAACAACTCACCGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGCTACCCATACCTCGCCGTCGGGGCAGATACGATGCCCCGACGAGTAGGCAGGCGTGGAGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAATAAAGTTCTAGATAGAACAA---TGATAATGACAATTTTCTATCTATATGTCTTGACTAA-ATCACGTGCCAGCAGTCGCGGTAATACGTGGAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGAGTACTTAGCC-CAAAATTAGAGGTACAAGTAATCTAGAGTTTTATATGAGGAGGGGAGAACTTTTGAAGTAGAGATAAAATTCCGTGATAACAAAAGGACTGGC-AAAGGCGAAAGCGACCTTTTATGTAAA-AACTGACGTTGAGGGACGAAGGCTT--GGGGAGCGATAAGGATTAGATACCCTTGTAGTCCAAGCAGAAAATTATGAATGTCATAGACTTGGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAACTATTTCTATAAATGAAAGTGTAAACATTCCACCTCAAGAGTAATGTGGCAACGCAGAAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTATTTAATTCGATGATCCGCGAAA-AACCTTACCACAATTTGAATATATT----------------------------------------------------------------------------------------------------------------------------------------------------------ACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGTGAGATTTTGGTTAGTTCCATTAATTAACGTAAACCCTTGCTTTATTTA------------------AAATGCGTGTATTTTTGTTACACATTTTCGTCATAAAGCGGC-TCTCCTAAATGT-TTGGG--ATTG-AT--A-ACAGGGACTAAGACAAGTCATC-ATGGCCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Spiromastix_warcupii_AFTOL_430 ACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAT-CTGGC-TCCTT--CG-GG-GCCCGAGTTGTAATTTGCAGAGGATGC-TCCGGGGGTGGTCGC-CGCCTAAGTCCCCTGGAACGGGGCGTCAGAGAGGGTGAGAATCCCGTCT-TTGGTGGGCTGATCGCTCCCGGGTG--AAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGTACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGGCCTTGGGGGCTCACTGAGCATGCTTG-CTTAG-GCAC--T-CCCTCAGGG-T-CGGGTCAGCATCGGTTCAGGCGGTCGGTCAAAGGCCCTCG-GAATGTGTCGCCT-CT---C-GGG--G-CG-TCTTATAGCCG-AGGGTGCAATGCGGCCTGCC-CGGATCGAGG-AACGCG-CTT-CGGCACGGATGCTGGCATAATGGCGGTCAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCCACGCGAGTGTTCGGGTGT-CAAACCC-GTCCGCGCAGTGAAAGCGAACGGAGGT-GAGAGCCCCTGA----------GGGTGCATCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAGGAGCGTGGCTGTGGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGTCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAAGTGAACGGGGACACTGGAATGGATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGAGGGATGAACCTAACGCGAGGTTATGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGCTACCCATACCTCGCCGTCGGGGTAGAAGCGACGCCCCGACGAGTAGGCAGGCGTGGGGGTCCGTGACGAAGCCCTGGG-CGTAGCCCGGGTCGAACGCCC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTCTTGACTAA-ATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTAGTCATCTTAATTAGGTTTAAAGG-TACCTAGACGGTGAATTAAACC-CTAAAA---GGGTATTTATTCACTAGAGTTTTATAGGAGAAGA-GAGAATTTTTGGAGGAGAGATAAAATTTTTTGATACCAAAAGGACTGAT-AACGGCGAAGGCAGTCTTCTATTTAA--AACTGACGTTGAGGGACGAAGGCTT--GGGGAGCAATAAGGATTAGATACCCTAGTAGTCCAAGCAGAAAATTATGAATGCCATAAGTTAGAATTATTAATTATCTAAAAAAAAAATTAGATAAAGTTTCATTTATGAGTATTATAAGTTAGACCTTAGATTTATAACATAAATGAAATCC--------------------------------------------------------------------------------------------------------------------TTTCTGACATATAAATGAAAGTGTAAGCATTCCACCTTAAGAGTATAATGGCAACATTGAAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTATTTAATTCGATGATCCGCGAAG-AATCTTACCACAATTTGTATAATATTTCTATTATAATAGAAGAATCTATAAATCAAAGTCTTATTAAAGATTGTAAGGTTTAAAGATTGTAGACAAAATGTTATTATATAAAAAATAATTTCTTTAATTATGCGGTTATTTTTATATAATAACATGGGGTATTATAATATGTAAATATTACAAGCGTTGCATGGCTGTCTTCAGTTGATGTCGTGAGATATTGGTTAACTCCTTTAATTGACGAAAACCCTAACTTTATTTA---------------------------------------------ATTTTATAAAGTAAC-TAACTAAGA-TA-ATGGT---TTA-AG--A-ATAGGGACTAAGACAAGTCATC-ATGACC?-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCGATCAGAAGTACTTAGATGCGCTCCGTTTCCGTGATCCCAAGAGACGTTTCGACGCCATATGGCGACTGTCTAAAGATGTCCTTATCTGCAAAGCTGATCCGACACCTGACGAAGACGATCCGTAC------TCGAAGGATCCCGTGAAGCCAGTGAGATCTCATGGTGGTTGTGGCAATGCGCAGCCCCAGGTTCGCAAAGAAGGGATTAGCCTTACTGGCACCTGGAAACCGAATAAGATGCGTGACATGATGGATGATACTGATACTCCACAGCCC---GAGAAGCGTCAAATCACGCCGCAGATGGCCTTGAATATATTCAGGAATATATCCGAGGAGGACGTCCGCTTGATGGGACTTAGCAATGACTATGCTCGGCCAGAG------------------------------------------------------TGGATGATCATCACCGTTCTACCCGTACCTCCGCCGCCCGTTCGACCTAGCGTTCTCGTTGGTGGTAGTGGCACCGGCCAGCGTGGTGAGGATGACTTGACGTACAAGCTTGCTGAGATCGTCCGTGCCAACCAGAACGTTACTCGATGCGAACAGGAAGGCTCTCCAGAGCACGTGGTCCGAGAATTCGAGTCGTTGCTGCAGTATCATGTTGCGACGTATATGGATAACGACATTGCTGGACAG------CCAAAGGCTATGCAAAAATCCAACCGCCCTGTTAAAGCGATTCGAGGCCGTCTAAAGGGCAAGGAAGGACGTCTACGACAGAACTTGATGGGAAAGCGTGTCGATTTCTCCGCTCGTACTGTTATTACCGGTGATCCGAATCTGTCTTTGGATGAAGTCGGTGTGCCAATTAGCATTGCGCAGACCCTGACATATCCGGAAGTTGTCACGCCTTACAATATTCACAAGTTGGGAGAACTCGTCGACAATGGCCCCAACGCCCATCCAGGTGCTCGCTACGTGATTCGCAACACCGGTGAGCGTATTGATCTTCGGCATCATAAAAGTGGCGGCGGCAAAAACTTTTTGCAGTACGGATGGCGGGTTGAACGTCACATCGTAGACGGAGATGTGAT-------------------------AAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCCATTCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTTGCCTTCACCCTCGGTGTCCGTCAGCTCATCGTCGCCATCAACAAGATG------------------------------------------------------GACACTGCCCAATGGTCCGAGGCTCGTTACAACGAAATCATCAAGGAGGTCACCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGGGTGTTCCGTTCGTCCCCATCTCTGGTTTCGAGGGTGACAACATGATCGAAGCCTCCACCCGTGTCCCCTGGTACAAGGGTTGGTCCAAGGAGACTCCT---------------GCTGGTAAGGCTTCCGGTAAGACCCTCCTTGAGGCTATCGACGCCATCGACCCCCCTACCCGTCCTACCGACAAGCCTCTCCGCCTCCCTCTCCAGGATGTCTATAAGATCTCTGGTATCGGAACAGTGCCCGTCGGTCGTGTCGAGACTGGTATCATCAAGCCTGGTATGGTCGTGACTTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCGGT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Staurothele_frustulenta_AFTOL_697 -----------------ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC-CCCTC-TCG-GG-GTCCGAGTTGTAATTTGTAGAGGATGC-TTCGGGCAAGGCCGC-GGTCTAATTTGCTTGGAACAGCGGGTCACAGAGGGTGAGAATCCCGTCT-AGGACC-GCGCGTCGCGCCCGTGTG--AAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTGCGCGTGACGGTTCCCCTGGCCTCCTGG-CCGGG-CTAC--T-CCGTCATGT-C-CAGGCCAACATCGGTTCGGGTGGTCGGTCAAAGACCCCGG-GAATGTATCTACC-TC---C-GGG--T-CG-ACTTATAGCCC-GGGGTGTAATGCGGCCCACC-TGGACCGAGG-AACGCG-CTC-CGGCTCGGATGTTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGT-CAAACCC-CTACGCGTAATGAAAGTGAACGGAGGT-AAGAACTCGCCCTTTCGGGGGTGGGCGCATTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGCGCATAGGGGCGAAAGACCAATCGAACCGTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGTCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTCATTGAACGGGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTCAGGGTTGAAATGATGCCCTGACGAGTAGGCAGGCGTGGGGGTTCGTGACGAAGCCTCGGGGGTGACCCCGGGTCGAACAACCTCTAGTG----------------------------------------------------------------------------------------------------------------------------------------------------------GCGTATAAAGTTCTAGATAGAAAAC---TGATAATGACAACTATCTATCTATTAGTCTTGACCAA-ATTACGTGCCAGCAGTCGCGGTAATACGCAGAAGACAAGTGTTATTCATCTTTATTCGGTTTAAAGGGTACCTAGACGGGAAATCAAGCC-ATAGT----AGGGACTAATTTTCTAGAGTTTTATGGGGGAAAG-TCGAATATTGGGAGGAGAGATGGAATATGTTGATACTAGGTGGACTGGT-AACGGTGGAGACAACTTTCTATGTAAA-AACTGACGTTGAGGGACGAAGCCCTCTGGTTAACGATAAGGATTAGATACCCTAATAGTCGGGGGAGACAATGATGAGTGTCATAGGCTAGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATTAGTTTATAAATGAAAGTGCAAGCATTCCACCTCATGACTAAAGCGGCAACGCCCAAATTGAAATCATTAGACCGTTCCTGAAACCAGTACTGAAGTATGCCCCTTAATTCGATGATCCACGAAT-AACCTTACCACGTTTTGAATATTACTAGTGGTTTACCCAATTTAATTTAATAGTAAT--------------------------------------------------------------------------------------------------------------------------ACAAGCGTTGCACGGCTGTCTTTAGTTAATGTCGTGAGATTGTGGTTAATTCCTTCAATTAACGAAAACCCTTATATTATATC---------------------------------------------TATATATAATATAGT-TCTCTACTA-GA-TCGGA--TAAG-AT--A-AGAGGGATTAAGGCAAGTCATCCATGGCCA------------------------------------------------------------AGCCATTAAGTTGGCGGTACCCGTCTACCATTATGGTTTCCTCGGAAAGGTAAAGAAGATTTTGGAGACGGTTTGCCACAACTGTGGTAAGATCAAGGCAGTTGAC---------------------------------------------------------------------------------------------TCCGAAGACCTGCGATAC---GCTCTCTCCGTTCGTGATCGTAAAAAGCGCTTCGAGCTCATTTGGCGTCTCAGTCAAAAACAGAACGTTTGCCAAGCCGACGCTCCTGAGGACGGAGACGACCAGGGT------GCAAAGGACAAAGGTGTCAAAACAAGA---CACGGTGGATGTGGCAATGCACAGCCAGTGATTCGCAAAACCGGTCTTGAACTTTGGGCACAGTACAAACCTCGAAAG------------GGCGATGATGAAGAAGAGTCTGTTCCC---GAGAAATCACAGATCTGGCCAGCGCAGGCACTGCAAGTCTTTCAACATCTCACTGATGAGACGCTGGAGACGCTGGGCCTATCTGTTGATTTTGCTAGGCCTGAA------------------------------------------------------TGGATGATCCTGCAGAGTTTGCCCGTGCCGCCTCCTCCTGTCCGGCCTAGCATCAGCGTCGACGGAAGCGGACAAGGCTCACGAGGCGAAGATGATCTTACTTTCAAGCTGGGAGATATCATCCGTGCAAACCAAAATCTGATCCGTATAAATGCAGAAGGTGCACCTGACCACATTGCCAAGGAACTTCAAGCCTTGCTACAATACCATGTGGCCACTTACATGGACAATGACATCGCCAACCTC------GACAAAGCACAGCACAAGAGTGGTAGGCCCATCAAATCGATACGTGCTCGCTTAAAGGGAAAAGAAGGCCGTCTGCGCCAGAACCTGATGGGCAAGCGAGTCGATTTTTCTGCACGTACGGTCATCACTGGAGATCCGAATCTTTCACTGGATGAGGTAGGTGTTCCTAGGAGCATTGCCCGAACTTTGACATACCCCGAGACTGTGACTCGATTCAATGCGGAAAAGCTGAAGCAACTTGTGGTAAATGGGCCTGAACGACATCCTGGGGCCAGATATATCATCCGTGAACAAGGGGAGCGCATTGATCTCCGTTTCCACAAAAACACCAAC---TCTATCACTCTCAAAGCAGGATGGAAAGTTGAACGACACATAATGGATGGAGACGTCATCCTGTTCAACCGACAACCATCGCTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Wahlenbergiella_mucosa_AFTOL_2264 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATAGCCAAACGGCTGAACCAGCAATTTGGAAGAATGC--------------------------------------------------------------------------------------------------------GTAGCGTGTAAAGTGTGTAAAATTCTAGATATAAAAC---TGATAATGACAGTTATTTATCTATTAGTCTTGACCAA-ATTACGTGCCAGCAGTCGCGGCAATACGTAGAAGACAAGTGTTATTCATCTTTAATCGGTTTAAAGGGTACCTAGACGGAAAATCAAGCC-AAACT----AGGAACTAATTTTCTAGAGTTTTATGGAAAAAAG-TCGAATAACTGGTGTAATGATCAAATACCTTGATACCAGGGAGACGGGT-AACGGCATAAGCAGCTTTTTATGTAAA-AACTGACGTTGAGGGACGAAGCCCT--GGGTAGTGATAGGGATTAGATACCCCAGTAGTCCAGGGAGACAATGATGAGTGCCATAAGCTAGGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATTAGTTTATAAATGAAAGTGCAAGCACTCCACCTTAAGACTAAAGCGGCAACGCCCAAATTGAAATCATTAGACCGTTCCTGAAACCAGTAGTGAAGTATGTTATTTAATTCGATAATCCGCGAAT-AACCTTACCACGTTTTGAATAATATTCAATTAAT-------------------------------------------------------------------------------------------------------------------------------------------------ACAAGCGCTGCACGGCTGTCTTTAGTTAATGTCGTGAGGCTTTGGTTAACTCCTTTAATTAACGAAAACCCTTGTTTTATTTA----------------------------------------------AACATAAAA-TAGT-TCTCCGTTA-TA-TTGGA-C-AAG-AT--A-ACAGGGATTAAGGCAAGTCATC-ATGGCCTTAATAAC-GT----ATCAAATTAGCCGTACCTGTCTACCATTACGGTAATTCATTCGTGATCATTCCTACTCACCCTCTTCTCACGCTTGAGTAGGATTCTTGGCCAAGGTAAAGAAAATCTTGGAGACTGTGTGTCATAACTGTGGCAAGATCAAAGCCGTCGATGTACGTTCCATCTATGTACGTGCTTGCGATGCCTTGCGTTGCTGACATATCCTGCTTTAG---------------------------------TCTGAAGAACTACGATAT---GCCCACTCCGTCCGCGACCGCAAGAAGCGCTTCGAGCTTATCTGGAGGCTGAGCCAAAAGCAGAACATGTGTCAAGCCGACGCGCCCGAAGATGGAGACGAT---------GGCATAGTCAAGGAAAAGGCTGGCAAGATCAAACATGGCGGATGTGGCAACGCACAACCAGCGATTCGCAAAAGCGGCTTGGAGCTCTGGGCTCAGTATAAACCACGAAAG------------GGTGATGATGAGGATGACTTCGTGCCC---GAAAAGTCGCAGATCTGGCCTTCGCAAGCACTACAGGTCTTCCAACATATGTCCGACGAGACCCTCGAGACCCTAGGTCTGAACCTCGATTTTGCCCGACCAGAA------------------------------------------------------TGGATGATCCTGCAGAGTTTGCCTGTGCCCCCCCCTCCTGTCCGGCCAAGTATCAGCGTTGACGGAAGCGGACAAGGCCAGCGAGGCGAGGACGATCTGACTTTCAAGTTGGGGGACATCATTCGTGCCAATCAAAACCTAATCCGCGTGAGTGCCGAGGGTGCACCAGATCACATCGCCAAGGAGCTTCAAGCCTTACTTCAGTACCATGTAGCTACTTACATGGATAATGATATCGCCAATCTC------GACAAGGCGCAGCACAAGAGTGGCAGACCTATCAAATCGATCCGCGCTCGCTTGAAGGGCAAGGAAGGACGCCTTCGCCAGAACTTGATGGGGAAACGGGTTGACTTTTCTGCACGGACAGTCATTACAGGTGATCCCAACCTCTCACTTGATGAGGTCGGGGTCCCAAGGACCATCGCTAGAAATCTAACCTACCCCGAGACCGTGACCAAATTCAATATCGGCCGCCTGTCCCAGCTTGTCGCCAATGGCCCGAATGTACATCCAGGCGCCAAATATGTTATTCGCAAGCAGGGAGACCGCATCGATCTTCGTCACGTAAAGTCTTCTAGA---GGCGTTGAGCTCCAGACAGGAATGAAAGTCGAGCGACATCTTCTAGATGGCGACGTAATTCTCTTCAACCGACAACCG??????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- rock_isolate_A14 -----------------ATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAAT-CTGGC--C-TT--CACGG-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGCAAGGCTTT-GGTTTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAATCCCGTCT-AGAACC-GCCAGCCGCGTCCATGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGTGTAACGGTTCCCCCGGTATTCTTA-CCGGG-CCAT--T-CCGTTATGT-C-CAGGCCAGCATCGGTTTGGGTGGTTGGTTAAAGACCTTGG-GAATGTATCTACC-TT---CGGG---T-CG-ACTTATAGCTC-AGGGTGTAATGCAGCCCACC-TAGACCGAGG-AACGCG-CTT-CGGCTCGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGT-CAAACCC-CTACGCGTAATGAAAGTGAACGGAGGT-AAGAACCCTTTT----------GGGCGCATTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC--------------A-CTA------TAAG-ATACGTC-T---A-GG-TGC--G--CC--AGGT---GGT-TAA----G-CA-----C-G----GT--T---GTTTT-GC-A--GCCGATCAG-T-CCTGT----G-ATGG----GGCAA-CA--CTACT-A-CTGTGAGG---GG----A-T--T--ACGA-G--AC--C-------C-GCAGC------CATT------TT----C--T-GAATG---GTCCACAGACTA-A-A---CGGT-GG-----TG-GCC--AG-CAACGTAA-CG-----CTG--GTAAAT--A--T--ATAGTCG--AACAT-TAG-AA-TGAGGAT-TCAGGGTCAGGCG--CGGGC-T--C------CG-TG--CCG-GCAAAGCTTGCCCCCAATCT-T-A----TAAC-----TAAATGTCGCTGGTAGCTGGTTTCCGTCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTTAAAGTTGAAATGATGCTTTAACGAGTAGGCGGACGTGGGGGTTTGTGACGAAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- rock_isolate_A95 -----------------ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC--CTTT---ACG--GTCCGAGTTGTAATTTGGAGAGGATGT-TTTGGGTACCGCCAC-GGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAGTCCCGTCT-TGGACC--GCGGTAGGG-CC-TGTGTAAAACTCCTTCGAAGAGTCGACTTGTTTGGGAATGCAGGTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTCGTGCG-CGGGGTTCCCCCTTGCTTCTGC-TTGGG-TCACT-T-CCCC-GTGT-C-CGGGCCATCATCAGTTTCGGGGGCCGGTTAAAGGCCCTGG-GAATGTACCCACGCCTT--CGGGG-GTG-G-ACTTATAGCCC-AGGGTGTCATGCGGCCACCC-GGGACTGAGG-AACGCG-CTT-CGGCGAGGATGATGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGT-CAAACCC-TTGCGCGGAATGAAAGTGAACGGAGGT-AGGAAGGCTTAA----------GCCTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGCGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGAAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCGCCGTCAGGGTTGACATGATGCCCTGACGAGTAGGCAGGCGTGGAGGTCCGTGACGAAGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGAAGGTCT?GGAGACCGTCTG?CACAACTGCGGCAAGATCAAGGCTCTCGAC---------------------------------------------------------------------------------------------AACGTGGAGCGACAGGCC---GCCATATCCGCCAGAAATCCCAAGATCAGATTTGAGAAGCTGTGGCGACTGAGCAAACCACGACTCATCTGCGAGCCATCTCCTCCTGCCGATGACGAC------------------AACCTGAAAGGCCCCAAAGGTCCTGACCACGGTGGTTGTGGTAACGTCCAGCCCATGATTCGAAAGAAAGGCCTTGCTCTCGAAGCTCACTATAAGAAAGGCAAG------------AACGAGGACGACGAGGATGTTCAGACC---GAGACCCACCGCATCTATGCGAGACGCGCCCTTCAGATCCTGCAACTGCTGAACGACGACACCCTCAAGATGATGGGTCTCAACAAGGACTACGCAAGACCGGAA------------------------------------------------------TGGTTCATTCTGCAGGCTCTGCCTGTCCCTCCTCCTGCTGTACGTCCCAGTGTCAGCCAGGACGGC---GGCTCGGGCCCCCGCAACGAGGATGATTTGACATACAAACTGGCCGACGTGGTACGCGCCAACCAGTCCGTCACCCGCTGCGAGGTTGAAGGCACTCCCGAGCACATCAAAAACCAACTCGTCGATCTCCTCGAGTACCACATCAACACATACATGGACAACGAAATTGCTGGTCTA------GATCGAGCTCAACATAAGAGTGGTCGTCCCATCAAGGCCATACGCGCCCGTCTGAAGGGTAAGGAGGGTCGACTGAGGCAGAACTTGATGGGCAAGCGTGTGGACTTCTCCGCCCGTACTGTCATCACCGGTGATCCCAACTTGTCCTTGGACGAGGTCGGTGTCCCACGCAGCATCGCCAGGACTTTGACCTTCCCAGAAACCGTCACTAACTTCAACATCGAGCGTCTGAAGAGATGCGTCGCCAATGGTCCAACAGAGTGGCCCGGTGCCAGATATGTCATCCGTGGCTCGGGCGACCGCATAGATCTGCGTCATGCAAAGAAGTCCGGC---GACATCAACCTGCAATATGGTTGGAAAGTCGAGCGTCACT?TCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- rock_isolate_TRN107 --------------------------------------------------GATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGC--C-TT---A-TG-GTCCGAGTTGTAATTTGTAGAGGATGT-TTTGGGTACCGTTGC-AGTTTAATTTTCTTGGAACAGAATGTCAGAGAGGGTGAGAGTCCCGTCT-GGAACT--GCGGTAGGGCCTATGTA--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGAGCGTGGCGGTTCCCCCTTGCTTTTGC-TTGGG-CTAC--T-CCGTCATGT-C-CAGGCCAACATCGGTTCTAGGGGCTGGTTAAAGACTTTAG-GAATGTATCTACCCT----CGGG---T-AG-ACTTATAGCCT-AGAGTGTCATGCAGCCT-CCCGGGACCGAGG-AACGCG-CTT-AGGCGAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGT-CAAACCC-TTACGCGGAATGAAAGTGAACGGAGGT-AAGAAGCCTTAA----------GGCTGCATTATCGACCGGTCCTGAAGTTTACGGATGGATCTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATT-AAAGAAATAGCT-ACCTAGGTGGTTAAGTGTA-GTCATAAGATGGCTGCAAGTGCCCAAGATTCGGGTGCAACACTGTCAAATTGCGGGGACGTCCTAAAGCTTTAGCGACCGCC--TT---TACCTGTCAAAGCA-GGTTCAGGC-ACCAGGTTAATGACCT-TG-GGTATGGTAACACTGCTAAA-GATGTTACAATGGATAATCTGCAGCCAAATCC--TAAGGCCTTCGGGCTATGGAG-GCA-GTTCACAGACTA-A-ATGGCAGTGGGCTCGTTGAGCCTAAGTTA---TAGTCGGTCCTCTGAAG-AAATTCAGGTGCATA--CGCTAA-ATCT-GTAGTTGAGGAT---AGG--C---C-TTTGGGCATAACTATAGACG-TGAACGGTGC--GG---GC-----ATCTCT-AGGGGT-GCCGGATTAAA---CGCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCTCTTGTTGCTTAATTGAACGTGAGCATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGAGAGGTTAAGGTGCCGGAGTGCACGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGTCACCTATACCTCTCCATAACCGTTTACTGGAAGCGATTATGAGTAGGCAGGCGTGGAGGTGCGTGACGA--------------------------------------AATGGCCTAACGGCTGAACCAGCAATTTGGAAGAAT-TAGGTAGATGTGATTATTAATTAATCATCCAGAGCACTGGCCCGAACGTTGTTTATTTTTAGGGAGAAAAGAACAACAAGTAAGCGAGCGATTTATATATATACCTAAACGAGAAATTCGTAGAATGTTCTAGATAAAGAA----TAATAATGACCATT-TTTATCTATAAGTCTTGGCCAA-ATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATCTTTAATCGGTTTAAAGGGTACCTAGACGGAAAATCAAGCC-TTAGT----CGGTACTAATTTTCTAGAGTTTTATGGAAGAATG-TCGAATTTCTAGAGGAGAGTCAAAATTCATTGATACTAGGAAGACGGGT-AACAGCGAAGGCGTCATTCTATGTAAA-AACTGACGTTGAGGAACGAAGCCTT--GGGTAGCGATAAGGATTAGATACCCTAGTAGTCCAAGGAGAAAATAATGAGTGCCATAGACTAGTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATTTTAGTTTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAAAGCGGCAACGCCGAAATTGAAATCATTAGACCGTGTCTGAAACCAGTAGTGAAGTATGTTATTTAATTCGATAATCCGCGAAT-AACCTTACCACGTTTTGAATATTTTATTTTTAATATCTT--------------------------------------------------------------------------------------------------------------------------------------------ACAAGCGCTGCACGGCTGTCTTCAGTTAATGTCGTGAGATTTTGGTTCGTTCCTTTAATTAACGAAATCCCCTGTTTTAATTT--------------------------------------------CTATTTAAAGC-AACT-TA-CCGCTA-GATTTGG----TAG-GT-CA-AGAGGGAACAAGACAAGTCACC-ATGGCCTTAATAAC-G------------------------------------------------------------------------------------TGGCTTTTTGACCAAAGTCAAGAAGATTCTCGAGACTGTCTGTCACAATTGTGGCAAAATCAAGGCTACAGAAGTGAGACGAGTCCAGTATTCTTCGATTGTTCACCGCGCTAACATTTTCACAG-----------------------------------------ACTCCAGAGTTGAAAGCT---GCCTTCAGAGCCCGAAGCCGAAAAGACCGATTCGAGAGAGTGTGGAAGTTGAGCAAGGGTATCTACACCTGTGAAGCTGATCCTCCTGAGGATGAAGAT------------GGCCAGAACAAGGAACCAGAGAAGGCCATCAAGCATGGCGGTTGTGGCAATGAACAACCCCAGATCCGAAAGGCTGCTCTGAAGCTCAATGCTGTGTGGCGAAAGAAGAAG------------GGCGCAGATGATGAGCCAGCTGCAGCTCGCGATACTGAGCGAATCTGGCCTTCCGATGCTCTGAACGTCTTCAAGCTCCTCACCGATGACACCCTGGAGAAGCTTGGCCTCAATGCTGACTTCGCTCGTCCCGAA------------------------------------------------------TGGATGATCCTCACTGCACTTCCCGTCCCACCTCCTCCCGTCAGACCCAGCATCAGCGTTGATGGCAGTGGTCAAGGTCAGCGTGGTGAAGATGATCTGACGTTCAAGTTGGGCGACATCATAAGAGCCAACCAAGCAGTTCTGCGTTGCGAGGTTGATGGTACACCTGATCACATCAAGAGCGATCTTCTGGATCTGCTGCAATATCACATCGCCACTTACATGGACAATGATATTGCTGGCCTT------GATCGTGCTCAGCACAAGAGTGGACGTCCCATCAAGTCAATTCGAGCTCGTCTAAAGGGCAAGGAGGGTCGTCTTCGTCAGAACCTGATGGGCAAGCGTGTTGACTTTTCTGCTCGAACGGTCATCACAGGTGACCCCAATCTGTCTCTCGATGAAGTCGGTGTTCCCAGAAGCATTGCTCGCACCCTCACATACCCTGTCAAGGTCACCGAATGGAATCGTGACAGGCTCAGCGAGTACGTCAGGAATGGTCCGGATACGCACCCTGGTGCTCGCTATGTCATTCGAGATGATGGCGAGAAGATCAACTTGCGCCACACGAAAGGCGAGATC---------ACTCTTCAGGTCGGCTGGACTGTCGAGAGACACATCCAAGACGGCGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- rock_isolate_TRN214 --------------------------------------------------GATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAT-CTGGCTTCTTT---G-GA-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGCACCGCAAC-GGCTTAAATTTCTTGGAACAGAATGTCAGAGAGGGTGAGAGTCCCGTCT-GGAGTC--GCGGTAGGGCCCATGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGTCTGCGGAGGTTCCCCCTTGCTTCTGC-TTGGG-CTAC--T-CC-T-TCGTACGCAGGCCAACATCGGTTTTGGCGGTCGGTTAAAGGCTTTGG-GAATGTACCTTCC-TC---CGGG---A-AG-ACTTATAGCCC-AGAGTGTCATGCGGCCTGCC-GGGACCGAGG-AACGCG-CTT-CGGCTCGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGT-CAAACCC-TTGCGCGGAATGAAAGTGAACGGAGGT-AGGAAGCCTTTT----------GGCTGCACTATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACTATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTCACTTAATTGGACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGAGAGGTTAAGGTGCCGGAGTGCACGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGTCACCCATACCTCTCCGTGGGCGTTGACTGGACGCGTCCACGAGTAGGCAGGCGTGGAGGTGCGTGACGAAGC--------------------------------------AGCCGAAAGGCTGAACCAGCAACTTGGAAGAATG--------------------------------------------------------------------------------------------------------AATAACGAATAAGTCGTATAAAATTCTAAATAAAAAG----TGATAGTGACAATT-TTTATTTATAAGTCTTGACCAA-ATTACGTGCCAGCAGTCGCGGTAACACGCAGAAGACTAGTGTTATTCATCTTTATTAGGTATAAAGGGTACCTAGACGGATTATCAAGCC-AAATGA---AGGGACTAATTTTCTAGAGTTTTATGGAAGAATA-TCGAATTGCTGGAGGAAAGTCAACATTTTTTGATACCAGTGAGACGGAC-AACTGCGAAGGCGTTATTCTATGTAAACAACTGACGTTGAGGGACGAAGCCTG--GGGGAGCGATAAGGATTAGATACCCTAGTAGTCCCAGGAGAAAATAATGAGTGTTATAGACTAGATTTGAAACAGTGAATTTAAGCTAGCTTGATTAAATTTAATTTAGCTTACCTTGGTATGTGTTAAGCTTTATCAATAGCACTAAGGTTTAAGGCCATGAGTGCGTATGTAAGCATTATTATTAAGTATAATGTTTAACGGCACTTGACTGTTTATATAAATATGACAGCTCTCCCAAAGGGGAGAATTCACTACTAA----------TATTAGTTTATAAATGAAAGTGCAAGCATTCCACCTCATGAGTAAAGCGGCAACGCCGGAATTGAAATCATTAGACCGTGTCTGAAACCAGTAGTGAAGTATGTTATTTAATTCGATAACCCGCGAAT-AACCTTACCACGTTTTGAATATTTTT---------------------------------------------------------------------------------------------------------------------------------------------------------ACAAGCGCTGCACGGCTGTCTTCAGTTAATGTCGTGAGATTTTGGTTAGTTCCATTAATTAACGAAAGCCCTTATTTTTTTTA---------------------------------------------TATCAAAAAAATATTTTCGCCGTTA-CA-TTGG---TTAGAAT--A-ATAGG-ACCAAGACAAGTCATC-ATGGCCTTAATAA-------------------------------------------------------------------------------------TATGGCTTCATGAACAAAGTCAAGAAGATTCTTGAGACTGTCTGT?A?AGTTGTGGCAAGATCAAGGCCGCCAACGTGAATTCAAACACCCCGCTCATGACTTTCGCAGTACTGACTTGCTCTTCCAG----------------------------------------GACGAAGCATACAGACAA---GCCATTGAGACCCGAAGACCGCGCGATCGATTCGAGAAAGTCTGGGCTCTCAGCAAGCCTCGACTCGTTTGCGAAGCTGATGCCAAGGACGACGATGAC------------GCTCCGAAGAAAGAGAAAGACACAAAGCCCCTTCACGGCGGATGCGGCAATGTGCAGCCCAAGATCAGAAAGGCAGGATTGCAGCTATGGGGAACCTATGAAGCTCGCAAG------------GGTGAAGACGACGAAGATGCAGAGCCT---ACGAACAAGAGACTCTTCGCCTCAGATGCACTTCACGTCTTCAATCTCCTCACTGAAGAAACCCTCGAACTGCTGGGCCTGAATGCCGACTACGCTCGTCCCGAA------------------------------------------------------TGGATGATCCTACAGTCTCTTCCTGTACCGCCGCCTCCGGTTCGACCCAGCATCAGCGTTGATGGAAGTGGTCAAGGTCAGCGTGGTGAAGACGATCTCACCTTCAAGTTGGGCGACATTGTGCGAGCCAACCAAGCAGTCACTCGCACCGAAGTCGATGGCACTCCTGATCACATCAAGATCGACCTGTGGGACTTGCTTCAATATCACATTGCCACCTACATGGACAACGACATTGCTGGCTTG------GATCGTGCGCAACACAAGAGCGGTCGTGCAATCAAGTCCATTCGAGCTCGACTGAAGGGTAAAGAGGGTCGACTTCGTCAAAACTTGATGGGCAAGCGCGTGGATTTCTCTGCACGTACAGTCATCACTGGTGATCCCAACCTCTCACTCGACGAGGTTGGTGTTCCTCGCAGCATCGCCCGCAATTTGACCTTCCCTGAGAAAGTCACACCTTTCAACGTTGACAAGCTCAAGGCGCTTGTGAAGAATGGTCCGACCGAGCACCCTGGTGCACGATATGTCATTCGAGATACTGGCGAGCGGATTGATCTTCGACACTTCAAAGGCTTCGAC---AACATGGCTCTGCAGTATGGCTGGACCGTCGAGCGACACATCCAAGATGGCGATGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- rock_isolate_TRN242 --------------------------------------------------GATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAAT-CTGGC--C-TT--CACGG-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGCAAGGCTCT-GGTTTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAGTCCCGTCT-AGAACC-GATGGCCGCGTCCATGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGCGTGTAGCGGTTCCCCCAGTCTTCTGA-CTGGG-CTAT--T-CCGTTATAT-C-CAGGCCAGCATCGGTTCGGGTGGTCGGTCAAAGGCCTTGG-GAATGTATCTACC-TT---CGGG---T-CG-ACTTATAGCCC-AGGGTGTAATGCGGCCTACC-TGGACCGAGG-AACGCG-CTT-CGGCTCGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGT-CAAACCC-TTGCGCGTAATGAAAGTGAACGGAGGT-AAGAACCCTTAA----------GGGCGCATTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCT---GAA----CCAACCTA-----CT--G-----G-------ATGG-T-C-AGTACC--AG-TCC---T-C-------TCA-----C-GGGA-G-------G-----GCGA-CG----TT-GATATC-GT----GC--GG----GG--A--GGGCT----ACCTATG---T--GG---------T--A-G--G---C--C-GAT--TC-GCAGCCG---CC--T------TT--AACAATAGAG-GCAGGTCCACAGACTAGATAT--CGGC-GGC-C---G-GC---AGTC--C-T-G-CG-----CTG----------A----C-----CG----------GTA--TGA-GATAT-AG---C---CGTTTAGGC----CT-----CGTTG--T--TG---AG---GC--------T-TGA-AGGT--C------AAA------GGGTAGCTGGTTCCTGTCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATATACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCTATACCTCGCCGTTAGAGTTGTAATGATGCTCTAACGAGTAGGCAGGCGTGGGGGTTTGTGACGAAGC-----------------------------------AATAGCCTAACGGCTGAACCAGCAACTTGGAAGAATG--------------------------------------------------------------------------------------------------------AAAAACGAATAAGTCGTATAAAGTTCTAGATAGAAAAA---TGATAATGACAATATACTATCTATAAGTCTTGACCAA-ATTACGTGCCAGCAGTCGCGGTAACACGTAGAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGGAAATCAAGCC-ATAAT----AGGGACTAATTTTCTAGAGTTTTATGTGAGAAGGGGCGAATTTCCGGAGGAAAGTTGATATTTTGTGATACCGGAAGGACGGGT-AACGGCGAAGGCAACCTTCTATGTAAA-AACTGACGTTGAGGGACGAAGCCTT--GGGTAACGAGAAGGATTAGATACCCTAGTAGTCCTTGGAGACAATTATGAATGCCATAGGTTAGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATTTTGGCCTATAAATGAAAGTGCAAGCATTCCACCTCATGAGTAAAGCGGCAACGCCCAAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTATTTAATTCGATGATCCGCGAAT-AACCTTACCACGCATTGAATATTATTCAATTATT-------------------------------------------------------------------------------------------------------------------------------------------------ACAAGCGCTGCACGGCTGTCTTCAGTTAATGTCGTGAGATTTTGGTTCGTTCCATAAATTAACGAAAACCCTTGCTTTATTTA---------------------------------------------TTTTTATAAAGTAGT-TCTCCGTTA-TA-TTGGA--TAAG-TT--A-AAAGGGACTAAGACAAGTCATC-ATGGCCTAAATAGC-G----------------------------------------------------------------------------------TACGGATTCATGACCAAGGTCAAGAAGATCCTGGAGACTGTGTGCC????CTGTGGCAAAATCAAAGCTACTGATGTTAGTCCACTTGTTCAAAGTGCATCTCTACAATTCGTATGCTAACATGCTTATCTCAG----------------------------------TCGGAGGATCTGCGACAT---GCCTTGTCAGTCCGCGATCGAAAGAGACGATTCGAAATGATCTGGCGCCTTAGCAAGCCCAAGCTCATCTGTGAAGCCGACCCTCCAGCTGAAGACGAAGAAGGTGGA---TTTGCCAAAGAAAAAGGAGCTCCACAAGCACTTCATGGAGGCTGTGGCAATGCACAGCCGGAAATTCGCAAGTCAGAGCTGAAGCTTTGGGCCTCGTGGAAACCAAGAAAA------------GGCGAAGATGAAGAAGATACGGTTGCC---GACAAGCAGCGCCTCTTTCCAGAAGAAGCTCTGAGGATTCTCAAACTTCTTTCTGACGAGACACTCGAAACCCTTGGCATGAACCTTGACTTTGCTCGACCAGAA------------------------------------------------------TGGATGATCCTCCAAGCTTTGCCAGTTCCTCCCCCACCTGTCAGACCGAGTATCAGTGTTGATGGTAGCGGACAAGGATCGCGTGGTGAAGATGATCTCACATTCAAGCTTGCAGACATCGTTCGAGCCAACCAGCAAGTCACACGGGCCGAGGCCGACGGTACGCCGGATCACATCAAAATCGACCACAAAGACCTCCTCCAGTACCATATTGCTACCTATATGGACAATAACATTGCTGGTCTT------AGTCCTTCACAACACAAGAGTGGAAGACCGATCAAATCGATCCGTGCTCGGCTAAAGGGAAAGGAAGGCCGTCTGCGCCAGAATCTCATGGGCAAGCGTGTGGATTTTTCTGCGCGTACAGTCATCACTGGTGATCCGAATCTCTCCTTGGACGAAGTTGGTGTTCCCAAAAGCATTGCAAGAAATTTGACATATCCCGAGACTGTCACGCCATTCAATCTGGATAAGCTGAAGAAGCTTGTTGCAAATGGTCCCAACGAACATCCTGGAGCTAGATATGTCATCCGTGACAATGGGGAGCGCCTCGATCTCAAGTATCACAAACGTGCTGGA---GAGATAACCTTGCAGTACGGCTGGAAGGTTGAGCGGCACATTGTCGATGGTGATGTC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- rock_isolate_TRN475 --------------------------------------------------GATTACCTCAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAAT-CTGGC-TCTTT--CA-GG-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGCACGGTTAC-GGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAGTCCCGTCT-TGAACC-GATTACTTCGTCCATGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGTAATCAGACTTGAGCTTAACAGTTCCCCCTTCGTTCTCG-TTGGG-TTAT--T-CTGTTTTGT-C-CAGGCCAACATCAGTTCGGGTGGTTGGTTAAAGACTTTAG-GAATGTATCTACCCCT---CGGGG--T-CG-ACTTATAGCCT-AGAGTGTCATGCAGCCTACC-TGGACTGAGG-AACGCG-CTT-CGGCTCGGATGTTGGCGTAATGGTTATAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCAAGTCTTTGAGTGG-AAAACTC-GCAGGCGTAATGAAAGTGAACGGAGGT-AAGAAGCCTTTA----------GGCTGCATTATCGACCGATCTTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCATGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGAGTGAAACACTCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCTATACCTCGCCATTAGAGTTGAAATTATGCTCTAATGAGTAGGCATGCGTGGGGGTTTGTGACGAAGC-----------------------------------AATAGCCTAACGGCTGAACCAGCAACTTGGAAGAATGT--------------------------------------------------------------------------------------------------------ATAATGAATAAGTCATATAAAGTTCTAGGTAAAAGAA---TGATAATGACAATTTTTTATCTATAAGTCTTGGCCAA-ATTACGTGCCAGCAGCCGCGGTAATACGTAGAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGGAAATAAAGCC-TTAAC----GGGGACTAATTTTCTAGAGTTTAATAGGAGAAAG-TCGAATTACTGGAGAAGTGTCAAAATATTATTATACTAGTAGGACGGAC-AACGGCGAAGGCTACTTTCTATCTAAA-AACTGACGTTGAGGGACGAAGCCTT--GGGTAGCAATAAGGATTTGATACCCTAGTAGTCCTTGGAGACAATTATGAGTGTCATAGGTTAAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATATAATATAACCTATAAATGAAAGTGTAAGCACTCCACCTCATGAGTAAAGCGGCAACGCCGAAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTATTTAATTCGATAATCCGCGAAT-AACCTTACCACGCCTTGTATAATATTAATTTATT-------------------------------------------------------------------------------------------------------------------------------------------------ACAAGCGCTGCACGGCTGTCTTCAGTTAATGTCGTGAGATCCTGGTTAGTTCCTTCAATTAACGAAAACCCTTGTTTTATTTG---------------------------------------------TTTTTATAAAACAGT-TCACCGCTA-TA-TTGGAG--AAG-AT--A-ATAGGGACTAAGACAAGTCATC-ATGGCCTTAATGGC-G----------------------------------------------------------------------------------------------------------AAGATCCTCGAGACTGTTTGCCACAATTGTGGTAAAATTAAAGCTACTGATGTAAGACCATTCCTTCAAGGGATGCCTCTTCATCTTGCAATGCTGACCTGAGAACTAAACAG-------------------------------TCCGAGGAGCTGCGAGTA---GCACTCAAATCTCGAGACCCGAAACGAAGATTCGATGCGATCCATAAGCTGAGCAGAACAAAGTTCATCTGCGAAGCTGATCCTCCTGAAGATGCAGAAGCTGGCTTC------AATCCCAAAGGAGTACCGGCTGTC---AAGCACGGTGGATGTGGTAATGCGCAGCCGAAGATTCGACGCACAGGTCTCCAGCTGTGGGCCGTATGGGACGCGAGAAAG---------------GGCGAAGATGAGGAAGACACAACCGCAGAAAAGAAGCGCATATTCCCCCAAGACGCATTGAATACCTTCCGAACCTTGACCGACGAGACCATTGCAACAATGGGCCTGAATGCCAAGTTTGCGCATCCTGAA------------------------------------------------------TGGATGATCCTCTCAGCTCTTCCAGTTCCTCCTCCTGCAGTGCGACCATCTATCAGTGTTGATGGAAGTGGGCAAGGCTCTCGCGGCGAAGACGATCTGACCTTCAAGCTGGGCGATATCATTCGAGCGAATCAGGCAGTCCTGCGCACCGAAGTCGACGGCACTCCTGATCACATCAAGGTTGATCTATGCGATCTCTTGCAGTACCACATTGCTACGTATATGGACAATGATATTGCTGGACTT------GACAAGGCACAACATAAGAGTGGTCGTCCGATTAAATCCATTCGAGCTCGATTAAAGGGTAAAGAAGGTCGTCTGCGACAGAACTTGATGGGCAAGCGTGTCGATTTTTCAGCTCGTACAGTCATCACTGGCGATCCCAACTTGTCTCTGGATGAAGTCGGTGTCCCGCGTAGTATCGCGCGCACCTTGACATACCCTGAGACAGTGACACCATTCAACATTCAGAAGCTGGCTCGACTTGTCGCTAACGGTCCTACCGAGCATCCTGGTGCTCGATATGTCATTCGAGACACTGGCGAGCGCATTGATCTTCGACACCACAAGCGTGCAGGC---GAGATGACCTTGCAATATGGCTGGAAGGTCGAGCGACACATTCAGGATGGGGACGTC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- rock_isolate_TRN488 -----------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATTCTGGC-TCTTT--CA-GG-GTCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGCACGGTTAC-GGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAGTCCCGTCT-TGAACC-GATTACTTCGTCCATGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGAGCTTAACGGTTCCCCCTTCGTTCTCG-ATGGG-TTAT--T-CCGTTTTGT-C-CAGGCCAACATCAGTTCGGGTGGTTAGTTAAAGACTTTAG-GAATGTATCTACCCTC---CGGGG--T-CG-ACTTATAGCCT-AGGGTGTCATGTAGCCTACC-TGGACTGAGG-AACGCG-CTT-CGGCTCGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTTTTAGAGTTT-CAAACTC-TGAGGCGTAATGAAAGTGAACGGAGGT-AAGAAGCCTTTA----------GGCTGCATTATCGACCGATCTTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCATGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGAGAGCAATTCTCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCTATACCTCGCCATTAGAGTTGAAATTATGCTCTAATGAGTAGGCATGCGTGGGGGTTTGTGACGAAGC-----------------------------------AATAGCCTAACGGCTGAACCAGCAACTTGGAAGAATGT--------------------------------------------------------------------------------------------------------ATAATGAATAAGTCATATAAAGTTCTAGATAAGAGAA---AGATAATGACAAATTTTTATCTATAAGTCTTGGCCAA-ATTACGTGCCAGCAGCCGCGGTAATACGTAAAAGACTAGTGTTATTCATCTTTATTGGGTTTAAAGGGTACCTAGACGGAAAATAAAGCC-ATAAC----TGGAACTAATTTTCTAGAGTTTAATAGGAGAAAG-TTGAATTACTGGAGAAGAGTCAAAATATTATTATACTAGTAGGACGGAC-AACGGCGAAGGCTACTTTCTATCTAAA-AACTGACGTTGAGGGACGAAGCCTT--GGGTAGCAATAAGGATTTGATACCCTAGTAGTCCTTGGAGACAATTATGAGTGTCATAGGTTTAAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTATATTTAGTTAAACCTATAAATGAAAATGTAAGCACTCCACCTCATGAGTAAAGCGGCAACGCCGAAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTATTTAATTCGATAATCCGCGAAT-AACCTTACCACGCCTTGTATAATATTTAATTATT-------------------------------------------------------------------------------------------------------------------------------------------------ACAAGCGCTGCACGGCTGTCTTCAGTTAATGTCGTGAGATTATGGTTAGTTCCTTCAATTAACGAAAACCCTTGTTTTATTTA---------------------------------------------TTATTATAAAACAGT-TCACCACTA-TA-TTGGAG--AAG-AT--A-ATAGGGACTAAGACAAGTCATC-ATGGCCTTAATGGC-G------------------------------------------------------------------------------------------------CAAGGTCAAGAAGATTCTCGAGACGGTTTGCCACAACTGTGGTAAAATCAAGGCTACTGATGTAAGACATCCCTCACAGGATGCCATTTCATTGTGCCGTGCTGACAGAGAATGAAACAG----------------------------------TCCGAGGAGCTGCGTGTA---GCACTCAAATCTCGTGACCCAAAGCGACGTTTCGATGCAATCTGGAAGTTGAGTAAACCCAAGCTCATCTGCGAAGCCGATCCTCCCGAAGATGCAGATGCTAGCTTC---------AATCCCAAAGGTCCACAGCTGCCAAAGCATGGCGGGTGTGGCAACGCGCAGCCGAAGATTCGACGAACAGGTCTCCAACTGTGGGCTTCGTGGGATGCACGTAAA------------GGCGAGGACGAGGAGGATACAACTCCA---GAAAAGAAGCGCATCTTCCCACAGGATGCACTGAACACCTTTCGAACGTTGACTGACGAGACTATCGAGACCATGGGCCTGAATGCAAACTTTGCGCACCCCGAA------------------------------------------------------TGGATGATTCTCTCAGCCCTGCCAGTCCCACCACCGGCTGTGCGACCCTCAATCAGTGTCGATGGTAGCGGACAAGGCTCTCGTGGTGAGGACGACTTGACTTTTAAGTTGGGCGACATCATTCGTGCGAATCAGGCTGTTCTCCGTACCGAAGTTGATGGCACTCCAGAGCATATCAAGGTTGATCTCTGCGATCTTCTACAGTACCACATCGCCACGTACATGGACAACGATATCGCTGGACTT------GACAAGGCGCAACACAAGAGCGGCCGTCCGATCAAGTCGATCCGAGCTCGACTCAAGGGAAAGGAAGGTCGTCTGCGACAGAACCTGATGGGTAAGCGCGTGGACTTCTCGGCTCGTACCGTTATCACTGGCGATCCAAACTTGTCCCTGGACGAAGTCGGTGTCCCGCGTAGTATCGCGCGCACCTTGACTTATCCAGAAACTGTGACACCTTTCAATATCCAGAAGTTGGCTCGTCTCGTCGCCAACGGTCCCACTGAGCATCCTGGCGCAAGATATGTCATTCGAGACACTGGAGAGCGCATTGATCTACGACACCACAAGCGCGCAGGC---GAGATGACGCTGCAATACGGTTGGAAGGTCGAGCGACATATCCAAGACGGCGATGTC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- rock_isolate_TRN508 -----------------ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAT-CTGGC----TT--C--G--GCCCGAGTTGTAATTTGTAGAGGATGT-TTCGGGCACCGCCCC-GGCGTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCT-GG--CGTCGTGGTAGGGCCCATGTG--AAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTGAGCCCGTCGGTTCCCCCTCGCTTCTGC-GTGGG-CTAC--T-CCGGCGGGT-C-CAGGCCAACATCGGTTCGGGTGGCTGGTCAAAGGCCCTGG-GAATGTATCTCGCCTC---CGGG--CT-TG-ACTTATAGCCC-AGGGTGTCATGCGGCCTACC-CGGACCGAGG-AACGCG-CTT-CGGCTCGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCGAAGAGCTATGCGAGTGTTTGGGTGT-CAAACCC-GTACGCGTAATGAAAGTGAACGGAGGT-AGGAAGCTTC------------GGCTGCACTATCGACCGATCCTGATGTTCTCGGATGGATTTGAGTAAGAGCATAACTCTCCGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATA-GCAGTAA-CGTT--TTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGACTGCACGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCGACCTATACCTCGCCGTCAGGGTTGACATGATGCCCTGACGAGTAGGCAGGCGTGGAGGTTTGTGACGAAGC-----------------------------------AATGGTCTAACGACTGAACCAGCAATTTGGAAGAACGT--------------------------------------------------------------------------------------------------------ATAATGAATGTATTATTTAAAGTTCTAGATAAAATAT---TTATAATGACTATTTTTTATCTATAAGTCTTGGCCAA-ATTACGTGCCAGCAGTCGCGGTAATACGTAAAAGACGAGTGTTATTCATCTTTAATCGGTTTAAAGGGTACCTAGACGGAAAATCAAGCTTAATTAAACTAAGGACTAATTTTCTAGAGTTTGACATGAGAAGGTACGAACTATCAGAGGAGAGATAAAATTTGTTGATACTGGTGGGACGGAC-AACGGCGAAGGCAATCTTCTA-CTAAA-AACTGACGTTGAGGGACGAAGCCTT--GGGGAGCGAGAAGGATTAGATACCCTAGTAGTCCTTGGAGAAAATTATGAGTGCCATAGGCTAAAGTGAAACAAGTCTCTTAAGTGTTCAATTTCTAAATAAAAAAAAAAAGTAGCTAAGAGATTTAAAA---------------------------------------------------------------------------------------------------------------------------------------------TAGCAGCCTATAAATGAAAGTGTAAGCATTCCACCTCATGACTAAAGCGGCAACGCCCAAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTATTTAATTCGATAACCCGCGAAT-AACCTTACCACGTTTTGAATTTTTAA---------------------------------------------------------------------------------------------------------------------------------------------------------ACAAGTGTTGCACGGCTGTCTTCAGTTAATGTCGTGAGATTTTGGTTTGTTCCATTAATTAACGAAAACCCTTGTTTCATTTT----------------------------------------------TAAATGAAA-TAGT-TCCCCGCTA-TA-TTGGA---AAG-AT--A-AAAGGGATCAAGACAAGTCATC-ATGGCCTTAATAAC-G-----------------------------------------------------------------------------------ATGGTTTCATGACAAAGGTCAAGAAGATTTTGGAGACGGTCTGCCACAATTGTGGCAAAATCAAGGCGCTTGATGTCAGTACACCTTACCAGGATGTTCTGTCATAAGTTACAGTGCTGACTATCTCACACAG----------------------------------TCCGAAGATTTGCGACAC---GCTCTTTCCATCCGTGACCGCAAGCGACGGTTTGATGCAGTCTGGCGCTTGAGCAAGCCTAGGAACATTTGCGAAGCAGATCCTCCCGAAGACCCT---------------GAAGCTCCAGCCAAAGGTGCTCCTGCTGTGCGGCACGGTGGATGCGGCAATGCGCAGCCAGATATTCGAAGAACAGGCCTCCAACTGTGGGCTTCCTGGAAACCGAAGAAA------------GGTGAAGATGATGAAGACATCACTCCA---GACAAGAAGCGTATCTTCCCCCAGGATGCACTGAATACCTTTCGTTTACTCACAGATGAGACACTGGAAGCGATGGGCTTAAGCTTGGATTATGCTCGACCCGAG------------------------------------------------------TGGATGATTCTGCAAGCTTTGCCAGTCCCACCTCCCCCTGTTCGTCCGAGTATCAGCGTTGATGGTAGTGGTCAAGGACAGCACAGTGAAGACGATCTCACCTTCAAGCTCGGCGACATTATTCGTGCCAACCAAGCTGTACTACGTACTGAGGTCGATGGTACTCCTGATCACATCAAGGTTGATCTTTGTGACCTTCTTCAATACCATATTGCAACCTACATGGACAACGACATTGCAGGCTTG------GATAAAGCACAGCACAAGAGTGGTAGACCAATCAAGTCGATTCGGGCTCGCCTCAAGGGCAAGGAAGGACGTCTTCGACAAAACCTGATGGGCAAACGTGTCGACTTCTCTGCACGTACCGTGATCACTGGTGATCCGAACTTGTCCCTGGACGAAGTCGGAGTCCCACGAAGTATTGCCCGAACGCTGACATATCCTGAAATCGTGACGCCTTTTAATATTGACAAGCTCAAGAGACTGGTTGCGAATGGTCCAACAGAACACCCAGGAGCTCGCTACGTCATTCGTGATACTGGTGAACGTATCGATTTGAGACACCACAAGCGCGCTGGC---GAGATGAAGGTGCAATATGGTTGGAGAGTCGAGCGACACATACAGGATGGTGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ ; END; BEGIN SETS; CHARSET RPB1C1 (CHARACTERS = Eurotiomycetes_Fig._11) = 3403 3406 3409 3412 3415 3418 3421 3424 3427 3430 3433 3436 3439 3442 3445 3448 3451 3454 3457 3460 3922 3925 3928 3931 3934 3937 3463 3466 3469 3472 3475 3478 3481 3484 3487 3490 3493 3940 3943 3496 3499 3502 3946 3949 3505 3508 3952 3511 3955 3958 3961 3514 3517 3520 3523 3964 3967 3526 3970 3529 3532 3535 3538 3973 3976 3541 3544 3979 3982 3547 3985 3550 3988 3991 3994 3553 3556 3559 3997 4000 3562 3565 4003 4006 3568 3571 3574 4009 4012 4015 3577 3580 3583 4018 4021 4024 3586 3589 3592 4027 4030 4033 3595 3598 3601 4036 4039 4042 3604 4045 3607 4048 3610 3613 3616 4051 4054 4057 4060 4063 3619 3622 3625 3628 3631 3634 3637 3640 3643 3646 3649 3652 3655 3658 4066 4069 4072 4075 4078 4081 4084 4087 4090 4093 4096 4099 4102 4105 4108 4111 4114 3661 3664 3667 3670 3673 3676 4117 4120 4123 4126 3679 4129 3682 4132 3685 3688 3691 3694 3697 3700 3703 4135 4138 4141 3706 3709 4144 3712 4147 4150 4153 3715 3718 3721 3724 4156 4159 3727 4162 4165 4168 3730 3733 3736 4171 4174 3739 3742 3745 4177 4180 4183 3748 4186 3751 4189 3754 3757 3760 4192 4195 4198 3763 3766 4201 4204 3769 3772 3775 4207 4210 4213 3778 3781 4216 4219 3784 4222 4225 3787 3790 4228 4231 4234 3793 3796 4237 3799 4240 3802 3805 3808 4243 4246 4249 4252 3811 3814 3817 3820 3823 3826 3829 3832 3835 3838 3841 4255 4258 4261 4264 4267 4270 4273 4276 4279 4282 4285 4288 4291 4294 4297 3844 3847 3850 3853 3856 3859 3862 3865 3868 3871 4300 4303 4306 4309 4312 3874 3877 3880 4315 4318 3883 4321 4324 4327 4330 3886 3889 3892 3895 3898 4333 4336 4339 3901 3904 4342 3907 3910 3913 4345 4348 4351 3916 3919 4354 4357 4360 4363 4366 4369 4372 4375 4378 4477 4480 4483 4381 4384 4486 4489 4387 4390 4393 4492 4495 4396 4399 4402 4498 4501 4504 4405 4507 4408 4411 4414 4510 4513 4516 4417 4420 4423 4426 4429 4432 4435 4438 4441 4444 4447 4450 4453 4456 4459 4462 4465 4468 4471 4474; CHARSET MSSU (CHARACTERS = Eurotiomycetes_Fig._11) = 1899-3402; CHARSET EFC2 (CHARACTERS = Eurotiomycetes_Fig._11) = 5017 5572 5575 5578 5581 5584 5587 5590 5593 5596 5599 5602 5605 5608 4519 4522 4525 4528 4531 4534 4537 4540 4543 4546 4549 4552 4555 4558 4561 4564 4567 4570 4573 4576 4579 4582 4585 4588 4591 4594 4597 4600 4603 4606 4609 4612 4615 4618 4621 4624 4627 4630 4633 4636 5020 4639 4642 4645 4648 4651 4654 4657 4660 4663 4666 4669 4672 4675 4678 4681 4684 4687 4690 4693 4696 4699 4702 4705 4708 4711 4714 4717 4720 4723 4726 4729 4732 4735 4738 4741 4744 4747 4750 4753 4756 4759 4762 4765 4768 4771 4774 4777 4780 4783 4786 4789 4792 4795 4798 4801 4804 5023 4807 4810 4813 4816 4819 4822 4825 4828 4831 4834 5026 4837 4840 5029 4843 4846 4849 5032 4852 4855 4858 5035 4861 4864 4867 4870 5038 4873 4876 4879 4882 4885 4888 4891 4894 4897 5041 4900 4903 5044 4906 4909 5047 4912 4915 5050 4918 4921 5053 4924 4927 5056 4930 4933 5059 4936 4939 5062 4942 4945 5065 4948 4951 4954 4957 4960 4963 4966 4969 4972 4975 4978 4981 4984 4987 4990 4993 5068 4996 4999 5002 5005 5071 5008 5074 5011 5014 5077 5080 5083 5086 5089 5092 5095 5098 5101 5104 5107 5110 5113 5116 5119 5122 5125 5128 5131 5134 5137 5140 5143 5146 5149 5152 5155 5158 5161 5164 5167 5170 5173 5176 5179 5182 5185 5188 5191 5194 5197 5200 5203 5206 5209 5212 5215 5218 5221 5224 5227 5230 5233 5236 5239 5242 5245 5248 5251 5254 5257 5260 5263 5266 5269 5272 5275 5278 5281 5284 5287 5290 5293 5296 5299 5302 5305 5308 5311 5314 5317 5320 5323 5326 5329 5332 5335 5338 5341 5344 5347 5350 5353 5356 5359 5362 5365 5368 5371 5374 5377 5380 5383 5386 5389 5392 5395 5398 5401 5404 5407 5410 5413 5416 5419 5422 5425 5428 5431 5434 5437 5440 5443 5446 5449 5452 5455 5458 5461 5464 5467 5470 5473 5476 5479 5482 5485 5488 5491 5494 5497 5500 5503 5506 5509 5512 5515 5518 5521 5524 5527 5530 5533 5536 5539 5542 5545 5548 5551 5554 5557 5560 5563 5566 5569; CHARSET LSU (CHARACTERS = Eurotiomycetes_Fig._11) = 1-1898; CHARSET EFC1 (CHARACTERS = Eurotiomycetes_Fig._11) = 4518 4521 4524 4527 4530 4533 4536 4539 4542 4545 4548 4551 4554 4557 4560 4563 4566 4569 4572 4575 4578 4581 4584 4587 4590 4593 4596 4599 4602 5031 5034 4605 4608 4611 4614 4617 4620 4623 5037 5040 4626 5043 5046 4629 4632 4635 5049 5052 4638 5055 5058 5061 4641 4644 4647 4650 5064 5067 4653 5070 5073 4656 4659 4662 4665 4668 4671 4674 4677 4680 5076 5079 5082 5085 4683 4686 4689 4692 5088 5091 5094 5097 4695 4698 5100 4701 5103 4704 5106 4707 5109 5112 5115 4710 4713 4716 5118 5121 4719 4722 5124 5127 4725 4728 4731 5130 5133 5136 4734 5139 4737 4740 5142 5145 4743 4746 4749 5148 5151 5154 5157 5160 5163 5166 5169 5172 5175 5178 4752 4755 4758 4761 4764 4767 4770 4773 4776 4779 4782 4785 4788 4791 4794 4797 4800 5181 5184 5187 5190 5193 5196 5199 5202 4803 4806 4809 4812 4815 4818 5205 5208 4821 4824 4827 4830 5211 5214 4833 5217 4836 4839 4842 5220 5223 4845 5226 4848 5229 4851 5232 5235 4854 4857 4860 5238 5241 5244 4863 5247 4866 5250 4869 4872 4875 5253 5256 5259 4878 4881 5262 5265 4884 4887 5268 5271 4890 4893 5274 5277 4896 5280 4899 5283 4902 5286 4905 4908 4911 5289 5292 5295 5298 4914 4917 5301 4920 5304 4923 5307 4926 5310 5313 5316 4929 4932 4935 5319 4938 5322 4941 5325 5328 5331 4944 4947 4950 5334 5337 5340 5343 5346 5349 5352 5355 5358 4953 4956 4959 4962 4965 4968 4971 4974 4977 4980 4983 4986 4989 4992 5361 5364 5367 5370 5373 5376 4995 4998 5001 5379 5382 5004 5007 5010 5013 5385 5388 5391 5394 5397 5016 5019 5022 5400 5403 5025 5028 5406 5409 5412 5415 5418 5421 5424 5427 5430 5433 5436 5439 5442 5445 5448 5451 5454 5586 5457 5460 5589 5592 5595 5463 5466 5598 5469 5601 5472 5475 5478 5604 5607 5610 5481 5484 5487 5490 5493 5496 5499 5502 5505 5508 5511 5514 5517 5520 5523 5526 5529 5532 5535 5538 5541 5544 5547 5550 5553 5556 5559 5562 5565 5568 5571 5574 5577 5580 5583; CHARSET RPB1C3 (CHARACTERS = Eurotiomycetes_Fig._11) = 3405 3408 3411 3414 3417 3420 3423 3426 3429 3432 3435 3438 3441 3444 3447 3450 3453 3456 3459 3462 3465 3468 3471 3474 3477 3480 3483 3486 3489 3492 3495 3498 3501 3504 3507 3510 3513 3516 3519 3522 3525 3528 3531 3534 3537 3540 3543 3546 3549 3552 3555 3558 3561 3564 3567 3570 3573 3576 3579 3582 3585 3588 3591 3594 3597 3600 3603 3606 3609 3612 3615 3618 3621 3624 3627 3630 3633 3636 3639 3642 3645 3648 3651 3654 3657 3660 3663 3666 3669 3672 3675 3678 3681 3684 3687 3690 3693 3696 3699 3702 3705 3708 3711 3714 3717 3720 3918 3921 3924 3723 3726 3729 3732 3927 3930 3735 3933 3936 3738 3741 3744 3939 3942 3747 3945 3948 3750 3753 3756 3951 3954 3759 3957 3960 3963 3762 3765 3768 3966 3771 3969 3774 3777 3780 3783 3786 3789 3792 3795 3798 3801 3804 3807 3810 3813 3816 3819 3822 3825 3828 3831 3834 3837 3840 3843 3846 3849 3852 3855 3858 3861 3864 3867 3870 3873 3876 3879 3882 3885 3888 3891 3894 3897 3900 3903 3906 3909 3912 3915 3972 3975 3978 3981 3984 3987 3990 3993 3996 3999 4002 4005 4008 4011 4014 4017 4020 4023 4026 4029 4032 4035 4038 4041 4044 4047 4050 4053 4056 4059 4062 4065 4473 4068 4071 4074 4077 4476 4479 4482 4080 4083 4086 4089 4092 4095 4098 4101 4104 4107 4110 4113 4116 4119 4122 4125 4128 4131 4134 4137 4140 4143 4146 4149 4152 4155 4158 4161 4164 4167 4170 4173 4176 4179 4182 4185 4188 4191 4194 4197 4200 4203 4206 4209 4212 4215 4218 4221 4224 4227 4230 4233 4236 4239 4242 4245 4248 4251 4254 4257 4260 4263 4266 4269 4272 4275 4278 4281 4284 4287 4290 4293 4296 4299 4302 4305 4308 4311 4314 4317 4320 4323 4326 4329 4332 4335 4338 4341 4344 4347 4350 4353 4356 4359 4362 4365 4368 4371 4374 4377 4380 4383 4386 4389 4392 4395 4398 4401 4404 4407 4410 4413 4416 4419 4422 4425 4428 4431 4434 4437 4440 4443 4446 4449 4452 4455 4458 4461 4464 4467 4470 4485 4488 4491 4494 4497 4500 4503 4506 4509 4512 4515; CHARSET RPB1C2 (CHARACTERS = Eurotiomycetes_Fig._11) = 3404 3407 3410 3413 3416 3419 3422 3425 3428 3431 3434 3437 3440 3443 3446 3449 3452 3455 3458 3461 3464 3467 3470 3473 3476 3479 3482 3485 3488 3491 3494 3497 3500 3503 3506 3509 3512 3515 3518 3521 3524 3527 3530 3533 3536 3539 3542 3545 3548 3551 3554 3557 3560 3563 3566 3569 3572 3575 3578 3581 3584 3587 3590 3593 3596 3599 3602 3605 3608 3611 3614 3617 3620 3623 3626 3629 3632 3635 3638 3641 3644 3647 3650 3653 3656 3659 3662 3665 3668 3671 3674 3677 3680 3683 3686 3689 3929 3932 3935 3938 3941 3944 3947 3950 3692 3695 3698 3701 3704 3707 3710 3713 3716 3719 3722 3725 3728 3731 3734 3737 3740 3743 3746 3749 3752 3755 3758 3761 3764 3767 3770 3773 3776 3779 3782 3785 3788 3791 3794 3797 3800 3803 3806 3809 3812 3815 3818 3821 3824 3827 3830 3833 3836 3839 3842 3845 3848 3851 3854 3857 3860 3863 3866 3869 3872 3875 3878 3881 3884 3887 3890 3893 3896 3899 3902 3905 3908 3911 3914 3917 3920 3923 3926 3953 3956 3959 3962 3965 3968 3971 3974 3977 3980 3983 3986 3989 3992 3995 3998 4001 4004 4007 4010 4013 4016 4019 4022 4025 4028 4031 4034 4037 4040 4043 4046 4049 4052 4055 4058 4061 4064 4067 4070 4073 4076 4079 4082 4085 4088 4091 4094 4097 4100 4103 4106 4109 4112 4115 4118 4121 4124 4127 4130 4133 4136 4139 4142 4145 4148 4151 4154 4157 4160 4163 4166 4169 4172 4175 4178 4181 4184 4187 4190 4193 4196 4199 4202 4205 4208 4211 4214 4217 4220 4223 4226 4229 4232 4235 4238 4241 4244 4247 4250 4253 4256 4259 4262 4265 4268 4271 4274 4277 4280 4283 4286 4289 4292 4295 4298 4301 4304 4307 4310 4313 4316 4319 4322 4325 4328 4331 4334 4337 4340 4343 4346 4349 4352 4355 4358 4361 4364 4367 4370 4373 4376 4379 4382 4385 4388 4391 4394 4397 4400 4403 4406 4409 4412 4415 4418 4421 4424 4427 4430 4433 4436 4439 4442 4445 4448 4451 4454 4457 4460 4463 4466 4469 4484 4487 4490 4493 4496 4472 4475 4478 4481 4499 4502 4505 4508 4511 4514 4517; CHARSET EFC3 (CHARACTERS = Eurotiomycetes_Fig._11) = 5027 5582 5585 5588 5591 5594 5597 5600 5603 5606 5609 4520 4523 4526 4529 4532 4535 4538 4541 4544 4547 4550 4553 4556 4559 4562 4565 4568 4571 4574 4577 4580 4583 4586 4589 4592 4595 4598 4601 4604 4607 4610 4613 4616 4619 4622 4625 4628 4631 4634 4637 4640 4643 4646 4649 4652 4655 4658 4661 4664 4667 4670 4673 4676 4679 4682 4685 4688 4691 4694 4697 4700 4703 4706 4709 4712 4715 4718 4721 4724 4727 4730 4733 4736 4739 4742 4745 4748 4751 4754 4757 4760 4763 4766 4769 4772 4775 4778 4781 4784 4787 4790 4793 4796 4799 4802 4805 4808 4811 4814 4817 4820 4823 4826 4829 4832 4835 4838 4841 4844 4847 4850 4853 4856 4859 4862 4865 4868 4871 4874 4877 4880 4883 4886 4889 4892 4895 4898 4901 4904 4907 4910 4913 4916 4919 4922 4925 4928 4931 4934 4937 4940 4943 4946 4949 4952 4955 4958 4961 4964 4967 4970 4973 4976 4979 4982 4985 4988 4991 4994 4997 5000 5003 5006 5009 5012 5015 5018 5021 5024 5030 5033 5036 5039 5042 5045 5048 5051 5054 5057 5060 5063 5066 5069 5072 5075 5078 5081 5084 5087 5090 5093 5096 5099 5102 5105 5108 5111 5114 5117 5120 5123 5126 5129 5132 5135 5138 5141 5144 5147 5150 5153 5156 5159 5162 5165 5168 5171 5174 5177 5180 5183 5186 5189 5192 5195 5198 5201 5204 5207 5210 5213 5216 5219 5222 5225 5228 5231 5234 5237 5240 5243 5246 5249 5252 5255 5258 5261 5264 5267 5270 5273 5276 5279 5282 5285 5288 5291 5294 5297 5300 5303 5306 5309 5312 5315 5318 5321 5324 5327 5330 5333 5336 5339 5342 5345 5348 5351 5354 5357 5360 5363 5366 5369 5372 5375 5378 5381 5384 5387 5390 5393 5396 5399 5402 5405 5408 5411 5414 5417 5420 5423 5426 5429 5432 5435 5438 5441 5444 5447 5450 5453 5456 5459 5462 5465 5468 5471 5474 5477 5480 5483 5486 5489 5492 5495 5498 5501 5504 5507 5510 5513 5516 5519 5522 5525 5528 5531 5534 5537 5540 5543 5546 5549 5552 5555 5558 5561 5564 5567 5570 5573 5576 5579; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = Eurotiomycetes_Fig._11) = N: 1-5610; CODONPOSSET * CodonPositions (CHARACTERS = Eurotiomycetes_Fig._11) = N: 1-5610; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4752] TITLE Eurotiomycetes_Fig._1; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1242; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Agonimia_sp_AFTOL_684 CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGCAAGGCTGCAGTCTAATTTGCTTGGAACAGCAAGTCACAGAGGGTGAGAGTCCCGTCTAGGACCGCGAGTCGCGTCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGAGCGACGGTTCCCCCGGCCCTCGGGCGGGCTACTCTGTCGTCTCCAGGCCAGCATCGGTTTGGGTGGTCGGTCAAAGACTCCGGGAATGTATCTACCTTCGGGTCGACTTATAGCCCGGGGTGCAATGCGGCCCACCCAGACCGAGGAACGCGC-TTCGGCCCGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCC-TACGCGTAATGAAAGTGAACGGAGGTAAGAGCCCCCTAGGCGCATTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCGTCTGGTAGCTGGTTCCTGTCGAAGTTTCCCTCAGGAT-AGCAGT-AACGAATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTT Capronia_munkii_AFTOL_656 CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCACCGCTCCGGTTTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAACCCCGTCTTGGACCGGCAGTAGGGCCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCGGCGGTTCCCCCTTCCTTCTG-TGGGTTATTCCGCCGTGTCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGGCCCGGGGAATGTATCTACCCTGGCGTAGACTTATAGCCCCGGGTGTCATGCGACCTCCCGGGACCGAGGAACGCGC-TTCGGCTCGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGGAATGAAAGTGAACGGAGGTAGGAAGCTTC-GGCTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGAT-AGCAGT-AACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCTATACCTCGCCGTC Capronia_pilosella_AFTOL_657 CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTACCGCTCCGGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACCGGTGGTAGGGCCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGCGCGCGGCGGTTCCCCCTTCCTTTTG-TGGGTTACTCCGCCGTGTCCAGGCCAATATCGGTTTTGGGGGTCGGTCAAAGGCGTTGGGAATGTACCTACCCTGGCGTAGACTTATAGCCCAGCGTGTCATGCGACCTCCCGGGACCGAGGAACGCGC-TTCGGCTCGGATATTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAACTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGTAATGAAAGTGAACGGAGGTAGGAAGCCTTTGGCTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAATTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGAT-AGCAGT-AACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTC Ceramothyrium_carniolicum_AFTOL_1063 CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCCGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGCCACGACCCCGGGTTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAACCCCGTCTTGACCCGGGCGTACGAGCCGTGTGGAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTGAGCGCGACGGTTCCCCCTTGCTTCTG-TGGGTTATTCCGTCGTGTCCAGGCCAACATCGGTTTCGGGGGTTGGTTAAAGGCTTAGGGAATGTATCTACCCCGGGGTCGACTTATAGCCCTAGGTGTCATGCGACCTCCCGGGACCGAGGAACGCGC-TTCGGCTCGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCT-TACGCGGAATGAAAGTGAACGG-GGTAGGAAGCCTTAGGCTGCACTATCGACCGATCCTGAAGTTTACAGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGCGTATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGAT-AGCAGT-AACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTC Cyphellophora_laciniata_AFTOL_1033 CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTGGTCCGAGTTGTAATTTGGAGAGGATGTTTCGGGTACGGTCCGGGCTTATATTTCTTGGAACAGAATGTCATAGAGGGTGAGAATCCCGTCTGGAGCTC-GGACACGGCCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGCATGTCGGGGTTCCCCCTTGCTTTTG-TGGGTTACTCCCCGGCGTTCAGGCCAACATCGGTTTCGGGGGTTGGTTAAAGGCCCTAGGAATGTACTTACCCTGGGGTAAACTTATAGCCTAGGGTGTCATGCGACCTCCCGGGACCGAGGAACGCGC-TTCGGCTCGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCT-TACGCGGAATGAAAGTGAACGGAGGTAGGAAGCCGTTGGCTGCACTATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGAT-AGCAGT-AACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTCACTTAATTGGACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGAGAGGTTAAGGTGCCGGAGTGCACGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGTCACCTATACCTCTCCGTC Dermatocarpon_miniatum_AFTOL_91 CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGCAAGGCCGCGGTCTAATTTGCTTGGAACAGCAAGTCACAGAGGGTGAGAGTCCCGTCTAGGGCCGTGGGCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGTGGGTGACGGTTCCCCCGGTCTTCTG-CGGGCTATTCCGTCACGTCCAGGCCAGCATCGGTTTGGGTGGCCGGTGAAAGACCCCGGGAATGTATCTACCTCCGGGTCGACTTATAGCCCGGGGTGCAATGCGGCCCACCCGGACCGAGGAACGCGC-TTCGGCCCGGATGCTGGCGTAATGGTCCCAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCCATGCGAGTGTTTGGGCGTCAAACCCC-GACGCGCAATGAAAGTGAAGGGAGGTAAGAACCCCGCGGGCGCATTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGTCGAAGTTTCCCTCAGGATAAGCAGTAAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTACAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTTCTTGACTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTC Dolabra_nepheliae_CBS_122119 ------AAGCGGCAACAGCTCAAATTTGAAATCTGGCTCGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAATGCGGGGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGGGTCCTTTGCAGCGCCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGTTGGGCGCGGTTCTCCCGCGGTTCTC-TGGTGTATTCCGT-GTCCACAGGCCAGCATCAGTTTTGGCGGTTAGTTAAAGACCTGGGGAATGTACCTACGCCGGGGTAGACTTATAGCCCCGGGTGCAATGTGACCCGCCGAGACTGAGGTACGCGC-ATCTGCTCGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTTAAACCCT-TACGCGGAATGAAAGTGAACGGAGGTAGGATCCCGCAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGAT-AGCAGT-AACGAAATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACTCGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGTCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGACCGAATGCATTGGCCCTGAAAATGGATGGCGCTCAAGCGAGTTACCTATACCTCACCGTT Dolabra_nepheliae_CBS_122120 ------AAGCGGCAACAGCTCAAATTTGAAATCTGGCTCGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAATGCGGGGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGGGTCCTTTGCAGCGCCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGTTGGGCGCGGTTCTCCCACGGTTCTC-TGGTGTATTCCGT-GTCCACAGGCCAGCATCAGTTTGGGCGGTTAGTTAAAGACCTGGGGAATGTACCTACGCCGGGGTAGACTTATAGCCCCGGGTGCAATGTGACCCGCCGAGACTGAGGTACGCGC-ATCTGCTCGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTTAAACCCT-TACGCGGAATGAAAGTGAACGGAGGTAGGATCCCGCAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGAT-AGCAGT-AACGAAATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACTCGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGTCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGACCGAATGCATTGGCCCTGAAAATGGATGGCGCTCAAGCGAGTTACCTATACCTCACCGTT Dolabra_nepheliae_CBS_123297 ------AAGCGGCAACAGCTCAAATTTGAAATCTGGCTCGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAATGCGGGGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGGGTCCTTTGCAGCGCCTATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGTTGGGCGCGGTTCTCCCACGGTTCTC-TGGTGTATTCCGT-GTCCACAGGCCAGCATCAGTTTGGGCGGTTAGTTAAAGACCTGGGGAATGTACCTACGCCGGGGTAGACTTATAGCCCCGGGTGCAATGTGACCCGCCGAGACTGAGGTACGCGC-ATCTGCTCGGATGCTGGCGTAATGGTTGTCAGCGACCCGT?????????????????????????????????????????????????????????-????????????????????GGAGGTAGGATCCCGCAGGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGAT-AGCAGT-AACGAAATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACTCGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGTCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGACCGAATGCATTGGCCCTGAAAATGGATGGCGCTCAAGCGAGTTACCTATACCTCACCGTT Endocarpon_pallidulum_AFTOL_661 CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGCCTGAGTTGTAATTTGCAGAGGATGCTTCGGGCAAGGCGGTGGTCTAATCTGCTTGGAACAGCAAGTCGAAGAGGGTGAGAATCCCGTCTAGGATCGTCAGCCGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGACGGACGGTTCCCCCGACCTTCTG-CGGGTTACTCCGTCACGTCCAGGCCAACATCGGTTTGGGTGGTCGGTTAAAGACCCCGGGAATGTATCTACCTTCGGGTCGACTTATAGCCCGGGGTGCAATGCGGCCCACCCGGACCGAGGAACGCGC-TCCGGCTCGGATGTTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTGTGCGAGTGTTTGGGTGTGAAACCCC-TACGCGGAATGAAAGTGAACGGAGGTAAGAACCCCGTGGGCGCATTATCGACCGATCCTGGTGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCATGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGTGCATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGTCGAAGTTTCCCTCAGGAT-AGCAGT-AACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGCAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGACATTTGAATGCATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTT Endophyte_422 ----------------AACTCAAATTTGAAATCTGGCCTGGCCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTACCGCCTCGGTTTAAATTTCTTGGAACAGAATGTCAGAGAGGGTGAGAATCCCGTCTTGGACCGGCGGTAGGGCCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGAGCGCGGCGGTTCCCCCTTCCTTTTG-TGGGTTACTCCGCCGTGTCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGGCCTGGGGAATGTATCTACTCCGGGGTAGACTTATAGCCCCGGGTGTCATGCGACCACCTAGGACCGAGGAACGCGC-TTCGGCTCGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGGAATGAAAGTGAACGGAGGTAGGAAGCCTTTGGCTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGAT-AGCAGT-AACGAAATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTGCTTAATTGAACGTGGGCATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCTATACCTCGCCGTT Endophyte_4466 ------------------------TTTGAAATCTGGCTCGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAACGTTTCGGTTTAAATTCCTTGGAACAGGATGTCATAGAGGGTGAGAGTCCCGTCTTGAACCGTATACCGCGTCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGTTTAACGGTTCCATCACTGTTCTC-TGGTCTATTCCGTTATATCCAGGCCAGCATCGGTTCGGGTGGTTAGTTAAAGGCCTTGGGAATGTATCTACCC--GGGTCGACTTATAGCCCTTGGTGTAATGTGACCTACCTGGACCGAGGCACGCGC-ATCTGCTCGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCC-TACGCGTAATGAAAGTGAACGGAGGTAAGAACCCGCAGGGTGCATTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGAT-AGCAGT-AACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGTCCGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACGGACCGAATGCATTGGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCTATACCTCGCCGTT Exophiala_dermatitidis_AFTOL_668 CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCACCGCTCCGGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAACCCCGTCTTGGACCGGCAGTAGGGCCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCGGCGGTTCCCCCTTCCTTTTG-TGGGTTATTCCGCCGTGTCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGGCCTGGGGAATGTATCTACCCTGGCGTAGACTTATAGCCCCGGGTGTCATGCGACCTCCCGGGACCGAGGAACGCGC-TTCGGCTCGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGGAATGAAAGTGAACGGAGGTAGGAAGCTTC-GGCTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGAT-AGCAGT-AACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTC Granulopyrenis_seawardi_AFTOL_612 CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGAGACTACGGTTTAAATTCCTTGGAACAGGATATCATAGAGGGTGAGAGTCCCGTCTTGAACCGTCTGTCGAGTCCATGTGAAACTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGGGCAGTGATTCAGCCGTTCTTCTG-CGGTGTACTTTGCTGTTTCCAGGCCAGCATCGGTTTGGGTGGTCAGTTAAAGGCTCCGGGAATGTATCTACCCTGGGGTAGACTTATAGCCCGGGGTGACATCTGGCCTACCTAGACCGAGGTACGCGC-TTCGGCACGGATGCTGGCATAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTAGGGTGTCAAACCCT-TACGCGTAATGAAAGTGAACGGAGGTAGGAACCTTTTAGGTGCACTATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGAT-AGCAGT-AACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGATACCACAAAAGGTGTTAGTTCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACACACCGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTT Phaeoacremonium_chlamydosporum_CBS_229_95 GCGAG{GT}AAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGACTTCGGTTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGAACCGTCTGTCGCGTCCGTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCTCTTGCAACCAGACTTGTTTCCAACGGTTCAACCGCTGTTTTC-TGGCCTATTCCGTTG-GTTCAGGCCAGCATCGGTTCGAGTGGTTAGTTAAAGACTTTGGGAATGTATCTACCCCGGGGTAGACTTATAGCCCTTTGTGTAATGTGACCTACCTGGACCGAGGGACGCGCTTTTTGCTCGGATGCTGGCGTA-TGGTTGTA-GCGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pyrenula_aspistea_AFTOL_623 CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGCAACGCTGCGGTACAAGTCTCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTCAACCGTGAGCCGCGTCCATGTGAAGCTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTGGGCGGTGATTCAGCCGTTCTTCTG-CGGTGCACTTTGCCGTCTCCAGGCCAGCATCGGTTTGGGCAGCCAGTTAAAGGCCTCGGGAATGTATCGACCCTGGGGTTGACTTATAGCCCGGGGTGCCATGTGGCTTGCCTAGACCGAGGTACGCGC-TCT-GCACGGATGCTGGCGTAATGGCTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCT-TGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCCTTGGGCGCACTATCGACCGATCCTGATGTTCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATACGCGTATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGAT-AGCAGT-AACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTTGAACGTGGGCATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGATACCACAAAAGGTGTTAGTTCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGT------------------------------------------------------------------------- Pyrenula_pseudobufonia_AFTOL_387 -------------AACAGCTCAAATTTGAAATCTGGCTCAGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGCAAGACTGCGGTTTAAGTCCCTTGGAACAGGGTGTCAGAGAGGGTGAGAATCCCGTCTTTAACCGTCCGTCGCGTCTATGTGAAACTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGGGCAGCAGTTCAGCCGTTATTCTT-CGGTGCACTCTGTTGTTTCCAGGCCAGCATCGGTTTAGGTAGCTAGTTAAAGGCTTAGGGAATGTATCTATCCTGGGGTAGACTTATAGCCCTAGGTGGCATCTGGCTTACCTGGACCGAGGAACGCGC-TTCGGCACGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCC-TGCGCGTAATGAAAGTGAACGGAGGTAGGAGCCCTT-GGGCGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGAT-AGCAGT-AACGTTTTCAGTTTTATGAGGTAAAGC-AATGATTAGCGGCCTTGGGGAAGTAACTTCCTTAACCGATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACCCCACAAAAGGTGTTAGTTCATCCAGACAGCCTGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACAGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGCTACCCATACCTCGCCGTT Ramichloridium_anceps_AFTOL_659 CGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTACCGCCTCGGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACCGGTGGTAGGGCCCGTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGCGCGGTGGTTCCCCTATCCTTTT--TGGGTTACTCCGCCGCGTCCAGGCCAACATCGGTTCTGGGGGTCGGTCAAAGGCCTTGGGAATGTATCTACCCTGGCGTAGACTTATAGCCCTTGGTGTCATGCGACCTCCCGGGACCGAGGAACGCGC-TTCGGCTCGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGGAATGAAAGTGAACGGAGGTAGGAAGCTTC-GGCTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGAT-AGCAGT-AACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTC Sarcinomyces_petricola_AFTOL_825 CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTGGTCCGAGTTGTAATTTGGAGAGGATGTTTTGGGTACCGCCACGGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAGTCCCGTCTTGGACCG-CGGTAGGGCCTGTGTAAAACTCCTTCGAAGAGTCGACTTGTTTGGGAATGCAGGTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTCGTGCGCGG-GGTTCCCCCTTGCTTCTG-TGGGTCACTTCCCCGTGTCCGGGCCATCATCAGTTTCGGGGGCCGGTTAAAGGCCCTGGGAATGTACCCACGCCGGGGTGGACTTATAGCCCAGGGTGTCATGCGGCCACCCGGGACTGAGGAACGCGC-TTCGGCGAGGATGATGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCT-TGCGCGGAATGAAAGTGAACGGAGGTAGGAAGGCTTAGCCTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGCGTATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGAT-AGCAGT-AACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGAAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTCAATGCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCGCCGTC Sphinctrina_turbinata_AFTOL_1721 CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGACCTGGTCCGAGTTGTAATTTGTAGAGGCTGTTTCGGGTACGGTCCCGGTCTAAGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTGTGTGACCGGGGACCACGCCCATGTGAAACACCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCATGTGAAATTGTTGAAAGGGAAGCGGAAGCAACCAGACTCGCTGCCGGGTGCTCAACCGGGGTTCTC-CGGGGCACTCACCCGGTCTCGGGCCAGCATCGGTTCGGACGGCCAGACAAAGGCTCCGGGAATGTAGCTCCCTCGGGGGAGTGTTATAGCCCGGGGTGGCATGTGGCCAGCCCGGACCGAGGAACGCGCGTTTTGCACGGATGCTGGCGTAATGGTTGTTCCCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTATTTGGGTGTCAAACCCA-CATGCGGAATGAAAGTGAACGGAGGTGAGAGCTCGCAGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAACTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAGTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGTCGAAGTTTCCCTCAGGAT-AGCAGT-AACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCTCTTGTTGCTTAGTTGAACGTGAGCATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCCGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGATCGTGTAACAACTCACCGGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGCTACCCATACCTCGCCGTC Staurothele_frustulenta_AFTOL_697 CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGCAAGGCCGCGGTCTAATTTGCTTGGAACAGCGGGTCACAGAGGGTGAGAATCCCGTCTAGGACCGCGCGTCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTGCGCGTGACGGTTCCCCTGGCCTCCTG-CGGGCTACTCCGTCATGTCCAGGCCAACATCGGTTCGGGTGGTCGGTCAAAGACCCCGGGAATGTATCTACCTCCGGGTCGACTTATAGCCCGGGGTGTAATGCGGCCCACCTGGACCGAGGAACGCGC-TCCGGCTCGGATGTTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCC-TACGCGTAATGAAAGTGAACGGAGGTAAGAACTCGCCGGGCGCATTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGCGCATAGGGGCGAAAGACCAATCGAACCGTCTGGTAGCTGGTTCCTGTCGAAGTTTCCCTCAGGAT-AGCAGT-AACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTCATTGAACGGGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTCAATGCATCCAGACAGCCGGACGGTGGCCATGGAAGTCGGAATCCGCTTAGGAGTGTGTAACAACTCACCGGCCGAATGCATTGGCCCTGAAAATGGATGGCGCTTAAGCGTGCTACCTATACCTCGCCGTC ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = Eurotiomycetes_Fig._1) = N: 1-1242; CODONPOSSET * CodonPositions (CHARACTERS = Eurotiomycetes_Fig._1) = N: 1-1242; END; BEGIN TREES; TITLE Tb11210; LINK TAXA = Taxa2; TRANSLATE 1 Cyphellophora_laciniata_AFTOL_1033, 2 Ceramothyrium_carniolicum_AFTOL_1063, 3 Capronia_munkii_AFTOL_656, 4 Capronia_pilosella_AFTOL_657, 5 Ramichloridium_anceps_AFTOL_659, 6 Exophiala_dermatitidis_AFTOL_668, 7 Sphinctrina_turbinata_AFTOL_1721, 8 Pyrenula_pseudobufonia_AFTOL_387, 9 Granulopyrenis_seawardi_AFTOL_612, 10 Pyrenula_aspistea_AFTOL_623, 11 Endocarpon_pallidulum_AFTOL_661, 12 Agonimia_sp_AFTOL_684, 13 Staurothele_frustulenta_AFTOL_697, 14 Dermatocarpon_miniatum_AFTOL_91, 15 Sarcinomyces_petricola_AFTOL_825, 16 Dolabra_nepheliae_CBS_122119, 17 Dolabra_nepheliae_CBS_122120, 18 Dolabra_nepheliae_CBS_123297, 19 Endophyte_4466, 20 Endophyte_422, 21 Phaeoacremonium_chlamydosporum_CBS_229_95; TREE Fig._1 = [&R] (7,((((1,2),(15,(20,((3,6),(4,5))))),((16,(17,18)),(19,21))),((11,14),(12,13))),(10,(8,9))); END; BEGIN TREES; TITLE Tb11211; LINK TAXA = Taxa1; TRANSLATE 1 Cyphellophora_laciniata_AFTOL_1033, 2 Ceramothyrium_carniolicum_AFTOL_1063, 3 Ramichloridium_anceps_AFTOL_659, 4 Exophiala_dermatitidis_AFTOL_668, 5 Exophiala_pisciphila_AFTOL_669, 6 Exophiala_salmonis_AFTOL_671, 7 Caliciopsis_pinea_AFTOL_1869, 8 Caliciopsis_orientalis_AFTOL_1911, 9 Penicillium_freii_AFTOL_378, 10 Eupenicillium_javanicum_AFTOL_429, 11 Eupenicillium_limosum_AFTOL_564, 12 Sphinctrina_turbinata_AFTOL_1721, 13 Histoplasma_capsulatum_AFTOL_1083, 14 Coccidioides_immitis_AFTOL_1084, 15 Spiromastix_warcupii_AFTOL_430, 16 Lithothelium_septemseptatum_AFTOL_12, 17 Pyrgillus_javanicus_AFTOL_342, 18 Pyrenula_pseudobufonia_AFTOL_387, 19 Pyrenula_aspistea_AFTOL_623, 20 Polyblastia_melaspora_AFTOL_1356, 21 Endocarpon_pallidulum_AFTOL_661, 22 Agonimia_sp_AFTOL_684, 23 Staurothele_frustulenta_AFTOL_697, 24 Dermatocarpon_miniatum_AFTOL_91, 25 Dolabra_nepheliae_CBS_122120, 26 Dolabra_nepheliae_CBS_122119, 27 Dolabra_nepheliae_CBS_123297, 28 Dactylospora_haliotrepha_AFTOL_186, 29 Sarcinomyces_petricola_AFTOL_825, 30 Dactylospora_mangrovei_AFTOL_832, 31 Endophyte_4466, 32 Phaeoacremonium_chlamydosporum_CBS_229_95, 33 rock_isolate_TRN488, 34 rock_isolate_TRN475, 35 rock_isolate_TRN107, 36 rock_isolate_TRN214, 37 rock_isolate_TRN508, 38 rock_isolate_A14, 39 rock_isolate_TRN242, 40 rock_isolate_A95, 41 Ahracothecium_nanum_AFTOL_1649, 42 Monascus_purpureus_AFTOL_426, 43 Geoglossum_nigritum_AFTOL_56, 44 Aspergillus_fumigatus_AFTOL_1079, 45 Aspergillus_nidulans_AFTOL_1080, 46 Wahlenbergiella_mucosa_AFTOL_2264; TREE Fig._2 = [&R] (43,(12,(((8,7),((14,(15,13)),(44,(45,(42,(9,(11,10))))))),((((((((2,(35,(1,36))),(29,40)),(37,(3,(4,(5,6))))),(34,33)),((38,39),(46,((22,23),(20,(24,21)))))),(32,(31,(26,(27,25))))),((16,(18,41)),(19,17))),(30,28))))); END;