#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 12:06 GMT TreeBASE (cc) 1994-2008 Study reference: Schoch C.L., Crous P.W., Groenewald J.Z., Boehm E., Burgess T., De gruyter J., De hoog G., Dixon L., Grube M., Gueidan C., Harada Y., Hatakeyama S., Hirayama K., Hosoya T., Huhndorf S., Hyde K.D., Jones E., Kruys Å., Kohlmeyer J., Li Y., Lücking R., Lumbsch H., Marvanová L., Mbatchou J., Mcvay A., Miller A.N., Mugambi G., Muggia L., Nelsen M., Nelson P., Owensby C., Phillips A., Phongpaichit S., Pointing S., Pujade-renaud V., Raja H., Rivas-plata E., Robbertse B., Ruibal C., Sakayaroj J., Sano T., Selbmann L., Shearer C., Shirouzu T., Slippers B., Suetrong S., Tanaka K., Volkmann-kohlmeyer B., Wingfield M.J., Wood A., Woudenberg J., Yonezawa H., Zhang Y., & Spatafora J. 2010. A class-wide phylogenetic assessment of Dothideomycetes. Studies in Mycology, 64(1): 1-1510. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10245] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=350; TAXLABELS Acanthostigma_perpusillum_UAMH Acrogenospora_sphaerocephala_CBS_164_76 Aglaospora_profusa_CBS_123109 Aigialus_grandis_2Q Aigialus_grandis_JK_5244A Aigialus_parvus_A6 Aliquandostipite_khaoyaiensis_CBS_118232 Alternaria_alternata_CBS_916_96 Amniculicola_parva_CBS_123092 Anteaglonium_abbreviatum_ANM_925_1 Anteaglonium_abbreviatum_GKM_1029 Anteaglonium_globosum_ANM_925_2 Anteaglonium_globosum_SMH_5283 Anteaglonium_latirostrum_L100N_2 Anteaglonium_parvulum_SMH_5210 Apiosporina_collinsii_CBS_118973 Apiosporina_morbosa_dimosp Arthopyrenia_salicis_1994_Coppins Arthopyrenia_salicis_CBS_368_94 Ascochyta_pisi_CBS_126_54 Ascocratera_manglicola_JK_5262C Asteromassaria_pulchra_CBS_124082 Astrosphaeriella_aggregata_MAFF_239486 Astrosphaeriella_bakeriana_CBS_115556 Astrothelium_cinnamomeum_DUKE_0000007 Aulographina_pinorum_CBS_174_90 Aulographina_pinorum_CBS_302_71 Aureobasidium_pullulans_CBS_584_75 Bagnisiella_examinans_CBS_551_66 Batcheloromyces_proteae_CBS_110696 Beverwykella_pulmonaria_CBS_283_53 Bimuria_novaezelandiae_CBS_107_79 Botryosphaeria_dothidea_CBS_115476 Botryosphaeria_tsugae_CBS_418_64 Byssolophis_sphaerioides_IFRDCC2053 Byssothecium_circinans_CBS_675_92 Camarosporium_quaternatum_CBS_483_95 Capnobotryella_renispora_CBS_215_90 Capnodiales_sp_TRN_111 Capnodiales_sp_TRN_137 Capnodiales_sp_TRN_138 Capnodiales_sp_TRN_152 Capnodium_coffeae_CBS_147_52 Capnodium_salicinum_CBS_131_34 Catenulostroma_abietis_CBS_459_93 Catenulostroma_elginense_CBS_111030 Catinella_olivacea_UAMH_10679 Cenococcum_geophilum_10 Cenococcum_geophilum_CGMONT Cenococcum_geophilum_HUNT_A1 Cercospora_beticola_CBS_116456 Chaetosphaeronema_hispidulum_CBS_216_75 Cladosporium_cladosporioides_CBS_170_54 Cladosporium_herbarum_CBS_399_80 Cladosporium_iridis_CBS_138_40 Clathrospora_elynae_CBS_196_54 Cochliobolus_heterostrophus_CBS_134_39 Cochliobolus_sativus_DAOM_226212 Columnosphaeria_fagi_CBS_171_93 Comminutispora_agavaciensis_CBS_619_95 Condioxyphium_gardeniorum_CPC_14327 Coniothyrium_palmarum_CBS_400_71 Corynespora_cassiicola_CBS_100822 Corynespora_cassiicola_CCP Corynespora_olivacea_CBS_114450 Corynespora_smithii_CABI_5649b Cryptothelium_amazonum_47 Cryptothelium_pulchrum_63C Cystocoleus_ebeneus_L315 Cystocoleus_ebeneus_L348 Davidiellaceae_sp_TRN_43 Delitschia_cf_chaetomioides_GKM_1283 Delitschia_cf_chaetomioides_GKM_3253_2 Delitschia_didyma_UME_31411 Delitschia_didyma_UME_31411v2 Delitschia_winteri_CBS_225_62 Delphinella_strobiligena_CBS_735_71 Devriesia_staurophora_CBS_375_81 Devriesia_strelitziae_CBS_122379 Didymella_bryoniae_CBS_133_96 Didymella_exigua_CBS_183_55 Didymocrea_sadasivanii_CBS_438_65 Diplodia_mutila_CBS_431_82 Dissoconium_aciculare_CBS_204_89 Dissoconium_commune_CBS_110747 Dissoconium_dekkeri_CBS_111282 Dothidea_hippophaes_CBS_188_58 Dothidea_insculpta_CBS_189_58 Dothidea_sambuci_DAOM_231303 Dothiora_cannabinae_CBS_737_71 Dothiora_ellyptica_CBS_736_71 Dothistroma_septosporum_CBS_112498 Dothistroma_septosporum_CBS_543_74 Elsinoe_centrolobi_CBS_222_50 Elsinoe_phaseoli_CBS_165_31 Elsinoe_veneta_CBS_150_27 Endosporium_aviarium_UAMH_10530 Endosporium_populitremuloidis_UAMH_10529 Entodesmium_rude_CBS_650_86 Falciformispora_lignatilis_BCC_21117 Falciformispora_lignatilis_BCC_21118 Farlowiella_carmichaeliana_CBS_179_73 Floricola_striata_JK_5678I Friedmanniomyces_endolithicus_CCFEE_522 Friedmanniomyces_simplex_CBS_116775 Gibbera_conferta_CBS_191_53 Gloniopsis_arciformis_GKM_L166A Gloniopsis_praelonga_CBS_112415 Gloniopsis_praelonga_CBS_123337 Gloniopsis_subrugosa_CBS_123346 Glonium_circumserpens_CBS_123342 Glonium_circumserpens_CBS_123343 Glonium_stellatum_CBS_207_34 Guignardia_bidwellii_CBS_237_48 Guignardia_citricarpa_CBS_102374 Guignardia_gaultheriae_CBS_447_70 Halomassarina_thalassiae_JK_5262D Helicomyces_roseus_CBS_283_51 Hortaea_acidophila_CBS_113389 Hortaea_werneckii_CBS_100496 Hortaea_werneckii_CBS_708_76 Hysterium_angustatum_CBS_123334 Hysterium_barrianum_ANM_1442 Hysterium_barrianum_ANM_1495 Hysterobrevium_mori_CBS_123336 Hysterobrevium_mori_GKM_1013 Hysterobrevium_mori_SMH_5273 Hysterobrevium_smilacis_CBS_114601 Hysterobrevium_smilacis_SMH_5280 Hysteropatella_clavispora_CBS_247_34 Hysteropatella_elliptica_CBS_958_97 Jahnula_aquatica_R68_1 Jahnula_bipileata_F49_1 Jahnula_seychellensis_SS2113_1 Julella_avicenniae_BCC_18422 Julella_avicenniae_BCC_20173 Kabatiella_caulivora_CBS_242_64 Kalmusia_scabrispora_MAFF_239517 Kalmusia_scabrispora_NBRC_106237 Karstenula_rhodostoma_CBS_690_94 Katumotoa_bambusicola_MAFF_239641 Keissleriella_cladophila_CBS_104_55 Kirschsteiniothelia_elaterascus_HKUCC_7769 Kirschsteiniothelia_maritima_CBS_221_60 Laurera_megasperma_AFTOL_2094 Lentithecium_aquaticum_CBS_123099 Lentithecium_arundinaceum_CBS_619_86 Lentithecium_fluviatile_CBS_122367 Lepidosphaeria_nicotiae_CBS_101341 Leptosphaeria_biglobosa_CBS_303_51 Leptosphaeria_doliolum_CBS_505_75 Leptosphaeria_dryadis_CBS_643_86 Leptosphaerulina_argentinensis_CBS_569_94 Leptosphaerulina_australis_CBS_317_83 Leptosphearia_maculans_DAOM_229267 Leptoxyphium_fumago_CBS_123_26 Letendraea_helminthicola_CBS_884_85 Letendraea_padouk_CBS_485_70 Lindgomyces_breviappendiculata_HHUF_28193 Lindgomyces_ingoldianus_ATCC_200398 Lindgomyces_rotundatus_HHUF_27999 Lophiostoma_alpigenum_GKM_1091b Lophiostoma_arundinis_CBS_621_86 Lophiostoma_caulium_CBS_623_86 Lophiostoma_caulium_CBS_624_86 Lophiostoma_compressum_IFRD_2014 Lophiostoma_crenatum_CBS_629_86 Lophiostoma_fuckelii_GKM_1063 Lophiotrema_bruneusporum_CBS_123095 Lophiotrema_lignicola_CBS_122364 Lophiotrema_nucula_CBS_627_86 Lophium_elegans_EB_0366 Lophium_mytilinum_CBS_114111 Lophium_mytilinum_CBS_269_34 Loratospora_aestuarii_JK_5535B Macrophomina_phaseolina_CBS_227_33 Macrovalsaria_megalospora_178149 Macrovalsaria_megalospora_178150 Massaria_anomia_CBS_591_78 Massaria_platani_CBS_221_37 Massarina_arundinariae_MAFF_239461 Massarina_arundinariae_NBRC_106238 Massarina_eburnea_CBS_473_64 Massarina_igniaria_CBS_845_96 Massariosphaeria_grandispora_CBS_613_86 Massariosphaeria_phaeospora_CBS_611_86 Massariosphaeria_typhicola_CBS_123126 Massariosphaeria_typhicola_KT_797 Mauritiania_rhizophorae_BCC_28866 Mauritiania_rhizophorae_BCC_28867 Melanomma_pulvispyrius_CBS_371_75 Melanomma_pulvispyrius_SMH_3291 Melanomma_rhododendri_ANM_73 Microthyrium_microscopicum_CBS_115976 Microxyphium_aciculiforme_CBS_892_73 Microxyphium_citri_CBS_451_66 Microxyphium_theae_CBS_202_30 Monascostroma_innumerosum_CBS_345_50 Monotosporella_tuberculata_CBS_256_84 Montagnula_opulenta_CBS_168_34 Morosphaeria_ramunculicola_BCC_18404 Morosphaeria_ramunculicola_BCC_18405 Mycosphaerella_endophytica_CBS_114662 Mycosphaerella_eurypotami_JK_5586J Mycosphaerella_graminicola_CBS_115943 Mycosphaerella_graminicola_CBS_292_38 Mycosphaerella_heimii_CBS_110682 Mycosphaerella_latebrosa_CBS_687_94 Mycosphaerella_marksii_CBS_110942 Mycosphaerella_punctiformis_CBS_113265 Myriangiales_sp_TRN_235 Myriangium_duriaei_CBS_260_36 Myriangium_hispanicum_CBS_247_33 Mytilinidion_acicola_EB_0349 Mytilinidion_andinense_CBS_123562 Mytilinidion_californicum_EB_0385 Mytilinidion_mytilinellum_CBS_303_34 Mytilinidion_resinicola_CBS_304_34 Mytilinidion_rhenanum_EB_0341 Mytilinidion_scolecosporum_CBS_305_34 Mytilinidion_thujarum_EB_0268 Mytilinidion_tortile_EB_0377 Neofusicoccum_ribis_CBS_115475 Neophaeosphaeria_filamentosa_CBS_102202 Neottiosporina_paspali_CBS_331_37 Oedohysterium_insidens_ANM_1443 Oedohysterium_insidens_CBS_238_34 Oedohysterium_sinense_CBS_123345 Opegrapha_dolomitica_DUKE_0047528 Ophiosphaerella_herpotricha_CBS_620_86 Ophiosphaerella_sasicola_MAFF_239644 Otthia_spiraeae_CBS_113091 Otthia_spiraeae_CBS_114124 Paraconiothyrium_minitans_CBS_122788 Patellaria_atrata_CBS_958_97 Patellaria_cf_atrata_BCC_28876 Patellaria_cf_atrata_BCC_28877 Phacellium_paspali_CBS_113093 Phaeocryptopus_gaeumannii_CBS_244_38 Phaeocryptopus_gaeumannii_CBS_267_37 Phaeocryptopus_nudus_CBS_268_37 Phaeodothis_winteri_CBS_182_58 Phaeosclera_dematioides_CBS_157_81 Phaeosphaeria_ammophilae_CBS_114595 Phaeosphaeria_avenaria_DAOM_226215 Phaeosphaeria_brevispora_MAFF_239276 Phaeosphaeria_brevispora_NBRC_106240 Phaeosphaeria_caricis_CBS_120249 Phaeosphaeria_eustoma_CBS_573_86 Phaeosphaeria_juncicola_CBS_595_86 Phaeosphaeria_luctuosa_CBS_308_79 Phaeosphaeria_nodorum_Broad Phaeosphaeriopsis_musae_CBS_120026 Phaeotrichum_benjaminii_CBS_541_72 Phoma_betae_CBS_109410 Phoma_complanata_CBS_268_92 Phoma_exigua_CBS_431_74 Phoma_glomerata_CBS_528_66 Phoma_herbarum_CBS_276_37 Phoma_heteromorphospora_CBS_115_96 Phoma_radicina_CBS_111_79 Phoma_zeaemaydis_CBS_588_69 Piedraia_hortae_CBS_480_64 Pleomassaria_siparia_CBS_279_74 Pleospora_ambigua_CBS_113979 Pleospora_herbarum_CBS_191_86 Polyplosphaeria_fusca_MAFF_239685 Polythrincium_trifolii_133 Preussia_funiculata_CBS_659_74 Preussia_lignicola_CBS_264_69 Preussia_terricola_DAOM_230091 Pseudocercospora_fijiensis_OSC_100622 Pseudocercospora_griseola_f_griseola_CPC_10461 Pseudocercospora_vitis_CPC_11595 Pseudotetraploa_curviappendiculata_MAFF_239495 Psiloglonium_araucanum_CBS_112412 Psiloglonium_clavisporum_CBS_123338 Psiloglonium_clavisporum_GKM_L172A Psiloglonium_simulans_CBS_206_34 Pyrenochaeta_nobilis_CBS_407_76 Pyrenophora_phaeocomes_DAOM_222769 Pyrenophora_triticirepentis_CBS_328_53 Pyrenophora_triticirepentis_OSC_100066 Quadricrura_septentrionalis_CBS_125429 Quintaria_lignatilis_CBS_117700 Quintaria_submersa_CBS_115553 Racodium_rupestre_L423 Racodium_rupestre_L424 Ramichloridium_apiculatum_CBS_156_59 Ramichloridium_cerophilum_CBS_103_59 Rasutoria_tsugae_ratstk Rhytidhysteron_rufulum_CBS_306_38 Rhytidhysteron_rufulum_GKM_361A Rimora_mangrovei_JK_5246A Roussoella_hysterioides_CBS_125434 Roussoella_hysterioides_MAFF_239636 Roussoella_pustulans_MAFF_239637 Roussoellopsis_sp_MAFF_239638 Saccharata_proteae_CBS_115206 Saccothecium_sepincola_CBS_278_32 Schismatomma_decolorans_DUKE_0047570 Schizothyrium_pomi_CBS_228_57 Schizothyrium_pomi_CBS_406_61 Schizothyrium_pomi_CBS_486_50 Scorias_spongiosa_CBS_325_33 Setomelanomma_holmii_CBS_110217 Setosphaeria_monoceras_AY016368 Spencermartinsia_viticola_CBS_117009 Sporormiella_minima_CBS_524_50 Stagonospora_macropycnidia_CBS_114202 Stylodothis_puccinioides_CBS_193_58 Sydowia_polyspora_CBS_116_29 Teratosphaeria_associata_CBS_112224 Teratosphaeria_cryptica_CBS_110975 Teratosphaeria_fibrillosa_CBS_121707 Teratosphaeria_fibrillosa_CPC_1876 Teratosphaeria_stellenboschiana_CBS_116428 Teratosphaeria_suberosa_CPC_11032 Teratosphaeriaceae_sp_TRN_123 Teratosphaeriaceae_sp_TRN_211 Tetraplosphaeria_sasicola_MAFF_239677 Thyridaria_rubronotata_CBS_419_85 Trematosphaeria_pertusa_CBS_122371 Tremoteia_halophila_JK_5517J Trichodelitschia_bisporula_CBS_262_69 Trichodelitschia_bisporula_CBS_262_69v2 Trichodelitschia_munkii_Kruys201 Triplosphaeria_maxima_MAFF_239682 Trypethelium_nitidiusculum_139 Trypethelium_nitidiusculum_AFTOL_2099 Trypethelium_tropicum_25 Tubeufia_cerea_CBS_254_75 Tubeufia_paludosa_CBS_120503 Tubeufia_paludosa_CBS_245_49 Tyrannosorus_pinicola_CBS_124_88 Ulospora_bilgramii_CBS_110020 Venturia_inaequalis_CBS_176_42 Venturia_inaequalis_CBS_594_70 Venturia_inaequalis_CBS_815_69 Venturia_populina_CBS_256_38 Verrucisporota_daviesiae_CBS_116002 Verruculina_enalia_JK_5253A Westerdykella_angulata_CBS_610_74 Westerdykella_cylindrica_CBS_454_72 Westerdykella_ornata_CBS_379_55 Wettsteinina_lacustris_CBS_618_86 Wicklowia_aquatica_AF289_1 Wicklowia_aquatica_CBS_125634 Zasmidium_cellare_CBS_146_36 Zopfia_rhizophila_CBS_207_26 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4727] TITLE 5_gene_Dothideomycetes; LINK TAXA = Taxa1; DIMENSIONS NCHAR=6466; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4210 4220 4230 4240 4250 4260 4270 4280 4290 4300 4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 4410 4420 4430 4440 4450 4460 4470 4480 4490 4500 4510 4520 4530 4540 4550 4560 4570 4580 4590 4600 4610 4620 4630 4640 4650 4660 4670 4680 4690 4700 4710 4720 4730 4740 4750 4760 4770 4780 4790 4800 4810 4820 4830 4840 4850 4860 4870 4880 4890 4900 4910 4920 4930 4940 4950 4960 4970 4980 4990 5000 5010 5020 5030 5040 5050 5060 5070 5080 5090 5100 5110 5120 5130 5140 5150 5160 5170 5180 5190 5200 5210 5220 5230 5240 5250 5260 5270 5280 5290 5300 5310 5320 5330 5340 5350 5360 5370 5380 5390 5400 5410 5420 5430 5440 5450 5460 5470 5480 5490 5500 5510 5520 5530 5540 5550 5560 5570 5580 5590 5600 5610 5620 5630 5640 5650 5660 5670 5680 5690 5700 5710 5720 5730 5740 5750 5760 5770 5780 5790 5800 5810 5820 5830 5840 5850 5860 5870 5880 5890 5900 5910 5920 5930 5940 5950 5960 5970 5980 5990 6000 6010 6020 6030 6040 6050 6060 6070 6080 6090 6100 6110 6120 6130 6140 6150 6160 6170 6180 6190 6200 6210 6220 6230 6240 6250 6260 6270 6280 6290 6300 6310 6320 6330 6340 6350 6360 6370 6380 6390 6400 6410 6420 6430 6440 6450 6460 6470 6480 6490 6500 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Acanthostigma_perpusillum_UAMH ----------------------------------------------------------------------GGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTGCTTGGTGATTCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGTGGGCCTGAGAAACGGCCGACACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAACTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAGTAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACTTTGGGCCTGACTGACCGGTCCGCCTCACCGCGAG-TACTGGTTCGGTCGGGCCTTTCCTTCTGGGGAGCCTCATGCCCTTCACTG-GGCGTGCTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATGGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGTATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTACCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACGATGCCGACTAGGGATCGGGCG-ATGTTATTATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-GGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGCT-TAC-GCCCC-GGTCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGACC--GGC--GGC--CC-CCGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGTCCGCGGATGCTCCGCCG-GTC---C-TT-------C--GGC-CG--GTT-TACTCTTCCGC-GG----T-CAGGCCAGCATCAGTTTGGGC-GGTCGG-ATAAAGGCCT-TGGGAATGTGGCT---CTCTTAATGCGACCCGTCCGGACTGA-GGC-CCGCG-CT----T-C--G--GCTAGGATGCTGGCATAATGGTCGTAAGCGGCCCGTC-TTG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Acrogenospora_sphaerocephala_CBS_164_76 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTCCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTAAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTACGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGGGATCCGCATGTCCTTTACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTACTATTCTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGT-----------------------------------------------------------------------------------------------------------------------GCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTAAAATCTGG-GGCCCGAGTTGTAATTTGGAGAGGATGCTTCGGCT-GCG-ACCCC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAACCCCGTATGTGGCC--AGG--TGT--CA-ACGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTATATTTCTTCTAAGGCTAAATACCGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGATTTGGACGCAGTGTTTAGCCTG-GCT---T-CC-------T--GCC-CG--GTG-CACTCTTCTGC-GT----C-CAGGCCAGCATCGGTTTGGGC-GGCCAG-ATAAAGACCG-CAGGAATGTAGCT---CCTTCAATGTGGCCAGCCTAGACCGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGCGAAA-CCCATGCGCGTAATG-AAAGTGAACGGAGGTGGGAGCCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATTTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-ATTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGATGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCT--ATACATCGCCGCCA-GGGTAGAA-A-CG-ATGCCCTGGCGAGTAGGCAGG-------------------------------------------------------------------------------------GGGCATATCGACCTTGCTACACCCGTCTTTCACATTGGT---TTCATGACGAAGATCAAGAAGCTGCTCGAGATTGTTTGTCACAATTGTGGAAAGATCCTTTTGGATGAGAGCAACCCTACCTTCGCTGATGCCACACGGATACGAGACCCTAAGAAGCGCTTTGAAGCAATATGGAAGTTATGCAAA---GGGAAGAAAGAGTGTGAGACCAGC---------CCTGCGCAGGAGTCCTCCCATGGCGGATGTGGAAACCGACAACCTGAT---ATTAGGAAAGACGGACTGACCCTGGTTGGTTCGTGGAAA---CCG---ACAAAG---GGTGATGAGGAAGAACTAGAGAAGAGG---CTCATCAAGCCTCAAGACGCTCTCAACATATTCCGAAACATCCAAGACGAGGACATCCGCAAGATCGGCTTGAACACGGAATTTGCGCGTCCAGAATGGATGATCATCAGTGTCTTGTCGGTACCCCCGCCACCCGTTCGACCTAGCATTTCAGTGGACGGTACTGGTCAGGGCATGCGAGGTGAAGACGATCTCACCTACAAGTTGGGAGACATCATCCGCGCCAACCAGAACGTCAGGCGCTGTGAACAAGAGGGCTCGCCTCAGCATATTCTCACCGACTTTGAGAATCTCCTTCAATATCATGTCGCGACCTACAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTCTTTTTAGGGTTCTATTCCGACGGTTGACAAATGATGTCAAGAAATATCTTGAGAGGTGCATCGACACAAACAAGGACTTCAACCTGAATCTTGGTGTGAAAGCCACTACCATCACTAACGGTCTCAAATATTCACTGGCCACCGGAAACTGGGGGGAGCAAAAGAAGGCCGGGACGTCGAAAGCTGGTGTCTCACAAGTGTTAAACAGATACACGTACGCGTCTACATTGTCGCATCTTCGGCGGACGAACACACCGATTGGGCGTGATGGCAAGCTTGCGAAGCCTCGTCAGCTCCACAACACTCACTGGGGTCTTGTTTGTCCGGCAGAGACACCCGAAGGACAGGCCTGCGGTCTAGTCAAGAACCTGTCTCTGATGTGCTACGTCAGTGTAGGGAGTGAGGGT---------GGCCCAATCATCGACTTTATGACCCAGCGAAATATGGACCTTCTGGAAGAATTTGAACCGATCCTAAACCCCAATGCAACGAAGATCTTTGTCAACGGTGTCTGGGTTGGTGTTCACAGAGATGCGGCACAGCTTACTGACACTGTACGAGAACTCCGAAGAAAT---GGTACACTTGCCTACGAGATCAGCTTGGTTCGCGATATTCGCGATAGTGAGTTCAGGATCTTTACTGATGCTGGGCGAGTAATGCGGCCTCTCTTCGTCATCGAAACAAACCCGAGGAGTGCAAACCGAGACAACTTAGTCCTCAAGAAGACACATATTGACAAACTGATATACGACAAAATGAATGATGAAGAC------CGGGAAAGG------ACTATTTTTGGATGGAGT---GGTTTGATCAAGGCTGGAGCTGTTGAATACCTCGACGCCGACGAGGAAGAGCAAGCCATGATTGTGATGACTCCAGAAGATCTCGCGGATCATCAACGTCTT---CGCCAAGGCCAGAGC------ATCGTTGAAGCGGCAGATCCTCATAAACGATTCAAACCCAAACCAAACCCCTCTATCAAGACCTACACGCATTGCGAGATTCATCCTAGCATGCTGCTAGGTATCTGCGCTAGCATCATTCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACTGCGC-ATCCTTATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACTCGTGAGCACGCTCTTCTCGCCTACACTCTGGGTGTGAGGCAGATCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGCTACAACGAGATCATCAAGGAGACCTCGAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCTTTCGTCCCCATCTCCGGCTTCAATGGAGACAACATGATCGAGCCGTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCTAGCGGCAAGACCCTGCTTGAGGCCATCGACGCCATCGACCCTCCTTCCCGTCCTACCGACAAGCCCCTCCGTCTCCCCCTTCAGGACGTGTACAAGATCGGCGGTATTGGCACGGTCCCCGTCGGCCGTGTTGAGACCGGTACCATCAAGGCTGGTATGGTTGTCACCTTCGCTCCCGCCAACGTTACCACTGAAGTGAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGCTGGCCTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCTGTCAAGGAGATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCGCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGCCAGGTCGGCGCTGGTTACGCTCCCGTCCTCGACTGCCACACTGCCCACATCGCCTGCAAGTTCGCCGAGCTTCTCGAGAAGATCGACCGCCGTACTGGCAAGTCTGTTGAGAACTCCCCCAAGTTCGTCAAATCGGGTGACGCTGCTATCGTCAAGATGGTTCCGTCCAAGCCCATGTGTGTTGAGGCTTTCACTGAGTACCCTCCT Aglaospora_profusa_CBS_123109 -----------------------------------------TAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAGCCAATGCCCTCCGGGGCTCTTTGGTGATTCATAGTAACTTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGT-CGGCCGGGCCTTTCCTTCTGGAGAACCCCATGCCCTTCACTG-GGTGTGCGGGGGAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGATCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTAATTTGTAGAGGGTGCTTCGGAG-TTG-GCCTT-GGTCTAAGTTCTTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACGTGGCC--AAT--GGT--CT-TCGCCATGTGAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTATATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCTGCAGTTGCTCATCTA-GGC---T-TT-------T--GCC-TG--GTG-CACTCTTCTGT-AG----G-CAGGCCAGTATCAGTTCGGGC-GGTTGG-ATAAAGACGT-TGGGAATGTAGCT---CTCCTAATACAGCCAGCCTGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATACTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGACGCGTAATG-AAAGTGAACGGAGGTAGGAACCGGTGCACTAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTTGA--T-AGGGTGAAGT-CAGAGGAAA--CTCT-GATGGAGGCCCGCTTCTGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCTTGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCCCCAAGTGGTCTGAGGAGCGTTTCAACGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACGGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGCCTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCGACTGGTAAGACCCTCCTTGAGGCCATCGATGCCATCGACAACCCCACTCGTCCCCACGACAAGCCCCTACGTCTTCCCCTCCAGGACGTGTACAAGATCGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTACCATCAAGGCCGGCATGGTCGTCACCTTCGCCCCTGCTGGTGTCACCACTGAAGTGAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGCCGGTCTT---CCTGGCGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGCCGTGGTAACGTCGCTGGTGACTCCAAGCAGGACCCTCCCAAGGGCTGCGAGTCTTTCAACGCCCAGGTCATCGTCCTTAACCACCCCGGTCAGGTCGGTGCCGGTTACGCACCAGTCTTGGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTTCTCGAGAAGATCGATCGCCGAACTGGCAAGTCTACTGAGCAGTCCCCCAAGTTCATCAAGTCTGGTGACGCCGCCATCGTCAAGATGATTCCCTCCAAGCCCATGTGTGTTGAGC-------------------- Aigialus_grandis_2Q AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCCAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCT-GGGCTCTTTGGTGATTCATGATAACTTCGCGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTCTCAACGGGTAACGGGGGATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCTGGTCCGCCTCACCGCGTG-CACTGGCATGGCCGGGCCTTTCCTCCTGGAGAGCCCCATGCCCTTCACTG-GGCGTGTGGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATGAAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTATCTTGACTCGCTCGGCACCTTACGAGAA-----------------------------------------------------------------------------------------------------------------------------CAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTACTTTGTAGAGGGTGCTCTGGCG-CTG-GCAGT-GGCCCAAGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTACATGGCC--GCG--CAG--CC-TCGCCATGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTAGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCACAGCCAGATGTGCCCGTGGCGTCTCATCTG-GAC---A-TT-------T--GTC-CA--GTG-TACTCTCCCAC-GG----G-CAGGCCAGCATCGGTCTGGGC-GGTTGG-ATAAAGGCAT-TGGGAATGTAGCT---CCCCCAATGCAGCCAGCTCGGACCGA-GGC-CTGCG-CG----C-A--T--GCTAGGATGCTGGCGTAATGGCTGTGAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCCATGCGAGTG-TTTGGGTGTCAAT-CCCAGGTGCACAATG-AAAGTGAATGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAGGAGCAT-GGCTGTT-AGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-GAATTTGGGCATAGGGGCGAAAGACTAATCGAA-C----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCTCTCGCCTATACCCTAGGTGTCAAGCAACTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGAGCGTTACAACGAGATCATCAAGGAGACTTCCAACTTCATTAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTCCCTATCTCCGGTTTCAACGGTGACAACATGATCGAGCCCTCCACCAACTGCCCGTGGTACAAGGGCTGGGAGAAGGAGACG---------------AAGCAG---AAGGCTTCTGGTAAGACCCTCCTTGAGGCCATCGACAACATTGACCCCCCGCAACGTCCATCTGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACTGTCCCCGTCGGGCGTGTCGAGACTGGTACCATCAAGGCTGGTATGGTCGTCACGTTCGCTCCTGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAACAGCTCGTTGAGGGTGTC---CCTGGCGACAATGTCGGCTTCAATGTCAAGAACGTCTCTGTCAAGGAGATCCGTCGTGGCAACGTCGCTGGTGATTCTAAGAACGACCCACCCAAGGGTGCCGAGTCTTTCAATGCTCAAGTCATCGTCCTCAATCACCCCGGTCAAGTCGGTGCTGGTTACGCTCCCGTCCTCGACTGCCACACTGCCCATATTGCCTGCAAGTTCTCCGAGCTCTTGGAGAAGATTGACCGACGAACTGGCAAGTCTGTTGAGAACAGCCCCAAGTTTATCAAGAGTGGCGACGCGGCCATCGTCAAGATGATCCCGTCCAAGCCCATGTGTGTTGAGC-------------------- Aigialus_grandis_JK_5244A AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCCAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCT-GGGCTCTTTGGTGATTCATGATAACTTCGCGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTCTCAACGGGTAACGGGGGATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCTGGTCCGCCTCACCGCGTG-CACTGGCATGGCCGGGCCTTTCCTCCTGGAGAGCCCCATGCCCTTCACTG-GGCGTGTGGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATGAAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTATCTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT--------------------TCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTACTTTGTAGAGGGTGCTCTGGCG-CTG-GCAGT-GGCCCAAGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTACATGGCC--GCG--CAG--CC-TCGCCATGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTAGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCACAGCCAGATGTGCCCGTGGCGTCTCATCTG-GAC---A-TT-------T--GTC-CA--GTG-TACTCTCCCAC-GG----G-CAGGCCAGCATCGGTCTGGGC-GGTTGG-ATAAAGGCAT-TGGGAATGTAGCT---CCCCCAATGCAGCCAGCTCGGACCGA-GGC-CTGCG-CG----C-A--T--GCTAGGATGCTGGCGTAATGGCTGTGAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCCATGCGAGTG-TTTGGGTGTCAAT-CCCAGGTGCACAATG-AAAGTGAATGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAGGAGCAT-GGCTGTT-AGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-GAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TGTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTGCTTGATTGAACGTGGACACTCGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCT--ATACCCCGCCGCCA-GGGCAGAG-A-TT-ATGCCCTGGCGAGTAGGCAGGCGTGGAGGCCTGTGACGAAGCCTTGGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTGTTTCGAATTTTATTCCTCAAGCTCACTAAGGATGTCTACAAATACCTCCAAAAGTGTGTGGAAAATAACCAGGAGTTCAACGTCCAGATGGCTGTCAAGGCTAGCGTCATCACAAACGGGCTGAAGTACTCACTCGCTACTGGCAACTGGGGTGACCAGAAGAAGGCGGCTTCGGCTAAGGCTGGCGTGTCGCAGGTGCTGAATAGGTACACATACGCCTCAACGCTGTCACATCTTCGTCGAACAAATACCCCCGTTGGACGCGACGGCAAGCTAGCGAAACCACGTCAATTACACAACACCCACTGGGGTCTAGTCTGTCCTGCTGAAACGCCGGAAGGTCAGGCTTGTGGCTTGGTCAAGAACCTCTCGTTGATGTGCTACGTCAGTGTTGGTACTGAGAGC---------ACGCCGATAACGGACTTCATGAGCCAACGAAACATGGAGATTCTGGAGGAGTACGACCCGCAGACCTCACCGAATGCGACCAAGGTTTTTGTCAATGGCGTTTGGGTCGGCGTACATTCGCAGCCATCACAACTCGTTTCTGTCGTACAGGAATTGCGGCGGAAT---GGGACTTTATCCTATGAGATGAGTCTGATTCGAGATATCCGTGATCGAGAGTTCAAGATCTTCACGGATGCAGGCCGGGTTATGAGGCCTTTATTTGTGGTTGAAACGGACCCTAGAAAACCCAATGTTGGCACCCTTGCCCTCAACAAGACTCACATCCAGAAGCTCGAGGATGATAAGATGAACGACGAAGAG------GCCCAAGCG------CTGAAGTACGGCTGGCGA---GGT-CGATCAACGATGGTATCATTGAGTACCTCGATGCCGAAGAGGAGGAGACCGCTATGATCATTATGACGCCGGAGGATCTCGACGATCACCGAAATCTC---AGGTCCGGCATTCCC------ATTCCTGACGGGCAGGATCGCCACAAGCGTATCAAACCGAAGCCGAGCGATTCCGTGAGGATGTATACCCATTGCGAGATCCATCCTAGTATGATTCTTGGCATCTGTGCAAGCATTATTCCGTTCCCCGATCATAATCAGTCTCCACGTAATACTTATCAGTCAGCTATGGGCAAGCAAGCTATGGGCGTTGCTCTGACGAATTATGCGCTCAGAATGGAGACTATGATGAATGTCCTTTACTACCCGCAGAAACCTCTGGCCACAACGCGATCCATGGAATATCTTAGGTTCCGTGAGTTGCCTGCGGGCCAGAACGCTATCGTAGCTATTGCGTGTTACTCTGGATACAATCAGGAAGACTCCGTCATCATGAACCAGAGCAGTATCGATCGCGGTTTGTTTAGGAGTTTGTTCTATCGCGCCTACACGGAGCAGGAAAAACGGATTGGTGTCAATGTGTTAGAACAATTCGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Aigialus_parvus_A6 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCCAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCT-GGGCTCTTTGGTGATTCATGATAACTTCGCGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTCTCAACGGGTAACGGGGGATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCTGGTCCGCCTCACCGCGTG-CACTGGCATGGCCGGGCCTTTCCTCCTGGAGAGCCCCATGCCCTTCACTG-GGCGTGTGGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATGAAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCCTAATGATTAATAGGGACAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTACTTTGTAGAGGGTGCTTTGGCGTTTG-GTAGC-GGTCTAAGTTCTTTGGGACAAGACGTCACGGAGGGTGAGAATCCCGTATGTGGCC--GCG--TAA--CC-TCGCCATGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCACAGCCAGACGTGCTCGTGGCTGCTCATCCG-GAC---A-CG-------T--GTC-CG--GTG-CACTCTCCCAC-GA----G-CAGGCCAGCATCGGTTTGGGC-GGTTGG-ACAAAGGCGC-CGGGAATGTAGCT---CCCTCAATGCAGCCAGCCCAGATCGA-GGC-CCGCG-CG----C-A--T--GCTAGGATGCTGGCGTAATGGCTGTGAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCCATGCGAGTG-TTTGGGTGTCAAATCCCAGGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-GGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGCGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-GAATTTGGGCATAGGGGCGAAAGACTAATCGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAAGTGCGTGGAAAATAATCAGGAGTTCAACGTCCAGATGGCTGTGAAGGCTAGCGTCATCACAAACGGGTTGAAGTATTCACTTGCTACTGGCAACTGGGGTGACCAGAAGAAGGCGGCTTCGGCTAAGGCTGGTGTATCGCAGGTGCTGAATAGGTATACATACGCCTCAACGCTGTCACATCTTCGTCGAACAAATACCCCCGTTGGACGTGACGGCAAGCTGGCGAAACCGCGCCAATTACACAACACCCACTGGGGCCTAGTTTGTCCTGCTGAAACGCCAGAAGGTCAAGCTTGTGGCTTGGTCAAGAACCTCTCATTGATGTGCTACGTCAGTGTTGGTACCGAGAGC---------ACGCCGATAACGGACTTCATGAGCCAACGGAATATGGAAATTCTGGAGGAGTACGACCCACAGACCTCGCCGAATGCGACCAAGGTGTTTGTCAATGGCGTTTGGGTCGGCGTACATTCGCAGCCATCGCAACTCGTTTCTGTCGTACAGGAATTGCGGCGGAAT---GGGACTTTATCCTATGAGATGAGCCTGATTCGAGATATTCGCGATCGAGAGTTCAAGATCTTTACGGATGCAGGCAGAGTCATGAGGCCTTTATTTGTGGTTGAAACGGACCCTAGAAAACCCAATGTTGGCAGCCTTGCCCTCAACAAGACTCACATCCAGAAGCTTGAAGATGATAAAATGAGCGACGAAGAG------GCCCAGGCG------TTGAAGTACGGCTGGCGA---GGTCTGATCAACGATGGTATTATAGAGTACCTTGATGCTGAAGAGGAGGAAACCGCTATGATCATCATGACGCCGGAGGATCTCGACGACCACCGGAATCTC---AGGTCGGGCATTCCT------ATTCCTGACGGGCAAGATCGCCACAAGCGTATCAAACCGAAGCCGAGCGATTCCGTGAGGATGTATACCCATTGCGAGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTACACCCTTGGTGTCAAGCAACTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGAGCGTTACAACGAGATCATCAAGGAGACTTCCAACTTCATTAAGAAGGTTGGCTACAACCCCAAGACCGTCCCCTTCGTCCCAATCTCCGGCTTCAACGGTGATAACATGATTGAGCCCTCCACCAACTGCCCATGGTACAAGGGTTGGGAGAAGGAGACG---------------AAGCAG---AAGGCTTCTGGAAAGACCCTCCTTGAGGCCATCGACAACATTGACCCCCCGCAACGTCCATCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACTGTCCCCGTCGGTCGTGTTGAGACTGGTACCATCAAGGCCGGTATGGTTGTCACTTTCGCTCCTGCTGGTGTGACCACTGAAGTCAAGTCTGTCGAGATGCACCACGAGCAGCTCTCTGAGGGTGTT---CCTGGCGACAATGTTGGCTTTAATGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGAACGACCCACCCAAGGGTGCCGAGTCTTTCAATGCCCAAGTCATCGTCCTTAACCACCCTGGTCAAGTTGGTGCTGGCTACGCTCCTGTCCTTGACTGCCACACCGCCCACATTGCCTGCAAGTTCTCCGAGCTCTTGGAGAAGATTGACCGACGAACTGGCAAGTCTGTTGAGAACAGCCCTAAGTTTATCAAGAGTGGTGACGCGGCCATCGTCAAGATGATCCCGTCCAAGCCCATGTG---------------------------- Aliquandostipite_khaoyaiensis_CBS_118232 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAC-GG-ATATCTGTGGTAATTCTAGAGTTAATACGTGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGACTAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTCAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGCTAGGGTAGTGGCCTAGCATGGTTACAACGGGTAACGGGGGATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACGATTTAAACACCCTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAACGCTCGTCGTTGAACCTTGGGCCTGGGCGACCGGTCTCCCTCACCGGATG-CACTGGTTCGGCCGGGCCTTTCCTTCTGGGGAATCGCATGCCCTTCGCTG-GGCGTGTCGAGGATCCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACCTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGTCAGTTGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTAGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAAGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCCTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTGTTTGGGTTC------------------------------------------------------------------------------------------------------------------------------------AGCGAAGCGGCAAGTGCTCAGATTTGAAATCTGG-GGTCCGAGTTGTAATCTGTAGGGGATGCTTCGGAG-TCG-GGCCC-GGTCCAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCCGCGGCC--GGC--GCA--AG-TCTCCGTGCGAAGCTCCTCCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGACCGCGGTGGTTCAACCC-TCC---C-AG-------C--GGA-GG--GCC-CACGCCGCCGT-GG----T-CGGGCCAGCATCGGTTCCGGC-GGTCGG-AGAAAGGCTT-GGGGAACGTGGCT---CCCTTAATGCGACCTGCCGGGACCGA-GGA-CCGCG-CT----C-C--G--GCAAGGATGCTGGCGTAATGGTCGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTGTGCGAGTG-TTCGGGTGTCAAA-CCCCTGCGCGTAATG-AAAGTGAACGGAGGTCGGAGCCGGCGCACGAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAGGAGCAC-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAG--T-AGGCCGAAGC-CAGCGGAAA--CGCT-GGTGGAGGGTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAACTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTTAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGCCC-TTGTTGCTTTGTTGAACGTGGGCACTCGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCCAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCA--ATACCTCGCCGCCG-GGGTGGGA-T-CT-TTGCCCCGGCGAGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCTTTTC-TTAAGTTGACAAGGGATGTTTACAAATATCTAGAGAAATGCGTAGAGACGAACAAGCAATTCCAGCTACAGCTCGCGGTCAAGTCGAATACTCTCACCAATGGCTTAAGATATTCTCTGGCTACTGGCAATTGGGGTGAGCAAAAGAAGGCCGGTCAGTCCAAGGCAGGAGTATCGCAGGTGTTGAACAGATATACCTACGCCTCAACACTATCCCATCTTCGAAGAACGAATACACCTATTGGTCGTGATGGGAAACTTGCAAAACCTCGCCAATTACACAATACACACTGGGGACTTGTCTGCCCTGCGGAGACCCCTGAGGGACAAGCCTGTGGGCTGG-GAAAAACTTGTCATTAATGTGCTACGTCAGTGTGGGAAGTGAAGGG---------GGTCCAATTGTCGATTTTATGGCTCAGAGAAATATGGATCTCCTCGAGGAATTCGACCCTTCATTGAATCCACACGCCACGAAGATTTTTGTCAATGGAGTTTGGGTGGGTGTACATCGGGATGCCAATCAGCTGGTGTCCGTTGTGCAAGAGCTTCGAAGAAAC---GGTACTCTTCCACATGAGATGAGCTTAATCCGTGATGTTCGTGAGCGCGAATT-AAGATCTTTACGGATGCGGGAAGAGTGATGCGTCCACTTTTCGTAATCGACAATAATGTCACTAGCCAGCACCGAGGGAGTCTTGTCCTCGACAAAACTCATATTTCGAGGCTTCTAGATGACAAGATGACCGACCAAGAA------CGTGATGAG------GCTCTGTTCGGTTGGAAA---GGGTTGATTAAGAGCGGAGTTATCGAATATCTTGACGCAGAAGAAGAAGAGGTTGCTATGATTATCATGACACCCGAGGACCTCGAAGATCATCATCGAATG---ACATCCGGGCTCCCA------CAGTTTCCGGATGATGATCCCCACAAGCGCTATAAGCTGAAACCAAATCCTACGGTCAAGATGTACACTCACTGCGAAATCCATCCTAGCATGTTGCTCGGTATCTGTGCTAGCATCATTCCCTTCCCCGACCACAACCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATCCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACTCGTGAACACGCCCTTCTCGCCTACACCCTTGGTGTCAGGCAGATCATCTGCGCCATTAACAAGATGGATACTGCCAAGTGGTCCGAGTCCCGTTTCCAGGAAATCGTCAAGGAAGTCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACGGTCCCGTTCGTCCCTATCTCTGGCTTTAACGGTGACAACATGATCGAGCCTTCGACCAACTGCCCATGGTACAAGGGTTGGGACAAGGAGTCC---------------AAGGCTGGAAAGGCCTCTGGCAAGACCCTTCTCGAGGCCATCGATGCCATCGATCCCCCATCCCGTCCCGTCGACAAGCCCCTTCGTCTCCCTCTCCAGGATGTGTACAAGATCGGTGGTATTGGAACAGTCCCAGTCGGTCGTGTCGAGACTGGCTCCATCAAGGCCGGTATGGTTGTCACTTTCGCTCCCGCCAACGTCACCACTGAAGTCAAGTCTGTCGAAATGCATCACGAAACTCTCACCGAGGGTCTT---CCTGGCGACAACGTTGGCTTCAATGTCAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGTAACGTCTGCGGTGACTCCAAGAACGATCCTCCAAAGGGTGCTGAGTCCTTCAGCGCCCAAGTTATTGTCCTTAACCACCCTGGTCAGGTCGGTGCCGGCTATGCTCCAGTCTTAGACTGTCACACTGCCCACATCGCTTGCAAGTTTGCCGAGCTTCAGGAGAAGATTGATCGTCGTACTGGCAAGTCTGTCGAACAGAGCCCCAAGTTCATCAAGTCCGGTGATGCCGCTATCGTTAAAATGGTT--------------------------------------------- Alternaria_alternata_CBS_916_96 --------------------------TTATCGTTTATTTGATAATA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCAT-AGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGG-CTGGCTGGCGGGTCCGCCTCACCGCGTG-CACTCGTCCGGCCGGGCC-TTCCTTCTGAAGAACCTCATGCCCTTCACTG-GGCGTGCTGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGT-GCGTTTCTA-TTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGATTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGTCACCACCAGGCGT---------------------------AGCGGAGGAAAAGAAACCACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-AGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCT-TTG-GCAGC-GGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTC--GCT--GGC--TA-TTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCG-GGT---T-TC-------T--ACC-CG--GTG-CACTCTTCTGT-AG----G-CAGGCCAGCATCAGTTTGGGC-GGTAGG-ATAAAGGTCT-CTGTCACGTACCT---CCTTTCATACTACCAGCCTGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCAT-GGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAATTGAACGTGGACAGTTGAATGAAACGTTATTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GAGGGGTTAAAGTGCCGGAATATACGCTCATCAGACACCACAAAAGGTGTTGGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACTT--ATACCCCTCCGCTG-GGGCAAAA-T-TT-ACGCCCCAGCGAGTAGGCAGGCGTGGAGGTCCGTGACGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTCACCAAGGATGTGTACAAGTACCTCCAGCGATGTGTTGAGAACAACCAGGATTTCAACGTTCAGATGGCTGTCAAGGCCAGCATCATCACAAACGGCCTGAAATACTCCCTGGCAACAGGAAACTGGGGTGACCAGAAGAAGGCCGCTTCCGCGAAAGCCGGTGTCTCCCAGGTGTTGAACCGATACACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCT---------TCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAAC---GGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAATGGAGCCAGGATGAG------GTCGAATCA------GCTACCTACGGCTGGAGA---GGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCA-GATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATG---AAATTGGGTTTGCCG------GCGGCGGAGCGAGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGCCTATACTCATTGCGAGATTCATCCGGCTATGATTCTCGGTATCTGTGCCAGTATCATTCCCTTCCCCGATCACAACCAATCGCCCCGTAACACTTACCAATCTGCTATGGGTAAGCAAGCTATGGGTGTTGCGCTCACCAACTTTGCGCTACGCATGGAAACCATGATGAACGTCCTGTACTACCCCCAGAAGCCATTGGCAACTACTCGATCGATGGAGTACCTCAAGTTCCGTGAGCTACCCGCTGGTCAGAACGCTATTGTCGCCATTGCTACATACGGTGGTTATAACCAGGAAGATTCCGTCATTATGAACCAGAGCAGTATCGATCGTGGACTGTTCAGGAGTTTGTTCTACCGTGCATACACTGAACAGGAGAAGCGTATTGGTGTCAACGTTCTCGAGCAATTCGAGAAGCCTACCCGTGCCGATACCCTCCGTCTTAAGGGTGGAACATACGACAAGCTTGATGATGACGGTGTTGTTGCGCCTGGTGTGCGTGTCTCTGGTGATGATATCATCATTGGAAAGACAGCGCCCATCGCAACCGATGCA------------------CAGGAGCTTGGTCAGAAAACTACTCTCCACACCAAGCGCGATGTTTCAACGCCACTCCGAAGTACCGAGAACGGTATCGTCGATCAGGTACTCTTCACCACCAACACCGAAGGCCTCCGATTCGTCAAGGTTCGTACGCGAACGACCAAGGTCCCGCAGATTGGTGACAAGTTTGCTTCTCGTCACGGTCAAAAGGGAACCATTGGTATCACCTACCGCCAGGAAGATATGCCATTCTCCAGGGAGGGACTCACA------------------------------------TGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTCCTCGCTTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGCCTCATCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGGCC---AAGGCCACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATCGACCCTCCCAGCCGTCCCACCGACAAGCCCCTC-GTCTTCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCTGGTTACGCCCCAGTCCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCTCCT Amniculicola_parva_CBS_123092 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAGCCAATGCCCTCCGGGGCTCTTTGGTGATTCATAGTAACTTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGT-CGGCCGGGCCTTTCCTTCTGGAGAACCCCATGCCCTTCACTG-GGTGTGCGGGGGAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGATCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTGGGGATCGGGCG-ATGTTTCTATCTTGACTCGCTCGGCACCCTAAGAGAAATCA-AAGTTTT-----------------------------------------------------------------------------------------------------------------------------CCCTAGT-ACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAA-CAGG-GGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGTA-TTA-GCTGT-GGTCTAAGACCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTATGTGGCC--AGC--AGC--TC-TTGCCTTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGTTCATCTA-GGC---T-TT-------T--GCC-TA--GTG-CACTCTTCTGC-GG----G-CAGGCCAGCATCAGTCCAGGC-GGTCGG-ATAAAGGCCT-TGGGAATGTGGCT---CCTTTCATGCGGCCAGCCTGAACTGA-GGT-CCGCG-CT----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTACACTCTTGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCAAGGACCGCTTCCAGGAGATCATCAAGGAGACCTCTTCCTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGACGTTTCCCCCAACTGCCCGTGGTACACTGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCTACCGGCAAGACCCTCCTCGAGGCCATCGATGCCATTGACCAGCCGTCCCGCCCGTCCGACAAGCCTCTCCGCCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTGCCTGTCGGCCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAGATGCATCACGAGCAGCTTGTCGAGGGTCTT---CCCGGAGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATTCGTCGTGGCAACGTCGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCCGGCCAGGTCGGTGCTGGTTACGCTCCCGTCTTGGATTGCCACACTGCCCACATCGCCTGCAAGTTCTCCGAGCTCCTCACCAAGATTGATCGCCGAACTGGCAAGTCCATCGAAGACAACCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATGATTCCCTCCAAGCCCATGTGCGTTGAGC-------------------- Anteaglonium_abbreviatum_ANM_925_1 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CGCCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCG-TCG-GCAGC-GGCCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAACCCCGTACGTGGCC---GCC-CGC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCGGTTGTTC----------------------------------------TTCTTCCGC-GG----G-CAGGCCAGCATCAGTCTGGGC-GGTCGG-ATAAAGGTCT-CGGGAATGTAGCT---CTCTCCATGCGGCCAGCCCGGACTGA-GGT-CCGCG-CG----T-C--T--GCTAGGATGCTGGCGTAATGGCTATAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACATGATCACTGGTACCTCCCAGGCTGACTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGTCAGACTCGCGAGCACGCTCTTCTCGCCTACACTCTCGGTGTCAAGCAACTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGACCGCTTCAACGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGCCCTCCAGCAACGCTCCTTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGACGACCGGCAAGACCCTCCTCGAGGCCATTGACGCCATCGACACCCCGTCTCGCCCGGTTGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTCCCTGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAACAGCTCGTCGATGGTGGCAAGCCCGGCGACAACGTCGGCTTCAACGTCAAGAACGTCTCTGTCAAGGAGATTCGTCGTGGCAACGTCGCTGGTGACTCCAAGAACGACCCACCCAAGGGTGCCGACTCTTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTTGGTGCCGGTTACGCTCCTGTCTTGGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCTCGAGAAGATCGATCGCCGAACTGGCAAGTCTGTTGAGGCTAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATGATTCCGTCCAAGCCCATGTGCG-------------------------- Anteaglonium_abbreviatum_GKM_1029 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CGCCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCG-TCG-GCAGC-GGCCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAACCCCGTACGTGGCC---GCC-CGC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCGGTTGTTC----------------------------------------TTCTTCCGC-GG----G-CAGGCCAGCATCAGTCTGGGC-GGTCGG-ATAAAGGTCT-CGGGAATGTAGCT---CTCTCCATGCGGCCAGCCCGGACTGA-GGT-CCGCG-CG----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACATGATCACTGGTACCTCCCAGGCTGACTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGTCAGACTCGCGAGCACGCTCTTCTCGCCTACACTCTCGGTGTCAAGCAACTCATCGTTGCCATCAATAAGATGGACACCACCAAGTGGAGCGAGGACCGTTTCAACGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGCCCTCCAGCAACGCTCCTTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGACGACCGGCAAGACCCTCCTCGAGGCCATTGACGCCATCGACACCCCGTCCCGCCCGGTTGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTCCCTGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAACAGCTCGTCGATGGTGGCAAGCCCGGCGACAACGTCGGCTTCAACGTCAAGAACGTCTCTGTCAAGGAGATTCGTCGTGGCAACGTCGCTGGTGACTCTAAGAACGACCCACCCAAGGGTGCCGACTCTTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTTGGTGCCGGTTACGCTCCTGTCTTGGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCTCGAGAAGATCGATCGCCGAACTGGCAAGTCTGTTGAGGCTAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATGATTCCGTCCAAGCCCATGTGCGTTGAGGC------------------- Anteaglonium_globosum_ANM_925_2 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-TGCCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCG-TCG-GCAGC-GGCCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAACCCCGTACGTGGCC---GCC-CGC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCGGTCGTTC----------------------------------------TTCTTCCGC-GG----G-CAGGCCAGCATCAGTCTGGGC-GGTTGG-ATAAAGGCCC-TGGGAATGTAGCT---CTCTTCATGCGGCCAGCCCGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACATGATCACTGGTACCTCCCAGGCCGACTGCGCCATTCTCATCATCGCTGCTGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACTCTCGGTGTCAAGCAACTCATCGTTGCCATCAACAAAATGGACACCGCCAAGTGGAGCGAGGACCGTTACAACGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCTTTTGTCCCCATCTCCGGGTTCAACGGCGACAACATGATCGAGCCCTCCTCCAACGCCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCGACTGGCAAGACCCTCCTCGAGGCAATCGACGCCATCGACCCCCCGTCCCGCCCGTCTGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCTCCTGCCAACGTCACCACCGAAGTGAAGTCCGTTGAGATGCACCACGAACAGCTCACCGAAGGTCTT---CCCGGTGACAACGTCGGCTTTAACGTCAAGAACGTCTCCGTTAAGGAGATCCGTCGTGGCAACGTCGCTGGTGACTCCAAGAACGATCCGCCCAAGGGTGCCGAATCCTTCAACGCCCAAGTCATCGTCCTCAATCATCCCGGCCAGGTTGGTGCTGGTTACGCTCCTGTTTTGGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCTGAGCTCCTCGAGAAGATCGATCGCCGAACTGGCAAGTCTGTTGAGTCCAGCCCTAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAAATGATTCCCTCTAAGCCTATGTGCG-------------------------- Anteaglonium_globosum_SMH_5283 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-TGCCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCG-TCG-GCAGC-GGCCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAACCCCGTACGTGGCC---GCC-CGC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCGGTCGTTC----------------------------------------TTCTTCCGC-GG----G-CAGGCCAGCATCAGTCTGGGC-GGTTGG-ATAAAGGCCC-TGGGAATGTAGCT---CTCTTCATGCGGCCAGCCCGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGCCGACTGCGCCATTCTCATCATCGCTGCTGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACTCTCGGTGTCAAGCAACTCATCGTTGCCATCAACAAAATGGACACCGCCAAGTGGAGCGAGGACCGTTACAACGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCTTTTGTCCCCATCTCCGGGTTCAACGGCGACAACATGATCGAGCCCTCCTCCAACGCCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCGACTGGCAAGACCCTCCTCGAGGCAATCGACGCCATCGACCCCCCGTCCCGCCCGTCTGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCTCCTGCCAACGTCACCACCGAAGTGAAGTCCGTTGAGATGCACCACGAACAGCTCACCGAAGGTCTT---CCCGGTGACAACGTCGGCTTTAACGTCAAGAACGTCTCCGTTAAGGAGATCCGTCGTGGCAACGTCGCTGGTGACTCCAAGAACGATCCGCCCAAGGGTGCCGAATCCTTCAACGCCCAAGTCATCGTCCTCAATCATCCCGGCCAGGTTGGTGCTGGTTACGCTCCTGTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Anteaglonium_latirostrum_L100N_2 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CGCCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCG-TCG-GCAGC-GGCCTAAGTTCCTTGGAACAGGGCGTCACAGAGGGTGAGAACCCCGTACGTGGCC---GCC-CGC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCGGCGGATC----------------------------------------CTCCTCCGC-GG----G-CAGGCCAGCATCAGTCTGGGC-GGTCGG-ATAAAGGCCT-CGGGAATGTAGCT---CTCTCCATGCGGCCAGCCCGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCTCATCATTGCCGCTGGCACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTCGCCTACACTCTCGGTGTCAAGCAACTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGACCGTTACAACGAGATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGACGCCTCGCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACCGGCAAGACCCTTCTCGAGGCCATTGACGCTATTGACACCCCGTCCCGTCCTTCCGACAAGCCGCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACTGGTGTCATCAAGGCCGGTATGGTTGTCACCTTCGCTCCTTCCAACGTCACCACCGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTCGCCGAGGGTGGCAAGCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATTCGTCGTGGCAACGTTGCTGGAGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGCCAGGTCGGTGCTGGTTACGCTCCAGTCTTGGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCTCGAGAAGATCGATCGCCGAACTGGCAAGTCTGTCGAGGCTAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTTAAGATGATTCCCTCCAAGCCCATGTGCG-------------------------- Anteaglonium_parvulum_SMH_5210 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGA--GCCCGAGTTGTAATTTGCAGAGGGTGCTTTGGTG-TTG-GCAGC-GGCCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAACCCCGTACGTGGCC---GCC-CGC--CT-TCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCGGTCGTTC----------------------------------------TTCTTCCGC-GG----G-CAGGCCAGCATCAGTCTGGGC-GGTCGG-ATAAAGGCCT-CGGGAATGTAGCT---CTCTTCATGCGGCCAGCTCGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCAGGCCGACTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTCGCCTACACTCTCGGTGTGAAGCAGCTCATTGTTGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGACCGTTTCAACGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCTTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGCCCTCCTCCAACGCCCCGTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACTGGCAAGACCCTCCTCGAGGCCATTGACGCCATCGACACCCCGTCCCGCCCGGTTGACAAGCCCCTCCGTCTTCCCCTCCAGGACGTGTACAAGATTGGCGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTTACCACCGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGCCGATGGTGGCAAGCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCTGGTGACTCCAAGAACGACCCGCCCAAGGGTGCCGATTCTTTCAACGCCCAGGTCATCGTCCTCAACCACCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Apiosporina_collinsii_CBS_118973 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCGCAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTCTGGTGATTCATAATAACTAAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATTGTAGAGTAGTGGTCTACAATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAACTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAGAAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATTTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGGGATCCGCATGCCCTTTACTG-GGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACG--GCTTTCCTA-TTTTGTTGGTTTCTAGGGAAGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTACTATCTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGG------------------------------------------------------------------------------------------------------------------------------AGT-ACGGCGAGTGAAGCGGC-ACAGCTCAAATTTGAAATCTC--CGCCCGAGTTGTAATTTGTAGAGGATGCTTCGGGT-GAA-GCCGC-GGTCCAAGTCCCTTGGAACAGGACGTCAGAGAGGGTGAGAACCCCGTACCTGGCC--GCC--GGTG-CC-CCCCGCTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATTGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTTGCCCGCGGTTGCTCAGCCC-GCC---T-TT-------T--GGC-GG--GTG-CACTCTTCCGC-GG----T-CAGGCCAGCATCGGTTCGGGC-GGCCGG-AGAAAGGCGT-CGGGAACGTGGCC---TCCCCAATGCGGCCAGCCCGGACCGA-GGT-TCGCG-CT----C-T-----GCTAGGATGCTGGCGTAATGGCCGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCGTGCGCGTAATG-AAAGTGAACGTGGGTGGGAACCGGTGCACCAT-CGA-CCGATCCCGATGTATTCGGAAGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CGTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGCGTATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCGAGCTGTCGGTTCCCGTTTTCCACGTTGGT---TTTATACGCAAAATTCAAAAGGTCCTCGAGACGATCTGCAACAAGTGCGGCAAAATCAAGGTTGACGAGAGCAACCCAGCCTACAAAGAGGCGCTAAAGAACAGAAATCCAAAGCGCCGCTTTGACGCGATCCATAAGCTTTGCAAG---CCCAAGATGGTTTGCGATGCCGAT---------CCATCCGAAGATCACAGACATGGCGGTTGTGGAAATCAGCAACCAGAG---ATCCGAAAGGATGGTCTGAGACTGGTGGCTACCTACAAG---CCC---TCAAAG---GACGAAGAAAAGGAACCCGAAAAACGC---CCCATCACACCAGAAGAATGCATCACGATCATGCAAGCCATGAGCGACGAAGACATTAGGACACTAGGATTCAACACTGAATTCGCGAGACCAGAGTGGATGATGATACGCAACCTGCTGGTGCCTCCGCCACCCGTCCGTCCCAGTGTATCTGTAGATGGCACCGGGCAAGGAATGCGCGGTGAGGATGATTTGACCCACAAATTGGGCGACATCATCCGTGCCAACGCAAACGTCAAGCGTTGTGAGTCTGAAGGTTCCCCTCAGCACGTCGTCTCCGAGTTGAGGC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTTGCCTACACCTTGGGTGTCAAGCAACTCATCGTCGCCATCAACAAGATGGACACCTGCAAGTGGTCCGAGGCTCGATTCAACGAAATCATCAAGGAGACTACCAACTTCATCAAGAAGGTTGGCTACAACGCCAAGCATGTCCCCTTCGTTGCAATCTCAGGTTTCAATGGTGACAACATGATCGAGAGTTCCACCAACTGCCCGTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGGTGACCGGAAAGACCCTTCTCGAGGCCATTGATGCCATTGACCCTCCGTCCCGCCCAACTGACAAGCCTCTCCGTCTTCCTCTTCAGGATGTTTACAAGATTGGCGGTATTGGCACAGTACCAGTCGGCCGTGTTGAGACCGGTGTCATCAAGGCCGGCATGGTCGTTACCTTCGCCCCAGCTGGTGTCACCACTGAAGTCAAGTCGGTTGAGATGCATCACGAGCAGCTCGTTGAAGGTCTC---CCAGGTGACAACGTTGGGTTCAACGTGAAGAACGTCTCTATCAAGGAAATCCGTCGTGGCAACGTTTGTGGTGACTCCAAGATCGACCCACCAAAGGGCTGTGAGAGCTTTAACGCTCAGGTTATCGTGCTCAACCACCCGGGTCAAATCGGTGCTGGTTACGCTCCAGTCCTGGATTGCCACACCGCCCACATTGCTTGCAAGTTCGCCGAGCTTTTGGAGAAGATTGATCGTCGTACGGGTAAAGGCACCGAGACTTGCCCCAAGAACATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCT----------------------------------------- Apiosporina_morbosa_dimosp ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTA--CGCCCGAGTTGTAATTTGTAGAGGATGCTTCGGGT-GAA-GCCGC-GGCCCAAGTCCCTTGGAACAGGACGTCGTAGAGGGTGAGAGCCCCGTACCTGGCC--GCC--GGTG-CC-CCCCGCTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATTGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTTGCCCGCGGTTGCTCAGCCC-GCC---C-TC-------T--GGC-GG--GTG-CACTCTTCCGC-GG----T-CAGGCCAGCATCGGTTCGGGC-GGCCGG-ATAAAGGCTC-CGGGAACGTAGCC---TCCCTAATGCGGCCAGCCCGGACCGA-GGT-TCGCG-CT----C-T-----GCTAGGATGCTGGCGTAATGGCCGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCGTGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CGTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGCGTATAGGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Arthopyrenia_salicis_1994_Coppins ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGTTGTAATTTGCAGAGGGTGCTTTGGTG-TCG-GCCGTG-GTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCC--GCC--GGT--CT-TCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTC-AAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCG-GGC---T-CTC------G---CC-CG--GGGC-ATTCTTCTGC-GG----G-CAGGCCAGCATCAGTTCGGGC-GGTTGG-ATAAAGGCCT-CCATCACGTATCT---TCCTTAACACGACCAGCCTGAACTGA-GGA-CCGCG-CA----T-C--A--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTAAAG-CCCGGGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGGGGAAA--CCCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAATTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGT---TTCGTCGTTAAAATTAAGAAAATCCTCGAGACGGTTTGCCACAACTGTGGTCTTATCCTAGCCGACTACTCCACGGCTGATTGGAAAGCTGCCATTCGCACCAAGGATGCAAAACGACGATTCGACACGATATGGCGCCTCTCTAAG---ATCAAGCGCGTCTGTGACGGGTCG---------ATACCCGAGGAAATAGCCCACGGCGGTTGTGGTCACAAACAGCCTGAC---ATCCGCAAAGAAGGCCTCAAGCTGACAGGTACTTGGAAG---GCC---AGCAAG---GACGACGAAGAGGGTGACGAGAAGCGT---GTCATTACCCCACAGGACGCGCTCAACATTTTCCGTAACATCAGCGACTCCACACTCGCTTTGCTCGGCTTGAATGCCGATTATGCACGTCCTGAGTGGATGGTCATCACCGTCCTCCCAGTCCCTCCACCCCCTGTCCGCCCGAGTATCTCTGTTGATGGAACCGGCCAAGGTATGCGAGGAGAGGATGATCTCACATACAAACTTGGCGACATTATCCGTGCCAATGGTCGTGTCATGGATTGCATCCAACAAGGCTCACCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Arthopyrenia_salicis_CBS_368_94 TAACTGCGAATGGGTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTTCTATATTGACTCGCTCGGCACCTTACGAGAAATCA-TAAGT--------------------------------------------------------------------------------AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-GGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGTG-TCG-GCCGT-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCC--GCC--GGT--CT-TCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCG-GGC---T-CT-------C--GCC-CG--GGG-CATTCTTCTGC-GG----G-CAGGCCAGCATCAGTTCGGGC-GGTTGG-ATAAAGGCCT-CCATCACGTATCT---TCCTTAACACGACCAGCCTGAACTGA-GGA-CCGCG-CA----T-C--A--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTAAAG-CCCGGGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGGGGAAA--CCCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAATTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCA--ATACCCCGCCGCTG-GGGCAGAA-A-TT-ATGCCCCAGCGAGTAGGCAGGCGTGGGGGCTTGCGACGAAGC--------------------------------------------------------------TTGGCCACATTGAGCTAGCAGTTCCCGTCTTTCACGTCGGT---TTCGTCGTTAAAATTAAGAAAATCCTCGAGACGGTTTGCCACAACTGTGGTCTTATCCTAGCCGACTAC-------CTGATTGGAAAGCTGCCATTCGCACCAAGGATGCAAAACGACGATTCGACACGATATGGCGCCTCTCTAAG---ATCAAGCGCGTCTGTGACGGGTCG---------ATACCCGAGGAAATAGCCCACGGCGGTTGTGGTCACAAACAGCCTGACGGCATCCGCAAAGAAGGCCTCAAGCTGACAGGTACTTGGAAG---------GCCAGC---AAGGACGACGAAGAGGACGAGAAGCGT---GTCATTACCCCACAGGACGCGCTCAACATTTTCCGTAACATCAGCGACTCCACACTCGCTTTGCTCGGCTTGAATGCCGATTATGCACGTCCTGAGTGGATGGTCATCACCGTCCTCCCAGTCCCTCCACCCCCTGTCCGCCCGAGTATCTCTGTTGATGGAACCGGCCAAGGTATGCGAGGAGAGGATGATCTCACATACAAACTTGGCGACATTATCCGTGCCAATGGTCGTGTCATGGATTGCATCCAACAAGGCTCACCGCAGCACGTTTTGACCGAGTTCGAAGCTCTCCTACAGTACCATGTTGCCACATACATGGACAACA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Ascochyta_pisi_CBS_126_54 --------------------------------------TGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-TACTTGTCCGGCCGGGCCTTTCCTTCTGGAGAACCTCATGCCCTTCACTG-GGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-A-------------------------------------------------------------------------------------------------------------------------------ACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCA-TTG-GCAGC-GGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTC--GCT--AGC--CT-TTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCG-GGT---T-TC-------T--ACC-CG--GTG-CACTCTTCTAT-AG----G-CAGGCCAGCATCAGTTTGGGC-GGTTGG-ATAAAGGTCT-CTGTCATGTACCT---CTCTTCATGCAACCAGCCTGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACAGTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCCCGCCGCTG-GGGCAGGA-T-TT-ATGCCCCAGCGAGTAGGCAGGCGTGGAGGTCCGTGACGAAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTACGCCTCCACATTGTCCCATCTGCGTCGAACAAACACACCAGTCGGTCGTGACGGCAAGCTTGCAAAGCCCCGCCAGTTGCACAACAGTCATTGGGGTCTTGTTTGCCCTGCTGAGACACCTGAAGGACAGGCGTGTGGTCTGGTCAAGAACTTATCTTTGATGTGCTACGTCAGTGTTGGTAGTGACGCT---------GGGCCAATCTCCGACTTCATGAGCCAGAGGAATATGCAACTCCTCGAGGAGTACGACCAGAATCAGAACCCTGATGCAACCAAGGTCTTCGTCAACGGTGTGTGGGTCGGTGTCCACTCCAACGCGCAGCAGCTTGTATCAACCGTGCAAGAACTGCGACGAAAC---GGAACACTGTCCTACGAGATGAGTTTGATTCGTGACATCCGTGACCGCGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGACCCTTGTTCGTCGTTGAGAGCGACGTTCGCAAGCCCAACCGCAACCACCTTGTCTTCAGCCAGGAACACTACAACAAGCTGGTCGCAGAACAGGTCGGTGAGGAGGAG------AAGACCGAG------CTCACCTACGGCTGGAAG---GGGCTTATCCAAGACGGAGTCATCGAATACCTCGACGCTGAAGAAGAAGAGACCGCCATGATTGTCATGTCTCCCGAGGACCTCGGTGAGTGGCGCGACATG---AAGATGGGCATTCCA------CAGGATGCTCGTAAAGACCGTCTTGCACGTATCAAGCCCAAGCCGGACCCTCGCATCCACGCCTACACGCATTGCGAGATTCACCCGGCTATGATTCTTGGTATTTGTGCCAGTATCATTCCCTTCCCAGATCACAACCAGTCGCCCCGTAACAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTATCTCCAAGGACGGCCAGACTCGTGAG-ACGCTCTCCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGCCCGTTTCTCCGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTCCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACCGGTAAGACCCTCCTCGAGGCCATTGACGCCATCGACACCCCCACCCGTCCCACCGACAAGCCCCTCCGCCTGCCCCTTCAGGACGTCTACAAGATTGGCGGTATTGGCACGGTGCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTTACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGCAGGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTGAACCACCCCGGTCAGGTTGGTGCTGGTTACGCCCCAGTTCTCGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGAAAGTCCACCGAGGCCAGCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCCCCT Ascocratera_manglicola_JK_5262C AAACTGCGAATGGCTCATTAAATCAGTTATCGTTCATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAGCCAATGCCCTTGGGGGCTCGTTGGTGATTCATGATAACTCAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGGATTGGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTCGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTCCTGGAGAGCCCCATGCCCTTCACTG-GGCGTGCGGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGGATACATTAGCATGGAATAATGGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCGATTGTCAGAGGTGAAATTCTTGGATTTATCGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTGTTTTGACTCGCTCGGCACCTTGCGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT-----------------ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGG-GACCCGAGTTGTAATTTGTAGAGGGCGCTTTGGCGATAG-GCTGC-GGCCCAAGTTCCTTGGAACAGGATGTCGTAGAGGGTGAGAGTCCCGTACGCGGCC--GCG--CGC--CT-TCGCCTTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAAATCTCTTCTAAAGCTAAATAACGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACATGCCCGCGGTCGCTCATCCG-GAC---C-CC-CCTAATT--GTC-CG--GTG-CAGTCTCCCGT-GA----G-CAGGCCAGCATCGGTCTGGGC-GGTTGG-ACAAAGGCCT-CGGGAATGTAGCTCCCCCCCCAATGCAGCCAGCCGAGACCGA-GGC-CCGCG-CG----TCG--T--GCTACGATGCTGGCGTAATGGCCGCAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCCATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGCAGTG-AGAGCGAATGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCAT-GGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGGA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATCTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-CCTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGAATGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCGCCGCCA-GGGCAGAG-G-GT-ACGCCCTGGCGAGTAGGCAGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAACGAATACCCCGGTCGGCCGTGACGGGAAGCTGGCGAAACCGCGTCAATTACACAACACACACTGGGGTCTGGTCTGTCCTGCCGAAACACCAGAAAGGCAGGCTTGTGGCTTGGTCAAGAACCTCTCATTAATGTGCTACGTCAGTGTGGGTACCGAGAGT---------ACGCCGATCACGGATTTCATGAGCCAACGAAACATGGAGATTCTGGAGGAGTACGACCCGCAAACATCGCCGAATGCGACCAAGGTGTTCGTCAATGGCGTTTGGGTCGGCGTGCATTCGCAGCCATCACAGCTCGTGTCTGTTGTACAGGAGCTGCGGCGCAAT---GGCACTCTGTCCTATGAGATGAGTCTTATTCGAGACATTCGAGATCGGGAATTCAAGATCTTCACGGACGCGGGTCGGGTTATGAGGCCTTTGTTTGTGGTTGAAACCGACCCTAGGAAACCTAACGTTGGCAGCCTTGTCCTGAACAAGACTCACATCCAGAAGCTTGAAGAGGACAAGATGAGCGATGAAGAC------GCCCAAGCG------CTGAAGTACGGCTGGCGA---GGTCTGATCAACGATGGCATCATCGAGTACCTCGATGCTGAAGAGGAGGAAACCGCCATGATCATCATGACGCCCGAGGATCTCGACGACCAC-GAAATCTC---AGGTCGGGCATGCCC------ATTCCCGACGGGCAGGATCGCCATAAGCGTATCAAACCGAGGCCGAGCGATTCCGTGAGGATGTACACGCATTGCGAGATTCATCCCAGCA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Asteromassaria_pulchra_CBS_124082 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTCATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCTTCTTGGTGATTCATGATAACTTAACAGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGAGCTCTTTAGGGTTTTGTAATCGGAATGAGTACAATTTAAATTCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTAATTTGCAGAGGGTGCTTCGGCG-TTG-GCAGC-GGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTC--GCC--CGC--CT-CCGCCGTGTGAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCG-GGC--AT-CT-------T--GCC-CG--GCG-CACTCTTCTGC-GG----G-CAGGCCAGCATCAGTTTGGGC-GACCGG-ATAAGGGTCT-CTGTCATGTATCT---CTCTTAGTACGGTCAGCCCGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGCAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAACGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTATTCCGCATTCTGTTCCTCAAGCTGACCAAAGATGTCTACAAGTACCTCCAGAAGTGCGTTGAAAACAACCAGGACTTCAACGTGCAGATGGCAGTAAAGGGCAGCGTTCTCACCAATGGCCTAAAGTATTCCTTGGCGACCGGTAACTGGGGAGACCAGAAGAAGGCTGCCTCGGCAAAAGCCGGAGTCTCACAGGTATTGAATCGTTACACCTATGCATCAACTCTCTCCCATCTTCGGCGGACGAATACCCCGGTCGGCCGTGACGGGAAGCTGGCTAAACCCCGACAGCTACACAACAGTCATTGGGGTCTGGTGTGCCCGGCTGAGACCCCCGAAGGACAGGCATGCGGTTTGGTAAAGAATCTTTCTCTCATGTGCTATGTCAGCGTCGGTAGCGAGAGT---------ACTCCAATCATCGACTACATGACGCAGAGACAAATGGAACTCCTTGAGGAGTTCGACCCGGTCATGAATCCGATGGCCACCAAGGTTTTCGTCAACGGTGTTTGGGTCGGAACACACAACAGTCCAGCAAACCTCGTTGCGAATGTGCAAGAGCTTCGACGAAAC---GGGACCCTATCCTACGAAATGAGCCTCGTCAGAGACATCCGTGACCGGGAATTTAAGATCTTCACGGATGCAGGCCGTGTCATGAGACCGCTTTTCGTTGTAGAGACCGATAAACGTAAACCCACCGTTGGCAGCTTGATATATAACAAATCACATCTTGCGCTACTTCAGACAGACTTGCTCAATGACGAGGAC------ACGATGAAC------AAGAAGTTCGGTTGGAGG---GGCCTCATCCATAGTGGTGTAGTTGAATATCTGGACGCAGAAGAAGAAGAAGGCGCAATGATCGTCATGTCTCCTGAAGAGCTGGATGAATGGCGCGACCTT---AAGCAAGGCCATTTA------GCACCCCCAGACAGGAACCGTCTTGGTCGCATCAAGCCAAAACCAAACCCTACAGTCGCTACCTACACGCACTGCGAAATTCACCCAGCCATGATTCTCGGCATCTGTGCCAGCATCATCCCGTCCCAGATCACAAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCTCGCATACACTCTCGGTGTTCGGCAGATCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCGAAGCACGTCCCCTTCGTTCCCATCTCCGGCTTCAATGGCGACAACATGATTGAGCCGTCTCCCAACTGCCCGTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGTCC---AAGTCTACCGGCAAGACCCTCCTCGAGGCCATCGACGCCATCGACCCCCCGTCCCGTCCTTCTGACAAGCCCCTCCGTCTGCCTCTCCAGGATGTGTACAAGATTGGTGGTATTGGCACGGTCCCTGTCGGCCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTGACTACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTCTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCGCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCCCCGGTTCTCGATTGCCACACCGCACACATCGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGAACTGGCAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGACGCCGCCATCGTCAAGATGCTTCCGTCCAAGCCCATGTGTGTT------------------------ Astrosphaeriella_aggregata_MAFF_239486 --------AATGGCTCATTAAATCAGTTATCGTTCATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTCCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGGATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACTCGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGAGAGCCCCATGCCCTTCACTG-GGCGTGTGGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTACTATTTTGACTCGCTCGGCACCT-------------------------------------------------------------------------------------------------------------------------------------------------------------CGAGTGAAGCGGCAAGAGCTTAAATTTGAAATCTGG-GGCCCGAGTTGTAATTTGGAGAGGGTGCTTTGGCG-TTG-GCAGCG-GTCCAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTACGTGGCT--GCA--GGC--CC-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGCAGCCAGACGTGCCTGCAGTTGCTCACCCG-GGC---C-AA-------C--GCC-CG--GGGC-ACTCTTCTGC-AG----G-CAGGCCAGCATCGGTCCGGGC-GGCCGG-ATAAAGGTCC-TGGGAACGTGGCT---CCCCCAATGCGGCCAGCCGGGACCGA-GGT-CCGCG-CG----T-A--T--GCTAGGATGCTGGCGTAAAGGCTGTGAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGACGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACGTTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCGCCGCCA-GGGCAGAG-T-TT-ATGCCCTGGCGAGTAGGCAGGCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCAATCTTTTCCGAGTACTGTTCCTCAAACTCACCAAGGACGTTTACAAGTACCTCCAGAAATGCGTGGAGAACAACCAGGAGTTCGACGTCCAGATGGCGGTAAAGGCTAGTGTGATCACGAATGGCCTCAAATACTCTCTCGCTACGGGGAACTGGGGTGACCAGAAGAAGGCAGCTTCAGCCAAGGCTGGTGTCTCGCAGGTGCTGAATCGGTACACCTACGCTTCGACCTTGTCACATCTTCGTCGAACAAATACCCCTGTTGGTCGTGATGGCAAGCTTGCCAAGCCACGTCAATTACACAATACACATTGGGGTCTAGTCTGTCCTGCCGAAACACCAGAAGGCCAGGCTTGTGGCTTGGTCAAGAACCTTTCATTAATGTGCTACGTCAGTGTTGGTACTGAGAGT---------ACACCAATCACGGATTTCATGAGTCAACGAAATATGGAAATCCTTGAGGAGTACGACCCAAGCAATAACCACGGTGCGACGAAAGTGTTCGTTAACGGAGTTTGGGTGGGCGTGCATTCACAGCCGTCACAGCTCGTATCTGTCGTGCAGGAACTCCGACGTAAT---GGCACCCTATCTTACGAAATGAGTCTCATTCGAGATATTCGAGATCGTGAGTTCAAGATATTCACGGATGCTGGTCGGGTCATGAGGCCTCTGTTTGTGGTCGAGACCGACCCTCGAAAACCCAATGTCGGAAATCTGGTTCTCAACAAGAGCCATATTCAGAAGCTTGAGGAGGATAAGATGAGCGATGAAGAA------GCTCAGACT------ATTAAGTTTGGCTGGCGG---GGTCTCATCAACGAAGGTGTTATAGAATATCTCGATGCTGAGGAAGAGGAAACCGCAATGATCATCATGACGCCCGAGGACTTAGATGATCACCGAAACCTC---AAGGCGGGTATGGCC------CTCCCTGATGGAGGATCGCCACAAGCGTATCAAACCGAAGCC---GAGCGCTCCGTCAGGATGTATACTCATTGCGAGATTCATCCTAGTATGATACTTGGATCTGCGCCAGT---------------------------------------------------------------------------------------------------------------------------------------------------C---ACGACTCGATCTATGGAGTACCTCAGGTTCCGGGAATTGCCGGCGGGTCAGAACGCCCTTGAGGCTATTGCGTGTTACACTGGATACAACCAGGAAGATTCCGTTGTCATGAACCAGAGCAGTATCGATCGTGGTTTGTTCAGGAGTCTGTTCTATCGCGCATACACGGAGCAAGAGAAGCGCATTGGTGTCAATGTCTTGGAACAATTCGAGAAGCCAACACGTGCGGACACGCTCAGACTAAAAGGTGGTACTTATGACAAGCTTGACGATGATGGTGTTGTTGCTCCTGGCGTTCGTGTCTCTGGAGACGACATAATCATCGGCAAGACGGCGCCTATCCCGCCTGATGCG------------------AAGGAGCTCGGTCAGAAGACAGCGCTGCACACAAAGCGTGATGTATCCACACCGCTTCGACAGACAGAGAACGGTATTGTTGATCAAGTCCTGTTCACGACTAACACGGAAGGCCTCCGTTTCGTGAAAGTCCGTACGCGAACTACGAAAGTTCCGCAGATTGGCGACAAGTTCGCCTCACGTCACGGTCAAAAAGGTACTATCGGTATCACGTACAGACAGGAAGACATGCCCTTCACTCGAGAAGGTCTCACC-------------------------------CTGACTGCGCCATTCTCATCATTGCCGCTGGTACTGGTGAGTTTGAGGCCGGTATCTCCAAGGATGGTCAGACTCGTGAGCACGCTCTTCTCGCCTATACCCTTGGTGTCAAGCAACTCATCGTTGCCATCAACAAGATGGACACCGCCAAATGGTCTGAGGAGCGTTTCAATGAGATCATCAAGGAGACCAGCAACTTCATCAAGAAGGTCGGGTACAACCCCAAGACTGTTCCCTTCGTTCCAATTTCCGGCTTCAATGGTGACAACATGATCGATGTCTCCACCAACGCCCCATGGTACAAGGGCTGGGTGAAGGAGACC---------------AAGACC---AAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACAGCATTGACCCCCCAAGCCGTCCCTCGGACAAGCCTCTTCGCCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACTGTCCCCGTTGGCCGTGTCGAGACTGGTATCATCAAGGCTGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTCACCACTGAAGTGAAGTCCGTTGAGATGCACCACGAACAGCTTGTCCAGGGTGTC---CCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCGCCAAAGGGTGCCGAGTCCTTCAACGCCCAGGTTATTGTCCTCAACCACCCCGGCCAGGTCGGTGCTGGTTATGCTCCTGTCCTTGACTGCCACACTGCCCACATCGCCTGCAAGTTCTCTGAGCTCTTGGAGAAGATCGACCGACGAACTGGCAAGTCTGTCGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCTGCCATCGTCAAGATGATTCCGTCCAAGCCCA-------------------------------- Astrosphaeriella_bakeriana_CBS_115556 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGCGAGTGAAGCGGCAGCAGCTCAAATTTGAAATCTGG-GGCCCGAGTTGTAATTTGCAGAGGGCGCTTCGGCG-TCG-GCCAT-GGCCTAAGTCCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTACGTGGCC--GCC--GGC--CT-TCGCCATGTGAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCAGCCC-GGC---C-TC-G-----C--GCC-TG--GCG-CACTCTTCTGC-GG----G-CAGGCCAGCGTCAGTTCGGGC-GGCCGG-ATAAAGGCCC-CGGGAATGTAGCT---CCCCTAATGCGGCCAGCCCGGACTGA-GGT-CCGCG-CT----C-C--G--GCTAGGACGCTGGCGTAATGGCCGCAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGCAATG-AAAGTGAACGGAGGTGGG-ACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACACTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCGCCGCCA-GGGCAGAA-G-TT-ACGCCCTGGCGAGTAGGC--------------------------------------------------------------------------------------------------------------CAGTCTTTCACGTCGGC---TTCATCGTCAAGATCAAGAAGATATTGGAGACTGTGTGCCATAACTGTGGGCTGATTTTGGCTGACTATAATCATCCTGATTTCAAACAATCCCTCAAGATCCGTGATCCGAAGAAGCGATTCGATGCTATCTGGCGGTGCTCAAAG---ACAAAGCATGAGTGTGTTATTGAT---------GTGGCCGAGGAGATCTTACACGGCGGCTGTGGCAATAGGCAACCAGACGCCATCAGGAAAGAGGGCTTGAAGCTCACGGCCACTTACAAG---------CCGAAG---AAAGATGACGACGAGGAGGAGAAGAAG---CCCATCACGCCCCAAGATGCCCTCAACATCTTCCGGAACTTGACTGACCAGACTCTCCACCTCCTCGGACTGAATGCCGACTATGCCCGCCCAGAATGGATGGTCATCTCAGTACTGCCAGTCCCTCCGCCTCCGGTCCGTCCTAGCATCTCCGTCGATGGAACTGGCCAAGGCATGCGTGGAGAAGACGACTTGACCTACAAGTTGGGCGACATCATCCGTGCCAATGGCCGTGTGGCCGAGTGCATTACTCAGGGTGCCCCACAGCACGTCCAAAATGAGTTTGAGACTCTCCTACAGTATCACGTTGCTAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGACTGCGCTATCCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGTCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTTGGTGTGAAGCAACTCATTGTTGCCATCAACAAGATGGACACCACCAAGTGGAGTGAGGAGCGTTTCAACGAAATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACCGTCCCCTTCGTCCCCATCTCTGGTTTCAACGGTGACAACATGATTGAGCCGTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGTCC---AAGGCCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGACCCCCCAAGCCGTCCCTCCGACAAGCCCCTCCGTCTGCCTCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTCCCAGTCGGCCGTGTCGAGACCGGTACCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGCGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAACAGCTCTCCGAGGGTGTT---CCCGGCGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAAATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGAATGACCCGCCAAAGGGTGCCGAATCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAAGTCGGTGCTGGTTACGCCCCTGTGCTGGACTGCCACACCGCCCACATTGCCTGCAAGTTCTCCGAGCTCTTGGAGAAGATCGACCGCCGAACTGGAAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTTAAGATGATTCCCTCCAAGCCAATGTGCGTTGAGGCTTTCACCGAGTACCCACCG Astrothelium_cinnamomeum_DUKE_0000007 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACCCACTGAACTTAAGCATATCAATAAGTGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTTAAATCTGCCCGGCCGAGTTGTAATTTGCAGAGGATGTCATGGGA-TTT-GTGCG-GACTCAAGTTCTTTGGAAAAAGACGCCATGGAGAGTGACAGTCTCGTCC-TGTC---CAC--CAC--AC-TTCCCTCGTATGACTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGACGTAAATTTGTTCCAAAGCTAAATACCGGCTAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCTTATGTTATCAGAGATGACGGCA-ATGTTCAGCC--------T-TT--------------TG--GTG-TATTCATTGCTT-G----T-CAAGCTAGCATCAATTGGGGT-AGCTGG-ATAAAAGTGT-CGGAAATGTAGCT---CCCCCAATGCAGCTAATCCCGATTGA-GGA-CCGC--TA----T---------CAGGATGCTGGCATAATGGTAGCATGAGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTT-TTTGAGTGACAAA-CTCATGAGCGTAATG-AAAGTGAACGGAGGTAGGAGCCGGCGCACTAT-CGA-CCGGTCTTGAAGTTTACGGATGGATCTGAGTATGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CGTGAG--T-AGGGTGAAGT-CAGAGGAAA--CTCT-GATGGAGGCTCGTCAGCGTCTTAACGTGC--AAATTAGTGCTT-AAACTTGCGCATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TCTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATG-AAAC-ATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAATTGAACGTGGACACTCGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCAAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAATCTGTCAGTGCATCCTGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGCACTGGCGATGAAAATGGA-TGGCGCTT-AA-GCGTATTACCC--ATACCTTGCCATTA-TTGCAGGT-G-CG-ATGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Aulographina_pinorum_CBS_174_90 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-ATGTTACTATTTTGACTCCATCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTC-------------------------------------------------------------------------------------------------------------CAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGG-CAG-CGGCC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATC--GG---TTG--GC-ACCCGCTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCCGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TACTC-GCCGC-GG----G-CAGGCCAGCATCATCTGGGAG-CGCCGG-ATAAAGGTAG-CGGGAATGTGGCC---CCTC-AATACGGCGCCTCCCGGGTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTATGC-GCCCGTC-TTGAAACACGGACCAAGGA-TCTACCATCTATGC-AGTG-TTCGGGTGTCAA---CCCTAC-CGCAAT---AAGTGAACG-AGGT-GGAACCGGTGCACCAT-C-A-CCGATCCTGA-GTCTT--GATGGA-TT-A-TAA-AGCAT-AGCTGGT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AATGCGTGCTACCC--ATACCTCGCCGCCATGGGTAGAA-ATCG-ATGCCCTGGCGAGTAGGCAGG--------------------------------------------------------------------------------------------------------------------------------------------TCAAGAAGGTCCTGGAGTCG-TGTGCCACAAC---T-CTTGATCAAGCCCGACGAGCGCAACAACCAGTTTGCGCAAGCCATCCGTCTCCGTGACCCCAAGCGCCGCTTCGAAGCCGTGCACAAGATCTGCAAG---CCCATCACCACCTGCGAGCCCGAC---------GCACCAGCAGAAAAGGGCCATGGCGGATGTGGTAACCAGCAGCCTGTC---ATTCGTAAAGAGCAGCTGCGGTTACATGGCTCCTACAAG---GCG---GCCAAG---TCGGATGAAGAGGAGCCGGAGAAGGTT---GCTATCACGCCGCAGTATGCGCTGAACGTCTTTCGCAACATCTCTGACGAGGACATGGCGAGACTGGGCTTGAACGGCGACTACGCTAGGCCAGAGTGGATGGTGCTTACTGTGCTGCCTGTCCCGCCTCCTGCTGTGCGCCCTTCGATCTCGGTCGACGGTACGAGCCAGGGTATGCGCTCCGAGGATGACTTGACCTACAAGCTCTCGGACATCATCCGCGCCAACTCCAACGTTCGGCGCTGCGAGCAGGAGGGCTCGCCACCGCATGTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTCTTCCGGTTGAAGTTCGCACAGCTGGTGAAGGATGTACGGCAGTACCTCCACCGCTGTGTCGAGTCGAACCGCGACTTCAACATCACACTCGCGGTGAAGAGCAATATCATCTCATCCGGCTTACGGTACTGTCTCGCAACAGGAAACTGGGGCGACCAGAAGAAGGCCGCGTCTGCGAAAGCGGGTGTCAGTCAGGTGCTGAATCGGTATACCTACGCCTCCACACTTTCACATTTGCGGCGGACAAACACGCCTATAGGCAGAGACGGCAAGATCGCGAAGCCACGGCAGCTGCACAACACCCACTGGGGCTTGGTGTGCCCTGCCGAGACGCCTGAAGGGCAGGCTTGTGGTTTGGTGAAGAATCTGGCACTGATGTGCTACGTCTCCGTCGGCACGCCTGGC---------ACCCCTCTCATCGAATACATGCGACACAGAGGCATGGAGCTGCTCGAGGAGTACGATGCCATCATGAATCCAAACGCCACGAAAGTCTTCCTGAACGGCACATGGGTGGGCGTGCACACCAACGGCAAAGCGCTCACTGACGCTATTCGCGACCTGCGGAGGAAG---CAGGTCATTGGCTTCGAGATCACAATCATCCGTGACGTCCGCGAGCGGGAGGTCAAGGTCTTTACCGACGCTGGAAGAGTGATGCGGCCGCTTTTTGTGGTGAACACTGATAAGCGGTCTCCGGACTTCGGCAGTCTGGCGTTGAAGCAGGAGCATGTGGCTAGGCTTCAACAAGATCAGATCAGTGAAGATGAG------AAAGCAGAT------GCTACTTTCGGGTGGAAG---GGCCTCATCAAGAACGGTGTCGTTGAGTTCCTCGATGCTGAAGAAGAAGAGACGGCCATGATCATCATGACGCCCGACGACCTCGAAGACTACAAGTCGGTC---AAGTCTGGCATACCC---------TGGGTTGAGGACGACCCACACCGTCGTATCAAATCCAAGCCGAACACGCAAGTCGCGCAGTGGACGCATTGCGAGATTCACCCGGCCATGATCTTGGGTATTTGCGCCTCCATCATTCCCT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATGGACACCACCAAGTGGTCCGAGGACCGCTACAACGAGATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTCCCGATCTCCGGCTTCAACGGCGACAACATGATCGACGCATCCCCCAACTGCCCGTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCGACCGGCAAGACCCTCCTCGAGGCCATTGACGCTATCGACCCACCGCAGCGCCCGACCGACAAGGCTCTCCGTCTTCCCCTTCAGGACGTTTACAAGATTGGTGTCATTGGGACCGTTCCGGTCGGCGGTGTCGAGACCGGTGTCATCAAGGCCGTCATGGTCGTTACCTTCGCCCCGGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACCGAGGGTCTC---CCGGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCGCCAAAGGGCTGCGACTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCGGGTCAGGTCGGTGCCGGTTACGCTCCAGTGCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCTCGAGAAGATCGACCGTCGTTCCGGCAAG--------------------------------------------------------------------------------------------------------- Aulographina_pinorum_CBS_302_71 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAGAATCTGGCACTGATGTGCTACGTCTCCGTCGGCACGCCTGGC---------ACCCCTCTCATCGAATACATGCGACACAGAGGCATGGAGCTGCTCGAGGAGTACGATGCCATCATGAATCCAAACGCCACGAAAGTCTTCCTGAACGGCACATGGGTGGGCGTGCACACCAACGGCAAAGCGCTCACTGACGCTATTCGCGACCTGCGGAGGAAG---CAGGTCATTGGCTTCGAGATCACAATCATCCGTGACGTCCGCGAGCGGGAGGTCAAGGTCTTTACCGACGCTGGAAGAGTGATGCGGCCGCTTTTTGTGGTGAACACTGATAAGCGGTCTCCGGACTTCGGCAGTCTGGCGTTGAAGCAGGAGCATGTGGCTAGGCTTCAACAAGATCAGATCAGTGAAGATGAG------AAAGCAGAT------GCTACTTTCGGGTGGAAG---GGCCTCATCAAGAACGGTGTCGTTGAGTTCCTCGATGCTGAAGAAGAAGAGACGGCCATGATCATCATGACGCCCGACGACCTCGAAGACTACAAGTCGGTC---AAGTCTGGCATACCC---------TGGGTTGAGGACGACCCACACCGTCGTATCAAATCCAAGCCGAACACGCAAGTCGCGCAGTGGACGCATTGCGAGATTCACCCGGCCATGATCTTGGGTATTTGCGCCTCCATCATTCCCTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Aureobasidium_pullulans_CBS_584_75 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTAAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT--------------------------------------------------------------------------------------TCAAATTTGAAAGCT-G-GGTTCGCATTGTAATTTGTAGAGGA-GATTTGGGG-AAG-CCGCC-TGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACA--GGAA-ATG--GC-ACCCTATGTAAATCTCCTTCGACGAGTCGAGTTGTT---GAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTTA-AACTGTTCGGCCG-GTC---T-TC-------T--GAC-CG--GTT-TACTCAGTT-T-GG----A-CAGGCCAGCATCAGTTTCGGC-GGCCGG-ATAAAGGCTC-TGGGAATGTGGCC---TCCACAATACGGCCAGCCGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTAT-GTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCTCGCCGCTA-CAGTAGAT-T-CG-ACGC------------------------------------------------------------------------------------------------------GGTCATATTGAGCTTGCCGTGCCCGTCTTCCACGTCGGT---TTCGTAACAAAGATCAAGAAGATTCTGGAGTCCGTCTGTCACAACTGTGGCAAAGTCTTGCTTGATGAAAGCGTACCCGCCTTTGCCCAAGCCGTCCGCCTAAGAGATCCCAAGCGCCGTTTCGACGCTATCCACAGATTGTGCAAA---GCCAAGACGACCTGTGACCCCGAT---------GAGGCGCCCGAACGATCACATGGCGGTTGCGGTAACCTGCAACCCACC---ATCCGCAAGGACGGTCTCAAGCTTACCGGTACCTGGACC---TAC---CCCAAG---GATGCAGACTCGGAGCAGGACAAGAAG---CTCATCACACCTCAAATGGCTCTCAACGTCTTCCGCAACATCTCGACATACGACCTGGCCAGAATGGGTCTCAATGCAGACTACGCTCGTCCTGAATGGATGATCCTGACTGTTCTACCTGTCCCACCGCCCGCAGTTCGCCCCAGTGTTTCGGTAGACGGTACCAACCAGGGCATGCGCTCTGAGGATGATTTGACCTTCAAACTTAGTGATATTATTCGCGCCAACGCCAATGTCCGCAAGTGCGAACTCGAGGGCTCACCACACCACGTTATTGCAGAGTTCGAGGCATTGCTGCAATTCCACGTCGCCACATACATGGACAACGACATTGCAGGACAGCCCAAGGCCCTCCAAAAGTCGGGTAGACCTGTCAAGGCTATTCGTGCGCGCCTGAAGTCCAAGGAGGGTCGTCTCCGTGGTAACCTTATGGGAAAACGTGTCGACTTCTCGGCCCGCACTGTCATCACTGGTGATCCCAACCTGTCTCTGGACGAAGTCGGCGTTCCCAGGAGTACCGCCCGCATCCTCACCTTCCCTGAAACTGTCAACGCTTTTAACATCGACAAGCTGCAACAACTCGTTCGAAACGGTCCCAATGAACATCCCGGAGCAAAGTATGTCATCAGACATACTGGCGAGCGT------------------------------------------------------------------------------------------------------------------------------------------TTTAATCTCACACTTGCTGTCAAGTCAAACATCCTCACATCTGGTCTGCGCTATTGCTTGGCCACTGGCAACTGGGGTGATCAGAAAAAGGCAGCCTCGGCAAAGGCCGGTGTCTCCCAGGTGCTGAACCGATACACATACGCTTCTACACTATCACATTTGCGACGAACGAATACTCCCATCGGTCGTGACGGAAAAATCGCCAAGCCTCGCCAATTGCACAACACCCATTGGGGTCTTGTGTGTCCCGCAGAAACACCTGAAGGACAGGCTTGCGGTCTGGTCAAGAACTTGTCTCTCATGTGTTACGTCAGTGTTGGTACGCCTGCC---------GAGCCCATCGTCGAGTTCATGAACCAGCGAAACATGGAATTGCTCGAAGAGTATGAGCCCAAGAACAACCCGGATGCCACAAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTCCACAGAGACCCCTCTCAGCTCGTCAAGGTTGTGCAAAGTCTCCGCCGTAAC---GGCACCATCTCTTTCGAAATCTCACTCATCAGAGATGTTCGTGAGCGAGAGTTCAAGATTTTCACTGATGCTGGTCGTGTCATGAGACCGCTGTTCGTTGTCAACAATGACCCTGCAAGTCCGACCAAGGGTCAGCTTACCCTGAACAGATCTCACATTTCTCAGCTGCTTAATGCACGCCTTAGCGAAGAGGAG------CGCGACGGT------ACAATTTATGGCTGGAAG---AACTTGATCAGTGATGGTGTCGTTGAGTACCTCGATGCCGAGGAAGAAGAGGTTGCCATGATGGTCATGTCACCTGAAGACCTCGACGAGCATCGCCAGATG---AGAGCTGGACTC---------GTCTATGAAGAGACTGACCCTCATCGAAGAATCAAGAGCAGGCCAAACGCCAACGTTAGAACATGGACTCATTGCGAGATTCACCCTGCCATGATTCTTGGTATTTGCGCTTCCATTATTCCTTTCCC-GATCACAACCAGTCGCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACTGCGCCATTCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTCCTCGCCTACACCCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGCCCGTTACCAGGAGATCATCAAGGAGACCTCCGGTTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGAGACAACATGATCGAGGTCAGCTCCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGACC---------------AAGACC---AAGTCCACTGGCAAGACCCTCCTCGAGGCCATTGACGCCATCGACACTCCTTCCCGCCCTACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGGCACGGTGCCCGTCGGTCGTGTTGAGACCGGTAAGATCATGGGTGGTATGGTTGTCACCTTCGCCCCCGCTGGTGTCACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGTCTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTTGCGACTCCTTCAACGCCCAAGTCATCGTCCTGAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTTGTTGAGAAGATTGACCGCAGAACCGGCAAGTCCGTTGAGGCTTCCCCCAAGTTCATCAAGTCTGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGTGTTGAGGCTTTCACCGACTACCCTCCT Bagnisiella_examinans_CBS_551_66 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTCCTGGGGATCCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGT---------------------------------------------------------------------------------------------------------AACCCACAGGGATTGC-TCAGTAACGGCGAGTGAAGCGGC-ACAGCTCAAATTTGAAATCTAG-GGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGCG-AGG-GCTCC-CGTCTAAGTTCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGTGATG--GGT--TGC--TC-GAGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGTTCAGCCG-GTC---T-CC-------T--GAC-CG--GCG-TACTCTTCTGC-GG----C-CAGGCCAGCATCAGTTCGGGC-GGCTGG-ATAAAGGCCT-CGGGAATGTGGCT---CTCTTAATGCAGCCAGCCTGGACTGA-GGA-TCTCG-CT----T-C--G--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCATACGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATTTCGGTCATATTGAACTGCACACGCCAGTATTCCACGTTGGT---TTTATCAACAAGATTAAGAAGCTGCTCGAATGTGTATGTCACAACTGCGGTAAGATTTTGACTGATGAACATGACTCGGGATTCAATGACGCCCTGCGATTTCGGGATCCGAAGAAGCGCTTCGAGGCGATATGGAAGGCCACCAAAGGCAAGAAAGGCAAATGTGACCCGGAT---------GACCCTCCAGACCGTAATCATGGCGGATGTGGCAATAAAATGCCAGAG---ATCCGTAGGGAGGGTCTAAAGTTGATGGGTACTTGGAAG---CCA---ACCAAG---GGAGAAGAAGAAGAGCCCGAGAAGCGC---GCCATCAAGCCCCAGGAAGTCCTGAACATCTTCCGCCTTCTCACCGACGAGACCTTGACTGTCCTGGGTTTGAACATCAAGTTTGCCCGTCCTGAGTGGATGGTGCTCACCATGTTGCCCGTTCCTCCTCCACCTGTCCGTCCTAGTATCTCGGTTGATGGTACCGGTCAGGGCATGCGCGGTGAAGATGACCTGACTTACAAGCTGGCCGATATCATCCGTGCGAATGCTTCCATCAAGCGTTGCTACAGCGAAGGTGCTGCACAGCATGTCATTGACGATTTCGAGACCCTTTTGCAATGGCACATTGCAACATACATGGACAACGA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCGGTCTCTTTTCTTGAAGTTGACCAGGGATATCTACAACTACTTGAAGAAGTGTGTTGAGAGTGGCCGTGTTTTCTCCCTGCAATCCGCAGTGAAGCAGGGTACGATCACAAACGGTCTCAAGTACTCGCTCGCCACCGGAAACTGGGGCGACCAGAAGAAGGCCGCCGCTAGCAAGGCTGGTGTGTCTCAGGTGCTGAACAGATATACCTACTCATCCACGTTGTCGCATCTTCGGCGCACGAACACCCCAATTGGCCGTGACGGTAAGATCGCCAAGCCTCGTCAATTGCACAACACCCATTGGGGACTGGTCTGCCCCGCCGAGACGCCAGAAGGACAGGCCTGTGGTCTGGTCAAGAACCTGTCGCTCATGTGCAATGTCACTGTCGGTAGCGACGTC---------ACTCCCATTGCCGACTTCATGACCCAGCGGAACATGGAGCTCCTGGAAGAGTTTGACCCTGCCGTCACCCCTAATGCCACCAAGATTTTCATCAACGGTGTCTGGGTCGGTGTGCACCGCGATCCGACGCAGCTTGTCTCGGTCGTTCGCAGCCTGCGCAGAGAC---GGCACCTTGTCCCCGGAAATGAGTTTGATCCGAGATGTCCGTGACCGTGAATTCAAGATCTTCACGGACGCTGGGCGCGTGCAAAGGCCGCTGTTCATTGTTGACGACGACCCGAAGAGTCCTAACAAGGGCAACCTGACTCTGAACAGAGAGCACATTCAAAAACTCGTTGATGACCGGATGGACGATGAGGAG------CGTGAGAAC------GCGAGGTTTGGCTGGAAC---GGACTGCTGCGCTCTGGCGTGGTCGAATATATGGATGCCGAAGAAGAAGAAACGGCTATGATTGTCATGACGCCAGAGGATTTGGAAGAGCACCACCGAATC---CGGACCGGCCAGCCG------AAAGAGGAGGAAAGAGATCCCCACAAGCGTGTCAAGCCTGAGCCGAGCAAGTCGATCAAGACCTACACGCACTGTGAGATCCATCCTAGCATGATTCTCGGTATTTGTGCCAGTATCATTCCGTTCCCCGACCACAACCAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGCCATTCTCATCATCGCCGCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACCGGCAAGACCCTCCTCGAGGCCATCGACAACATCGACGCCCCCGTCCGTCCCTCCGACAAGCCCCTCCGCCTGCCCCTCCAGGATGTCTACAAGATTGGCGGCATTGGCACGGTCCCCGTCGGCCGTGTCGAGACCGGTACCATCAAGGCCGGCATGGTCGTCACCTTCGCCCCCGCCGGTGTCACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCCCCCAAGGGCTGCGACTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTTGGTGCTGGCTACGCTCCGGTTCTGGACTGCCACACTGCCCACATCGCCTGCAAGTTCTCTGAGCTGCTCGAGAAGATTGACCGCCGTACCGGCAAGTCCATTGAGAACTCCCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATGATTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACCGAGTACCCCCC- Batcheloromyces_proteae_CBS_110696 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTCAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACGCGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTCGCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-ATGTTCCTATTTTGACTCCATCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCAGGG-CAG-CGGCC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACC--GG---TTG--GC-ACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCCACCAGACTTGTCGGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TACTC-GCCGC-CG----A-CAGGCCAGCATCATCTGGGGG-CGCCGG-ATAAAGGCGC-GGGGAATGTGGCT---CCCT-AATACGGTGACCCTCGGGTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTTTGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGGAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGCTG-AAAC-AGCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCGC-TTGTTACTTAGTTGAACGTGCGCATTCGAATGTAGCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCTCGCCGTCG-GGGTAGAA-A-CG-ATGCCCCGACGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGCCTTGGGGGTGACCCCGGGTCGAACGGCCTCTAGTGCAGATCTTGGT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Beverwykella_pulmonaria_CBS_283_53 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTAG-GGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCG-TCG-GCAGT-AGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGCT--GCC--TGC--CT-TCGCCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCATCTG-GGG---T-TT-------T--CCC-CA--GTG-CACTCTTCTGT-GG----G-CAGGCCAGCATCAGTTCAGGC-GGTTGG-AGAAAGACCT-GTGTCATGTAGCT---CTCTTAATGCAACCAGCTTGAACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGT---TGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTTCTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCCCGCCGCCA-GGGCAGAA-A-TT-ATGCCCTGGCGAGTAGGCAGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTCCCATCTCCGTCG-ACTAATACCCCAGTCGGTCGTGATGGAAAATTGGCCAAGCCCCGTCAATTGCACAACACGCATTGGGGCTTGGTTTGTCCCGCCGAGACTCCGGAAGGGCAAGCTTGTGGCTTGGTGAAGAACCTGTCATTGATGTGCTACGTCAGTGTCGGTAGTGAGAGC---------ACTCCTATCACGGATTTCATGAGCCAGCGAAACATGGATCTGCTCGAAGAGTACGACCCAGTTGTCAACCCCAACGCCACCAAGGTCTTCGTCAACGGTGTTTGGGTGGGTGTGCATTCGGCACCATCACAGCTCGTCGGCGTTGTGCAGGAGCTCCGGCGGAAC---GGAACTTTGTCCTACGAAATGAGTCTTATTCGAGACATTCGAGATCGAGAGTTCAAGATTTTCACTGACGCTGGCCGAGTCATGAGACCTTTATTCGTTGTCGAGACCAATTACCAAAAGCCTAATCGTGGACACCTTGTCCTGAACAAGACACACATCCAGAAGCTGCTTGATGATAGTCTGAACGATGAAGAC------ACCGCGAAC------GCGAAATTCGGTTGGAGA---GGTCTGATCCATAGTGGCGTGGTCGAATACCTTGATGCTGAGGAAGAAGAAACCGCCATGATTGTCATGACACCCGATGATTTGGTAGAGTGGCGAGATCTC---AAATCAGGACATGCA------CCGATGGATGCAAATGACCGACACAGGAGGGTCAAGCCGAAGGCCAATCCTTCCATACACGCCTACACACATTGCGAGATCCACCCCAGCATGATTCTCGGCATTTGCGCCAGCATCATTCCATTCCCTGACCACAATCAATCTCCTCGTAACACCTACCAGTCGGCCATGGGTAAACAAGCCATGGGTGTTGCCCTTACGAATTACGCGCTGCGCATGGAAACCATGATGAATGTCCTCTATTACCCTCAGAAGCCTTTGGCCACAACCCGATCTATGGAGTATCTCAAATTCCGAGAACTGCCTGCAGGTCAAAATGCCATTGTCGCCATCGCCTGCTATTCCGGATACAATCAGGAAGATTCCGTTGTTATGAATCAAAGCAGTATCGATCGAGGTCTGTTCAGGAGTCTCTTTTACCGCTCTTATACCGAACAGGAAAAGCGCATTGGTGTCAATGTTCTGGAGCAGTTTGAGAAGCCTACTCGTGCCGATACCCTCAGACTGAAGGGCGGAACTTACGACAAGCTCGATGACGACGGTGTCGTTGCTCCTGGTGTTCGTGTGTCAGGTGATGATATTATCATTGGAAAGAC-GCTCCTATCCCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Bimuria_novaezelandiae_CBS_107_79 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATA-CCTTACTACAT-GGAATACCTGTGGAAAATCTAGAGCTAATACATGCTAAAAGCCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCTCCTTGGTGATTCATGATAACTTCTCGGATCGCAT-GGCCCTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTAGTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATTCCGACTAGGAGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCGGGTCCGCCTCACCGCGTG-CACTCGTCCGGCCGGGCCTTTTCTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-GTGTTTCTATTGTGACCCGCTCGGCACCTTACGAGAAATCA-AAGTGTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT-----CTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACAAACATGGATAGCCCTAGTAACGGCGAGTGAAGCGGCTACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCG-TTG-GCGGC-GGTCTAAGTTCCCTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGC--GCC--TGC--CT-TCGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAATTGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGT-CAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCA-GGC---T-CC-------G--GCC-TG--GGG-CACTCTTCTGC-GG----G-CAGGCCAGCATCGGTTCGGGC-GGTCGG-ATAAAGGTCT-CTGTCACGTACCT---CCCTTAATGCGACCAGCCCGGACCGA-GGT-CCGCG-CA----T-C--T--GCCAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTGCGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCGCCGCTG-GGGCAGAC-G-TT-ATGCCCCAGCGAGTAGGCAGGCGTGGAGGTCCGTGACGAAGCCTTGGGGGTGACCCCGGGTAGAACGGCCTCTAGTGCAGATCTTGGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAT-G-GTGACCAGAAGAAGGCTGCGTCGGCCAAGGCTGGTGTGTCGCAGGTGCTAAATCGGTACACCTATGCATCCACGCTTTCCCATCTTCGGCGAACGAATACACCCGTTGGCCGTGACGGCAAGCTGGCCAAACCGCGCCAGCTTCACAACAGTCACTGGGGTCTTGTATGCCCCGCTGAAACGCCCGAAGGACAAGCTTGTGGGCTCGTCAAGAACCTCTCCCTCATGTGCTACGTCAGTGTGGGCAGCGAAAGC---------GCACCCATCATTGACTACATGACAGGTCGCAACATGAATCTGCTTGAGGAGTACGATCCGATGATGAACCCAACGGCCACCAAGGTCTTTGTGAATGGTGTCTGGGTGGGAACACACGACAACCCGCAGCAGTTGGTGTCCAATGTTCAAGAACTTCGCCGAAAT---GGAACGTTGTCATACGAGATGAGCTTGGTTCGCGACATTCGAGATCGAGAGTTCAAGATCTTCACAGACGCTGGTCGTGTTATGAGGCCGCTGTTCACTATCGAGAATGACACTAAGAGGCCAAACCGAAATCACCTGATTTTCAGTCGCACTCATCTGGATAAACTTCTAGCTGACAAACTCAATGAGGAAGAC------CGAGACAGT------CGAACATATGGTTGGAAG---GGTCTGCTCCATGATGGTTGTGTTGAATACCTCGACGCTGAGGAAGAAGAAAGCGCCATGATTGTCATGACGCCTGAGGATTTGAACGACTGGCGCGATGTAGTGAAAGAGGGCATGCCT------GAAGCCGAAAAGGCCCTACGCCTCGCGCCTCTCAAACCGCCTGTCAATCGCAAGGTCAATGCGTTCACACATTGCGAGATTCATCCTGCCATGATACTTGGCATCTGCGCGAGTATCATTCCATTCCCGGATCACAACCAGTCTCCTCGTAACACCTACCAGTCGGCGATGGGTAAACAAGCGATGGGTGTCGCAATCACAAACTACGCCTTGAGTATGGAAACGATGATGAA-GTCCTGTACTATCCTCAGAAGCCTTTGGCCACCACGCGGTCCATGGAGTACCTCCGGTTCCGTGAGCTGCCTGCTGGACAAAACGCTATTGTGGCCATTGCTTGTTACTCGGGATACAACCAGGAAGATTCCGTCATTATGAACCAAAGCAGTATCGATCGTGGTCTATTCAGGAGTTTGTTCTACCGCGCATACACTGAGCAAGAGAAGCGCATCGGTGTAAATGTTCTAGAGCAGTTCGAGAAACCGACGCGCATGGATACGATGAGGATGAAGGGTGGCACGTACGACAAGCTTGATGACGACGGCATCGTCGCGCCAGGTGTTCGTGTCTCGGGTGACGATATCATCATCGGCAAGACGGCACCTATTCCCAACGATGAG---------------AACAAGGAGATGGGTCAGAAGTTGGCCAACCACACAAAGCGCGATGTGTCAACTCCGCTGCGAAGTACTGAGAACGGTCTTGTT-ACCAAG-GGT----ACCACCAACACCGAAGGCTCA-G-TTCGTCAAAGTG-GTACGCGAACG-CAAAGGTTCCACAGATTGGTGATAAATTTGCCTCT-GTCACGGTCAGAAAGGTACTATTGGTATCACATATCGTCAAGAGGACA---------------------------TCAAGAACATGATCACTGGTACCTCGCAGGCTGACTGCGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTTGCCTACACTTTGGGTGTCAAGCAGCTCATCGTTGCTATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGTTTCCAGGAGATCATCAAGGAGACCTCTTCCTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGCTTTAACGGCGACAACATGATTGAGTCCTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGGCTACTGGCAAGACCCTCCTTGAGGCCATCGACGCCATCGACACCCCGGTCCGTCCCTCCGACAAACCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACCGGTGTCATCAAGCCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTGACTACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGTCTC---CCGGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATTCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCGAAGGGTGCTGAGTCCTTCAACGCCCAGGTCATCGTTCTCAACCACCCTGGTCAGGTCGGTGCTGGTTACGCTCCCGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAATCTTCTCCCAAGTTCGTCAAGTCTGGTGATGCCGCTATCGTCAAGATGATTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGAGTACCCGCCC Botryosphaeria_dothidea_CBS_115476 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATTAACTTTCGATGGTAGGATAGAGGCCTACCATGGTATCAATGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGG-TGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGATCCGCATGGCCTTCACTG-GCTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTCTTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGGATTGACGGAAG-------------------------------------------------------------CAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGG-AGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCA-AGG-GCTCC-CGCCTAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTATGCGGTG--GGC--TGC--CT-AAGCCATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCG-GTC---T-CC-------T--GAC-CG--GTG-TACTCTTCTGC-GG----C-CAGGCCAGCATCAGTTCGGGC-GGTCGG-ATAAAGACCT-CGGGAATGTAGCT---CCTCTAATGCGGCCAGCCTGGACTGA-GGA-TCTCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCATGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGATGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACATCGCCGCCA-GGGTAGAT-A-CG-ATGCCCTGGCGAGTAGGCAGGCGTGGAGGCCCGT------------------------------------------------------GAGTGTCCGGGGCATTTCGGACACATCGAGTTGCATACCCCCGTCTTCCACGCCGGT---TTCATCAACAAAATCAAGAAGCTTCTTGAGTGTGTGTGCCACAATTGTGGCAAAATCTTAGCAGACGAATCTGAGCAACAGTTCAAGGACGCCCTAAGGTTACGAGACCCGAAGAAGCGCTTCGAAGCCATATGGAAGGTCTGCAAG---CCTAAGGCTGTCTGTCAGATGGAC---------CAACCCTCAGACATCCAACACGGCGGATGCGGCAACCGCCAGCCAGAG---CTTCGAAAGGACGGCTTGAAACTCGTTGGAACCTGGAAG---CCT---CAGAAG---GGAGAAGATGAAGAGCCGGAGAAGCGC---GTCATCAAGCCCCAGGACGTGCTTAACATTTTCAAATTGATCACCGACGAGTCCCTCGTCACCCTGGGCTTGAACGTCAACTTCGCCAGGCCTGAGTGGATGGTCATCACCATGCTGCCCGTGCCGCCTCCTCCTGTCAGGCCTAGTATCTCCGTCGACGGTACTGGACAAGGCATGCGCGGTGAGGATGACTTGACCTACAAGCTCGCTGATATCATCCGTGCCAACGCTAGCATCAAGCGCTGTCACACTGAGGGTGCTGCGCAGCACGTCATCGATGACTTCGAGGTGCTTCTCCAGTGGCACGTAGCAACTTACATGGACAATGACCTTGCCGGTCAACCTCAGGCTCAGCAGAAGTCTGGTAGGGCTTTGAAGACTATTCGTGGTCGTTTAAAGGGCAAGGATGGTCGTCTCCGTGGAAACTTGATGGGCAAACGTGTAGATTTCTCCGCACGTACTGTCATTACTGGTGATCCCAACCTGGATCTGGACGAAGTCGGTGTTCCGCGATCCATTGCTAGGACTTTGACATATCCCGAGACGGTCACCCCGTACAACATTGCGAAGCTCCACGAGCTCGTCAAGAACGGCCCCAACGAGCACCCTGGTGCCAAGTACATCATTCGTGACGATGGCACGCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCGCCGTACCAACACACCTAT-GGTCGTGATGGCAAGCTTGCAAAGCCACGTCAGCTGCACAACACCCACTGGGGTCTGGTCTGCCCGGCAGAAACGCCCGAAGGTCAGGCTTGTGGCCTGG-GAAGAACCTGTCACTGATGTGTCACGTCACGGTCGGTAGCGACGTC---------ACTCCGATCCAGGACTTCATGACACAGCGGAACATGGAGCTTCTGGAAGAGTACGAGCCAAGCGTATCACCGCACGCCACGAAGATTTTCGTCAACGGTGTCTGGGTTGGTATTCACCGTGATCCCACCCAACTCGTCTCCGTCGTCAAGAAGCTGCGTCGTGAC---GGCACTCTCTCCCCGGAGATGAGTCTTGTTCGCGATGTTCGTGACAGGGAGTTCAAGATCTTCACCGATGCCGGGCGCGTCTGTAGGCCTCTTTTCATCATCGACGACGATCCTACAAGCGCGAACAAGGGTAACTTGGTTTTGTCCCGTGAACACATCGACAGGCTTGAGGAAGATCAACTGTCCGATGAAGAG------AGG-AAGAG------AAGAGGTATGGCTGGAAG---GGTTTACTTACCAGTGGTGTGGTTGAGTACATGGACGCAGAAGAAGAGGAAGCTGCCATGA-TGTCATGACTCCCGATGATTTGCGTGCCCACCACAGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTTTCAA-GGCGACAACATGATTGAGGCCTCCACCAACTGCCCCTGGTACAAGGG-TGGGAGAAGGAGACC---------------AAGACC---AAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACAGCATCGACGCCCCCGTCCGTCCTTCGGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTCTACAAGATTGGCGGTATTGGCACGGTCCCCGTCGGCCGTGTGGAAACTGGTGTCATCAAGGCCGGTATGGTCGTTACCTTCGCCCCCGCTGGTGTCACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCCCCCAAGGGCTGCGACTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTGGCTACGCTCCTGTCCTGGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCTGAGCTGCTCGAGAAGATCGACCGCCGTACCGGCAAGTCCATTGAGAACAACCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATGATTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACCGAGTACCCCCCT Botryosphaeria_tsugae_CBS_418_64 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATGATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGA-GGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGA-GGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCTGCCTCACCGCATG-TACTGGTTCGGCCGGGCCTTTCCTCCTGGGGATCCGCATGCCCTTCACTG-GGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTCTTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGG-TTCTGGGG-GAGTATGT-CGCAAGGTGCA-----------------------------------------------------------------------------------------------------------------------------------------TAG-GGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCG-AGG-GCTCC-CGCCTAAGTCCCCTGGAACGGGGCGTCGTAGAGGGTGAGAATCCCGTATGCGGTG--GGC--CGC--CT-TAGCCATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCG-GTC---T-CC-------T--GAC-CG--GCG-TACTCTTCTGC-GG----C-CAGGCCAGCATCAGTTCGGAC-GGTCGG-ATAAAGACCT-CGGGAATGTAGCT---CCTCTAATGCGGCCAGCCTGGACTGA-GGA-TCTCG-CT----T-C--G--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCATACGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGG-CCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGCTG-AAAC-AGCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGATGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACATCGCCGCCA-GGGTAGAT-A-CG-ATGCCCTGGCGAGTAGGCAGGCGTGGAGGCCCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACCTCAAGAAGTGCGTTGAGGCTGGCCGCCCTTTCTCTCTCCAGTCCGCCGTCAAACAGGGGACCATTACGAACGGTCTGAAATATTCGCTCGCGACCGGTAACTGGGGAGACCAGAAGAAGGCAGCTTCGGCCAAGGCAGGTGTCTCGCAGGTGTTGAACAGATACACCTACTCCTCTACCCTGTCGCATTTGCGTCGCACGAACACGCCAATCGGTCGTGATGGCAAACTTGCCAAGCCGCGCCAGCTGCACAACACTCATTGGGGTCTTGTCTGCCCGGCAGAAACGCCAGAAGGCCAGGCTTGCGGTCTGGTGAAGAACTTGTCCCTGATGTGCAACGTTACTGTCGGCAGCGACGTC---------ACTCCTATCCAGGATTTTATGACCCAGCGAAACATGGAGCTTCTGGAAGAATACGAGCCCAACGTCTCCCCGCACGCCACGAAGATTTTCATCAACGGTGTTTGGGTCGGTGTCCATCGCGATCCTACCCAGCTCGTCTCCACGGTCAAGAAGCTGCGTCGTGAT---GGCACACTCTCTCCGGAGATGAGTCTTATTCGCGATGTTCGTGACAGGGAGTTCAAGATCTTCACGGATGCGGGTCGTGTGTGCAGACCTCTTTTCATCATCGAAGATGATCCGTTCAGCCCTAACAAGGGCAATCTAGCTCTGACCCGGGAGCATATCGACAAGCTTGATGCGGATCAACTGTCTGATGAGGAG------AGGCAAGAG------AAGAGATACGGCTGGCAA---GGACTGCTGCACAGCGGTGTGGTTGAGTACATGGATGCCGAAGAAGAAGAAGTGGCCATGAT-GTCATGACACCTGACGAT-TGAGAGCACATCACAGAGCT---CG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTATCTCCAAGGATGGCCAGACGCGTGAGCACGCTCTGCTCGCCTACACGCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGAGCGTTACCAGGAGATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTCCCCATCTCGGGCTTCAACGGTGACAACATGATCGAGCCCTCGAGCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACCGGTAAGACGCTGCTCGAGGCCATCGACAGCATCGATGCCCCCGTCCGTCCCTCGGACAAGCCCCTCCGCCTGCCCCTCCAGGACGTGTACAAGATCGGTGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACGGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCCGGTGTCACGACCGAGGTCAAGTCGGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTG---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCCCCCAAGGGCTGCGACTCGTTCAACGCCCAGGTCATCGTCCTCAACC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Byssolophis_sphaerioides_IFRDCC2053 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGAGAGCCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTTCTATCTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGG-----------------------------------------------------------------------------------------------------------GATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-GGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGTG-TTG-ACTAC-GGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGCT--GCT--AGC--CT-TCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCG-GGC---T-CT-------T--GCC-CG--GTG-CACTCTTCTAT-GG----G-CAGGCCAGCATCAGTCTGGGC-GGTCGG-ATAAAGGCCC-TGGGAATGTAGCT---CTCTTCATGCGACCAGCCTGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTTGAGAACAACCAGGACTTCAACGTCCAGATGGCGGTGAAGGCTAGCGTCATTACCAACGGCCTTAAGTACTCTTTAGCTACTGGGAATTGGGGAGATCAGAAGAAAGCTGCCTCGGCCAAAGCTGGTGTCTCACAGGTGCTGAATAGGTACACCTACGCATCGACGTTATCGCATCTTCGTCGAACAAATACCCCCGTTGGCCGTGATGGCAAGCTAGCTAAGCCTCGCCAGTTACACAACACCCATTGGGGTTTGGTCTGCCCTGCCGAGACACCAGAAGGGCAAGCTTGCGGTTTGGTCAAGAATCTGTCTTTGATGTGCTATGTCAGTGTTGGTAGCGAGAGC---------ACGCCCATCACCGACTTCATGAGCCAGCGGAATATGGACCTCCTTGAAGAATATGATCCGATCGTAAATCCTAACGCTACTAAGGTCTTCGTCAACGGCGTGTGGGTCGGTGTTCACTCACAACCCAATCAACTTGTATCTGTTGTTCAGGAGCTCCGGCGGAAT---GGAACACTATCTTACGAGATGAGCTTGATTCGTGACATTCGAGACCGAGAATTCAAGATTTTCACAGACGCTGGGCGTGTAATGAGGCCTCTGTTCGTTGTTGAAACGGATTACCGCAAGCCTAACCGGGGCAACTTGGTTCTCAACAAAGGACACATTCAGAAGCTTCTCGAAGATAAACGCAATGACGATGAT------ACCGAAGCC------ATGACATTTGGATGGAAG---GGTCTTATCCAGTCTGGTGTTGTAGAGTATCTCGATGCTGAAGAGGAAGAAACAGCGATGATCATCATGACTCCGGAAGATCTCGAAGAGCACCGAGACTTG---ATGCAAGGCATTCCG------CAGCCCGAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTACACTCTCGGTGTCAAGCAGCTCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGAGCGAGGACCGTTACAACGAGATCATTAAGGAGACCTCCAGCTTCATCAAGAAGGTCGGCTATAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGATGCCTCTCCCAACTGCCCCTGGTATAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGTCTTCTGGTAAGACCCTCCTCGAGGCCATCGATGCCATTGACCCCCCGTCCCGTCCTTCCGACAAGCCCCTCCGTCTTCCCCTCCAGGACGTGTACAAGATCGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGTCCGGTATGGTCGTCACCTTCGCCCCATCCAATGTCACCACCGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTTGTTGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCGCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTTAACCACCCTGGTCAGGTTGGTGCTGGTTACGCTCCTGTCTTGGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCTCGAGAAGATCGACCGACGAACTGGTAAGTCTGTTGAGAGCGGCCCCAAGTTCATCAAATCTGGCGATGCCGCCATCGTCAAGATGATTCCGTCCAAGCCCATGTG---------------------------- Byssothecium_circinans_CBS_675_92 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACCACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACCTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACATGGCTCTTTAGAGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTAGCGGGTCCGCCTCACCGCGTG-CACTTGTCCGGCTGGACCTTTCCTTCTGGAGAACCTCATGCCCTTCACTG-GGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGATCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTTCTATCTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT---------------------------------------------------------------------------------------------------CTGG-GGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGTG-TTG-GTGGC-GGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTTTGTGGTC--GCA--TGC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCG-GGC---G-TA-------T--GCC-CG--GGG-CACTCTTCTGC-GG----G-CAGGCCAGCATCAGTTTGGGC-GGTCGG-ATAAAGGCCT-CTGTCACGTATCT---TCCTTCATGCGACCAGCCCGGACTGA-GGT-CCGCG-CT----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GTGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCCCACCGCCG-GGGCAGAC-A-TT-AAGCCCCGGCGAGTAGGCAGGCGTGGAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACGGCCTCAAGTACTCACTAGCCACGGGTAATTGGGGTGACCAGAAGAAGGCCGCATCGGCGAAAGCTGGTGTATCACAGGTGTTGAATCGATACACCTACGCTTCCACCCTGTCCCATCTTCGGCGCACAAACACACCCGTTGGTCGTGATGGAAAGTTGGCAAAACCCCGCCAGCTGCATAACAGTCATTGGGGTCTCGTCTGTCCCGCTGAGACGCCTGAAGGACAAGCTTGTGGGCTTGTCAAGAATCTGTCACTCATGTGCTACGTCAGTGTTGGTAGCGAGAGT---------CAGCCCATCACGGATTTCATGTCTGGTCGAAACATGGAATTGCTTGAGGAATTCGACCCGCAGATGAACCCGAATGCCACTAAGGTGTTCGTGAACGGTGTTTGGGTTGGTACACACAGCAACCCTCAACAGCTCATTTCGACGGTACAGGAGCTTCGCCGAAAC---GGTACCTTGTCTTACGAGATGAGTTTAGTTCGTGACATCCGAGATCGAGAGTTCAAGATCTTCACGGATGCTGGTCGTGTCATGAGGCCGCTGTTTGTGGTAGACAACGACGTCCGGAGCCCGAATCAGAACCGCCTCGTCTTCAATCGGGAGCATTTCAACTTAATCCTCAACGATGAGATGAACGAAGAGGAA------GCGAATCGG------GCGAGGTTCGGCTGGAGG---GGTCTTCTCCAGAACGGCTGCGTTGAGTATCTGGACGCCGAAGAAGAAGAGTCGGCCATGATCGTCATGTCACCAGAGGACTTGGACGAATGGCGCGAGATG---AAGCAGGGCAACACT------GGGCCTCCACAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCCGACAGATCATCGTCGCCATCAACAAGATGGACACTGCCAAGTGGTCCGAGGACCGTTACAAGGAGATTGTCAAGGAGACGTCCAACTTCATCAAGAAGGTTGGCTTCAACCCCAAGCACATCCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGATTCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGACATC---------------AAGGGC---AAGGTCACCGGCAAGACCCTCCTTGACGCCATCGATGCCATCGACCCCCCATCTCGTCCCTCTGACAAGCCTCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTGTTATTAAGGCCGGCATGGTCGTCACCTTCGCTCCCGCCGGTGTCACCACTGAAGTCAAGTCCGTTGAGATGCATCACGAGCAGCTCGTCCAGGGTCTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCTGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGACCGACCCGCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTTGGTGCCGGTTACGCTCCCGTCCTCGACTGCCACACTGCCCACATCGCTTGCAAGTTCTCTGAGCTTCTTGAGAAGATTGATCGCCGTACTGGCAAGTCTGTCGAGGACCAACCCAAGTTCATCAAGTCTGGTGATGCCGCCATCGTC------------------------------------------------------ Camarosporium_quaternatum_CBS_483_95 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCGCAACTTCGGAAGCGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCATTAGAGTATATTAAAGTTGTGGCAGTTAAAAAGCTTGTAGATGAAACTTGGGTCTGGGTGGCAGGTCTGCCTCACCGCGTG-TACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTG-GGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAATGTTCAAAGCAGGCCTTTGCTCGAATACGTTAACATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTTTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTGGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTCTTTTTGTGACTCGCTGGGCACCTTACGAGAAATCA-AA-------------------------------------------------------------------------------------------------------------------------------------------------------------CAGCTCAAATTTGAAATCTAG-AGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCG-TTG-GCAGC-GGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTC--GCT--AAC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCG-GGC---T-TT-------T--GCC-CG--GTG-CACTCTTCTGC-GG----G-CAGGCCAGCATCAGTTTGGGC-GGTTGG-ATAAAGGTCT-CTGTCATGTACCT---CTCTTCATGCAACCAGCCTGGACTGA-GGT-CCGCG-CA----T-TT-T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTTGGGTGTCAAG-CCCGAGCGCGCAATG-AAAGTGAACGGAGGTGGGACCCGGTGCACCAT-CGA-CCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCAT-GGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AATGCGTGTTACCC--ATACCCCGCCGCCG-GGGC---------------------------------------------------------------------------------------------------------------------GTCACATTGAGCTCGCCACCCCCGTCTTCCATGTCGGT---TTCGTGGTGAAGATCAAGAAGCTCCTAGAGACGGTGTGCCACAACTGTGGTCTGATCTTGGCTGACTACAATCACGTAGACTGGGCTTCTGCCATTAGGACCAAGGACGCCAAGAAGCGCTTCGATAAGATCTGGCGCATGTCGAGG---ACAAAGAACATATGCGACCAAGGC---------GCAGGCGAGGAAATACCCCACGGCGGCTGTGGTAGCCACCAGCCCGATACCATCCGCAAAGAGGGTCTCAAGCTGACGGCCACCTACAAG---AAC---AAGAAG---AAGGACGACGATGATGACCGCAAGGAA---GTCATCACCCCGCTGGCCGCCCAAGGCATTTTCAAGCTCCTTTCCGACAACACACTCCAGCTGCTCGGACTAAACGCCGACTACGCTCGTCCCGAGTGGATGATTCTCTCTGTCCTGCCCGTGCCCCCGCCACCAGTGCGCCCTAGTATTTCCGTTGATGGCACAGGCCAGGGTATGCGCGGAGAAGACGATCTGACCTACAAGCTGGGCGACATTATCCGTGCCAATGGTCGTGTCCAGGAATGTATACAAGAGGGTTCGCCACAGCACGTCCTAGCTGAGTTTGAAGCACTCGTCCAATACCATGTTGCTACCTACATGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTTGCCTACACCCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACTAAGTGGTCCGAGGACCGTTACCAGGAAATCATCAAGGAAACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTCCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATTGACGCTTCCTCCAACTGCCCATGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACCGGTAAGACCCTCCTCGAGGCCATCGATGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGCCTGCCCCTCCAGGATGTCTACAAGATTGGTGGCATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGTCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTTCCGAGGGTGTC---CCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAATGACCCTCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTTATCGTCCTTAACCACCCTGGTCAAGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTTGAGAAGATTGACCGCCGTACCGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCTATGTGCGTTGAGGCTTTCACTGACTACCCTCCT Capnobotryella_renispora_CBS_215_90 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTACTTATTAGATAAAAAACCAATGCCCTCCGGGGCTCCTTGGTGAATCATAATAATTCAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-GTGTTATTATTTTGACCCCATCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCGGGG-CAG-CGGCC-GGTCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCGACC--GG---CTG--GC-ACCCCACACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCTACCAGACTTGCCGGAGG-CGTTCACCCG-GTC---T-TC-------T--GAC-CG--GGC-CACTC-GTCGT-CG----G-CAGGCCAGCATCACTTGGGGC-CGCCGC-AGAAAGGCGG-AGGGAATGTAGCT---CTTC-AATTCGGCGCGCCCCGGGTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTCGTATGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTACCATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGGT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTCACTTAGTTGGACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCTCGCCGCCG-GGGTAGAA-A-CG-ATGCCCCGGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGCCTCGGGCGTGAGCCCGGGTCGAACGGCCTCTAGTGCAGATCTTGGT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Capnodiales_sp_TRN_111 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTCACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAGCCCCGACTCCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTGCGTGGTGAATCATAATAACTTCACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATGCCGACACGGCGAGGTAGTGACAATAAATACTGATCCAGGGCTCTTTCGGGTCTTGGAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAACTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAGTAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGGCCTTCACTG-GCCGTGCCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGGATACATTAGCATGGAATAATTGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCTGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACAAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAG-GAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-ATGTTACTATTTTGACTCCATCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTT----------------------------------------------------------------------------------------------------------------------GCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGGAGAGGATGCTTTTGGG-CAG-CGGCC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGACC--GG---TTG--GC-ACCCTCCACGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACCGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCGACGG-TGTTCCCCCG-GTC---T-TC-------T--GAC-CG--GTC-CACTC-GCCGT-CG----G-CAGGCCAGCGTCGTCTGGGGC-CGCCGG-ATAAAGGCCT-GGGGAATGTGGCT---CCCT-AATACGGCGCGCCCCGGGCGA-GGT-CCGCG-CT----C-C--G--GCAAGGACGCTGGCGTAATGGTCGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCGATCAATCATGCGAGTG-TTCGGGTGGCAAA-CCCCTACGCGCAATG-AAAGTGAACGGAGGCGAGAACCGGTGCATCGT-CGA-CCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCAT-GGCTGAT-CGGA-CCCG-AAAGATGGTGAACTATG-CCTAAA--T-AGAATGAAAC-CAGGGGAAA--CCCT-GGCGGAAGTTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCTC-TTGTTGCTTAGTTGAACGTGAGCATTCGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GTGGGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCACCGCCG-GCGTAGAA-G-CG-ACGCGTC-GCGAGTAGGC------------------------------------------------------------------------------------------------------------ACCAGTCTTGAATGTTCGC---TTCATCAACAAGGTCAAGAAAATCCTCGAGTGTGTCTGCCACAACTGCCGGAAGCTCTTGGAAGATGAGCGCCACCCTGTGTTCAGGCAAGCCGTCCGTCTACGCGACCCCGAGCGTCGTTTCGAACAGATACATCCCCTCTGCAAG---GGGAAGAAGACGTGCAAGGCCGAC----------AGCCATCAGATAAGGAACACGGTGGCTGCGAAAATGTCCAACCGGAG---ATTCACAAAGAGCAGCTGCGCCTCTGGGGCATGTGGAAG---GTC---GCGAAG---GGT---TATGATGAACGCACAGAGGGC---CTCATCGCTCCAGCAGACGCTCTGCAAGTCTTGCGCAACATCTCCAAAGATGACCTCAACCGCATGGGCGTGAATGTCGCCTACGCCCGGCCGGAGTGGATGATCCAGACTGTGGTGCCTGTCCCGCCGACAGCAGTG-GACCAAGCATATCACTGGATGGCACCAGCCAAGGCATGCGATCGGAGGACGACTTGACCTACAAGCTCTCCGACATCATCACCGCCAACTCCCACGTCAGGCGATGCGAGCAGGATGGCTCTCCGCAACAGGTCATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTCCGATTGAAGTTCTCACAACTTGTCAAGGATATCAAATCCTACTTGCACAGATGTGTTGAGCAAGGCAAGGACTTCAATCTGACATTAGCTGTCAAAAGCAACATCATCACCTCCGGTCTGCGGTACTGCTTAGCAACGGGAAATTGGGGCGACCAGAAGAAAGCAGCGAGTGCGAAGGCTGGTGTGAGTCAAGTGCTGAATCGATACACCTATGCTTCGACGCTTTCCCATTTGCGACGAACCAACACGCCTATTGGTCGTGATGGCAAGATCGCGAAGCCGAGACAACTGCACAACACGCACTGGGGTCTCGTCTGCCCAGCCGAGACACCAGAAGGACAGGCGTGCGGTTTGGTGAAGAACCTTGCGCTTATGTGCTTTGTGTCCGTCGGCACGCCCGGC---------CAGCCGATCATGGAGTTCATGCGGCAACGAGGGATGGAGCTGCTGGAAGAATACGACCCTGTTGTTAATCCCGACGCGACGAAAGTCTTCCTGAACGGCACGTGGGTAGGTGTGCATCGTAACGCCGGTCAACTCACAGAGACGCTCCGCGACATTCGAAGGCGT---GGCATCATTAGCTTTGAGGTCACGATCATTCGAGATGTCCGTGAGCGTGAGATCAAGATCTTCACGGACGCTGGGCGGGTGTGCAGACCGCTCTTCGTGGTTGACAACAACCCTCGCTCTCCTACGTGCGGTGGGCTTGTGCTGCAGCAGGATCATCTACAGTCGATAGTCGACGATCGTGAGAGCGAGGAGGAA------ACGAAAGCG------AATACATTCGGCTGGCAC---AGTCTACTCGAGAAGGGTATTGTCGAGTACCTTGATGCTGAAGAAGAGGAGACTGCTATGATTGTCATGACGCCCGAGGACCTCGAAGAGCACACTAGGCAC---AAAGCCAAGGCTGAA---------TACTACGAGGAAGATCCGCATCGCAGAATTAAGGCGAAGCCGAATCCATTCGTACGGACTTGGACACACTGTGAGATTCATCCAGCCATGATTCTGGGTGTGTGCGCGAGTATTATCCCGTTCCCGGATCACAACCAGTCGCCACGAAATACCTACCAGGTAAGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACTGCGCCATTCTCATCATTGCCGCCGGCACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACGCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGCTACAACGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGGGTGTCCCATTCGTCCCCATCTCTGGCTTCAATGGTGACAACATGATCGAGCCATCCTCCAACTGCCCATGGTACAAGGGTTGGGAGAAGGAAACC---------------AAGACC---AAGTCCTCCGGCAAGACCCTGCTCGAGGCCATCGACAGCATCGACCAGCCGACGCGTCCGTCCGACAAGCCTCTCCGCCTGCCACTCCAGGACGTCTACAAGATCGGCGGTATCGGCACGGTCCCCGTTGGTCGTGTTGAGACTGGCACCATCAAGTCCGGTATGGTCGTCACCTTCGCCCCAGCTGGCGTGACCACCGAGGTCAAGTCTGTTGAGATGCACCACGAGCAGCTCGTCGAGGGCACT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCGCCCAAGGGCTGCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAATCACCCAGGCCAGGTTGGCGCCGGCTACGCTCCCGTCCTCGACTGCCACACCGCCCACATCGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATCGATCGTCGCTCCGGCAAGTCGATCGAAGCCTCACCGAAGTTCATCAAATCTGGT--------------------------------------------------------------------- Capnodiales_sp_TRN_137 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAGCCCCGACTTCGGAAGGGGTGTACTTATTAGATAAAAAACCAATGCCCTTCGGGGCTGCTTGGTGAATCATAATAATTTCACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATGCCGACACGGCGAGGTAGTGACAATAAATACTGATCCAGGGCTCTTTCGGGTCTTGGAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAACTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAGTAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGTCTGGCTGGCCGGTCCGCCTCACCGCGTGTTACTGGTCCGGCCGGACCTTTCCTTCTGGGGAACCGCATGGCCTTCACTG-GCCGTGTCGGGGATCCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGGATACATTAGCATGGAATAATTGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCTGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACAAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAG-GAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-ATGTTACTATTTTGACTCCATCGGCACCTTACGAGAAATCA-AAGTTTTTGG-------------------------------------------------------------------------------------------------------------------------------GTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTAGG-CAG-CGGCC-GGTCTAAGTTTCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACC--GG---TTG--GC-ACCTTGCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAACCAGACTTGTCGGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TATTC-GCCGC-CT----G-CAGGCCAGCGTCGTCTGGGGC-CGCCGG-ATAAAGGCTT-TGGGAATGTAGCT---CCTC-AATACGGCGCGCGCCGGGCGA-GGT-CCGCG-CT----T-C--G--GCAAGGACGCTGGCGTAATGGTCGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCGATCAATCGTGCGAGTG-TTCGGGTGGAAAA-CCCTTGCGCGCAATG-AAAGTGAACGGAGGCGAGAACCGGTGCATCGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-GGCTGAT-CGGA-CCCG-AAAGATGGTGAACTATG-CCTAAA--T-AGAATGAAAC-CAGGGGAAA--CCCT-GGCGGAAGTTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCTC-TTGTCTCTTAGTTGGACGTGGGCATTCGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCTCGCCGCCG-GCGTAGAA-G-CG-ACGCGTCGGCGAGTAGGC----------------------------------------------------------------------------------------------------------------------------GGC---TACATTAACAAGGTCAAGAAGATTCTCGAGTGTGTCTGTCACAACTGCGGCAAGCTTTTGGAAGATGAACGCAACCCAGCGTTCGGACAAGCCGTCCGCCTTCGCGATCCCAAACGTCGCTTCGAAGCCGTGCATCGTCTCTGCAAG---ATGAAGAAGACGTGCGAGGCCGAC---------GAGCCTGCTGATAAGGGTCACGGTGGCTGCGGTAATGTCCAGCCCGAG---ATCCGGAAAGAGCAGCTGCGACTGTGGGGCACGTGGAAG---GTC---GCGAAG---AGCGACGAAGAC---GCTGAAAAGCGT---CTGATCGCTCCTGCCGATGCGCTGCAAGTCTTCCGCAACATCTCCAACGACGACCTCAACCGTCTAGGCTGCAACGTCGACTATGCGAGGCCAGAGTGGATGATCCTGACTGTGCTGCCTGTCCCGCCGCCAGCAGTGAGACCAAGCATATCGGTCGACGGCACCAGTCAGGGCATGCGTTCAGAAGACGACTTGACCTACAAGCTTTCTGACATCATCCGCGCCAACTCTAATGTCAGGAGATGCGAGCAAGAAGGCTCTCCACAGCACGTGGTCGAGGAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACTGAAGTTTTCGCAGCTCGTCAAGGACATCAAGGGCTACCTCCACCGATGCGTGGAGTCAGGCAAAGATTTCAATCTGACTCTGGCGGTGAAGAGTAACATTATCACCTCAGGACTCAGATACTGTCTCGCGACAGGGAATTGGGGCGACCAGAAGAAAGCTGCGAGCGCAAAGGCTGGCGTGAGTCAAGTGCTGAACCGCTATACCTATGCTTCTACGCTTTCACATTTGCGTCGTACGAACACACCCATCGGTCGAGACGGCAAGATTGCGAAGCCCAGACAGTTGCACAACACACATTGGGGTCTTGTGTGTCCAGCAGAAACGCCGGAAGGACAGGCTTGTGGGTTGGTGAAGAATCTGGCGCTGATGTGTTTCGTCTCGGTCGGTACACCTGGT---------CCACCAATCGTTGAGTTCATGCGGCAGCGAGGGATGGAGCTGCTGGAAGAGTACGATCCAGTTGTGAACCCAGATGCGACCAAAGTCTTCGTCAACGGCACCTGGGTTGGTGTGCACCGTAATGCAGGCCAGCTGACAGACAATCTTCGTGACATCAGGCGGAGA---GGTGTCGTCAGCTACGAAGTCACCATCATCCGTGACGTTCGAGAGCGAGAAATCAAGATCTTTACTGACGCAGGGCGAGTGTGCAGGCCTCTTTTCGTGGTCGACAACAGCCCTCGCGCACTCACTCCTGGTGGTTTAGTGCTGCAACGGGAGCATATTCAGAAGCTCAACGCGGATAGAATCAGCGAAGAGGAA------ATGCAGAAG------AGAGTTTTCGGCTGGCAC---ACTCTGCTCGACAATGGCGTGGTGGAGTATCTTGACGCCGAAGAGGAGGAGACAGCCATGATCATCATGACTCCGGCAGATCTGGACGAGCACACCGAGGTA---CGGAAGAGTGCTGACTCGGAGCCGTACGTCGAGGATGATCCGCATCGTAGGATCAAGGCACCACCGAACCGATCGGTGCGGGTTTGGACTCACTGCGAGATCCATCCGGCTATGATTCTTGGTGTTTGTGCGAGCATTATTCCTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Capnodiales_sp_TRN_138 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCCTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATCCAGGGCTCTTTCGGGTCTTGGAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGGCCTTCACTG-GCCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGGATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCTGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACAAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-ATGTTACTATTTTGACTCCATCGGCACCTTACGAGAAATCA-AAGTTTTTGGGT---------------------------------------------------------------------------------------------------------------------------TAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCGAGG-CAG-CGACC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGACC--GG---TTG--GC-ACCTCATACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTGGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-CATTC-GCCGT-CG----A-CAGGCCAACATCGTCTGGGGC-CGCCGG-AGAAAGGCTT-GGGGAATGTAGCT---CCTCTAATACGGTGTGTCCCGGGCGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGTTGGCGTAATGGTCGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCGATTAACTGTGCGAGTG-TTCGGGTGGAAAA-TCCCTACGCGCAATG-AAAGTGAACGGAGGCGAGAACTGGTGCATCGT-CGA-CCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCAT-AGCTAAT-CGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGG-TCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAAGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAATTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAATTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACTTCGCCGCCA-GCGTAGAA-G-CG-ACGCGCTGGCGAGTA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATGTATCTGTCGGTACGCCTGGT---------GTGCCTCTAGTCGATTTCATGCGGCAAAGAGGCATGGAGTTGCTGGAAGAGTACGATCCCGTCATGAACCCTGATGCTACGAAGGTATTTGTGAACGGGACGTGGGTGGGTGTGCATCGCAATGCTGGACAACTGACTGATACACTACGCGAGATCCGGCGGAAA---GGTCTGATCAACTTCGAGGTCACGATCATTCGTGATGTGCGTGAACGGGAGATCAAGGTATTTACCGACGCGGGCAGGGTGTGTAGGCCTTTGTTCGTAGTGGACAATCACCCCGGAAGTGAGAACCGTGGCCGACTTATGCTGCAGAACGAACACATCTACCAGCTTCAAGAGGGCCGGCTGAGCGAGGCTGAG------AAGGACGAG------CAATTCTTTGGCTGGCAT---CAGATGATCAAGAGCGGTATTGTAGAGTACCTCGATGCCGAAGAGGAAGAGACTGCGATGATCATCATGACGCCTCAGGAGCTTGAAGAGCACGGTAGAGCA---AAGGCGGGTGAAGAC---------GATTACGATGAGGATCCGCATCGGAGAATCATGGCGAAGCCGAATCCTTTCGTCAGGACATGGACACATTGCGAGATTCATCCCGCTATGATCCTGGGCGTGTGCGCCAGTATCATTCCGTTCCCAGATCACAACCAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Capnodiales_sp_TRN_152 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CTTCACTACAT-GG-ACAACTGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGTGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTCTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTCGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAACCGCATGGCCTTCACTG-GCCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCTGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACAAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-GTGTTATTATTTTGACCCCATCGGCACCTTACGAGAAATCA-AAGTT---------------------------------------------------------------------------------------------------------------------ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGG-CAA-CGGCC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGACC--GG---CTC--GT-ACCCTCCACGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGTCGGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TACTC-GCCGT-CG----G-CAGGCCAGCATCATCTGGGGC-CGCCGG-ATAAAGGCTT-GGGGAATGTAGCT---CCCCCAATACGGCGTGCCTCGGGTGA-GGT-CCGCG-TC----T-C--G--GCAAGGATGCTGGCGTAATGGTCGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCGATTGTCTATGCGAGTG-TTCGGGCGTCAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCCAAT-CGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTCGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGAGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTT-AA-GCGTGCTACCC--ATACTCCGCCGCCA-GCGTAGAA-T-CG-ACGCGCTGGCGAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGACTGGTCAAGAACTTGGCGCTCATGTGCTACGTCTCGGTCGGCTCGCCCGGT---------GAGCCGCTCATCCAGTTTATGCAGCAGCGAGGCATGGAGCTGCTGGAAGAGTACGATCCGGTCATGTACCCGAACGCGACGAAAGTCTTTGTCAACGGGACGTGGGTGGGCGTGCACATGAACCCTTCGCATCTCACGGAGGTGGTGAAGAATCTGCGGCGCGAG---GGTCGGGTCAGCTTTGAGATTACGATTATTCGACATGTAAGAGAGAGGGAGTTTATGGTGTTTACTGATGCTGGGCGAGTGTGCAGACCGCTGTTTGTGGTTGATAATGATCCTCGTTCGGCGAATAGGGGGAATCTTGTGCTGAACCAGGAGCACCTTGGAAGGCTGCGGAACGATCAAATGTCTGAGCAGCAG------CGCTTGCAGGATGATGAGTACTTCGGCTGGCAC---GGTCTTGTGAAAGCGGGTGCCATTGAGTATCTTGATGCTGAGGAAGAGGAGACGGCCATGATCATCATGACACCCGAGGATCTACTCGAGCATCAAGCAGCGCAGAGGCGGGAGGAAGAG---------TTGCCAGACGCCGATCCTCATCGGAGAATCAAGCCGAAGCCGAACAGAGCCATCCGGACATGGACGCATTGCGAGATTCATCCCGCCATGATTCTGGGCGTTTGCGCCAGCATTATTCCCTTCCCTGACCACAACCAATCGCCCAGAAACACATACGTGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Capnodium_coffeae_CBS_147_52 -----------------------------------------------------------------ACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCAATGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAACCGCATGCCCTTCACTG-GGCGTGTGTGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGGG-GTGTTATCATTTTGACCTCCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT---------------------------------------------------ATTGCCCTAGTAACGGCGAGTGAAGCGGCAATAGCTCAGATTTGAAATCTGG-CGTCCGAGTTGTAATCTGTAGAGGATGCCTTTGGG-TAG-CCACC-GGTCTAAGTCCCCTGGAACGGGGCGTCACAGAGGGTGAGAATCCCGTATGTGACC--GGA--AGG--GC-ACCCTCCACAAGGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTGGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-CACTC-ACCGT-CT----G-CAGGCCAGCATCATCTGGGGC-CGCCGG-ATAAAAGCGA-GGGGAACGTGGCT---CCCT-AATACGGCGAGCCTCGGGTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTCGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTGGGAGCCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGGA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GTGGGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCACCGCCG-GGGTAGAA-A-CG-ATGCCCCGGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAG-----------------------------------------------------------------------------------------------------GGC---TTCGTCGTTAAAATCAAGAAAATCCTAGAGTCAGTCTGTCACAACTGTGGCAAGCTTCTACAAGATGAGCGAAACCCTGCTTTCAAGCAAGCTATCTCGCTCCGCGACCCGAAGCGTCGTTTCGAAGCCGTGCACAAGCTCTGCAAA---GGTACAAAGGTCTGTGAGGCAGAC---------CA-C-TGACGACCAGGGTCATGGTGGATGCGGCAATGCTATGCCAATC---ATCCGAAAGGATGGCTTGGCTTTGAACGGCACCTGGGAA---CCT---ACCAAG---CAGGAGCAGGAAGAAAAGGAAACCCGA---CAGATCATGCCCGCGGACGCTCTCAGGGTCTTCCGCCTGATCTCGGAACTTGATATGGTTCGTCTCGGTCTGAACGTCGACTATGC-CGTCCCGAGTGGATGATCTTAACCGTGCTGCCCGTTCCACCGCCACCGGTCAGGCCCTCCATCTCTGTTGATGGCACTAACCAGGGCATGCGCTCCGAAGACGACTTGACGTACAAGCTGTCGGATATCATTCGTGCCAACAGTAACGTCAAACGGTGCGAGCAAGAAGGGTCTCCTCAGCATGTTGTAAATGAGTTCATACAGCTGCTACAGTTTCATGTTGCAACATACATGGACAACGACATCGCAGGCACCGCTAAGGCCCTACAAAAGAGTGGACGCCCGATCAAGGCCATTCGAGCCCGGTTGAAGTCGAAGGAGGGCCGCCTGCGTGGTAATCTGATGGGCAAGCGTGTCGATTTCTCAGCACGAACTGTCATCACTGGTGACCCTAATCTTGATCTCGATGAAGTTGGAGTGCCGCGATCAATAGCAAGGATCTTGACATTTCCCGAGACGGTCAATGCCTACAATATTCAGAAGCTACAGACTTTGGTCAAGAACGGGCCAGCGCTGCACCCAGGTGCTAAATACATCATTCGTGACACCGGCGAGCGT---------------------------------------------------------------------------------------------GACATGCAACAGTATCTTGTCAGGGCTATTGAGTCCGGCCGGGACTTCAATGTCAACCTTGCTTGTAAAAGCAACATCATAACATCTGGTCTGCGCTACAGTCTTGCTACTGGTAATTGGGGTGATCAAAAGAAAGCCATGTCAACAAGAGCGGGTGTCAGTCAGGTGCTTAACCGATTTACTTACGCTTCAACGTTGTCACATTTGCGTCGTACGAACACTCCCATCGGCAGAGACGGAAAGATCGCTAAGCCTAGACAATTGCACAACACTCATTGGGGTTTGGTGTGCCCAGCAGAGACGCCTGAAGGACAAGCTTGTGGATTAGTCAAGAATCTTGCGCTCATGTGCTATGTGAGTGTTGGTACACCAGGC---------ACACCTTTGGTCGAGTTTATGCAACAACGTGACATGGAATTGCTTGAAGAGTATGACCCTGTGACCAATCCCAACGCCACCAAGATCTTCGTCAACGGTGTTTGGGTGGGTGTTCACAAGAACCCGACCCAGCTGATCGAAACTCTTCGAGAGATCCGCCGAAGA---GGTACTGTCAGTTTCGAAATCACCATCATCCGTGACGTCCGAGACCGAGAGATCAAGGTTTTCACGGATGCTGGCAGAGTCTGCAGGCCGCTATTCGTCGTTGACAACAACCCGCGCTCTGCAAGAAAAGGAAAGCTGGCACTTAGGCGTGAGCACGTTGAGCACTTGCAGGAAGACCGACTCTCAGAGGAAGAA------CGTGACGAG------CAGACTTTCGGGTGGAAG---GGCCTGGTCAAGGAGGGTGTCGTTGAATACTTGGACGCTGAAGAAGAGGAGCAAGCCATGATCATCATGACGCCAGACGACCTCGATGAACACAGACAGGTG---CTGCAATATGGCTCG------TCATTTACAGACGACGATCCTCATCGCCGTATCAAGCCGAAACCTAACCTTGCAGTGCGGATGTGGACGCATTGTGAGATTCACCCTGCCATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTGACTGCGCTGTCCTCATCATCGCTGCTGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGAGCGCTACAACGAGATCATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCAAAGCACGTCCCATTCGTGCCAATCTCCGGCTTCAACGGTGACAACATGATTGAACCTTCCACCAACTGCCCATGGTACAAGGGATGGGAGAAGGAGACC---------------AAGACC---AAGTCCACTGGCAAGACCCTCCTCGAGGCCATCGACGCCATCGACACCCCGTCTCGTCCAGTCGACAAGCCACTTCGTCTGCCTCTCCAGGATGTGTACAAGATTGGCGGTATCGGAACTGTTCCAGTCGGCCGTGTCGAGACCGGTGCCATCAAGGCCGGCATGGTCGTCACCTTCGCCCCAGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGCCGAGGGTCTG---CCAGGTGACAACGTTGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCACCAAAGGGCTGCGACAGCTTCAACGCCCAGGTCATCGTCCTGAACCACCCTGGCCAGGTTGGTGCTGGTTACGCTCCAGTCCTTGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCCATTGAGAACGCTCCTAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGATCCCATCCAAGCCAATGTGCGTTGAGGCCTTCACTGAGTACCCACCT Capnodium_salicinum_CBS_131_34 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAACCGCATGCCCTTCACTG-GGCGTGCTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGGG-ATGTTATCATTTTGACTCCCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAA-----------------------------------------------------------------------------------------------------------GCAACAGCTCAAATTTGAAATCTGG-CGTCCGAGTTGTAATTTGTAGAGGATGCTTCTGGG-CAG-CCACC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACC--GGA--AGG--GC-ACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCTGGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTT-CATTC-GCCGT-CT----G-CAGGCCAGCATCATCTGGGGC-CGCCGG-ATAAAAACGG-TGGGAATGTGGCT---CCCT-AATACGGCGTGCCTCGGGTGA-GGT-CCGCG-CT----T-C--G--GCTTGGATGCTGGCATAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTGGGAACTTGTGCACCAT-CGA-CCGATCCTGATGTCTTC-GATGGATTTGAGTAAGA--AT-AGCTGTT-GGGA-CCC--AAA-ATGGTGAACTATG-CCTGAA--T-A-GGTGAAGC-CAGA-GAAA--CTCT-GGTGGAGG-TCGCAGCGG-----------------------------------------------------------------CTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGAGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACTCCGCCGCCA-GGGTAGAA-A-CG-ATGCCCT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGAACATGATCACCGGTACCTCCCAGGCCGACTGCGCTATCCTCATCATCGCTGCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTTCTCGCCTACACCCTCGGTGTCAGGCAGATCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCACGAGATCGTCAAGGAGACCTCTGCCTTCATCAAGAAGGTCGGCTACAACCCAAAGCACGTCCCCTTCGTCCCCATCTCTGGTTTCAACGGTGACAACATGATTGAGCCTTCGCCAAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGTCC---AAGACCACCGGCAAGACCCTCCTCGAGGCTATTGACGCCATCGACCCGCCTTCCCGTCCGTCTGACAAGCCTCTCCGTCTTCCTCTTCAGGATGTTTACAAGATTGGTGGTATTGGCACAGTTCCTGTCGGCCGTGTCGAGACCGGTGCCATCAAGGCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTTGAGGGTCTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCTGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCGCCAAAGGGCTGTGACAGCTTCAACGCCCAGGTCATCGTTCTCAACCACCCTGGTCAGGTTGGTGCCGGTTACGCCCCAGTCCTCGACTGCCACACCGCCCACATTGCCTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGCAAGTCGATCGAAGCTTCTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGATTCCGTCCAAGCCCATGTGCGTGGAGGCCTTCACTGAGTACCCACCT Catenulostroma_abietis_CBS_459_93 ---------------------------------------------------------T-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-ATGTTACTATTTTGACTCCATCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT--------------------------------------------------------------------------------AACAGCTC-AATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGG-CAG-CGGCC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATC--GG---TTG--GC-ACCCGCTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCCGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TACTC-GCCGC-GG----G-CAGGCCAGCATCATCTGAGAG-CGCCGG-ATAAAGGTAG-CGGGAATGTGGCC---CCTC-AATACGGCGCCTCTCGGGTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTATGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTACCATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGGT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCTCGCCGCCA-GGGTAGAA-A-CG-ATGCCCT-GCGAGTAGGCAGGCGTGGAG--------------------------------------------------------------------------------------------------------------CGTCGGC---TTCATCACCAAGATCAAGAAGGTCCTGGAGTCGGTGTGCCACAACTGCGGTAAGATCAAGACCGACGAGCGCAACAACCAATTTGCGCAAGCCATCCGTCTCCGTGACCCCAAGCGCCGCTTCGAAGCCGTGCACAAGATCTGCAAG---CCCATCACCACCTGCGAGCCTGAC---------GCACCAGCGGAAAAGGGCCATGGTGGGTGTGGTAACCAGCAGCCTGTC---ATCCGTAAGGAGCAGCTGCGGTTACATGGCTCATACAAG---GCA---GCCAAG---TCGGATGAAGAGGAGCCGGAGAAGGTC---GCCATCACGCCGCAATATGCGCTCAACGTCTTCCGCAACATCTCCGACGAGGACATGGCGAGGCTTGGCTTGAACGGCGATTACGCTAGGCCAGAGTGGATGGTGCTCACTGTGCTGCCTGTTCCGCCTCCTGCTGTGCGCCCTTCGATCTCGGTCGATGGCACAAGTCAGGGTATGCGCTCCGAAGACGACTTGACCTACAAGCTCTCGGACATCATCCGCGCCAACTCCAACGTTCGGCGCTGCGAGCAAGAGGGCTCACCACCGCATGTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCATTGCCGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCTTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGCTACAACGAGATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTCCCGATCTCTGGCTTCAACGGCGACAACATGATCGATGCCTCCCCCAACTGCCCATGGTACAAGGGCTGGGAGAAGGAGACT---------------AAGACC---AAGTCGACCGGCAAGACCCTCCTCGAGGCCATTGACGCCATCGACCCGCCGTCGCGCCCGACCGACAAGGCTCTCCGTCTTCCCCTTCAGGATGTCTACAAGATTGGTGGCATTGGGACAGTTCCTGTCGGCCGTGTCGAGACTGGTGTCATCAAGGCCGGCATGGTCGTTACCTTCGCCCCAGCTGGTGTCACCACTGAGGTGAAGTCCGTCGAGATGCACCACGAGCAGCTTACCGAGGGTCTT---CCGGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCGCCAAAGGGCTGCGACTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCGGGTCAGGTAGGTGCCGGTTACGCTCCAGTGCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCGCCGAGCTCCTCGAGAAGATCGACCGTCGTTCCGGCAAGTCGATTGAGGCCAGTCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGATTCCGTCCAAGCCGATGTGCGTGGAGGCCTTCACCGACTACCCACCT Catenulostroma_elginense_CBS_111030 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATACCTGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTAGCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGATACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTCGGGGAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGGTGGTTTCTAGGGCCGCCGTAATGATTAATAGGGATAGTCGGGGGCATTAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATCTGCCAAGGATGTTTTCATTAATCAG-GAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-GTGTTACTTTTATGACCCCATCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGG-CAG-CGGCC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACC--GG---TTG--GC-ACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGTGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TACTC-GCCGC-CG----G-CAGGCCAGCATCGTCTAGGTG-CGCCGG-ATAAAGGTGT-CGGGAATGTGGCC---CCTC-AATACGGTGCCGCCTGGGCGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTCTGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGGAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGCTG-AAAC-AGCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACGTTAGAATGTAGCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCTCGCCGCCC-GGGTAGAA-A-CG-ATGCCCGGGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGCCTTGGGGGTGACCCCGGGTCGAACGGCCTCTAGTGCAGATCTTGGT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Catinella_olivacea_UAMH_10679 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTCCGGGGCTCCTTGGTGATTCATGATAACTTAACGAATCGCAT-GGCCTTGTGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACGGGGCTCTTTCGGGTCTCGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATGGCGTATATTAAATTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCACCTCACCGTGAG-TACTGGTCCGGTCGGGCCTTTCCTTCTGGGGATCCGCATGCCCTTCGCTG-GGCGTGTTGGGGAGCCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCATTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTATGTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAGTAGCTCAAATTTGAAATCGGG-GTGACGAGTTGTAATCTCCAGAGGATGCTTCGGTA-CGG-TCACC-GGTTTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTTTATGGCC--GGGTCGAA--CC-AAACCAAGTGAAGCTCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGCAACCAGACTCAGGCGCGGGTGTTCAAACA-GCC---T-TC-------T--GGC-AG--TTG-CACTCACTCGC-AAACGTC-TGGGCCAGCATCAGTTCGGGC-GGCTGG-ATAAAGGCCC-TAGGAATGTGGCA---CCTCTAATACGGCTTGCTTGGACTGA-GGA-CCGCG-CT----T-T--ATTGCTAGGATGCTGGCGTAATGGTTGTGAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCATGCGCGTAATG-AAAGTGAACGTAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCCTATGTCATCGGATGGATTTGAGTACGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TCTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCCAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTT-AA-GCGTGCTACCC--ATACCTCGCCGCCA-CAGCAGAT-A-TG-ATGCTCTGGCGAGTAGGCAGGCGTGGGGGCTTGTGACGAAGCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cenococcum_geophilum_10 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGGATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTT-CCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cenococcum_geophilum_CGMONT AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGGATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cenococcum_geophilum_HUNT_A1 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGAACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGGATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cercospora_beticola_CBS_116456 -AAATGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-ATGTTATCTTTTTGACTCCATCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGG-CGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT------------------------------------------------------------------GCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGG-TAG-CGACC-GATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACC--GG---CCC--GC-ACCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGCGGCAG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTT-CATTC-TCTGT-CG----C-GAGGCCATCATCGTCTGGGCC-CGCCGG-AT-AAGACCT-GAGGAATGTGGCT---CCCCCGATGCGGCGTGGCTCGGGCGA-GGT-CCGCG-CT----T-C--G--GCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTT-AA-GCGTATTACCC--ATACCTCGCCGCCA-GGGTAGAA-A-CG-ATGCCCTGGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTCGCCTACACCCTTGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACAACGAGATCATCAAGGAGACCTCCTCCTTCATCAAGAAGGTCGGCTACAACCCAAAGACCGTCCCATTCGTCCCGATCTCTGGTTTCAACGGCGACAACATGATCGACAACTCCACCAACTGCCCATGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACTGGCAAGACCCTCCTGGAGGCCATCGATGCCATCGACCCACCTCAGCGACCAACTGAGAAGCCTCTCCGTCTCCCACTCCAGGATGTGTACAAGATTGGTGGTATTGGCACGGTCCCAGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCAGCTGGTGTCACCACCGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACTGAGGGTCTT---CCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCACCAAAGGGCTGCGACTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCAGGTCAGGTCGGTGCCGGTTACGCTCCAGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCTGAGCTCCTCGAGAAGATCGATCGTCGTTCCGGCAAGTCCATTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTGCCATCCAAGCCAATGTGCGTTGAGGC-TTCACCGACTACCCACCA Chaetosphaeronema_hispidulum_CBS_216_75 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTCTTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGATACAGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-TACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTG-GGCGTGTTGGGG-ACCAGAACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTT---------------------------------------------------------------------------------------------------------------------ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-AGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCG-TTG-GCAGCG-GTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTC--GCT--ATC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCCG-GAC---T-TT-------T--GTC-CG--GTGC-ACTCTTCTAT-AG----G-CAGGCCAGCATCAGTTTGGGC-GGTTAG-ATAAAGGTCT-CTGTCATGTACCT---CTCTTCATGTAACCAGCCTGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCAGACGCGTAATG-AAAGTGAACGGAGGTAAGAACCGGTGCATTAT-CGA-CCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCAT-GGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGGCG-AAAC-GCTCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCCCGCCGCCG-GGGCAGAA-T-TT-ATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGG-----------------------------------------------------------------------------------------------GGT---TTCGTCGTCAAGATCAAGAAGCTGCTCGAGACGGTGTGCCACAACTGCGGTCTCATCCTGGCTGACTACAACCACCCAGACTGGGCAGGTGCGATCAGGACCAAGGATGCCAAGAAGCGTTTCGACAAGATCTGGCGCATGTCGAGG---GGCCGCACAGTGTGCGAGCAAGAC---------TCCACCGACAGCATCGCACACGGCGGCTGCGGCAACATCCAGCCCGACACCATCCGCAAGGAGGGCCTCAAGCTGACGGGAACCTGGAAG---GCGAAGAAGAAG---GAGGACGACGATGGCGAAAAGAAGGAG---GTCCTCACCCCGCAGTACGCCCTCAACGTCTTCAAGCACTTCTCCGACAACACGCTGGCCCTGCTCGGACTCAACAAGGACTACGCCCGTCCGGAGTGGATGATCATGACGGTGCTCCCCGTGCCTCCACCACCAGTTCGCCCCAGTATCTCCGTCGACGGCACCGGTCAGGGTATGCGCGGAGAGGACGACTTGACCTACAAGCTCGGCGACATCATCCGCGCCAACGGTCGTGTGCAAGAGTGTATCCAGGATGGCTCACCGCAGCACGTTCTCCAAGAGTTCGAAGCCCTGGTCCAATACCACGTCGCCACCTATATGGACAACGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGCTGACCAAGGATGTCTACAAGTATCTGCAGCGCTGCGTCGAGAACAACACCGACTTCAATGTCCAGATGGCCGTGAAAGCTAGCATCATCACGAACGGACTGAAGTACTCGTTAGCGACAGGTAACTGGGGTGATCAGAAGAAGGCTGCTTCTGCCAAGGCTGGTGTCTCACAAGTGTTGAACCGCTACACATATGCCTCGACATTGTCTCATTTGCGGCGGACAAACACACCCGTCGGTCGTGATGGAAAGCTAGCAAAGCCGCGACAGCTGCACAACTCCCACTGGGGTCTTGTGTGCCCCGCTGAGACTCCCGAAGGACAAGCCTGCGGTCTCGTCAAGAACTTGTCTCTTATGTGTTACGTCAGTGTTGGAAGCGACGCC---------ACACCCATCATCGACTTCATGTCGCAGCGCAACATGCAGCTTCTCGAGGAGTACGATCAGGCACAAAACCCTGACGCCACAAAGGTCTTTGTCAATGGTGTCTGGGTCGGCGTGCACTCCAATGCGCAACAGCTAGTGTCTGTTGTCCAGGAGCTGCGCAGGAAC---GGAACTCTGTCCTATGAGATGAGTTTGATTCGTGATATTCGCGACCGAGAGTTTAAGATCTTTACAGACGCCGGTCGTGTCATGCGGCCTTTGTTCGTCATCGAGACAGATCCGCGCAAGCCGAACCGCAATCACCTTATCTTCGACAGGTCAATTAGTGACACACTTGTACAAGAGCAAATGACTGAAGATGAG------ATTGACCAA------CAGATCTACGGTTGGAAG---GGCCTGGTCCAGAATGGCGTGGTGGAATACCTCGACGCCGAGGAAGAAGAGACTGCCATGATCACATTCTCCCCCGAGGACCTTCAGGAGTGGCGAGACATG---AAGTTGGGACTTCCT------GCCAACGAGCGAAAGGACCGCCTCAAGCGCATCAAGCCCAAGCCCGACTCGCGCATCCACGCCTACACACATTGCGAGATTCACCCTGCCATGATATTGGGTATCTGCGCCAGCATCATCCCCTTCCAGTCACACC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cladosporium_cladosporioides_CBS_170_54 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAA-GCAGCAGGCG-GCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTT-AATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAACCTCATGCCCTTCACTG-GGCGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATCGTCAGAGGTGAAATTCTTGGATTGATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGACG-GTGTTAGTATTTTGACCCGTTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT------------------------------------------------GGGATTGCTCTAGTAACGGCGAGTGAAGCAGCAATAGCTCAAATTTGAAATCTGA-CGTCCGAGTTGTAATTTGTAGAGGATGCTTCTGAG-TGG-CCACC-GACCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGTC--GGA--AAG--GC-GCTCTATACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATAATGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTAAAAGGGAAGGGATTGCAACCAGACTTGCTCGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TACTC-GCCGCGTT----G-CAGGCCAGCATCGTCTGGTGC-CGCTGG-AT-AAGACTT-GAGGAATGTAGCT---CCCT-GATGCAGCGAGCGCCGGGCGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTCGTAATCCGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTGAGAACCGGTGCATCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGTACGCTTATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTACTACCA--ATACCTCGCCGCTA-GGGTAGAA-A-CG-ATGCCCTAGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAG------------------------------------------------------------------------------------AACTTGTGCTTCCCCCAGGC---TTCGTCACCAAAGTCAAGAAGATACTCGAATCAGTGTGCCACAACTGCGGGAAACTCTTGGATGACGAACGTAACCCTCAATTCAAGCAGGCCGTCAACATCCGTGACCCAAAGCGTCGTTTCGACCAGGTCCACAAGATTTGCAAG---CCTAAGATGATCTGTGAGCCCGAC---------TCAACAGAAGACAAGGGCCACGGCGGCTGCGGAAACATCCAACCGGAG---ATCCGCAAGGAGGCTCTGAAGCTGAACGGCACATGGAAG---CTG---CCCAAG---GGACAAGAAGACGAACCCGAAAAGAGG---CCCATCACACCACAAATGGCGCTCAACGTGTTCCGCAACGTCTCTGACCGCGACCTCACAATCCTCGGCTGCAACGCCGACTACGCACGACCTGAGTGGATGATCATGACTGTCATGCCTGTGCCGCCACCCGCAGTCCGTCCCAGTATCTCCGTTGATGGCACCAGCCAGGGCATGCGGTCGGAGGACGATTTGACTTACAAGCTATCCGACATTATTCGCGCAAACTCGAACGTCAAGCGATGTGAGCAGGAAGGCTCGCCTCAGCACGTTGTCGACGAGTTCATCTCTCTCTTGCAGTACCACGTTGCGACTTACATGGACAACGACATTGCTGGTCTGCCAAAGGCACAACAGAAGTCCGGTCGTCCCGTCAAGGCCATCCGTGCGCGCTTAAAGTCGAAGGAGGGCCGTCTTCGTGGTAACTTGATGGGCAAGCGTGTCGACTTCTCCGCGCGTACGGTCATTACAGGTGACCCTAACCTTTCGCTCGACGAGGTTGGTGTTCCCAGATCCATTGCTAGAACCCTGTCTTTCCCCGAGACAGTGAACAACTACAACATCAACAAGATGCACGAGCTGGTCCGCAACGGCCCCGACCAGCACCCCGGTGCCAAGTACGTGATCCGCGATACTGGTGAGCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAAAGCTG-T-TCAGTCAAGTGCTC-ACAGATATACTTACGCGTCGACACTTTCGCATTTGCGACGCACCAACACGCCTATTGGTCGTGATGGCAAGATCGCGAAGCCACGTCAACTACACAACACTCACTGGGGTCTGGTCTGCCCTGCCGAAACACCAGAAGGACAAGCTTGTGGTCTCGTCAAGAACCTGAGTCTTATGTGTTTCGTGTCCGTTGGTACGCCCGGT---------GGCCCTTTGACCGACTTCATGCGTCAACGCGACATGGAACTGTTGGAAGAGTACGATCCGGTTATGAACCCCAACGCCACCAAGGTCTTCGTTAACGGTACATGGGTCGGTGTGCACAAGAACGCCTCGCAACTCATGGACGTCTTACTCGACATCCGTCGCAAG---GGCCTGATCAGCTTCGAATGCACCATCATAAGAGACGTGCGCGACCGCGAGATCAAGATTTTCACAGACGCCGGACGTGTCATGCGACCGTTGTTCGTCGTTGACAACGACCCTCGCAGCGATAGCCGTGGCACTCTCATGCTCAAACAGGACCACGTGCAGCGACTTCGGGATGATCTTATGAGCGAGGAGGAG------CGTGACGCG------AACATCTTCGGCTGGAAG---GGTCTTATCAAGAACGGTGTGGTCGAATACCTTGACGCAGAAGAGGAGGAGACTGCCATGATCATCATGTCACCTGACGACTTGGATGAGCACCGCATGGTC---AAAAAGGGCTTGGAG---------TATGAGGAGCTCGACCCGCACAGGCGCATCAAGCCCAAACCCAATCCGGCGATTCACAGATGGACACACTGCGAGATTCATCCGTCCATGATCTTGGGTATTTGCGCGTCCATCATTCCCTTCCCCGACCACAACCAATCTCCTCGTAACACCTACCAATCTGCCATGGGTAAGCAAGCCATGGGAATCACCCTCACAAACTACAATGTCCGCATGGACACGATGGCCAACGTCCTCTACTACCCCCAAAAACCTCTGGCAACCACCCGATCCATGGAGTTCTTGAAGTTCAGAGAATTGCCTGCTGGCCAGAACGCCATCGTTGCCATCGCATGTTACTCTGGGTACAACCAAGAAGATTCCGTCATCATGAACCAGTCTTCCATTGACCGTGGATTGTTCCGCTCCCTCTTCTACCGTGCCTACCTCGACCAGGAGAAGAAGGTCGGCATGTCCGTGATGGAGTCCTTTGAGAAGCCGAACCGAACCGACACCCTCAGAATGAAGCAGGGCACATACGACAAGCTTGACAACGACGGTATCATTACCCCAGGCTCTCGTGTCTCTGGTGACGACATCATCATTGGCAAGGTCGCGCCAATTGCACCGGATGCT------------------GAGGAACTCGGCCAGAGAACAAAGTTGCACGTCAAGCGCGATGTCTCCACGCCTCTGAGGAGTACCGAAAACGGTATCATTGACCAGGTCCTGTTGACCACCAACTCGGACGGTCTCAAGTTCGTCAAGGTGCGCACTCGTACAACCAAGGTCCCTCAGATTGGTGACAAGTTTGCTTCTCGTCACGGTCAGAAGGGTACCATTGGCATCACATACCGCCAAGAGGACATGCCCTTCACCTCTGATGGCATCATT-------------------------------------------TTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGACGGCCAGACCCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGCCCGTTACCAGGAGATCATCAAGGAGACCTCCGGTTTCATCAAGAAGGTCGGCTTCAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGACAACTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGGCC---AAGGTCACCGGCAAGACCCTCCTCGAGGCCATTGACGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTGTGATCAAGGCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCCCCGAGGGTCTC---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGTCCGACCCCCCCAAGGGCTGCGACAGCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGCGCTGGTTACGCGCCCGTCCTCGACTGCCACACCGCTCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATCGACCGCCGTTCCGGCAAGTCTATCGAGTCCGGCCCCAAGTTCATCAAGTCTGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACCGACTACCCCCCT Cladosporium_herbarum_CBS_399_80 --------------TCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAACCTCATGCCCTTCACTG-GGCGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATCGTCAGAGGTGAAATTCTTGGATTGATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGACG-GTGTTAGTATTTTGACCCGTTCGGCACCTTACGAGAAATCA-AAGTTTTTG----------------------------------------------------------------------------------------------------------------------------TCTAGTAACGGCGAGTGAAGCAGCAATAGCTCAAATTTGAAATCTGA-CGTCCGAGTTGTAATTTGTAGAGGATGCTTCTGAG-TGG-CCACC-GACCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGTC--GGA--AAG--GC-GCTCTATACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTAAAAGGGAAGGGATTGCAACCAGACTTGCTCGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TACTC-GCCGCGTT----G-CAGGCCAGCATCGTCTGGTGC-CGCTGG-AT-AAGACTT-GAGGAATGTAGCT---CCCT-GATGCAGCGAGCGCCGGGCGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTCGTAATCCGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTGAGAACCGGTGCATCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGTACGCTTATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTACTACCA--ATACCTCGCCGCTA-GGGTAGAA-A-CG-ATGCCCTAGCGAGTAGGCAGGCGTGGAGGCCCGT-----------------------------------------------------------------------------------------------------TCACCCTGGC---TTCGTCACCAAAGTCAAGAAGATCCTCGAATCAGTGTGCCACAACTGCGGGAAACTCTTAGATGACGAACGTAACCCTCAATTCAAGCAGGCCGTCAACATCCGCGACCCGAAGCGTCGCTTCGACCAGGTCCACAAGATCTGCAAG---CCCAAGATGATCTGTGAGCCCGAC---------TCAACAGAAGACAAGGGCCACGGAGGTTGCGGCAACATCCAACCGGAG---ATCCGCAAGGAGGCTCTCAAGTTGAACGGTACCTGGAAA---TTG---CCCAAG---GGACAAGAAGACGAACCTGAAAAGAGG---CCCATTACACCACAAATGGCGCTGAACGTCTTCCGCAACGTCTCCGACCGCGACCTCACAATCCTCGGCTGCAATGCCGACTACGCACGACCGGAGTGGATGATCATGACTGTTATGCCCGTGCCGCCACCCGCAGTCCGTCCCAGTATCTCCGTCGATGGTACCACCCAGGGCATGCGTTCAGAGGATGATTTGACTTACAAGCTGTCCGACATCATCCGCGCAAACTCCAACGTCAAGCGTTGTGAGCAGGAGGGCTCACCTCAGCACGTTGTCGAGGAGTCATCTCT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCAGTCAAGTTCTCAACAGATACACATACGCCTCGACGCTTTCTCATTTGCGACGTACCAACACCCCTATCGGTCGTGATGGCAAGATCGCAAAGCCACGTCAATTACACAACACTCACTGGGGTCTGGTCTGCCCTGCCGAAACACCAGAAGGACAGGCTTGTGGTCTCGTCAAGAACCTGAGTCTTATGTGTTTCGTGTCCGTTGGTACGCCCGGC---------GGTCCTTTGACCGACTTCATGCGTCAACGTGACATGGAATTGTTGGAGGAGTACGATCCGGTTATGAACCCCAACGCCACCAAGGTCTTCGTCAACGGTACATGGGTAGGTGTACACAGGAATGCCTCTCAACTCATGGACGTCTTACTCGACATCCGTCGCAAG---GGCTTGATCAGCTTCGAATGCACCATCATAAGAGACGTGCGCGATCGCGAGATCAAGATTTTCACAGACGCCGGACGTGTCATGCGACCGTTGTTCGTCGTTGACAACGACCCTCGCAGCGACGCCCGTGGTCGCCTCATGTTCAAGAGAGAGCACGTGGAGCGACTTAAGGAGGATCTTGCGAGTGAGGAGGAG------CGCGATGCG------ACCATTTTCGGCTGGAAG---GGTCTCATCACGCACGGTGTGGTCGAATACCTTGACGCAGAGGAGGAAGAGACCGCCATGATCATCATGTCGCCTGAGGACTTGGAGGATCACCGCTATGTC---TTGGAACACGGCGAG---------TATGAGGAACTCGACCCACACAGGCGCATCAAGCCCAAGCCAAACCCATCGATTCACAAATGGACGCACTGCGAGATTCACCCGTCCATGATCTTGGGTATCTGCGCGTCCATCATTCCCTTCCCCGACC-CAACCAATCTCCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGTCAGACCCGCGAGCACGCCCTCCTCGCCTACACTCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGCCCGTTACCAGGAGATCATCAAGGAGACCTCCGGTTTCATCAAGAAGGTCGGCTTCAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGATCGACAACTCCCCCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGACC---------------AAGTCC---AAGGTCACCGGCAAGACCCTCCTCGAGGCCATTGACGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGCGGTATCGGCACGGTTCCCGTCGGTCGTGTTGAGACCGGTGTGATCAAGGCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCCCCGAGGGTCTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGCAGGACCCCCCCAAGGGCTGCGACAGCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGCGCTGGTTACGCGCCCGTCCTCGACTGCCACACCGCTCACATCGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATCGACCGCCGTTCCGGCAAGTCCATCGAGTCTGGCCCCAAGTTCATCAAGTC------------------------------------------------------------------------- Cladosporium_iridis_CBS_138_40 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGATTGCTCTAGTAACGGCGAGTGAAGCAGCAATAGCTCAAATTTGAAATCTGA-CGTCCGAGTTGTAATTTGTAGAGGATGCTTCTGAG-TGG-CCACC-GACCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGTC--GGA--AAG--GC-GCTCTATACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTAAAAGGGAAGGGATTGCAACCAGACTTGCTCGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TACTC-GCCGCGTT----G-CAGGCCAGCATCGTCTGGTGC-CGCTGG-AT-AAGACTT-GAGGAATGTAGCT---CCCT-GATGCAGCGAGCGCCGGGCGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTCGTAATCCGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTGAGAACCGGTGCATCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Clathrospora_elynae_CBS_196_54 -----------------------------------ATTTGATAATA-CCTTACTACTT-GG-ATATCCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACAGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGATACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-TACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTG-GGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGAC-T-GTGGTCTTA-TTTTGTTGGTTTCTAGGACCGCAGTAATGATTAATAGGGACAGTCGGGGGCATTAGTATTCAATAGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTATGAATCGGGCG-ATGTTCTTTTT-TGACTCGCT-------------------------------------------------------------------------------------------------------------------------------------------------AGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-AGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCG-TTG-GCAGC-GGTCTAAGTTCCTTGGAACAGGACGCCATTCAGGGTGAGAGCCCCGTACATGGTC--GCT--AGC--CA-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCA-GGC---T-TT-------T--GCC-TG--GTG-CACTCTTCTGC-GG----G-CAGGCCAGCATCAGTTTGGGC-GGTTGG-ATAAAGGTCT-CTGTCATGTACCT---CTCTTCATACAACCAGCCTGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGGAATG-AAAGTGAACGGAGGTGGGACCCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-GGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cochliobolus_heterostrophus_CBS_134_39 -----------------------------------------------------------------ACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCAT-AGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTG-CACTCGTCCGGCCGGGCC-TTCCTTCTGAAGAACCTCATGCCCTTTACTG-GGCGTGTTGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGT-GCGTTTCTA-TTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGATTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGTCACCACCAGGCGT-CCCGCTGAAACTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-AGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCT-TTG-GCAGC-GGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTC--GCT--AGC--TA-TTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCG-GGC---T-TT-------T--GCC-CG--GTG-CACTCTTCTGT-AG----G-CAGGCCAGCATCAGTTTGGGC-GGTGGG-ATAAAGGTCT-CTGTCACGTACCT---CTCTTCATACCACCAGCCTAGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGAAGTTTACGGAAGGATTTGAGTAAGAGCAT-GGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTTGTTACTTAATTGAACGCGGGCATTTGAATGAAACGTTATTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GAGGGGTTACGGTGCCGGAGTACACGCTCATCAGACACCACAAAAGGTGTTGGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTCACCT--ATACCCCTCCGCCG-GGGCAAAA-T-TT-ACGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGGGGTGACCCCAGGTCGAACGGCCTCTAGTGCAGATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTGACCGATACACCTACGCTTCTACTTTGTCCCATCTTCGCCGAACAAACACACCCGTTGGACGTGATGGTAAGTTGGCCAAGCCCCGCCAACTTCATAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACGCCTGAAGGACAGGCTTGCGGACTGGTCAAGAACTTGTCTCTCATGTGCTACGTCAGTGTCGGTAGCGATGCA---------TCCCCCATTATCGACTTCATGACGCAACGTAACATGCAACTTCTCGAGGAATACGACCAGAACCAAAACCCAGATGCGACAAAGGTTTTCGTGAACGGTGTATGGGTCGGTGTTCACTCCAACGCTCAGCAACTTGTCACAGTTGTGCAGGAGCTCCGACGAAAC---GGAACTCTATCTTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACGGATGCTGGCCGTGTCATGAGACCTCTGTTCGTCGTTGAGAACGATATCCGAAAGCCGAACCGAAACCACCTGATCTTCACCAAGGAAATCAGTAACAAGCTCAAGGCTGAGCAATGGAGTCAAGAGGAG------GTCGAGCAG------GCCACCTACGGCTGGAGA---GGTCTGATCCAAGACGGTGTTGTCGAGTATCTCGATGCCGAAGAAGAAGAAACTGCCATGATAACATTCTCACCCGAAGATTTGGAGGAATGGCGAGAGATG---AAGATGGGTTTGCCT------GCAGCCGAGCGAAAGGACCGACTTCGTCGTCTCAAGCCCCAGCCAGATCCTCGCATTCACGCCTATACCCATTGCGAGATTCATCCGGCCATGATCTTGGGTATCTGTGCCAGTATCATTCCCTTCCCAGATCACAACCAGTCGCCCCGTAACACGTACCAATCTGCCATGGGTAAACAAGCCATGGGTGTTGCTCTTACCAACTTTGCGCTCCGTATGGAAACCATGATGAACGTCCTCTACTACCCCCAGAAGCCTTTGGCGACAACCAGGTCAATGGAGTACCTCAAGTTCCGTGAGCTTCCCGCTGGACAGAACGCTATCGTCGCCATTGCTACCTATGGTGGTTACAACCAGGAAGATTCCGTCATCATGAACCAGAGCAGTATCGATCGTGGTCTCTTCAGGAGTTTGTTCTACCGTGCGTACACTGAACAAGAGAAACGCATTGGTGTCAACGTTCTGGAACAGTTCGAGAAACCTACGCGTGCTGACACTCTCCGTTTGAAGGGTGGTACTTATGACAAGCTCGACGACGATGGTGTTGTCGCGCCTGGTGTACGTGTGTCTGGTGACGATATCATCATCGGAAAGACTGCACCCATCGCGGCGGATGCC------------------CAGGAGCTTGGTCAAAAGACTACTCTACACACCAAGCGCGACGTTTCAACGCCTCTTCGTAGTACCGAGAACGGTATCGTCGATCAGGTGCTCTTCACCACCAACACTGAGGGTCTTCGATTCGTCAAGGTCCGTACTAGGACTACCAAGGTACCCCAGATTGGTGACAAGTTTGCTTCTCGTCACGGTCAAAAGGGTACTATTGGTATTACCTACCGCCAAGAGGATATGCCTTTCACTCGAGAGGGAGTGACA------------------------------------------------------------------------------GCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTTCTCGCCTACACCCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGCCTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGTCC---AAGGCCACCGGTAAGACCCTCCTCGAGGCCATCGACGCCATCGACCCTCCCAGCCGTCCTACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTGACCGAGGGTGTC---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGCTTCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCTGTTGAGAACTCCCCCA-AGTCATCAAGTCTGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCTCCT Cochliobolus_sativus_DAOM_226212 --ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCAT-AGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAA-TTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTG-CACTCGTCCGGCCGGGCC-TTCCTTCTGAAGAACCTCATGCCCTTTACTG-GGCGTGTTGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGT-GCGTTTCTA-TTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGATTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGTCACCACCAGGCGT-------------CAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-AGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCT-TTG-GCAGC-GGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTC--GCT--AGC--TA-TTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCG-GGC---T-TT-------T--GCC-CG--GTG-CACTCTTCTGT-AG----G-CAGGCCAGCATCAGTTTGGGC-GGTGGG-ATAAAGGTCT-CTGTCACGTACCT---CTCTTCATACCACCAGCCTAGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGAAGTTTCCGGAAGGATTTGAGTAAGAGCAT-GGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTTGTTACTTAATTGAACGCGGGCATTTGAATGAAACGTTATTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GAGGGGTTACGGTGCCGGAGTACACGCTCATCAGACACCACAAAAGGTGTTGGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTCACCT--ATACCCCTCCGCCG-GGGCAAAA-T-TT-ACGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTGTTGAACCGATACACCTACGCTTCTACTCTATCCCATCTTCGTCGAACAAACACCCCCGTTGGACGTGATGGTAAACTGGCCAAGCCCCGCCAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACGCCTGAAGGACAGGCTTGCGGACTGGTCAAGAACTTGTCTCTCATGTGCTACGTTAGTGTCGGTAGCGATGCA---------TCGCCCATTATCGACTTCATGACGCAACGTAACATGCAACTTCTCGAGGAATACGACCAGAATCAGAACCCGGATGCGACAAAGGTTTTCGTGAACGGTGTATGGGTCGGTGTTCACTCCAACGCTCAACAACTTGTTACAGTTGTGCAGGAGCTTCGACGAAAT---GGAACTCTATCTTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAATTCAAGATCTTCACGGATGCTGGTCGTGTCATGAGACCTTTGTTCGTTGTTGAGAACGATATCCGAAAGCCGAACCGAAACCACCTTATCTTTACCAAGGAAATCAGTAACAAGCTCAAGGCCGAGCAATGGAGTCAAGAGGAG------GTCGAGCAG------GCCACCTACGGCTGGAGA---GGTCTGATCCAAGACGGTGTTGTCGAGTATCTCGATGCAGAAGAAGAAGAAACTGCCATGATAACATTCTCGCCTGAAGATTTGGAGGAATGGCGAGAGATG---AAGATGGGCTTGCCT------GCAGCCGAGCGAAAGGACCGACTTCGTCGTCTCAAGCCCCAGCCAGATCCTCGCATTCACGCCTATACCCATTGCGAGATTCATCCGGCCATGATCCTGGGTATCTGTGCCAGTATCATTCCTTTCCCAGATCATAACCAATCGCCCCGTAACACGTACCAATCTGCCATGGGTAAGCAAGCCATGGGTGTTGCTCTCACCAACTTTGCGCTCCGTATGGAAACCATGATGAACGTCCTCTACTACCCCCAGAAGCCTTTGGCGACAACCAGGTCAATGGAGTACCTTAAGTTCCGTGAACTTCCCGCTGGGCAGAACGCTATTGTTGCCATTGCTACCTATGGTGGTTACAACCAGGAAGATTCCGTCATCATGAACCAGAGCAGTATCGATCGTGGTCTATTCAGGAGTTTGTTCTACCGTGCGTACACTGAACAAGAGAAGCGCATCGGTGTCAACGTCTTGGAACAGTTCGAGAAACCTACGCGTGCCGACACTCTCCGCTTGAAGGGTGGTACCTATGACAAGCTCGACGATGACGGTGTTGTCGCCCCTGGTGTACGTGTGTCCGGTGACGATATCATTATCGGAAAGACTGCGCCCATTGCAGCGGACGCT------------------CAGGAGCTTGGCCAGAAGACCACTCTGCACACCAAGCGAGATGTTTCCACACCTCTTCGTAGTACCGAGAACGGTATCGTCGATCAAGTGCTCTTCACCACTAACACTGAGGGTCTTCGATTCGTCAAGGTTCGTACCAGGACTACCAAGGTACCCCAGATTGGTGACAAGTTTGCTTCTCGTCACGGTCAAAAAGGTACAATTGGTATCACCTACCGTCAAGAGGACATGCCTTTTACTCGTGAAGGAGTGACA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Columnosphaeria_fagi_CBS_171_93 --------------------------------------------------------TT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTAAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT-------------------------------------------------------------------------AAGCGGCAACAGCTCAAATTTGAAAGCTG--GGTTCGCATTGTAATTTGTAGAGGATGATTTGGGG-AAG-CCGCC-TGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACA--GGAA-ATG--GC-ACCCTATGTAAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTTA-AACTGTTCGGCCG-GTC---T-TC-------T--GAC-CG--GTT-TACTCAGTT-T-GG----A-CAGGCCAGCATCAGTTTCGGC-GGCCGG-ATAAAGGCTC-TGGGAATGTGGCC---TCCACAATACGGCCAGCCGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCTCGCCGCTA-CAGTAGAT-T-CG-ACGCTGTAGCGAGTAGGCAGGCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTCAGTTCACTCAACTCGTGCGCGATATGCGTGTCTACCTCTCCCGCTGCATCGAGCAAGGTAGAGACTTTAATCTCACACTTGCTGTCAAGTCAAACATCCTCACATCTGGTCTGCGCTATTGCTTGGCCACTGGCAACTGGGGTGATCAGAAAAAGGCAGCCTCGGCAAAGGCCGGTGTCTCCCAGGTGCTGAACCGATACACATACGCTTCTACACTATCACATTTGCGACGAACGAATACTCCCATCGGTCGTGACGGAAAAATCGCCAAGCCTCGCCAATTGCACAACACCCATTGGGGTCTTGTGTGTCCCGCAGAAACACCCGAAGGACAGGCTTGCGGTCTGGTCAAGAACTTGTCTCTCATGTGTTACGTCAGTGTTGGTACGCCTGCC---------GAGCCCATCGTTGAGTTCATGAACCAGCGAAACATGGAATTGCTCGAAGAGTATGAGCCCAAGAACAACCCGGATGCCACAAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTCCACAGAGACCCTTCTCAGCTCGTCAAGGTTGTGCAAAGTCTCCGCCGTAAC---GGCACCATCTCTTTCGAAATCTCACTCATCAGAGATGTTCGTGAGCGAGAGTTCAAGATTTTCACTGATGCTGGTCGTGTCATGAGACCGCTGTTCGTTGTCAACAATGACCCTGCAAGTCCGACCAAGGGTCAGCTTACCCTGAACAGATCTCACATTTCTCAGCTGCTTAATGCACGCCTTAGCGAAGAGGAG------CGCGACGGT------ACAATTTATGGCTGGAAG---AACTTGATCAGTGATGGTGTCGTTGAGTACCTCGATGCCGAGGAAGAAGAGGTTG-CATGATGGTCATGTCACCTGAAGACCTCGACGAGCATCGCCAGATG---AGAGCTGGACTC---------GTTTAC-AAGAGACTGACCCTCATCGAAGAATCAAGAGCAG--CAAACGCCAACGTTAGAACATGGACCCATTGCGAGATTCACCCTGCCATGATTCTTGGTATTTGCGCTTCCATTATTCCTTTCCCCGATCACAACCAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Comminutispora_agavaciensis_CBS_619_95 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGGTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCTTGGTGAATCATGATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCGGTTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAATCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGACCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAACCGCATGCCCTTCACTG-GGCGTGCCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACAT-GTGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTCATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGGAGCC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CGTCCGAGTTGTAATTTGCAGAGGATGCTTCTGGG-CAG-CCGCC-GGTCTAAGTTCCTTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGCGACC--GG---CCG--GC-ACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCCGCGG-TGTTCGGCCG-GTC---T-CC-------T--GAC-CG--GTT-TACTC-GCCGC-GT----G-CAGGCCAGCATCACTTGGGAC-CGTCGG-AC-AAACCCC-CGGTAATGTGGCT---CTTC-CATGCGACGAGTCCCGGGTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTGCGCGTAATG-AAAGTGAACGGAGGTGGGAAGCGCTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTGCTTAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Condioxyphium_gardeniorum_CPC_14327 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCAATGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAACCGCATGCCCTTCACTG-GGCGTGTGTGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGGG-GTGTTATCATTTTGACCTCCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGT---------------------------------------------------------------------------------------------------------------------TTGCCCTAGTAACGGCGAGTGAAGCGGC-ATAGCTCAGATTTGAAATCTGG-CGTCCGAGTTGTAATCTGTAGAGGATGCCTTTGGG-TAG-CCACC-GGTCTAAGTCCCCTGGAACGGGGCGTCACAGAGGGTGAGAATCCCGTATGTGACC--GGA--AGG--GC-ACCCTCCACAAGGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTGGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-CACTC-ACCGT-CT----G-CAGGCCAGCATCATCTGGGGC-CGCCGG-ATAAAAGCGA-GGGGAATGTGGCT---CCCC-AATACGGCGAGCCTCGGGTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTCGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTGGGAGCCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGGA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GTGGGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCCCACCGCCG-GGGTAGAA-A-CG-ATGCCCCGGCGAGTAGGCAGG-------------------------------------------------------------------------------------GGTCACATCGAGCTCGCAGTGCCGGTGTTCCATGTCGGG---TTTGTCGTCAAGATCAAGAAAATCCTTGAGTCAGTCTGTCACAACTGTGGCAAGCTTCTTCAAGACGAGCGAAACCCTGCTTTCAAGCAAGCTATCTCGCTCCGCGACCCGAAGCGTCGTTTCGAAGCCGTGCACAAACTCTGCAAA---GGTACAAAGGTCTGTGAGGCAGAC---------CAGCCCGATGATCAGGGTCACGGTGGATGCGGTAATGCTATGCCAATT---ATCCGAAAGGATGGCTTGGCTTTGAACGGCACTTGGGAG---CCT---ACCAAA---CAGGAGCAGGAAGAGAAGGAAACCCGA---CAGATCATGCCTTCGGACGCTCTCCGGGTCTTCCGCCTGATCTCGGAACTTGATATGGTTCGTCTTGGTCTGAATGTTGACTATGCTCGTCCCGAGTGGATGATCCTAACGGTGCTGCCCGTTCCACCGCCACCGGTCAGGCCCTCCATCTCCGTCGATGGCACCAACCAGGGCATGCGATCCGAAGACGACTTGACGTACAAGCTGTCCGATATCATTCGTGCAAACAGTAACGTCAAACGTTGCGAGCAAGAGGGGTCTCCTCAGCATGTTGTAAACGAGTTCATACAGCTACTACAGTTTCATGTTGCAACATACATGGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGAATGAAGGTTCGCGACAGCTGAAGAACGACATGCAGCAATATCTCGTGAGGGCTATTGAGTCCGGCAGAGACTTCAACGTCAACCTTGCTTGCAAGAGCAACATCATCACATCTGGTCTGCGTTACAGTCTTGCTACCGGTAATTGGGGCGATCAAAAGAAAGCAATGTCAACAAGAGCAGGTGTTAGTCAAGTGCTTAACCGCTTTACTTACGCTTCAACATTGTCACATTTGCGTCGTACGAACACTCCCATTGGCAGAGACGGCAAGATTGCGAAGCCTAGACAATTGCATAACACCCATTGGGGTCTGGTGTGTCCAGCAGAGACGCCTGAAGGACAAGCTTGTGGGTTGGTCAAGAATCTTGCGCTCATGTGCTATGTAAGTGTTGGCACACCAGGT---------ACACCTCTGGTCGAGTTCATGCAGCAACGAGACATGGAACTGCTTGAAGAGTATGACCCTGTGACCAACCCCAACGCCACAAAGATTTTTGTCAACGGTGTTTGGGTGGGCGTTCACAAGAACCCAACTCAGCTGATTGAAACTCTTCGCGAGATTCGTCGAAGA---GGTACTGTCAGTTTCGAAATCACTATCATCCGTGACGTCCGAGACCGAGAGATCAAAGTTTTCACAGATGCTGGCAGAGTCTGCAGGCCGTTGTTCGTTGTTGACAACAATCCTCGTTCCGCAAGAAAGGGAAAATTGGCGCTTAGGCGGGAGCACGTCGAGCATTTGCAGGAAGACCGACTATCAGAGGAAGAA------CGTGACGAG------CAGACCTTCGGGTGGAAG---GGCCTGGTCAAGGAGGGCGTGGTTGAATACTTGGATGCTGAAGAAGAAGAGCAAGCCATGATCATCATGACACCAGACGACCTCGACGAACACAGACAAGTG---CTGCAGTATGGCTCG------TCATTCACAGATGACGATCCTCATCGCCGTATCAAGCCGAAACCTAACCTTGCGGTGCGGATGTGGACGCATTGTGAGATTCACCCTGCAATGATCCTCGGTATCTGTGCCCCATCATTCCAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACTGCGCTGTCCTCATCATCGCTGCCGGCACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTGAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGTTTCAACGAGATCATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCAAAGCACGTTCCATTTGTGCCAATCTCCGGCTTCAACGGTGACAACATGATCGAGCCTTCCTCCAACTGCCCATGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGTCC---AAGTCCACTGGCAAGACCCTCCTCGAGGCTATTGACGCCATCGACCCCCCATCCCGCCCAGTCGACAAGCCACTCCGTCTGCCCCTCCAGGATGTGTACAAGATTGGCGGTATCGGAACTGTCCCAGTCGGCCGTGTCGAGACCGGTGCCATCAAGGCCGGCATGGTCGTCACCTTCGCCCCAGCTGGTGTCACCACTGAGGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGCCGAGGGTCTC---CCAGGTGACAACGTTGGCTTCAACGTCAAGAACGTCTCTGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGAATGACCCACCAAAGGGCTGCGACAGCTTCAACGCCCAGGTCATCGTCCTGAACCACCCTGGCCAGGTCGGTGCTGGTTACGCTCCAGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGCAAGTCCATCGAGAACTCTCCTAAGTTCATCAAGTCTGGTGATGCCGCCATCGTCAAGATGATTCCATCCAAGCCAATGTGCGTTGAGGCCTTCACCGAGTACCCACC- Coniothyrium_palmarum_CBS_400_71 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATACCCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTG-TACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTG-GGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAAAGGTCT-CTGTCGTGTACCT---CTCTTCATACAACCAGCCTGGACTGA-GGT-CCGCG-CA----T-TT-T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCTGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAACGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-GGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAAC-GGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCCCGCCGCCG-GGGCAAGA-T-TT-AAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGGGTGACCAAAAGAAGGCTGCGTCAGCCAAGGCCGGTGTGTCGCAAGTGCTGAACCGATACACTTACGCCTCTACCCTCTCCCATCTGCGGCGAACGAACACTCCTGTCGGTCGTGACGGGAAGCTGGCCAAGCCCCGACAATTGCACAACTCTCATTGGGGTCTGGTTTGCCCCGCAGAAACCCCTGAAGGCCAAGCCTGTGGCTTGGTCAAGAACT-GTCGTTGATGTGCTATGTCAGCGTTGGTAGCGAAGCC---------ACACCTATCGT-GACTTCATGACCCAGCGGAACATGCAACTTCTGGAAGAGTATGACCAAAGCCAGAATCCGGAGGCTACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTGCATTCCAACGCTCAACAACTGGTATCAGTCGTACAGGAGCTCCGGCGAAAC---GGCACTCTGTCTTACGAGATGAGCTTGATTCGAGATATTCGTGATCGGGAGTTCAAAATCTTCACGGATGCCGGTCGTGTTATGAGGCCCTTGTTCGTCGTCGAGAACGACGTTCGAAAACCCAACCGAAACCAGCTCATCTTCACAAAGGACATTAGTAGGAAGCTTCTCTATGAGCAATGGAGTGAAGAGGAA------ATAGCAGCC------GCCACCTATGGCTGGAAA---GGCCTCATCCAAGATGGTGTGATCGAGTATCTTGACGCTGAGGAGGAGGAAACTGCAATGATAACCTTTGCCCCGGAAGATCTGGATGAATGGCGGGACATG---AAGCTAGGTCTCCCG------CCGAACGAGCGAAAAGACCGTTTGCGGCGTCTCAAGCCAGATCCTGATCCTCGCATCCATGCTTACACCCATTGTGAGATCCATCCAGCCATGATTCTGGGTATCTGCGCCAGTATCATCCTTTCCCGGATCACAACCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGATTATCGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACTCGTGAGCACGCTCTGCTTGCCTACACCCTTGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTTGGATACAACCCCAAGCACGTCCCCTTCGTCCCCATCTCCGGATTCAACGGTGACAACATGATCGAAGTCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACCGGTAAGACTCTCCTCGAGGCCATTGACGCCATCGACCCCCCCAGCCGTCCTACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTTCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Corynespora_cassiicola_CBS_100822 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTTCAGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-TACTTGTCCGGCCGGGCCTTTCCTTCTGGAGAACCTCATGCCCTTCACTG-GGTGTGCTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTTCTATCTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGG--------------------------------------------------------------------------------------------------------------------GGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCG-TTG-GCAGC-GGT-T-AGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTC--GCC--AGC---T-CCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCAGCCG-GGC---T-CC-------G--GCC-CG--GTG-CACTCTTCTGC-GG----G-CAGGCCAGCATCAGTTCGGGC-GGCCGG-ATAAAGACCT-CTGTCACGTACCT---CCCTCAATGCGGCCAGTCCGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCGGTCACATCGAGCTGGCGGTGCCCGTCTTCCACGTCGGC---TTCATTGTGAAGATCAAGAAGATACTCGAGACTGTGTGCCACACCTGTGGCCTCATTCTGGCCGATTTCAACCACCCAGACTGGAAGAGTGCCATCCGGATCAAGGACCCCAAGAAGCGTTTCGACCAAATCTGGCGGCTGTCCAAG---ACGAAGAAGGAGTGCGTGTTTGAT---------ACCGGCGAGGAAATTCCTCACGGCGGCTGTGGCAGTCGTCAGCCCGACACCATTCGCAAGGAAGGCTTGAAGCTCACTGCAACCTTCAAG---------CCCCAG---AAGAATGATGACGAGGAGGAGAAGAAG---CCCATCACCCCACAGGACGCGCTCAATATCTTCCGCAACTTGACCGACAACACACTGCATCTGCTCGGTCTGAACGCAGACTATGCTCGCCCCGAATGGATGATCCTTACAGTGTTGCCCGTCCCCCCACCACCTGTCCGGCCCAGTATCTCGGTCGATGGTACTGGCCAGGGAATGCGTGGCGAGGACGACCTGACATACAAACTGGGCGACATTATCCGCGCCAACGGCCGTGTTCAAGAGTGTTACCAACAGGGTTCGCCACAGCACGTCATCACCGAGTTCGAGGCTCTCCTCCAGTACCACGTTGCCACCTACATGGACAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAACAACGACTTCAACGTCCAGATGGCTGTCAAGGCTAGCATCCTGACAAACGGATTGAAGTATTCGCTCGCCACGGGAAACTGGGGTGACCAGAAGAAGGCCGCTTCCGCCAAAGCCGGTGTCTCTCAGGTGTTGAACCGTTACACTTATGCATCCACCTTGTCGCATCTTCGACGAACCAATACTCCGATTGGTCGTGACGGCAAGCTTGCGAAGCCGCGCCAGCTGCACAACAGTCACTGGGGCTTGGTGTGCCCTGCAGAGACCCCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACCTTTCGTTGATGTGCTACGTCAGTGTCGGTAGCGAGAGC---------ACGCCTATTGTCGATTTCATGACCCAGCGGAACATGGAACTACTCGAGGAGTACGATCCCATCGTCAACCCGAACGCCACAAAGGTCTTCGTCAACGGTGTCTGGGTGGGTGTTCACACCAACCCGGCACAGCTCGTCACTGTCGTCCAGGAGCTTCGACGTAAC---GGAACTCTTTCCTACGAAATGAGTCTTATCCGTGACATCCGTGATCGAGAATTCAAAATCTTCACCGATGCCGGTCGTGTCATGAGGCCTCTGTTCGTCATCGAAAACGACGTTCGCAAACCAAACGTCAACTGCCTTGCCCTCACCAAGGAGCATGTCGACAAGCTCATCGAGGACAAGGTGAGTGACGAGGAG------GCCGCAAAC------GCCAAGTATGGCTGGAGG---GGACTCATCCACGACGGTGTGGTCGAGTACCTCGACGCCGAAGAGGAGGAGACGGCCATGATTGTCATGACTCCCGAAGACTTGGAGGAATGGCGCGACCTC---AAGATGGGTGTTGTC------GCTGCCGAGGTGGCGGATCGCCACAAGCGTATCAAACCCAAGCCGAACCCGACCGTCTTCCAGTACACTCTGAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGTCC---AAGGCCACTGGTAAGACCCTCCTTGAGGCCATCGACGCCATCGACCCTCCTTCCCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGAGGTATTGGCACGGTGCCCGTCGGTCGTGTCGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCCAACGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCCGGTTACGCTCCCGTCTTGGATTGCCACACCGCCCACATTGCCTGCAAGTTCTCTGAGCTTCTTGAGAAGATTGACCGCCGTACCGGCAAGTCTGTCGAGTCTTCTCCCAAGTTCATCAAGTCTGGTGATGCTGCCATCGTCAAGATGATTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACCGAGTACCCCC-- Corynespora_cassiicola_CCP -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-TACTTGTCCGGCCGGGCCTTTCCTTCTGGAGAACCTCATGCCCTTCACTG-GGTGTGCTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTTCTATCTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Corynespora_olivacea_CBS_114450 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCG-TTG-GTGGC-GGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTTTGTGGTC--GCC--TAC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCACCCG-GGC---T-TT-------T--GCC-CG--GGG-CACTCTTCTGC-GG----G-CAGGCCAGCATCAGTTTGGGC-GGTCGG-ATAAAGGCCT-CTGTCACGTATCT---TCCTTCATGCGACCAGCCCGGACTGA-GGT-CCGCG-CT----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATATAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTA-CC--ATACCCCGCCGCTG-GGGCAGATCA-TT-ATGCCCCAGCGAGTAGGC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGTCAGACCCGTGAGCACGCTCTTCTCGCCTACACCCTCGGTGTTAGGCAGATCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGCCCGTTACCAGGAGATCGTCAAGGAGACCTCCAACTTCATCAAGAAGGTTGGCTTCAACCCCAAGCACATCCCCTTCGTGCCCATCTCTGGCTTCAACGGCGACAACATGATCGACGCCTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGATC---------------AAGACC---AAGGTCACCGGCAAGACCCTACTTGACGCCATCGATGCCATCGACCCCCCGTCCCGTCCCTCCGACAAGCCCCTCCGTCTGCCCCTTCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCCGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTCTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGACCGACCCGCCCAAGGGCGCCGAGTCGTTCAACGCCCAGGTTATTGTCCTCAACCACCCTGGCCAGGTTGGTGCCGGTTATGCTCCCGTCCTTGACTGCCACACTGCCCACATCGCTTGCAAGTTCTCTGAGCTTCTTGAGAAGATCGATCGCCGAACTGGCAAGTCTGTTGAGGCTTCCCCCAAGTTCATCAAGTCCGGTGATGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAAGCTTTCACTGAGTACCCTCCT Corynespora_smithii_CABI_5649b --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCG-TTG-GCGGCG-GTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGTC--GCC--GGC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTC-AAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCAGCCG-GGC---T-CCG------G---CC-CG--GTGC-ACTCTTCTGC-GG----G-CAGGCCAGCATCAGTTCGGGC-GGCCGG-ATAAAGACCT-CTGTCACGTACCT---CCCTTAATGCGGCCAGTCCGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCCCGCCGCCA-GGGCAGAA-A-TT-ATGCCCTGGCGAGTAGGCAGGCGTGGAGGCTTG----------------------------------------------------------------GGTCATTTTGGCCACATCGAGCTTGCCGTGCCTGTCTTCCACGTCGGC---TTTATCGTGAAGATCAAGAAGATTCTCGAGACCGTGTGCCACAACTGTGGCCTCGTCTTGGCCGACTTCAACCACCCAGACTGGAAAAACGCCATCCGGGTCAAGGACCCCAAGAAGCGCTTCGACTTGATCTGGCGGCTGTCCAAG---ACCAAGAAGGAGTGCGTTTCTGAG------------CCTCTGGACATTCCCCATGGCGGCTGCGGCAATCGCCAGCCTGATTCCATTCGCAAAGAAGGCCTCAAGTTGACGGCATCGTATAAG---CCA---AAGAAG---GACGACGACGAGGGCGAGGAGAAGAAG---CCCATCACCCCGCAAGACGCGTTGAACATTTTCCGCAACTTGTCCGACAACACGCTCCAGTTGCTCGGCCTGAACGCCGACTACGCCCGTCCCGAGTGGATGATCCTCACTGTACTGCCTGTTCCCCCGCCACCTGTCCGACCCAGTATTTCGGTCGATGGAACTGGCCAGGGCATGCGCGGTGAAGATGATCTGACCTACAAGCTGGGCGACATCATCCGCGCCAATGGTCGCGTGCAAGAGTGCTACCAGCAAGGCTCGCCACAGCACGTCATCACCGAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCTGTTCCGCATCCTGTTCCTCAAGTTGACTAAGGACGTCTACAAATATCTCCAGAAGTGTGTCGAGAACAACAACGATTTTAACGTGCAAATGGCCGTCAAGGCTAGCATCCTCACAAACGGCCTCAAATACTCTCTGGCCACGGGCAACTGGGGCGACCAGAAGAAGGCGGCCTCTGCCAAGGCGGGTGTCTCCCAGGTCTTGAACCGTTACACTTACGCATCCACCTTGTCACATCTTCGGCGAACAAACACTCCAATCGGCCGTGACGGCAAGCTTGCTAAGCCACGGCAGCTTCACAACAGTCACTGGGGCTTGGTGTGTCCCGCCGAGACCCCTGAAGGGCAAGCGTGTGGATTGGTCAAGAATCTCTCTCTGATGTGCTACGTCAGTGTCGGTAGTGAGAGC---------ACGCCTATCGTCGACTTCATGACCCAGCGGAACATGGAACTTCTGGAGGAGTATGACCCGATCGTAAACCCGAACGCGACTAAGGTCTTTGTCAACGGAGTCTGGGTCGGCGTGCACACGAACCCGGCGCAACTCGTCACCGTCGTGCAGGAGCTTCGACGAAAC---GGAACCTTGTCATACGAAATGAGTCTTATCCGCGACATTCGTGACAGAGAGTTCAAGATCTTCACCGATGCCGGTCGTGTGATGAGGCCTTTGTTCGTCATCGAGAATGACGTCCGAAAACCGAACGTCAACTGTCTTTCCCTTACTAAGGACCATGTTGAGAAGCTGCTTGCAGATAAGATGAGCGACGAGGAC------GCTGCAAAT------GCCAAGTACGGTTGGAGG---GGACTCATCCACGATGGTGTGGTAGAGTACCTCGACGCTGAGGAAGAGGAGACGGCCATGATCGTCATGACTCCCGAAGACCTAGAGGAATGGCGAGACCTC---AAGATGGGCGTGGTC------GCAGCTGAGGTTCGTCACAAGCGCATCAAACCTAAGCCGAACCCT------ACCGTTTATTCCTACACCCACTGCGAGATCCACCCCAGTATGATTCTCGGTATCTGCGCCAGTATCATTCCGTTCCCCGACCACAACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCAAGAACATGATCACTGGTACCTCCCAGGCCGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTCCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTTCCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGCCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACTGGCAAGACCCTCCTCGAGGCCATCGATGCCATCGACACCCCCAGCCGTCCCTCCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTGCCCGTCGGTCGTGTCGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGCCAGGTCGGTGCTGGTTACGCCCCTGTCTTGGACTGCCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cryptothelium_amazonum_47 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GG-CCGAGTTGTAATTTGCAGAGGATGTCATGGGA-TTT-GTGCAG-ACTCAAGTTCTTTGGAAAAAGACGCCATGGAGAGTGACAGTCTCGTCC-TGTCT--ACC--A-C--AC-TTCCCTCGTATGACTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGACGTAAATTTGTTCCAAAGCTAAATACCGGCTAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCTTATGTCATCAGAAATGACGGCAA-TGTTCAGCC--------T-TT-------T--G-------GTGT-ATTCAT-TGCTTG----T-CAGGCTAGCATCAATTGGGGT-GGCTGG-ATAAAAGCTT-CGGAAATGTAGCT---CCCCCAATGCAGCCAATCCCGATTGA-GGA-CCGCTTTGAGGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGGATTGTGCTATTCTCATCATCGCCGCTGGTACTGGTGAATTTGAAGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTCCTCGCATACACCCTTGGTGTCCGGCAACTCATTGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGAACGTTACAATGAAATCATCAAAGAAACGTCCAATTTCATCAAGAAGGTCGGCTACGCCCCCAAGACTGTGCCCTTCGTCCCCATCTCAGGCTTCAACGGTGACAACATGATTGACGCCTCCACCAATTGTCCATGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGTCGACCGGCAAGACTCTTCTTGAAGCCATTGACAGCATTGATCCTCCCAGCCGTCCCTCTGATAAACCTCTCCGTCTGCCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cryptothelium_pulchrum_63C -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------T----CCGGCCGAGTTGTAATTTGCAGAGGATGTCATGGGA-TTT-GTGTG-GGCGCAAGTTCTTTGGAAAAAGACGCCATGGAGAGTGACAGTCTCGTCC-CGTCC--CAC--CAC--AC-TTTCCCCGTATGACTCCTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGACGTAAATTTGTTCCAAAGCTAAATACCGGCTAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCTTATGCCATCAGAAATGGCGTCA-ATGTTCAGCCT-------T-TT--------------TG--GTG-TACTCATTGATTGG----C-CATGCTAGCATCAATTGGGAT-AGTCGG-ATAAAAGTGT-TGGAAATGTAGCT---CCCTCAATGCGTCTAATCCCGATTGA-GGA-CCGCCTTT----T---------TAGGATGCTG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cystocoleus_ebeneus_L315 ----------------------------------------------------------------------------CCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAGCGCCCTCCGGGGCCTCTTGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAAGGAGCCTGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGTCTGGCTGGTCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGACCTTTCCTTCTGGGGAGCCGCATGGCCTTCACTG-GCCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGGATACATTAGCATGGAATAATAGAATAGGACGT-G------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAGCTCAAATTTGAAACCCA--AGCCTGACTTGTCATTTGTAGAGGATGCTTCTGGG-TAG-CGGCC-GGTCTAAGTTCCTTGGGACAGGACGTCACAGAGGGTGAGAACCCCGTACGTGACC--GG---CTC--GC-ACCCTTTCCGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGAAAATTCCTTCTAAAGCTAAATATCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGTCGGCGG-CGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TAGTC-GTCGC-CG----G-CAGGCCAGCATCACCTGGGAC-CGCCGG-ATAAAGACGT-GGGGAACGTAGCT---CCTCTAATACGGCGTGCCCCGGGTGA-GGT-CCGCG-TC----T-C--G--GCGAGGATGTTGGCGTAATGGGTGCAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCGACCATCTGTGCGAGTG-TTCGGGCATCAAA-CCCCTACGCGCAATG-AAAGTGAACGGAGGTGGGAGCTGGCGCACCAT-CGA-CCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCAC-AGCTGGT-CGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-AT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cystocoleus_ebeneus_L348 --------------------------------------------------------------------------ATTCTAGAGCCAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAGCGCCCTCCGGGGCTTCTTGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAAGGAGCCTGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Davidiellaceae_sp_TRN_43 ----TGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTGCTACAT-GG-ATACCTGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTAGCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGATACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTCGGGGAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGGCCGCCGTAATGATTAATAGGGATAGTCGGGGGCATTAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATCTGCCAAGGATGTTTTCATTAATCAG-GAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-GTGTTACTATTATGACCCCATCGGCACCTTACGAGAAATCA-AAGTTT-----------------------------------------------------------------------------------------------------------------------------GCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGG-CAG-CGGCC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACC--GG---TTG--GC-ACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATACCGGCTAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TACTC-GCCGC-CG----G-CAGGCCAGCATCGTGTGGGCG-CGCCGG-ACAAAGGCGC-CGGGAATGTGGCC---CCTC-AATACGGTGCCGCCCGCGCGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTCTGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGGAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGC-GTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACGTTAGAATGTAGCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-G---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGT---T-CATCACTAAGATCAAGAAGGTCCTGGAGTCGGTCTGCCACAACTGCGGTAAGATCAAGACAGATGAGCGCAACCAGCAATTTGCGCAAGCCACCCGTCTCCGCGATCCCAAGCGTCGCTTCGAAGCCGTGCACAAGATCTGCAAG---CCGATCACCGTCTGCGAGGTTGAT---------GCTCCGGCAGAACAAGGTCACGGTGGATGTGGTAACCAGCAGCCTGTC---ATTCGTAAAGAGCAGTTGCGGTTGAACGGCACGAACAAG---GCG---GCCAAG---TCGGACGAAGACGACGACGAGAAGTTC---CAGATCACGCCCGGGTATGCGCTCAGCGTCTTCAAGAACATCTCCGACCTCGACCTGGCCCGCCTAGGCTTGAACGCCGACTACGCTAGGCCAGAATGGATGGTACTCACCGTCCTGCCTGTCCCGCCGCCGGCTGTGCGTCCTTCGATCTCGGTTGATGGCACGAGCCAGGGCATGCGCTCCGAGGACGACTTGACGTACAAGCTATCCGACATCATCCGCGCCAACTCCAACGTGCGTCGATGCGAGCAGGAAGGTTCGCCACCGCACGTCACGGAGGAGTTTGTGCAGCTTCTGCAGTTCCACGTGGCGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGGCTCAGTTCGCGCAGCTGGTGAAGGATGTGAGGAACTACTTGCACCGCACGGTGGAGAGCGGGAAGGAGTTCAATATGACGCTTGCGGTGAAGAGTCAGATCATCACGAGCGGGTTAAGGTACTGTTTAGCGACGGGTAATTGGGGCGATCAGAAGAAGGCGGCGAGCGCGAAGGCTGGTGTGAGCCAGGTGCTGAATCGGTATACGTACGCTTCTACGCTCTCGCATCTACGGCGGACGAACACTCCTATTGGGCGAGACGGCAAGATCGCGAAGCCCCGGCAGCTGCACAACACGCATTGGGGGCTGGTGTGTCCTGCAGAGACTCCGGAAGGGCAGGCGTGCGGGCTGGTGAAGAACCTGGCACTGATGTGCTATGTGTCGGTGGGCACGCCAGGG---------ACGCCACTGATTGAGTACATGCGGCATCGTGGGATGGAGCTCCTGGAGGAGTACGACGCGGTGATGAATCCGAATGCGACGAAAGTCTTCCTTAACGGGACGTGGGTAGGTGTGCATTCGAACGGCGGGCAGTTGACGGCGGCGCTACGGGAGCTGAGGCGGAAG---GAGGTCATTGGCTTTGAAGTTACGATTATTCGGGACGTGCGAGAAAGGGAGATTCGAGTCTTCACCGACGCTGGACGCGTGATGCGTCCTCTGTTCGTCGTCAACTCGGATCGCGGCTCGCCGGACTTTGGCAACCTGGCCCTGCGACAGGAGCACGTGGCGCAGCTGCAAAACGACCAGGTCAGCGAGGAGGAG------AAGACCGAC------GCGACGTTCGGGTGGAAG---GGCCTGGTGAAGGGCGGCGTGATCGAGTATCTGGATGCGGAGGAAGAGGAGACGGCCATGATCATCATGACGCCCGACGACCTCGAGGATTACAAGGCCGCA---CGCTCTGGCGTGCCC---------TGGTCAGAGGATGACCCGCACAGGAGGATCAAGGCAAAGCCGAACACGCAGGTGGCGATGTGGACCCACTGCGAGATCCACCCTGCGATGATCTTGGGGATCTGCTCGAGTATCATCCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTGAGTTCGAGGCTGGTAAATCAAAGGACGGCCAGACGCGTGAGCACGCCCTGCTTGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGCTACACCGAGATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTACAACCCGAAGACCGTCCCCTTCGTCCCGATCTCCGGGTTCAACGGCGACAACATGATCGACAACTCCCCCAACTGCCCGTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGACCACCGGCAAGACCCTGCTCGAGGCCATCGACGCTATCGACCCACCGTCGCGCCCAACCGACAAGCCTCTCCGTCTGCCGCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACAGTTCCCGTCGGTCGTGTCGAGACTGGTGTGGTACGTTCCGGCATGGTCGTTACCTTCGCCCCGGCTGGTGTCACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTCTG---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATTCGTCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCGCCCAAGGGCTGCGACTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCGGGTCAGGTCGGTGCCGGCTACGCACCAGTCCTCGACTGCCACACCGCCCACATCGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCCATTGAGAACGCCCCCAAGTTCATCAAGTCCGGTGACGCCGCGATCGTC------------------------------------------------------ Delitschia_cf_chaetomioides_GKM_1283 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTACTTTGCAGAGGGTGGTTCGGCA-ACG-GCGCC-TGTCTAAGTTCCTTGGAACGGGACGTCAGAGAGGGTGAGAACCCCGTACGCGGCA---GGT--GC--CT-GCGCCATGTGAACCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTATATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGCTGCCGCTGTTCATCGGGGGT---C-CG-------T--CCC-TC--GTG-CATTCGGCGGC-AG----G-CAGGCCAGCATCAGTTGGGGC-GGCTGG-AGAAAGGCCC-TGGGAATGTAGCT---CTCTTCATGCAGCCAGCCCCGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTCGCAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGGAATG-AAAGTGAACGGAGGTGGGACCCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTGCTTTG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Delitschia_cf_chaetomioides_GKM_3253_2 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTACTTTGCAGAGGGTGGTTCGGCG-TCG-GCTCC-TGTCTAAGTTCCTTGGAACGGGACGTCAGAGAGGGTGAGAACCCCGTACGCGATG---GGC-GGC--CGGTCGCCGTGTGAACCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTATATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGCTGCCGTTGTTCATCGGGGGT---T-TG-------T--CCC-CC--GTG-TACTCGACGGC-AG----G-CAGGCCAGCATCAGTTGGGGC-GGTTGG-AAAAAGGCCT-TGGGAATGTAACT---CTCTTCATACAGCCAGCCCCGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTCGCAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGGAATG-AAAGTGAACGGAGGTGGGACCCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTGCTTTGTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Delitschia_didyma_UME_31411 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-AGTCCGAGTTGTAATTTGTAGAGGGTGTTTCGGCG-TCG-ACCCT-TGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACG--AGC--GGT--CT-TCGCCATGTGAAACCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTATATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCTGCCGTCGTTCATCCG-GGC---T-TC-------T--GCC-CG--GTG-CATTCGTCGGC-AG----A-CAGGCCAGCATCAGTTTGGGC-GGTCGG-ACAAAGGCCC-TGGGAATGTAGCT---CTCTTCATGCGGCCAGCCTGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTCGCAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-AATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTGCTTAATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Delitschia_didyma_UME_31411v2 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCCTTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACTTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGAGAGCCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAATTTAGGGGATCGAAAACAATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTATTCTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT---------------------------GCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-AGTCCGAGTTGTAATTTGTAGAGGGTGTTTCGGCG-TCG-ACCCT-TGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACG--AGC--GGT--CT-TCGCCATGTGAAACCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTATATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCTGCCGTCGTTCATCCG-GGC---T-TC-------T--GCC-CG--GTG-CATTCGTCGGC-AG----A-CAGGCCAGCATCAGTTTGGGC-GGTCGG-ACAAAGGCCC-TGGGAATGTAGCT---CTCTTCATGCGGCCAGCCTGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTCGCAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-AATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTGCTTAATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-T------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Delitschia_winteri_CBS_225_62 --------------------------------------TGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGTACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTTCGGTCGGGCCTTTCCTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATCAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT-----------TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGCCCGAGTTGTAATTTGCAGAGGGTGTTTCGGCG-AGG-GCCTG-GGTCTAAGTTCCTTGGAACGGGACGTCATAGAGGGTGAGAACCCCGTACGTGGCC--CCT--GGT--CT-TCGCCATGTGAAACCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTATATTTCTTCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCTGCAGTCGTTCATCCG-GGC---C-TC-G-----C--GCC-CG--GTG-CACTCGTCTGC-AG----G-CAGGCCAGCATCGGTTGGGGC-GGCCGG-ACAAAGGCCT-TGGGAATGTGGCT---CTCTTAATACGGCCAGCCCCGACCGA-GGA-CCGCG-CT----T-C--G--GCTAGGATGCTGGCATAATGGTCGCAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGGAATG-AAAGTGAACGGAGGTGGGACCCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTGCTTAATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCGCCGCCG-GGGCAAAA-G-TT-AGGCCCCGGCGAGTAGGCAGGCGTGGAGGTCCGTGACGAAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTGGGGTGACCAGAAAAAGGCTGCATCTGCCAAGGCAGGTGTCTCGCAGGTGCTTAACCGTTACACATACGCCTCCACGCTGTCCCATTTGCGACGTACGAACACCCCCGTAGGTCGTGACGGCAAGTTAGCCAAACCGCGCCAACTGCACAACACCCATTGGGGATTGGTCTGTCCTGCAGAGACTCCCGAAGGACAAGCTTGTGGTTTAGTCAAGAATCTGTCGTTGATGTGCTACGTCAGTGTGGGTAGCGAAAGC---------ACCCCTATCACCGATTTCATGAGCCAGAGGAACATGGAGCTTCTGGAGGAATATGACCCGGTTGTCAACCCAACTGCCACCAAAGTCTTTGTGAACGGTGTTTGGGTCGGTGTCCATTCACAACCATCCCAGTTGACCACAGTGGTGCAAGAACTTCGGCGAAAC---GGAACCTTGTCCTACGAGATGAGTCTTATTCGGGATATCAGAGATAGGGAGTTTAAGATCTTCACCGATGCTGGCCGCGTAATGAGGCCGTTGTTCGTTATTGAGACGGATTACAAGAAGCCTAATCGGGGGATGCTGGTTCTGAACAAGAGCCACATTCAAAAGCTTTACGAAGACAAGGAATG-CGAGGACG-------CG--GC-GC------CAAGTT-GG-TGGAGGGG---A-T---TCACAGCGG-GTCGTGGAGTACCTTGACGCAGAAGAGGAAGAATC-GCAATG-TTATAATGAC-C--GAGGACTTGGACGATCACCACAATCTCAC----CAAGGTAT-CCAAT------CCAGGATACTTCAGAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATCGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGACGGACAGACCCGTGAGCACGCTCTGCTCGCTTACACCCTCGGTGTCAAGCAGCTCATCGTTGCTATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTTGGATACAACCCCAAGACCGTCCCCTTCGTCCCCATCTCTGGTTTCAACGGTGACAACATGATCGACGTCTCCTCCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGACC---------------AAGACC---AAGTCCACTGGTAAGACCCTCCTCGAGGCCATTGATGCCATCGACCCTCCTTCCCGCCCTACCGACAAGCCTCTCCGCCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTGACCACTGAAGTCAAGTCCGTTGAGATGCATCACGAGCAGCTCGTCGATGGTGGCAAGCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACAGCAAGAACGACCCCCCCAAGGGTGCTGAGTCCTTCAACGCCCAGGTCATCGTCCTTAACCACCCTGGTCAGGTTGGTGCCGGTTATGCGCCAGTGTTGGATTGCCACACTGCCCACATTGCCTGCAAGTTCGGTGAACTCCTCCAGAAGATCGATCGCCGTACCGGAAAGTCCACTGAGGACAACCCTAAGTTCATCAAGTCCGGTGATGCTGCTATCGTCAAGATGATTCCCTCCAAGCCTATGTGCGTTGAGGCTTTCACCGAGTATCCCCCT Delphinella_strobiligena_CBS_735_71 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTT--GGTCCGCATTGTAATTTGTAGAGGATGCTTTTAGG-CAG-CCGCC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACC--GGCT-CAG--GC-ACCTTCTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGCCTCGGTTGTTCAACCG-GTC---T-TT-------T--GAC-CG--GCC-TATTCAATCGG-GG----G-CAGGCCAGCATCAGTTTCGGC-GGCCGG-ATAAAGGCCT-TGGGAATGTGGCC---TCTCCAATACGGTCAGCCGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTAGGGTGTCAAA-CCCTTACGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATG-AAAC-ATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCTCGCCGCCA-TGGTAGAT-T-CG-AAGCCATGGCGAGTAGGCAGGCGTGGAGGTCAGTG-----------------------------------------------------------------------GGCCACATCGAGTTTGCCGTTCCCGTCTTTCACGTTGGT---TTTGTCACCAAGATCAAGAGGATCCTTGAGACCGTCTGTCACAACTGCGGCAAGATCTTGGTTGACGAAAGCAATCCCGCTTTCGCACACGCTGTTCGCATGAGAGATCCCAAGAGACGATTCGATGCCGTGTCCAGGCTTTGCAAG---CCCAGGTTGAACTGCGAACCCGAT---------GAGGCTCCCGATCGATCGCACGGCGGCTGTGGCAACCTGCAACCTACC---ATTCGAAAAGATGGT-TCAAGCTCACCGGCACCTGGACA---TGG---CCGAAG---GAGGCCGACACAGAGATCGAGAAGCGC---GACATCACTCCTCAGATGGCCCTCAACATCTTCCGCAACATCTCAACCTACGATCTCGCCAGAATGGGTTTGAATGCTGACTATGCCCGCCCCGAATGGATGATTTTGACCGTCTTGCCCGTTCCACCACCCGCTGTCCGTCCTAGTGTCTCGGTTGACGGCACGAACCAGGGCATGCGATCTGAGGATGATTTGACTTACAAGCTTAGTGACATCGTTAGAGCTAATAGCAACGTCCGAAGGGCCGAGCAAGAAGGCTCTCCTCAGCACGTCAT-CAAGAATTCATCGACTTGCTACAATTCCACGTCGCAACATACATGGATAATGATATCGCCGGTCAGCCCAAGGCTCTGCAAAAGTCCGGAAGACCCATCAAGTCCATCCGTGCTCGACTCAAGTCCAAGGAGGGTCGTCTCCGAGGTAACCTTATGG-C-AGCGTGT-GATTTCTCTGCCCGAACCGTCATTACGGGTGACCCTAACCTCTCTCTCGATGAAGTCGGTGTACCGCGCAGTATCGCTCGCATTCTCACTTTCCCTGAGACTGTCAACGCATTCAACATTGACAGGCTTCAACAGCTTGTCCGCAATGGTCCCAATGAGCATCCAGGTGCCAAGTACGTCATAAGAGACACAAACGAGAGA------------------------------------------------------------------------------------------------------------------------------------------TTCAACCTGACCCTTGCCGTCAAGAACAACATTCTCACCAGTGGCTTGCGTTACTGTCTTGCCACGGGTAATTGGGGCGATCAGAAAAAGGCCGCATCGGCAAAGGCTGGTGTTTCTCAGGTCCTGAACAGATATACATACGCTTCCACCCTCTCTCACTTGCGGAGAACAAACACGCCCATTGGCCGAGACGGCAAGATCGCCAAGCCGCGTCAACTACACAATACCCATTGGGGCTTGGTCTGCCCGGCCGAGACGCCCGAGGGTCAAGCGTGTGGCCTGGTCAAGAATTTGTCCCTCATGTGCTACGTCAGCGTAGGCACCCCCAGC---------GAGCCTATTATCGAATTCATGAACCAGAGGAACATGGAACTGCTCGAGGAGTATGAGCCCAAGAACAATCCGGACGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCACAGGGATCCCTCTCAGCTGGTCAAGGTCGTTCAGAGCCTGCGGAGGAGC---GGTACCATTTCATTCGAAATTAGTTTGATCAGAGATGTCCGTGACCGCGAATTCAAGATCTTCACCGACGCTGGACGTGTCATGAGGCCCCTCTTCGTCGTTGACAACGACCCCTCGAGCGAACGCAGAGGCCAATTGGTCCTGGCCCGAGAGAACATCGACAGACTGCAGGCTGAGAGGTTGAGCGAGGAGGAG------CGGGACAGC------AGCATATACGGCTGGAAG---GGCTTGATTTCCGACGGTATCATCGAATACTTGGATGCTGAGGAAGAGGAGGCTGCCATGATCATCATGACTCCCGAAGATCTGGACGAGCACCGTCAAGCC---CGTTCTGGTGTGCCC------GTCTACGAGGATATAGATCCACACAGGCGCTTCAAGGCCAAGCCCAACCAGAATGTCAGGACGTGGACCCATTGCGAGATTCATCCTGCCATGATTCTCGGTATCTGTGCCTCTATCATCCCCTTCCCCGATCACAATCAGTCTCCTCGTAACACCTACCAGTCGGCTATGGGTAAGCAAGCTATGGGTGTCACTCTTACCAACTACGGCGTCCGCATGGACACCATGGCGAATGTTCTCTACTACCCCCAGAAGCCACTTGGCACCACGCGATCCATGGAGTACCTCAAGTTCAGAGAGCTACCTGCCGGTCAGAATGCTATCGTGGCCATTGCATGTTACGGTGGTTACAACCAGGAGGATTCCGTCATTATGAACCAGTCCTCGATCGATCGTGGCCTCTTCAGATCTCTGTTCTACCGTGCCTACATGGACCAAGAGAAAAAGGTCGGCATATCGACCGTCGAAAAGTTTGAGAAGCCTGTTCGCTCAGACACAATGCGCATGAAGCACGGTACTTATGACAAGCTTGACGACGATGGAATCATCGCCCCCGGATCGCGTGTCTCCGGTGAAGATATCATCATCGGCAAGACAGCACCAATGGCACCTGATGCA------------------GAGGAACTCGGCCAGCGTACCAAGCTGCACGTGAAGCGCGATGTCTCGACGCCTCTCCGTTCGACAGAAAGCGGTATCATCGACCAAGTTCTTTTGACTACTAGCATGGATGGTCTCAACTTCGTCAAAGTCCGTACCAGAACTACGAAGATTCCTCAGATCGGTGACAAGTTCGCCTCCCGTCACGGTCAGAAGGGTACTATAGGTGTCACATACCGACAAGAAGACATGCCGTTTAC-----------------------------------------------------------TCCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTCCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCTCCTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTGCCTTCGTTCCTATCTCCGGTTTCAACGGTGACAACATGATCGAGCCCTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGTCTACTGGTAAGACTCTCCTCGAGGCCATCGATGCCATCGACACCCCTAGCCGTCCTACCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTCTACAAGATCGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTCTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCACCAAAGGGTGCCGACTCCTTCAACGCCCAGGTCATCGTTCTCAACCACCCTGGTCAGGTTGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGATCCTCGAGAAAATTGACAGACGTACCGGCAAGTCCATGGAGGCCAACCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCTATGTGCGTTGAGGCCTTCACTGACTACCCTCCT Devriesia_staurophora_CBS_375_81 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-ATGTTACTATTTTGACTCCATCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTAGG-TTG-CGGCC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGACC--GG---CTT--GC-ACCTTCTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TACTC-GCCGC-CG----A-CAGGCCAGCATCGTCTGGGGG-CGCCGG-AGAAAGGTGC-CAGGAATGTAGCT---CCTC-AATACGGTGACTCCCGGGCGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGCCTGCGACCCGTC-TTGAAACACGGACCAAGGAGTCGACCATCTGTGCGAGTG-TTCGGGTGTTAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTGGGAACGAGTGCACCAT-CGA-CCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCAT-AGCTGGT-CGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCTCGCCGCCG-GGGTAGAA-A-CG-ATGCCCCGGCGAGTAGGCAGGCGTGGAGGTCCGTGACGAAGCCTTGGGGGTGACCCCGGGTCAAACGGCCTCTAGTGCAGATCTTGGT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Devriesia_strelitziae_CBS_122379 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CTTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCCTGGTGATTCATGATAACTTAACGAATCGCAT-GGCCTTGAGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTCTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTCGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAACCGCATGGCCTTCACTG-GCCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-GTGTTATTATTTTGACCCCATCGGCACCTTACGAGAAATCA-AAGTTTTTGGGT---------------------------------------------------------------------------------------------------------------------------------CGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAATTGTAATTTGCAGAGGATGCTTCTAGG-CAG-CGGCC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACC--GG---TTG--GC-ACCTTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGTCGGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TACTC-GCCGT-CG----G-CAGGCCAGCATCATCTGGAGC-CGCCGG-ATAAAGGCGG-AGGGAATGTAGCT---CCCCTAATACGGCGCGCTCCGGGTGA-GGT-CCGCG-TC----T-C--G--GCAAGGATGCTGGCGTAATGGTCGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCGATTATCTATGCGAGTG-TTCGGGCATCAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTGAGAACTGGTGCATCAT-CGA-CCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTAAT-CGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTCGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGAGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTT-AA-GCGTGCTACCC--ATACTCCGCCGCCA-GCGTAGAA-T-CG-ACGCGCTGGCGAGTAGGC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGATTTTCCGGCTGAAGTTCAATCAGCTGGTCAGGGACATGCGGCTGTACCTGCACCGAGCCATCGAGACAGGCAAGCAATTCAATCCCACGGTTGCTGTCAAGAGCAATATCATGACGATGGGCCTGCGCTACAGCTTGGCTACGGGTAATTGGGGTGATCAGAAGAAGGCGGCCACCGCGAAAGCGGGGGTCAGCCAGGTGCTGAATCGATACACATACGCGTCGACGCTGTCGCATCTGCGGCGAACGAACACTCCCATCGGCAGAGATGGCAAGATCGCAAAGCCGCGGCAGCTGCACAACACGTACTGGGGTCTTGTCTGCCCAGCAGAGACACCCGAAGGACAAGCTTGCGGTCTGGTCAAGAATCTGTCGCTGATGTGCTATGTTTCCGTCGGCTCGATCGGC---------GAACCCCTCATCGAGTTCATGAGGCAGAGAGGAATGGAGCTGCTCGAAGAGTACGATCCGGTCATGTATCCCAACGCAACCAAGGTGTTTGTAAATGGGACATGGGTCGGAATTCACATGAACCCTGGCCACCTTACAGACCACATGAAATCGTTGAAACGTGAC---GGCACGATCAACTTCGAGACCACCATCATCCGCCACGTCCGCGAGCGGGAAATCATGTTCTTCACCGATGCTGGGCGAGTGTGCAGGCCGCTGTTCGTCATCGACAACAAGCACGATTCGCCAAACCGGGGCAATCTTGTTCTCAAGCAGGATCATCTCATGAGACTGCGGAATGATCAACGATCTGAGCAGGAG------CGAGCAGAGGACAAGAACTACTATGGATGGGAC---GGCCTGGTCAGGGAGGGCGTTGTCGAGTATTTGGACGCCGAGGAGGAGGAGACGGCGATGATCATCATGACGCCAGAGGACCTGCTCGAGCATCAAGCCGCGTTGAGGCGAGAGGAGGAA---------TTGCCCGATGACGATCCGCACCGCAGGATCAAGCCGAAGCCGAATACCTCTATCCGGACGTGGACGCATTGCGAGATCCATCCGGCTATGATTTTGGGTGTCTGCGCCAGCATTATCCCGTTCCCCGACCACAACCAGTCGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACTGCGCCATTCTCATCATTGCTGCCGGCACCGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTGGCCTACACGCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGCTTCAACGAGATCATCAAGGAGACGAGCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGCACGTCCCGTTCGTCCCGATCTCCGGCTTCAACGGCGACAACATGATCGAGGCCTCCCCCAACTGCCCGTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGTCC---AAGGTCACCGGCAAGACCCTCCTCGAGGCCATCGACAACATCGACCCGCCACAGCGTCCCTCCGACAAGCCGCTCCGTCTGCCTCTGCAGGATGTCTACAAGATCGGCGGCATTGGCACGGTCCCGGTCGGCCGTGTCGAGACTGGTACCATCAAGTCCGGCATGGTCGTCACCTTCGCCCCGGCTGGCGTCACCACCGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTGACCGAGGGTCTG---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACAGCAAGAACGACCCGCCGAAGGGCTGCGACAGCTTCAACGCCCAGGTCATCGTCCTGAACCACCCTGGCCAGGTCGGTGCCGGCTATGCGCCCGTCCTCGACTGCCACACCGCCCACATCGCCTGCAAGTTCGCCGAGCTCCTCGAGAAGATCGACCGTCGTTCCGGCAAGTCCATCGAGAACTCGCCCAAGTTCATCAAGTCTGGTGACGCCGCCATCGTCAAGATGATTCCGTCCAAGCCGATGTGCGTTGAGGCATCACCGA-GTACCCGCCG Didymella_bryoniae_CBS_133_96 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCA-TTG-GCAGC-GGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTC--GCT--AGC--CT-TTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCG-GGT---T-TC-------T--ACC-CG--GTG-CACTCTTCTAT-AG----G-CAGGCCAGCATCAGTTTGGGC-GGTTGG-ATAAAGGTCT-CTGTCATGTACCT---CCTTTCATGCAACCAGCCTGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAACGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACAGTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCCCGCCGCTG-GGGCAAGA-T-TT-AAGCCCCAGCGAGTAGGCAGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGCCTCTGCGAAAGCTGGTGTCTCTCAAGTCTTGAATCGTTACACATATGCTTCGACGTTGTCCCATATGCGGCGAACCAACACACCCGTGGGCCGTGACGGTAAACTCGCAAAGCCTCGTCAGCTGCACAACAGTCATTGGGGTCTTGTCTGTCCAGCCGAGACACCTGAGGGACAAGCTTGCGGTCTGGTGAAGAACTTGTCCCTCATGTGCTACGTCAGTGTCGGCAGTGACGCC---------ACGCCTATTGCCGACTTTATGGGCAAGAGAAACATGCAGCTTCTCGAAGAGTACGATCAGAACCAGAACCCTGATGCTACAAAGGTCTTTGTCAACGGTGTCTGGGTGGGTGTACACAACAACGCGCAACAACTCGTTTCGACCGTGCAGGAACTGCGTCGAAAT---GGAACCCTATCATATGAGATGAGTCTGATTCGAGATATCCGTGATCGAGAGTTCAAGATCTTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Didymella_exigua_CBS_183_55 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCCTCACCGCGTG-TACTTGTCCGGCCGGGCCTTTCCTTCTGGAGAACCTCATGCCCTTCACTG-GGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGT---TTCGTTGTGAAGATCAAGAAGATTCTTGAGACGGTGTGCCACAGTTGCGGCTTGATCCTCGCTGATACCAACCATCCAGACTGGGATCAGGCTATGAAGACCAAGGATGCGAAGCGGCGATTTGACAAGATTTGGCGCATGTCCCGC---ACACGGCGAGTCTGCGAGCAGGAC---------ACCACTGAAGAG---CCCCACGGCGGCTGTGGCAATCCGCAGCCAGACACTATCCGCAAGGAGGGTCTTAAGCTCACCGGCACATGGAAG---GCG---AAGAAG---AAGGACGAGGATGACGACCGCAAGGAG---GTCATTACCCCGCAAACAGCTCTGAACATCTTTAAGCTGCTCTCCGACGGGACGCTCCAGATGCTCGGTTTGAACAAGGACTACGCTCGCCCGGAGTGGATGATCCTTACAGTTCTGCCTGTTCCTCCGCCACCGGTCCGTCCCAGTATCTCGGTCGACGGTACAGGACAGGGTATGCGTGGTGAAGACGATCTGACATACAAGCTCGGCGACATCATTCGCGCCAACAGTCGTGTTCTGCAATGCATTCAGGACGGCTCACCGCAGCACGTTCTGACTGAGTTCGATACCCTCCTCCAGTACCATTGCGCGACATACATGGACAACG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCCGCATCCTTTTCCTGAAGTTGACCAAGGATGTCTACAAGTACCTCCAGAGATGCGTTGAGAATAACCAGGACTTTAACGTGCAAATGGCCGTCAAAGCCAGCATCATCACCAACGGTCTCAAATACTCGCTCGCTACAGGAAACTGGGGTGACCAGAAGAAAGCCGCTTCTGCAAAGGCCGGTGTCTCCCAGGTGTTGAACCGATACACATACGCCTCGACACTGTCCCATTTGCGACGAACGAACACACCCGTTGGTCGTGACGGCAAGCTTGCGAAGCCCCGCCAATTGCACAACAGTCATTGGGGTCTCGTCTGCCCCGCCGAGACACCCGAAGGACAGGCTTGTGGTTTGGTCAAGAACCTGTCTCTCATGTGCTACGTCAGTGTTGGTAGTGATGCC---------GGGCCCATCTCTGATTTCATGAGCCAGAGGAATATGCAACTTCTTGAGGAGTACGACCAGAACCAGAATCCTGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCCAACGCACAGCAGCTTGTGTCGACCGTACAGGAGCTGCGCCGTAAC---GGAACTCTTTCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACCGATGCTGGACGTGTCATGAGGCCGCTGTTTGTTGTCGAGAGCGATGTCCGCAAGCCAAACCGTAACCACCTCGTCTTCAACCAGGAGCACTACAGCAAACTGGTAGCGGAGCAGGCCGGTGAAGAGGAG------AAGAGCGAG------CTCACATATGGCTGGAAG---GGACTCATCCAAGACGGTGTCATCGAGTATCTAGACGCTGAAGAAGAGGAGACTGCCATGATTGTCATGTCCCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Didymocrea_sadasivanii_CBS_438_65 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTCTCAGATCGCAT-GGCTCTACGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTAGTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATTCCGACACGGAGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-CACTTGTCCGGCCGGGCCTTTTCTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-GTGTTTCTATTGTGACCCGCTCGGCACCTTACGAGAAATCA-AAGTGTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT--------------------------------------------------------------AACGGCGAGTGAAGCGGCTACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTGGCA-TTG-GCGGC-GGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGC--GCC--TGC--CT-TTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTCCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGT-CAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCA-GGC---T-CT-------T--GCC-TG--GGG-CACTCTTCTGC-GG----G-CAGGCCAGCATCAGTTTGGGC-GGTCGG-ATAAAGGCCT-CTGTCATGTACCA---CCCTTAATGCGACCAGCCCGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diplodia_mutila_CBS_431_82 --------------------------------------TGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATGATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCTGCCTCACCGCATG-TACTGGTTCGGCCGGGCCTTTCCTCCTGGGGATCCGCATGCCCTTCACTG-GGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTCTTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT---------ACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTAG-GGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCG-AGG-GCTCC-CGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTG--GGC--TGC--CT-TAGCCATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCG-GTC---T-CC-------T--GAC-CG--GCG-TACTCTTCTGC-GG----C-CAGGCCAGCATCAGTTCGGGC-GGTCGG-ATAAAGACCT-CGGGAATGTAGCT---CCTCTAATGCGGCCAGCCTGGACTGA-GGA-TCTCG-CT----T-C--G--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCATACGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGG-CCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGG-AAAGCGAATGATTAGAGGCCTTGGGGCTG-AAAC-AGCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGAC--TTGAATGTACC-TTACTAGTGGGCCATTTTTGGTAAGCAGAACTG--GATGCGGGATGAACCGAAC-GCGATGTTAAG--GCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACATCGCCGCCA-GGGTAGAT-A-CG-ATGCCCTGGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGGTGTCTCGCAGGTGTTGAACAGATACACCTACTCCTCTACCCTGTCGCATTTGCGTCGCACGAACACGCCCATCGGTCGCGATGGCAAACTTGCAAAGCCGCGTCAGCTGCACAACACTCACTGGGGTCTTGTCTGCCCAGCAGAAACGCCAGAAGGTCAGGCTTGCGGTCTGGTGAAGAACTTGTCCCTAATGTGCAACGTTACTGTCGGCAGCGACGTC---------ACTCCTATCCAGGATTTTATGACCCAGCGAAACATGGAACTTCTGGAAGAATACGAGCCCAATGTCTCCCCGCACGCCACGAAGATTTTCATCAACGGTGTTTGGGTCGGTGTCCATCGCGATCCTACCCAGCTCGTCACCGTGGTCAAGAAGCTGCGTCGTGAT---GGCACACTCTCTCCGGAGATGAGTCTTATTCGCGATGTTCGTGATAGAGAGTTCAAGATCTTCACGGATGCGGGTCGTGTGTGCAGGCCTCTTTTCATCATCGAGGATGATCCGTTCAGCCCCAACAAGGGTAATCTAGCTCTGACCCGGGAGCATATTGACAAGCTTGATGCGGATCAATTGTCCGATGAGGAG------AGGCAGGAG------AAGAGATACGGCTGGCAA---GGACTGCTGCACAGCGGTGTGGTTGAATACATGGATGCCGAAGAAGAAGAAGTGGCCATGATCGTCATGACACCTGACGATCTGAGAGCACATCACAGGGCT---CGTCAGGGTATCGTT------GATGAAGATGACAGGGACCCTCATGAGCGAGTCGTCCCGCCTCCCAACCCCAGCGTCAAGCAGTACACCCATTGCGAGATCCACCCGAGCATGATCCTGGGTATCTGTGCTTCCATCATTCCGTTCCCGGATCACAACCAGTCGCCTCGTAACACGTAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCAAGAACATGATCACTGGTACCTCGCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACACGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGAGCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACCGGCAAGACCCTCCTCGAGGCCATCGACAGCATCGATACCCCCGTCCGTCCCTCGGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTCTACAAGATCGGTGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACCGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTGTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGACCGACCCCCCCAAGGGCTGCGACTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTGGCTACGCTCCTGTCCTGGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCTGAGCTGCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTATTGAGAACAGCCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATGATTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACCGAGTACCCCCCT Dissoconium_aciculare_CBS_204_89 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTCACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTCACGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATGATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTCTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGAG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGCCGTCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTCGGCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-GTGTTATTATTTTGACCCCATCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTATTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGG-TAG-CGGCC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATC--GG---CGC--GC-GCCCTCTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGGGTGG-TGTTCCGCCG-GGC---T-TC-------T--GCC-CG--GTC-TACTC-ACCGC-CC----G-CAGGCCATCATCGTCTGGGGC-CGCCGG-AG-AAACCGT-CAGGAATGTGGCT---CCCT-CATGCGGCGCGCCCCGGGCGA-GGT-CCGCG-CA----A-T-----GCAAGGATGATGGCGTAATGGTTGTCAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTGGGAGCTGGCGCACCAT-CGA-CCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCACCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTGGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTT-AA-GCGTATTACCC--ATACCTCGCCGCCC-GGGTAGAA-A-CG-ATGCCCGGGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGCCTTGGGGGTGACCCCGGGTCGAACGGCCTCTAGTGCAGATCTTGGT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dissoconium_commune_CBS_110747 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTCACTACAT-GG-ACAACTGTGGCAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTACGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATGATAACTAAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGCCGTCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTCGGCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-GTGTTATTATTTTGACCCCATCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGG-TAG-CGGCC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATC--GG---CCC--GC-GCCCTCTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGGGCTTGCAACCAGACTTGACGGCGG-TGTTCCCCCG-GGC---T-TC-------T--GCC-CG--GGT-TATTC-ACCGT-CG----G-CAGGCCATCATCGTCTGGGAC-CGCTGG-AG-AAACCGT-CAGGAATGTGGCT---CCCT-CATGCAGCGTGCCCCGGGCGA-GGT-CCGCG-CT----T-A--G--GCAAGGATGATGGCGTAATGGTTGTCAGCCGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTGGGAGCTGGCGCACCAT-CGA-CCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTGGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTT-AA-GCGTATTACCC--ATACCTCGCCGCCC-GGGTAGCA-G-CG-ATGCCCGGGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGCCTTGGGGGTGACCCCGGGTCGAACGGCCTCTAGTGCAGATCTTGGT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dissoconium_dekkeri_CBS_111282 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTCACTACAT-GG-ACAACTGTGGCAATTCTAGAGCTAATACATGCTAAAAACCCCGACTCACGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATGATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTCTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGCCGTCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTCGGCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-GTGTTATTATTTTGACCCCATCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGG-TAG-CGGCC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATC--GG---CCC--GC-GCCCTCTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGACGGCGG-TGTTCCCCCG-GGC---T-TC-------T--GCC-CG--GGT-TATTC-ACCGT-CT----T-CAGGCCATCATCGTCTGGGGC-CGCCGG-AG-AAACCGT-CAGGAATGTGGCT---CCCT-CATGCGGCGTGCCCCGGGCGA-GGT-CCGCG-CT----T-A--G--GCAAGGATGATGGCGTAATGGTTGTCAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTGGGAGCTGGCGCACCAT-CGA-CCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTGGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTT-AA-GCGTATTACCC--ATACCTCGCCGCCC-GGGTAGCA-G-CG-ATGCCCGGGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGCCTTGGGGGTGACCCCGGGTCGAACGGCCTCTAGTGCAGATCTTGGT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dothidea_hippophaes_CBS_188_58 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAGCGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTAGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGTATGCCCTTCACTG-GGCGTATTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGACTTGACTGTTCAACAG-GTC-----TC-------T--GAC-CT--GCC-TATTCAGTC-T-GT----C-CAGGCCAGCATCAGTTTCGGC-GGCCGG-ATAAAGGCCC-TAGGAATGTGGCT---TTCCCAATACGGCCAGCTGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTAGGGTGTCAAA-CCCTTACGCGTAATG-AAAGTGAACGGAGGTGAGAACCGGTGCATCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATG-AAAC-ATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCTCGCCGCCA-TGGTAGAT-T-CG-AAGCCATGGCGAGTAGGCAGGCGTGGAGGTCAGT------------------------------------------------------------------------------------------------------------GGT---TTCGTCACCAAGATCAAGAAAATCCTCGAGACCGTCTGTCACAACTGCGGCAAGATCTTGCAGGATGAATCCAGCATCCAATTCGCACAGGCTGTCCGCCTCCGAGACCCAAAGAGGCGGTTCGACGCCGTCCACAGACTCTGCAAG---CCAAAGACTACGTGCGAACTGGAT---------GACACGCCAGACCGAGCCCATGGCGGATGTGGCAACCTGCAGCCCACC---ATCCGAAAGGACGGACTCAAGCTGACTGGCACGTGGACC---TTT---GCAAAG---CAACAAGACGAGGAAGTGGAGAAGAAG---GTCATCACTCCCAAGATGGCCCTCGACGTCTTTCGCAACATTTCCACCATCGATCTGGCAAGAATGGGCTTGAACGCCGACTATGCCCGCCCTGAATGGATGGTCTTGACCGTCCTACCCGTACCACCTCCAGCAGTCCGACCCAGTGTCTCGGTCGACGGCACAAACCAGGGCATGCGATCCGAGGACGATTTGACCTACAAGCTCAGTGACATTGTCAGAGCAAACAGCAACGTTCGCAGGGCCGAGCAGGAAGGCTCTCCTCAGCACGTCTACTCCGAGTCGTCGAGC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAGATATACATACGCCTCCACCCTTTCTCATTTGCGCCGCACAAACACCCCGA--GGTCGAGATGGTAAGATTGCCAAGCCCCGCCAACTACACAACACTCACTGGG-TCTTGTCTGCCCTGCCGAGACGCCCGAAGGTCAGGCTTGTGGTCTGGTCAAGAACCTGTCTCTCATGTGTTATGTCAGTGTGGGTACCCCAAGT---------GAGCCTATTATCGAGTTCATGAACCAAAGAAACATGGAACTGCTCGAGGAGTACGAACCCAAGAACAACCCGGATGCGACAAAGGTTTTCGTCAACGGTGTCTGGGTTGGTGTTCACAGAGATCCCGCCCAACTCGTCAAGGTTGTGCAAAGCCTGAGAAGAAGT---GGTACCATCTCTTTCGAAATCAGTTTGATTCGCGACGTGCGTGATCGAGAGTTTAAAATCTTTACCGATGCCGGACGTGTCATGAGGCCCTTGTTCGTCGTAGACAACGAGCCCACGAGCGAGCGCAAGGGTCACCTGGTCCTGGCCCGTGCAAACATTGACAGGCTGCAGTCCGACAGGCTAAGTGAAGAGCAG------CGTGACAGC------AACATTTACGGATGGAAG---GGTCTGATTGGTGACGGTATCATCGAATATCTCGATGCTGAAGAAGAGGAGGCTGCCATGATCATCATGAGTCCCGAAGATCTCGACGAGCATCGTCAAATA---AGACTTGGCGGCCCC------GTTTACGAGGATCTAGATCCTCACAGACGGTTCAAGGCCAAGCCGAACCAAAGTGTACGCATGTGGACTCATTGTGAGATCCATCCCGCCATGATTCTGGGCATTTGCGCTTCCATCATCCCCTTCCCGGATCACAACCAATCGCCTCGTAACACTTACCAGTCCGCTATGGGCAAGCAAGCCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCTCTCCTCGCCTACACCCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGCTACAAGGAGATCATCAAGGAGACCTCCTCCTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGATGTCTCCACCAACTGCCCTTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGTCTACCGGTAAGACTCTCCTCGAGGCCATTGACGCCATCGACCAGCCTTCCCGTCCTACCGACAAGGCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATTGGTGGCATTGGCACGGTTCCCGTCGGTCGTGTTGAGACCGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTCTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTTGCGACTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACCGCCCACATTGCCTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGCAAGTCCATCGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCTATGTGCGTTGAGGCCTTCACTGACTACCCTCCT Dothidea_insculpta_CBS_189_58 -----------------------------------------------------------------ACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAGCGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTAGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGTATGCCCTTCACTG-GGCGTATTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT----------------------------------------------CAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTT--GGCCCGCATTGTAATTTGTAGAGGATGCTTTTAGG-CAG-CCGCC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACC--GGCT-CTG--GC-ACCTTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGACTTGGCTGTTCAACAG-GTC---T-TC-------T--GAC-CT--GCC-TATTCAGTCTT-GT----C-CAGGCCAGCATCAGTTTCGGC-GGCCGG-ATAAAGGCCC-TGGGAATGTGGCT---TCTCCAATACGGCCAGCTGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTAGGGTGTCAAA-CCCTTACGCGTAATG-AAAGTGAACGGAGGTGAGAACCGGTGCATCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCT--CCGAAGTTTCC-CTCAGGAT-GCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATG-AAAC-ATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTTCTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAG-TCATCTAGACAGC-GGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGA-TGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCTCGCCGCCA-TGGTAGAT-T-CG-AAGCCATGGCGAGTAGGCAGGCGTGGAGGTCA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGAGGACGATATGACTTACAAGCTCGTGGACATTGTCAGGGCCAACAGCAACGTT-GCAGAGCTGAGCAAGAAGGCTCGCCTCAGCACGTCTACTCGGAGTTCGTCGAGCTCCTACAATTCCACGTTGCCACTTATATGGACAACGACATTGCCGGCCAACCCAAAGCTCTCCAAAAGTCTGGAAGACCCGTCAAGGCCATCCGTGCTCGTCTGAAGTCCAAGGAGGGTCGTCTCAGAGGTAACCTCATGGGAAAGCGTGTGGATTTCTCTGCTCGAACTGTCATCACCGGTGACCCTAACCTTTCTCTCGATGAGGTCGGTGTTCCGCGAAGTATCGCCCGTATCTTGACTTTCCCAGAAACCGTCAATGCCTTCAATATCGAGAAGCTCCAGCAACTTGTTCGCAACGGCCCCAACGAGCACCCTGGCGCCAAGTACGTCATC------------------GACGACAGAGATCACTTTGGCAAGAAGCGCCTCGATCTCGCCGGTCCTCTGATGGCCCAAGTCTTCAGACTCAAGTTTACCCAGCTTATCCGTGACACGAGAGTCTACCTCTCCCGCTGCGTCGAAGGAGGCAAGGAGTTCAACCTGACCCTCGCCGTAAAGGCAAACATTCTTTCCAGCGGTCTGCGTTATTGTCTCGCCACTGGTAATTGGGGTGATCAGAAAAAGGCCGCCTCGGCTAAAGCTGGTGTGTCTCAAGTGCTGAACAGATATACATACGCCTCGACCCTATCTCATTTGCGCCGCACAAACACTCCAATTGGACGAGATGGCAAAATTGCCAAGCCCCGCCAATTGCACAACACCCACTGGGGCCTCGTCTGCCCTGCCGAAACACCCGAGGGTCAGGCTTGTGGCCTGGTCAAGAACCTGTCTCTCATGTGTTACGTCAGTGTGGGTACTCCCAGC---------GAGCCCATTATCGAGTTCATGAACCAAAGGAACATGGAACTGCTTGAGGAGTACGAGCCCAAGAACAACCCGGATGCGACAAAGGTTTTCGTCAACGGTGTCTGGGTCGGTGTCCACAGAGACCCCGCCCAGCTCGTCAAGGTCGTGCAAAGCCTTAGGAGAAGC---GGCACCATCTCTTTCGAAATCAGTTTGATCCGTGACGTGCGTGATCGAGAGTTCAAAATCTTCACAGATGCCGGACGAGTCATGAGGCCGTTGTTCGTTGTAGACAACGAGCCAACGAGCGAGCGCAGAGGTCACTTGGTCCTGGCCCGCTCAAACATTGAGAGGCTGCAGACCGACAGGCTGAGCGAGGAGCAG------CGCGATAGC------AACATCTACGGCTGGAAG---GGTTTGATTGGTGACGGTATTATCGAATATCTGGATGCTGAGGAAGAGGAGGCTGCCATGATCACCATGAGTCCGGAAGATCTTGATGAGCATCGCCAAGTA---AGGGCTGGCGCTCCA------GTATACGACGATCTAGACCCCCACAGACGTTTCAAGGCCAAACCGAACCAAAGTGTACGCATGTGGACCCATTGCGAGATTCATCCTGCTATGATTCTAGGCATTTGCGCTTCCATCATTCCCTTCCCCGATCACAACCAATCGCCCCGTAACACTTACCAGTCCGCTATGGGCAAGCAAGCCATGGGTGTCACCCTGACCAACTACAATGTGCGCATGGATACTATGGCCAACGTTCTCTACTACCCACAGAAGCCCCTTGGAACCACGCGATCAATGGAATACCTGAAATTCAGAGAGCTGCCTGCAGGTCAAAACGCCATTGTTGCTATCGCATGTTACGGTGGTTACAA{CT}CAGGAAGATTCCGTCATCATGAATCAATCGTCGATTGATCGTGGTCTCTTCCGTTCTCTCTTCTACCGCGCATACATGGATCAGGAGAAGCGAGTTGGCATGTCGGTTGTCGAACAGTTCGAGAAGCCCACACGTGCGGACACACTTCGCATGAAGCACGGAACTTACGACAAGCTTGATGATGACGGAATCATCTCCCC{CT}GGATCGCGTGTCTCTGGCGAGGACATCATCATTGGCAAGACTGCGCCAATGGCCCCCGATGCG------------------GAAGAACTTGGCCAACGGACCAAGTTGCACGTCAAGCGTGACGTTTCAACCCCTCTTCGTTCTACCGAGAGCGGTATCATCGATCAAGTTCTCCTTACAACCAACATTGACGGCCACAAATTCGTCAAGGTTCGCACAAGAACGACCAAGATTCCTCAGATTGGTGACAAATTTGCATCTCGTCACGGTCAAAAGGGTACGATTGGTGTCACATACAGGCAAGAAGATATGCCCTTCACTGCGGATGGTCTGGTA--------------------------------CGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCCCTTCTCGCCTACACCCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGCTACAAGGAGATCATCAAGGAGACCTCCTCCTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGACGTCTCCAGCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACCGGTAAGACTCTCCTCGAGGCCATTGATGCCATCGACCAGCCTTCCCGTCCTACCGACAAGGCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATTGGTGGCATTGGCACGGTTCCCGTCGGTCGTGTTGAGACCGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTCTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTTGCGACTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTTGATTGCCACACCGCCCACATTGCCTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGCAAGTCCATCGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTC--------------- Dothidea_sambuci_DAOM_231303 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAGCGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTAGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGTATGCCCTTCACTG-GGCGTATTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT------------TAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTATTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTT--GGCCCGCATTGTAATTTGTAGAGGATGCTTTTAGG-CAG-CCGCC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACC--GGCT-CTG--GC-ACCTTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGACTTGGCTGTTCAACAG-GTC---T-TC-------T--GAC-CT--GCC-TATTCAGTCTT-GT----C-CAGGCCAGCATCAGTTTCGGC-GGCCGG-ATAAAGGCTC-TGGGAATGTGGCT---TTCCCAATACGGCCAGCTGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTAGGGTGTCAAA-CCCTTACGCGTAATG-AAAGTGAACGGAGGTGAGAACCGGTGCATCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATG-AAAC-ATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAATTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCTCGCCGCCA-TGGTAGAT-T-CG-AAGCCATGGCGAGTAGGCAGGCGTGGAGGTCAGTGACGAAGCCTTCGGGGTGACCGGGGGTAGAACGACCTCTAGTGCAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCTCCACCCTTTCTCACTTGCGCCGCACAAATACCCCAATTGGCCGAGATGGCAAGATTGCCAAGCCCCGCCAACTACATAACACCCACTGGGGTCTCGTCTGTCCTGCCGAAACGCCCGAAGGTCAGGCTTGTGGGCTAGTCAAGAACCTGTCTCTCATGTGTTATGTCAGTGTCGGTACCCCCAGC---------GAGCCCATCATCGAATTCATGAACCAAAGAAACATGGAACTGCTCGAGGAGTACGAGCCCAAGAACAACCCGGATGCGACAAAGGTTTTTGTCAACGGTGTCTGGGTCGGTGTCCACAGAGATCCTGCTCAACTAGTCAAGGTTGTACAAAGCCTCAGAAGAAGC---GGTACTATCTCTTTCGAGATCAGTTTGATTCGCGACGTACGTGATCGAGAGTTTAAAATCTTTACGGATGCCGGACGAGTCATGAGGCCGCTGTTCGTCGTAGACAACGACTCTACGAGCGAGCGCAGAGGTCACCTGGTCCTCGCCCGTTCAAACATTGAAAGGCTACAATCCGACCGGCTGAGTGA-GAGGAG------CGTGATGGC------CATATCTATGGCTGGAAG---GGCCTGATC------------------------------------------------------CT----GAGCCCGAAGATCTGGACGAGCATCGTCAAGTG-TAGAGGCTGGCGCCCCG------GTCTATGACGATCTAGACCCTCACAGGCGCTTCAAGGCAAAGCCGAACCAAAGTGTGCGCATGTGGACCCATTGCGAGATCCATCCTGCCATGATTCTGGGAATTTGCGCTTCCATCATTCCATTCCCAGATCACAACCAATCTCCTCGTAATACTTACCAGTCGGCCATGGGCAAGCAAGCCATGGGTGTCACTCTGACCAACTACAACGTCCGCATGGACACCATGGCCAACGTTCTCTACTACCCACAAAAGCCTCTTGGCACTACGCGATCGATGGAATACCTCAAATTCAGAGAGCTGCCCGCCGGTCAAAACGCCATTGTTGCCATTGCATGTTACGGCGGTTACAACCAGGAAGATTCCGTCATTATGAACCAATCGTCGATTGATCGCGGTCTCTTCCGTTCGCTCTTCTACCGCGCCTACATGGACCAGGAGAA-CGGGTTGGCATGTCGGTCGTCGAACAGTTTGAGAAGCCCACTCGTGCCGATACGCTTCGCATGAAACACGGAACTTACGACAAGCTCGATGACGATGGAATCATCTCGCCGGGATCGCGTGTCTCTGGTGAGGATATCATCATCGGTAAGACTGCGCCCATGGCCCCCGATGCA------------------GAAGAACTTGGCCAACGGACCAAGCTGCATGTCAAGCGTGACGTGTCGACCCCTCTTCGTTCTACCGAGAGCGGTATCATCGACCAAGTCCTCCTGACTACCAACATTGACGGCCACAAATTCGTCAAGGTCCGCACCCGAACGACCAAGATTCCTCAGATTGGTGACAAGTTTGCATCTCGTCACGGTCAAAAGGGTACCATTGGTGTCACATATAGGCAAGAAGACATGCCTTTTACTGCGGATGGTCTGGTGATCAAG-ACATGATCACTGGTACCTCCCAGGC-GATTGCGCCATTCTCATCATTGCCGCTGGTACTGGTGAGTTTGAGGCTGGTATCTCCAAGGACGGCCAGACCCGCGAGCACGCCCTTCTCGCCTACAACCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGATCGCTACAAGGAGATCATCAAGGAGACCTCCTCCTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTCGCCTTCGTCCCTATCTCCGGCTTCAACGGTGACAACATGATCGATGTCTCTGCCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGACC---------------AAGACC---AAGTCCACCGGTAAGACTCTCCTCGAGGCTATTGACGCCATCGACCC----------------------------------------------------------------------------------------------------------------GGCATGGTCGTCACTTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTCTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTTGCGACTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTTGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGATCGCCGTACCGGCAAGTCCATCGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACCGACTACCCTCCT Dothiora_cannabinae_CBS_737_71 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAGCGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTAAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT-----------------------------------------------AGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTT--GGTCCGCATTGTAATTTGTAGAGGATGCTTTTAGG-CAG-CCGCC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACC--GGCT-CTG--GC-ACCTTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGACTTGGCTGTTCAACCG-GTC---T-TC-------T--GAC-CG--GCC-TACTCAGTCTT-GT----C-CAGGCCAGCATCAGTTTCGGC-GGCCGG-ATAAAGGCCC-TGGGAATGTAGCT---GTCTCAATACGGCCAGCTGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTAGGGTGTCAAA-CCCTTACGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATG-AAAC-ATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCTCGCCGCCA-T--------------------------------------------------------------------------------------------------------------------------CACATCGAACT-GCAGTTCCCGTCTTCCACGTCGGC---TTCGTCACCAAGATCAAGAAGATTCTTGAGTCCGTCTGCCACAACTGTGGCAAACTCTTGCTTGATGAAAGCATACCTGCCTTTGCACAAGCCATTCGCCTTCGAGATCCCAAGCGGAGATTCGACGCTGTTCACAGGCTGTGTAAA---GTCAAGATGAACTGCGAGCTGGAC---------GATGCGCCCGACCGATCTCACGGTGGTTGTGGCAACTTGCAGCCAAGC---ATTCGAAAGGACAGTCTGAAACTCACCGGCACATGGACA---TGG---CCGAAA---GAGCAGGACACTGAGATTGAGAAGCGC---GTCATTACCCCCAAGATGGCCCTCGAAGTCTTCCGCAACATTTCCACCATCGATCTGGCCAAGATGGGTCTGAGTGCTGACTATGCCCGTCCGGAGTGGATGGTCCTGACCGTCTTGCCTGTGCCCCCTCCTGCCGTCCGACCAAGTGTGTCTGTCGACGGCACCAACCAAGGCATGCGCTCAGAGGACGATTTGACATACAAGCTTAGTGATATTGTGCGCGCCAACGCCGAAGTGCGCAGAGCAGAGCAAGAGGGCTCTCCGCAGCACGTCCA-ACCGAGCGCATCG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGGCGACCAGAAGAAGGCGGCTTCGGCCAAAGCCGGTGT-TCGCAG-TCTTGAACAGATACACATATGCATCCACACTTTCCCATCTTCGACGAACAAACACACCCATCGGCCGAGACGGCAAGATTGCCAAGCCACGTCAACTCCACAACACCCATTGGGGTCTTGTCTGCCCTGCCGAGACGCCCGAAGGCCAGGCCTGTGGTCTGGTCAAGAACCTGTCTCTGATGTGTTACGTCAGTGTAGGTACTCCGAGC---------GAGCCCATCATTGAGTTCATGAACCAGAGAAACATGGAGTTGCTCGAGGAATATGAGCCCAAGAACAACCCGGACGCCACAAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCACAGAGACCCTGCTCAGCTTGTCAAGGTTGTGCAAAGCCTCAGAAGAAGC---GGCACCATTTCCTTTGAAATCAGTTTGATCCGAGATGTGCGTGACCGCGAGTTCAAGATCTTCACCGACGCTGGACGAGTCATGAGGCCGCTCTTTGTCGTCGAGAACGACGCCGCGAGCGAGCGCAGGGGCAACCTTGTCTTGACACGTGACCACATTGACAAACTGCATCTCGACAAGTTTAGTGAAGAGGAG------CGTGACGCC------AACGTCTATGGCTGGAAG---GGCTTGATTGGAGACGGCATCATCGAGTATCTCGACGCCGAGGAAGAGGAAGCTGCCATGATCATCATGAGTCCTGAAGATCTGGACGAGCACCGTCAAGCT---CGAGCAGGTGTCCCC------ATGATTGACGACGGAGATCCGCACAAACGTTTCAAGGCCAAACCTAACCAGAACGTCCGGACGTGGACTCACTGCGAGATTCA-CCTGCCATGATTCTCGGTATCTGCGCCTCGATC-------------------------------------------------------------------TGGGCGTGACGCTAACCAACTACAACGTCCGTATGGACACCATGGCCAACGTTC-GTACTACCCACAAAAGCCACTAGACA-TACAAGATCCATGGAGTATCTCAAGTTCAGAGAACTTCCTGCCGGCCAAAACGCCATCGTTGCCATTGCATGTTACGGCGGATACAACCAAGAAGATTCCGTCATCATGAACCAGTCATCAATCGATCGCGGTCTCTTCCGCTCGCTCTTCTACCGCGCTTATATGGATCAGGAGAAGCGTGTCGGCATGTCGGTCGTCGAGCAGTT-GAAAAGCCTACTCGCGCAGACACTCTGCGTATGAAGCACGGTACTTATGACAAGCTTGACGACGATGGAATCATCTCTCCAGGTTCGCGTGTCTCGGGTGAGGACATCATCAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGCCAGACCCGCGAGCACGCTCTCCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGTCCCGCTTCCAGGAGATCATCAAGGAGACCTCCTCCTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGCCCTCCGCCAACTGCCCTTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAG------AAGTCCACTGGTAAGACTCTCCTCGAGGCCATTGATGCCATCGACACTCCTTCCCGTCCTTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTCTACAAGATCGGTGGTATTGGAACGGTTCCCGTCGGCCGTGTCGAGACCGGTGTCATCAAGGCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTCTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGCAGGACCCCCCCAAGGGCGCCGACTCCTTCAACGCCCAGGTCATTGTCCTGAACCACCCTGGTCAGGTCGGTGCCGGATACGCCCCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCCATTGAGAACTCCCCCAAGTTCATCAAGTCTGGTGACGCCGCCATCGTCAAGATGATTCCCTCCAAGCCCATGTGTGTTGAGGCCTTCACTGAGTACCCTCCT Dothiora_ellyptica_CBS_736_71 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTT--GGTCCGCATTGTAATTTGTAGAGGATGCTTTTAGG-CAG-CCGCC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACC--GGCT-CTG--GC-ACCTTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGACTTGGCTGTTCAACCG-GTC---T-TC-------T--GAC-CG--GCC-CACTCAGTCTT-GT----C-CAGGCCAGCATCAGTTTCGGC-GGCCGG-ATAAAGGCCC-TGGGAATGTAGCT---GTCTCAATACGGCCAGCCGGGACTGA-GGT-CCGCG-CT----C-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTAGGGTGTCAAA-CCCTTACGCGTAATGAAAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATG-AAAC-ATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AACGCGTGTTACCC--ATACCTCGCCGCCA-TGGTAGAT-T-CG-AAGCCATGGCGAGTAGGCAGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGTCAGACCCGTGAGCACGCTCTTCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGCTTCAAGGAGATCATCAAGGAGACCTCTTCTTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTCGCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGCCTTCCCCTAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGTCTACTGGTAAGACTCTCCTCGAGGCCATTGATGCCATCGACACTCCTTCCCGTCCTTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTCTACAAGATCGGTGGTATTGGAACGGTTCCCGTCGGCCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTCTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGAAACGTTGCCGGTGACTCCAAGCAGGACCCCCCTAAGGGCTGTGACTCCTTCAACGCCCAGGTCATTGTCCTGAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACCGCCCACATTGCCTGCAAGTTCTCTGAGCTCCTCGAGAAGATCGATCGCCGTACCGGCAAGTCCATTGAGAACTCCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGATTCCTTCCAAGCCCATGTGTGTTGAGGCCTTCACTGAGTACCCTCCT Dothistroma_septosporum_CBS_112498 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-ATGTTATCTTTTTGACTCCATCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGC-CAG-CGGCC-GTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACC--GG---CGC--GC-AGCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTCGTAGCGA-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TACTC-ATCGT-CG----C-GAGGCCAACATCGTCTGGGGC-CGCTGG-AT-AAGACCT-AAGGAATGTAGCT---TCCCTGATGCAGCGTGTCTCGGGCGA-GGT-CCGCG-CT----T-C--G--GCAAGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTGGGAAGCGCTGCACCAT-CGA-CCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTT-AA-GGGTGCTACCC--ATACCTCGCCGCCT-GGGTAGAA-A-CG-ATGCCCAGGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGCCTTGGGAGTGATCCCGGGTCGAACGGCCTCTAGTGCAGATCTTGGT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dothistroma_septosporum_CBS_543_74 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGCTCAAATTTGAAATCT-A-AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGC-CAG-CGGCC-GTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACC--GG---CGC--GC-AGCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTCGTAGCGA-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TACTC-ATCGT-CG----C-GAGGCCAACATCGTCTGGGGC-CGCTGG-AT-AAGACCT-AAGGAATGTAGCT---TCCCTGATGCAGCGTGTCTCGGGCGA-GGT-CCGCG-CT----T-C--G--GCAAGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTGGGAAGCGCTGCACCAT-CGA-CCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCCTCTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTATTAGTGGGCCATTTTTGGTAAGCAGAACCGG-GATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCC-GAATGTACG-TCATCAG-CACCAC-AAAGGTGTTAGTT-AT-TAGACAGCAGGACGGTG-CCATGGAAGTCGGAATCCG-TA--GAGTGTGTAACAACTCACCTGC-GAATGAACTAGCCCTGAAAATGGACTGGCGC-T-AACGCGTGCTAACCCATAACCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTGTTTCCGTCTCA-GTTTCAGCAGCTTGTGAAGGATATGAAGACCTATCTCCACCGCTGCATTGAGGGTGGCAGGGAGTTCAACATCGCGCTCGCGATCAAGTCGAACATCATCACATCTGGCCTGCGGTACTGTTTGGCGACTGGTAACTGGGGAGACCAGAAGAAAGCGGCGAGTGCGAAGGCTGGTGTCAGTCAAGTACTGAACAGATACACCTACGCATCGACGCTCAGTCACTTGCGGAGAACAAACACTCCCATCGGGCGTGATGGCAAGATCGCCAAACCTCGACAACTTCACAACACGCATTGGGGTCTTGTCTGTCCCGCCGAGACGCCAGAAGGACAGGCATGTGGCCTAGTGAAGAATCTGTCGCTGATGTGCTACGTCACTGTTGGTACACCTGCA---------GAGCCGCTGATTGACTTCATGCGGCAACGTGGCATGGACCTGCTGGAGGAGTATGATCCGGTGCTGAACCCGAAGGCGACCAAGATCTTTCTCAATGGTACCTGGATCGGCGTGCACAAGGACGCAGGCGGTCTCACAAACACGCTGCGCGGTCTTCGACGGAAG---GGTGTGGTCAGCTTTGAGGTGACCATCATCCGCGATGTCAGAGAGCGCGAGATCAAGATCTTCACTGACTGTGGTCGAGTGTGTCGACCGCTGTTCGTTGTTGAGAATGATCCAAAGTCAACCAATAACGGCAACTTGGTCCTCCAGCGAGAGCATTGCCAGAGACTGGCGGATGACCAGGTGTCAGAGGAAGAG------CGAGAAACA------AAGATTTTCGGCTGGAAA---GGCCTGATCGACAAGGGTGTGGTGGAGTACCTTGACGCTGAGGAGGAGGAGACTGCCATGATCATAATGACACCCGAAGACCTCGAAGAGCACAAGCTGATG---CGACAAGGCGTGCAA---------ATGGACGATGCTGATCCTCATCGGCGAATCAAGAATAAGCCGAACCCGTACGTGCGGACATGGACACATTGCGAGATTCACCCGGCCATGATTCTGGGCATTTGCGCTAGTATCATTCCCTTCCCTGACCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Elsinoe_centrolobi_CBS_222_50 -----------------------CAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTCTGGTGATTCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATTGTAGGATAGAGGCCTACAATGGTATCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTTCGGCCGGGCCTTTCCTTCTGGGGAACCGCATGCCCTTCACTG-GGCGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTCGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGCCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGGCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGACG-GTGTTATTATTTTGACCCGTTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT------------------------------------------------------------------------------------ACAGCTCAATTTGATCTGG-CGTCCGAGTTGTAATTTGTAGAGGATGCTATTGGG-TTG-CCACC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGACC--GGC--CAG--GC-GCTCTCTGTATAGCTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCCCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGTCTCGACGGCGGCTGTTCGGCCT-CTC---T-TC-------T--GAG-TG--GTT-TATTCAGTCGC-CG----C-CGGGCCAGCATCAGTTTTGGC-GGCCGG-ATAAAGGCGC-GGGGAATGTAGCT---CCCTCAATACGGCCCGCCGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGAAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTACGCGAGTG-TTTGGGTGTCAAA-CCCGTGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCGT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCC-TTGTTACTTAGTTGAACGTGGGCATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCTCGCCGCCG-GGGCAGA--G-CA-ACGCCCCGGCGAGTAGGCAGGCGTGGAGGCCC------------------------------------------------------------------------------ACATCGAACTCGCCACTCCCATGTTCCACGTTGGC---TTCATCGGC-AGGTCAAGAAGATCCTGGAAACAGTCTGCCACAACTGTGGCAAGATCTTGCTCGATGAATCCATTCCAGCCTTTGCGCAAGCCGTACGATTCCGAGATCCCAAGCGACGGTTTGATGCTATACATCGACTCTGCAAG---CCGAAACTCATGTGTGACGTGACC---------GAAGCACCAGAACCGCAACATGGCGGGTGTGGCAATTTGCAGCCTTCG---ATCAGAAAAGATGGCTTGAAACTGACAGGGACGTGGACA---TGG---CCTAAG---GATGCGGATACAGAAGTCGAGAAGAGG---CTGATCTCGCCACAAATGGCGCTGAACGTGTTCCGCAACATCTCGCCTGAAGACATGGCAAGGATGGGGTTGAACGCCGATTACGCCAGGCCCGAGTGGATGATCTTGACAGTACTGCCTGTCCCACCACCAGCAGTCCGACCTAGTGTCTCTGTCGATGGCACACCTACAGGTATGCGATCCGAGGACGATTTGACATACAAGTTGAGCGACATCATTCGCGCGAACAGTAACGTCAGACGTTGTGAACAGGAAGGCTCCCCTCAGCACGTCATCGCCGACTTTGAGCAGCTTCTGCAATTCCACGTCGCGACCTACATGGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGCACGCCCTTCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGCTTCAGCGAGATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTCCCCTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGATCGACGTCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCTACCGGCAAGACCCTCCTCGAGGCCATCGACGCCATCGACACCCCAACCCGTCCTTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATCGGTGGCATTGGCACAGTACCAGTCGGTCGTGTCGAGACTGGTACCATCAAGTCCGGCATGGTCGTCACCTTCGCGCCAGCTGGTGTCACCACCGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACCGAGGGTGCT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGATCCTCCCAAGGGTTGCGACAGCTTCAACGCCCAGGTCATTGTCCTGAACCACCCTGGTCAGGTCGGTGCCGGTTACGCCCCAGTCCTCGACTGCCACACCGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGAAAGTCCATTGAGAACTCCCCCAAGTTCATCAAGTCTGGTGACGCCGCCATCGTCAAGATGATTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACCGAGTATCCTCCT Elsinoe_phaseoli_CBS_165_31 -------------------AAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTCTGGTGATTCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATTGTAGGATAGAGGCCTACAATGGTATCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTTCGGCCGGGCCTTTCCTTCTGGGGAACCGCATGCCCTTCACTG-GGCGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTCGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGCCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGGCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGACG-GTGTTATTATTTTGACCCGTTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT--------------------------------------------------------------------------------------------------TCTGG-CGTCCGAGTTGTAATTTGTAGAGGATGCTATTGGG-TTG-CCACC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGACC--GGC--CAG--GC-GCCTTCTGTATAGCTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCCCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGTCTCGACGGCGGCTGTTCGGCCT-CTC---T-TC-------T--GAG-TG--GTT-TATTCAGTCGC-CG----C-CGGGCCAGCATCAGTTTTGGC-GGTCGG-ATAAAGGCGC-AGGGAATGTAGCT---CCCCCAATACGGCCCGCCGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGAAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTACGCGAGTG-TTTGGGTGTCAAA-CCCGTGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCGT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCC-TTGTTACTTAGTTGAACGTGGGCATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCTCGCCGCCG-GGGCAGAT-G-CA-ACGCCCCGGCGAGTAGGCAGGC------------------------------------------------------------------------------CATTTTGGTCACATCGAGCTCGCAACTCCCATGTTCCACGTCGGC---TTCATCACCAAGGTCAAGAAGATCCTGGAGACAGTATGTCACAATTGTGGCAAGATCCTGCTCGATGAATCTATTCCAGCTTTCGCGCAGGCCGTCCGGTTCCGCGATCCCAAGAGACGGTTCGATGCCATACACCGACTCTGCAAA---CCGAAGCTGATGTGCGACGTGACC---------GAGGCGCCGGAACCACAGCACGGCGGATGCGGCAATTTGCAGCCGTCG---ATCAGGAAGGATGGGTTAAAGTTGACTGGTACATGGACC---TGG---CCAAAA---GATGCGGATACAGAGGTTGAGAAGAGG---ATGATATCTCCACAAATGGCGACGAACGTGTTTCGCAACATCTCCCCTGCGGATATGGCGAGGATGGGCTTGAATGCCGATTATGCCAGACCCGAGTGGATGATTCTGACGGTTCTTCCGGTACCGCCTCCAGCAGTAAGGCCCAGTGTCTCTGTCGATGGCACCAGCACTGGTATGAGATCCGAGGATGATTTGACCTACAAGCTCAGCGACATCATCCGCGCGAACAGTAATGTCAGGCGCTGTGAACAGGAAGGATCTCCACAGCATGTCATTGCCGACTTTGAGCAGCTTCTTCAGTTCCACGTCGCGACATACATGGACAACGACAATCGC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGATCACTGGTACTTCCCAGGCCGACTGCGCTATCCTCATTATCGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGATCGTTTCAACGAGATCATCAAGGAGACCTCCTCCTTTGTCAAGAAGGTCGGCTTTAACCCCAAGCACATTCCTTATGTCCCCATCTCCGGCTTCAACGGCGACAATATGATTGATGTCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGATC---------------AAGACC---AAGGTCACCGGCAAGACTCTCCTGGAGGCCATTGACGCTATCGAGCCTCCTTCGCGTCCTTCTGACAAGCCCCTTCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGCACGGTACCAGTCGGTCGTGTTGAGACTGGTCTCATCAAGGCCGGTATGGTCGTCACTTTCGCCCCAGCTGGCGTGACCACCGAAGTCAAGTCCGTCGAGAT-CACCACGAGCAGCTTACCGAGGGTGCT---CCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTC--------------------------------------------------------CTGCGACAG-TTCAAC-CCCAGGTCATTGTCCTGAACCACCCTGGTCAGGTTGGTGCCGGTTACGCCCCAGTCCTCGACTGCCACACCGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGATCGCCGTACCGGAAAGTCCATTGAGAACTCTCCCAAGTTCATCAAGTCTGGTGACGCCGCCATCGTCAAGATGATTCCCTCCAAGCCCATGTGCGTTGAGGCTTC---------------- Elsinoe_veneta_CBS_150_27 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGGGCCTTTCCTTCTGGGGAACCGCATGCCCTTTACTG-GGCGTGT-GGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTCGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGCCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGGCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGACG-GTGTTATTATTTTGACCCGTTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT--------------------------------------------------------------------------------------------------TCTGG-CGTCCGAGTTGTAATTTGTAGAGGATGCTATTGAG-TTG-TCACC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACC--GGC--CAG--AC-GCTCTCTGTATAGCTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCCCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGTCTCGACGGCGGCTGTTCGGCCT-CTC---T-TC-------T--GAG-TG--GTT-TATTCAGTCGC-CG----C-CGGGCCAGCATCAGTTCTGGC-GGTCGG-ATAAAGACGC-GGGGAATGTAGCT---CCTCTAATACGGCCTGCCGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGAAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCGTACGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCC-TTGTTACTTAGTTGAACGTGGGCATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCTCGCCGCCA-GGGCAGAT-G-CA-ACGCCCTGGCGAGTAGGCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTTCT-GCCTACACCCT-GGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGCTTCAACGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGCACGTTCCTTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGATTGAGCCATCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACTGGCAAGACTCTCCTCGAGGCCATTGACGCCATTGACCCCCCCAGCCGTCCTACCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACAGTTCCCGTCGGCCGTGTCGAGACCGGTACCATCAAGGCCGGCATGGTCGTCACTTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGCTGGTCTT---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGCAGGACCCTCCCAAGGGCTGCGACTCTTTCAACGCCCAGGTCATTGTCCTGAA-CACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTTTTGGACTG-CACACCGCCCACATTGCCTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCCATTGA------------------------------------------------------------------------------------------------- Endosporium_aviarium_UAMH_10530 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTTACTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATATCTTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGCCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGGCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGACG-ATGTTATTATTTTGACTCGTTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT----------------------------------------AACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGG-CAG-CCACC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGACC--GGC--CAG--GC-ACCCTTTGTAAAGCTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCCCTAAATTGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGTCTCGACGGCGGCAGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-CACTCTGCCGC-CG----C-CGGGCTAGCATCAGTTTCGGC-GGTCGC-ATAAAGGCCT-CGGGAACGTAACT---CCCCCAATTCGATCAGCCGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCAAAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCATACGCGTAATG-AAAGTGAACGGAGGTAGGAACCGGTGCACTAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Endosporium_populitremuloidis_UAMH_10529 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTTACTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATATCTTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGCCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGGCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGACG-ATGTTATTATTTTGACTCGTTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGG-TAG-CCACC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACC--GGC--CAG--GC-TCCCTCTGTAAAGCTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCCCTAAATTGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGTCTCGACGGCGACCGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TACTCGGTCGC-CG----C-CGGGCCAGCATCAGTTTTGGC-GGCCGC-ATAAAGGCCG-CGGGAATGTAGCT---CCCTCAATTCGGCCAGCCGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCAAAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCATACGCGTAATG-AAAGTGAACGGAGGTAGGAACCGGTGCACTAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-GAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTTGTTGAACGTGGACATTTGAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Entodesmium_rude_CBS_650_86 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTAG-GGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCG-TTG-GCAGC-GGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTC--GCT--ATC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCTG-GAC---T-TT-------T--GTC-CG--GTG-CACTCTTCTAT-AG----G-CAGGCCAGCATCAGTTTGGGC-GGTTAG-ATAAAGGTCT-CTGTCATGTACCT---CTCTTCATGTAACCAGCCCAGACTGA-GGT-CCGCG-CA----T-C--T--GCTA-GATGCTGGCGTAATGGCTGTAA-CGGCCCGTC--TGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCAGACGCGTAATG-AAAGTGAACGGAGGTAGGACCCGGTGCACTAT-CGA-CCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCAT-GGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGCTG-AAAC-AGCCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACTGCGCTATTCTCATCATCGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGACGGCCAGACCCGCGAGCACGCTCTCCTTGCTTACACCCTTGGTGTCAAGCAGTTGATCGTCGCTATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAGCTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGGTTCAACGGCGACAACATGATCGACGTTTCCTCCAACTGCCCATGGTACAAGGGTTGGGAGAAGGAGACT---------------AAGTCC---AAGTCTACCGGCAAGACCCTCCTTGAGGCCATTGATGCCATCGACCCTCCTTCCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTATCATTAAGGCCGGTATGATCGTCACCTTCGCCCCCGCCGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTC---CCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCTGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTTGGTGCCGGTTACGCACCAGTCCTCGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCGGTCGAGAACTCCCCCAAGTTCATCAAGTCTGGAGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCTCCT Falciformispora_lignatilis_BCC_21117 ---CTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATCGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTACTTGGTGATTCATGATAACTTCGCAGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGAGGGTTAGTGCTCGACCCCGGAGAATCCGCCTGAGAAACGGCGAATACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATGCCAACACGGCGAGGTAGTGACGAGCAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAAGTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCACGAAAATGTATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-CACTTGACCGGCCGGGCCTTCTTTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGGATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAAACGATCAGATACCGTTGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-GTGTTTTCATTTTAACTCGCTCGGCACCTTACGAGAAATCA-AAGTGTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGC-------------------------------------------------GGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCT---GTCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCG-TTG-GCGGC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTC--GCC--TGC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGCGGTTGCTCAGCCG-GGT---C-CG-------T--GCC-CG--GTG-CACTCTTCCGC-GG----G-CAGGCCAGCATCAGTTTGGGC-GGCTGG-AGAATGGCCT-CTGTCATGTACTG---CCCTTAATGCAGTCAGCCTGGACTGA-GGT-CCGCG-CT----T-C--G--GCGAGGATGCTGGCGTAATGGCCGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAAGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACACTTGAATGCAACGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCGCCATTCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGTCAGACTCGTGAGCACGCTCTCCTCGCCTACACCCTTGGTGTCCGACAGATCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGACCGCTACCACGAAATCGTCAAGGAGACGTCGAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTCCCCTTCGTCCCAATCTCTGGCTTCAACGGCGACAACATGATTGAGCCGTCCTCCAACTGCCCGTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGGTCACCGGCAAGACGCTCCTCGAGGCCATCGACAACATCGATCCCCCGTCCCGTCCCTCCGACAAGCCCCTCCGCCTGCCCCTTCAGGATGTGTACAAGATCGGTGGTATCGGCACTGTCCCTGTGGGCCGTGTCGAGACCGGTACCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTTACCGAGGGTGTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATTCGTCGTGGCAACGTCGCTGGTGACTCCAAGAACGACCCACCAAAGGGTGCTGAGTCCTTCAACGCCCAGGTCATCGTCCTTAACCACCCCGGCCAGGTCGGCGCTGGTTACGCTCCTGTCCTTGATTGCCACACCGCCCACATTGCCTGCAAGTTCTCTGAGCTTCTCGAGAAGATCGACCGCCGAACTGGCAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCTATTGTCAAGATGATTCCGTCCAAGCCCATGTGCGTTGAGGCTTTCACGGAGTATCCTCCT Falciformispora_lignatilis_BCC_21118 ---CTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATCGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTACTTGGTGATTCATGATAACTTCGCAGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGAGGGTTAGTGCTCGACCCCGGAGAATCCGCCTGAGAAACGGCGAATACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATGCCAACACGGCGAGGTAGTGACGAGCAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAAGTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCACGAAAATGTATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-CACTTGACCGGCCGGGCCTTCTTTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGGATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAAACGATCAGATACCGTTGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-GTGTTTTCATTTTAACTCGCTCGGCACCTTACGAGAAATCA-AAGTGTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGC-------------------------------------------------GGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCT---GTCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCG-TTG-GCGGC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTC--GCC--TGC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGCGGTTGCTCAGCCG-GGT---C-CG-------T--GCC-CG--GTG-CACTCTTCCGC-GG----G-CAGGCCAGCATCAGTTTGGGC-GGCTGG-AGAATGGCCT-CTGTCATGTACTG---CCCTTAATGCAGTCAGCCTGGACTGA-GGT-CCGCG-CT----T-C--G--GCGAGGATGCTGGCGTAATGGCCGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAAGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACACTTGAATGCAACGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCGCCATTCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGTCAGACTCGTGAGCACGCTCTCCTCGCCTACACCCTTGGTGTCCGACAGATCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGACCGCTACCACGAAATCGTCAAGGAGACGTCGAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTCCCCTTCGTCCCAATCTCTGGCTTCAACGGCGACAACATGATTGAGCCGTCCTCCAACTGCCCGTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGGTCACCGGCAAGACGCTCCTCGAGGCCATCGACAACATCGATCCCCCGTCCCGTCCCTCCGACAAGCCCCTCCGCCTGCCCCTTCAGGATGTGTACAAGATCGGTGGTATCGGCACTGTCCCTGTGGGCCGTGTCGAGACCGGTACCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTTACCGAGGGTGTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATTCGTCGTGGCAACGTCGCTGGTGACTCCAAGAACGACCCACCAAAGGGTGCTGAGTCCTTCAACGCCCAGGTCATCGTCCTTAACCACCCCGGCCAGGTCGGCGCTGGTTACGCTCCTGTCCTTGATTGCCACACCGCCCACATTGCCTGCAAGTTCTCTGAGCTTCTCGAGAAGATCGACCGCCGAACTGGCAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCTATTGTCAAGATGATTCCGTCCAAGCCCATGTGCGTTGAGGCTTTCACGGAGTATCCTCCT Farlowiella_carmichaeliana_CBS_179_73 ----------------------TCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTCCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTAAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTACGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGGGATCCGCATGTCCTTTACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTACTATT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Floricola_striata_JK_5678I AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATACCCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTTTGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCCGGGCTCTTTGGTGATTCATAATAACTTAACAGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGAGAGCCCCATGCCCTTCACTG-GGTGTGCGGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGGATACGTTAGCATGGAATAATAGAATAGGACGT-GCGATCCTA-TTTTGTTGGTTTTTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTCCTTTGTTGACTCGCTCGGCACCTTTCGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT--------------------------------------------------GATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCG-TTG-GCTGT-GGTCCAAGTTCCCTGGAACAGGACGTCGCAGAGGGTGAGAACCCCGTACGTGGCC--GCC--AGC--CT-CCGCCGTGTAAAGCCCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAATTGGGAGGTAAATTCCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-GAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGGAGCCAGACGTGCCCGTAGTTGCTCAGCCG-GGG---T-CT-------T--CCC-CG--GTG-CACTCTTCTGC-GG----G-CAGGCCAGCATCAGTTTGGGC-GGTCGG-ACAAAAGCCT-GCTAAACGTACCT---CCCCCCATACGACCAGCCCGGACTGA-GGA-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAAAATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGCAATG-AAAGTGAACGCAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGAAGTTTTCGGAAGGATTTGAGTATGAGCAT-AGCTTTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGTTG-AAAC-AACCTTCA-CTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GTGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCT--ATACCCCGCCGCCG-GGGCAGGC-A-TT-ATGCCCCGGCGAGTAGGCAGGCGTGGGGGTCTGTGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCTCTCATTGCCATCTGTTCCGCATTCTTTTCCTCAAATTGACAAAGGATGTGTTCAAATACCTGCAGAAATGCGTTGAGAACAACACCGAGTTCAATGTTCAGATGGCAGTCAAAGGCAGCGTCCTCACCAACGGTCTTAAGTATTCCCTGGCTACGGGCAACTGGGGCGACCAGAAGAAGGCGGCTTCTGCGAAGGCTGGCGTGTCCCAGGTGCTCAACCGATACACATACGCTTCCACGTTGTCGCATTTGCGCCGGACCAACACCCCAGTAGGCCGTGATGGAAAACTGGCTAAGCCGCGTCAACTGCACAACACCCACTGGGGCTTGGTGTGTCCTGCCGAGACGCCGGAAGGTCAAGCCTGTGGTTTGGTGAAGAATCTGTCATTGATGTGCTACGTCAGTGTTGGTACTGAGAGT---------ACTCCCATCACGGATTACATGGGCCAGCGCCAGATGGAGCTGCTTGAGGAATATGATCCGGTCGTTAACCCCAATGCCACAAAGGTTTTCGTCAACGGTGTTTGGGTCGGCACACACAACAGTCCGTCACAGCTTGTTGAGAATGTGCAGGCCCTACGACGAAAC---GGTACTCTGTCATACGAAATGAGTTTGATTCGAGATATTCGGGATCGAGAATTCAAAATTTTCACTGATGCAGGTCGTGTAATGCGGCCGCTATTCGTTGTGGAGAATCGTCACAACGCATCCAACCGGGGGCAACTTGCGCTCAATAAAGGCCATATCCAGCAATTGCTGAGCGATAAGTATAACGATGAGGAC------ACGGCGAAG------ATGAAGTACAGCTGGAGG---GGCCTCATTCACAATGGTGTCATCGAGTATCTCGATGCCGAAGAAGAAGAGACGGCCATGATTGTGATGTCGCCAGAAGACCTTGAGGAGCACAGAGACCTC---ATGCAAGGGATTCCT------GCCGCTGACGTAGAAGATCGACATAAGCGTATCAAGCCCCAACCGAATCCCTCGATCAGGATGTACACTCATTGTGAGATTCATCCCAGTATGATTCTCGGCATCTGCGCCAGTATC--TCCGTTCCCCGACCACAACCAATCTCCTGTAACACTTACCAAT--TGCTATGGGTAAACAAGCCATGGGCGTTGCACTCACCAAATTTA----------------------AATGTT-TTTAACTACCCACAGAAACCTCTCGCCACCACACGGTCTATGGAGTATCTCAAGTTCCGTGAGCTACCTGCTGGTCAGAATGCAATTGTTGCGATTGC-TGTTATTCTGGATACAACCAGGAAGATT-CCTCATCATGAACCAGAGCAGTATCGATCGTGGTTTGTTCAGAAGTTTGTTCTACCGTGCCTACACAGAGCAGGAGAAGCGCATCGGCGTGAATGTTCTGGAGAAATT-GAAAAACCGACCCGTGGTGACACGCTTCGCTTGAAGGGTGGAACATACGATAAACT-GACGACGACGGCGTTGTCGCTCCCGGCGTGCGTGTGTC-GGAGATGATATTATCATCGGAAAGACGGCTCCCAT-CCGACCGATGCA------------------AAGGAGCTCGGCCAGAAGACGACTATGCATACGAAGAGAGACGTATCCACTCCTCTCCGCAGTACAGAGAATGGTATCGTGGACCAGGTCCTCTTCACCACCAATACCGAAGGTCTCCGCTTCGTCAAAGTACGTAC-CGAACCACGAAAGTCCCTCAAATTGGCGACAAGTTCGCTTCGCGTCACGGTCAGAAAGGAACCATTGGTATCACTTATCGGCAAGAGGATATGCCCTTCACTCGTGAAGGGCTGACG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Friedmanniomyces_endolithicus_CCFEE_522 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATACCTGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTTGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTGGCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGGCCGCCGTAATGATTAATAGGGATAGTCGGGGGCATTAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATCTGCCAAGGATGTTTTCATTAATCAG-GAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-GTGTTACTATTATGACCTCATCGGCACCTTGCGAGAAATCA-AAGTTTTTGGG-TCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGCGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Friedmanniomyces_simplex_CBS_116775 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATACCTGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATGATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCGAATTTCTGCCCTATCAACTTTCGATGGTAAGATAGAGGCTTACCATGGTGGCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGATACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTCGGGGAGCCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGGCCGCCGTAATGATTAATAGGGATAGTCGGGGGCATTAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATCTGCCAAGGATGTTTTCATTAATCAG-GAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-GTGTTACTATTATGACCCCATCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGCGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Gibbera_conferta_CBS_191_53 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCGAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTCTGGTGATTCATAATAACTAAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATTGTAGAGTAGTGGTCTACAATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAACTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAGAAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATTTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTCCTGGGGATCCGCATGCCCTTTACTG-GGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACG--GCTTTCCTA-TTTTGTTGGTTTCTAGGGAAGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTACTATCTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGT--------------------------------------------------------------------------------------------------------------------------------------------GCGGCAACAGCTCAAATTTGAAATCTA--CGCCCGAGTTGTAATTTGTAGAGGATGTTTCGGGT-GAA-GCCAC-GGTCCAAGTCCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACCTGGCC--GTC--GGTG-CC-CCCCGCTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATTGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTTGCCCGCGGTTGCTCATCCC-GCC---T-TT-------T--GGC-GG--GTG-CACTCTTCCGC-GG----T-CAGGCCAGCATCGGTTTGGGC-GGTCGG-ATAAAGGCGC-TGGGAACGTGGCC---TCCCCAATGCGGCCAGCCCGGACCGA-GGT-TCGCG-CT----T-T-----GCTAGGATGCTGGCGTAATGGCCGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGC-AGTGTTTTGGGTGTCAAA-CCCGTGCGCGTAATG-AAAGTGAACGGA-GTGGGA-CCGGTGCACCAT-CGA-CCGATCCTGATTTCTTCGGAAGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CGTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGCGTATAGGGGCGAAAGACTAATCGAA-CC-ATTTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAACTAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GGGGGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTGGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACCAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCCCCTCCG-CGGCAGGC-T-TT-ATGCCGCGGAGAGTAGGCAGG------------------------------------------------------------------------------------TGGCCATATCGAGCTCTGTGTTCCGGTCTTTCACGTTGGT---TTTATCCGGAAAATTCAGAAGGTCCTCGAGACTGTGTGCAACAAGTGCGGAAAGATTAAGGTCGACGAG-----CCCTGCTTACAAGGAAGCTCTCATAAACAGGAATCCAAAGCGACGATTCGATGCGATCCTCAAACTTTGCAAG---CCCAAGATGATTTGCGATGCTGAT---------CCATCA---GACCATATACACGGTGGATGTGGAAATCAACAGCCAGAG---ATCCGAAAGGACGGGTTGAGGCTGATGGCCACTTTCAAG---CCC---TCCAAG---GACGAGGAAAAAGAACCCGAGAAGCGC---CCCATCACTCCCGAAGAATGCATTACAATCATGCTATCTATGAGCGACGAAGACATTAGGACCCTAGGATTCAACACCGAGTTCGCGAGACCAGATTGGATGATGATTCGCAACCTGCTTGTGCCTCCACCACCTGTTCGTCCCAGTGTCTCTGTTGATGGTACTGGGCAGGGTATGCGCGGCGAGGACGATTTGACGCACAAATTGGGTGACATCTTCCGTGCCAATGCAAACGTCAGCGTTTGCATTTCAGAAGGCTCCCCCCAGCACGTCGTCTCTGAGTTTGAGCAGTTACTCCAATACCACGTTGCTACGTACATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATTGCGCAATTCTCATCATTGCCGCAGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACTCGTGAGCATGCCCTGCTTGCCTACACCTTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAATGGTCCGAGGAGCGATTCAACGAAATCATCAAGGAGACTTCCTCCTTCATCAAGAAGGTCGGCTACAACCCAAAGCACGTTCCCTTCGTCCCAATCTCCGGTTTCAACGGTGACAACATGATCGACAACTCCCCCAACTGCCCATGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGTCC---AAGGTCACTGGAAAGACTCTCCTCGAGGCCATTGACGCCATTGATCCTCCATCCCGCCCATCCGACAAGCCTCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACAGTACCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGTCCGGTATGGTCGTCACCTTCGCCCCAGCTGGTGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGTCGAGGGTCTC---CCAGGCGACAACGTCGGATTCAACGTCAAGAACGTCTCCGTCAAGGAAATTCGCCGTGGTAACGTCGCTGGTGACTCCAAGAACGATCCTCCAAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTTAACCACCCCGGTCAAGTCGGTGCTGGTTACGCTCCAGTCTTGGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCTGAGCTTTTGGAGAAGATCGATCGCCGTACTGGTAAATCCACAGAATCTTCCCCCAAGTTCATCAAGTCTGGGGATGCCGCCATCGTCAAGATGATTCCCTCCAAGCCAATGTGCGTTGAGGCTTTCACCG----------- Gloniopsis_arciformis_GKM_L166A ----------------------------------------------------------------------GGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTCTGGTGAATCATAATAACTTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATTGTAGGGTAGTGGCCTACAATGGTATCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCAATACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGTCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGACCTTTCCTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-GGCCCGAGTTGTAATTTGTAGAGGATGCTTCGGCG-AGG-GCCCC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCC---GGC-GGT--GC-TCGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGCGGTTGCTCATCCA-GGC---T-TC-------T--GCC-TG--GTG-CACTCTTCCGC-GG----T-CAGGCCAGCATCAGTTCTGGC-GGTCGG-ATAAAGGCGG-CGGGAATGTGGCT---CCCCTCATGCGGCCAGTCGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTGTGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGTAATG-AAAGTGAACGGAGGCGGGAACCGGTGCACCGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Gloniopsis_praelonga_CBS_112415 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATTGTAGGGTATTGGCCTACAATGGTATCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACGATGCCGACTAGGGATCGGGCG-ATGTTATTATTTTGACTC--------------------------------------------------------------------------------------------------------------------ACATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-GGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGCG-TGG-GCCCC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCC--GGC--GGC--GC-TCGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGATCGTAGCTGCTCATCCG-GGC---T-CC-------T--GCC-CG--GTG-CACTCTTCTGC-GG----T-CAGGCCAGCATCAGTTCTGGC-GGTCGG-ATAAAGGCGG-CGGGAATGTGGCT---CCTCTCATGCGGCCAGCCGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTGTGCGAGTG-TTTGGGTGTCAAG-CCCGGACGCGTAATG-AAAGTGAACGGAGGCGGGAACCGGTGCACCGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCGCCGCCG-GGGCAAGA-G-TT-ACGCCCCGGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGCCTTGGGGGTGACCCCGGGTAGAACGGCCTC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTATTTAGGATCCTTTTCCTCAAGCTGACAAAGGACATC-ACAAGTACCTGCAGAGATGCGTCGAGAACAACTCTGAATTTAGCGTGCAATTGGCCATCAAAGCCAGTACCATCACGAACGGCTTGAAGTACTCGTTGGCCACAGGCAACTGGGGTGATCAAAAGAAGGCGGCATCCTCAAAAGCAGGTGTCTCCCAAGTGCTCAATCGCTATACTTATGCCTCAACATTGTCCCATCTTCGGCGCACAAATACTCCAGTTGGTCGGGATGGCAAACTAGCGAAACCTCGCCAGCTGCACAACACGCACTGGGGTCTGGTTTGTCCTGCAGAGACACCAGAAGGCCAAGCTTGCGGTCTCGTCAAGAATCTGTCGTTGATGTGCTATGTTAGTGTGGGCAGTGAAAGT---------ACACCCATCACCGACTTTATGACACAGAGGAACATGGAACTTCTAGAAGAGTATGACCCTATGGTCAACCCGACAGCGACCAAGGTTTTTGTCAACGGTGTCTGGGTGGGCGTGCATTCTCAACCAGCACAGCTTACATCAGTCGTTCAAGAACTG----------------------------------------------------------------CAAGATTTTTCACAGATGCAGGTCGTGTAATGCGACCGCTTTACGTTGTGGAGACCGATTACAGAAAGCCAA-CCGTGGATGCCTTGCTTTGAGCAAGGATCATGTTGCCCGGTTGTTGGCAGACAAGATGAATGACGAAGAC------GCAGCCAAT------GCCAAATTCGGCTGGATG---GGCCTTATTCGAAGCGGAGTCATAGAGTATTTGGACGCTGAGGAAGAAGAGACGGCCATGATTATTATGACTCCTGAGGATCTCGAAGATC-CCTCCGGGTC---TCACAAGGAGGGCAG------GTTTACGTCGAGGCAGAAGCACACAAACGCATCAAACCCAAGCCTAATCCGACGGTCAAAACTTACACCCATTGCGAGATTCACCCAAGTATGATATTGGGTATTTGCGCTAGTATCATTCCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAAGCTGGTATCTCTAAGGATGGCCAGACTCGTGAGCACGCTCTCCTCGCCTACACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGATCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACCGTTCCTTTCGTCCCCATCTCTGGTTTCAACGGTGACAACATGATCGAGGTTTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACTGGTAAGACTCTCCTCGAGGCCATCGACGCCATCGACCCTCCCAGCCGTCCTTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTGTACAAGATTGGTGGTATTGGCACGGTCCCTGTCGGTCGTGTTGAGACTGGTGTCATCAAGTCCGGTATGGTCGTCACCTTCGCCCCCGCCGGTGTTACCACTGAAGTCAAGTCCGTCGAGATGCACCATGAACAGCTCACTGAGGGTCTT---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTTTCCGTCAAGGAAATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCACCAAAGGGTGCCGAATCCTTCAACGCCCAGGTCATCGTTCTTAACCACCCTGGTCAGGTTGGTGCTGGTTACGCTCCAGTTTTGGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATCGATCGCCGAACTGGCAAGTCCATTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATGATT-CCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGAGTACCCACCT Gloniopsis_praelonga_CBS_123337 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATTGTAGGGTATTGGCCTACAATGGTATCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTG-TCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGAAAGCGATGCCGACTAGGGATCGGGCG-ATGTTATTATTTTGACTCGCTCGGC--------------------------------------------------------------------------------------------------------------CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-GGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGCG-TGG-GCCCC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCC--GGT--GGC--GC-TCGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGATCGTAGCTGCTCATCCG-GGC---T-CC-------T--GCC-CG--GTG-CACTCTTCTGC-GG----T-CAGGCCAGCATCAGTTCTGGC-GGTCGG-ATAAAGGCGG-CGGGAATGTGGCT---CCTCTCATGCGGCCAGCCGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTGTGCGAGTG-TTTGGGTGTCAAG-CCCGGACGCGTAATG-AAAGTGAACGGAGGCGGGAACCGGTGCACCGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCGCCGCCG-GGGCAAGA-G-TT-ACGCCCCGGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGCCTTGGGGGTGACCCCGGGTAGAACGGCCTCTAGTGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGCC-TATTCTCATCATCGCTGCCGGTACTGGTGAGTTCGAAGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTCCTCGCCTACACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGATCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACCGTTCCTTTCGTCCCCATCTCTGGTTTCAACGGTGACAACATGATCGAGACCTCCTCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACTGGTAAGACTCTCCTCGAGGCCATTGACGCCATCGACCCTCCCAGCCGTCCTTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTGTACAAGATTGGTGGTATTGGCACGGTCCCTGTCGGTCGTGTTGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCTCCCGCCGGTGTTACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAACAGCTCACTGAGGGTCTT---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTTTCCGTCAAGGAAATCCGTCGTGGTAACGTTGCTGGTGATTCCAAGAACGACCCACCAAAGGGTGCCGAATCCTTCAACGCCCAGGTCATCGTTCTTAACCACCCTGGTCAAGTTGGTGCTGGTTACGCTCCAGTTCTGGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGATCGCCGAACTGGCAAGTCCATTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATGATTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGAATACCCACCT Gloniopsis_subrugosa_CBS_123346 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATACCTGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCTGGGCTCCTTGGTGAATCATAATAACTTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATTGTAGGGTATTGGCCTACAATGGTATCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACGCGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGTTGGTCGGTCCGCCTCACCGCGTG-CACTGATCCGACCGGGCCTTTCCTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGCCGGGGAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGC-GCGGTCTTA-TTTTGTTGGTTTCTAAGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTCAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTGACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCGG----------------------------------------------------------------------------ACATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAGCAGCTCAAATTTGAAATCTAG-GGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGCG-TGG-GCCCC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCC--GGC--GGT--GC-TCGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTAACCGTAGTTGCTCATCCA-GGC---T-CC-------T--GCC-TG--GTG-CACTCTTCTGC-GG----C-TAGGCCAGCATCAGTTCTGGC-GGTCGG-ACAAAGGCGG-CGGGAATGTAGCT---CCTCTCATGCGGCCAACCGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTGTGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGTAATG-AAAGTGAACGGAGGCGGGAACCGGTGCACCGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTATGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTGCTTAGTTGAACGTGGACATTCGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCGCCGCCG-GGGCAAGA-G-TT-ACGCCCCGGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGCCTTGGGGGTGACCCCGGGTAGAACGGCCTCTA------------------------GGCATTTCGGTCACATTGAACTGGCAGTGCCCGTTTTCCACGTTGGT---TTCATCACTAAAATAAAGAAACTCTTGGAATCAGTGTGTCACAACTGCGGGTTGATTCTCGCTGATTATAATCATCCCGACTGGAAAGCAGCCATCAGAATCAAAGACCCGAAGAAGCGCTTTGATGCCGTCTGGCGAGTCTCCAAG---GGCAAGCGCGTGTGTGAAGTCGAA---------GTTCCTGAAGACGCCCCTCACGGTGGTTGCGGCAACAGACAACCTGATACTATAAGAAAGGAAGGTCTCAAGCTCACTGCGACATATAAG---GCT---AAGAAG---AACGAAGAAGATGAGGACGAGAAGAAA---AACGTTTCGGCTCAGGATGCTCTTAATATTTTCCGAAACCTCTCCGACAATACCCTTCATCTGCTTGGCTTGAACAAGGACTATGCTCGACCGGAGTGGATGGTCCTCTCGGTTCTTCCTGTGCCTCCACCTCCCGTGCGACCTAGTATTTCCGTTGACGGGACTGGTCAAGGCATGCGCGGCGAAGATGACTTGACGTACAAATTAGGAGACATCATCCGTGCCAATGCTCGCGTCGAAGAATGTCTACGAGAAGGTTCACCCCAGCACATTGTCAACGAATTTGAGACGCTTCTTCAATACCACATTGCCACGTACATGGACAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGCAATTTATTCAGAATCCTTTTCCTCA-GCTTACAAAAGACATCACGAAATACCTTCAGAAGTGCGTGGAGAACAACCAGGAGTTCAGCGTGCAAATGGCCGTCAAAGCTAGTCTTATCACGAACGGTTTGAAATACTCACTAGCTACGGGTAACTGGGGCGACCAGAAAAAGGCAGCATCTTCTAAAGCGGGTGTCTCACAAGTGCTCAACCGCTATACCTACGCCTCAACATTGTCCCATCTTCGGCGTACAAACACTCCGGTCGGCCGTGACGGCAAGCTAGCG-AACCTC-CCAACTGCACAATACACACTGGGGTCTTGTCT-T-C-GCAGAGA-CCCCGAAGGCCAAGCTTGTGGTCTAGTCAAGAATTTGTCGTTGAT-TGCTACGTTAGTGTAGGCAGTGAGAGT---------ACACCGATCACCGACTTTATGACCCAGAGGAATATGGAACTTCTTGAAGAATATGATCCTATGGTAAACCCGACAGCGACCAAGGTTTTTGTGAACGGTGTCTGGGTTGGCGTGCATTCTCAGCCAGCACAGCTCACATCAGTCGTCCAAGAGCTGAGGAGAAAC---GGGACACTTTCGTACGAAATGAGCGTGATTCGAGATATTCGCGACCGTGAGTTCAAGATCTTCACAGATGCAGGCCGTGTCATGCGACCACTATTCGTTGTCGAGACCGATT-CAGAAAGCCGAATCGTGGATGCCTTGCTTTGAGTAAGGA-CATATTGCAAGACTCTTAGCAGATAAGATGAATGAT-AA-AC-------CTGCCGCT------TCGAAATTCGGCTGGATG---GGCCTTATCCGAAGCGGTGTCATAGAGTACTTGGATGCTGAAGAGGAAGAAACGGCTATGATCATCATGACTCCCGAGGATCTTGAGGACCATCTTCGGGTG---CAACAGGGAGGCCAG------GTCTACGTTGAGGCAGAGGCACACAAGCGCATCAAGCCAAAGCCTAATCCGACGGTGAGGACTTACACTCATTGCGAGATTCATCCAAGTATGATACTGGGTATTTGCGCTAGTATCATTCCATTCCCCGACCACAAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Glonium_circumserpens_CBS_123342 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTTCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGGATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGG------------------------------------------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-GGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGCG-TCG-GCTCC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGATC--GGT--TGC--CT-TCGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCTGCAGTTGCTCATCCA-GGC---T-TT-------T--GCC-TG--GTG-CACTCTTCTGC-TG----T-CAGGCCAGCATCAGTTCGGGC-GGTCGG-ATAAAGGCTT-CGGGAATGTGGCT---CCTCTAATGCGACCAGCCTGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCGTGCGCGTAATG-AAAGTGAACGGAGGCGGGAACCGGTGCACCGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAAGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACTTCGCCGCTG-GGGCGGAA-A-CT-ATGCCCCAGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGCCTTGGGGGTGACCCCGGGTAGAACGGCCTCTAGTG-------------------------------TCACATTGAACTCTCCGTGCCAGTTTTTCATGTTGGA---TTCATCACCAAGATCAAGAAGCTTTTAGAGACCGTCTGTCACAATTGCGGGCTGATTCTGGCAGATTACAACCATCCAGACTGGAAGGCTGCTATCAGAATTAAAGATCCAAAGAAACGCTTCGATGCTATATGGCGATGTTCTAAA---GGCAAGAGGACATGTGAAATTGAG---------ATGCCA---GACGTCCCGCATGGTGGTTGTGGCAACAAGCAGCCAGAAATGATTCGAAAAGAAGGTCTGAAGCTTTACGCGATCTACAAG---GCA---AAGAAA---GGTGATGAAGACGAGGATGAGAAGAAA---CCCATCTCTCCCCAAGATGCGCTTAACATCTTCCGAAACCTATCCGATAATACCCTGCATTTACTGGGTCTCAACAAGGATTACGCAAGGCCCGAATGGATGATCATTTCAGTTCTTCCCGTGCCACCCCCTCCAGTTCGACCGAGTATCTCCGTCGACGGTACCGGCCAAGGCATGCGTGGAGAGGACGATTTGACCTACAAGCTTGGAGATATCATTCGCGCAAACGCTAGAGTACGAGAGTGTATCCACGAAGGGTCGCCACAACATATA-TGACAGAATTCGAAAGTTTGTTACAATATCATGTGGCAACATACATGGACA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCTTAGAATTCTGTTCATCAAACTTACTAGGGACGTTTACAAGTATCTACAGAAATGTGTGGAGAACAACCAAGAGTTCAGCATTCAGATGGCGGTCAAGGCTAGTCTTATAACGAATGGGTTAAAATATTCATTAGCCACCGGAAACTGGGGCGACCAAAAGAAGGCGGCCTCCTCCAAAGCTGGTGTCTCACAGGTGCTTAACCGTTATACCTACGCGTCGACATTATCCCATCTTCGGCGGACTAATACCCCAGTCGGTCGCGATGGCAAGCTTGCCAAGCCCCGCCAGTTGCATAACACCCATTGGGGGTTGGTTTGCCCTGCAGAAACGCCCGAAGGCCAAGCATGCGGCCTCGTAAAGAATCTTTCGTTGATGTGTTACGTCAGTGTCGGCAGTGAGAGC---------ACACCAATTACCGATTTTATGAGCCAGAGAAACATGGAACTTCTAGAAGAATATGACCCAGTGGTGAACCCAAGCGCGACGAAGGTCTTTGTCAATGGTGTTTGGGTTGGTGTTCATTCACAACCTTCCCAGCTTGTCACCGTCGTGCAAGAGCTGCGGCGAAAC---GGTACTCTTTCTTATGAAATGAGTCTGATTCGAGACATCCGTGATCGAGAGTTCAAGATATTCACAGATGCGGGACGAGTAATGCGACCGTTGTTTGTTATTGAAAACAACCCCACAAAAACTAACCGCGGCTCTTTGGTACTTAATAAGACGCATATCGAGAAGCTTCACGAGGATAAATTGAATGATGAAGAT------GCCGAGAAA------GCCAAATTCGGCTGGAAG---GGTCTCCTTCACAGCGGTGTGGTGGAGTACTTAGACGCCGAAGAAGAGGAGACTGCTATGATTATAATGACTCCAGAAGACCTCGAAGACCACCATCGCGTC---AGCGCAGGGACCATG------ATATATGATGATGGTGACCCTCACAAGCGCATCAAACCGAAGCCAAATCCCACTGTTAAGACGTTTACTCATTGCGAAATCCATCCTAGTATGATTTTGGGTATTTGCGCGAGTATCATT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTACTGGTGAATTCGAGGCTGGTATCTCCAAGGACGGTCAGACTCGTGAGCATGCTCTGCTCGCATACACCCTTGGTGTCAGGCAAATCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGTTTCAATGAAATCATCATGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCTTTCGTCCCTATCTCTGGTTTCAACGGTGACAACATGATTGAGCCATCCAGCAACTGCCCGTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGTCC---AAGTCTACCGGCAAGACCCTCCTCGAAGCCATTGACGCTATTGACCCCCCTGCTCGTCCTTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTCTACAAGATCGGTGGTATTGGCACGGTACCAGTCGGCCGTGTTGAGACTGGTGTGATTAAGGCTGGTATGGTCGTCACCTTCGCTCCTGCTGGTGTCACCACTGAAGTCAAGTCTGTTGAGATGCACCATGAACAGCTCGTGGAGGGTCTC---CCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTAAAGGAAATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCTCCTAAGGGTGCCGAATCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCTCCAGTGTTGGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAACTCCTCGAGAAGATCGATCGCCGAACTGGCAAGTCCATCGAAAACAACCCCAAGTTCATCAAGTCTGGTGACGCTGCTATCGTTAAGATGATTCCCTCTAAGCCCATGTGTGTGGAAGCTTTCACTGAGTATCCTCCG Glonium_circumserpens_CBS_123343 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTTCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGGATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGG----------------------------------------------------------------------------------GCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-GGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGCG-TCG-GCTCC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGATC--GGT--TGC--CT-TCGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCTGCAGTTGCTCATCCA-GGC---T-TT-------T--GCC-TG--GTG-CACTCTTCTGC-TG----T-CAGGCCAGCATCAGTTCGGGC-GGTCGG-ATAAAGGCTT-CGGGAATGTGGCT---CCTCTAATGCGACCAGCCTGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCGTGCGCGTAATG-AAAGTGAACGGAGGCGGGAACCGGTGCACCGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAAGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACTTCGCCGCTG-GGGCGGAA-A-CT-ATGCCCCAGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGCCTTGGGGGTGACCCCGGGTAGAACGGCCTCTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Glonium_stellatum_CBS_207_34 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTTCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGGATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGG-----------------------------------------------------------------------------------CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-GGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGCG-TTG-GCTCC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGATC--GGT--TGC--CT-TTGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCTGCAGTTGCTCATCCA-GGC---T-TT-------T--GCC-TG--GTG-CACTCTTCTGC-TG----T-CAGGCCAGCATCAGTTCGGGC-GGTCGG-ATAAAGGCTT-CGGGAATGTGGCT---CCTTTAATGCGACCAGCCTGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCGTGCGCGTAATG-AAAGTGAACGGAGGCGGGAACCGGTGCACCGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAAGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACTTCGCCGCTG-GGGCGGAA-A-CT-ATGCCCCAGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGCCTTGGGGGTGACCCCGGGTAGAACGGCCTCT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATGGACACCACCAAGTGGTCCGAGGAGCGTTTCAACGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCAAAGACCGTTCCTTTCGTTCCTATCTCTGGTTTCAACGGTGACAACATGATTGAACCATCCAGCAACTGCCCGTGGTATAAGGGTTGGGAGAAGGAGACC---------------AAGTCC---AAGTCTACCGGCAAGACCCTTCTCGAAGCCATTGACGCTATTGACCCCCCTGCTCGTCCTTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTTTACAAGATCGGTGGTATCGGCACGGTACCAGTCGGCCGTGTTGAGACTGGTGTGATTAAGGCCGGTATGGTCGTCACCTTCGCTCCTGCTGGTGTCACCACTGAAGTCAAGTCTGTTGAGATGCACCACGAACAGCTCGTGGAGGGTCTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTAAAGGAAATCCGTCGTGGTAATGTTGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGATTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCTCCAGTGTTGGATTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAACTCCTCGAGAAGATCGATCGC-GAACTGGCAAGTCCATCGAAA-CAACCCC--------------------------------------------------------------------------------------- Guignardia_bidwellii_CBS_237_48 -----------------------------------------------------------------------------------------------------------------------------------------------GCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTAGCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTCGAGTCTTGTAATTGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGATCCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT-----------TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGA-CGTCCGCGTTGTAATTTGTAGAGGATGCTTCGGCG-AGG-ACTCC-TGCCTAAGTCCCCTGGAACGGGGCGTCACAGAGGGTGAGAATCCCGTACGTGGCG--GGC--GGT--CC-GAGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCTCGCAGTTGCTCAGCCG-GCC---T-CT-------T--GGC-CG--GTG-CACTCTTCTGC-GA----T-CGGGCCAGCATCAGTTCGGGC-GGCCGG-ATAAAGGCGT-CGGGAATGTAGCA---CCCTTAATGCGGCCAGCCTGGACTGA-GGA-TCTCG-CT----T-C--G--GCAAGGATGCTGGCGTAATGGTTGCAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCATGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-AATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGATGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACATCGCCGCCA-GGGTAGAT----------------------------------------------------------------------------------------------------------------------------CTGGTCGTGCCCGTGTTCCACGTCGGG---TTCATCAACAAAATCAAAAAGCTGCTGGAGTGTGTTTGTCACAACTGTGGCAAAATCCTAGCAGATGAGAGCGATCAACATTTCAAGGATGCGTTGCGCTTGCGTGACCCCAAAAAGCGCTTCGAGGCCATTTGGAAAGTCTGCAAG---CCGAAGCTAGCATGTGCTGTAGAT---------TCCCCTGCCGATGTTCAACATGGCGGCTGCGGAAACCGCCAGCCCGAG---ATTCGCAAGGACGGACTGAAGCTCATGGGCACTTGGAAG---CCC---CAGAAA---AACGAGGAGGAGGAGCCCGAGAAGAGA---CCCATCAAGCCCCAGGATGCGATGAACATCTTCAAGCTCATCAGCGACGATGCGCTCTCCGTCCTCGGATTGAACGTCGAATTTGCCCGCCCGGAGTGGATGATTCTCAGCGTTCTTCCAGTTCCCCCCCCGCCGGTGCGGCCCAGTATTTCGGTAGACGGAACCGGTCAGGGCATGCGTGGCGAGGATGACTTGACCTACAAGCTTGCGGACATCGTTCGTTCCAACGGTACGATCAAGCAATCCATGGAGAATGGAGCTGCTCAGCACGTTTTGAACGATTACGAGGACCTTTTGCAATGGCACGTGGCAAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTGTCGAGGCCGGCAAGTTCTTTTTCTGTCCTCTCTGCCGTCAAGCAGGGCACCATCACCAACGGTCTCAAGTACTCTCTCGCGACGGGCAACTGGGGGGACCAAAAAAAGGCAGCATCCGCCAAGGCAGGTGTCTCTCAGGTGCTCAACCGGTACACTTACTCGTCTACGCTTTCCCACTTGCGGCGCACAAACACTCCCATTGGCCGTGATGGCAAGCTTGCAAAGCCTCGTCAGCTGCACAACACACACTGGGGCTTGGTCTGCCCGGCAGAAACGCCAGAAGGCCAGGCTTGCGGTCTGGTCAAAAACCTTTCACTCATGTGCAACGTGACGGTTGGCAGCGATGTC---------ACGCCCATTACAGATTTCATGACTCAGCGAAACATGGAGCTGTTGGAAGAATACGACCCCAACGTCTCCCCACACGCCACCAAGATCTTCGTCAACGGTGTCTGGGTTGGTGTGCACCGCGATGCGACACAGCTCGTGTCTCTGGTCAAAGGCCTTCGCAGAGAT---GGTACCGTCTCGCCAGAAATGAGTCTGATCCGTGACGTTCGTGACCGCGAGTTCAAGATCTTCACAGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTCTCATGAGAAGCGGTGTTGTCGAGTACATGGATGCCGAGGAAGAAGAGACGGCCATGATTGTCATGACTCCTGATGACCTTAGGGCACACCTCCGAAGC---CGCCAAGGC-TGAAC------GAAGACCAGCAAAAAGACCCGCATGAACGTGTCGTGCCCTCGCCGAGCCCGTCGATCAAGTTCTTCACTCATTG-GAGGTCCATCCCAGCATGATCCTAGGCATTTGCGCAAGCATCATTCCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Guignardia_citricarpa_CBS_102374 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATGATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTAGCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTCGAGTCTTGTAATTGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGATCCGCATGCCCTTCACTG-GGTGTGCCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGT----------------------------------------------------------------------------------------------------------------AGGGATTGCCTCAGTAACGGCGAGTGAAGCGGC-ATAGCTCAAATTTGAAAGCTGA-CGTCCGCGTTGTAATTTGTAGAGGATGTTTCGGCG-AGG-GCTCC-TGCCTAAGTTCCCTGGAATGGGACGTCACAGAGGGTGAGAATCCCGTATGTGGCG--GGC--GGC--CT-TAGCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGTTCGCAGTTGCTCAGCCC-GCC---T-CT-------T--GGT-GG--GTG-TACTCTTCTGC-GG----T-CGGGCCAGCATCAGTTCGGGC-GGTCGG-ATAAAGGTGT-CGGGAATGTAGCA---CCCTTAATGCGGCCAGCCTGGACTGA-GGA-TCTCG-CT----T-C--G--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCATGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGC---TTCATCAACAAGATCAAGAAGCTCCTGGAGTGCGTTTGTCACAACTGTGGCAAAATCCTTGCAGATGAGAGCGATCAACATTTCAAGGATGCGTTGCGCTTGCGTGACCCCAAGAAGCGTTTCGAGGCCATCTGGAAAGTCTGCAAG---CCGAAGCTCTCATGTCAAGTAGAT---------TCTCCGAGCGAAGTTCAGCATGGCGGCTGCGGAAACCGCCAACCCGAG---ATTCGCAAGGACGGATTGAAGCTCATGGGCACATGGAAG---CCT---CAGAAG---AATGAGGAGGAGGAACCGGAGAAGAGA---CCCATCAAGCCCCAGGATGCCATGAACATCTTCAAGCTCATCAGCGACGAGGCGCTTTCTGTTCTGGGATTGAACGTCGAATTCGCCCGCCCAGAATGGATGATCCTCAGTGTCCTTCCGGTCCCTCCGCCCCCGGTGCGGCCCAGTATCTCGGTAGACGGAACTGGCCAAGGCATGCGTGGCGAGGACGACTTGACCTACAAGCTCGCGGATATCGTTCGTTCCAATGGCCAGATCAAATCATCTATTGAGAATGGCGCCGCACAACATGTGCTGAACGATTACGAAGACCTTTTGCAATGGCACGTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGTTACCAGGAAATCATCAAGGAAACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGGGCGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATTGAGCCCTCGACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGACCACCGGCAAGACCCTCCTCGAGGCCATTGACAACATCGACGCCCCCGTCCGTCCCTCGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGCCGTGTCGAGACCGGTACCATCAAGGCCGGCATGGTCGTTACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGTTGACCGAGGGTGTC---CCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCGAAGAACGACCCCCCCAAGGGCTGCGACTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTTGGTGCTGGTTACGCGCCCGTCCTCGACTGCCACACCGCCCACATTGCCTGCAAGTTCTCTGAGCTTCTTGAGAAGATCGACCGCCGTACCGGCAAGTCCATTGAGAACAACCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGATTCCCTCCAAGCCCATGTGTGTTGAGGC------------------- Guignardia_gaultheriae_CBS_447_70 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCAAATTTGAAAGCTGA-CGTCCGCGTTGTAATTTGTAGAGGATGCTTCGGCG-AGG-ACTCC-TGCCTAAGTCCCCTGGAACGGGGCGTCACAGAGGGTGAGAATCCCGTATGTGGCG--GGC--GGT--CC-AAGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCTCGCAGTTGCTCAGCCG-GCC---T-CT-------T--GGC-CG--GTG-TACTCTTCTGC-GA----T-CGGGCCAGCATCAGTTCGGGC-GGCTGG-ATAAAGGTGT-CGGGAATGTAGCA---CCCTTAATGCGGCCAGCCTGGACTGA-GGA-TCTCG-CT----T-C--G--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCATGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-AATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGATGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACATCGCCGCCA-GGGTAGAT-A-CG-ATGCCCTGGCGAGTAGGCAGGCGTGGAGGCCC--------------------------------------------------------------------------------ATTGAGCTGGTCGTCCCAGTGTTTCACGTCGGT---TTCATCAATAAAATCAAAAAGCTGCTGGAGTGCGTCTGTCACAACTGTGGCAAGATCCTTGCAGATGAGAGCGATCAACATTTCAAGGATGCGTTGCGCTTGCGTGACCCCAAGAAGCGCTTCGAGGCCATTTGGAAAGTCTGCAAG---CCCAAGCTCGCGTGTGCAGTAGAT---------TCACCAAGCGAAGTTCAGCATGGCGGCTGCGGAAACCGCCAGCCCGAG---ATTCGCAAGGACGGTCTGAAGCTGATGGGCACCTGGAAG---CCC---CAGAAG---AACGAGGAGGAAGAACCCGAGAAAAGA---CCCATCAAGCCCCAGGATGCGATGAACATCTTCAAGCTCGTCAGCGACGATGCGCTGTCCGTCTTGGGATTGAACGTCGAATTCGCCCGTCCGGAGTGGATGATTCTCAGCGTTCTCCCAGTCCCTCCCCCGCCGGTGCGCCCCAGTATCTCAGTAGACGGAACTGGCCAGGGCATGCGTGGCGAGGACGACTTGACCTACAAGCTCGCCGACATTGTTCGTTCGAACGGCACGATTAAGCAATCCATGGAAAATGGAGCCGCTCAGCACGTGCTCAACGACTACGAGGACCTTTTGCAATGGCATGTAGCAACCTACATGACA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTTCCCATCTGCGGCGCACCAACACTCCCATTGGCCGTGATGGTAAACTTGCAAAGCCACGCCAGCTGCACAACACGCACTGGGGCTTGGTCTGCCCGGCAGAAACGCCTGAAGGCCAGGCTTGTGGATTGGTCAAGAATCTTTCGCTCATGTGCAACGTCACCGTTGGCAGCGACGTC---------ACGCCCATCACAGACTTTATGACGCAGCGAAACATGGAGCTGTTGGAGGAATAC-ACCCCAACGTCTCCCCGCACGCCACCAAGATCTTCGTCAATGGTGTCTGGGTGGGTGTGCATCGTGATGCCACACAGCTCGTGTCTCTTGTCAAGGGGCTTCGTAGAGAT---GGTACAGTCTCGCCAGAGATGAGTCTGATCCGAGATGTCCGTGACCGCGAGTTCAAAATCTTCACCGACGCTGGAAGAGTGACTCGGCCGCTCTTCATCATTGACGATGACCCAAACAGCCCCAACAAGGGCAACCTCGTCCTCAGCCGAGAGCACATCAACAAGCTCGAGGATGATGGTATGAATGACGAAGAG------CGAGAGCAG------GCCAGATATGGCTGGGCT---GGTTTGATGAGGAGCGGTGTTGTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Halomassarina_thalassiae_JK_5262D ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGATTGCCCTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCGTT-AGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGTG-TGG-GTGGC-TGTCTAAGTTCCTTGGAACAGGTCATCATGGAGGGTGAGAATCCCGTATGTCGCCTGCCC--GGC--CT-ACACTATGTAAAGCCCCCTCGAAGAGTCGCGTTGTTTGGGAATGCAGCGCTAAGTGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-GAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACATGCCTGCGGTTGCTCAGCTA-GGCATCT-TT-------A--GCC-TG--GTG-CACTCTTCCGT-GG----G-CAGGCCAGCATCAGTTTGGGC-GGTTGG-AGAATGGCCT-CTGTCATGTATCT---TCCTTAATGCAGCCAGCCCAGACTGA-GGT-CTGCG-CAGTCTT-C--T--GCTAGGATGCTGGCATAATGGTGGCAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCCATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGCAATG-AAAGTAAATGGAGGTGGGATCCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-GGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAACAA-GATCCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAAAT-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCT-CTGTTGCTTTAGTGAACGGGGACACTTGAATGGATTGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTT-AA-GCGTGTTACCT--ATACCCCACCGCCA-CGGCAGAC-A-TT-ATGCCGCGGCGAGTAGGCAGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCCATCAACAAGATGGACACTACCAAGTGGAGCGAGGAGCGTTACCACGAAATCGTCAAGGAAACCTCCAACTTCATCAAGAAGGTCGGCTATAACCCCAAGCACGTCCCCTTCGTTCCCATCTCCGGCTTCAACGGCGACAACATGATTGAGCCGTCCAGCAACTGCCCGTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGGTCACCGGCAAGACCCTCCTTGAGGCGATCGACAACATCGATCCCCCGACTCGTCCCTCCGACAAGCCCCTTCATCTGCCACTCCCGGATGTGTACAAGATCGGCGGTATTGGCACGGTCCCTGTCGGCCGTGTCGAGACCGGTACCATTAAGGCCGGTATGGTCGTCACCTTCGATCCGGCTGGTGTGACCACGGAAGTCAAGTCCGTC-AGATGCATCACGAGCAGCTGAGCGAGGGTGTC---CCCGGTGATAATGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATTCGCCGTGGCAACGTCGCTGGTGACTCCAAGAATGACCCGCCCAAGGGCGCTGAGTCCTTCAACGCCCAAGTCATCGTCCTTAACCACCCCGGCCAGGTCGGAGCTGGTTACGCACCCGTCCTCGACTGCCACACTGCCCACATTGCGTGCAAGTTCTCCGAGCTTCTCGAGAAGATTGATCGCCGAACTGGCAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCAATCGTCAAGATGATTCCGTCCAAGCCC--------------------------------- Helicomyces_roseus_CBS_283_51 -AACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTGCTTGGTGATTCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCCCTTATGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAACTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAGTAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGTCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGATCCTCATGCCCTTCACTG-GGCGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATGGAATAGGACGT-GCGGTCTTA-TTTTGTTGGTTTCTAAGACCGCCGTAATGATTAATAGGGATAGTCGGGGGTATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTACCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACGATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT--------------------TCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTAG-AGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGCT-TAC-GTTTC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTTTGTGGCC--GA---GAC--TT-CCGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTATATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGCCCGCGGATGCTCAACCG-GTC---C-TT-------C--GGC-CG--GTG-CACTCTTCCGC-GG----T-CAGGCCAGCATCAGTTCGAGC-GGTCGG-ATAAAGGCCT-TGGGAATGTGGCT---CTCTTAATACGGCCCGCCTGGACTGA-GGC-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTCGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCGTGCGCGAAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTGAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACACTTGAATGTACCGTCACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTT-AA-GCGTGTTACCC--ATACCTCGCCGCCA-TAGTAGAT-A-CG-ATGCTTTGGCGAGTAGGCAGGCGTGGAGGTCAGTGACGAAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGACAGCGC-CAATGCGACAAAGATCTTTGTCAACGGTGTTTGGGTAGGTGTGCATCGCGACCCAGGACAATTGGCTCCTCACATGCAGTCACTGCGAGGC------TCTATGCTGGATCCTGAAATTAGTATGATCCGTGACATTCGTGATCGCGAATTTAAGATCTTCACGGATGCCGGGCGCGTCTGCAGGCCACTCTTCAAGATCGACAATAACCCAAGCAGTCCCAACCGTGGCAACCTTGTACTGAAGCGTGAGCATATTGAGAAACTCATCCAAGAGAAATACTCTAAGAAGGAA------CGTGAAGAG------TACGGTATCGGTTGGACG---GGCCTGCTAAAGGAGGGCGTTGTCGAGTATCTGGACGCTGAGGAAGAAGAAGCTGCGATGATTGTCATGACACCCGATGATCTCACAGAGCATCACCTTATC---CGCTCAGGCCAAACG------ATCTACCAGCATATTGATCCACACTCGCGTGTCAAGCTCAAGCCGAATCCCGCAGTCAAGATGTATACGCATTGCGAAATTCACCCTGCTATGCTACTGGGTATCTGTGCCAGCATTATTCCATTCCCGGATCATAATCAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTTCTCATCATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTAGGCGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGATACTACCAAGTGGTCCGAGGAACGTTTCAACGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGAGCCTTCCAGCAACTGCCCGTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTACAGCGGCAAGACCCTGCTCGAAGCCATCGATGCCATCGAGGCTCCCCAGCGTCCTTCCGATAAGCCTCTCCGCCTTCCTCTCCAGGATGTGTACAAGATTGGTGGTATCGGAACGGTCCCTGTTGGTCGTGTCGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCTCCTGCCAATGTCACCACCGAAGTCAAGTCCGTCGAGATGCACCACGAACAGCTTGTTGAGGGCCTT---CCCGGCGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAAATTCGCCGTGGTAACGTCGCTGGTGACTCCAAGAACGACCCGCCACTTGGTGCCGACTCCTTCAACGCTCAGGTCATCGTCCTGAACCACCCTGGTCAGGTTGGTGCCGGTTATGCGCCAGTGCTCGACTGCCACACTGCCCATATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGATCGCCGTACTGGCAAGTCGATTGAAAACAACCCCAAGTTCATCAAGTCTGGTGATGCCGCCATCGTCAAGATGATTCCCTCCAAGCCTATGTGCGTCGAGGCTTCACT------------- Hortaea_acidophila_CBS_113389 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGGATTGCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGGAGAGGATGCTTCTGGG-CAG-CGGCC-GGTCTAAGTTTCTTGGAACAGAACGTCATAGAGGGTGAGAATCCCGTATGCGACC--GG---CTG--GC-ACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCCCCCAGACTTGTCGGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GCC-TACTC-GCCGC-CG----A-CAGGCCAGCATCGTCCGGGAC-CGCCGG-AGAAAGGCGA-CGGGAATGTGGCT---CTTC-AATACGGCGCGCCCCGGGCGA-GGT-CCGCG-CT----T-C--G--GTTAGGATGCTGGCGTAATGGCGGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCGACCATCTGTGCGAGTG-TTTGGGCGTCAAA-CCCCGGCGCGTAATG-AAAGTGAACGGAGGCGGGAACCGGTGCACCGT-CGA-CCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCAT-AGCTGGT-CGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGCCGAAGC-CAGAGGAAA--CTCT-GGTGGAGGGTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTCACTTTGTTGGACGTGGACATTCGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAATTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAATTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCTCGCCGCCG-GCGCAGGA-T-CG-ACGCGTCGGCGAGTAGGCAGGCGTGGGGGCCCGTGACGAAGC----------------------------------------------------------------------------------------------------------TTCATCTCCAAAATCAAGAAGGTACTTGAGGCCGTGTGCCACAACTGCGGAAAGCTTTTGGATGATGAACGCAACCCTACCTTCGCTCAAGCTACCCGCCTGCGCGATCCCAAGCGTCGCTTCGAAGCCGTCCACAAGCTCTGCAGG---ATCAAGAAGATCTGTGAGGCCGAC---------GAGCCTGCTGATAAAGGACATGGTGGCTGTGGTAACCTGCAGCCCGAG---ATCCGCAGGGAGCAGCTTCGACTTTGGGGCTCGTGGAAG---GTG---GCGAAG---AGTGAAGAGGACATGGTTGAGAAGAAG---CTAATCACCCCCCAAGACGCGCTGAACGTCTTCCGTAACATCCGCGACGAGGATCTTCTCAGACTTGGATTGAACGCCGACTACGCCCGCCCCGAGTGGATGGTGCTGACAGTCTTGCCGGTTCCGCCTCCAGCTGTCAGACCAAGTGTGTCGGTGGACGGAACGTCCCAAGGCATGCGATCGGAAGACGACTTGACCTACAAGCTCTCCGACATCATTCGCGCCAACTCCAACGTCCGACGCTGCGAGCAAGAAGGCTCCCCGCAACACCGT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hortaea_werneckii_CBS_100496 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGGCCTTCACTG-GCCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGATCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGG-ATGTTACTATTATGACTCCATCGGCACCTTACGAGAAATCA-AAGTTTTTG------------------------------------------------------------------------------------------------------------------------TTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGG-CAG-CGGCC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACC--GG---CTT--GC-ACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAGGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCTCACGCAACCAGACTTGTCGGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TATTC-GCCGC-CG----G-CAGGCCAGCATCACTTGGGAG-CGCCGG-ATAAAGGCGT-GCGGAATGTAGCC---CCTC-AATACGGCGCCTCCCGAGTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGCTTGAGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGGAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTCGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATGCCCTGAA--T-AGGGTGAAGC-CAGAGGAAA-CTTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTCAAAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTTTGAGGTAAACCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCCTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGTACGCTTATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTACTACCC--ATACCTCGCCGCCA-GGGTAGAA-A-CG-ATGCCCTGG------------------------------------------------------------------------------------------------------------------CCAGCCAGTGTTCCATGTCGGC---TTTATCGCCAAGATCAAAAAGATCCTGGAATCGGTTTGCCACAACTGTGGCAAGCTCAAAGCAGATGAGCGCAACGTCCAGTTCGCGCAAGCCATTCGCCTTCGCGATCCGAAGCGCCGCTTCGAACAGGTGCATAAGATCTGCAAG---CCCATCATGACCTGCGAGACCGAC---------GAGCCTTCTTCCAAAGGCCATGGAGGGTGCGGAAATGTTCAACCCGCA---ATTCGCAAAGAACAGTTGAGATTGAACGGATCATGGAAA---ATT---GCCAAA---TCTGATGATGAAGAGAAGGAAACCAGG---CAAATTACGCCGCAGATGGCGCTGAATGTCTTCCGGAACATTTCCGACATCGACATGGCCAAACTCGGCCTGAACGCCGATTATGCAAGGCCGGAATGGATGGTTTTGACTGTGCTGGGAGTTCCACCGCCCGCGGTGAGGCCCAGTATCTCCGTGGACGGCACAAGCCAGGGCATGCGGTCCGAAGATGACTTGACCTACAAGCTCTCGGACATCATCCGCGCCAACTCAAACGTGCGGCGTTGCGAGCAAGAAGGCAGCCCACAGCACGTTCAGGACGAATTTGTGCAGCTGCTCCAGTTTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCATCTATTCAAGGACGTGCTAGGATACCTGCACATATGCGTTGAGAACGGCAGGGAGTTCATCGTCAACTTGGCTGTAAAATCGGGCATCATGACCAATGGCCTTCAATACTGTTTGGCGACTGGTAACTGGGGCGATCAGAAAAAAGCTGCATCTTCGAAGGCTGGTGTGTCGCAAGTGCTGAACAGGTTCACATACGCTTCGACTCTCTCTCACTTGCGGCGAACGAATACTCCAATTGGACGAGACGGCAAGATCGCGAAGCCTCGCCAGCTGCACAACACGCACTGGGGTCTTGTTTGTCCAGCCGAGACTCCTGAGGGACAAGCATGTGGGTTGGTCAAGAACTTGGCGCTGATGTGCTACGTCTCCGTCGGTACGCCGGGC---------ACGCCGCTTATCGAGTACATGAGGCATCGAGGCATGGAATTGCTTGAGGAGTGGGATGCAGTGCTCAATCCGAATGCCACCAAGGTGTTCCTGAATGGAACATGGGTGGGTGTGCACAACAATGGCGGTCAGCTAACGGATTCGTTGCGCACGCTCAGGCGTAAG---AACACCATTGGTTTTGAGGTGACGATCATCCGCGACGTCCGTGAGCGTGAGATCAAGGTCTTTACTGATGCTGGTCGTGTCTGCCGACCCCTCTTCGTTGTCGACAATGATCCCAGTTCGGAGAACCGTGGCAATTTGGTCCTCAAGCGGGAGCACATCCAAGCTCTCGAAAATGACCGCGTTAGTGAGGAAGAG------AAGCAGGAT------CGTACCTTTGGCTGGCAT---GGTCTTGTCCGCAGCGGCGTCGTCGAGTATCTCGATGCCGAAGAAGAAGAAACAGCTATGATTATCATGGCCCCCGATGAACTCGAGGAGCATCGCCAGATC---CGTGCTGGCAATCCC---------TGGATAGAAGATGACCCGCACAGACGTATCAAGGCCAAACCCAATCCGATGGTGCGAACATGGACTCATTGTGAGATTCATCCTGCTATGATTCTCGGTATTTGTGCTTCCATGATTCCCT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACTGCGCTGTCCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAATAAGATGGACACCACCAAGTGGTCCGAGGAGCGTTACGGCGAGATCATCAAGGAGACCTCTGCCTTCATCAAGAAGGTCGGTTTCAACCCGAAGCACGTCCCGTTCGTCCCGATCTCCGGTTTCAACGGTGACAACATGATCGAGGCCTCCACCAACTGCCCGTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGGCC---AAGGTCACCGGCAAGACCCTCCTTGAGGCCATTGACAACATCGACCCGCCGAGCCGTCCTTCCGACAAGCCGCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGGACAGTCCCAGTCGGCCGTGTCGAGACCGGTACCATCAAGGCCGGCATGGTCGTTACCTTCGCTCCGGCTGGTGTCACCACTGAAGTGAAGTCCGTTGAGATGCACCACGAGCAGCTCGCTGAGGGTCTG---CCGGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACAGCAAGGCTGACCCGCCGAAGGGCTGCGACAGCTTCAACGCCCAGGTCATCGTCCTGAACCACCCTGGCCAGGTCGGTGCTGGTTACGCTCCAGTCCTGGACTGCCACACTGCCCACATTGCCTGCAAGTTCGGCGAGCTCCTCGAGAAGATCGACCGTCGCTCTGGCAAGTCCATTGAAGCCTCGCCTAAGTACATCAAGTCTGGTGACGCTGCCATCGTCAAGATGATTCCGTCCAAGCCGATGTGCGTTGAGCCATTCACTGAGTACCCGCCG Hortaea_werneckii_CBS_708_76 ---------------------------------------------------------T-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGGCCTTCACTG-GCCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGATCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGTCTAGGGATCGGTGG-ATTTTACT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGG-CAG-CGGCC-GGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACC--GG---CTT--GC-ACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAGGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCTCACGCAACCAGACTTGTCGGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TATTC-GCCGC-CG----G-CAGGCCAGCATCACTTGGGAG-CGCCGG-ATAAAGGCGT-GCGGAATGTAGCC---CCTC-AATACGGCGCCTCCCGAGTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGCTTGAGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGGAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGA--ATAGGGGTGAAGC-CAGAGGAAAA-CTCTTGGTGGAGGCTCGCAGCGGTTCTGACGTTCCAAATCCGATCGTCAAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCC-ATCTAGTAGCTGGTTTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGTACGCTTATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTACTACCC--ATACCTCGCCGCCA-GGGTAGAA-A-CG-ATGCCCTGGCGAGTAGGCAGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGGTTGAGTTCGCCCAGCTGGTCAAGGACGTGAGAGGATACCTGCACAGATGCGTCGAGAACGGCAGGGAATTCAATGTCAATCTGGCTGTAAAGTCGGGCATCATGACCAATGGCCTTCGATACTGTTTGGCGACTGGTAACTGGGGTGATCAGAAGAAAGCTGCGTCAGCGAAGGCTGGTGTGTCGCAAGTGCTGAACAGGTACACATACGCTTCGACTCTCTCTCATTTGCGGCGAACGAATACGCCAATTGGACGAGACGGCAAGATCGCGAAGCCTCGCCAGCTGCACAACACGCACTGGGGTCTTGTTTGTCCAGCCGAGACTCCTGAGGGACAAGCATGCGGGTTGGTCAAGAACTTGGCACTGATGTGCTACGTCTCCGTCGGTACGCCGGGC---------ACGCCGCTTATCGAGTACATGAGGCATCGAGGCATGGAGTTGCTTGAGGAGTGGGATGCAGTGCTCAATCCGAATGCCACGAAGGTGTTCCTGAATGGAACATGGGTGGGTGTGCACAACAATGGCGGTCAGCTGACGGATTCGTTGCGCACGCTCAGGCGTAAG---AATACCATCGGTTTTGAGGTGACAATCATCCGCGACGTTCGTGAGCGTGAGATCAAGGTCTTCACTGATGCTGGTCGTGTCTGCCGACCCCTCTTCGTTGTCGACAACGACCCCAGTTCCGAGAACCGTGGCAATTTGGTCCTCAAGCGGGAGCACATCCAAGCTCTCGAAAATGACCGGGTCAGTGAGGAAGAG------AAGCAAGAT------CGTACCTTTGGCTGGCAT---GGTCTTGTCCGCAGCGGCGTTGTCGAATATCTCGATGCTGAAGAAGAAGAAACAGCTATGATTATCATGGCCCCCGATGAACTCGAGGAGCATCGCCAGATC---CGTGCCGGTAATCCC---------TGGATAGAAGATGACCCGCACAGACGTATCAAGGCCAAACCCAATCCGATGGTGCGAACATGGACTCACTGTGAGATTCATCCTGCTATGATTCTCGGCATT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACTGCGCTGTCCTCATCATTGCTGCTGGTACTGGTGAGTT-GAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGTTACGGCGAGATCATCAAGGAGACCTCTGCCTTCATCAAGAAGGTCGGTTTCAACCCGAAGCACGTTCCGTTCGTCCCGATCTCCGGTTTCAACGGTGACAACATGATCGAGGCCTCCACCAACTGCCCGTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGGCC---AAGGTCACCGGCAAGACCCTCCTTGAGGCCATTGACAACATCGACCCGCCGAGCCGTCCTTCCGACAAGCCGCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGGAC{AT}GTCCCAGTCGGCCGTGTCGAGACCGGTACCATCAAGGCCGGCATGGTCGTTACCTTCGCTCCGGCTGGTGTCACCACTGAAGTGAAGTCCGTTGAGATGCACCACGAGCAGCTCCCTGAGGGTCTG---CCAGGTGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTCAAGGAGATCCGTCGTGGTAACGTCGCTGGTGACAGCAAGTCTGACCCGCCGAAGGGCTGCGACAGCTTCAACGCCCAGGTCATCGTCCTGAAC---CCTGGCCAGGTCGGTGCTGGTTACGCTCCAGTCCTGGACTGCCACACTGCCCACATTGCCTGCAAGTTCGGCGAGCTCCTCGAGAAGATCGACCGTCGCTCTGGCAAGTCCATTGAAGCCTCGCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGATTCCGTCCAAACCGATGTGCGTTGAGGCATTCACTGAGTACCC---- Hysterium_angustatum_CBS_123334 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATTGTAGGGTATTGGCCTACAATGGTTTCAACGGGTAACGGGGAGTTAGGGCTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGAGAGCCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTT--------------------------------------------------------------------------------------CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGTG-TTG-GCCCC-GGCCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTACGCGGCC--GGT--GTC--CC-TCGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGCGGTCGCTCATCCA-GGC---T-CC-------T--GCC-TG--GTG-CACTCTTCCGT-GG----T-CAGGCCAGCATCGGTTCGGGC-GGTCGG-ACAAAGACGG-TGGGAATGTGGCT---CCTCTAATGCGGCCAGTCCGGACCGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTGTGCGAGTG-TTTGGGTGTCAAG-CCCGGACGCGTAATG-AAAGTGAACGGAGGCGGGAACCGGTGCACCGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCGCCGCCG-GGGCAAGA-G-TT-ACGCCCCGGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGCCTTGGGGGTGACCCCGGGTAGAACGGCCTCTAGTG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAGATGTTTACAAGTACCTCCAAAAGTGTGTGGAAAATGGTCAAGACTTTAACGTTCAGATGGCTGTCAAAGCCAGTCTTATTACGAACGGTTTGAAGTATTCTTTAGCTACTGGTAATTGGGGCGACCAGAAGAAAGCAGCGTCTTCCAAGGCAGGTGTATCACAGGTGCTTAATCGTTACACCTATGCCTCCACATTATCACATCTTCGGCGGACAAATACTCCCGTCGGTCGTGATGGTAAACTTGCGAAACCTCGTCAGTTGCACAATACTCATTGGGGTCTCGTGTGTCCTGCAGAGACTCCAGAAGGGCAGGCTTGCGGTCTGGTCAAAAACCTTTCATTGATGTGCTACGTGAGCGTCGGCAGCGAAAGC---------ACTCCAATTACCGACTTCATGAGCCAGAGGAATATGGAGCTTCTGGAAGAATACGACCCGGTGGTAAACCCCACGGCCACAAAGGTGTTTGTGAATGGCGTCTGGGTAGGAGTCCACTCTCAACCAGCCCAGCTGGTGTCCGTCGTCCAGGAGCTTCGGAGAAAT---GGCACCCTTTCGTACGAAATGAGTCTCATTCGA----------------------------------------------------------------TTATCGAGCCCGACTATAGGAAACCCAATCGTGGA-GCCTTGTTCTAAAC-AGAGCCATATACAGACACTTATGGATG-T-AAATGA-CGACGAAGAT------GCCGCTGCC------TCCAAGTTTGGCTGGAAG---GGCTTGATCCACAGTGGCGTTGTCGAGTATCTTGATGCTGAAGAAGAAGAA-CCGCGATGATTATCATGACTCCAGAGGACCTTGAGGATCACCACCGAGTC---GCCCAAGGAACTCCA------TACGAAGTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATCATCAAGGAGACCTCCAACTTCATTAAGAAGGTCGGATACAACCCCAAGACTGTTCCTTTCGTCCCCATTTCTGGTTTCAACGGAGACAACATGATCGATGCCTCCCCCAACTGCCCGTGGTACAAGGGCTGGGAGAAGGAGACT---------------AAGACC---AAGTCCACCGGTAAGACTCTCCTTGAGGCCATCGACGCCATCGACCCTCCTTCTCGTCCATCCGACAAGCCTCTCCGTCTTCCTCTTCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCTGTCGGTCGTGTTGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCTCCTGCTGGTGTCACCACCGAAGTCAAGTCCGTTGAAATGCACCACGAACAGCTCACCGAGGGTCTT---CCCGGCGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTCAAGGAAATCCGTCGTGGTAACGTGGCTGGTGACTCCAAGAACGATCCCCCCAAAGGCGCCGAATCCTTCAACGCCCAGGTCATCGTTCTCAACCACCCTGGTCAAGTTGGTGCTGGTTATGCTCCAGTTTTGGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATCGATCGCCGAACTGGC------------------------------------------------------------------------------------------------------------ Hysterium_barrianum_ANM_1442 -----------GGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCTTCACGGGCTTCTTGGTGATTCATAATAACTCAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATTGTAGGGTATTGGCCTACAATGGTATTAACGGGTAACGGGGAGTTAGGGCTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACGGGGCTCTTTTGGGTCTCGTAATTGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCCGGAGAACCCCATGTCCTTCGCTG-GACGTGGTGGGGAACCGGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTATTTTGACTCGCTCGGCAC-------------------------------------------------------------------------------------------------------TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGG-TGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGCG-TTA-GTCCC-GGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCC---GGT-GGC--TG-TCGCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGCAACCAGACCTGCCCGCGGTCGCTCATCCA-GGC---T-CC-------T--GCC-TG--GTG-CACTCTTCCGC-GG----T-CAGGCCAGCATCAGTTCGGGC-GGTCGG-ACAAAGGCGG-CGGGAATGTGGCT---CCCCTAACACGGCCAGCCCGGACTGA-GGT-CCGCG-CT----C-C--G--GCTAGGATGCTGGCGTAATGGTTGTGAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTGCAACATCTGTGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGTAATG-AAAGTGAACGGAGGCGGGAACCGGTGCACCGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAC-AGCTGTT-GCGA-CCCG-AAAGATGGTGATCTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTGCTTAGTTGAACGTGGACACT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Hysterium_barrianum_ANM_1495 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCTTCACGGGCTTCTTGGTGATTCATAATAACTCAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATTGTAGGGTATTGGCCTACAATGGTATTAACGGGTAACGGGGAGTTAGGGCTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACGGGGCTCTTTTGGGTCTCGTAATTGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCCGGAGAACCCCATGTCCTTCGCTG-GACGTGGTGGGGAACCGGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTATTTTGACTCGCTCTGCACCTTACGAGAAATCA-AAG----------------------------------------------------------------------------------AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGG-TGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGCG-TTA-GTCCC-GGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCC---GGT-GGC--TG-TCGCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGCAACCAGACCTGCCCGCGGTCGCTCATCCA-GGC---T-CC-------T--GCC-TG--GTG-CACTCTTCCGC-GG----T-CAGGCCAGCATCAGTTCGGGC-GGTCGG-ACAAAGGCGG-CGGGAATGTGGCT---CCCCTAACACGGCCAGCCCGGACTGA-GGT-CCGCG-CT----C-C--G--GCTAGGATGCTGGCGTAATGGTTGTGAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTGCAACATCTGTGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGTAATG-AAAGTGAATGGAGGCGGGAACCGGTGCACCGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAC-AGCTGTT-GCGA-CCCG-AAAGATGGTGATCTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hysterobrevium_mori_CBS_123336 ---CTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATTGTAGGGTATTGGCCTACAATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGAGAGCCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTG---------------------------------------------------------------------------------TAACATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTCA-GGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGCG-TTG-GACCC-GACCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCC--GGT--GTC--CC-TCGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGCGGTCGCTCATCCA-GGC---T-TC-------T--GCC-TG--GTG-CACTCTTCCGC-GG----T-CAGGCCAGCATCGGTTCGGGC-GGTCGG-ACAAAGGCGG-CGGGAATGTGGCT---CCCTTAATGCGGCCAGTCCGGACCGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTGTGCGAGTG-TTTGGGTGTCAAG-CCCGGACGCGTAATG-AAAGTGAACGGAGGCGGGAACCGGTGCACCGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCGCCGCCG-GGGCAAAA-G-TT-ACGCCCCGGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGCCTTGGGGGTGACCCCGGGTAGAACGGCCTCTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hysterobrevium_mori_GKM_1013 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGCG-TGG-GCCCC-GGTCCAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTACGTGGCC--GGC--GGT--GC-TCGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGACCGTGGTCGCTCATCCG-GGC---T-CC-------T--GCC-CG--GTG-CACTCTTCTGC-GG----T-CAGGCCAGCATCAGTTCCGGC-GGTTGG-ATAAAGGCGG-CGGGAATGTGGCT---CCCTCCATGCGGCCAGCCGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTCGCAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGGAATG-AAAGTGAACGGAGGCGGGAACCGGTGCACCGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATTCTCATCATCGCTGCCGGTACTGGTGAGTTCGAAGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTCCTTGCCTACACCCTTGGTGTCAAGCAACTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGAGCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGCCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACTGGTAAGACTCTCCTTGAGGCTATCGACGCTATCGACGCTCCTGTCCGTCCTTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTCCCTGTCGGTCGTGTTGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAACAGCTCGCCGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAAATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCACCAAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTTAACCACCCCGGTCAGGTCGGTGCTGGTTACGCTCCAGTCTTGGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGATCGCCGAACCGGCAAGTCCATTGAGAACAACCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATGATTCCCTCCAAGCCCATGTGTGTTGAGGCTTTCACTCAGTACCCACCT Hysterobrevium_mori_SMH_5273 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTCA-GGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGCG-TTG-GACCC-GACCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCC--GGT--GTC--CC-TCGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGTCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGCGGTCGCTCATCCA-GGC---T-TC-------T--GCC-TG--GTG-CACTCTTCCGC-GG----T-CAGGCCAGCATCGGTTCGGGC-GGTCGG-ACAAAGGCGG-CGGGAATGTGGCT---CCCTTAATGCGGCCAGTCCGGACCGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTGTGCGAGTG-TTTGGGTGTCAAG-CCCGGACGCGTAATG-AAAGTGAACGGAGGCGGGAACCGGTGCACCGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGAGAGCACGCCCTTCTCGCCTACACTCTCGGTGTCAGGCAAATCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGAGCGTTACCATGAAATCGTCAAGGAGACATCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACCGTTCCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGAGCCATCTTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACCGGTAAGACTCTCCTCGAGGCCATCGACGCTATCGACCCCCCATCCCGTCCTTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGACGTGTACAAGATTGGTGGTATTGGCACGGTCCCTGTCGGCCGTGTTGAGACCGGTGTCATCAAGGCTGGTATGGTCGTGACCTTCGCCCCCGCTGGCGTCACCACTGAAGTCAAGTCCGTTGAAATGCACCACGAACAGCTCACTGAGGGTCTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAAATTCGCCGAGGCAACGTCGCTGGTGACTCCAAGAACGACCCACCCAAGGGTGCCGAATCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAAGTCGGTGCCGGTTACGCACCAGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hysterobrevium_smilacis_CBS_114601 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATTGTAGGGTATTGGCCTACAATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAGACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGAGAGCCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGG--------------------------------------------------------------------CCCGCTGGACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTCA-GGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGCG-TTG-GACCC-GACCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCC--GGT--GTC--CC-TCGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGCGGTCGCTCATCCA-GGC---T-TC-------T--GCC-TG--GTG-CACTCTTCCGC-GG----T-CAGGCCAGCATCGGTTTGGGC-GGTCGG-ACAAAGGCGG-CGGGAATGTGGCT---CCCCTAATGCGGCCAGTCCGGACCGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTGTGCGAGTG-TTTGGGTGTCAAG-CCCGGACGCGTAATG-AAAGTGAACGGAGGCGGGAACCGGTGCACCGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCGCCGCCG-GGGCAAAA-G-TT-ACGCCCCGGCGAGTAGGCAGGCGTGGAGGCCCGTGACGAAGCCTTGGGGGTGACCCCGGGTAGAACGGCCTCT-----------------------------------------------------------------CGTCGGC---TTCATTACGAAGATCAAGAAGCTGCTGGAAACAGTGTGTCACAACTGCGGGTTGATTCTGGCAGACTACAACCACCCAGACTGGAAAAACGCGTACAGAATCAAAGAGCCCAAGAAGCGATTTGATTATATATGGCGATTGTCCAAG---ACTAGGCGGAACTGTGAAGTTGAA---------TTTCCC---GACCTACCGCATGGCGGTTGTGGTAACAAGCAGCCAGACACCATCAGGAAAGAAGGGTTGAAGCTGTACGCCAATTTCAAG---GCC---AACAAG---GGCGATGATGACGACGATGAGAAGAGA---CTAATCAGCCCGCAAGACGCGCTCAACATATTCCGTAACGTTTCTGACAACACTCTAGACCTACTCGGTCTGAACAAAGATTACGCTCGACCCGAATGGATGGTTCTCTCGGTTCTCCCGGTCCCCCCACCTCCTGTTCGTCCCAGTATCTCAGTCGACGGTACTGGTCAAGGCATGCGCGGAGAGGACGATTTGACATACAAGCTCGGTGATATTATTCGTGCCAACGCTCGCGTTCAAGAGTGTATCCGAGATGGGTCCCCACAACACATTCTGATCGAGTTTGAGAGTCT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCTTTTCCTAAAGCTTACGAAGGATATGTTCAAGTATCTTCAGAAATGCGTAGAGAACAACCAGGAGTTCAATTTGCAGCTGGCCATCAAAGCAAGTCTTGTCACGAATGGTTTGAAATATTCACTGGCCACAGGAAATTGGGGTGATCAGAAGAAGGCCGCTTCATCCAAGGCTGGTGTCTCACAGGTCCTTAATCGTTACACTTATGCCTCCACCTTATCACATCTCCGCCGAACGAACACCCCAGTGGGCCGTGACGGCAAACTCGCCAAACCTCGTCAATTGCACAACACCCATTGGGGTCTCGTATGCCCTGCCGAAACACCCGAAGGACAAGCATGCGGTTTGGTCAAGAACCTGTCATTGATGTGCTACGTCAGCGTTGGTAGTGAGAGC---------ACTCCAATCACCGATTTCATGACTCAGAGGAACATGGAACTCTTGGAAGAATACGATCCTGTGGTGAATCCGACTGCTACTAAGGTCTTCGTAAACGGCGTCTGGGTCGGAGTTCACTCACAACCAGCACAACTGGTATCCGTCGTCCAAGAGTTACGCAGGAAT---GGAACACTATCATACGAAATGAGTCTCATTCGAGACATTCGTGACCGAGAATTCAAGATCTTCACGGATGCAGGACGAGTTATGAGACCGCTTTTCGTGATCGAGACCGACTATCGGAAGCCTAATCGTGGCTGCCTTGTACTCAACAAGTCACACATACAAAAGCTCCTAGACGACAAGATGAGCGACGAGGAA------TCCGCAGCG------GTCAAGTTTGGCTGGAAA---GGCTTGATCCACAGCGGTGTCGTGGAGTATCTCGATGCCGAGGAAGAAGAGGGGGCAATGATCATCATGACTCCGGAGGATCTGGAAGACCACCACCGCGTC---AGTCAAGGAGCTCCA------GTGAGCGAGTTTCCTGATCCGCACAAACGTATCAAACCAAAACCAAACCCAACCGTTAAGACATACACACACTGCGAGATTCATCCAAGCATGATCTTAGGTATTTGCGCCAGCATTATT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGAGAGCACGCCCTCCTCGCCTACACTCTCGGTGTTAGGCAAATCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGATCGTTTCCACGAAATCGTCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACCGTTCCTTTCGTCCCTATCTCTGGCTTCAACGGTGACAACATGATTGAGCCATCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACCGGCAAGACTCTCCTCGAGGCTATCGACGCCATCGATCCCCCATCCCGTCCCTCAGACAAGCCTCTCCGTCTTCCTCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTCCCTGTCGGCCGTGTTGAGACCGGTGTCATCAAGTCTGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTTAAGTCCGTTGAAATGCACCACGAACAGCTCGTTGAGGGTCTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGTAATGTCGCTGGTGACTCCAAGAACGACCCCCCCAAAGGTGCCGAATCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAAATCGGTGCCGGTTACGCACCAGTCTTGGATTGCCACACCGCCCACATTGCTTGCAAATTCTCTGAGCTCCTTGAAAAGATCGACCGACGAACTGGCAAGTCTATTGAGAACAGCCCCAAGTTCGTCAAGTCTGGTGATGCCGCTATCGTAAAGATGCTTCCCTCCAAGCCTATGTGCGTTGAGGCATTCACTGAGTACCCACCT Hysterobrevium_smilacis_SMH_5280 ---------------CACTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTAACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATTGTAGGGTATTGGCCTACAATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAGACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-CACTGGTCCGGCCGGGCCTTTCCTTCTGGAGAGCCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTATTATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAG-----------------------------------------------------------------------------------------GCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTA--GGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGCG-TTG-GACCC-GACCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCC---GGT-GTC--CC-TCGCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACCTGCCCGCGGTCGCTCATCCA-GGC---T-TC-------T--GCC-TG--GTG-CACTCTTCCGC-GG----T-CAGGCCAGCATCGGTTCGGGC-GGTCGG-ACAAAGACGG-CGGGAATGTGGCT---CCCCTAATGCGGCCAGTCCGGACCGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTGTGCGAGTG-TTTGGGTGTCAAG-CCCGGACGCGTAATG-AAAGTGAACGGAGGCGGGAACCGGTGCACCGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTCGGTCATATTGAACTGGCCGTGCCAGTCTTCCACGTCGGTCAGTTCATTACGAAGATCAAGAAGCTGCTGGAAACAGTGTGTCACAACTGCGGGTTGATTCTGGCAGACTACAACCACCCAGACTGGAAAAACGCGTACAGAATCAAAGAGCCCAAGAAGCGATTTGATTATATATGGCGATTGTCCAAG---ACTAGGCGGAACTGTGAAGTTGAA---------TTTCCT---GACCTACCGCATGGCGGTTGTGGTAACAAGCAGCCAGACACCATCAGGAAAGAAGGGTTGAAGCTGTACGCCAATTTCAAG---GCC---AACAAG---GGCGATGATGACGATGATGAGAAGAGA---CTGATCAGCCCGCAAGACGCGCTCAACATATTCCGTAACCTTTCTGACAACACTCTAGACCTACTCGGTCTAAACAAAGATTACGCTCGACCCGAATGGATGGTTCTCTCGGTTCTCCCGGTCCCCCCCCCTCCTGTTCGTCCCAGTATCTCAGTCGACGGTACTGGTCAAGGCATGCGCGGAGAGGACGATTTGACATACAAGCTCGGTGATATTATTCGTGCCAACGCTCGCGTTCAAGAGTGTATCCGAGATGGGTCCCCACAACACATTCTGACCGAGTTTGAGAGTCTTCTGCAATATCACACTGCCACCTACATGGACAAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACACCCCAGTAGGCCGTGACGGCAAGCTCGCCAAACCTCGACAATTACACAACACCCATTGGGGTCTCGTATGTCCTGCCGAAACACCAGAAGGACAAGCATGCGGTTTGGTCAAGAACCTATCATTGATGTGCTACGTCAGCGTTGGTAGTGAGAGC---------ACTCCGATCACCGATTTCATGACTCAGAGGAACATGGAACTCTTGGAAGAATACGATCCTGTGGTGAATCCGACTGCTACTAAGGTTTTTGTAAACGGCGTCTGGGTCGGAGTTCACTCACAACCAGCACAACTGGTATCCGTCGTCCAAGAGTTGCGCAGGAAT---GGAACACTATCATACGAAATGAGTCTCATTCGAGACATTCGTGACCGAGAATTCAAGATCTTCACGGATGCAGGACGAGTTATGAGACCGCTCTTCGTGATCGAGACCGACTATCGGAAGCCTAATCGTGGCTGCCTTGTACTCAACAAATCACACATACAAAAGCTCCTAGACGACAAGATGAGCGACGAGGAA------TCCGCAGCG------GTCAAATTTGGCTGGAAA---GGCTTGATCCACAGCGGTGTCGTGGAATACCTCGATGCTGAGGAAGAAGAGGGGGCAATGATTATCATGACTCCGGAGGATCTGGAAGACCATCACCGAGTC---AGTCAAGGAGCTCCG------GTGAGCGAGTTTCCTGATCCCCACAAACGTATCAAGCCAAAACCGAACCCAACTGTTAAGACATACACACACTGCGAGATTCATCCAAGCATGATCCTGGGTATTGCGCCAGCATTATTCCCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Hysteropatella_clavispora_CBS_247_34 ---------------------------------TTATTTGATAG-A-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTCAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACGGGGCTCTTTTGGGTCTCGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAATCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT----------CTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGAG-TCG-GCTCC-GGTCTAAGTGCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCC--GGC--CGC--CT-TCTCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCCGCGGTTGCTCAACCG-GCC---T-TT-------T--GGCTCG--GTG-CACTCTTCCGC-GG----T-CAGGCCAGCATCGGTTCGGGC-GGTCGG-ATAAAGGCCT-TGGGAATGTAGCA---CCCTTAATGCGGCCAGCCTGGACCGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCATGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGAAGGATTTGAGTATGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCC-TTGTTACTTAGTTGAACGTGGGCACTTGAATGTAGCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTGGACAGCAGGACGGTGGCCATGGAAGTCGGAAACCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCTCGCCGCCA-GGGTAGAT-T-CG-ATGCCCTGGCGAGTAGGCAGGCGTGGAGGTCAGTGACGAAGCCTTGGGGGTGACCCCGGGTCGAACGGCCTCTAGTGCAGATCTTGGT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTGTCTCGCAAGTCTTGAACAGGTACACATATGCGTCGACCTTGTCCCATCTTCGGCGGACAAACACTCCTATTGGTCGAGATGGAAAGATTGCTAAGCCTCGACAATTGCACAACACCCATTGGGGCCTTGTCTGTCCTGCA-AAACGCCTGAAGGGCAGGCCTGCGGCTTAGTCAAGAACCTATCTCTGATGTGTTACGTGACCGTTGGCACAGACGGT---------AGTCCTATGGTCGATTTCATGGTGCAACGTAACATGGAGCTGCTTGAAGAATATGACCCTGTCACCTCGCCGAACGCCACGAAGGTTTTCTTGGATGGAGTTTGGGTTGGTGTGCATCGTGAGCCTGCCAAGCTAGTCAACGATGTTATGAAGTTGAGGAGGTAT---GGTACCCTCTCTTTCGAGTACGGCATGGTCTGGGATATCCGTGATCGCGAGTTCAAGCTTATTACGGATGCTGGCCGTGTCTGTCGGCCACTTTTCGTTGTAGACAATGATCCTCGAAGCCTTAATAAGGGCGGACTTGTTCTTAACAAGGAGCATATCGCAAAGCTTCAATCCACCAAGTTCACCGATGAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGAGTTGCCAGCGGGTCAAAACGCGATCGTTGCTATTGCTTGCTACTCAGGTTACAACCAAGAAGATTCCGTGATCATGAATCAGAGCAGCATCGATCGAGGTCTCTTCCGAAGTCTCTTCTACCGCTGCTACACTGATCAGGAGAAGAAGGTTGGAATGTCAGTCATCGAGTCTTTCGAGAAACCAATGCGATCAGATACTCTTCGTCTCAAGCACGGTACTTATGATAAGCTCGATTTCGATGGTCTTGTCGCTCCTGGTGTTCGTGTGTCCGGCGACGACATCATCATCGGAAAGACCGCCCCCATCGCGCCAGACGCA------------------GAAGAGCTTGGACAACGGACGAAAGCCCACGTCAAGCGCGATGTGTCTACGCCACTGCGGAGTACCGAATCAGGTATCATCGATCAGGTTGTGCTCACCACCAATCCCGAAGGTCTTCGGTTCGTCAAAGTTAGAACCCGGACGACGAAAGTTCCGCAGATTGGCGATAAGTTTGCTTCTCGTCACGGTCAAAAGGGTACAATCGGTATCACATACCGTCAGGAAGATATGCCTTTCACAGCTGAAGGTCTTACT----------------------------------------------------TCGCCGCCGGTACTGGTGAGTTCGAAGCCGGTATCT-CAAGGATGGCCAGACTCGTGAGCACGCCTTGCTCGCCTACACCCTCGGTGTCAGG-AGATCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGCTACAACGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCTTTCGTCCCCATCTCTGGCTTCAACGGTGACAACATGATCGACGCCTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCTACCGGCAAGACCCTCCTCGAGGCCATCGATGCCATCGACCCACCATCCCGCCCATCTGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTCTACAAGATCGGCGGTATTGGAACTGTGCCAGTCGGTCGTGTTGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACCGAAGTCAAGTCCGTCGAGATGCATCACGAGCAGCTTACCGAGGGTCTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAAATCCGTCGTGGCAACGTCGCTGGTGACTCCAAGAACGATCCACCAAAGGGCGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGCCAGGTCGGTGCTGGTTACGCTCCAGTCTTGGATTGCCACACCGCCCACATCGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGATCGTCGTACCGGCAAGTCCATTGAAGACAGCCCCAAGTTCATCAAGTCCGGTGATGCTGCCATCGTCAAGATGATTCCATCCAAGCCCATGTGCGTTGAGGCT--CACCGAGTACCCGCCT Hysteropatella_elliptica_CBS_958_97 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCCTGGTGATTCATAATAACTCAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACGGGGCTCTTTTGGGTCTCGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAATCGCATGCCCTTCACTG-GGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATCTGG-GGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGAG-TCG-GCTCC-GGTCTAAGTGCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGCC--GGC--CGC--CT-TCTCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCCGCGGTTGCTCAACCG-GCC---T-TT-------T--GGCTCG--GTG-CACTCTTCCGC-GG----T-CAGGCCAGCATCGGTTCGGGC-GGTCGG-ATAAAGGCCT-TGGGAATGTAGCA---CCCTTAATGCGGCCAGCCTGGACCGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCATGCGCGTAATG-AAAGTGAACGGAGGTGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAGC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCC-TTGTTACTTAGTTGAACGTGGGCACTTGAATGTAGCGCTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTGGACAGCAGGACGGTGGCCATGGAAGTCGGAAACCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCTCGCCGCCA-GGGTAGAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCCAAAGCAGGCGTATCCCAGGTCTTGAACAGATACACATACGCCTCGACGTTGTCTCATCTTCGACGAACGAATACCCCGATCGGCCGAGATGGAAAGATCGCCAAGCCACGGCAGTTGCATAATACCCACTGGGGTCTTGTCTGTCCTGCA-AAACGCCGGAAGGACAGGCCTGTGGTTTGGTTAAGAACTTGTCCTTGATGTGCTACGTGACCGTGGGAACAGACGGT---------AGCCCCATGGTTGATTTCATGGTGCAGCGTAACATGGAGCTTCTC-AAGAATAC-ACCCGG-CACCTCGCCGAACGCTACAAAGGT----CTGGATGGTGTCTGGGTTG-TGTGCATCGTGAGCCTG-CAA-CTTGTCAACGATGTTATGAAGTTGAGGCGGTAT---GGTACCCTCTCTTTTGAGTATGGTATGGTCTGGGATATCCGAGACCGCGAATTCAAGCTCATCACGGATGCTGGTCGCGTTTGTCGACCCCTTTTTGTCGTAGACAACGATCCTCGAAGCCTGAACAAGGGTGGTCTCGTTCTCAACAAGGAACATATTGCAAAACTTCTAACCTCAAAGTTTTCCGATGAACAG------ATGGAG---------ACCGTCTACGGATGGAAG---GACTTGCTAAGAGAGGGAGTTATTGAGTACATGGATGCCGAGGAAGAAGAGACAGCGATGATCGTGATGTCTCCTGAAGACTTGGAAGACTATCAACGGATG---CG-CAAGGC------------------------GTAGATCCTCTCAGACGATTGAAGACCAGGATGAATCCTGCGATCAAGACATTTACTCATTGCGAGATCCATCCAAGCATGTTACTGGGCATATGTGCTAGTATTATTCCGTTCCCGGATCACAACCAGGCTCCTCGTAACTGCTACCAATCTGCTATGGGTAAACAAGCTATGGGTGTCATGCTCACGAATTACCAACTACGTATGGACACTATGTCCAACGTGCTTTACTACCCGCAGAAGCCTCTCGCGACTACGCGATCCATGGAGTACTTGAAGTTCAGAGAGCTTCCAGCCGGTCAAAACGCGATCGTCGCCATCGCATGTTACTCGGGTTACAACCAAGAAGATTCCGTCATC-TGAACCAGAGCAGCATCGATCGAGGCCTCTTCCGAAGTCTTTTCTACCGCTGCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Jahnula_aquatica_R68_1 ---CTGCGAATGGCTCATTAAATCAGTTATCGTTTATTT-ATAGTA-CCTTACTACAC-GG-ATATCTGTGGTAATTCTAGAGTTAATACGTGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGACAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTCAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGCTAGGGTAGTGGCCTAGCATGGTTACAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCCGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACTCGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACGATTTAAATACCCTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAACGCTCGTCGTTGAACCTTGGGCCTGGGCGACCGGTCTCCCTCACCGGATG-CACTGGTTCGGCCGGGCCTTTCCTTCTGGGGATCCGCATGCCCTTCGCTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACCTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGTCAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTAGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCCTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCA-TTTGACTCGCTCGGCACCTTACGA-AAATCA--AGTG-------------------------------------------------------------------------------------------------------------------------------------TAACGGCGAGCGAAGCGGCAAGAGCTCAGATTTGAAATCTGG-GGTCCGAGTTGTAATCTGTAGGGGATGCTTCGGAG-CCA-TACCC-GGCCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTGTGCGGCC---GGT-GGA--CG-GTTCCGTGTGAAGCTCCTCCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGATCGTCGTGGATCACCCC-TCC---C-CG-------C--GGA-GG--GCT-CACTCCGCCTC-GA----T-CGGGCCAGCATCGGTTCCGGC-GGTCGG-ATAAAGGCGTTCGGGAATGTGGCT---CCTCTAATACGGCCTGCTGGGACCGA-GGA-CCGCG-CT----T-C--G--GCAAGGATGCTGGCGTAATGGTCGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTCGGAGCCGGCGCACGAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCGAAAGATGTGCGAGCTATA-CCTGAG--T-AGGCCGAAGC-CAGCGGAAA--CGCT-GGTGGAGGGTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAACTTGGGTATAGGGGCGAAAGACTAATCGAG-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTTAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGCCC-TTGTTACTTAGTTGAACGTGGGCACTCGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCCAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAATGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCA--ATACCTCGCCGCCGTAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Jahnula_bipileata_F49_1 ---CTGCGAATGGCTCATTAAATCAGTTATCGTTTATTT-GTAGTA-CCTTACTACAC-GG-ATATCTGTGGTAATTCTAGAGTTAATACGTGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGACTAAAAACCAACGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTCAACGAATCGCAT-GGCCTTGAGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGCTAGGGTAGTGGCCTAGCATGGTGACAACGGGTAACGGGGGATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACGATTTAAATACCCTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAACGCTCGTCGTTGAACCTTGGGCCTGGGCGATCGGTCCCCCTCACCGGGAG-CACTGGTTCGGCCGGGCCTTTCCTTCTGGGGATCCGCATGCCCTTCGCTG-GGCGTGCTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACCTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGTCAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTAGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCCTAACCATAAACTATGCCGACTAGGGATCGGGGT-ATACTCAT-TTTTGGTTACCTCGGCACCTTACGA-AAATCA-AA-TG-------------------------------------------------------------------------------------------------------------------------------------TAACGGCGAGCGAAGCGGCAAGTGCTCAGATTTGAAATCTGG-GGCCCGAGTTGTAATCTGTAGGGGATGCTTCGGAG-TCG-AACCC-GGCCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGCGGCC---GGT-GGG--CG-TCTCCGTGCGAAGCTCCTCCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGGCCGCTTCGGTTCAACCC-TAC---C-CG-------T--GTA-GG--GCT-TACTCCGTTGC-GG----T-CGGGCCAGCATCGGTTTGGGC-GGTCGT-TTAAAGGCGT-TGGGAATGTAGCT---CCTCTAATGCGGCCTGCCTGGACCGA-GGA-CCGCG-CT----T-C--G--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAA-CCCCTACGCGCAATG-AAAGTGAACGGAGGTCGGAGCCGGCGCACGAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AAATGTT-GGGA-CCCGAAAGATGTGCGAACTATG-CTTGAG--T-AGGCCGAAGC-CAGCGGAAA--CGCT-GGTGGAGGGTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAACTTGAGTATAGGGGCGAAAGACTAATCGAG-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTTAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGCCC-TTGTTGCTTAGTTGAACGTGGGCACTCGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGGTGAACCGAAC-GCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCCAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCA--ATACCTCGCCGCCTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Jahnula_seychellensis_SS2113_1 ---CTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAC-GG-ATATCTGTGGTAATTCTAGAGTTAATACGTGCTAAAAACCTCGACTTCGGGAGGGGTGTATTTATTAGACTAAAAACCAACGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTCAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGCTAGGGTAGTGGCCTAGCATGGTGACAACGGGTAACGGGGGATTAGGGTTCTATTCCGGAGAGGGAGCCCGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACGATTTAAACACCCTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAACGCTCGTCGTTGAACCTTGGGCCTGGACGATCGGTCCCCCTCACCGGGAG-CACTGGTTCGGCCGGGCCTTTCCTTCTGGGGATCCGCATGCCCTTCGCTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACCTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGTCAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTAGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCCTAACCATAAACTATGCCGACTAGGGATCGGGGT-ATACTCAT-TTTTGGTTACCTCGGCACCTTACGAGAAATCA-AAGTGTTTGGGTTCTGGGGGGAGTATA----------------------------------------------------------------------------------------------------GGATTCCTTAGTAACGGCGAGGGAAGCGGCAATTGTTCAGATTTGAAATCTGG-GGCCCGAGTTGTAATCTGTAGGGGATGCTTCGGAG-TCT-GACCC-GGCCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGCGGCC--GGT--GGA--CG-TCTCCGTGCGAAGCTCCTCCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGACCGTAAAGGATCACCCC-TCC---C-CG-------T--GGA-GG--GCT-CACTCCTCTGC-GG----T-CGGGCCAGCATCGGTTCGGGC-GGTCGT-TTAAAGGCGT-TGGGAATGTGGCT---CCTCTAATGCGGCCTGCCCGGACCGA-GGA-CCGCG-CT----C-C--G--GCAAGGATGCTGGCTTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGCAATG-AAAGTGAACGGAGGTCGGAGCCGGCGCACGAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AAATGTT-GGGA-CCCG-AAAGATGTGGAACTATG-CTTGAG--T-AGGCCGAAGC-CAGCGGAAA--CGCT-GGTGGAGGGTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAACTTGAGTATAGGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Julella_avicenniae_BCC_18422 ---CTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATATCCGTGGTAATTCTAGAGCTAATACATGCGTAAATCCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCAGAATAACTTTTCAGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTT-CCATGGTTTCAACGGGTAACGGGAGATTAGGGTTTGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAGCTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTG-TACTTGACCGGCCGGGCCTTTCCTCCTGGAGAATCTCATGCCCTTCACTG-GGCGTGCTGGGGATCCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACG--GCAGTCTTA-TTTTGTTGGTTTCTAAGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATTAGTATTCAATAGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTGTGCCGACTAGGGATCGGGCG-ATGTTTCTATCTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGT-TTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCG------------------------------------------------CAGAATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTTAAATTTAAAATCT---CGTCTAAGTTGTAATTTGCAGAGAGTGCTTTAGTG-TTA-GTAAG-AGCCTAAGTTCCTTAGAATAGGGCGTTATAGAGGGTAAGAATCCTGTATATAGTT--GCT--ATT--CT-TTACTGTGTAAAGCCCCTTTGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGT-CAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCCGCCAGACGTGGCTGTAGTTGCTCAGCTA-GGC---T-TT-------T--GCC-CG--GTG-CACTCTTCTAT-AG----T-CAGGCCAGCATCAGTTTGGGC-GGCTGG-ATAAAGACCT-CTGTCATGTACCT---CCTTTAATACAGCCAGCCTGGACTGA-GGTTCCGCG-CA----T-C-----GCTAGGATGCTGGCGTAATGGCGGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCAAGCGCGTAATG-AAAGTAAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATTAAA-CT-ATCTAGTAGCTAG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-GTATTTTAGTTTTATAAGGTAAAGCAAATAATTAGAGGCCTAGGGGTTA-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCCTTGTTACTTGATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGTACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACAGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTT-AA-GCGTGCTACCC--ATACCCCGCCGCCA-ATGC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCAACACACCAGTCGGTCGAGACGGCAAGCTGGCTAAGCCACGCCAGCTGCACAACTCTCACTGGGGTCTCGTGTGCCCCGCTGAAACCCCAGAAGGACAAGCGTGTGGTCTAGTCAAGAACCTATCTCTTATGTGCTACGTTAGTGTAGGTAGTGACGCC---------ACCCCTATAACCGATTTCATGAGTCAGCGAGGTATGGATTTGCTGGAAGAGCACGATCCTGTCTTGAACCCAGCTACTACCAAGGTGTTCGTCAATGGTGTTTGGGTCGGGGTTCACAATAATGCTGCACAACTCTTCACCACAGTTCAAGAGCTTCGACGGAAC---GGAACTCTCTCATACGAGATGAGTCTTGTACGAGAAATTCGTGACAGAGAGTTCAAGATATTCACGGACGCCGGCCGTGTCATGAGGCCGTTGTTCATTGTAGAAAATGATCCCCGCCAACCGAACCGTCATCATCTCATGTATACCAAGGCTCATGCCAACAAGCCTGCTCGAGGAAGT---------------------ATTTCTCAT------GCCAGGTACGGGTGGAGA---GGTCTTATTCAAGATGGTATAATTGAGTATCTCGACGCCGAAGAAGAGGAAGCTGCCATGATTGTCATGTCGCCTGATGACCTTGACGAATGGCGTGGCGTA---AAACAGGGTCAACCA------------------GCAGATCGACTGAAACGTCTCAAGCCAAAGCCAAACCAATTCGTTGCACAATATACCCACTGCGAAATCCACCCAGCTATGATTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCGCTATTCTGATTATCGCTGCCGGTACTGGTGAGTTCGAAGCCGGTATCTCCAAGGATGGCCAAACTCGTGAGCACGCTTTGCTTGCCTACACTCTTGGTGTCAAGCAGCTTATTGTTGCCATCAACAAGATGGACACCACCAAATGGTCAGAGGATCGTTACAATGAGATCATCAAAGAGACGACCAACTTCATCAAGAAGGTCGGATACAACCCCAAGGCCGTCCCATTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGGCTCCACCAACTGCCCTTGGTACAAGGGTTGGGAGAAGGAGGTCGTCGACGAGAACAAGAAAACCCAGAAGTACACTGGCAAGACTCTGCTCGAGGCCATTGACAAGATCGTCCCCCCGACCCGTCCTTCTGACAAGCCTCTCCGTCTGCCTCTCCAGGATGTGTACAAGATTGGTGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACTGGTACCATCAAGGCTGGTATGGTCGTCACTTTCGCTCCTGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTGTCCGCGGGTATG---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATTCGTCGTGGAAACGTCGCTGGTGACTCCAAAACCGACCCCCCCAAGGGCTGCGACTCTTTCAACGCTCAGGTCATTGTCCTCAACCACCCCGGCCAGGTCGGTGCTGGTTACGCTCCTGTCTTGGATTGCCACACTGCCCATATCGCTTGCAAGTTCTCTGAGCTCCTTGAGAAGATCGACCGACGAACTGGCAAGTCTGTTGAGAGCAGCCCTAAGTTCATCAAGTCTGGTGATGCTGCCATCGTCAAGATGGTCCCCTCCAAGCCGATGTGCGTTGAGACATTCAACGAGTACCCACCT Julella_avicenniae_BCC_20173 ---CTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATATCCGTGGTAATTCTAGAGCTAATACATGCGTAAATCCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCAGAATAACTTTTCAGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGAGATTAGGGTTTGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAGCTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTG-TACTTGACCGGCCGGGCCTTTCCTCCTGGAGAATCTCATGCCCTTCACTG-GGCGTGCTGGGGATCCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACG--GCAGTCTTA-TTTTGTTGGTTTCTAAGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATTAGTATTCAATAGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTGTGCCGACTAGGGATCGGGCG-ATGTTTCTATCTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGT-TTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCG-----------------------------------------------------------------CGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCT---CGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGTG-TTG-GTGGG-AGCCTAAGTTCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTATGTGGTT--GCT--ATC--CT-TCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGT-CAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCCGCCAGACGTGGCTGTAGTTGCTCAGCTG-GGC---T-TT-------T--GCC-CG--GTG-CACTCTTCTAT-AG----T-CAGGCCAGCATCAGTTTGGGC-GGCTGG-ATAAAGACCT-CTGTCATGTACCT---CCTTTAATACAGCCAGCCTGGACTGA-GGTTCCGCG-CA----T-C-----GCTAGGATGCTGGCGTAATGGCGGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCAAGCGCGTAATG-AAAGTAAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-GTATTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCCTTGTTACTTGATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGTACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTT-AA-GCGTGCTACCC--ATACCCCGCCGCCA-ATGCAAAT-A-CT-ATGTGTTGGCGAGTAGGCAGGCGTGGGGGTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCCATCTCCGCCGAACCAACACACCAGTCGGTCGAGACGGCAAGCTGGCTAAGCCACGCCAGCTGCACAACTCTCACTGGGGTCTCGTGTGCCCCGCTGAAACCCCAGAAGGACAAGCGTGTGGTCTAGTCAAGAACCTATCTCTTATGTGCTACGTTAGTGTAGGTAGTGACGCC---------ACCCCTATAACCGATTTCATGAGTCAGCGAGGTATGGATTTGCTGGAAGAGCACGATCCTGTCTTGAACCCAGCTACTACCAAGGTGTTCGTCAATGGTGTTTGGGTCGGGGTTCACAATAATGCTGCACAACTCTTCACCACAGTTCAAGAGCTTCGACGGAAC---GGAACTCTCTCATACGAGATGAGTCTTGTACGAGAAATTCGTGACAGAGAGTTCAAGATATTCACGGACGCCGGCCGTGTCATGAGGCCGTTGTTCATTGTAGAAAATGATCCCCGCCAACCGAACCGTCATCATCTCATGTATACCAAGGCTCATGCCAACAAGC-TGCTCGAGGAAGT---------------------ATTTCTCAT------GCCAGGTACGGGTGGAGA---GGTCTTATTCAAGATGGTATAATTGAGTATCTCGACGCCGAAGAAGAGGAAGCTGCCATGATTGTCATGTCGCCTGATGACCTTGACGAACCGCGGGGCGTA---AAACAGGATCATCCA------------------GCAGGAAATGGAGCCCTTCGCAAGCCAAAGCCAATCCTATTC-CCGCACAGTATACCCACTG-GAAATCCACCCAGTTATGGCTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCGCTATTCTGATTATCGCTGCCGGTACTGGTGAGTTCGAAGCCGGTATCTCCAAGGATGGCCAAACTCGTGAGCACGCTTTGCTTGCCTACACTCTTGGTGTCAAGCAGCTTATTGTTGCCATCAACAAGATGGACACCACCAAATGGTCAGAGGATCGTTACAATGAGATCATCAAAGAGACGACCAACTTCATCAAGAAGGTCGGATACAACCCCAAGGCCGTCCCATTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGGCTCCACCAACTGCCCTTGGTACAAGGGTTGGGAGAAGGAGGTCGTCGACGAGAACAAGAAAACCCAGAAGTACACTGGCAAGACTCTGCTCGAGGCCATTGACAAGATCGTCCCCCCGACCCGTCCTTCTGACAAGCCTCTCCGTCTGCCTCTCCAGGATGTGTACAAGATTGGTGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACTGGTACCATCAAGGCTGGTATGGTCGTCACTTTCGCTCCTGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTGTCCGCGGGTATG---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATTCGTCGTGGAAACGTCGCTGGTGACTCCAAGACCGACCCCCCCAAGGGCTGCGACTCTTTCAACGCTCAGGTCATTGTCCTCAACCACCCCGGCCAGGTCGGTGCTGGTTACGCTCCTGTCTTGGATTGCCACACTGCCCATATCGCTTGCAAGTTCTCTGAGCTCCTTGAGAAGATCGACCGACGAACTGGCAAGTCTGTTGAGAGCAGCCCTAAGTTCATCAAGTCTGGTGATGCTGCCATCGTCAAGATGGTCCCCTCCAAGCCGATGTGCGTTGAGACATTCAACGAGTACCCACCT Kabatiella_caulivora_CBS_242_64 --------------------------TTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTAAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTG-GGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT---------------------------------------------ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTG--GGTCCGCATTGTAATTTGTAGAGGATGCTTTGGGG-AGG-CCGCC-TGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACA--GGAA-ATG--GC-ACCCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTCCA-AACCGTTCGGCCG-GTC---T-TC-------T--GAC-CG--GTT-TACTCGGTT-T-GG----G-CAGGCCAGCATCAGTTTCGGC-GGCCGG-ATAAAGGCTC-TGGGAATGTGGCC---CCCTCAATACGGCCAGCCGGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTGCTGTGCCCGTCTTCCACGTCGGT---TTCGTAACAAAGATCAAGAAGATTCTCGAGACCGTCTGTCACAACTGTGGCAAAATCTTGCTTGATGAAAGTGTACCCGCCTTTGCCCAAGCCGTGCGCCTAAGAGATCCCAAGCGCCGCTTCGATGCCATCCACAGATTGTGCAAA---CCCAAGACCACCTGTGACCCCGAC---------GAGGCTGGCGAGCGCTCACACGGTGGCTGCGGCAACCTGCAACCGACG---ATTCGCAAGGACGGTCTTAAGCTTACTGGTACCTACACC---TTT---CCCAAG---GATGCAGACTCGGAGGCCGACAAGAAG---ATCATCACTCCTCAAATGGCTCTCAATGTCTTCCGCAACATCTCGACCTACGACTTGGCCCGCATGGGTCTCAACGCAGACTACGCTCGTCCTGAGTGGATGATCCTCACTGTTCTGCCCGTCCCTCCCCCCGCAGTCCGTCCCAGTGTCTCGGTAGACGGAACCAACCAGGGTATGCGCTCCGAGGATGATTTGACCTTCAAGCTCAGTGATATTATTCGCGCCAACGCCAACGTGCGCAAGTGTGAACTGGAGGGCTCCCCGCATCACGTTATTGCAGAGTTCGAGGCTCTGTTGCAATTCCATG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Kalmusia_scabrispora_MAFF_239517 --------AATGGCTCATTAAATCAGTTATCGTTTATTTGAAAATA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCTCCTTGGTGATTCACAATAACTTCTCGGATCGCAT-GGCTTTACGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTAGTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACACAATTCCGACTCGGAGATGTAGTGACAATACATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-CACTTGTCCGGCCGGGCCTTTTCTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATGGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-GTGTTTCTATTGTGACCCGCTCGGCACCT-------------------------------------------------------------------------------------------------------------------------------------------------------------CGAGTGAAGCGGCTACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCA-TTG-GCGGCG-GTCTAAGTTCCCTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGC--GCC--TGC--CT-TTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTCCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCG-GGC---T-CC-------C--GCC-CG--GGGC-ACTCTTCTGC-GG----G-CAGGCCAGCATCAGTTTGGGC-GGTCGG-ATAAAGGTCT-CTGTCATGTACCA---CCCTTATTGCGATCAGCCCGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCCCGCCGCTG-GGGCAGAC-G-TT-ACGCCCCAGCGAGTAGGCAGGCGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTAACTTATTCCGCATTCTGTTTCTTAAGCTCACCAAGGACGTGTTTAGGTATCTCCAGCGATGTGTGGAGAACAATCAAGACTTCAACGTGCAGATGGCCATCAAGAATAGTATCTTGACGAATGGCCTAAAGTACTCGTTGGCGACTGGCAACTGGGGTGACCAAAAGAAGGCAGCCTCGGCCAAGGCTGGCGTTTCCCAGGTCCTGAACCGCTATACCTACGCGTCCACTCTATCCCATCTTCGGCGAACCAACACGCCCGTTGGCCGTGACGGTAAGCTCGCAAAACCGCGCCAGCTTCACAACAGTCATTGGGGTCTTGTCTGCCCAGCCGAGACACCCGAAGGACAAGCTTGTGGGCTTGTCAAAAACCTCTCGCTCATGTGCTATGTCAGTGTGGGCAGTGAAAGT---------GCACCCATCATTGACTATATGACGGGCCGCAGCATGGAATTGCTTGAGGAGTACGATCCAATGATGAATCCAAATGCCACCAAGGTTTTCGTCAACGGTGTTTGGGTAGGAACGCACGACAATCCGCAGCAACTGGTGTCAAACGTACAAGAACTGCGTCGAAAT---GGAACACTGTCCTACGAGATGAGCTTGATCAGGGACATTCGAGATCGCGAATTCAAAATCTTCACAGATGCTGGTCGCGTCATGCGACCGCTTTTCACTATTGAAAACGATGCGAAAAAGCCGAACCGGCACCACCTGATCTTCAACCGGACTCATCTAGACAAACTTCTGAAAGACAAACTCAACGACGAAGAC------AGGGACAAT------CAGACGTATGGCTGGAAA---GGTCTTCTTCACGATGGCTGCGTTGAGTACCTTGAGGCTGAAGACGAAGAGAGCGCCATGATCGTTATGACGCCTGAGGATCTGAATGACTGGCGTGAAGTG---GTCAAGGGGGGCATG------CCTGAAGCTGAGGACT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATGATGAACGTTTTATACTATCCTCAAAAACCTCTGGCCACCACACGCTCAATGGAGTATCTTAGGTTCCGTGAACTGCCTGCTGGGCAAAACGCTATTGTCGCCATCGCCTGTTACTCGGGATATAACCAGGAAGATTCCGTCATCATGAATCAGAGCAGTATCGATCGTGGTCTATTTAGGAGTTTGTTCTACCGCGCATACACGGAGCAAGAAAAGCGTATTGGTGTAAACGTTCTGGAGCAATTTGAGAAGCCAACGCGTATGGATACGATGAGAATGAAAGGTGGTACGTACGACAAGCTCGACGACGACGGAATCGTCGCGCCAGGTGTTCGAGTTTCTGGTGATGACATCATAATCGGAAAGACAGCACCTATCCCCAACGACGAGAAT---------------AAGGAGATGGGCCAGATATTGGCCAATCATACGAAGCGCGATGTATCCACTCCGCTGCGAAGCACAGAGAACGGCCTCGTTGACCAAGTTCTTTTCACAACTAATACCGAAGGTTTGCGATTCGTCAAAGTGCGTACACGAACGACGAAGGTACCACAAATTGGTGATAAGTTCGCCTCGCGCCACGGTCAGAAAGGTACTATCGGTATCACATATCGCCAAGAAGACATGCCTTTCACCAGGGATGGTCTCGGC-------------------------------CTGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGTCAGACTCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTACCAAGTGGTCCGAGGAGCGTTTCCAGGAGATCATCAAGGAGACCTCTTCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGTCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACCGGCAAGACCCTCCTCGAGGCCATCGACGCCATCGACAACCCCGTCCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTCCCTGTCGGTCGTGTTGAGACCGGTGTCATCAAGCCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACCGAGGGTCTC---CCGGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAAGGTGCTGAGTCTTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGCCAGGTCGGTGCTGGTTACGCTCCCGTTCTCGACTGCCACACTGCCCACATCGCCTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGTCGTACCGGAAAGTCTGTCGAGTCCAGCCCCAAGTTCATCAAGTCTGGTGATGCTGCCATCGTCAAGATGTTGCCGTCCAAGCCCA-------------------------------- Kalmusia_scabrispora_NBRC_106237 --------AATGGCTCATTAAATCAGTTATCGTTTATTTGAAAATA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCTCCTTGGTGAATCACAATAACTTCTCGGATCGCAT-GGCTTTACGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTAGTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACACAATTCCGACTCGGAGATGTAGTGACAATACATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-CACTTGTCCGGCCGGGCCTTTTCTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATGGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-GTGTTTCTATTGTGACCCGCTCGGCACCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGG-GGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCA-TTG-GCGGCG-GTCTAAGTTCCCTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGC--GCC--TGC--CT-TTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTCCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCG-GGC---T-CC-------C--GCC-CG--GGGC-ACTCTTCTGC-GG----G-CAGGCCAGCATCAGTTTGGGC-GGTCGG-ATAAAGGCCT-CTGTCATGTACCA---CCCTTATTGCGATCAGCCCGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCCCGCCGCTG-GGGCAGAC-G-TT-AC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTAACTTATTCCGCATTCTGTTTCTTAAGCTCACCAAGGACGTGTTTAGGTATCTCCAGCGATGTGTGGAGAACAATCAAGACTTCAACGTGCAGATGGCCATCAAGAATAGTATCTTGACGAATGGCCTAAAGTACTCGTTGGCGACTGGCAACTGGGGTGACCAAAAGAAGGCAGCCTCGGCCAAGGCTGGCGTTTCCCAGGTCCTGAACCGCTATACCTACGCGTCCACTCTATCCCATCTTCGGCGAACCAACACCCCCGTTGGCCGTGACGGTAAGCTCGCAAAACCACGCCAGCTTCACAACAGTCATTGGGGTCTTGTCTGCCCAGCCGAGACACCCGAAGGACAAGCTTGTGGGCTTGTCAAAAACCTCTCGCTCATGTGCTATGTCAGTGTGGGCAGTGAAAGT---------GCACCCATCATTGACTATATGACGGGCCGCAGCATGGAATTGCTTGAGGAGTACGATCCAATGATGAATCCAAATGCCACCAAGGTTTTCGTCAACGGTGTTTGGGTAGGAACGCACGACAATCCGCAGCAACTGGTGTCAAACGTACAAGAACTGCGTCGAAAT---GGAACACTGTCCTACGAGATGAGCTTGATCAGGGACATTCGAGATCGCGAATTCAAAATCTTCACAGATGCTGGTCGCGTCATGCGACCGCTTTTCACCATTGAAAACGATGCGAAAAAGCCGAACCGGCACCACCTGATCTTCAACCGGACTCATCTAGACAAACTTCTGAAAGACAAACTCAACGACGAAGAC------AGGGACAAT------CAGACGTATGGCTGGAAA---GGTCTTCTTCACGATGGCTGCGTTGAGTACCTCGAGGCTGAAGAAGAAGAGAGCGCCATGATCGTTATGACGCCTGAGGATCTGAATGACTGGCGTGAAGTG---GTCAAGGGGGGCATG------CCTGAAGCTGAGGACT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATGATGAACGTTTTATACTATCCTCAAAAACCTCTGGCCACCACACGCTCAATGGAGTATCTTAGGTTCCGTGAACTGCCTGCTGGGCAAAACGCTATTGTCGCCATCGCCTGTTACTCGGGATATAACCAGGAAGATTCCGTCATCATGAATCAGAGCAGTATCGATCGTGGTCTATTTAGGAGTTTGTTCTACCGCGCATATACGGAGCAAGAAAAGCGTATTGGTGTAAACGTTCTGGAGCAATTTGAGAAGCCAACGCGTATGGATACGATGAGAATGAAAGGTGGTACGTACGACAAGCTCGACGACGACGGAATCGTCGCGCCAGGTGTTCGAGTTTCTGGTGATGACATCATCATCGGAAAGACAGCACCTATCCCCAACGACGAGAAT---------------AAGGAGATGGGCCAGAAATTGGCCAATCATACGAAGCGCGATGTATCCACTCCGCTGCGAAGCACAGAGAACGGCCTCGTTGACCAAGTTCTTTTCACAACCAATACCGAAGGTTTGCGATTCGTCAAAGTGCGTACACGAACGACGAAGGTACCACAAATTGGTGATAAGTTCGCCTCGCGCCACGGTCAGAAAGGTACTATCGGTATCACATATCGCCAAGAAGACATGCCTTTCACCAGGGATGGTCTCGGC-------------------------------CTGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGTCAGACTCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTACCAAGTGGTCCGAGGAGCGTTTCCAGGAGATCATCAAGGAGACCTCTTCCTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGTCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACCGGCAAGACCCTCCTCGAGGCCATCGACGCCATCGACAACCCCGTCCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGTGGTATTGGCACGGTCCCTGTCGGTCGTGTTGAGACCGGTGTCATCAAGCCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACCGAGGGTCTC---CCGGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCTGAGTCTTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGCCAGGTCGGTGCTGGTTACGCTCCCGTTCTCGACTGCCACACTGCCCACATCGCCTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGTCGTACCGGAAAGTCTGTCGAGTCCAGCCCCAAGTTCATCAAGTCTGGTGATGCTGCCATCGTCAAGATGTTGCCGTCCAAGCCCA-------------------------------- Karstenula_rhodostoma_CBS_690_94 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTCTCAGATCGCAT-GGCTTTACGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATTCCGATACGGAGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-CACTTGTCCGGCCGGGCCTTTTCTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-GTGTTTCTATTGTGACCCGCTCGGCACC-----------------------------------------------------------------------------------------------------------------------------------------------------TAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCA-TTG-GCGGC-GGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTC--GCC--TGC--CT-TTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCA-GGC---T-TT-------G--GCC-CG--GGG-CACTCTTCTGC-GG----G-CAGGCCAGCATCAGTTTGGGC-GGTTGG-ATAAAGGCCT-CTGTCACGTATCT---CCCTTAATGCAACCAGCCCGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACTTGTTCCGCATCCTGTTCCTCAAGCTCACCAAGGACGTCTACAAATATCTCCAGCGATGCGTGGAGAACAACCAGGATTTCAACGTTCAGATGGCTATTAAAGCTAGTATCCTTACTAACGGACTGAAGTACTCCCTGGCAACTGGCAACTGGGGTGACCAGAAGAAGGCAGCCTCCGCCAAAGCTGGTGTGTCACAAGTGTTGAACCGGTATACCTACTCATCCACCTTGTCCCATCTTCGACGGACAAACACTCCCGTCGGTCGAGACGGCAAGCTAGCCAAACCGCGCCAGCTTCACAACAGTCATTGGGGTCTTGTCTGCCCTGCCGAGACACCCGAAGGACAAGCTTGTGGACTCGTCAAGAACTTGTCACTTATGTGCTACGTCAGTGTAGGAAGTGAAAGT---------GCGCCTATCATTGACTATATGACGGGCCGTAACATGGAGCTGCTCGAGGAATACGACCCGATGATGAATCCTAGTGCTACCAAGGTTTTCGTTAACGGTGTCTGGGTCGGAACACACAGCAACCCGCAACAGCTGGTTACAAACGTGCAAGAGCTTCGCCGAAAT---GGAACCCTGTCATACGAAATGAGTCTGGTCCGAGACATTCGAGATCGCGAGTTCAAGATTTTCACCGATGCTGGTCGCGTCATGAGGCCGCTCTTTACCGTTGAAAACGATTCTAAGAAGCCGAACAAAGATCAATTGGTCTTCAACAGGACTCATCTCGAGAAACTCTTGTCAGATAAATTGAACGAAGAAGAC------ACTGACGCT------GCGCAATATGGATGGAAA---GGTCTGCTTCACGATGGCTGCGTTGAGTATCTCGATGCTGAGGAAGAAGAGAGTGCTATGATTGTCATGTCGCCTGAAGATTTGACTGATTGGCGTCAAGTGGCCAAAGAGGGCCAGCCA------GAGCCTGGAAAGCTCTGCGTCTTGCGCCTCTCAAACCT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCTCGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGCTTCAACGAGATCATCAAGGAGACCTCTTCCTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACAACTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACCGGCAAGACCCTCCTTGAGGCCATTGACGCCATCGACAACCCCGTCCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATTGGCGGTATTGGCACGGTCCCTGTCGGTCGTGTTGAGACCGGTGTCATCAAGCCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTGACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGCAAG---CCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAATGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGCGCCGAGTCTTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCTCCCGTCCTTGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGATCGCCGTACCGGCAAGTCTACTGAGTCCAGCCCCAAGTTCATCAAGTCTGGCGACGCTGCTATCGTCAAGATG------------------------------------------------ Katumotoa_bambusicola_MAFF_239641 --------AATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAGCCAATGCCCTCCGGGGCTCCTTGGTGATTCACAATAACTTCTCAGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCGGAGGAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCGGGTCCGCCTCACCGCGTG-CACTTGTCCGGCCGGGCCTTCTCTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATGGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-GTGTTATTATTTTGACTCGCTCGGCACCT-------------------------------------------------------------------------------------------------------------------------------------------------------------CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGCCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCG-TCG-GCAGCG-GTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTC--GCC--TGC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTCGCAGTTGCTCATCCG-GGC---T-TT-------T--GCC-CG--GAGC-ACTCTTCTGC-GA----G-CAGGCCAGCATCAGTTTGGGC-GACCGG-ATAATGGCCT-CTGTCATGTATCT---TCCTTCATGCGGTCAGCCCGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCGCCGCTG-GGGCAGAC-A-TT-ATGCCCCAGCGAGTAGGCAGGCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCACTTGTTTCGCATCCTGTTCCTCAAGCTCACCAAGGATGTCTACAAGTATCTCCAGAGGTGTGTGGAGAACAACCAGGACTTCAACGTGCAGATGGCAATCAAGGCCGGCATCATCACGAATGGCCTCAAGTACTCGTTGGCTACTGGCAACTGGGGCGACCAGAAGAAGGCCGCTTCTGCCAAGGCAGGTGTCTCGCAAGTGCTGAACCGCTATACCTACGCCTCTACCCTGTCCCATCTTCGACGAACGAACACACCCGTTGGTCGTGACGGCAAATTGGCAAAGCCTCGACAGCTTCACAATAGTCATTGGGGCCTTGTGTGTCCTGCCGAGACGCCCGAAGGACAGGCCTGCGGTCTGGTGAAGAACTTGTCCCTCATGTGCTACGTCAGCGTTGGCAGCGAGAGT---------GCGCCCATCACCGATTACATGACAGGCCGCAACATGGAACTTTTGGAAGAGTTCGATCCGTCGAGCAACGCTCAAGCCACAAAGGTGTTTGTGAACGGTGTCTGGGTCGGCACCCATCGGAACCCATCGCAACTTGTCTCGAAGGTGCAAGAGCTTCGACGAGAC---GGCACGCTCTCGTACGAAATGAGCTTGGTTCGAGATATCCGCGACCGTGAGTTCAAGATCTTTACTGATGCCGGCCGTGTCATGCGACCACTTTTTGTGGTGGAGCATGATGTCCGCAAGCCGAACTCGGGACAGCTTCTTTTCACTCGAAATCATCTCGCTAGACTCCTCGAGGATAGCCTCAATGATGAGGAC------ACGATGGAA------AGGAAGTATGGCTGGCGA---GGCCTTCTCCACGACGGATGCGTCGAGTACCTCGATGCCGAAGAAGAAGAATCTGCAATGATTTCCATGACCCCTGAGGATCTAGACGAATGGCGGGAAATG---AAGGCAGGAAACCCT------CCATCGTCTGCCGACAAGCGTCTTGCTCCGATCAAGCCGCCGCCAAACAAGAAGATCGCCGCTTACACGCATTGCGAGATCCATCCCGCCATGATCCTTGGTATCTGTGCCAGT---------------------------------------------------------------------------------------------------------------ATGATGAACGTCCTCTACTACCCTCAGAAACCCCTAGCTACGACGCGCTCTATGGAATACCTCAGGTTCCGTGAGCTGCCTGCCGGGCAAAATGCCATTGTCGCCATTGCTTGCTACTCCGGATACAACCAAGAAGATTCCGTCATCATGAATCAGAGCAGTATCGATCGTGGCCTATTCAGGAGTTTGTTCTACCGAGCATATACCGAACAGGAGAAACGAATTGGTGTCAACGTGCTTGAGCAGTTTGAGAAGCCAACGCGAGCCGACACCATGAGACTGAAAGCAGGCACCTACGACAAGCTTGACGACGACGGTGTTGTTGCTCCTGGTGTTCGTGTATCGGGCGATGATATTATCATTGGAAAGACGGCGCCAATTCCAAGCGATGCG------------------AAGGAGTTGGGCCAGAAAACGATCCTGCATACAAAGCGCGATGTTTCAACGCCTCTCAGGAGCACCGAGAATGGTATCGTCGACCAAGTGCTCTTCACCACCAACACAGAAGGACTGCGCTTCGTCAAGGTGCGAACCCGAACCACCAAGGTACCCCAGATTGGCGACAAGTTTGCCTCTCGTCACGGTCAGAAGGGTACGATTGGTATCACATACCGCCAAGAAGACATGCCCTTCACTCGTGACGGTCTTACT-------------------------------CCGATTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCTCTCCTCGCCTACACCCTCGGTGTGAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGTCCCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGCCCTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGATC---------------AAGGTC---AAGGCCTCCGGCAAGACCCTCCTCGAGGCCATTGACGCCATCGAGCCCCCGAGCCGTCCCTCCGACAAGCCCCTCCGCCTGCCCCTCCAGGACGTGTACAAGATTGGCGGCATTGGCACTGTTCCCGTCGGCCGTGTCGAGACTGGTGTCATCAAGTCCGGCATGATCGTCACCTTCGCCCCCGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTC---CCGGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCTGGTGACTCCAAGCAGGACCCCCCCAAGGGCGCCGAGTCCTTCAACGCCCAGGTTATCGTCCTTAACCACCCCGGTCAGGTCGGTGCTGGTTACGCCCCGGTCCTCGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTTGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTTAAGATGATTCCCTCCAAGCCCA-------------------------------- Keissleriella_cladophila_CBS_104_55 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTCTCAGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-CACTTGTCCGGCCGGGCCTTTTCTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-GTGTTATTATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTGTTTGGGT---------------------------------------------------------------------------------------------------------------------------------CGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCG-TCG-GCAGC-GGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTC--GCC--TGC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTCGTAGTTGCTCATCCG-GG------TC-------C--GCC-CG--GAG-CACTCTTCTGC-GA----G-CAGGCCAGCATCAGTTTGGGC-GACCGG-ATAAAGGCCT-CTGTCATGTATCT---TCCTTAATGCGGCCAGCCCGGACTGA-GGT-CCGCG-CT----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTAT-C-AGTGTTTTGGGTGTCAAG-CCCGG-CGCGTAATG-AAAGTGAACGGAGGTGGGACCCGGTGCACCAT-CGA-CCGATCCTGATGTCTT-GGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCGCCGCTG-GGGCAGAC-A-TT-ATGCCCCAGCGAGTAGGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGTAGATTCCTTCAATTGTTCCTCGAAGCTCACAAAGGATGTATACAAGTACCTCCAGAGGTGCGTGGAGAACAACCAGGACTTCAATGTGCAGATGGCCATCAAGGCTGGTATTATCACCAATGGTCTAAAGTACTCGCTCGCCACCGGTAACTGGGGTGACCAGAAGAAGGCGGCATCTGCCAAGGCTGGTGTCTCCCAGGTGCTTAATCGGTACACCTATGCTTCCACGCTGTCCCATCTTCGGCGAACAAACACACCCGTCGGACGTGACGGCAAGCTGGCTAAACCGCGACAGCTTCACAACAGTCATTGGGGTCTTGTGTGTCCTGCCGAGACGCCAGAAGGACAAGCCTGTGGTCTGGTGAAGAACCTGTCTCTGATGTGCTATGTCAGTGTCGGTAGCGAGAGC---------GCGCCCATCACTGATTACATGACTGGACGTAACATGGAGCTGTTGGAAGAATTTGATCCGACCAACAACGCGCAAGCCACTAAGGTGTTCGTGAACGGTGTTTGGGTTGGAACACATCGCCAACCAGCACAACTCGTTGCCAAGGTCCAGGAACTTCGACGAGAC---GGCACACTCTCTTACGAGATGAGTCTGGTTCGGGACATCCGCGATCGCGAATTTAAGATTTTTACGGACGCCGGTCGTGTCATGCGACCACTTTTCGTAGTCGAGCATGACGTGCGCAAAGCGAACGCGGGACAATTATTGTTCACCCGTGACCATCTGAACAAACTTGTCGCTGACAGCTTCACGACGAGGAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCTAAGGATGGTCAGACTCGTGAGCACGCTCTGCTCGCCTACACTCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGTCCCGTTTCCAGGAGATCATCAAGGAGACGACCAACTTCATCAAGAAGGTTGGCTACAACCCCAAGCACGTTCCCTTCGTTCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGCCTCCCCCAACTGCCCTTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGCAG---AAGTCTACTGGCAAGACCCTCCTCGAGGCCATCGATGCCATTGACCCTCCGTCGCGTCCCACCGACAAGCCCCTCCGTCTGCCCCTTCAGGATGTGTACAAGATTGGAGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACTGGTGTGATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTTACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTCTT---CCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGAGCGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGTCAGGTTGGTGCCGGTTACGCACCCGTCCTCGACTGCCACACTGCCCACATTGCGTGCAAGTTCTCTGAGATCCTCGAGAAGATTGACCGCCGTACCGGCAAGTCGGTTGAGAACAACCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTGCCGTCCAAGCCCATGTGCGTTGAGGCTTTCACCGACTACCCCCCG Kirschsteiniothelia_elaterascus_HKUCC_7769 ---CTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAGACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTCTCAGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-TACTTGACCGGCCGGGCCTTCTCTTCTGGAGAACCTCATGCCCTTTACTG-GGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATATGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGGCCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGCCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-ATGTTTCAATATTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTGTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGC----------------------------------------------------GATTGCCCTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTAAAATCT---CGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCA-CTG-ATGGC-GGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTATGTGGTC--GCT--GAT--CT-TTGCCGTGTAAAGCCCCTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCCGCCAGACTTGCCTGCAGTTGCTCACCTA-GGC---T-TC-------A--GCC-TG--GGG-CACTCTTCTGC-AG----G-CAGGCCAGCATCAGTTTGGGC-AGCCGG-ATAAAGGTCT-CTGACACGTTCCT---ACCTTCATGCGGTTAGCCTGGACTGA-GGT-CCGCG-CA----T-T-----GCTAGGATGCTGGCGTAATGGCTGCAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGCAATA-AACGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Kirschsteiniothelia_maritima_CBS_221_60 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCT---TGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGTA-TTA-GCTCC-AGTCTAAGTCCCTTGGAACAGGGCGTCGCAGAGGGTGAGAATCCCGTACGCGACT--GGC--TGC--TT-TTGCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAATTGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACCTGCTTGCAGTTGTTCATCTG-GAC---T-TT-------T--GTC-TA--GTG-CACTCTTCTGT-GA----G-CAGGCCAGTATCGGTTTGGGC-GGTTGG-ATAAAGATTT-CAGGAATGTAGCT---CTCTTAATGCAACCAGCCCAGATCGA-GGA-CCGCG-CT----T-C--G--GCTAGGATACTGGCGTAATGGTTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTGTGCGAGTG-TTCGGGTGTCAAA-CCCGTGCGCGTAATG-AAAGTGAACGGAGGCGGGAACCGGTGCACTGT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGCACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGAGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACTCCGCCGCTG-GGGTGAGA-T-CT-ATACCCCAGCGAGTAGGCAGGCGTGGAGGCCCGTGAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTTGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGTCCCGCTTCCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTTGGCTACAACCCGAAGACCGTTCCTTTCGTCCCTATCTCTGGCTTCAACGGCGACAACATGATCGACGTCTCCGCCAACTGCCCCTGGTATAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGACCACCGGCAAGACCCTCCTTGAGGCCATTGATGCCATCGACCCCCCGGCACGTCCTACCGACAAGCCCCTCCGTCTTCCCCTTCAGGATGTGTACAAGATTGGAGGCATTGGCACGGTTCCCGTCGGACGTGTCGAGACCGGAATCATCAAGGCTGGTATGGTCGTGACTTTTGCCCCCGCTGGTGTCACTACCGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTCTC---CCTGGTGACAACGTCGGGTTCAACGTTAAGAACGTCTCCGTCAAGGAGATTCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTTATCGTCCTGAACCACCCCGGTCAGGTCGGTGCTGGTTACGCCCCAGTGTTGGACTGCCACACCGCCCACATTGCCTGCAAGTTCTCTGAGATCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCCATCGAGAACAACCCCAAGTTCATCAAGTCTGGCGATGCCGCCATCGTCAAGATGGTGCCCTCCAAGCCCATGTGTGTCGAGGCCTTCACCGATTACCCACCG Laurera_megasperma_AFTOL_2094 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATCAATAAGTGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCATCAGCTCAAATTTGAAATCTGCCAGGCCGAGTTGTAATTTGCAGAGGATGTTATGGAA-TCT-GTATG-GACTCAAGTTCTTTGGAAAAAGACGCCATGGAGAGTGACAGTCTCGTGC-TTTC---CGA--TAC--AT-TTTCCATGTATAACTCCTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGACGTAAATTTGTTCCAAAGCTAAATACCGGCTAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCTTATGTCATCAGAAATGGTTTCA-TTGTTCAGCC--------T-TT--------------TG--GTG-TATTCAATGACG-A----C-CAGGCTAGCATCAGTTTGGAC-AGTTGG-ATAAAAGCGT-TAGAAATGTAACT---TCTCCAATGCAGCTCGTCCAGACTGA-GGA-CCGC--TT----T---------AAGGATGCTGGCATAATGGTGGCATGAGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTT-TTTGAGTGACAAA-CTCATGAGCGTAATG-AAAGTGAACGGAGGTAGGAGCCGGCGCACTAT-CGA-CCGGTCTTGATGTCTTCGGATGGATCTGAGTATGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CGTGAG--T-AGGGTGAAGT-CAGAGGAAA--CTCT-GATGGAGGCTCGTCAGCGTCTTAACGTGC--AAATTAGTGCTT-AAACTTGCGCATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TCTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCTC-TTGTTACTTAATTGAACGTGAGCACTCGAATGTAGCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCAAGGTTAAGGTGCCGGAATATACGCTCATCAGACACCACAAAATCTGTCAGTGCATCCAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGCACTGGCGATGAAAATGGA-TGGCGCTT-AA-GCGTATTACCC--ATACCTTGACATCA-TG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Lentithecium_aquaticum_CBS_123099 ------------------------------CGGTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTCTCAGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-CACTTGTCCGGCCGGGCCTTCTCTTCTGGAGAACCTCATGCTCTTCACTG-GGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-GTGTTATTATTTG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCCAGAGGGTGCTTTGGCG-TCG-GCAGC-GGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTC--GCC--TGC--AT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTCGTAGTTGCTCATCCG-GGC---T-CT-------T--GCC-CG--GAG-CACTCTTCTGC-GA----G-CAGGCCAGCATCAGTTTGGGC-GACCGG-ATAAAGGCCT-CTGTCATGTATCT---TCCTTAATGCGGCCAGCCCGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCG-A-CT-ATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCAGGACTTCAACGTGCAGATGGCCATCAAGGCTGGCATCATCACAAACGGCCTCAAGTACTCGCTGGCCACCGGCAACTGGGGCGACCAGAAGAAGGCTGCATCAGCCAAGGCGGGTGTCTCGCAAGTTCTGAACCGCTATACCTACGCTTCCACCCTGTCCCATCTTCGACGAACGAACACACCCGTGGGCCGTGACGGCAAGCTGGCAAAACCGCGACAGCTTCACAACAGTCATTGGGGTCTCGTTTGCCCCGCCGAGACGCCTGAAGGACAAGCATGCGGGCTGGTGAAGAACCTGTCCCTGATGTGCTACGTCAGTGTCGGCAGCGAGAGT---------GCACCTATCACCGATTATATGACGGGACGTAACATGGAACTCCTAGAAGAGTTCGACCCGTCTTCGAATGCGCAAGCCACAAAGGTGTTTGTGAACGGTGTCTGGGTAGGAACTCACCGCAACCCAGCGCAGCTAGTGTCGAAGGTGCAAGAGCTTCGACGAGAC---GGCACGCTCTCGTACGAAATGAGTCTGGTGCGAGACATTCGCGACCGCGAATTCAAGATCTTCACCGACGCCGGCCGTGTCATGCGGCCGCTTTTCGTGGTTGAGCATGACGTTCGCAAGCCGAACTCGGGGCAACTGTTATTCACCCGCGATCATCTCAACAGACTGCTCTCCGACAGCTTCAATGATGAAGAC------ACGATGGAG------ATGAAGTATGGGTGGCGA---GGGCTTCTCCACGATGGATGCGTGGAATACCTTGATGCCGAAGAAGAAGAATCCGCTATGATCGTTATGTCGCCCGAGGATCTTGATGAATGGCGAGAGATG---AAAGCAGGAAACCCT------CCGACGGCTGCCGACAAGCGTCTAGCTCCTATCAAGCCGCCACCCAACAAAAAGATTGCCGCATACACGCATTGCGAGATTCATCCAGCCATGATTCTTGGTATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTCTCGCCTACACCCTGGGTGTGAAGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGTCCCGCTTCCAGGAGATTATCAAGGAGACCTCCAACTTCATCAAGAAGGTTGGATACAACCCCAAGCACGTCCCCTTTGTCCCCATCTCTGGCTTCAACGGCGACAACATGATCGAGCCCTCTCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACA---------------AAGTCC---AAGTCCACTGGCAAGACCCTCCTCGAGGCCATCGATGCCATTGATCCCCCGTCCCGTCCCTCCGACAAGCCCCTCCGCCTGCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACTGGCATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTGACCACTGAAGTCAAGTCCGTGGAGATGCACCACGAGCAGCTTGTCGAGGGTGTC---CCGGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGCAGGACCCGCCCAAGGGTGCTGAGTCCTTTAACGCTCAGGTCATCGTCCTTAACCACCCCGGTCAGGTCGGTGCCGGTTACGCTCCCGTCCTCGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGATCGCCGTACCGGCAAGTCGGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATGATTCCCTCCAG------------------------------------- Lentithecium_arundinaceum_CBS_619_86 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTCTCAGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-CACTTGTCCGGCCGGGCCTTCTCTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-GTGTTATTATTTTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTGTTTGGGT------------------------------------------------------------------------------------------------------------CAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGTG-TTG-ACAGC-GGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCC--GCT--TGC--CT-CCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCACCCG-GAC---T-TT-------T--GCC-CG--GGG-CACTCTTCTGC-GG----G-CAGGCCAGCATCAGTTTGGGC-GACCGG-ATAACGGCCT-CTGTCATGTATCT---TCCTCAATGCGGCCAGCCTGGACTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATCTCCAGCGGTGTGTGGAGAACAACCAGGACTTTAACGTGCAGATGGCTATCAAGGCCGGTCTCATTACCAACGGTCTCAAGTACTCGCTGGCTACGGGCAACTGGGGCGACCAGAAAAAGGCCGCTTCGGCCAAGGCCGGTGTCTCACAGGTGCTGAATCGCTACACCTACGCCTCCACCTTATCCCATCTTCGACGAACGAACACGCCCGTAGGTCGTGACGGCAAGCTGGCGAAACCCCGACAACTCCACAACAGTCATTGGGGTCTTGTGTGTCCTGCTGAGACGCCCGAAGGACAGGCTTGCGGTTTGGTGAAGAATTTGTCACTCATGTGCTATGTCAGTGTCGGCAGCGAGAGT---------GCCCCAATCACAGATTACATGATAGGCCGCAACATGGAACTTCTGGAAGAATTCGACCCGTCGAACAACGCTACAGCTACAAAGGTGTTTGTCAACGGTGTCTGGGTAGGCACCCATCGCAACCCCTCGCAGCTTGTTTCAAAGGTTCAAGAGCTTCGGCGAGAC---GGCACGCTGTCATACGAAATGAGTTTGGTCCGCGACATTCGCGACCGTGTATTCAAGATATTCACCGACGCTGGACGTGTCATGCGACCACTCTTTGTAGTGGAGCATGATGTCCG-CAACCGAATTCTGGACAGCTTTTGTTCACCCGGAATCATCTCGAAAGACTGCTTGCCGACAGC------TT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Lentithecium_fluviatile_CBS_122367 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGGA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCTCCTTGGTGATTCATAATAACTTCTCAGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-CACTTGTCCGGCCGGGCCTTCTCTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCG-GTGTTATTATTTTGACTCGCTCGGCACCTTACGAGCAAATA-CAAAGT-----------------------------------------------------------------------------------------------------------------ACCACATGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGT-GGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCG-TCG-GCAGC-GGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTC--GCC--TGC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCCGCCAGACTTGCCCGTAGTTGCTCATCGG-AAC---TCTT-------T--GCT-CC--GAG-CACTCTTCTGC-GG----G-CAGGCCAGCATCAGTTTGGGC-GACCGG-ATAAAGGCCT-CTGTCATGTATCT---TCCTTAATGCGGCCAGCCCGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTCTCGCCTACACCCTGGGTGTGAAGCAGCTCATCGTCGCCATCAACAAGATGGACA-CATTAAGGGGTCCGAGTCCCGTTTCCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTCCCCTTCGTCCCCATCTCAGGCTTCAACGGCGACAATATGATCGAGCCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGTCC---AAGTCCACTGGCAAGACCCTCCTCGAGGCCATTGATGCCATCGACCCCCCCTCCCGTCCCTCCGACAAGCCCCTCCGCCTGCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACTGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAGATGCATCACGAGCAGCTTGTTGAAGGTGTT---CCGGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTTAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACTCCAAGCAGGACCCCCCGAAGGGTGCTGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAAGTCGGTGCCGGTTACGCTCCCGTCCTCGATTGCCACACCGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGCAAGTCGGTCGAGAACAGCCCCAAGTTCATCAAGTCTGGTGACGCCGCTATCGTCAAGATGATTCCCTCTAAGC----------------------------------- Lepidosphaeria_nicotiae_CBS_101341 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-GGTCCGAGTTGTAATTTGTAGAGGGCGCTTTGGCG-TTG-GCCCT-GGCCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAACCCCGTACGTGGCC--GGT--GGT--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCG-GGC---T-TC-------C--GCC-CG--GTG-CACTCTTCTGC-GG----G-CAGGCCAGCATCAGTCCAGGC-GGCCGG-ATAAAGGCCT-TGGGAATGTGGCT---CCCTTAATGCGGCCAGCTTGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGGGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCCCGCCGCCA-GGGCAGAA-T-TT-ATGCCCTGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTGCATCTGCTAAAGCTGGTGTCTCCCAGGTGCTCAATCGTTACACTTACGCTTCTACGCTCTCTCACTTACGCCGAACGAACACGCCAGTTGGCCGTGACGGCAAGCTGGCCAAACCGCGACAGCTACACAACACTCACTGGGGTTTGGTGTGTCCCGCCGAGACTCCGGAAGGGCAAGCTTGTGGCTTGGTCAAGAATCTTTCGTTGATGTGCTACGTCAGTGTTGGTAGCGAGAGC---------ACACCCATCACCGATTTCATGAGCCAGCGAAACATGGAACTTCTTGAGGAGTACGACCCTATAATCAACCCGACCGCTACGAAAGTGTTTGTTAACGGTGTGTGGGTGGGTGTCCATTCTCAGCCTTCTCAGCTTGTGTCTGTCGTGCAAGAGCTCCGAAGGAAT---GGCACGTTGTCTTATGAAATGAGTTTGATTCGAGACATTCGAGATCGGGAGTTCAAGATCTTCACAGATGCAGGTCGAGTCATGAGGCCGTTGTTCGTTGTTGAAACGGACTATCGTAAGCCTAATCGTGGAAGCTTAGTCCTTGACAAGAGTCATATCCAGAAGCTTGAGGAGGATAAGTACAACGATGAGGAT------ACTGCCACC------ATGACGTTTGGCTGGAAA---GGCCTTATTCAGAGTGGTGTGGTTGAGTATCTAGATGCGGAAGAGGAAGAAACGGCCATGATAGTCATGAGTCCCGAGGACCTTGAAGAGCATCGAGATCTA---ATGCAAGGTATACCA------CAGGTTGAGGGTCAGGATCAACATAGGCGCATCAAGCCGAAGCCAAACCCTTCAATCAAGACCTACACTCACTGCGAGATTCACCCAGCTATGATTCTTGGCATTTGCGCCAGTATCATTCCCTCCCCG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTCGCCTACACTCTTGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGAGCGTTTCAACGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGACC---AAGTCCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATTGACCCCCCTAGCCGTCCCTCCGACAAGCCCCTCCGCCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTCCCTGTCGGTCGTGTTGAGACTGGTGTAATCAAGGCGGGTATGGTCGTCACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCATCACGAGCAGCTTAGTGAGGGTGTT---CCCGGTGACAACGTCGGCTTCAACGTGAAGAACGTCTCTGTCAAGGAGATCCGCCGTGGTAACGTTGCTGGTGACTCCAAGAACGATCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTTATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCCCCAGTTTTGGACTGTCACACTGCCCATATCGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATCGACCGCCGAACTGGCAAGTCTGTTGAGAGCAGCCCCAAGTTCATCAAGTCTGGTGACGCTGCTATCGTCAAGATGATTCCCTCTAAGCCCATGTGCGT------------------------- Leptosphaeria_biglobosa_CBS_303_51 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-GGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCG-TTG-GCAGC-GGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTC--GCT--GGT--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCG-GGC---T-TT-------T--GCC-CG--GTG-CACTCTTCTAT-AG----G-CAGGCCAGCATCAGTTTGGGC-GGTTGG-ATAAAGGTCT-CTATCACGTACCT---CTCTTCATGCAACCAGCCTGGACTGA-GGT-CCGCG-CA----T-T--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAACGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGCGCACCAT-CGA-CCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCAT-GGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCCCGCCGCCG-GGGCAAAGAT-TTAAAGCCCCGGCGAGTAGGC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATTGCGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTTCTTGCCTACACCCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGCTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCATTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGTCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGACC---AAGTCGACTGGCAAGACCCTGCTCGAGGCTATTGATGCCATCGACCCTCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTTGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTTCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATTGATCGCCGTACCGGAAAGTCTGTTGAGAACTCCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACTGACTACCCTCCT Leptosphaeria_doliolum_CBS_505_75 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTAATAGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCAT-GGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTG-TACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTTACTG-GGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTTGG------------------------------------------------------------------------------------------------------------ACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTAG-GGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCG-TTG-GCAGC-GGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTC--GCT--GGC--CT-TCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCA-GGC---T-TT-------T--GCC-TG--GTG-CATTCTTCTAT-GG----G-CAGGCCAGCATCAGTTTGGGC-GGTTGG-ATAAAGGTCT-CTGTCATGTACCT---CCTTTCATGCAACCAGCCTGGACTGA-GGT-CCGCG-CA----T-T--C--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAACGCGCAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTACACCCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCTTCCTTCATCAAGAAGGTCGGTTACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGATCGACAACTCCCCCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGACC---------------AAGACC---AAGACCACCGGAAAGACCCTCCTCGAGGCCATTGATGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGCCTTCCCCTCCAGGATGTGTACAAGATTGGTGGCATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTT---CCCGGTGACAACGTAGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCTCCCGTTCTCGATTGCCATACCGCCCATATTGCGTGCAAGTTCTCCGAGCTCCTCGAGAAGATTGACCGCCGTACCGGTAAGGCCACCGAGACCAACCCCAAGTTCATCAAGTCTGGTGATGCTGCCATCGTCAAGATGGTGCCATCCAAGCCCATGTGCGTTGA---------------------- Leptosphaeria_dryadis_CBS_643_86 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAGCGGCAACAGCTCAAATTTGAAATCTAG-AGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCG-TTG-GCAGC-GGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTC--GCT--AAC--CT-TCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-CAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCG-GAC---T-TT-------T--GTC-CG--GTG-CACTCTTCTAT-AG----G-CAGGCCAGCATCAGTTTGGGC-GGTTGG-ATAAAGGTCT-CTGTCATGTACCT---CCTTTCATGCAACCAGCCTGGACTGA-GGT-CCGCG-CA----T-TTAT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAACGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-GGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AATGCGTGTTACCC--AT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTGTTCCGCATTCTGTTCTTGAAGTTGACCAAGGATGTTTACAAGTACCTACAACGGTGCGTTGAGAACAACACGGATTTCAATGTCCAAATGGCCGTCAAGGCCAGTATCATTACGAACGGCCTGAAGTACTCTCTGGCGACAGGCAACTGGGGTGATCAGAAGAAGGCTGCTTCGGCAAAGGCCGGTGTCTCGCAGGTGCTGAACCGATACACATACGCTTCGACATTGTCCCATCTTCGACGAACAAACACCCCAGTCGGACGTGACGGAAAGTTGGCAAAGCCTCGACAACTCCACAACTCCCATTGGGGCCTTGTTTGTCCCGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACCTGTCCCTGATGTGCTACGTCAGTGTCGGCAGCGACGCC---------ACACCCATTGTTGACTTCATGACGCAGCGCAATATGCAGCTGCTTGAAGAATACGATCAGAACCAGAACCCTGATGCTACAAAGGTCTTCGTTAACGGCGTCTGGGTCGGCGTCCATTCCAACGCTCAACAGCTTGTCTCGGTTGTGCAAGAGCTTCGGAGGAAC---GGAACCTTGTCGTATGAGATGAGTTTGATCCGTGACATTCGTGACAGAGAGTTCAAGATCTTCACTGATGCTGGACGTGTCATGAGGCCATTGTTCGTGGTTGAAAATGATATTCGCAAGCCAAATCGCAAT-AGCTCATCTTCACCAAAGAGATCAGTAAGAAACTTTTGTACGAGCAATGGAGCGAAGAGGAG------ATTGCAGCT------GCGACGTACGGTTGGAAG---GGCCTTATCCAGGACGGTGTGATTGAGTATCTTGATGCTGAGGAAGAAGAGACAGCGATGATAACCTTCTCTCCTGAGGACCTCGACGAATGGCGTGACATG---AAATTGGGACTACCA------CCGAACGAGCGTAAGGATCGTTTGAGGAGACTAAAGCCCAAGCCCGACACACGCATCCACGCTTATACGCATTGCGAGATCCACCCGGCCATGATATTGGGTATTTGCGCCAGCATCATTCCCTTCCCCGATCACAACCAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATTGCGCTATCCTCATCATTGCCGCCGGTACCGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTGCTTGCCTACACCCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGCTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGTTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGTCC---AAGACCACCGGAAAGACCCTCCTCGAGGCCATTGATGCCATCGACCCCCCCAGCCGTCCTACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTTAACCATCCCGGTCAGGTCGGTGCCGGTTACGCACCAGTCCTCGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCCACTGAGAACTCCCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACTGACTACCCTCCT Leptosphaerulina_argentinensis_CBS_569_94 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCA-TTG-GCAGC-GGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTC--GCT--AGC--CT-TTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCG-GGT---T-TC-------T--ACC-CG--GTG-CACTCTTCTAT-AG----G-CAGGCCAGCATCAGTTTGGGC-GGTTGG-ATAAAGGTCT-CTGTCATGTACCT---CCTTTCATGCAACCAGCCTGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGG-T-TAAGCGGCCC-TC--TGAAACACGGA-CAA-GAGTCT-A-AT-TATGC-AGTG--TT-GGTGTC-AG-CCC-A-CGCGTAATG-AAAGTGA-CGGAGG-GGGAACCGG-GC--C-T-C-A-CCGATCCTGAT-T-TT--GA-GGATTTGA-TAA-A-C---A-CT-TT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACAGTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCCCGCCGCTG-GGGCAGGA-T-TT-ATGCCCCAGCGAGTAGGCAGG-------------------------------------------------------------------------------------------------------------------------TCT---TTTGTCGTCAAAATCAAGAAGATTCTTGAGACAGTATGCCACAGCTGTGGTTTGATCCTCGCTGATACCAACCATCCAGATTGGGATCAGGCTATGAAGACGAAGGACGCGAAACGGCGATTTGACAAGATCTGGCGCATGTCTCGA---ACACGGCGAGTGTGTGAGCAAGAC---------ACTACTGAGGAA---CCTCACGGCGGTTGTGGCAACCCGCAGCCTGACACTATTCGCAAAGAAGGCCTCAAGCTTACTGGCACATGGAAA---CAG---AAAAAG---AAGGATGAAGACGATGATCGCAAGGAG---GTCATTACCCCACAAACGGCACTAAACATTTTCAAGCTGCTGTCCGACGAGACGCTTCAGATTCTTGGCCTGAACAAAGACTACGCTCGCCCAGAGTGGATGATCCTTACCGTTCTACCCGTCCCTCCACCACCCGTTCGACCCAGTATTTCTGTTGACGGCACAGGGCAGGGCATGCGTGGCGAGGATGATTTGACCTACAAGCTAGGCGACATTATTCGCGCCAACAGCCGCGTACTGCAATGTATCCAGGATGGCTCACCGCAACACGTTCTTACCGAGTTTGACACCTTACTTCAGTACCATGTAGCAACATACATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTCCTCGCCTACACCCTTGGTGTTAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGCCCGTTTCTCCGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGGCCTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGGCC---AAGGCCACTGGTAAGACCCTCCTCGAGGCCATCGATGCTATCGATGCTCCTAGCCGTCCTACCGACAAGCCTCTCCGTCTTCCCCTCCAGGATGTTTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTTGAGACTGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACTGAGGGTGTT---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGCAGGACCCCCCCAAGGGTGCTGAGTCCTTCAACGCCCAGGTCATCGTCTTGAACCACCCCGGTCAGGTTGGTGCTGGTTACGCCCCAGTTCTCGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACCGACTACCCCCCT Leptosphaerulina_australis_CBS_317_83 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-TACTTGTCCGGCCGGGCCTTTCCTTCTGGAGAACCTCATGCCCTTCACTG-GGTGTGCTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCA-AA----------------------------------------------------------------------------------------------------------------------CAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCA-TTG-GCAGC-GGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTC--GCT--AGC--CT-TTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCG-GGT---T-TC-------T--ACC-CG--GTG-CACTCTTCTAT-AG----G-CAGGCCAGCATCAGTTTGGGC-GGTTGG-ATAAAGGTCT-CTGTCATGTACCT---CCTTTCATGCAACCAGCCCGGACTGA-GGT-CCGCG-CA----T-C--T--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTTGGGTGTCAAG-CCCGAGCGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACTTGTTCCGCATCCTCTTCTTAAAGTTGACAAAGGATGTCTACAAGTACCTACAGAGGTGCGTTGAAAACAACCAAGATTTCAACGTGCAGATGGCTGTTAAAGCCAGCATCATCACGAATGGTCTCAAGTACTCGCTCGCTACGGGAAACTGGGGTGATCAAAAGAAAGCCGCCTCCGCAAAGGCCGGTGTCTCCCAGGTGTTAAACCGATATACTTACGCCTCTACATTATCTCATCTGCGTCGAACCAATACACCAGTTGGTCGTGACGGCAAGCTTGCAAAGCCTCGTCAGCTGCATAACAGTCACTGGGGTCTCGTCTGCCCTGCCGAGACGCCCGAAGGACAGGCTTGTGGTCTAGTCAAGAACTTGTCACTAATGTGCTATGTCAGTGTTGGTAGCGATGCT---------GGCCCAATTTCTGATTTCATGAGTCAAAGGAATATGCTTTTTCTTGAGGAGTACGACCAGAACCAGAATCCCGATGCTACCAAAGTCTTCGTCAACGGTGTATGGGTTGGTGTGCATTCCAACGCACAGCAGCTTGTGTCAACTGTACAAGAACTGCGACGAAAC---GGAACGCTGTCATACGAAATGAGTTTGATTCGAGACATTCGTGACCGTGAGTTCAAGATTTTCACAGATGCTGGACGTGTTATGAGGCCTTTATTCGTCGTGGAAAGCGATGTCCGCAAGCCCAACCGCAACCATCTCGTTTTCAGTCAAGAACACTACAACAAGCTCGTTGCAGAGCAGATCGGCGAAGAAGAG------AAGACCGAA------CTCACTTATGGCTGGAAG---GGGCTCATCCAGGACGGTGTTATCGAGTACCTCGACGCAGAAGAGGAAGAGACTGCTATGATTGTCATGTCGCCCGAAGATCTTGGCGAGTGGCGTGACATG---AAGATGGGCATCCCA------CAAGATGTTCGCAAAGACCGTCTTGCGCGCATCAAACCAAAACCGGTTCCGCGCATCCACGCCTACACACATTGCGAGATTCATCCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCCTACACCCTTGGTGTC-AGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGCCCGTTTCTCCGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACC---------------AAGGCT---AAGGCCACTGGTAAGACCCTTCTCGAGGCCATCGATGCTATCGACCCCCCCACACGTCCTACCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTTTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCTCCCGCTGGTGTCACCACTGAGGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGCTGAGGGTGTT---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTTTCCGTAAAGGAAATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGGCTGACCCCCCCAAGGGTGCTGAGTCTTTCAACGCCCAGGTCATCGTCCTGAACCACCCCGGTCAGGTTGGTGCCGGTTACGCCCCAGTCCTCGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGA-------------------------------------------------- Leptosphearia_maculans_DAOM_229267 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCAT-GGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTG-TACTTGTCCGGCCGGGCC-TTCCTTCTGGAGAACCTCATGCCCTTCACTG-GGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCG-ATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCA-AAGTTTTT-GGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGCGT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTG-TTTGGGTGTCAG--CCCGGACGCGTAATG-AAAGTGAACGGAGGTGGGAACCGGTGCACCAT-CGA-CCCATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCAT-GGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CTTGAA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGCATAGGGGCGAAAGACTAATCGAA-CT-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTG-AAAC-AACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGTTACCC--ATACCCCGCCGCCG-GGGCAAGA-T-TT-AAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG-----------------------------------------------------------------------GGTC-CATTGAGCTGGCCACGCCCGTCTTCCATGTTGGA---TTCGTCATCAAGATCAAGAAGATCCTTGAGACCGTCTGCCACAACTGTGGGCTAATCCTGGCTGACTTCAACCGCCCAGAATGGCAAGCGGCTATCAAGACCAAGGACGCAAAGAAGCGTTTCGAGAAGATCTGGCGCCTGTCCAAG---ATTCGAACAAGATGCGAGCAGACT---------GCAGAAGATGATATTCCTCACGGCGGTTGTGGTAGTGACGCACCCGATGCCATTCGCAAGGAGGGCCTAAAGCTCACAGCTACCTACAAG---AGC---AAGAAG---AAGGACGAAGACGATGACCGCAAGGAG---CCGATTACTCCGCAGCTTGCCCTCAACATCTTCAAGCTCCTATCCGACAACACTCTTCAGCTGTTAGGACTCAACGCTGACTACGCCCGTCCGGAATGGATGATTCTTACCGTTTTGCCAGTTCCACCACCCCCGGTCCGTCCTAGTATCTCGGTCGATGGCACTGGTCAGGGCATGCGCGGAGAGGACGATTTGACTTACAAGCTCGGCGATATCATCCGTGCCAATGGGCGTGTACAGGAGTGTATACAAGAGGGATCGCCACAGCACGTCCTGAACGAGTTTGAAGCTCTCGTCCAATACCACGTCGCTACTTACATGGACAACGACGCCAATGGTGTTCCACAGGCCATGCAAAAGTCCGGTCGACCTTTGAAGACAATCCGAGGCCGCTTGAAGGGCAAGGAGGGCCGTCTACGTGGTAACTTGATGGGCAAGCGTGTCGACTTTTCTGCACGTACCGTCATTACTGGTGATCCAAATTTATCGCTTGACCAAG-GGG-GTACCGCGCTCAATCGCACGAACTCTCACCTACCCCGAGGTGGTTACAAAGTTCAACATCAGCAAACTCACTGCCCTGGTTCGCAATGGGCCCAACCAACATCCTGGTGCCAATTATGTCATCAAGGCCGATGGCGTACGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGGCGAAGCTGGCGGTATCACAGGTGCTGAACCGATACACGTATGCCTCTACCCTCTCTCATCTTCGTCGAACAAACACTCCGGTTGGTCGAGATGGCAAGTTGGCAAAGCCGCGTCAGCTGCACAACTCTCACTGGGGTCTTGTGTGTCCGGCTGAGACCCCTGAGGGCCAGGCTTGTGGTTTGGTCAAGAACTTGTCCCTGATGTGCTACGTCAGTGTCGGCAGCGACGCA---------TCGCCTATCATCGACTTCATGACACAGAGAAACATGCAGCTTCTCGAAGAGTACGATCAAAACCAAAGTCCGGATGCTACCAAGATCTTTGTAAATGGTGTCTGGGTCGGCGTACATTCGAATCCTCATCAGCTTGTGTCGGTGGTGCAAGAACTCCGGAGGAAC---GGTACCCTGTCCTACGAAATGAGTCTGATTCGAGACATCCGTGACCGTGAATTCAAGATCTTTACGGATGCTGGTCGGGTCATGCGGCCGTTATTCGTTATTGAAAATGACATTCGAAAGCCAAATCGTCATCAGCTTATCTTTACCAAGGAGATTAGTAGAAAGCTCACGTACGAACAATGGAGTGAAGAGGAT------ATTGCAGCT------GCGACATACGGCTGGAAG---GGACTTATTCAGGATGGTGTTATCGAGTACTTGGATGCAGAGGAGGAAGAGACCGCTATGATCACCTTCTCACCTGAAGACCTGGATGCATGGCGGGATATG---AAGACAGGTCGTGCA------CCTGATGAGAGAAACTTCCGTCTCAGTAGC---A----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCTCTCCTTGCCTACACTCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCAGGAAATCATCAAAGAGACCTCCAACTTCATCAAGAAGGTTGGATACAACCCCAAGCACGTTCCTTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGTCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGATC---------------AAGAGC---AAGGTCACTGGTAAGACCCTGCTCGAGGCCATTGACGCCATTGACCCTCCATCCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGACGTGTACAAGATCGGCGGTATTGGCACGGTTCCCGTTGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTGACCTTCGCCCCCGCTGGTGTTACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTTGAGGGTGTT---CCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTCTCGGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCTGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCAGTTCTTGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTTCTCGAGAAGAT---------------------------------------------------------------------------------------------------------------------------- Leptoxyphium_fumago_CBS_123_26 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTA-CCTTACTACAT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTCACGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTT-GGGCTTCATGGTGAATCATAATAACTTAACGAATCGCAT-GGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTG-TACTGGTCCGGCCGGGCCTTTCCTTCTGGGGAACCGCATGCCCTTCACTG-GGCGTGTGTGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGGG-GTGTTATCATTTTGACCTCCTCGGCACCTTACGAGAAATCA-AAGTCTTTGGGT----------------------------------------------------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGCAAAAGCTCAGATTTGAAATCTGG-CGTCCGAGTTGTAATCTGTAGAGGATGCCTTTGGG-TGG-CCACC-GGTCTAAGTCCCCTGGAACGGGGTGTCACAGAGGGTGAGAATCCCGTATGTGACC--GGG--AAG--GC-GCCCTATACATGGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGT-TAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTGGCGG-TGTTCCGCCG-GTC---T-TC-------T--GAC-CG--GTC-TACTC-ACCGT-CT----G-CAGGCCAGCATCATCTGGGGC-CGCTGG-ATAAAAGCGG-AGGGAATGTGGCT---CCTC-AATACAGCGAGTCCCGGGTGA-GGT-CCGCG-CT----T-C--G--GCTAGGATGCTGGCGTAATGGTCGTAAGCGGCCCGTC-TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTG-TTCGGGTGTCAAA-CCCCTACGCGTAATG-AAAGTGAACGGAGGTGGGA-CCGGTGCACCAT-CGACCCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT-AGCTGTT-GGGA-CCCG-AAAGATGGTGAACTATG-CCTGGA--T-AGGGTGAAGC-CAGAGGAAA--CTCT-GGTGGAGGCTCGCAGCGGTTCTGACGTGC--AAATCGATCGTC-AAATTTGGGTATAGGGGCGAAAGACTAATCGAA-CC-ATCTAGTAGCTGG-TTCCTG-CCGAAGTTTCC-CTCAGGATAGCAGTAAC-G-TTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTG-AAAC-AACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCC-TTGTTACTTAGTTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAAC-GTGGGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGA-TGGCGCTC-AA-GCGTGCTACCC--ATACCCCACCGCCG-GGGTAGAA-A-CG-ATGCCCCGGCGAGTAGGCAGG-----------------------------------------------------------------------------------------------AGACTGCGGTTCCTGTCTTCCACGTTGGT---TTCATCGTGAAAATCAAGAAGATCTTAGAATCAGTTTGTCACAACTGTGGCAAACTCCTTCAAGACGAGCGAAACCCTGCCTTCAAACAGGCAATTTCCCTGCGAGACCCCAAGCGTCGGTTTGAAGCTGTACACAAGCTATGCAAA---GGCACCAAGGTTTGCGAGGCAGAT---------CAGCCTGATGATAAAGGCCATGGTGGGTGTGGCAACGCAATGCCTGTC---ATCAGAAAGGACGGTTTGAACCTCAACGGTACCTGGGAA---CCT---ACCAAG---CAGGAGCAAGAGGAAAAGGAGACTAGA---CAAATTATGCCTTCGGATGCTCTCAAGGTTTTCCGCCTGATTTCCGACTTGGACATGATCCGTCTCGGATTGAACGTCGAGTATGCTCGTCCAGAATGGATGATTCTGACTGTGCTACCAGTTCCCCCACCTCCTGTGCGGCCCTCAATCTCAGTCGATGGTACAAACCAGGGTATGCGGTCAGAAGACGATCTGACATACAAGCTCTCAGACATCATTCGCGCAAACAGCAATGTCAAACGCTGCGAGCAGGAAGGTTCACCTCAGCACGTGGTGAATGAATCATCCAACTACTCCAGTTC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATATTCAGAATGAAATTCGCCCAGTTGAAGAACGACATGCAGCAATATCTCGTGAGAGCAATTGAGAGCGGTAGGGATTTCAACGTCAACTTGGCTTGCAAAAGCAACATCATTACTTCTGGTCTCCGCTACAGCTTGGCTACAGGAAACTGGGGTGATCAGAAAAAAGCAATGTCTACAAGGGCAGGTGTCAGTCAGGTGTTGAATCGCTTCACATACGCCTCAACGTTGTCACATTTACGGCGTACAAATACTCCCATTGGTCGAGATGGTAAGATTGCCAAACCTAGACAGTTGCACAACACGCACTGGGGATTGGTCTGCCCAGCTGAAACACCTGAGGGTCAAGCCTGCGGTTTGGTCAAGAACTTGGCTCTGATGTGTTACGTAAGCGTTGGAACACCAGGA---------ACTCCCCTCGTGGAATTCATGCAACAAAGAGACATGGAGTTGTTGGAAGAGTACGATCCTGTCACCAATCCGAATGCTACCAAAGTCTTCGTCAACGGCGTCTGGGTTGGCGTTCACAAAAACCCGACACAGTTGATCGAGACGCTGCGCGAAATTCGACGAAGA---GGAACTGTCAGTTTTGAAATCACGATCATTCGTGACGTTCGTGAGAGGGAGATCAAGGTCTTCACCGATGCTGGCAGAGTTTGTCGACCTCTCTTTGTTGTTGATAACAACCCACGATCTGAACACAAGGGCCAACTGGCTCTCAGACGTGAGCATGTTGAAAGGCTTCAGGATGATCGCCTCTCGGAAGAAGAA------CGCGATGAA------AGAATCTTTGGATGGAAA---GGCTTGGTCAAGGAAGGTGTCGTTGAGTATTTGGACGCCGAAGAAGAGGAGCAAGCCATGATCACAATGTCACCAGACGATCTTGATGAGCATACCAAACTG---ATGCAACACGGCAAT------GTGATTCATGAAGAAGATCCGCATCGCCGTATCAAGGCAAAACCAAGTTCTGCCGTGAGCATGTATACCCATTGTGAGGTTCATCCGGCTATGATCTTGGGCGTCTGCGCATCGATCATTCCCT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATTGCGCTATCCTCATCATTGCCGCCGGTACCGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTGCTCGCCTTCACCCTCGGTGTGAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGACCGTTACAACGAGATCATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTTCAACCCAAAGCACGTCCCATTCGTGCCAATCTCCGGTTTCAACGGTGACAACATGATCGAGCCATCCACCAACTGCCCATGGTACAAGGGTTGGGAGAAGGAGACC---------------AAGGCC---AAGGCCACTGGCAAGACCCTCCTCGAGGCCATCGATGCCATCGACCCACCTCAGCGTCCAAGTGACAAGCCTCTCCGTCTTCCTCTCCAGGATGTGTACAAGATTGGTGGTATTGGCACGGTTCCTGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCAGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGCCGAGGGTCTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGCAGGACCCACCAAAGGGCTGTGACAGCTTCAACGCCCAGGTTATCGTCCTTAACCACCCTGGTCAGATTGGCGCTGGTTACGCTCCAGTCCTCGACTGCCACACTGCTCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGCAAGTCCATTGAGGCCAGCCCCAAGTTCGTCAAGTCTGGTGACGCCGCCATTGTCAAGATGATTCCATCCAAGCCAATGTGCGTTGAGGCTTTCACTGAGTACCC---- Letendraea_helminthicola_CBS_884_85 AAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATA-CCTTACTACTT-GG-ATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTCTCAGATCGCACGTGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATTCCGACTTGGAGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTG-CACTTGTCCGGCCGGGCCTTTTCTTCTGGAGAACCGCATGCCCTTCACTG-GGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTA-TTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAA