#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 4:08 GMT TreeBASE (cc) 1994-2008 Study reference: Zhang J., Zhang L., Li G., Yang L., Jiang D., Zhuang W., & Huang H. 2010. Botrytis sinoallii, a new species of the grey mould pathogen on Allium crops in China. Mycoscience, 51: 421-431. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10344] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=68; TAXLABELS Botrytis_aclada_MUCL3106 Botrytis_aclada_MUCL8415 'Botrytis aclada OnionBC-15' 'Botrytis aclada OnionBC-18' 'Botrytis aclada OnionBC-7' Botrytis_aclada_PRI006 Botrytis_allii_MUCL403 Botrytis_byssoidea_MUCL94 'Botrytis byssoidea OnionBC-76' Botrytis_calthae_CBS175.63 Botrytis_calthae_MUCL1089 Botrytis_calthae_MUCL2830 Botrytis_cinerea_B05.10 Botrytis_cinerea_BC7 'Botrytis cinerea GarlicBC-5' 'Botrytis cinerea LeekBC-8' Botrytis_cinerea_MUCL87 'Botrytis cinerea OnionBC-1' Botrytis_cinerea_SAS405 Botrytis_cinerea_SAS56 Botrytis_convoluta_9801 Botrytis_convoluta_MUCL11595 Botrytis_croci_MUCL436 Botrytis_elliptica_BE0022 Botrytis_elliptica_BE9610 Botrytis_elliptica_BE9714 Botrytis_fabae_CBS109.57 Botrytis_fabae_MUCL98 Botrytis_ficariarum_CBS176.63 Botrytis_ficariarum_MUCL376 Botrytis_galanthina_MUCL3204 Botrytis_galanthina_MUCL435 Botrytis_gladiolorum_9701 Botrytis_gladiolorum_MUCL3865 Botrytis_globosa_MUCL21514 Botrytis_globosa_MUCL444 Botrytis_hyacinthi_0001 Botrytis_hyacinthi_MUCL442 Botrytis_narcissicola_MUCL18857 Botrytis_narcissicola_MUCL2120 Botrytis_paeoniae_0003 Botrytis_paeoniae_MUCL16084 Botrytis_pelargonii_CBS497.50 Botrytis_pelargonii_MUCL1152 Botrytis_polyblastis_CBS287.38 Botrytis_polyblastis_MUCL21492 'Botrytis porri GarlicBC-16' 'Botrytis porri GarlicBC-38' Botrytis_porri_MUCL3234 Botrytis_porri_MUCL3349 'Botrytis porri OnionBC-95' Botrytis_ranunculi_CBS178.63 'Botrytis sinoallii LeekBC-18' 'Botrytis sinoallii OnionBC-23' 'Botrytis sinoallii OnionBC-59' Botrytis_sphaerosperma_MUCL21481 Botrytis_sphaerosperma_MUCL21482 'Botrytis squamosa GarlicBC-2' 'Botrytis squamosa LeekBC-2' Botrytis_squamosa_MUCL1107 Botrytis_squamosa_MUCL9112 'Botrytis squamosa OnionBC-19' Botrytis_squamosa_PRI026 Botrytis_tulipae_BT9001 Botrytis_tulipae_BT9830 Botrytis_tulipae_BT9901 Monilinia_fructigena_9201 Sclerotinia_sclerotiorum_484 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M9998] TITLE 'G3PDH, RPB2, and HSP60'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2969; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Botrytis_aclada_MUCL3106 TAAGTTTCCGCTATCGGACCTCCCGCACATTGTA--AGGACCCGAGCTAATCTATTCTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACTTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTTACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGACGAGATCAAGGCCGTCATCAAGAAGGCTGCCGATGGTCCTCTCAAGGGTAAGTTATTCTGTTAATCTTTCTTCCGTCCTAATTTACTAATCGTAACATA--GGCATATTGGGTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTTTAAACTAATCACTTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGTAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCCCCAAAGATCACTAAAGGTTTGTGAAACCCCC---CGGCTGCCTAGT-TGCAAAATTCTAATTGTTGGTAAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGG{AT}GTCATCACAGTCAAGGAGGGCAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACTGATACCAAGTCGCAAAAAGTTGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAGAAGATCTCAAACGTCCAAGACATCATCCCAGCACTTGA{AG}GCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCTGGTTTCGGTGACAACAGAAAGTCCATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTCCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTCGAAAACAACCGAGAGTTTAACTTAACTCTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATACTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAATAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAACACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCTGCCGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCATTGATGTGTTATGTTACAGTTGGTACACCAAGTGATCCAATCGTCGAGTTCATGATTCAGCGAAACATGGAAGTGTTGGAGGAGTATGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAACGATCCTGATAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGATGCTACCAGCAAACATGGATAAGCTTGTTAAAGAACAAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGACGCTGAGGAAGAAGAGACTGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCAATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTGAAGTTCAAT---GAAGTCATTC Botrytis_aclada_MUCL8415 TAAGTTTCCGCTATCGGACCTCCCGCACATTGTA--AGGACCCGAGCTAATCTATTCTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACTTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTTACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGACGAGATCAAGGCCGTCATCAAGAAGGCTGCCGATGGTCCTCTCAAGGGTAAGTTATTCTGTTAATCTTTCTTCCGTCCTAATTTACTAATCGTAACATA--GGCATATTGGGTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCGTTTTTTGA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATAGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAATCCCC---CGGCACCGTCGT-TATAAAATTCTAATTGTTGGTTAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACTGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTAGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATTACAACCAGCGAGGAAATCGCACAAGTCGCGACTATCAGTGCCAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGAGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAAGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATTGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTACGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACTAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTCGAAAACAACCGAGAGTTTAACTTAACTCTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATACTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAATAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAACACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCTGCCGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCATTGATGTGTTATGTTACAGTTGGTACACCAAGTGATCCAATCGTCGAGTTCATGATTCAGCGAAACATGGAAGTGTTGGAGGAGTATGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAACGATCCTGATAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGCTGCTACCAGCAAACATGGATAAGCTTGTTAAAGAACAAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGACGCTGAGGAAGAAGAGACTGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCAATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTGAAGTTCAAT---GAATTCATTC 'Botrytis aclada OnionBC-15' TAAGTTTCCGCTATCGGACCTCCCGCACATTGTA--AGGACCCGAGCTAATCTACTCTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACTTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTTACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGTCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGACGAGATCAAGGCCGTCATCAAGAAGGCTTCCGATGGTCCTCTCAAGGGTAAGTTATTCTGTTAATCTTTCTTCCGTCCTAATTTACTAATCGTAACATA--GGCATATTGGGTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCGTTTTTTGA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATAGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAATCCCC---CGGCACCGTCGT-TATAAAATTCTAATTGTTGGTTAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGCGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACTGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTAGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATTACAACCAGCGAGGAAATCGCACAAGTCGCGACTATCAGTGCCAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGAGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAAGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATTGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTACGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACTAATGCTACCGTCTTCACTCTGTTCCGTAGATCGACAACAGATGTGTACAAATACTTGCAACGTTGCGTCGAAAACAACCGAGAGTTTAACTTAACTCTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATACTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAATAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAACACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCTGCCGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCATTGATGTGTTATGTTACAGTTGGTACACCAAGTGATCCAATCGTCGAGTTCATGATTCAGCGAAACATGGAAGTGTTGGAGGAGTATGAACCACCCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAACGATCCTGATAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGCTGCTACCAGCAAACATGGATAAGCTTGTTAAAGAACAAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGACGCTGAGGAAGAAGAGACTGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCAATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTGAAGTTCAAT---GAATTCATTC 'Botrytis aclada OnionBC-18' TAAGTTTCCGCTATCGGACCTCCCGCACATTGTA--AGGACCCGAGCTAATCTATTCTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTACGGGTGTCAACAACGAGACTTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAGCCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTTACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAAGGTGCTTCTTATGACGAGATCAAGGCCGTCATCAAGAAGGCTGCCGATGGTCCTCTCAAGGGTAAGTTATTCTGTTAATCTTTCTTCCGTCCTAATTTACTAATCGTAACATA--GGCATATTGGGTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCGTTTTTTGA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATAGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAATCCCC---CGGCACCGTCGT-TATAAAATTCTAATTGTTGGTTAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACTGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTAGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATTACAACCAGCGAGGAAATCGCACAAGTCGCGACTATCAGTGCCAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGAGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAAGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATTGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTACGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACTAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTCGAAAACAACCGAGAGTTTAACTTAACTCTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATACTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAATAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAACACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCTGCCGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCATTGATGTGTTATGTTACAGTTGGTACACCAAGTGATCCAATCGTCGAGTTCATGATTCAGCGAAACATGGAAGTGTTGGAGGAGTATGAACCACTCCGAGCACCCAATGCAACAAAGGTCTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAACGATCCTGATAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGCTGCTACCAGCAAACATGGATAAGCTTGTTAAAGAACAAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGACGCTGAGGAAGAAGAGACTGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCAATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGGTCTTGGGTATCTGCGCAAGCATTACTCCCTTCCCGGATCACAATCAGGTAAGCTTGAAGTTCAAT---GAATTCATTC 'Botrytis aclada OnionBC-7' TAAGTTTCCGCTATCGGACCTCCCGCACATTGTA--AGGACCCGAGCTAATCTATTCTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACTTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTTACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGACGAGATCAAGGCCGTCATCAAGAAGGCTGCCGATGGTCCTCTCAAGGGTAAGTTATTCTGTTAATCTTTCTTCCGTCCTAATTTACTAATCGTAACATA--GGCATATTGGGTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCGTTTTTTGA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATAGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAATCCCC---CGGCACCGTCGT-TATAAAATTCTAATTGTTGGTTAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACTGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTAGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATTACAACCAGCGAGGAAATCGCACAAGTCGCGACTATCAGTGCCAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGAGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAAGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATTGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTACGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACTAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTCGAAAACAACCGAGAGTTTAACTTAACTCTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATACTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAATAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAACACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCTGCCGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCATTGATGTGTTATGTTACAGTTGGTACACCAAGTGATCCAATCGTCGAGTTCGTGATTCAGCGAAACATGGAAGTGTTGGAGGAGTATGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAACGATCCTGATAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGCTGCTACCAGCAAACATGGATAAGCTTGTTAAAGAACAAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGACGCCGAGGAAGAAGAGACTGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCAATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTGAAGTTCAAT---GAATTCATTC Botrytis_aclada_PRI006 TAAGTTTCCGCTATCGGACCTCCCGCACATTGTA--AGGACCCGAGCTAATCTATTCTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACTTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTTACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGACGAGATCAAGGCCGTCATCAAGAAGGCTGCCGATGGTCCTCTCAAGGGTAAGTTATTCTGTTAATCTTTCTTCCGTCCTAATTTACTAATCGTAACATA--GGCATATTGGGTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCGTTTTTTGA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATAGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAATCCCC---CGGCACCGTCGT-TATAAAATTCTAATTGTTGGTTAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACTGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTAGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATTACAACCAGCGAGGAAATCGCACAAGTCGCGACTATCAGTGCCAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGAGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAAGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATTGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTACGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACTAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTCGAAAACAACCGAGAGTTTAACTTAACTCTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATACTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAATAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAACACACCCATCGCTCGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCTGCCGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCATTGATGTGTTATGTTACAGTTGGTACACCAAGTGATCCAATCGTCGAGTTCATGATTCAGCGAAACATGGAAGTGTTGGAGGAGTATGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAACGATCCTGATAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGCTGCTACCAGCAAACATGGATAAGCTTGTTAAAGAACAAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGACGCTGAGGAAGAAGAGACTGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCAATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTGAAGTTCAAT---GAATTCATTC Botrytis_allii_MUCL403 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATTTGTATGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTTCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACTTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTTACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGACGAGATCAAGGCCGTCATCAAGAAGGCTGCCGATGGTCCTCTCAAGGGTAAGTTATTCTGTTAATCTTTCTTCCGTCCTAATTTACTAATCGTAACATA--GGCATATTGGGTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCGTTTTTTGA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATAGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAATCCCC---CGGCACCGTCGT-TATAAAATTCTAATTGTTGGTTAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACTGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTAGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATTACAACCAGCGAGGAAATCGCACAAGTCGCGACTATCAGTGCCAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGAGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAAGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATTGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTACGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACTAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTCGAAAACAACCGAGAGTTTAACTTAACTCTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATACTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAATAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAACACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCTGCCGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCATTGATGTGTTATGTTACAGTTGGTACACCAAGTGATCCAATCGTCGAGTTCATGATTCAGCGAAACATGGAAGTGTTGGAGGAGTATGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAACGATCCTGATAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGCTGCTACCAGCAAACATGGATAAGCTTGTTAAAGAACAAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGACGCTGAGGAAGAAGAGACTGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCAATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTGAAGTTCAAT---GAATTCATTC Botrytis_byssoidea_MUCL94 TAAGTTTCCGCTATCGGACCTCCCGCAGAGTTCA--AGGACTCGAGCTAATTTGTATGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTTCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCCGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAATTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTTAAGGGTTAGTTACTCTCTCAATCCTTCTTCCGTTCTAATTTATTAATCGCAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATTTTCGATGCCAAGGCCGATTTTAAACTAATCACTTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGTAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCCCCAAAGATCACTAAAGGTTTGTGAAACCCCC---CGGCTGCCTAGT-TGCAAAATTCTAATTGTTGGTAAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGCAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACTGATACCAAGTCGCAAAAAGTTGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAGAAGATCTCAAACGTCCAAGACATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCTGGTTTCGGTGACAACAGAAAGTCCATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTAACGACCAATGTGTACAGATACTTGCAGCGTTGCGTGGAAAATAACCGAGAGTTCAATTTGACTTTGGGTGTGAAATCCACAACAATCACAAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACACATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGTGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTATTGGAGGAGTATGAACCACTTCGAGCACCCAACGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGACCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGAGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAACGACCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGAGCACATTCGCCGTCTGGAGGAGGATCAGATGCTGCCAGCAAATATGGATAAGGACGATAAAGTAAAAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTATCTGGACGCTGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATTTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGCGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATTTTGGGTATCTGCGCAAGCATTATTCCTTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTCATTC 'Botrytis byssoidea OnionBC-76' TAAGTTTCCGCTATCGGACCTCCCGCAGAGTTCA--AGGACTCGAGCTAATTTGTATGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTTCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCCGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAATTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTTAAGGGTTAGTTACTCTCTCAATCCTTCTTCCGTTCTAATTTATTAATCGCAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATTTTCGATGCCAAGGCCGATTTTAAACTAATCACTTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGTAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCCCCAAAGATCACTAAAGGTTTGTGAAACCCCC---CGGCTGCCTAGT-TGCAAAATTCTAATTGTTGGTAAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCCCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGCAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACTGATACCAAGTCGCAAAAAGTTGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAGAAGATCTCAAACGTCCAAGACATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCTGGTTTCGGTGACAACAGAAAGTCCATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTAACAACCGATGTGTACAGATACTTGCAGCGTTGCGTGGAAGATAACCGAGAGTTCAATTTGACTTTGGGTGTGAAATCCACAACAATCACAAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACACATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGTGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTATTGGAGGAGTATGAACCACTTCGAGCACCCAACGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGACCTTCGTAGACCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGAGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAACGACCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGAGCACATTCGCCGTCTGGAGGAGGATCAGATGCTGCCAGCAAATATGGATAAGGACGATAAAGTAAAAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTATCTGGACGCTGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATTTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGCGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTAGACTCATTGTGAAATTCATCCAAGTATGATTTTGGGTATCTGCACAAGCATTATTCCTTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTCATTC Botrytis_calthae_CBS175.63 TAAGTTTCCGCTATCGGACCTCCCGCAGATATCA--AGGACCCGAGCTAATTTGTATTATGTGCAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTCGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACTGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGCGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTTATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGCTACTCCATTACTCTTTCTTTGGCTCTAATTTACTAATCGTAACACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGAATCCAAGGCTGATTGTAAACTGATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCTACAACCTTGGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACCAAAGGTTTGCGAAACTCC----CGGCTACCTAGT-TTCAAAATTCTAATTATTGGTGAATAGATGGTGTAACCGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTGGGTGCTAGACTTATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCCGCCGTGGAGGCTGTTGTTGAATTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAAAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAAGGAAAAACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTTTCCCCATACTTTATCACCGATACCAAGTCGCAAAAGGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATTTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCGTCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATTGATGGAGAAGCTCTCGCTGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACTAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACAGAGAGTTTAATTTGACTTTGGGTGTGAAATCAACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCCGCAAGTTCCACCGCCGGAGTGTCTCAAGTGTTGAACAGATATACCTTTGCATCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACCCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTTAAGAACTTGGCTCTGATGTGTTACGTTACAGTCGGTACGCCAAGTGATCCAATCGTTGAGTTCATGATTCAACGAAATATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCTAATGCAACAAAAGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTTAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGATAGAGAATTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCGCCAACAAAGGTAACTTGGTGTTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGGATGAGAAAGTAAGAAACGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTACTTGGATGCCGAGGAAGAAGAGACTGTCATGATTACAATGACACCTGAAGATCTGGACATCTCCCGACAGCTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAACCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_calthae_MUCL1089 TAAGTTTCCGCTATCGGACCTCCCGCAGATATCA--AGGACCCGAGCTAATTTGTATTATGTGCAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTCGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACTGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGCGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTTATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGCTACTCCATTACTCTTTCTTTGGCTCTAATTTACTAATCGTAACACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTGTAAACTGATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCTACAACCTTGGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACCAAAGGTTTGCGAAACTCC----CGGCTACCTAGT-TTCAAAATTCTAATTATTGGTGAATAGATGGTGTAACCGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTTATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAAAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAAGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTTTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATTTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCGTCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATTGATGGAGAAGCTCTCGCTGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTCCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACAGAGAGTTTAATTTGACTTTGGGTGTGAAATCAACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCCGCAAGTTCCACCGCCGGAGTGTCTCAAGTGTTGAACAGATATACCTTTGCATCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACCCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTTAAGAACTTGGCTCTGATGTGTTACGTTACAGTCGGTACGCCAAGTGATCCAATCGTTGAGTTTATGATTCAACGAAATATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCTAATGCAACAAAAGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTTAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGATAGAGAATTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCGCCAACAAAGGTAACTTGGTGTTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGGATGAGAAAGTAAGAAACGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTACTTGGATGCCGAGGAAGAAGAGACTGTCATGATTACAATGACACCTGAAGATCTGGACATCTCCCGACAGCTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_calthae_MUCL2830 TAAGTTTCCGCTATCGGACCTCCCGCAGATATCA--AGGACCCGAGCTAATTTGTATTATGTGCAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTCGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACTGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGCGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTTATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGCTACTCCATTACTCTTTCTTTGGCTCTAATTTACTAATCGTAACACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTGTAAACTGATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCTACAACCTTGGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACCAAAGGTTTGCGAAACTCC----CGGCTACCTAGT-TTCAAAATTCTAATTATTGGTGAATAGATGGTGTAACCGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTGGGTGCTAGACTTATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCCGCCGTGGAGGCTGTTGTTGAATTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAAAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAAGGAAAAACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTTTCCCCATACTTTATCACCGATACCAAGTCGCAAAAGGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATTTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCGTCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATTGATGGAGAAGCTCTCGCTGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACTAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACAGAGAGTTTAATTTGACTTTGGGTGTGAAATCAACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCCGCAAGTTCCACCGCCGGAGTGTCTCAAGTGTTGAACAGATATACCTTTGCATCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACCCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTTAAGAACTTGGCTCTGATGTGTTACGTTACAGTCGGTACGCCAAGTGATCCAATCGTTGAGTTCATGATTCAACGAAATATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCTAATGCAACAAAAGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTTAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGATAGAGAATTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCGCCAACAAAGGTAACTTGGTGTTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGGATGAGAAAGTAAGAAACGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTACTTGGATGCCGAGGAAGAAGAGACTGTCATGATTACAATGACACCTGAAGATCTGGACATCTCCCGACAGCTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAACCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_cinerea_B05.10 TAAGTTTCCGCTATCGGAGCTCCCGCAGATATCA--AGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTCCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTCTTTCTTCGGCTCTAATTTGCTAATCGTAACACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTGTAAACTGATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAAAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCTACAACCTTGGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAACTCC----CGGCTACCTAGT-TTCAAGATTCTAATTATTGGTGAATAGATGGTGTAACCGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTTATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCTGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACAAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAAAAGGTTGGAAAGGAAGGTGTTATCACAGTTAAGGAAGGAAAGACCATGGAGGACGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTTTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATTTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCGTCTACTCAACTTCGTCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCAGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGCAGATTGACAACAGACGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCAACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCCGGAGTGTCTCAAGTGTTGAACAGATATACCTTTGCATCCACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACCCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTTAAAAATTTGGCTCTGATGTGTTACGTTACAGTCGGTACGCCAAGTGATCCAATCGTTGAGTTCATGATTCAACGAAATATGGAAGTATTGGAGGAGTATGAACCACTCCGAGCCCCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGATAGAGAATTCAAGATTTTCACAGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCAAACAAAGGTAACTTGGTGTTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGGATGAGAAAGTAAGAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGATGCCGAGGAAGAAGAGACTGTCATGATTACAATGACACCTGAAGATCTGGACATCTCCCGACAGCTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GACTTTATTC Botrytis_cinerea_BC7 TAAGTTTCCGCTATCGGAGCTCCCGCAGATATCA--AGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTCCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTCTTTCTTCGGCTCTAATTTGCTAATCGTAACACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTGTAAACTGATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAAAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCTACAACCTTGGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAACTCC----CGGCTACCTAGT-TTCAAGATTCTAATTATTGGTGAATAGATGGTGTAACCGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTTATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACTCAAGCTGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACAAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAAAAGGTTGGAAAGGAAGGTGTTATCACAGTTAAGGAAGGAAAGACCATGGAGGACGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTTTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATTTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCGTCTACTCAACTTCGTCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCAGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGCAGATTGACAACAGACGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCAACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCCGGAGTGTCTCAAGTGTTGAACAGATATACCTTTGCATCCACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAGCTGCATAATACCCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTTAAGAATTTGGCTCTGATGTGTTACGTTACAGTCGGTACGCCAAGTGATCCAATCGTTGAGTTCATGATTCAACGAAATATGGAAGTATTGGAGGAGTATGAACCACTCCGAGCCCCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGATAGAGAATTCAAGATTTTCACAGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCAAACAAAGGTAACTTGGTGTTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGGATGAGAAAGTAAGAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGATGCCGAGGAAGAAGAGACTGTCATGATTACAATGACACCTGAAGATCTGGACATCTCCCGACAGCTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCTCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC 'Botrytis cinerea GarlicBC-5' TAAGTTTCCGCTATCGGAGCTCCCGCAGATATCA--AGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTCCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTCTTTCTTCGGCTCTAATTTGCTAATCGTAACACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTGTAAACTGATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCTACAACCTTGGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAACTCC----CGGCTACCTAGT-TTCAAGATTCTAATTATTGGTGAATAGATGGTGTAACCGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTTATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAACCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCTGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACAAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAAAGGGTTGGAAAGGAAGGTGTTATCACAGTTAGGGAAGGAAAGACCATGGAGGACGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTTTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATTTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCGTCTACTCAACTTCGTCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCAGTATGCATTCTTAACAAGCTC-GTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGCAGATTGACAACAGACGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCAACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCCGGAGTGTCTCAAGTGTTGAACAGATATACCTTTGCATCCACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAGCTGCATAATACCCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTTAAGAATTTGGCTCTGATGTGTTACGTTACAGTCGGTACGCCAAGTGATCCAATCGTTGAGTTCATGATTCAACGAAATATGGAAGTATTGGAGGAGTATGAACCACTCCGAGCCCCTAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGATAGAGAATTCAAGATTTTCACAGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCAAACAAAGGTAACTTGGTGTTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGGATGAGAAAGTAAGAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGATGCCGAGGAAGAAGAGACGGTCATGATTACAATGACACCTGAAGATCTGGACATCTCCCGACAGCTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCTCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC 'Botrytis cinerea LeekBC-8' TAAGTTTCCGCTATCGGAGCTCCCGCAGATATCA--AGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCGAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTCCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTCTTTCTTCGGCTCTAATTTGCTAATCGTAACACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTGTAAACTGATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCGGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCTACAACCTTGGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAACTCC----CGGCTACCTAGT-TTCAAGATTCTAATTATTGGTGAATAGATGGTGTAACCGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTTATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCTGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACAAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAAAAGGTTGGAAAGGAAGGTGTTATCACAGTTAAGGAAGGAAAGACCATGGAGGACGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTTTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATTTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCGTCTACTCAACTTCGTCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCAGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGCAGATTGACAACAGACGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCAACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCCGGAGTGTCTCAAGTGTTGAACAGATATACCTTTGCATCCACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAGCTGCATAATACCCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTTAAGAATTTGGCTCTGATGTGTTACGTTACAGTCGGTACGCCAAGTGATCCAATCGTTGAGTTCATGATTCAACGAAATATGGAAGTATTGGAGGAGTATGAACCACTCCGAGCCCCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCCTCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGATAGAGAATTCGAGATTTTCACAGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCAAACAAAGGTAACTTGGTGTTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGGATGAGAAAGTAAGAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGATGCCGAGGAAGAAGAGACTGTCATGATTACAATGACACCTGAAGATCTGGACATCTCCCGACAGCTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCTCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_cinerea_MUCL87 TAAGTTTCCGCTATCGGAGCTCCCGCAGATATCA--AGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTCCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTCTTTCTTCGGCTCTAATTTGCTAATCGTAACACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTGTAAACTGATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCTACAACCTTGGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAACTCC----CGGCTACCTAGT-TTCAAGATTCTAATTATTGGTGAATAGATGGTGTAACCGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTTATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCTGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACAAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAAAAGGTTGGAAAGGAAGGTGTTATCACAGTTAAGGAAGGAAAGACCATGGAGGACGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTTTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATTTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCGTCTACTCAACTTCGTCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCAGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGCAGATTGACAACAGACGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCAACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCCGGAGTGTCTCAAGTGTTGAACAGATATACCTTTGCATCCACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAGCTGCATAATACCCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTTAAGAATTTGGCTCTGATGTGTTACGTTACAGTCGGTACGCCAAGTGATCCAATCGTTGAGTTCATGATTCAACGAAATATGGAAGTATTGGAGGAGTATGAACCACTCCGAGCCCCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGATAGAGAATTCAAGATTTTCACAGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCAAACAAAGGTAACTTGGTGTTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGGATGAGAAAGTAAGAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGATGCCGAGGAAGAAGAGACTGTCATGATTACAATGACACCTGAAGATCTGGACATCTCCCGACAGCTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCTCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC 'Botrytis cinerea OnionBC-1' TAAGTTTCCGCTATCGGAGCTCCCGCAGATATCA--AGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTCCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTCTTTCTTCGGCTCTAATTTGCTAATCGTAACACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTGTAAACTGATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCTACAACCTTGGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAACTCC----CGGCTACCTAGT-TTCAAGATTCTAATTATTGGTGAATAGATGGTGTAACCGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTTATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCTGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACAAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAAAAGGTTGGAAAGGAAGGTGTTATCACAGTTAAGGAAGGAAAGACCATGGAGGACGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTTTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATTTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCGTCTACTCAACTTCGTCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCAGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGCAGATTGACAACAGACGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCAACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCCGGAGTGTCTCAAGTGTTGAACAGATATACCTTTGCATCCACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACCCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTTAAGAATTTGGCTCTGATGTGTTACGTTACAGTCGGTACGCCAAGTGATCCAATCGTTGAGTTCATGATTCAACGAAATATGGAAGTATTGGAGGAGTATGAACCACTCCGAGCCCCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGATAGAGAATTCAAGATTTTCACAGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCAAACAAAGGTAACTTGGTGTTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGGATGAGAAAGTAAGAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGATGCCGAGGAAGAAGAGACTGTCATGATTACAATGACACCTGAAGATCTGGACATCTCCCGACAGCTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GACTTTATTC Botrytis_cinerea_SAS405 TAAGTTTCCGCTATCGGAGCTCCCGCAGATATCA--AGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTCCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTCTTTCTTCGGCTCTAATTTGCTAATCGTAACACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTGTAAACTGATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAAAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCTACAACCTTGGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAACTCC----CGGCTACCTAGT-TTCAAGATTCTAATTATTGGTGAATAGATGGTGTAACCGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTTATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCTGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACAAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAAAAGGTTGGAAAGGAAGGTGTTATCACAGTTAAGGAAGGAAAGACCATGGAGGACGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTTTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATTTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCGTCTACTCAACTTCGTCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCAGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGCAGATTGACAACAGACGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCAACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCCGGAGTGTCTCAAGTGTTGAACAGATATACCTTTGCATCCACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAGCTGCATAATACCCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTTAAGAATTTGGCTCTGATGTGTTACGTTACAGTCGGTACGCCAAGTGATCCAATCGTTGAGTTCATGATTCAACGAAATATGGAAGTATTGGAGGAGTATGAACCACTCCGAGCCCCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGATAGAGAATTCAAGATTTTCACAGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCAAACAAAGGTAACTTGGTGTTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGGATGAGAAAGTAAGAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGATGCCGAGGAAGAAGAGACTGTCATGATTACAATGACACCTGAAGATCTGGACATCTCCCGACAGCTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCTCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_cinerea_SAS56 TAAGTTTCCGCTATCGGAGCTCCCGCAGATATCA--AGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTCCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTCTTTCTTCGGCTCTAATTTGCTAATCGTAACACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTGTAAACTGATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAAAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCTACAACCTTGGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAACTCC----CGGCTACCTAGT-TTCAAGATTCTAATTATTGGTGAATAGATGGTGTAACCGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTTATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCTGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACAAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAAAAGGTTGGAAAGGAAGGTGTTATCACAGTTAAGGAAGGAAAGACCATGGAGGACGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTTTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATTTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCGTCTACTCAACTTCGTCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCAGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGCAGATTGACAACAGACGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCAACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCCGGAGTGTCTCAAGTGTTGAACAGATATACCTTTGCATCCACACTTTCTCATTTGCGCCGAACCAATACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAGCTGCATAATACCCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTTAAGAATTTGGCTCTGATGTGTTACGTTACAGTCGGTACGCCAAGTGATCCAATCGTTGAGTTCATGATTCAACGAAATATGGAAGTATTGGAGGAGTATGAACCACTCCGAGCCCCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGATAGAGAATTCAAGATTTTCACAGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCAAACAAAGGTAACTTGGTGTTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAATTGCTACCAGCAAACATGGATAAGGATGAGAAAGTAAGAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGATGCCGAGGAAGAAGAGACTGTCATGATTACAATGACACCTGAAGATCTGGACATCTCCCGACAGCTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCTCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_convoluta_9801 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTGATTTATTTTATCTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCTCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAATGCCTCCTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCTGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATTAATCTTTCTTCCGTTCTAATTTACTAATCGTAAAATA--GGCATATTGGCTTACACTGAGGACGACGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTGTAAACTAATCATTTTTTTTTAATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGTGAAACCCCC---CGGCTACCTAGT-TGTAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCAATGGAGAAGGTTGGAAAGGAAGGCGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTCAATTTGACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAAGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTGTTGGAGGAGTATGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTTAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGACCGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTGCCAGCAAACATGGATAAGGATGATAAAGTAAAACACGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCATAATCAGGTAAGCTTAAAGTTCAAT---GAATTTATTC Botrytis_convoluta_MUCL11595 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTGATTTATTTTATCTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCTCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAATGCCTCCTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCTGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATTAATCTTTCTTCCGTTCTAATTTACTAATCGTAATATA--GGCATATTGGCTTACACTGAGGACGACGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTGTAAACTAATCATTTTTTTTTAATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGTGAAACCCCC---CGGCTACCTAGT-TGTAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCAATGGAGAAGGTTGGAAAGGAAGGCGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTCAATTTGACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAAGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTGTTGGAGGAGTATGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTTAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGACCGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTGCCAGCAAACATGGATAAGGATGATAAAGTAAAACACGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCATAATCAGGTAAGCTTAAAGTTCAAT---GAATTTATTC Botrytis_croci_MUCL436 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCCATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCTGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCTAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATTATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTCACTCTATCAATCCATCTTCTGTTACAATTTACTAATCGTAATATA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGATATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTTTAAACTAATCACTTTTTTC--ATTCAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGTAGAACTCTC---CGGCTACCTAGT-TGTAAAATTCTAATTGTTGGCGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCTGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACTAGCGAGGAAATCGCCCAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAGAAGATCTCAAACGTCCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATTGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTTCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGACCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTCCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCTACAACAATCACAAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTTTTGAACAGATATACCTTTGCTTCAACACTTTCTCATTTGCGCCGAACCAATACGCCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACACATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGTGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTGCTGGAGGAGTATGAACCACTTCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAACGATCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGAACACATTCACCGTCTGGAGGAGGATCAGTTGCTGCCAGCAAATATGGATAAGGATGATAAAGTAAAAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTATCTGGACGCGGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_elliptica_BE0022 TAAGTTTCCGCTATCGGACCTCCCACAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTATGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATTCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCGGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCCGTTTTAATTTACTAATCGTAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCAAGTTTTT--GATTTAGGAGCTCAAATTCGGTGTTGAGGGCAAAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCGAAAGCTGTTGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCGAA-CTCCT---CGGTTACCTAGT-TGTAAAATTCTAATCGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAGTTCGAGAACCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACTGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGAACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGACATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTCGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACGGATGTGTACAGATACTTGCAACGCTGCGTGGAAAACAACCGAGAGTTTAATTTAACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACTTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCTATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCTGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAAAGAAACATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGGGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCACCAACAAAGGTAACTTGGTATTGAATAAGGACCACATTCACCGTCTGGAGGAAGATCAGACGATGCCAGCCAACATGGATAAGGGTGATAAACTAAGGGAAGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGCATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_elliptica_BE9610 TAAGTTTCCGCTATCGGACCTCCCACAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTATGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATTCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCGGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCCGTTTTAATTTACTAATCGTAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCAAGTTTTT--GATTTAGGAGCTCAAATTCGGTGTTGAGGGCAAAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCGAAAGCTGTTGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCGAA-CTCCT---CGGTTACCTAGT-TGTAAAATTCTAATCGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAGTTCGAGAACCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACTGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGAACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGACATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTCGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGTACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCCGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACGGATGTGTACAGATACTTGCAACGCTGCGTGGAAAACAACCGAGAGTTTAATTTAACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACTTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCTATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCTGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAAAGAAACATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGGGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCACCAACAAAGGTAACTTGGTATTGAATAAGGACCACATTCACCGTCTGGAGGAAGATCAGACGATGCCAGCCAACATGGATAAGGGTGATAAACTAAGGGAAGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGCATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_elliptica_BE9714 TAAGTTTCCGCTATCGGACCTCCCACAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTATGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATTCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCGGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCCGTTTTAATTTACTAATCGTAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCAAGTTTTT--GATTTAGGAGCTCAAATTCGGTGTTGAGGGCAAAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCGAAAGCTGTTGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCGAA-CTCCT---CGGTTACCTAGT-TGTAAAATTCTAATCGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAGTTCGAGAACCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACTGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGAACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGACATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTCGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCCGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACGGATGTGTACAGATACTTGCAACGCTGCGTGGAAAACAACCGAGAGTTTAATTTAACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACTTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCTATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCTGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAAAGAAACATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGGGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCACCAACAAAGGTAACTTGGTATTGAATAAGGACCACATTCACCGTCTGGAGGAAGATCAGACGATGCCAGCCAACATGGATAAGGGTGATAAACTAAGGGAAGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGCATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_fabae_CBS109.57 TAAGATTCCGCTATCGGAGCTCCCGCAGATATCA--AGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTCTTTCTTCGGCTCTAATTTGCTAATCGTAACACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTGTAAACTGATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCTACAACCTTGGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAACTCC----CGGCTACCTAGT-TTCAAGATTCTAATTATTGGTGAATAGATGGTGTAACCGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTTATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACAAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAAAAGGTTGGTAAGGAAGGTGTTATCACAGTTAAGGAAGGAAAGACCATGGAGGACGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTTTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATTTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCGTCTACTCAACTTCGTCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGCAGATTGACAACAGACGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCAACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCCGGAGTGTCTCAAGTGTTGAACAGATATACCTTTGCATCCACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACCCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTTAAAAATTTGGCTCTGATGTGTTACGTTACAGTCGGTACGCCAAGTGATCCAATCGTTGAGTTCATGATTCAACGAAATATGGAAGTATTGGAGGAGTATGAACCACTCCGAGCCCCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGATAGAGAATTCAAGATTTTCACAGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCAAACAAAGGTAACTTGGTGTTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGGATGAGAAAGTAAGAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGATGCCGAGGAAGAAGAGACTGTCATGATTACAATGACACCTGAAGATCTGGACATCTCCCGACAGCTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GACTTTATTC Botrytis_fabae_MUCL98 TAAGATTCCGCTATCGGAGCTCCCGCAGATATCA--AGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTC----TTCGGCTCTAATTTGCTAATCGTAACACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTGTAAACTGATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCTACAACCTTGGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAACTCC----CGGCTACCTAGT-TTCAAGATTCTAATTATTGGTGAATAGATGGTGTAACCGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTTATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACAAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAAAAGGTTGGTAAGGAAGGTGTTATCACAGTTAAGGAAGGAAAGACCATGGAGGACGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTTTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATTTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCGTCTACTCAACTTCGTCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGCAGATTGACAACAGACGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCAACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCCGGAGTGTCTCAAGTGTTGAACAGATATACCTTTGCATCCACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACCCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTTAAAAATTTGGCTCTGATGTGTTACGTTACAGTCGGTACGCCAAGTGATCCAATCGTTGAGTTCATGATTCAACGAAATATGGAAGTATTGGAGGAGTATGAACCACTCCGAGCCCCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGATAGAGAATTCAAGATTTTCACAGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCAAACAAAGGTAACTTGGTGTTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGGATGAGAAAGTAAGAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGATGCCGAGGAAGAAGAGACTGTCATGATTACAATGACACCTGAAGATCTGGACATCTCCCGACAGCTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GACTTTATTC Botrytis_ficariarum_CBS176.63 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCCGTTTTAATTTACTAATCGTAATATA--GGCATATTGGCTTACACTGAGGATGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATCGCAAGGCCGA??GTAAACTAATCAAGTTTAT--GATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGT??GCGAA-CTCCC---CGGTTA?CTAGT-TGTAAAATTCTAATCGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTGAAGGACAAATTCGAGAACCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACTGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGAACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGACATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTCGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAACTGCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACGGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTAACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACTTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGCCCTGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAAAGAAACATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGGGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCACCAACAAAGGTAACTTGGTATTGAATAAGGACCACATTCACCGTCTGGAGGAAGATCAGACGATGCCAGCCAACATGGATAAGGTTGATAAATTAAGGGAAGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGCATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_ficariarum_MUCL376 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCCGTTTTAATTTACTAATCGTAATATA--GGCATATTGGCTTACACTGAGGATGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCAAGTTTTT--GATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTCGAGACTTTGGCAAAAGCTGTTGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCGAA-CTCCT---CGGTTACCTAGT-TGTAAAATTCTAATCGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACTGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGAACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTCGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACGGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTAACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACTTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGCCCTGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAAAGAAACATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGGGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCACCAACAAAGGTAACTTGGTATTGAATAAGGACCACATTCACCGTCTGGAGGAAGATCAGACGATGCCAGCCAACATGGATAAGGTTGATAAATTAAGGGAAGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGCATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_galanthina_MUCL3204 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCAAAGTCACGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAATGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAGCTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTATTCTATTAATCTTTCTTCCGTTATAATTTACTAATCGTGATATA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTTCAA-CTAATCACTTTTTTA---TTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCCCCAAAGATCACCAAAGGTTTGTGAAACCCCC---CGGCTGCCTACT-TGCGAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTACCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGCGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCTAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTCGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTTTCCGAGAAGAAGATCTCGAACGTCCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTAAAATCCACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACTCTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGTGATCCAATCGTCGAGTTTATGATTCAACGAAATATGGAAGTGTTGGAGGAGTATGAACCACTTCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTCTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGTAGACCTTTATTGGTTATTGACAACGATCCCGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGATCACATTCACCGTCTGGAGGATGATCAAACGCTGCCAGCAAGCATGGATAAGGATGATAAATTGAAAAACGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTACCTGGATGCCGAGGAAGAAGAGACTGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTCCAGGCTGGTTATCAAATTCGTCCTGATGAAAGCGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCGAT---GAATTTATTC Botrytis_galanthina_MUCL435 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCAAAGTCACGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAATGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACTGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAGCTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTATTCTATTAATCTTTCTTCCGTTATAATTTACTAATCGTGATATA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTTCAA-CTAATCACTTTTTTA---TTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCCCCAAAGATCACCAAAGGTTTGTGAAACCCCC---CGGCTGCCTACT-TGCGAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTACCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGCGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCTAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTCGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTTTCCGAGAAGAAGATCTCGAACGTCCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTAAAATCCACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACTCTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGTGATCCAATCGTCGAGTTTATGATTCAACGAAATATGGAAGTGTTGGAGGAGTATGAACCACTTCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTCTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGTAGACCTTTATTGGTTATTGACAACGATCCCGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGATCACATTCACCGTCTGGAGGATGATCAAACGCTGCCAGCAAGCATGGATAAGGATGATAAATTGAAAAACGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTACCTGGATGCCGAGGAAGAAGAGACTGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTCCAGGCTGGTTATCAAATTCGTCCTGATGAAAGCGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCGAT---GAATTTATTC Botrytis_gladiolorum_9701 TAAGTTTCCGCTATCGGACCTCCCGCGGATTTCA--AGGACCCGAGCTAATTTGTACGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCCGAGGCATACTATGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAATTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTTAAGGGTGAGTTACTCTCTCCACCCTTCTCCCGTTCTAATTTACTAATCGCAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTTGATGCCAAGGCCGATTTTAAACTAATCTCTTTTTTA--ATT-AGGAGCTCAAATTCGGTGTTGAGGGTAGAGCAGCTCTTCTTGCCGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACCACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCCCCAAAGATCACTAAAGGTTTGTGAAACCCCC---CGGCTGCCTAGT-TCCAGAATTCTAATGGCTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTTCTTGCCAAATCCATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGGGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATTGCACAAGTTGCGACTATCAGTGCAAATGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGCAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAGAAGATCTCAAACGTCCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGACATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTACAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCCTTACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTAACAACCGATGTGTACAGATACTTGCAGCGTTGCGTGGAAAACAACCGAGAGTTCAATTTGACTTTGGGTGTGAAATCCACAACAATCACAAACGGTCTGAAGTATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACACATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCCTTGATGTGTTACGTTACAGTTGGTACGCCGAGTGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTATTGGAGGAGTATGAACCACTTCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGAGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAACGACCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGAGCACATTCACCGTCTGGAGGAGGATCAGATGCTGCCAGCAAACATGGATAAGGACGATAAAGTAAAAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTATCTGGACGCGGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATTTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTATGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATCATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_gladiolorum_MUCL3865 TAAGTTTCCGCTATCGGACCTCCCGCGGATTTCA--AGGACCCGAGCTAATTTGTACGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCCGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAATTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTTAAGGGTGAGTTACTCTCTCCACCCTTCTCCCGTTCTAATTTACTAATCGCAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTTGATGCCAAGGCCGATTTTAAACTAATCTCTTTTTTA--ATT-AGGAGCTCAAATTCGGTGTTGAGGGTAGAGCAGCTCTTCTTGCCGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACCACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCCCCAAAGATCACTAAAGGTTTGTGAAACCCCC---CGGCTGCCTAGT-TCCAGAATTCTAATGGCTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTTCTTGCCAAATCCATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGGGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATTGCACAAGTTGCGACTATCAGTGCAAATGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGCAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAGAAGATCTCAAACGTCCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGACATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTACAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCCTTACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTAACAACCGATGTGTACAGATACTTGCAGCGTTGCGTGGAAAACAACCGAGAGTTCAATTTGACTTTGGGTGTGAAATCCACAACAATCACAAACGGTCTGAAGTATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACACATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCCTTGATGTGTTACGTTACAGTTGGTACGCCGAGTGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTATTGGAGGAGTATGAACCACTTCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGAGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAACGACCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGAGCACATTCACCGTCTGGAGGAGGATCAGATGCTGCCAGCAAACATGGATAAGGACGATAAAGTAAAAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTATCTGGACGCGGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATTTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTATGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATCATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_globosa_MUCL21514 TAAGTTTCCGCTATCGGACCTACCGCAGATTTCA--AGGACCCGAGCTAATTTGTATGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTCTCCGACGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACTGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTTAAGGGTGAGTTACTCTCTCAACCCTTCTTCCGTTCTAATTTACTAATGATAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTTTCA-CTAATCTCTTTTTTC-CATTTAGGAGCTCAAATTCGGTGTTGAGGGTAGAGCAGCTCTCCTTGCTGGTGTTGAGACTTTGGCAAAAGCGGTTGCCACAACCCTTGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCTCCAAAGATCACTAAAGGTTTGTGAAACCCCC---CGGCTGCCTAGT-TGCAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCCATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTGAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGCAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAGAAGATCTCGAACGTCCAAGATATCATTCCAGCACTTGAGGCATCTACTCAACTTCGCCGCCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAGGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTCGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACCTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCCACAACAATCACAAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACGCATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGCGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTGTTGGAGGAGTATGAACCACTTCGAGCACCCAATGCCACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATCCGAGAAATTCGTGACAGAGAGTTCAAGATTTTTACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAACGACCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGAGCACATTCACCGTCTGGAGGAGGATCAGATGCTGCCAGCAAATTTGGATAAGGACGACAAAGTAAAAAACGGGTACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTATCTGGATGCGGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATTTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTCATTC Botrytis_globosa_MUCL444 TAAGTTTCCGCTATCGGACCTACCGCACATTTCA--AGGACCCGAGCTAATTTGTATGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTCTCCGACGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACTGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTTAAGGGTGAGTTACTCTCTCAACCCTTCTTCCGTTCTAATTTACTAATGATAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTTTCAACTAATCTCTTTTTTC-CATTTAGGAGCTCAAATTCGGTGTTGAGGGTAGAGCAGCTCTCCTTGCTGGTGTTGAGACTTTGGCAAAAGCGGTTGCCACAACCCTTGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCTCCAAAGATCACTAAAGGTTTGTGAAACCCCC---CGGCTGCCTAGT-TGCAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTGAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGCAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAGAAGATCTCGAACGTCCAAGATATCATTCCAGCACTTGAGGCATCTACTCAACTTCGCCGCCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAGGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTCGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACCTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCCACAACAATCACAAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACGCATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGCGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTGTTGGAGGAGTATGAACCACTTCGAGCACCCAATGCCACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATCCGAGAAATTCGTGACAGAGAGTTCAAGATTTTTACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAACGACCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGAGCACATTCACCGTCTGGAGGAGGATCAGATGCTGCCAGCAAATTTGGATAAGGACGACAAAGTAAAAAACGGGTACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTATCTGGATGCGGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATTTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTCATTC Botrytis_hyacinthi_0001 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCCATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCTGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCTAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATTATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTCACTCTATCAATCCATCTTCTGTTACAATTTACTAATCGTAATATA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGATATGAACGGTGACAACCACTCCTCCATCTTCGAATCCAAGGCCGATTTTAAACTAATCACTTTTTTC--ATTCAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGTAGAACTCTC---CGGCTACCTAGT-TGTAAAATTCTAATTGTTGGCGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCTGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACTAGCGAGGAAATCGCCCAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAGAAGATCTCAAACGTCCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATTGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTTCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGACCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCTACAACAATCACAAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTTTTGAACAGATATACCTTTGCTTCAACACTTTCTCATTTGCGCCGAACCAATACGCCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACACATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGTGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTGCTGGAGGAGTATGAACCACTTCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAACGATCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGAACACATTCACCGTCTGGAGGAGGATCAGTTGCTGCCAGCAAATATGGATAAGGATGATAAAGTAAAAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTATCTGGACGCGGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_hyacinthi_MUCL442 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCCATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCTGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCTAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATTATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTCACTCTATCAATCCATCTTCTGTTACAATTTACTAATCGTAATATA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGATATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTTTAAACTAATCACTTTTTTC--ATTCAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGTAGAACTCTC---CGGCTACCTAGT-TGTAAAATTCTAATTGTTGGCGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCTGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACTAGCGAGGAAATCGCCCAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAGAAGATCTCAAACGTCCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATTGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTTCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGACCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGATATCTACAACAATCACAAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTTTTGAACAGATATACCTTTGCTTCAACACTTTCTCATTTGCGCCGAACCAATACGCCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACACATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGTGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTGCTGGAGGAGTATGAACCACTTCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAACGATCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGAACACATTCACCGTCTGGAGGAGGATCAGTTGCTGCCAGCAAATATGGATAAGGATGATAAAGTAAAAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTATCTGGACGCGGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_narcissicola_MUCL18857 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATTTGGATGATGTACAGGCATACATGCTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCCGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAATTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACTGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCTGTCATCAAGAAGGCCGCTGATGGTCCTCTTAAGGGTGAGTTACTCTCTCAACCCTTCTTCCGTTCTAATTTACTAACCACAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTTTAAACTAATCACTTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCTTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCCCCAAAGATCACTAAAGGTTTGTGAAACCCCA---CGGCTGCCTAAT-TGCAAAATTCTAATTGTTGTTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACTGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGCAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAGAAGATCTCAAACGTCCAAGACATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGACATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAACTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCCTTACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTAACAACCGATGTGTACAGATACTTGCAGCGTTGCGTGGAAAACAACCGAGAGTTCAATTTGACTTTGGGTGTGAAATCCACAACAATCACAAACGGTCTGAAGTATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACACATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGTGATCCAATTGTCGAGTTCATGATTCAACGAAACATGGAAGTATTGGAGGAGTATGAGCCACTTCGAGCGCCTAACGCAACAAAGGTTTTCGTCAATGGTGTCTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGAGACAGAGAGTTCAAGATTTTCACCGATGCAGGGCGAGTGTGCAGACCTTTATTGGTTATTGACAACGACCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGAGCACATTCACCGCTTGGAGGAGGATCAGATGTTGCCAGCAAATATGGATAAGGACGATAAAGTAAAAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTATCTGGACGCGGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATTTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGCGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATTTTGGGTATCTGCGCAAGCATCATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTCATTC Botrytis_narcissicola_MUCL2120 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATTTGGATGATGTACAGGCATACATGCTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCCGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAATTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACTGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCTGTCATCAAGAAGGCCGCTGATGGTCCTCTTAAGGGTGAGTTACTCTCTCAACCCTTCTTCCGTTCTAATTTACTAACCACAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTTTAAACTAATCACTTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCTTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCCCCAAAGATCACTAAAGGTTTGTGAAACCCCA---CGGCTGCCTAAT-TGCAAAATTCTAATTGTTGTTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACTGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGCAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAGAAGATCTCAAACGTCCAAGACATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGACATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAACTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCCTTACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTAACAACCGATGTGTACAGATACTTGCAGCGTTGCGTGGAAAACAACCGAGAGTTCAATTTGACTTTGGGTGTGAAATCCACAACAATCACAAACGGTCTGAAGTATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACACATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGTGATCCAATTGTCGAGTTCATGATTCAACGAAACATGGAAGTATTGGAGGAGTATGAGCCACTTCGAGCGCCTAACGCAACAAAGGTTTTCGTCAATGGTGTCTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGAGACAGAGAGTTCAAGATTTTCACCGATGCAGGGCGAGTGTGCAGACCTTTATTGGTTATTGACAACGACCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGAGCACATTCACCGCTTGGAGGAGGATCAGATGTTGCCAGCAAATATGGATAAGGACGATAAAGTAAAAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTATCTGGACGCGGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATTTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGCGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATTTTGGGTATCTGCGCAAGCATCATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTCATTC Botrytis_paeoniae_0003 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACAAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAGGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCTCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATTAATCTCTTTTCCATTTTAATTTACTAATCGTAATATA--GGCATATTGGGTTACACTGAGGACGATGTTGTCTCCACTGACATGAATGGTGACAACAACTCCTCCATCTTCGATGCTAAGGCCGATTTTAAACTAATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGTGAAATCCCC---TGGCTAACTAGT-TGTAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATCTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAATCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATCATCCCAGCACTAGAGGCATCCACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCCCTCGCTGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATTCTCGGCGACCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAAGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCCTGTGGTTTGGTTAAGAATTTGGCTCTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTGTTGGAGGAGTATGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGATCATATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGGATGATAAAGTAAAACACGGATACTATGGATTCCAAGGTTTGATTAATGATGGCGTGGTTGAGTACCTGGATGCCGAGGAAGAAGAGACTGTCATGATTACCATGACACCTGAAGATTTGGACATCTCTCGACAGCTTCAGGCTGGTTACCAAATCCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_paeoniae_MUCL16084 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACAAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAGGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCTCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATTAATCTCTTTTCCATTTTAATTTACTAATCGTAATATA--GGCATATTGGGTTACACTGAGGACGATGTTGTCTCCACTGACATGAATGGTGACAACAACTCCTCCATCTTCGATGCTAAGGCCGATTTTAAACTAATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGTGAAATCCCC---TGGCTAACTAGT-TGTAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATCTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAATCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATCATCCCAGCACTTGAGGCATCCACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCCCTCGCTGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATTCTCGGCGACCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAAGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCCTGTGGTTTGGTTAAGAATTTGGCTCTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTGTTGGAGGAGTATGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGATCATATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGGATGATAAAGTAAAACACGGATACTATGGATTCCAAGGTTTGATTAATGATGGCGTGGTTGAGTACCTGGATGCCGAGGAAGAAGAGACTGTCATGATTACCATGACACCTGAAGATTTGGACATCTCTCGACAGCTTCAGGCTGGTTACCAAATCCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_pelargonii_CBS497.50 TAAGTTTCCGCTATCGGAGCTCCCGCAGATATCA--AGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTCCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTCTTTCTTCGGCTCTAATTTGCTAATCGTAACACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTGTAAACTGATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCTACAACCTTGGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAACTCC----CGGCTACCTAGT-TTCAAGATTCTAATTATTGGTGAATAGATGGTGTAACCGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTTATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCTGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACAAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAAAAGGTTGGAAAGGAAGGTGTTATCACAGTTAAGGAAGGAAAGACCATGGAGGACGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTTTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATTTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCGTCTACTCAACTTCGTCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCAGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGCAGATTGACAACAGACGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGCGTGAAATCAACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCCGGAGTGTCTCAAGTGTTGAACAGATATACCTTTGCATCCACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACCCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTTAAGAATTTGGCTCTGATGTGTTACGTTACAGTCGGTACGCCAAGTGATCCAATCGTTGAGTTCATGATTCAACGAAATATGGAAGTATTGGAGGAGTATGAACCACTCCGAGCCCCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGATAGAGAATTCAAGATTTTCACAGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCAAACAAAGGTAACTTGGTGTTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGGATGAGAAAGTAAGAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGATGCCGAGGAAGAAGAGACTGTCATGATTACAATGACACCTGAAGATCTGGACATCTCCCGACAGCTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_pelargonii_MUCL1152 TAAGTTTCCGCTATCGGAGCTCCCGCAGATATCA--AGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTCCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTCTTTCTTCGGCTCTAATTTGCTAATCGTAACACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTGTAAACTGATCATGTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCTACAACCTTGGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAAACTCC----CGGCTACCTAGT-TTCAAGATTCTAATTATTGGTGAATAGATGGTGTAACCGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTTATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCTGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACAAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAAAAGGTTGGAAAGGAAGGTGTTATCACAGTTAAGGAAGGAAAGACCATGGAGGACGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTTTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTGGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATTTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCGTCTACTCAACTTCGTCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCAGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTCCCGCAGATTGACAACAGACGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGCGTGAAATCAACAACAATCACCAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCCGGAGTGTCTCAAGTGTTGAACAGATATACCTTTGCATCCACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACCCATTGGGGCTTGGTCTGTCCGGCAGAGACGCCCGAAGGACAAGCTTGTGGTTTGGTTAAGAATTTGGCTCTGATGTGTTACGTTACAGTCGGTACGCCAAGTGATCCAATCGTTGAGTTCATGATTCAACGAAATATGGAAGTATTGGAGGAGTATGAACCACTCCGAGCCCCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGAGAAATTCGTGATAGAGAATTCAAGATTTTCACAGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCAAACAAAGGTAACTTGGTGTTGAACAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGGATGAGAAAGTAAGAAACGGATACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTACCTGGATGCCGAGGAAGAAGAGACTGTCATGATTACAATGACACCTGAAGATCTGGACATCTCCCGACAGCTTCAGGCTGGTTACCAAATTCGTCCTGACGAAAGTGGTGATTTGAACAAGCGTGTTAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAAGTTATTC Botrytis_polyblastis_CBS287.38 TAAGTTTCCGCTATCGGACCTCCCGCACATTTCA--AGGACCCGAGCTAATTTGTATGATGTCCAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTCTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCCGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTAATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCCTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCCAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTTAAGGGTGAGTTACTCTCTCAACCCTTCTTCCGTTCTAATTTACTGATCATAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTTTCAACTAATCACTACTTTC-CATTTAGGAGCTCAAATTCGGTGTTGAGGGTAGAGCAGCTCTCCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTTGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCTCCCAAGATCACTAAAGGTTTGTGAAACCCCC---CGGCTGCCTAGT-TGCAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTGAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTACGCAGAGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAAAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACGCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGCAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGTGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAGAAGATCTCAAACGTTCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATCCTCAACAAACTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTTTGTTCCGTAGATTAACAACCGACGTGTACAGATACTTGCAGCGTTGTGTGGAAAACAACCGAGAGTTCAATTTGACTTTGGGTGTGAAATCCACAACAATCACAAACGGTCTGAAGTATTCTTTGGCCACAGGCAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACACTTTCTCATTTGCGCCGAACAAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACGCATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGTGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTATTGGAGGAGTATGAACCACTTCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAACGACCCTGACAGCGCCAACAAAGGTAACTTGGTTTTGAACAAGGAGCACATTCACCGTCTGGAGGAGGATCAGATGCTGCCCGCAAATATGGATAAGGACGATAGAGTAAAAAACGGATACTATGGATTCCAAGGGTTGATTAATGACGGTGTAGTTGAGTATCTGGACGCGGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATTTCTCGGCAACTCCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATCTGAATAAGCGTGTCAAGGCACCTATCAATCCAACAGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GA-GTTATTC Botrytis_polyblastis_MUCL21492 TAAGTTTCCGCTATCGGACCTCCCGCACATTTCA--AGGACCCGAGCTAATTTGTATGATGTCCAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTCTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCCGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTAATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCCTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCCAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTTAAGGGTGAGTTACTCTCTCAACCCTTCTTCCGTTCTAATTTACTGATCATAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTTTCAACTAATCACTACTTTC-CATTTAGGAGCTCAAATTCGGTGTTGAGGGTAGAGCAGCTCTCCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCCTTGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCTCCCAAGATCACTAAAGGTTTGTGAAACCCCC---CGGCTGCCTAGT-TGCAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTGAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTACGCAGAGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAAAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACGCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGCAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGTGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAGAAGATCTCAAACGTTCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATCCTCAACAAACTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTTTGTTCCGTAGATTAACAACCGACGTGTACAGATACTTGCAGCGTTGTGTGGAAAACAACCGAGAGTTCAATTTGACTTTGGGTGTGAAATCCACAACAATCACAAACGGTCTGAAGTATTCTTTGGCCACAGGCAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACACTTTCTCATTTGCGCCGAACAAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACGCATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGTGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTATTGGAGGAGTATGAACCACTTCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAACGACCCTGACAGCGCCAACAAAGGTAACTTGGTTTTGAACAAGGAGCACATTCACCGTCTGGAGGAGGATCAGATGCTGCCCGCAAATATGGATAAGGACGATAGAGTAAAAAACGGATACTATGGATTCCAAGGGTTGATTAATGACGGTGTAGTTGAGTATCTGGACGCGGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATTTCTCGGCAACTCCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATCTGAATAAGCGTGTCAAGGCACCTATCAATCCAACAGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GA-TTTATTC 'Botrytis porri GarlicBC-16' TAAGTTTCCGCTATCGGAGCTCCCGCAGATATCA--CGGACCCGAGCTAATTCGTATTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCATTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATTAATCTTTCTTCCATTCTAATTTACTAATCGTAATATA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATATGAAACTAATCATGGTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTCGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAA-CCCCC---TGGCTACCAAGT-TGTAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGTACCACAACCGCTACTGTCCTTGCCAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTCGCGCAGAGGTACCCAAGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGGTATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATCACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTTGAATTCGAGAAACCATTGATTCTCCTCTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCATCTACCCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGCGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCGACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGTCTGGTCTGCCCGGCAGAGACACCCGAGGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAATTCATGATTCAACGAAACATGGAAGTGTTGGAGGAGTATGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCCAACAAAGGTAACTTGGTGTTGAATAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGATTGGGAAAGTAAAAAACGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATCACTATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAACCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC 'Botrytis porri GarlicBC-38' TAAGTTTCCGCTATCGGAGCTCCCGCAGATATTA--CGGACCCGAGCTAATTCGTATTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCATTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCACCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGGTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATTAATCTTTCTTCCATTCTAATTTACTAATCGTAATATA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATATGAAACTAATCATGGTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTCGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAA-CCCCC---TGGCTACCAAGT-TGTAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGTACCACAACCGCTACTGTCCTTGCCAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATCACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTTGAATTCGAGAAACCATTGATTCTCCTCTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCATCTACCCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGCGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTCGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCGACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGTCTGGTCTGCCCGGCAGAGACACCCGAGGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAATTCATGATCCAACGAAACATGGAAGTGTTGGAGGAGTATGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTAACAGCGCCAACAAAGGTAACTTGGTGTTGAATAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGATTGGGAAAGTAAAAAACGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATCACTATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAACCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCCGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_porri_MUCL3234 TAAGTTTCCGCTATCGGAGCTCCCGCAGATATTA--CGGACCCGAGCTAATTCGTATTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCATTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATTAATCTTTCTTCCATTCTAATTTACTAATCGTAATATA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATATGAAACTAATCATGGTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTCGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAA-CCCCC---TGGCTACCAAGT-TGTAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGTACCACAACCGCTACTGTCCTTGCCAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATCACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTTGAATTCGAGAAACCATTGATTCTCCTCTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCATCTACCCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGCGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACCGATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCGACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGTCTGGTCTGCCCGGCAGAGACACCCGAGGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAATTCATGATTCAACGAAACATGGAAGTGTTGGAGGAGTATGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCCAACAAAGGTAACTTGGTGTTGAATAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGATTGGGAAAGTAAAAAACGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATCACTATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAACCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_porri_MUCL3349 TAAGTTTCCGCTATCGGAGCTCCCGCAGATATTA--CGGACCCGAGCTAATTCGTATTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCATTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATTAATCTTTCTTCCATTCTAATTTACTAATCGTAATATA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATATGAAACTAATCATGGTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTCGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAA-CCCCC---TGGCTACCAAGT-TGTAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGTACCACAACCGCTACTGTCCTTGCCAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATCACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTTGAATTCGAGAAACCATTGATTCTCCTCTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCATCTACCCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGCGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCGACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGTCTGGTCTGCCCGGCAGAGACACCCGAGGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAATTCATGATTCAACGAAACATGGAAGTGTTGGAGGAGTATGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCCAACAAAGGTAACTTGGTGTTGAATAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGATTGGGAAAGTAAAAAACGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATCACTATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAACCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC 'Botrytis porri OnionBC-95' TAAGTTTCCGCTATCGGAGCTCCCGCAGATATCA--CGGACCCGAGCTAATTCGTATTATGTATAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATTAATCTTTCTTCCATTCTAATTTACTAATCGTAATATA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCTGATTTGAAACTAATCATGGTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTCGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAA-CCCCC---TGGCTACCAAGT-TGTAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGTACCACAACCGCTACTGTCCTTGCCAAATCTATTTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAAGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACCAGTTGCGACTATCAGTGCAGACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATCACCGAGGGAATGAGATTTGACCGCGGGTATGTCTCCCCATACTTCATCAACGATACCAAGTCGCAAAAGGTTGAATTCGAGAAACCATTGATTCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCATCTACCCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGCGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCTTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCGACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACCTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGTCTGGTCTGCCCGGCAGAGACACCCGAGGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAATTCATGATTCAACGAAACATGGAAGTGTTGGAGGAGTATGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTCTATTGGTTATTGACAATGATCCTGACAGCGCCAACAAAGGTAACTTGGTGTTGAATAAGGATCACATTCGCCGTCTGGAGGATGATCAGTTGCTACCAGCAAACATGGATAAGATTGGGAAAGTAAAAAACGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATCACTATGACACCTGAAGATCTGGACATCTCTCGACAACTTTAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAACCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_ranunculi_CBS178.63 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTATTATTTCTTCCGTTTTAATTTACTAATCGTAATGTA--GGTATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGCAAACTAATCAAGTTTTT--GATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTCGAGACTTTGGCAAAAGCTGTTGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCGCCAAAGATCACTAAAGGTTTGCGAA-CTCCC---CGGTTACCTAGT-TGTAAAATTCTAATCGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACTGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGAACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTCGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGACATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCCGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACGGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTAACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACTTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGCCCTGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAAAGAAACATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGGGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCACCAACAAAGGTAACTTGGTATTGAATAAGGACCACATTCACCGTCTGGAGGAAGATCAGACGATGCCAGCCAACATGGATAAGGGTGATAAAGTAAGGGAAGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGCATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC 'Botrytis sinoallii LeekBC-18' TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAACTCACTGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTTATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCCGTTTTAATTTACTAATCGTAATATA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCAAGTTTTT--GATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATTACTAAAGGTTTGCGAA-CTCCC---CGGTTACCTAGT-TGTAAAATTCTAATCGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACTGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGAACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACGATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTCGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACGGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTAACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACAGCTGGTGTGTCTCAAGTGTTGAACAGATATACTTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGCCCTGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAAAGAAACATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGGGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCACCAACAAAGGTAACTTGGTATTGAATAAGGACCACATTCACCGTCTGGAGGAAGATCAGGCGCTGCCAGCCAACATGGATAAGGATGATAAAGTAAGACAAGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGCATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC 'Botrytis sinoallii OnionBC-23' TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTAGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAGAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAACTCACTGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTTATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCTGTTTTAATTTACTAATCGTAATATA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCAAGTTTTT--GATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATTACTAAAGGTTTGCGAA-CTCCC---CGGTTACCTAGT-TGTAAAATTCTAATCGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACTGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGAACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACGATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTCGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACGGATGTATACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTAACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAGTATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACAGCTGGTGTGTCTCAAGTGTTGAACAGATATACTTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGCCCTGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAAAGAAACATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGGGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCACCAACAAAGGTAACTTGGTATTGAATAAGGACCACATTCACCGTCTGGAGGAAGATCAGGCGCTGCCAGCCAACATGGATAAGGATGATAAAGTAAGACAAGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGCATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC 'Botrytis sinoallii OnionBC-59' TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGCACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGCTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAACTCACTGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTTATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTCCCGTTTTAATTTACTAATCGTAATATA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACACGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCAAGTTTTT--GATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTTGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATTACTAAAGGTTTGCGAA-CTCCC---CGGTTACCTAGT-TGTAAAATTCTAATCGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAACCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACTGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGAACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCGAGGAGGGAAAGACGATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTCGAATTCGAGAAGCCATTGATTCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACGGATGTGTACAGATACTTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTAACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGCGACCAGAAGAAGGCAGCAAGTTCTACAGCTGGTGTGTCTCAAGTGTTGAACAGATATACTTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCCATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGCCCTGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAAAGAAACATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGGGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCACCAACAAAGGTAGCTTGGTATTGAATAAGGACCACATTCACCGTCTGGAGGAAGATCAGGCGCTGCCAGCCAACATGGATAAGGATGATAAAGTAAGACAAGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGCATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_sphaerosperma_MUCL21481 TAAGTTTCCGCTATCGGACCTACCGCAGATTTCA--AGGACCCGAGCTAATTTGTATGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACTGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTTAAGGGTGAGTTACTCTCTCAACCCTTCTTCCGTTCTAATTTACTAATGATAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTTTCAACTAATCACTTTTTTC-CATTTAGGAGCTCAAATTCGGTGTTGAGGGTAGAGCAGCTCTCCTTGCTGGTGTTGAGACTTTGGCAAAAGCGGTTGCCACAACCCTTGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCTCCAAAGATCACTAAAGGTTTGTGAAACCCCC---CGGCTGCCTAGT-TGCAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTGAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGCAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAGAAGATCTCGAACGTCCAAGATATCATTCCAGCACTTGAGGCATCTACTCAACTTCGCCGCCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAGGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTCGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACCTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCCACAACAATCACAAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACGCATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGCGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTGTTGGAGGAGTATGAACCACTTCGAGCACCCAATGCCACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATCCGAGAAATTCGTGACAGAGAGTTCAAGATTTTTACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAACGACCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGAGCACATTCACCGTCTGGAGGAGGATCAGATGCTGCCAGCAAATTTGGATAAGGACGACAAAGTAAAAAACGGGTACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTATCTGGATGCGGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATTTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAACCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTCATTC Botrytis_sphaerosperma_MUCL21482 TAAGTTTCCGCTATCGGACCTACCGCAGATTTCA--AGGACCCGAGCTAATTTGTATGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACTGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTTAAGGGTGAGTTACTCTCTCAACCCTTCTTCCGTTCTAATTTACTAATGATAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTTTCA-CTAATCACTTTTTTC-CATTTAGGAGCTCAAATTCGGTGTTGAGGGTAGAGCAGCTCTCCTTGCTGGTGTTGAGACTTTGGCAAAAGCGGTTGCCACAACCCTTGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCTCCAAAGATCACTAAAGGTTTGTGAAACCCCC---CGGCTGCCTAGT-TGCAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTGAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGCAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAGAAGATCTCGAACGTCCAAGATATCATTCCAGCACTTGAGGCATCTACTCAACTTCGCCGCCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAGGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTCGCCGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTCCCGTAGATTGACAACAGATGTGTACAGATACCTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCCACAACAATCACAAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACGCATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGCGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTGTTGGAGGAGTATGAACCACTTCGAGCACCCAATGCCACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCACTCATCCGAGAAATTCGTGACAGAGAGTTCAAGATTTTTACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAACGACCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGAGCACATTCACCGTCTGGAGGAGGATCAGATGCTGCCAGCAAATTTGGATAAGGACGACAAAGTAAAAAACGGGTACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTATCTGGATGCGGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATTTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAACCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAAGTCATTC 'Botrytis squamosa GarlicBC-2' TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCTGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCCGTTTTAATTTACTAATCGTAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCTACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCAAGTTTTT--GATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCGAAAGCTGTTGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCGAA-CTCCT---CGGTTACCTAGT-TGTAAAATTCTAATCGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAGTTCGAGAACCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGGCCGCTGGTGATGGAACCACAACTGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGAACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGACATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCCCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTCGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACGGATGTGTACAGATACTTGCAACGCTGCGTGGAAAACAACCGAGAGTTTAATTTAACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACTTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCTATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCTGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAAAGAAACATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGGGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCACCAACAAAGGTAACTTGGTATTGAATAAGGACCACATTCACCGTCTGGAGGAAGATCAGACGATGCCAGCCAACATGGATAAGGGTGATAAACTAAGGGAAGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGCATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC 'Botrytis squamosa LeekBC-2' TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCTGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGCTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGCCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCCGTTTTAATTTACTAATCGTAATACA--GGCATATTGGCTTACACCGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCAAGTTTTT--GATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCGAAAGCTGTTGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCGAA-CTCCT---CGGTTACCTAGT-TGTAAAATTCTAATCGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAGTTCGAGAACCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACTGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGAACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGACATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTCGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCTGTCAAGGCCCCTGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACGGATGTGTACAGATACTTGCAACGCTGCGTGGAAAACAACCGAGAGTTTAATTTAACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACTTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCTATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCTGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAAAGAAACATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGGGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCACCAACAAAGGTAACTTGGTATTGAATAAGGACCACATTCACCGTCTGGAGGAAGATCAGACGATGCCAGCCAACATGGATAAGGGTGATAAACTAAGGGAAGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAGGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGCATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_squamosa_MUCL1107 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCTGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCCGTTTTAATTTACTAATCGTAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCAAGTTTTT--GATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCGAAAGCTGTTGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCGAA-CTCCT---CGGTTACCTAGT-TGTAAAATTCTAATCGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAGTTCGAGAACCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACTGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGAACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGACATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTCGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCCGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACGGATGTGTACAGATACTTGCAACGCTGCGTGGAAAACAACCGAGAGTTTAATTTAACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACTTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCTATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCTGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGCACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAAAGAAACATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGGGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCACCAACAAAGGTAACTTGGTATTGAATAAGGACCACATTCACCGTCTGGAGGAAGATCAGACGATGCCAGCCAACATGGATAAGGGTGATAAACTAAGGGAAGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGCATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_squamosa_MUCL9112 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCTGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCCGTTTTAATTTACTAATCGTAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCAAGTTTTT--GATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCGAAAGCTGTTGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCGAA-CTCCT---CGGTTACCTAGT-TGTAAAATTCTAATCGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAGTTCGAGAACCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACTGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGAACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGACATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTCGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCCGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACGGATGTGTACAGATACTTGCAACGCTGCGTGGAAAACAACCGAGAGTTTAATTTAACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACTTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCTATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCTGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGCACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAAAGAAACATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGGGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCACCAACAAAGGTAACTTGGTATTGAATAAGGACCACATTCACCGTCTGGAGGAAGATCAGACGATGCCAGCCAACATGGATAAGGGTGATAAACTAAGGGAAGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGCATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC 'Botrytis squamosa OnionBC-19' TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGCGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCTGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTGTCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCCGTTTTAATTTACTAATCGTAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCAAGTTTTT--GATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCGAAAGCTGTTGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCGAA-CTCCT---CGGTTACCTAGT-TGTAAAATTCTAATCGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAGTTCGAGAACCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACTGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGAACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGACATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTCGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCCGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACGGATGTGTACAGATACTTGCAACGCTGCGTGGAAAACAACCGAGAGTTTAATTTAACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACTTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCTATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCTGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGCACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAAAGAAACATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGGGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCACCAACAAAGGTAACTTGGTATTGAATAAGGACCACATTCACCGTCTGGAGGAAGATCAGACGATGCCAGCCAACATGGATAAGGGTGATAAACTAAGGGAAGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGCATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_squamosa_PRI026 TAAGTTTCCGCTATCGGACCTCCCGCAGATTTCA--AGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCTGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCCGTTTTAATTTACTAATCGTAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTGTAAACTAATCAAGTTTTT--GATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCGAAAGCTGTTGCCACAACCTTAGGTCCCAAAGGCCGAAATGTTCTTATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCGAA-CTCCT---CGGTTACCTAGT-TGTAAAATTCTAATCGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAGTTCGAGAACCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACTGCTACTGTCCTTGCTAAATCTATCTTCTCCGAGACCGTAAAGAACGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGAACCCAAGCCGCCGTGGAGGCCGTTGTTGAGTTTTTGCAAAAGAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAGTTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGAAAGACCATGGAGGATGAACTCGACATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAGGTCGAATTCGAGAAGCCATTGATCCTCCTTTCTGAGAAGAAGATCTCAAACGTCCAAGATATTATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAAGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCCGCCGTCAAGGCCCCCGGTTTCGGTGATAACCGAAAGTCTATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACGGATGTGTACAGATACTTGCAACGCTGCGTGGAAAACAACCGAGAGTTTAATTTAACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTGTTGAACAGATATACTTTTGCTTCAACGCTTTCTCATTTGCGCCGAACCAATACACCTATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGCTTGGTCTGTCCTGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGCACGCCAAGTGATCCAATCGTCGAGTTCATGATTCAAAGAAACATGGAAGTGTTGGAGGAGTACGAACCACTCCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGTGTCCAAGATCTTCGTAGATCACACTTGATCTCTCATGAAGTTTCACTTATTCGGGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAATGATCCTGACAGCACCAACAAAGGTAACTTGGTATTGAATAAGGACCACATTCACCGTCTGGAGGAAGATCAGACGATGCCAGCCAACATGGATAAGGGTGATAAACTAAGGGAAGGATACTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAGTATCTGGACGCCGAGGAAGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTGGACATCTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCCGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGCATCTGCGCAAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_tulipae_BT9001 TAAGTTTCCGCTATCGGACCTCCCGCTGATTTCA--AGGACCCGAGCTAATTTTTATGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCCGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCGCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAATTCACCATCATTGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTCTCAACCCTTCTTCCGTTCTAATTTACTAATCATAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTTTAAACTAATCACTTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTCGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCCCCGAAGATCACTAAAGGTTTGTGAAATCCCC---CGGCCACCTAGT-TGCAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAATGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAAAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGCAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAAAAGATCTCAAACGTCCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAGGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCTGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACCTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACGCATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGTGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTGTTAGAGGAGTATGAACCACTTCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGCGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCTCTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAACGACCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGAGCACATTCACCGTCTGGAGGAGGATCAGGCGCTGCCAGCAAATATGGATAAGGACGATAAAGTAAAAAACGGGTACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTATCTGGACGCGGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATTTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCGAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_tulipae_BT9830 TAAGTTTCCGCTATCGGACCTCCCGCTGATTTCA--AGGACCCGAGCTAATTTTTATGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCCGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCGCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAATTCACCATCATTGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTCTCAACCCTTCTTCCGTTCTAATTTACTAATCATAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTTTAAACTAATCACTTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTCGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCCCCGAAGATCACTAAAGGTTTGTGAAATCCCC---CGGCCACCTAGT-TGCAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAATGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAAAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGCAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAAAAGATCTCAAACGTCCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAGGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCTGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACCTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACGCATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGTGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTGTTAGAGGAGTATGAACCACTTCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGCGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCTCTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAACGACCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGAGCACATTCACCGTCTGGAGGAGGATCAGGCGCTGCCAGCAAATATGGATAAGGACGATAAAGTAAAAAACGGGTACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTATCTGGACGCGGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATTTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCGAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Botrytis_tulipae_BT9901 TAAGTTTCCGCTATCGGACCTCCCGCTGATTTCA--AGGACCCGAGCTAATTTTTATGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCCGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCGCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAATTCACCATCATTGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTCTCAACCCTTCTTCCGTTCTAATTTACTAATCATAATACA--GGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTTTAAACTAATCACTTTTTTA--ATTTAGGAGCTCAAATTCGGTGTTGAGGGCAGAGCAGCTCTTCTTGCTGGTGTTGAGACTTTGGCAAAAGCTGTCGCCACAACCCTAGGTCCAAAAGGCCGAAATGTTCTTATTGAGTCAGCATACGGCTCCCCGAAGATCACTAAAGGTTTGTGAAATCCCC---CGGCCACCTAGT-TGCAAAATTCTAATTGTTGGTGAATAGATGGTGTAACTGTTGCCAGAGCTATTTCCCTCAAGGACAAATTCGAGAATCTCGGTGCTAGACTCATCCAAGATGTTGCCTCGAAAACCAACGAGACCGCTGGTGATGGAACCACAACCGCTACTGTCCTTGCTAAATCTATTTTCTCCGAGACCGTAAAGAATGTCGCCGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACCCAGGCCGCCGTGGAGGCCGTCGTTGAGTTTTTGCAAAAAAACAAGCGTGATATCACAACCAGCGAGGAAATCGCACAAGTTGCGACTATCAGTGCAAACGGTGATACCCACATCGGAAAATTGATTGCCAACGCTATGGAGAAGGTTGGAAAGGAAGGTGTCATCACAGTCAAGGAGGGCAAGACCATGGAGGATGAACTCGATATTACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGATACCAAGTCGCAAAAAGTGGAATTCGAGAAGCCACTGATCCTCCTCTCCGAGAAAAAGATCTCAAACGTCCAAGATATCATCCCAGCACTTGAGGCATCTACTCAACTTCGCCGTCCTTTGGTCATCATTGCTGAAGATATCGATGGAGAGGCTCTCGCTGTATGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCTGCTGTCAAGGCCCCCGGTTTCGGTGACAACCGAAAGTCCATCCTCGGCGATCTCGGTATCCTGACCAATGCTACCGTCTTCACTCTGTTCCGTAGATTGACAACAGATGTGTACAGATACCTGCAACGTTGCGTGGAAAACAACCGAGAGTTTAATTTGACTTTGGGTGTGAAATCCACAACAATCACGAACGGTCTGAAATATTCTTTGGCCACAGGTAACTGGGGTGATCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTGTCTCAAGTATTGAACAGATATACCTTTGCTTCAACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACGCATTGGGGCTTGGTCTGCCCGGCAGAGACGCCCGAAGGTCAAGCTTGTGGTTTGGTTAAGAATTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCGAGTGATCCAATCGTCGAGTTCATGATTCAACGAAACATGGAAGTGTTAGAGGAGTATGAACCACTTCGAGCACCCAATGCAACAAAGGTTTTCGTCAATGGTGTTTGGGTTGGTATTCATCGAGATCCTGCTCATTTGGTCAAATGCGTCCAAGATCTTCGTAGATCACACTTGATCTCTCACGAAGTTTCTCTCATTCGAGAAATTCGTGACAGAGAGTTCAAGATTTTCACCGATGCAGGACGAGTGTGCAGACCTTTATTGGTTATTGACAACGACCCTGACAGCGCCAACAAAGGTAACTTGGTATTGAACAAGGAGCACATTCACCGTCTGGAGGAGGATCAGGCGCTGCCAGCAAATATGGATAAGGACGATAAAGTAAAAAACGGGTACTATGGATTCCAAGGTTTGATTAATGACGGTGTGGTTGAGTATCTGGACGCGGAGGAGGAAGAGACCGTCATGATTACCATGACACCTGAAGATCTTGACATTTCTCGACAACTTCAGGCTGGTTATCAAATTCGTCCTGATGAAAGTGGTGATTTGAACAAGCGTGTCAAGGCACCTATCAATCCAACTGCCCATGTCTGGACTCATTGTGAAATTCATCCAAGTATGATCTTGGGTATCTGCGCGAGCATTATTCCCTTCCCGGATCACAATCAGGTAAGCTTTAAGTTCAAT---GAATTTATTC Monilinia_fructigena_9201 TAAGTTTCCGCTTTCGGACCTCCCAATGACACCA--AGGACCCGAGCTAATTTTTATCCTTCACAGGCATACATGTTGAAATATGACTCCACTCACGGTCAATTCAAGGGTGATATCAAAGTCCTCTCCGACGGATTGGAGGTTAATGGCAAGAAAGTCAAGTTCTACACTGAGAGAGACCCTGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTCTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCCCCAATGTACGTCATGGGTGTCAACAACGAGACCTACAATGGTGAAGCAGATGTTATCTCCAACGCTTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATTCACTCCTACACTGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATTCCATCGAGCACCGGTGCCGCCAAGGCCGTCGGAAAGGTCATTCCAGAGCTTAACGGCAAGCTCACCGGAATGTCTATGCGTGTTCCAACTGCCAACGTCTCTGTTGTTGACTTGACTGTCCGCATTGAGAAGGCTGCTTCTTATGATGAGATCAAGGAGGTCATCAAGAAGGCCGCCAATGGTCCTCTCAAGGGTAAGA-AATTTGTCAATATTCATTACTTTTCAATTTACTAACAGCAATGTATAGGCATATTGGCTTACACCGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGATTATGTGCTAATCAGTCCTTCATTTTATAGGAGCTCAAATTTGGTGTTGAAGGCAGAGCAGCTCTTCTCGCCGGTGTTGAGACGTTGGCCAAGGCTGTTGCCACTACTTTGGGACCTAAAGGCCGTAATGTTCTCATTGAGTCAGCATATGGCTCTCCAAAAATTACTAAAGGTTTGGAAAGCTGTT---AAATATTTATGA--CTATAACTCTAATTATTCGTAAACAGATGGTGTAACCGTTGCCAGAGCCATTACTCTTAAGGACAAATTCGAGAATCTTGGTGCAAGACTTATTCAAGATGTTGCCTCCAAAACCAACGAGACTGCTGGTGATGGAACTACAACCGCCACTGTCCTTGCCAAATCTATCTTCTCCGAGACCGTAAAGAATGTTGCTGCAGGATGCAACCCAATGGACTTGCGCAGAGGTACACAAGCTGCCGTGGAAGCTGTTGTCGAATTTTTGCAGAAGAACAAGCGCGATATCACAACTAGCGAAGAAATCGCTCAAGTTGCAACTATCAGTGCAAATGGTGATACCCACATCGGAAAGTTGATTGCCAATGCTATGGAGAAGGTTGGAAAGGAAGGTGTGATCACAGTCAAGGAAGGAAAGACCATGGAGGATGAACTTGATATCACCGAGGGAATGAGATTTGACCGCGGTTATGTCTCCCCATACTTCATCACCGACACCAAGTCGCAAAAGGTAGAATTCGAGAAACCATTGATCCTCCTCTCCGAGAAGAAGATCTCGAACGTTCAAGACATTATCCCAGCTCTTGAGGCTTCTACTCAACTCCGTCGCCCATTAGTCATCATTGCTGAAGACATTGATGGAGAGGCTCTTGCTGTATGCATTCTTAACAAGCTCCGTGGTCAACTCCAAGTTGCTGCTGTCAAAGCTCCTGGCTTTGGCGACAACCGAAAGTCTATTCTCGGCGATCTCGGTATCTTGACCAATGCCACTGTCTTCACCCTGTTCCGCAGATTGACGACAGATGTTTACAGATACTTGCAGCGTTGCGTGGAGAACAACCGAGAGTTCAATTTAACTTTAGGTGTTAAATCTACGACGATCACGAACGGTCTGAAATGTTCCTTGGCTACAGGAAATTGGGGTGACCAAAAGAAGGCAGCAAGTTCTACTGCTGGTGTGTCTCAAGTATTGAACAGATATACTTTTTCATCAACACTTTCTCATTTGCGCCGAACCAATACACCCATTGGACGTGATGGAAAGATTGCCAAGCCTAGACAATTGCACAATACTCATTGGGGTTTGGTATGTCCGGCAGAGACGCCCGAAGGACAAGCTTGTGGCTTGGTCAAGAACTTGGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGACCCTATCGTTGAGTTCATGATTCAGCGAAACATGGAAGTGCTGGAGGAGTATGAACCGCTTCGAGCACCCAATGCCACTAAGGTTTTTGTCAATGGTGTTTGGGTTGGCATTCATCGAGATCCCGCCCATCTGGTCAAATGTGTACAAGACCTTCGTAGATCGCACTTGATTTCTCATGAAGTCTCACTTATTCGAGAAATTCGAGACAGAGAATTCAAGATCTTCACCGACGCAGGACGAGTCTGCAGACCTCTGTTGGTCATCGACAATGATCCTGACAGCCCTAACAAAGGTAATCTGGTATTGAACAAAGATCATATTCGCCGTTTGGAGGATGATCAGTCGCTACCAGCAAACATGGATCCTGCAGAGCGAGTAAATCAAGGATATTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTCGAATATCTGGACGCCGAGGAAGAAGAGACTGTCATGATTACCATGACCCCTGAAGATCTGGACATTTCTCGACAACTTCAAGCTGGTTATCAAATTCGTCCCGACGAGAGTGGCGATTTAAATAAGCGTGTCAAGGCACCTATCAATCCTACTGCTCATATATGGACTCATTGTGAAATTCATCCAAGTATGATTCTGGGTATCTGTGCAAGCATTATTCCCTTCCCTGATCACAACCAGGTAAGTTTTGAATCCAAGAATGAATTGGTTA Sclerotinia_sclerotiorum_484 TAAGTTATTCCCTCCGGACCTCCCGCATATACCCTCAGAACCCGAGCTAATCCTTTTTCTTTGCAGGCATACATGTTGAAGTATGACTCCACCCACGGTCAATTCAAGGGTGATGTCAAGGTCCTCCCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCTGCCAACATTCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACGGGTGACGCTGATGTCATCTCCAACGCTTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAGGGTTTGATGACCACCATCCACTCCTACACTGCCACCCAAAAGACCGTTGATGGTCCATCCGCCAAGGACTGGCGTGGAGGACGTACCGCTGCTCAAAACATTATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAGCTCACCGGAATGGCCATGCGTGTCCCAACTGCCAACGTCTCCGTTGTTGACTTGACCTGCCGCATTGAGAAGGGTGCTACTTATGAAGAGATCAAGGCTGTCGTCAAGAAGGCTGCTGAGGGTCCTCTCAAGGGTATGA-GCTTTCATAATCTTTTATGCTTTCCAGATTACTAACAGTGATATATAGGCATATTGGGTTACACTGAGGACGATGTTGTCTCTACTGATTTGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCCGAATTTATGTTAATCATTTTGTCA---TTTAGGAGCTCAAATTCGGTGTTGAAGGCAGAGCAGCTCTTTTGGCTGGTGTGGAGACTTTAGCAAAGGCTGTTGCCACAACCCTAGGACCCAAAGGACGAAATGTTTTGATTGAGTCAGCATATGGCTCCCCAAAGATCACTAAAGGTTTGCAAATTCTTCAAAAGGCTTCTTTGAATGCACAATTCTAACTGTTGGTGAACAGATGGTGTAACTGTTGCTAGAGCGATTACTCTCAAGGATAAATTCGAGAATCTCGGTGCTAGACTTATTCAAGATGTTGCCTCAAAAACCAACGAGACAGCTGGTGATGGAACCACAACCGCAACTGTCCTTGCCAAATCTATCTTCTCCGAGACTGTAAAGAACGTTGCTGCAGGATGCAACCCAATGGACTTGCGCAGGGGTACACAGGCTGCTGTAGAAGCTGTTGTTGAGTTTTTGCAAAAGAACAAACGTGATATCACGACCAGCGAGGAAATTGCACAAGTCGCAACTATCAGTGCAAATGGCGATACCCACATTGGAAAATTGATTGCCAACGCCATGGAGAAGGTTGGAAAGGAAGGTGTAATCACAGTTAAGGAAGGAAAGACCATGGAAGATGAACTCGACATTACCGAGGGAATGAGATTTGACCGCGGTTACGTCTCGCCATACTTCATCACCGACACCAAGTCGCAAAAAGTGGAGTTCGAGAAGCCATTGATTCTCCTCTCTGAGAAGAAGATCTCAAACGTTCAAGACATTATCCCAGCACTTGAGGCATCTACTCAACTTCGTCGTCCTTTGGTCATCATTGCTGAGGATATTGATGGAGAGGCACTCGCTGTGTGCATTCTCAACAAGCTCCGTGGTCAACTCCAAGTTGCAGCTGTCAAGGCACCCGGCTTCGGCGACAACCGAAAGTCCATTCTTGGTGATCTTGGTATCTTAACCAATGCCACCGTCTTTACTCTGTTCCGCAGATTAACAACAGATGTCTACAGGTACCTGCAACGTTGCGTGGAAAACAACAGAGAGTTCAATTTGACGCTGGGTGTGAAATCCACGACGATCACGAACGGTCTGAAATATTCTTTGGCTACAGGTAACTGGGGTGACCAGAAGAAGGCAGCAAGTTCTACCGCTGGTGTTTCTCAAGTATTGAACAGATATACCTTCGCATCAACACTTTCTCATTTGCGCCGAACCAATACGCCTATCGGACGTGATGGAAAGATCGCCAAACCTAGACAACTGCATAATACTCATTGGGGTCTGGTTTGTCCAGCAGAGACGCCAGAAGGTCAAGCTTGTGGTTTGGTCAAGAATTTAGCTTTGATGTGTTACGTTACAGTTGGTACGCCAAGTGATCCAATCGTTGAGTTCATGATTCAACGAAATATGGAAGTGCTGGAGGAGTATGAACCGCTCCGAGCACCCAATGCAACAAAGGTCTTCGTCAATGGTGTTTGGGTTGGTGTCCATCGAGACCCTGCCCATTTGGTTAAATGTGTACAAGATCTTCGTAGATCACATTTGATTTCTCATGAAGTCTCACTTATTCGAGAAATTCGAGACAGAGAGTTCAAGATTTTCACTGATGCAGGACGAGTGTGCAGACCTCTGTTGGTCATCGACAATGATCCAGACAGCCCCAACAAAGGTAATTTGGTACTGAACAAGGATCACATCCGCCGTTTGGAGGATGATCAATCTCTGCCATCGAACATGGATAAGGATGAGAAAGTACACCATGGTTATTATGGATTCCAAGGTTTGATTAATGATGGTGTGGTTGAATATTTAGACGCCGAGGAAGAGGAGACTGTTATGATTACCATGACACCTGAAGATTTGGATATTTCTCGACAGCTTCAAGCTGGTTATCAAATTCGTCCTGATGACAGCGGTGATTTGAATAAGCGTGTCAAGGCACCTATCAATCCAACTGCGCACGTCTGGACTCATTGTGAAATTCATCCAAGTATGATTCTGGGTATCTGTGCAAGCATCATTCCCTTCCCGGATCATAATCAGGTAAGCTTTAAGTCCAATAATGAATTTATTA ; END; BEGIN CODONS; CODONPOSSET * UNTITLED (CHARACTERS = 'G3PDH, RPB2, and HSP60') = N: 1-2969; CODONPOSSET CodonPositions (CHARACTERS = 'G3PDH, RPB2, and HSP60') = N: 1-2969; END; BEGIN TREES; TITLE NJ_Result; LINK TAXA = Taxa1; TRANSLATE 1 Botrytis_aclada_MUCL3106, 2 Botrytis_aclada_MUCL8415, 3 'Botrytis aclada OnionBC-15', 4 'Botrytis aclada OnionBC-18', 5 'Botrytis aclada OnionBC-7', 6 Botrytis_aclada_PRI006, 7 Botrytis_allii_MUCL403, 8 Botrytis_byssoidea_MUCL94, 9 'Botrytis byssoidea OnionBC-76', 10 Botrytis_calthae_CBS175.63, 11 Botrytis_calthae_MUCL1089, 12 Botrytis_calthae_MUCL2830, 13 Botrytis_cinerea_B05.10, 14 Botrytis_cinerea_BC7, 15 'Botrytis cinerea GarlicBC-5', 16 'Botrytis cinerea LeekBC-8', 17 Botrytis_cinerea_MUCL87, 18 'Botrytis cinerea OnionBC-1', 19 Botrytis_cinerea_SAS405, 20 Botrytis_cinerea_SAS56, 21 Botrytis_convoluta_9801, 22 Botrytis_convoluta_MUCL11595, 23 Botrytis_croci_MUCL436, 24 Botrytis_elliptica_BE0022, 25 Botrytis_elliptica_BE9610, 26 Botrytis_elliptica_BE9714, 27 Botrytis_fabae_CBS109.57, 28 Botrytis_fabae_MUCL98, 29 Botrytis_ficariarum_CBS176.63, 30 Botrytis_ficariarum_MUCL376, 31 Botrytis_galanthina_MUCL3204, 32 Botrytis_galanthina_MUCL435, 33 Botrytis_gladiolorum_9701, 34 Botrytis_gladiolorum_MUCL3865, 35 Botrytis_globosa_MUCL21514, 36 Botrytis_globosa_MUCL444, 37 Botrytis_hyacinthi_0001, 38 Botrytis_hyacinthi_MUCL442, 39 Botrytis_narcissicola_MUCL18857, 40 Botrytis_narcissicola_MUCL2120, 41 Botrytis_paeoniae_0003, 42 Botrytis_paeoniae_MUCL16084, 43 Botrytis_pelargonii_CBS497.50, 44 Botrytis_pelargonii_MUCL1152, 45 Botrytis_polyblastis_CBS287.38, 46 Botrytis_polyblastis_MUCL21492, 47 'Botrytis porri GarlicBC-16', 48 'Botrytis porri GarlicBC-38', 49 Botrytis_porri_MUCL3234, 50 Botrytis_porri_MUCL3349, 51 'Botrytis porri OnionBC-95', 52 Botrytis_ranunculi_CBS178.63, 53 'Botrytis sinoallii LeekBC-18', 54 'Botrytis sinoallii OnionBC-23', 55 'Botrytis sinoallii OnionBC-59', 56 Botrytis_sphaerosperma_MUCL21481, 57 Botrytis_sphaerosperma_MUCL21482, 58 'Botrytis squamosa GarlicBC-2', 59 'Botrytis squamosa LeekBC-2', 60 Botrytis_squamosa_MUCL1107, 61 Botrytis_squamosa_MUCL9112, 62 'Botrytis squamosa OnionBC-19', 63 Botrytis_squamosa_PRI026, 64 Botrytis_tulipae_BT9001, 65 Botrytis_tulipae_BT9830, 66 Botrytis_tulipae_BT9901, 67 Monilinia_fructigena_9201, 68 Sclerotinia_sclerotiorum_484; TREE c._Fig._3 = [&R] (67:0.0442025,(68:0.065972,(((11:6.49E-4,(10:6.88E-4,12:0.0):0.002457):0.007087,((27:0.0,28:0.0):0.001753,(((13:6.87E-4,18:0.0):3.42E-4,(43:0.0,44:6.87E-4):3.44E-4):0.0,(15:0.001721,((16:0.001377,17:0.0):0.0,(20:6.87E-4,(14:3.43E-4,19:0.0):0.0):3.43E-4):0.0):6.88E-4):0.001353):0.010121):0.01777,((51:0.002445,(47:6.88E-4,(48:0.002064,(49:3.43E-4,50:0.0):0.0):3.42E-4):0.001008):0.013502,(((54:0.001719,(53:0.0,55:0.002408):0.0):0.003009,(52:0.003146,((29:0.003272,30:5.45E-4):0.001159,((24:0.0,(25:3.43E-4,26:0.0):3.43E-4):0.002019,((58:0.001029,59:0.001718):0.0,(60:0.0,(61:0.0,(62:6.86E-4,63:0.0):0.0):0.0):6.86E-4):3.9E-4):0.003258):4.13E-4):0.001218):0.015862,((21:3.42E-4,22:0.0):0.00722,(((41:3.43E-4,42:0.0):0.012791,(1:0.006087,(7:0.003807,(5:6.85E-4,(3:0.002407,(4:0.002061,(2:0.0,6:6.86E-4):0.0):0.0):0.0):0.0):0.008932):0.016857):0.003023,((31:0.0,32:3.43E-4):0.017358,((23:3.42E-4,(37:6.86E-4,38:3.43E-4):0.0):0.010827,((66:0.0,(64:0.0,65:0.0):0.0):0.008286,(((33:3.42E-4,34:0.0):0.009425,((8:6.72E-4,9:0.001733):0.006549,(39:0.0,40:0.0):0.009831):0.001913):0.003557,((45:3.42E-4,46:0.0):0.01399,((35:3.41E-4,36:3.43E-4):0.001371,(56:0.0,57:6.84E-4):3.42E-4):0.007416):0.00258):0.001505):0.005874):0.004445):0.005698):7.79E-4):0.002119):0.003646):0.002483):0.043718):0.0442025); END;