#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 8:16 GMT TreeBASE (cc) 1994-2008 Study reference: Chaverri P., Gazis R., & Samuels G.J. 2010. Trichoderma amazonicum, a new endophytic species on Hevea brasiliensis and H. guianensis from the Amazon basin. Mycologia, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10335] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=23; TAXLABELS Hypocrea_alni Hypocrea_aureoviridis Hypocrea_brunneoviridis Hypocrea_chlorospora Hypocrea_cinnamomea Hypocrea_epimyces Hypocrea_parepimyces Hypocrea_straminella Trichoderma_aggressivum Trichoderma_amazonicum_IB50 Trichoderma_amazonicum_LA90 Trichoderma_catoptron Trichoderma_harzianum_CBS_226.95 'Trichoderma harzianum GJS 00-08' 'Trichoderma harzianum GJS 00-18' 'Trichoderma harzianum GJS 85-119' 'Trichoderma harzianum GJS 90-254' 'Trichoderma harzianum GJS 92-100' Trichoderma_harzianum_dis_218e Trichoderma_harzianum_dis_377a Trichoderma_pleuroticola Trichoderma_pleurotum Trichoderma_virens ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M5233] TITLE TEF; LINK TAXA = Taxa1; DIMENSIONS NCHAR=644; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Hypocrea_alni -CTTCACATCCAATTGTGCTCGATCATTCTGAA-GAGAATCTTCGTGTCG----ACAA-TTTTTC-------------ACCA-CCCCGCT--------TTGGGTTACCCCTCATTT-GCAGCGACGC----AAATTTTTT---TGCTGT-CGTTTG-GTTTTAGTGGGGTCCCTTGT----------GT-A--CCCCACTAGCTCACTGC-----TTTTTTTGTGCTTCACTCTC----ACTGC-TCAGCCATCATTCAGCGCGCTC--------TGTC------------TCTCATCATGCAGCGATGCTAACCAC-TTTTCCATC-AATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGCGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTGCTACA--TCAACTTCATGCTGCGATTGCGAGCCAGTG--CTAACAGACAATT--CTCAGACGCCCCCGGCCACCGTGATTT-CATCAAGAACAT-GATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTGAG Hypocrea_aureoviridis --TCGGGCCTCGATTGTGACGAGCAATTCTTCA-TCGAATTCCCTTGTCA----ACGA-GTTTCC-------------GTCA-CCCCGCTTTCACACTGCCCATTACCCCTCCTTT-GCTGCGGCGT---GCAATTTTTTTTTTGGCAG-CCTTCA-TTTTTAGTGGGACTGCACCA----------GC-T-GCTCCGCCACTGTTCAAC---AGCTTATTGCAACCTCATTGCCTCTTACCTC-GTCAATTCCATTCGA-ACGCTT------TTAATC------------ATCC--CTCTCAGTGATGCTAACCATCTTTCCCATC-AATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATTGCTCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TCTGCCTCATGACTCTTTGCTCGCCCTTTGCAAGCCTGTA--CTGATGCGAGTTTTGTACAGACGCTCCCGGCCACCGTGATTT-CATCAAGAACAT-GATCACTGGTACTTCCCAGGCCGATTGCGCCGTTCTCATCATTGCCGCCGGTACTGGTGAGTGAG Hypocrea_brunneoviridis -CTTCACATTCAATTGCGTCCGACAATTCTGAA-GGGAATTTTCGTGTCG----ACAA-CTTTTC-------------ATCT-CCCCGCT--------TTCCGTTACCCCTCCTTT-GCAGCAACGC--AAAATTTTTTT---TGCTGTGCTTTTG-GTTTTAGTGGAGTTTCTTGT----------GC-A--CCCCACTAGCTCACTGC------TTTTTTGTGCTTGACTCTC----ACTTCGCCAGTCATCATTCAACGTGTTC------CGTGTC------------TTTGGTCATTCAGCGATGCTAACCAC-TTTTTCATC-AATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTCCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTGCTTCA--TCAACTTTATGCTACAATTGCAAGCCAGTG--CTAACAGGCAATT--CGCAGACGCTCCCGGCCACCGTGATTT-CATCAAGAACAT-GATCACTGGTACTTCCCAGGCCGACTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTGAG Hypocrea_chlorospora -TTCCCCTTCCAATTGTGACGGACAATTCTCAACCGGAATTGTCTTGTCA----ACAA-TTTTGC-------------ATCA-CCCCGCTTT--CACTTCCCATTACCCCTCCTTT-GCAGCGACGC---AAAATTTTTT----GCAGC-C-TCGA-ATTTTAGTGGGGTCGCTTGT----------GC-ATCCCCCACCAACCATTCAC----TGCTTTTTGCCCTCGACTGC-----GTGTG-CCTGTCATCATTCCACGCTCTT--------GATC------------ATCT--CTTTCAGCGATGCTAACCAT-CTTTCCATC-AATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATTGCCCTTTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTTTACGGATCTCATCCCGTTCTTTGTTCGCCAGCCTGTA--CTAATGCCAGTTT--GACAGACGCTCCCGGCCACCGTGATTT-CATCAAGAACAT-GATCACTGGTACTTCCCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTGAG Hypocrea_cinnamomea -ATTCGCATTCCATTATGCCCGACAATTCTGAA-AAGAATTTTCGTGTCA----ACAA-GTTTTG-------------GTCA-CCCCGCT--------TTCGATTACCCCTCGTTT-GCAGCGACGC---AAATTTTTTT----GCTGT-CTTTTG-GTTTTAGTGGGGTTTCCTGC----------GC-A--CCCCACTAGTCAACTGC------TTTTTTGTGCTTCACTTTC----ACTGC-CCAG---TCATTCGACGTG---------------------------------CTTTCACCGATGCTAACCAC-CTTTTCATC-AATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTGATGCA--TCAACCTGATGCGGCGATTGCAAGCCAGTG--CTAACAGATGCTT--CACAGACGCTCCCGGCCACCGTGATTT-CATCAAGAACAT-GATCACTGGTACCTCCCAGGCCGATTGCGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTGAG Hypocrea_epimyces ---------------GTGCTCGATCATTTCGAA-GAGAATTTTCGTGTCG----ATAA-TTCTTC-------------ATCA-CCCCGCT--------TTCCGTTACCCCTCCTTT-GCAGCGACAC-----AATTTTTT---TGCTGT-CGTTGG-GTTTTAGTGGGGTTCCCTGT----------GC-A--CCCCACTAGCTCACTGC----CTTTTTTTGTGCTTCACTCTC----ACTGC-CCAGCCGTCGTTCAACGTGCTC--------TGTC------------TC--GTCATTCAGCGATGCTAACCACTTTTTCCATC-AATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTCCTTCA--TCATCTTGATGCAGCAATCACGAGCCAGTG--CTAACAGGCAATT--CACAGACGCTCCCGGCCACCGTGATTT-CATCAAGAACAT-GATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATCATTGCTGCCGGTACTGGTGAGTGAG Hypocrea_parepimyces -CTCCACATTCAATTGTGCGCGATCATTCTGCA-GAGAATTTTCGTGTCG----ACAA-TGTTTC-------------ATCA-CCCCGCT--------TTCCGTTACCCCTCCTTT-GCAGCGGCGCAAAAAAATTTTTT---TGCTGT-CGTTTG-GGTTGAGTGGGGTTCCCTGT----------GC-A--CCCCACTAGCTCACTGC-----TTTTTTTGTGCTTCACTCTC----ACTGC-CCAGCCGTCATTCAACGTGCTC--------TGTC------------TCTGGTCATTTGGCGATGCTAACCACCTTTTCCATC-AATAGGAAGCCGCCGAACTCGGTAAGGGCTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTCATTCA--TCACCTTGTTGCCGCAATTGTGAGCCGCTG--CTAACAGGCAATT--CGCAGACGCCCCCGGCCACCGTGATTT-CATCAAGAACAT-GATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTGAG Hypocrea_straminella -ATTCGCATTCAATTGTGCCCGACAATTCTGAA-AAGAATTTTCGTGTCA----ACAA-CTTTTC-------------GTCA-CCCCGCT--------TTCCATTACCCCTCCTTT-GCAGCGACGC---AAATTTTTTT----GCTGT-CATTTG-GTTTTAGTGGGGTTTCCTGC----------GC-A--CCCCACTAGTCAACTGC------TTTTTTGTGCTTCACTTTC----ACTGC-CCAGTCATCATTCAACGTGCCC------TACGTC------------GTCA--CTTTCAGCGATGCTAACCAC-TTTTCCATC-AATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTGATTCA--TCAACTTGATGCAGCAATTGCAAGCCAGTG--CTAACAGATGTTT--CATAGACGCCCCCGGCCACCGTGATTT-CATCAAGAACAT-GATCACTGGTACTTCCCAGGCCGATTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTGAG Trichoderma_aggressivum -CTCCACATTCAATTGTGCTCGATCATTCTGAA-GAGAAT-----TGTCG----ACAA-TTTTTC-------------ATCACCCCCGCT--------TTCCATTACCCCTCCTTT-GCAGCGACAC---AAATTTTTTT--TTGCTGT-CGTTTG-GTTTTAGTGGGGTTCCTTGT----------GC-A-CCCCCACTAGCTCACTGC----TTTTTTTTGTGCTTCACTATC----ACTAC-CCAGCCGTCGTTCAACGTGCTC------TGTCTC------------TCGT--CATCCAGTGATGCTAACCACTTTTTCCATC-AATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTCCTTCA--TCACCCCGATGCAGCAATTACAAGCCAGTG--CTAACAGGCAATT--CACAGACGCTCCCGGCCACCGTGATTT-CATCAAGAACAT-GATCACTGGTACTTCCCAGGCCGATTGCGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTGAG Trichoderma_amazonicum_IB50 -CCCCACATGCAATTGTGCCCGACGATTC-GCA-GAGAATTTTCGTGTCG----ACAATTTTTTC-------------ATCA-CCCCGCT--------TTCCGTTACCCCTCCTTTGGCAGCGACGC---AAATTTTTTT---GGCAGT-CGGTTG-GCTCTGGTGGGGTTTCCTGT----------GC-A--CCCCACTAGCCCACTGC--TTTTTTTTTTCTGCTTCACTCTCCCC-ACTGG-CCAGTCATCATTCAACGTGCTC------TATGTC------------TCGC--CATTCAGCAATGCTAACCAC-TTTTCCATCAAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Trichoderma_amazonicum_LA90 -CTCCACATGCAATTGTGCCCGACGATTCTGCA-GAGAATTTTCGTGTCG----ACAATTTTTTC-------------ATCA-CCCCGCT--------TTCCGTTACCCCTCCTTTGGCAGCGACGC---AAATTTTTTT---GGCAGT-CGGTTG-GCTCTGGTGGGGTTTCCTGT----------GC-A--CCCCACTAGCCCACTGC--TTTTTTTTTTCTGCTTCACTCTCCCC-ACTGG-CCAGTCATCATTCAACGTGCTC------TATGTC------------TCGC--CATTCAGCAATGCTAACCAC-TTTTCCATCAAATAGGAAGCCGCC-AACTCGGCAAGGGTTCCTTCAAGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Trichoderma_catoptron -CTTCACATTCAATTGTACCCGACAATTCTGAA-CAGAATTTTCATGTCAAATTATTT-TTTTTC-------------ATCA-CCCCGCT--------TTCCATTACCCCTCCTTT-GCAGCGACGC---AAATTTTTTT---TGCAGT-ATTTTG-ATTTTAGTGGGGTTGCCTCT----------GC-A--CCCCACTAACTTGCTAC------TTGTTTAC-CTTCACAATC----ACTGC-ACAGTCGGCATTCAACGGTCTCCATCCATGCCTT------------TTCA--TTTTCAACGATGCTAACCAC-TTTTCCATC-AATAGGAAGCCGCCGAACTTGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTCATTCA--TCAACTCCATGCAGCAATTGCGAGCCAGCA--CTAACAGAAATTC--CACAGACGCTCCCGGCCACCGTGATTT-CATCAAGAACAT-GATCACTGGAACTTCTCAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTGAG Trichoderma_harzianum_CBS_226.95 -CTCCACATTTAATTGTGCCCGATAATTCTGCA-GAGAATTTTCGTGTCG----ACAA-TTTTTC-------------ATCA-CCCCGAT--------TTGCATTACCCCTCCTTT-GCAGCGACGC---AAATTTTTTT---GGCTGT-CGTTTG-GTTTTAGTGGGGTTTCTCGT----------GC-A--CCCCACTAGGTCACTGC-----TTTTTTTCTGCTTCGCTCTT----ACTGC-CCAGCCATCATTCAACGTGCTC------TGCGTC------------TCATCACTTTCAGCGATGCTAACCAC-TTTTCCATC-AATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Trichoderma harzianum GJS 00-08' CCCTCCAATTCAATTGTGCCCGACGATTCTGAA-GAGAATTTTCGTGTCG----ACAA-TTTTTC-------------GTCA-CCCCGC--------TTTCCATTACCCCTCCTTT-GCAGCGACGC---AAATTTTTTT-?--GGTGT-CTTTTGG?TTTTAGTGGGGTTTCTTGT----------GC-A?-CCCCACTAGCTCACTGCTTTTTTTTTTTTTGGCTTCACTCTC----ACTTC-CCCGCCAT---TCAACGTACTC------TGTGT?------------TTTAGTCATTCAGCGATGCTAACCAC?TTTTCCATC-AATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Trichoderma harzianum GJS 00-18' CCACACCATTCAATTGTGCCCGACAATTCTGCA-GAGAATTTTCGTGTCG----ACAA-TTTTTC-------------ATCA-CCCCGC--------TTTCCATTACCCCTCCTTT-GCAACGACGC---AAATTTTTTTG?--GCTGT-CGTTTGG?TTTTAGTGGGGTTTCTTGT----------GC-A-CCCCCACTAGCTCACTTT----TTTTTCCCCTGCTTCACTCTC----ACTTC-CCAGCCATCATTCAACGTGTTC------TGTGTC------------GTCA??CTTTCAGCAATGCTAACCAC?TTTTCCATC-AATAGGAAGCCGCCGAACTCGGTAAGGGTTCCTTCAAGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Trichoderma harzianum GJS 85-119' CTTTCATATTCAATCGTGCCCGACAATTCTTCA-GAGAATTTTCGTGTCG----ACAA-TTTTTC-------------ATCA-CCCCGC--------TTTCCATTACCCCTCCTTT-GCAGCGACGC---AAATTTTTTTT?--GCTGC-CGTTTGATTTTTAGTGGGGTTCTCTGT----------GCAA--CCCCACTAGCTCACTGC-----TGTTTTTGTGCTTCACTC------ACTTC-CCAGTCACCATTCAACGTGCTCCG----TGTCT--------------TTGGTCATTCAACGATGCTAACCAC?TTTTCCATC-AATAGGAAGCCGCCGAACTCGGTAAGGGTTCCTTCAAGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Trichoderma harzianum GJS 90-254' -CTTCACATTCAATTGTGCCCGACAATTCTGCA-GAGAATTTTCGTGTCG----ACAA-TTTTTC-------------ATCA-CCCCGCT--------TTCCATTACCCCTCCTTT-GCAGCGACGC--AAAAATTTTTT---TGCTGT-CGTTTGGTTTTTAGTGGGGTTCTCTGT----------GCAA--CCCCACTAGCTCACTGC------TTTTTCCTGCTTCACTCTC----ACTTC-CTAGTCATCATTCAACACGCTT------TGTGGC------------TTTGGTCATTCAGCGATGCTAACCAC-TTTTCCATC-AATAGGAAGCCGCCGAACTCGGTAAGGGTTCCTTCAAGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Trichoderma harzianum GJS 92-100' ?CTCCACATTCAATTGTGTCCGACAATTCTGCA-GAGAATTTTCGTGTCA----ACAA?TTTTTC-------------ATCA-CCCCGC--------TTTGCATTACCCCTCCTTT?GCAGCGACGC?-AAAAATTTTTT?---GCTGT-CGTTTG-GTTTTAGTGGGGTTTCTTGT----------GC-A--CCCCACTAGCTCG----------TTTTTTCTGCTTCGCTCTC----ACTTC-CCAGCCATCATTCAACGTATTC------TGTGTC----------TCGTCA--CTTTCAGCGATGCTAACCAC?TTTTCCATC-AATAGGAAGCCGCCGAACTCGGTAAGGGTTCCTTCAAGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Trichoderma_harzianum_dis_218e CCTCCAAATTCAATTGTGCCCGACGATTCTGAA-GAGAATTTTCGTGTCG----ACAA-TTTTTC-------------GTCA-CCCCGC--------TTTCCATTACCCCTCCTTT-GCAGCGACGC---AAATTTTTTT-?--GCTGT-CTTTTGG?TTTTAGTGGGGTTTCTTGT----------GC-A?-CCCCACTAGCTCACTGC--TTTTTTTTTTTGGCTTCACTCTC----ACTTC-CCCGCCAT---TCAACGTACTC------TGTGTC------------TTTGGTCATTCAGCGATGCTAACCAC?TTTTCCGTC-AATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_harzianum_dis_377a CCTCCACATTCAATTGTGCCCGACAATTCTGCA-GAGAATTTTGGTGTCG----ACAA?TTTTTC-------------ATCA-CCCCGC--------TTTGCATTACCCCTCCTTT?GCAGCGACGC?-AAAATTTTTTT?---GCTGT-CGTTTG-GTTTTAGTGGGGTTTCTTGT----------GC-A-CCCCCACTAGCTCACTGC----TTTTTTTCCTGCTTCGCTCTC----ACTTC-CCGGCCATCATTCAACGTGCTC------TGTGTC----------TCGTCA--CTTTCAGCGATGCTAACCGC?TTTTCTATC-AATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Trichoderma_pleuroticola -CTCCACATTCAATTGTGCCCGACGATTCTGCA-GAGAATTTTCGTGTCG----ACAA-TTTTTC-------------ATCA-CCCCGCT--------TTCCGTTACCCCTCCTTTGGCAGCAACGC---AAATTTTTTG--TAGCAGC-CTTTTG-GCTTTGGTGGGGTTTCGCGT----------GC-A--CCCCACTAGCTCACTGC------TTTTTTCTGCTTCACTCTCCC--ACTGC-CCAGTCATCATTCAACGTGCTC------TGTGTC------------TCAC--CATTCAGCGATGCTAACCAC-TTTTCCATC-AATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTGCTCCA--TCATCTTGATGCAGGAATTGCGAGCTGGTG--CTAACAGGTAATT--CGCAGACGCTCCCGGCCACCGTGATTT-CATCAAGAACAT-GATCACTGGTACTTCCCAGGCCGATTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTGAG Trichoderma_pleurotum -CTCCACATTCAATTGTGCCCGACGATTCTGCA-GAGAATTTTCGTGTCG----ACAA-TTGAT--------------ATCA-CCCCGCT--------TTCCGTTACCCCTCCTTTGGCAGCGACGC---AAATTTTTTT--TGGCAGC-CGTTTG-GCTTTGGTGGGGTTTTGTGT----------GC-A--CCCCACTAGCTCGCTGC---TTTTTTTTTCTGCTTCACTCCCCCC-ACTGGCCCAGTCATGATTCAACGTGCTC------TGTGTC------------GC----CATTCAGCGATGCTAACCAC-TTTTCCATC-AATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTGCTGCTCCA--TCACCTCCATGCAGGAATGGCGAGCTGGTG--CTAACAGGTCATG--CGCAGACGCTCCCGGCCACCGTGATTT-CATCAAGAACAT-GATCACTGGTACTTCCCAGGCCGATTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTGAG Trichoderma_virens -CTTCACATTCAATTGTGCTCGACAATTCTGTT-CAGAATCATCGAGGCA----ACAATTTTTTC-------------GTCA-CCCCGCTTTCG----TTCCATTACCCCTCCTTT-GCAGCGACGC---AAAATTTTTT----GCTGC-CTCTAGTTTTTTAGTGGGGGTGCACCA----------GCAA--CCCCACCACTACCTCGC----TGCTCTTTGCCCTCGTCTACC----ACTTC-CCAGTCCTCATTCAACGATCTG------TGTCTC------------GTTA--TTTGCAGCGATGCTAACCAC-CGTTCCCTC-AACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTCG------TCCCATTCAGCCAGCTCCCGTAAACCAGTG--CTAACCAGGATCT--CACAGACGCCCCCGGCCACCGTGATTT-CATCAAGAACAT-GATCACTGGTACTTCCCAGGCCGATTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTGAG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M5232] TITLE ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=680; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Hypocrea_alni -------------------------------------------------ACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATC-TCTGCCCCGGGCGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--CCAAAACTCTTATT-------------GTGTACCCCCTCGCGGG----------TTTATTTATAATCTGAGCC-TTCTCGGCGCCCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTT-CAACAACGG-ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTCCCTCGCG-------GGG--AGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCACCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCC--AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAAGCGG----- Hypocrea_aureoviridis ACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGCTACCAAACCGTTGCCTCGGCGGGATC-TCTGCCCCGGGCGCTTCGCGGCCCCGGACCCAAGGCGCCCCGCCGGAGGAAGAAACAAC--C-AAAACTCCTTTTCCCCATGCCCCTCGCACGCCCCCTCGCGGGCCGCGTCGGGCTCTCTCTCTGAGCAAAAC-TTCTCGGCGCCCCTCACCGGGCGCCTCGAAAATGAATCAAAACTTT-CAACAACGG-ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAGCCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCC-TCCTCCCTCCGCGGGCGGGG-GGCCGGCCCCGAAATTCAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCACCGGGAGCGCGGCGCGTCCAATGCCGTAAAACAACCCAAACCTTCTGGAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAAGCG------ Hypocrea_brunneoviridis ----------------------------AGGA-CATTACCGAGTTTACAACTCCCAAACCCAGTGTGAACGCTACCGAACCGTTGCCTCGGCGGGATC-TCTGCCCCGGGCGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAA--CCGAAACCCTTGAT-------------GTACACCCCCTCGCGGG---------TTTTCCACGTGATCTGAGCC-TTCCCGGCG-CCCCCCGCGGGCGCCCCGAAAACGAATCAAAACTTT-CAACAACGG-ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTACTCTGGCGGGCATGCCTGTCCGAGCGTCATGTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTCCCTC-GC-------GGG--GGCCGTCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCCCCTGCGCAGTAGTTTGCAC-GCTCGCACCGGGAGCGCGGCGCGTCCACGGCCGTTAAACACCC--AACTCTCCGGAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAAGCGG----- Hypocrea_chlorospora --------------------ACTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATC-TCTGCCCCGGGCGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGAAAAACAACCAAAACTCTT-TT-------------GTATACCCCCTCGCGGG----------TTTTCTTACTTCTGAGAAC-TTCTCGGCGCCCCTTAGCGGGCGTTTCGAAAATGAATCAAAACTTT-CAACAACGG-ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTCCCTTCGC-------GGGGCGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCATCGGGAGCGCGGCGCGTCCAATGCCGTAAAACACCC--AACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAA------------ Hypocrea_cinnamomea ---------------------CTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCACTGTGAACGTTACCAAACCGTTGCCTCGGCGGGATCTTCTGCCCCGGGCGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGAACCAA--CCAAAACTC---TT-------------GCATACCCCCTCGCGGG---------TTTTTTCCACAATCTGAGCC-TTCTCGGCG-CCCCTCGCGGGCGTTCCGAAAATGAATCAAAACTTT-CAACAACGG-ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGTCCGGCGTTGGGGATCGGCCCTCCTCTCGC-------GGG--GGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCCCCTGCGCAGTAGCTTGCAC-ACTCGCACCGGGAGCGCGGCGCGTCCACGGCCGTTAAACAACCC-AACTCTCTGGAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATAT--------------- Hypocrea_epimyces -------------------------------------------------------------------------------------CCTCGGCGGGATC-TCTGCCCCGGGCGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--CCAAAACTCTTGTT-------------GTATACCCCCTCGCGGG------TTTTCCTTTTTACTATCTGAGCCTTTCTCGGCGCCCCCTCGTGGGCGTCTCGAAAATGAATCAAAACTTT-CAACAACGG-ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTCCCTCGCG-------GTG--GGCCGTCTCCGAAATCCAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCACCGGGAGCGCGGCGCGTCCACGGCCGTTAAACACCC--AACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAAGCGG----- Hypocrea_parepimyces ---------------------------------CATTACCGAGTTTACAACTCCCAAACCCAATGTGAACATTACCAAACCGTTGCCTCGGCGGGATC-TCTGCCCCGGGCGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--CCAAAACTCTTATT-------------GTATACCCCCTCGCGGG-TTTTCATTTTATCTTTACTATCTGAGCC-TTCTCGGCGCCCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTT-CAACAACGG-ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTCCCTCGCG-------GTG--GGCCGTCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCACCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCC--AACTTTCCGAAACGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAAGCGG----- Hypocrea_straminella ---------------------CTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGAATCAA--CCAAAACTCTTATT-------------GTATACCCCCTCGCGGG-----------TTTTTTATAATCTGAGCC-TTCTCGGCG-CCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTT-CAACAACGG-ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCC-TCCTTTA-C-------GGG--GGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCC--AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCA------------- Trichoderma_aggressivum ACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATC-TCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--CCAAAACTCTTATT-------------GTATACCCCCTCGCGGG---------TTATTTTTACTATCTGAGCC-TTCTCGGCG-CCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTT-CAACAACGG-ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTCCCTC-GC-------GGG--GGCCGTCTCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCACCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCC--AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCCGCTGAACTTAAGCATATCAATAAG-------- Trichoderma_amazonicum_IB50 ----------------------AGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATC-TCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--C-AAAACTCTTATT-------------GTATACCCCCTCGCGGG-----------TTTTTTATAATCTGAGCC-TTCTCGGCG-CCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTT-CAACAACGG-ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTCCCTCTGC-------GGG--GGCCGTCTCCGAAATCCAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCACCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCC--AACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCC-------------------------------- Trichoderma_amazonicum_LA90 -----------------------------------TTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATC-TCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--C-AAAACTCTTATT-------------GTATACCCCCTCGCGGG-----------TTTTTTATAATCTGAGCC-TTCTCGGCG-CCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTT-CAACAACGG-ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTCCCTCTGC-------GGG--GGCCGTCTCCGAAATCCAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCACCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCC--AACTTTCTGAAATGTTGACCTCGGA------------------------------------------------- Trichoderma_catoptron ---------------------CTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACCGTTGCCTCGGCGGGATCTTCTGCCCCGGGCGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--CAAAAACTCCCTTC-------------GCATGCCCCCTCGCGGG----------TTTTTTCACAATCTGAGCC-TTCTCGGCG-CCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTT-CAACAACGG-ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCCCC--GGGGGGTCGGCGTTGGGGATCGGCC-TCCCTCTGC-------GGG--GGCCGTCTCCGAAATGCAGTGGCGGTCCCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCACCGGGAGCGCGGCGCGCCCACAGCCGTTAAACACCCCAAAC--TCCGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATA-------------- Trichoderma_harzianum_CBS_226.95 ---------------------------------C---ACCGAATTTA-AACTCCCAAACCCAATGTGAACGTTACCAAACTG-TGCCTCGGCGGGATC-TCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAAGACCAAC--CTAAAACTCTTATT-------------GTATACCCCCTCGCGGG--------TTTTTTTTTATAATCTGAGCC-TTCTCGGCG-CCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCCAACAACGGAATCTCTTGGTTCTGGCATCGATAAAGAACCCACCAAAATGCAATAAATAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTCCCTTAGC-------GGG-TGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCC--AAC-TTCTGAAATGTTGACCTCGGAT------------------------------------------------ 'Trichoderma harzianum GJS 00-08' --AAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATC-TCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--C?AAAACTCTTATT-------------GTATACCCCCTCGCGGG?????-----TTTTTTTATAATCTGAGCC?TTCTCGGCG-CCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTT?CAACAACGG?ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTCCCTTAGCG------GGT--GGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCC?-AAC?TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGC------------------- 'Trichoderma harzianum GJS 00-18' --???????CCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGAT?-T?TGCCCCGGGTG?GT?GCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--C?AAAACTCTTATT-------------GTATACCCCCTCGCGGG-----TTTTTTTTTTTTATAATCTGAGCC?TTCTCGGCG-CCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTT?CAACAACGG?ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTCCCTTAGCG------GGT--GGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCC?-AAC?TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGC------------------- 'Trichoderma harzianum GJS 85-119' --AAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATC-TCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--C?AAAACTCTTTTT-------------GTATACCCCCTCGCGGG-----??????TTTTTTATAATCTGAGCC?TTCTCGGCG-CCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTT?CAACAACGG?ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTGCCTCTTGGC-----GGT--GGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCC?-AAC?TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGC------------------- 'Trichoderma harzianum GJS 90-254' --AAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATC-TCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--C-AAAACTCTTATT-------------GTATACCCCCTCGCGGG----------TTTTTTTATAATCTGAGCC-TTCTCGGCG-CCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTT-CAACAACGG-ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTGCCTTGGC-------GGT--GGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCC--AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGC------------------- 'Trichoderma harzianum GJS 92-100' --AAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATC-TCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--C?AAAACTCTTATT-------------GTATACCCCCTCGCGGG?????-----TTTTTTTATAATCTGAGCC?TTCTCGGCG-CCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTT?CAACAACGG?ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTGCCTTGGC-----??GGT--GGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCC?-AAC?TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGC------------------- Trichoderma_harzianum_dis_218e --AAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATC-TCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--C?AAAACTCTTATT-------------GTATACCCCCTCGCGGG?????-----TTTTTTTATAATCTGAGCC?TTCTCGGCG-CCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTT?CAACAACGG?ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTCCCTTAGCG------GGT--GGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCC?-AAC?TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAA??------------------- Trichoderma_harzianum_dis_377a --AAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATC-TCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--C?AAAACTCTTTTT-------------GTATACCCCCTCGCGGG????-----TTTTTTTTATAATCTGAGCC?TTCTCGGCG-CCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTT?CAACAACGG?ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTCCCTTAGCG------GGT--GGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCC?-AAC?TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGC------------------- Trichoderma_pleuroticola ACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATC-TCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--C-AAAACTCTTATT-------------GTATACCCCCTCGCGGG----------TTTTTTTATAATCTGAGCC-TTCTCGGCG-CCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTT-CAACAACGG-ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTCCCTCTGC-------GGG--GGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCACCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCC--AACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAAAGCGGAGGA Trichoderma_pleurotum ACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATC-TCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--C-AAAACTCTTATT-------------GTATACCCCCTCGCGGG----------TTTTTTTATAATCTGAGCC-TTCTCGGCG-CCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTT-CAACAACGG-ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCTCCCTCTGC-------GGG--GGCCGTCTCCGAAATCCAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCACCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCC--AACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAAA----------- Trichoderma_virens ---------------------CT-CGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATC-TCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGG------CGCCCGCCGGAGGACCAAC--C-AAAACTCTTATT-------------GTATACCCCCTCGCGGG-----------TTTTTTACTATCTGAGCC-ATCTCGGCG-CCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTT-CAACAACGG-ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC--GGGGGGTCGGCGTTGGGGATCGGCCCT---TTA-C--------GG--GGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCAC-ACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCCAAAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCA------------- ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M5231] TITLE RPB2; LINK TAXA = Taxa1; DIMENSIONS NCHAR=876; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=- GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Hypocrea_alni TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCTGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTGGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTCGGAATTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCTAGACACTCGTCGCAAGTCCTATCTCCAGTACGAAGTCTCTCTCGTGAGAGAAATCCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAACAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCCGAGCCTCCGGAAGACCCCAGCATGAAGATGGGATGGGAGGGATTGATTAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACACCAGAGGATCTCGAAATGTATCGTCTTCAGAAGGCCGGTATTAACACCGAGGAAGACATGGGAGATGATCCGAACAAGCGACTCAAGACAAAGACAAACCCCACAACTCACATGTACACCCATTGCGAGATTCATCCAAGTATGATCTTA Hypocrea_aureoviridis TGGGGTGATGAGAAGAAAGGGATGAGTTGAAGAGGTGGTGTGTGGGAGGTGGTTAATGGTTAGAGGTTTGGTTGGAGGGTGTGAGATTTGGGGGGTAGGAAGAGAGGGATTGGAAGAGATGGTAAAGTGGGGAAGGGTGGAGAGGTTGAGAAGAGGGATTGGGGGTTGGTGTGGGGGGGGGAGAGAGGGGAAGGGGAAGGGTGTGGTGTGGTGAAAAAGGTGTGGTTGATGTGTTAGGTGAGTGTGGGTTGGGGTTGGGAAGGTGTGATTGAGTTGATGATGAAGGGAGGTATGGAAGTGGGGGAAGAGTAGGAGGGAGTGGGATATGGGGGGGGTAGGAAGATTTTTGTGAATGGGGTGTGGGGGGGAGTGAGGGAAGAGGGTAAGGGGGTGGTGAAGGAGGTTGTGGAGGGTGGGGGGGAGTGTTATTTGGAGTAGGAAGTGTGTGTGGTGAGAGAAATTGGAGAGGAGGAGTTGAAAATGTTTTGGGAGGGAGGTGGTGTGATGGGGGGGGTGTTTAGAGTTGAGGAGGAAGATGAGGGTGAAAGGGGGATGAAGAAGGGTGATGTGGTATTGAGGAAGGAAGTGGTGAAGAGAGTGGGGAAAGAGGAGGGGGAAGGGGGAGAGGAGGGAAGGATGAAGATGGGGTGGGAGGGGTTGATGAGGGGTGGTGGGGTTGAATATGTGGAGGGGGAGGAAGAGGAGAGATGGATGATTTGGATGAGTGGAGAAGATGTGGAGGTGTATGGTGTTGAAAAGGGGGGTATTTGTAGGGAAGAGGAGATGGGAGATGATGGGAATAAGGGAGTGAAGAGAAAGAGAAAGGGAAGAAGTGAGATGTAGAGTGATTGTGAAATTGAGGGAAGGATGATATTG Hypocrea_brunneoviridis TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTCGCTTCGACCTTGTCACACTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGCAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAAAACCTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAATTCATGATCAACAGAGGTATGGAAGTCGTCGAGGAGTACGAGCCGCTGCGGTATCCTCATGCTACAAAGATTTTCGTGAACGGTGTCTGGGTTGGAGTCCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCCGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGGTTGGCCAAGGAGCAGGCTGAACCTCCAGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCGGTTGAGTATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAAGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTTCCACTGAGGAAGACATGGCAGATGATCCGAACAAGCGACTAAAGACCAAGACAAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTA Hypocrea_chlorospora TGGGGTGATGAGAAGAAGGGGATGAGGTGAAGTGGAGGGGTGTGGGAGGTGGTTAAGGGGTAGAGGTTTGGTTGGAGGGTGTGAGATTTGGGTGGTAGGAAGAGAGGGATTGGAAGAGATGGGAAGTTGGGGAAGGGTGGAGAGGTTGAGAAGAGGGATTGGGGTTTGGTGTGGGGGGGGGAGAGAGGGGAAGGGGAAGGTTGTGGTGTTGTGAAAAATGTGTGGTTGATGTGTTATGTGAGTGTGGGTTGGGGATGTGAAGGTGTGATTGAGTTGATGATGAAGGGAGGTATGGAAGTTGTAGAGGAGTATGAGGGAGTAGGATATGGTGATGGTAGGAAGATTTTTGTGAAGGGTGTATGGGTTGGAGTTGAGGAAGATGGGAAGGAGGTGGTGAAGGAGGTTGTGGAGAGTGGTGGGAAGTGTTAGTTGGAGTAGGAAGTGTGTGTGGTGAGAGAAATTGGAGAGGAGGAATTGAAAATGTTTTGGGAGGGGGGGGGTGTGATGGGAGGTGTGTTTAGGGTGGAGGAAGAAGATGAGGGTGAAAGGGGTATTAAGAAGGGGGATTTGGTAGTGAGGAAGGAAGTGGTGAATAGGGTGGGGAAGGAGGAGGGGGAAGGTGGAGAGGAGGGGAGGATGAAGATTGGATGGGAGGGATTGATGAGGGGTGGTGGAGTTGAATATGTGGAGGGGGAGGAAGAGGAGAGGTGGATGATGTGGATGAGAGGAGAAGATGTGGAGGTTTATGGGGTTGAAAAGGGTGGTATGTGTAGTGAAGAGGAGATGGGAGAGGATGGGAAGAAGGGATTGAAAAGAAGGAGAAAGGGAAGAAGTGAGATGTAGAGTGATTGTGAGATTGATGGAAGGATGATTTTG Hypocrea_cinnamomea TGGGGTGATGAGAAGAAGGGGATGAGGTGAAGTGGAGGTGTGTGGGAGGTGGTTAAGGGTTAGAGGTTTGGTTGGAGGGTGTGGGATTTGGGTGGTAGGAAGAGTGGGATTGGAAGAGATGGTAAGGTGGGGAAGGGTGGAGAGGTTGAGAAGAGGGATTGGGGTTTGGTGTGGGGAGGGGAGAGAGGTGAAGGAGAGGGTTGTGGTGTAGTGAAAAAGTTGTGTTTGATGTGTTAGGTGAGTGTGGGTTGTGGGTGGGAAGGTGTGATTGAGTTGATGATGAAGAGAGGTATGGAAGTGGTGGAAGAGTAGGAGGGGGTGGGTTATGGTGATGGGAGAAAGATGTTTGTGAAGGGGGTGTGGGTTGGAGTTGAGGAAGAGGGTAAGGAGTTGGTGAAGGAGGTTGTGGAGAGTGGTGGGAAGTGGTATGTGGAGTAGGAAGTGTGTGTGGTGAGAGAAATTGGAGAGGAGGAATTGAAAATGTTGTGGGAGGGAGGGGGTGTGATGGGAGGTGTGTTTAGTGTTGAGGAGGAAGATGAGGGGGAAAGGGGGATGAAGAAGGGGGAGGTGGTATTGAGGAAGGAGGTGGTGAATAGATTGGGGAAGGAGGAGGGTGAAGGTGGGGAAGATGGTAGGATGAAGATGGGATGGGAGGGATTAATGAGAGGGGGTGGGGTTGAATATGTGGAGGGGGAGGAAGAGGAGAGGTGGATGATGTGGATGAGGGGGGAGGATGTTGAGGTGTATGGTGTTGAGAAGGGGGGTATTTGTAGTGAGGAAGAGATGGGAGATGATGGGAAGAAGGGAGTAAAGAGAAAGAGAAATGGGAGAAGGGAGATGTAGAGGGATTGGGAGATTGAGGGAAGTATGATTTTA Hypocrea_epimyces TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGGCAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACTCCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTTCTCCCTCCGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTCGGAGTTCACCAAGACCCGAAGCACTTGGTGAACCAGGTCCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCCGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATCGGATGGGAGGGATTAATTAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAAAAGGCCGGTATTAACACTGAGGAAGACATGGGAGATGATCCGAACAAGCGACTCAAGACAAAGACAAACCCCACAACTCACATGTACACCCATTGCGAGATTCAACCAAGTATGATCTTA Hypocrea_parepimyces TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCCACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCCTGTGGGCTGGTCAAGAACTTATCTTTGATGTGTTACGTCAGTGTCGGTTCTCCATCCGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCTCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCATTTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTCCAGTACGAAGTCTCTCTCGTGAGAGAAATCAGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCAGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATCGGATGGGAGGGATTAATTAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAAAAGGCCGGTATTAACACCGAGGAAGACATGGGAGACGATCCGAACAAGCGACTCAAGACCAAGACAAACCCCACAACTCACATGTATACCCATTGCGAGATTCACCCAAGTATGATCTTG Hypocrea_straminella TGGGGTGATGAGAAGAAGGGGATGAGGTGAAGTGGAGGTGTGTGGGAGGTGGTTAAGGGTTAGAGATTTGGTTGGAGTGTGTGAGATTTAGGTGGTAGGAAGAGTGGGATTGGAAGAGATGGTAAGGTGGGGAAGGGTGGAGAGGTTGAGAATAGGGATTGGGGTTTGGTGTGGGGAGGGGAGAGAGGTGAAGGAGAGGGTTGTGGTGTGGTGAAAAAGTTGTGTTTGATGTGTTAGGTGAGTGTGGGGTGTGGTTGGGAAGGTGTGATTGAGTTGATGATGAAGAGAGGTATGGAAGTGGTGGAAGAGTAGGAGGGGGTGGGTTATGGTGATGGTAGAAAGATTTTTGTGAAGGGTGTGTGGGTTGGAGTTGAGGAAGAGGGTAAGGAGTTGGTGAAGGAGGTTGTGGAGAGTGGTGGGAAGTGGTATGTGGAGTAGGAAGTGTGTGTGGTGAGAGAAATTGGAGAGGAGGAGTTGAAGATGTTTTGTGAGGGAGGTGGTGTGATGGGAGGTGTGTTGAGTGTTGAGGAGGAAGATGAGGGGGAAAGGGGGATGAAGAAGGGGGAGGTTGTATTGAGGAAGGAGGTGGTGAATAGAGTGGGGAAGGAGGAGGGTGAAGGTGGGGAAGATGGGAGGATGAAGATGGGATGGGAGGGATTAATGAGAGGGGGTGGGGTTGAATATGTTGAGGGGGAGGAAGAGGAGAGGTGTATGATGTGGATGAGGGGAGAGGATGTGGAGGTGTATGGTGTTGAGAAGGGGGGTATTTGGAGTGATGAAGAGATGGGAGATGATGGGAAGAAGGGAGTAAAGAGAAAGAGAAAGGGGAGAAGTGAGATGTAGAGGGATTGGGAGATTGATGGAAGTATGATGTTA Trichoderma_aggressivum TGGGGTGATGAGAAGAAGGGGATGAGGTGAAGTGGAGGGGTGTGGGAGGTGGTTAATGGTTAGAGATTTGGTTGGAGGGTATGAGATTTGGGTGGTAGGAAGAGTGGTATGGGAAGAGATGGTAAGGTGGGGAAGGGTGGGGAGGTTGAGAAGAGGGATTGGGGTTTGGTGTGGGGGGGGGAGAGAGGGGAAGGAGAGGGGTGTGGTGTGGTGAAGAAGTTGTGTTTGATGTGTTATGTGAGTGTGGGTTGTGGGTGGGAGGGTGTGATTGAGTTGATGATGAAGAGAGGTATGGAAGTGGTGGAAGAGTAGGAGGGGGTGGGGTATGGTGATGGTAGGAAGATTTTTGTGAAGGGTGTGTGGGTGGGAGTTGAGGAAGAGGGTAAAGATTTGGTGAAGGAGGTTGTGGAGAGTGGTGGGAAGTGGTATGTGGAGTAGGAAGTGTGTGTGGTGAGAGAGATGAGAGAGGAGGAATTGAAAATGTTTTGGGAGGGAGGGGGTGTGATGGGAGGAGTGTTTAGGGTTGAGGAGGAAGATGAGGGGGAAAGGGGGATGAAGAAGGGGGAGGTGGTATTGAGGAAGGAGGTGGTGAATAGATTGGGGAAGGAGGAGGGTGAGGGTGGGGAAGAGGGGAGGATGAAGATTGGATGGGAGGGATTAATGAGGGGTGGTGGGGTTGAATATGTGGATGGGGAGGAAGAGGAGAGGTGGATGATGTGGATGAGGGGAGAGGATGTGGAGGTGTATGGTGTTGAAAAGGGGGGTATTAAGAGGGAGGAAGAGATGGGAGATGATGGGAAGAAGGGAGTGAAGAGAAAGAGAAAGGGGAGAAGTGAGATGTAGAGGGATTGGGAGATTGAGGGAAGTATGATGTTA Trichoderma_amazonicum_IB50 TGGGGTGACCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTATCCCATTTGCGTCGTACCAACACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACGCCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAGCCTCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCACGCTACCAAGATTTTTGTCAACGGTGTCTGGGTCGGAGTTCACCAAGACCCCAAGCACTTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCCCTCGTGAGAGAAATCCGAGACCAGGAATTCAAAATCTTTTCCGACGCTGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCCTGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAAAAGGCCGGTATCAACACTGAGGAGGACATGGGAGATGATCCGAACAAGCGACTCAAGACCAAGACAAACCCCACAACTCACATGTACACCCATTGCGAGAT------------------- Trichoderma_amazonicum_LA90 TGGGGTGACCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTATCCCATTTGCGTCGTACCAACACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACGCCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAGCCTCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCACGCTACCAAGATTTTTGTCAACGGTGTCTGGGTCGGAGTTCACCAAGACCCCAAGCACTTGGTGAACCAGGTTCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCCCTCGTGAGAGAAATCCGAGACCAGGAATTCAAAATCTTTTCCGACGCTGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCCTGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAAAAGGCCGGTATCAACACTGAGGAGGACATGGGAGATGATCCGAACAAGCGACTCAAGACCAAGA-------------------------------------------------------- Trichoderma_catoptron TGGGGTGATGAGAAGAAGGGGATGAGGTGGAGTGGAGGTGTGTGGGAGGTGGTTAAGGGTTAGAGGTTTGGTTGGAGGGTATGGGATTTGGGTGGTAGGAAGAGTGGGATGGGAAGAGATGGTAAGGTGGGGAAGGGTGGAGAGGTTGAGAAGAGGGATTGGGGTTTGGTGTGGGGAGGGGAGAGAGGGGAAGGAGAGGGTTGTGGTGTGGTGAAAAAGTTGTGTTTGATGTGGTAGGTGAGTGTTGGTTGTGGGTGGGAAGGTGTGATTGAGTTGATGATGAAGAGAGGTATGGAAGTGGTGGAAGAGTAGGAGGGGGTGGGGTATGGTGATGGTAGGAAGATTTTTGTGAAGGGTGTGTGGGTTGGAGTTGAGGAAGAGGGTAAGGAGTTGGTGAAGGAGGTTGTGGAGAGTGGTGGGAAGTGGTATGTGGAGTAGGAAGTGTGTGTTGTGAGAGAAATTGGAGAGGAGGAATTGAAAATGTTTTGGGAGGGAGGGGGTGTGATGGGAGGTGTATTTAGGGTTGAGGAGGAAGATGAGGGGGAAAGGGGGATGAAGAAGGGGGAGGTTGTATTGAGGAAGGAGGTGGTGAATAGATTGGGGAAGGAGGAGGGTGAAGGTGGGGAAGAGGGGAGGATGAAGATTGGGTGGGAGGGATTAATGAGGGGTGGTGGGGTTGAATATGTGGAGGGGGAGGAAGAGGAGAGTTGGATGATGTGGATGAGGGGAGAGGATGTGGAAGTGTATGGTGTTGAGAAGGGGGGGATGTGTAGGGAGGAAGAGATGGGAGATGATGGGAAGAAGGGAGTAAAGAGGAAGAGAAAGGGGAGGAGTGAGATGTATAGGGATTGGGAGATTGAGGGAAGTATGATGTTA Trichoderma_harzianum_CBS_226.95 TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACCAATACTCCTATCGGAAGAGATGGTAAGCTCGCAAAGCCTCGACAGCTTCACAACACGCACTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAGGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTGGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTCCACCAAGACCCTAAGCACTTGGTGAACCAGGTCCTGGACACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTCCGACCGCAGGCCGTGTAATGCGGCCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATTAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCTGGTATTAACACTGAGGAAGACATGGGAGATGACCCGAACAAGCGACTAAAGACCAAGACAAACCCGACTACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTA 'Trichoderma harzianum GJS 00-08' TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGATACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACTCCCATAGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTAGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACCTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTATGAGCCTCTGCGGTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCTAGATACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGTCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCTAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATTAGGGCTGGTGCAGTTGAATATCTCGACGCTGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTAACACTGAGGAAGACATGGGAGATGAT--------------------------------------------------------------------------------- 'Trichoderma harzianum GJS 00-18' TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACGTTGTCACATTTGCGTCGTACCAACACACCTATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCCGAAACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTCCACCAAGACCCTAAGCACTTGGTGAACCAGGTCCTGGACACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGGCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATTAGGGCTGGTGCAGTTGAATATCTCGACGCCGAAGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTAACACTGAGGAAGACATGGGAGATGAT--------------------------------------------------------------------------------- 'Trichoderma harzianum GJS 85-119' TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGATACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGCAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAGGTCGTCGAAGAGTACGAGCCTCTGCGGTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTCCTGGATACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCTATGATCTGCATGACGCCAGAGGATCTCGAGTTGTACCGTCTTCAGAAGGCCGGTATCAACACTGAGGAAGACATGGGAGATGAT--------------------------------------------------------------------------------- 'Trichoderma harzianum GJS 90-254' TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTTAACCGATACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACCCCTATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCTGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTTGTCGAAGAGTACGAGCCGCTGAGGTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCTGGATACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAG-AATTCGAGACCAGGAATTTAAAATCTTTTCCGACGCAGGTCGTGTCATGCGACCAGTCTTTACCGTTCAACAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTAACACTGAGGAAGACATGGGAGATGACCCGAACAAGCGACTAAAGACCAAGACGAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTA 'Trichoderma harzianum GJS 92-100' TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCTGGTGTGTCTCAGGTGCTTAACCGTTACACATTTGCTTCGACCTTGTCACATTTGCGTCGTACCAACACCCCTATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCTGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAATACGAGCCTCTGCGATATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCTGGATACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGACCCCGAAACGGGCATCAACAAGGGCCACCTTGTATTGACCAAGGAACTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTAACACCGAGGAAGACATGGGAGATGAT--------------------------------------------------------------------------------- Trichoderma_harzianum_dis_218e TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGTAT{AGT}GAAGTCGTTGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTCCTGGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGTCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGATCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATTAGGGCTGGTGCAGTTGAATATCTCGACGCCGAAGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTAACACTGAGGAAGACATGGGAGATGAC--------------------------------------------------------------------------------- Trichoderma_harzianum_dis_377a TGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCACAGGTGCTTAACCGTTACACGTTTGCTTCGACCTTGTCACATTTGCGTCGTACCAATACTCCTATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGTCCTGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAGCCTCTGATTGAATTCATGATCAACAGAGGTATGGAGGTCGTCGAAGAGTATGAGCCGCTGCGGTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCTGGATACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTTTTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAAGCTGAACCTCCGGAAGACCCTAGCATGAAGATCGGATGGGAGGGACTGATTAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCTGAGGATCTCGAGCTGTATCGCCTTCAGAAGGCCGGTATTAACACTGAGGAAGACATGGGAGATGAT--------------------------------------------------------------------------------- Trichoderma_pleuroticola TGGGGTGATTCTAAAAAGGCCATGAGCTCAACTGCTGGTGTGTCCCAGGTGCTCAACCGTTACACATTTGCTTCGACCCTATCCCATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGTTGGCGAATCCTCTACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACGCCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTTTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTCAACGGTGTCTGGGTCGGAGTTCACCAAGACCCCAAGCACTTGGTGAACCAGGTCCTGGACACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATCCGAGACCAGGAATTCAAAATCTTTTCCGACGCTGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCCTGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTTGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAAAAGGCCGGTATCAACACTGAGGAGGACATGGGAGATGATCCGAACAAGCGACTCAAGACCAAGACAAACCCCACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTA Trichoderma_pleurotum TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTATCCCATTTGCGTCGTACCAACACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACGCCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTCAACGGTGTCTGGGTCGGAGTTCACCAAGACCCCAAGCACTTGGTGAACCAGGTCCTGGATACTCGTCGCAAGTCCTATCTGCAATACGAAGTTTCTCTCGTGAGAGAAATCCGAGACCAGGAATTCAAAATCTTTTCCGACGCTGGCCGTGTCATGCGGCCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGGTTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCCTGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAAAAGGCCGGTATCAACACGGAGGAGGACATGGGAGATGATCCGAACAAGCGACTCAAGACCAAGACAAACCCCACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATTCTA Trichoderma_virens TGGGGTGATGAGAAGAAGGGGATGAGGTGAAGTGGTGGTGTGTGTGAGGTGGTTAAGGGTTAGAGGTTTGGTTGGAGGGTATGAGATTTGGGTGGTAGGAAGAGGGGGATTGGAAGAGATGGTAAGGTGGGGAAGGGTGGAGAAGTTGAGAAGAGGGATTGGGGTTTGGTGTGTGGAGGGGAGAGAGGGGAAGGGGAGGGTTGTGGTGTGGTGAAAAAGTTGTGTGTGATGTGGTAGGTGAGTGTGGGTTGTGGGTGGGAAGGAGTGATTGAGTTGATGATGAAGAGAGGTATGGAAGTGGTGGAAGAGTAGGAGGGGGTGGGATATGGTGATGGTAGGAAGATTTTGGTGAAGGGTGTGTGGGTTGGAGTTGAGGAAGAGGGTAAGGATGTGGTGAAGGAGGTTGTAGAGAGTGGTGGGAAATGGTATGTGGAGTAGGAAGTGTGTGTGGTGAGAGAGATTGGAGAGGAGGAATTGAAAATGTTTTGGGATGGAGGGGGTGTGATGGGAGGTGTATTTAGGGTTGAGGAGGAGGATGAGGGTGAAAGAGGGATGAAGAAGGGGGAGGTGGTATTGAGGAAGGAGGTGGTGAAGAGATTGGGTAAGGAGGAAGGTGAAGGTGGGGAAGAGGGGAGGATGAAGATTGGATGGGAGGGAGTAATGAGGGGTGGTGGGGTTGAATATGTGGAGGGGGAAGAAGAGGAGAGGTGGATGATTTGGATGAGAGGAGAGGATGTGGAGGTGTATGGTGTTGAGAAAGGGGGTATGTGTAGGGATGAAGAGATGGGAGATGATG-------------------------------------------------------------------------------- ; END; BEGIN TREES; TITLE Combined_MP; LINK TAXA = Taxa1; TRANSLATE 1 Trichoderma_aggressivum, 2 Hypocrea_aureoviridis, 3 Trichoderma_catoptron, 4 Hypocrea_chlorospora, 5 Hypocrea_cinnamomea, 6 Hypocrea_alni, 7 Trichoderma_harzianum_CBS_226.95, 8 Trichoderma_harzianum_dis_218e, 9 Trichoderma_harzianum_dis_377a, 10 'Trichoderma harzianum GJS 00-08', 11 'Trichoderma harzianum GJS 00-18', 12 'Trichoderma harzianum GJS 85-119', 13 'Trichoderma harzianum GJS 90-254', 14 'Trichoderma harzianum GJS 92-100', 15 Hypocrea_brunneoviridis, 16 Hypocrea_epimyces, 17 Trichoderma_amazonicum_IB50, 18 Trichoderma_amazonicum_LA90, 19 Hypocrea_parepimyces, 20 Trichoderma_pleuroticola, 21 Trichoderma_pleurotum, 22 Hypocrea_straminella, 23 Trichoderma_virens; TREE Parsimony_Tree = [&R] (((((1:32.0,(((6:40.0,(16:33.0,19:39.0):10.0):17.0,((17:1.0,18:0.0):10.0,(20:20.0,21:20.0):5.0):30.0):9.0,((((((7:40.0,11:19.0):4.0,14:20.0):5.0,9:22.0):8.0,(8:12.0,10:14.0):11.0):8.0,(12:24.0,13:17.0):8.0):11.0,15:68.0):16.0):222.0):34.0,3:66.0):11.0,(5:50.0,22:28.0):27.0):41.0,23:62.0):23.0,(2:145.0,4:85.0):93.0):0.0; END;