#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 30, 2021; 19:22 GMT TreeBASE (cc) 1994-2008 Study reference: Pennington R., Lavin M., Prado D., A pendry C., Pell S., & Butterworth C. 2003. Neotropical seasonally dry forest plants show patterns of both Tertiary and Quaternary diversification. Philosophical Transactions of the Royal Society B, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1036] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=38; TAXLABELS Ruprechtia_albida_1_.4 Ruprechtia_albida_2_.4 Ruprechtia_aperta_1_.4 Ruprechtia_aperta_2_.4 Ruprechtia_aperta_3_.5 Ruprechtia_apetala_1_.3._chaco Ruprechtia_apetala_2_.3._chaco Ruprechtia_apetala_3_.3._chaco Ruprechtia_apurensis Ruprechtia_brachysepala Ruprechtia_carina Ruprechtia_chiapensis Ruprechtia_costaricensis Ruprechtia_cruegerii_1_wetamaz Ruprechtia_cruegerii_2_wetamaz Ruprechtia_curranii Ruprechtia_fagifolia Ruprechtia_fusca_1_.8 Ruprechtia_fusca_2_.8 Ruprechtia_fusca_3_.8 Ruprechtia_fusca_4_.8 Ruprechtia_laevigata_1_.8 Ruprechtia_laevigata_2_.8 Ruprechtia_laevigata_3_.8 Ruprechtia_laevigata_4_.8 Ruprechtia_laxiflora_.1._.2._.3 Ruprechtia_pallida_.8 Ruprechtia_ramiflora_1_.7._wetamaz_wetmeso Ruprechtia_ramiflora_2_.7._wetamaz_wetmeso Ruprechtia_ramiflora_3_.7._wetamaz_wetmeso Ruprechtia_ramiflora_4_.7._wetamaz_wetmeso Ruprechtia_ramiflora_5_.7._wetamaz_wetmeso Ruprechtia_ramiflora_6_.7._wetamaz_wetmeso Ruprechtia_tangarana_wetamaz Ruprechtia_tenuiflora_1_wetamaz Ruprechtia_tenuiflora_2_wetamaz Ruprechtia_triflora_1_chaco Ruprechtia_triflora_2_chaco ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=8; TAXLABELS Cardenasiodendron_brachypterum Loxopterygium_grisebachii Loxopterygium_huasango_137 Loxopterygium_huasango_138 Loxopterygium_sagotii Loxostylis_alata Schinopsis_brasiliensis Schinus_areira ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=75; TAXLABELS Coursetia_andina Coursetia_axillaris Coursetia_brachyrhachis Coursetia_caribaea_1064 Coursetia_caribaea_892 Coursetia_caribaea_chi_4514 Coursetia_caribaea_och_1063 Coursetia_caribaea_tri_5189 Coursetia_chiapensis Coursetia_dubia Coursetia_elliptica Coursetia_ferruginea Coursetia_fruticosa Coursetia_glabella Coursetia_glandulosa_4671 Coursetia_glandulosa_5347 Coursetia_gracilis Coursetia_grandiflora Coursetia_hassleri_5805 Coursetia_hassleri_6937 Coursetia_hidalgoana Coursetia_hintonii Coursetia_insomniifolia Coursetia_madrensis Coursetia_maraniona_745 Coursetia_maraniona_948 Coursetia_mollis_1039 Coursetia_mollis_1048 Coursetia_oaxacensis Coursetia_paniculata Coursetia_planipetiolata Coursetia_polyphylla Coursetia_pumila Coursetia_rostrata_1062 Coursetia_rostrata_930 Coursetia_vicioides Genistidium_dumosum Gliricidia_brenningii Gliricidia_ehrenbergii Gliricidia_maculata Gliricidia_robustum Gliricidia_sepium Hebestigma_cubense Lennea_melanocarpa Lennea_modesta Lennea_viridiflora Olneya_tesota Peteria_glandulosa Peteria_scoparia Peteria_thompsoniae_6157 Peteria_thompsoniae_7048_2 Poissonia_heterantha_5832 Poissonia_heterantha_5860 Poissonia_hypoleuca_121088 Poissonia_hypoleuca_5787 Poissonia_orbicularis Poissonia_weberbaueri_917 Poissonia_weberbaueri_918 Poitea_campanilla Poitea_carinalis Poitea_dubia Poitea_florida Poitea_galegoides Poitea_glyciphylla Poitea_gracilis Poitea_immarginata Poitea_multiflora Poitea_paucifolia Poitea_punicea Robinia_hispida Robinia_neomexicana_190789 Robinia_neomexicana_717 Robinia_pseudoacacia Robinia_viscosa Sphinctospermum_5120 ; END; BEGIN TAXA; TITLE Taxa4; DIMENSIONS NTAX=29; TAXLABELS Chaetocalyx_blanchetiana Chaetocalyx_brasiliensis_744_.2_3 Chaetocalyx_brasiliensis_768_.2_3 Chaetocalyx_brasiliensis_912_.2_3 Chaetocalyx_brasiliensis_913_.2_3 Chaetocalyx_glaziovii Chaetocalyx_klugii_741_wetamaz Chaetocalyx_klugii_746_wetamaz Chaetocalyx_latisiliqua_745_.5._wetmes Chaetocalyx_latisiliqua_890_.5._wetmes Chaetocalyx_latisiliqua_891_.5._wetmes Chaetocalyx_longiflora_902_wetatl Chaetocalyx_longiflora_903_wetatl Chaetocalyx_longiflora_906_wetatl Chaetocalyx_longiflora_944_wetatl Chaetocalyx_nigricans Chaetocalyx_scandens_666_.7_8_9 Chaetocalyx_scandens_900_.7 Chaetocalyx_scandens_901_.7 Nissolia_diversifolia Nissolia_gentryi Nissolia_hirsuta_466_.8 Nissolia_hirsuta_774_.8 Nissolia_leiogyne_776_.8 Nissolia_leiogyne_780_.8 Nissolia_microptera Nissolia_platycalyx_467_mexdesert Nissolia_platycalyx_779_mexdesert Nissolia_shottii ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M638] TITLE Fabaceae; LINK TAXA = Taxa3; DIMENSIONS NCHAR=745; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Coursetia_andina TCATTGTCGATGACCCG-AAAAAACAACAGACCCGCGGACATGTT--TCTA---CTACTCGGGG-TTGGC-TCGGGGCGCCCAGCGCC-TCGA--------CCTCCCCTGGG--CAAGGGGGCGAGGCCACATC--------GTG--CCCTCTCCCC--TCAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAACCATAATCA-----TTTTCACGTGCTCGCGTTGACCCG----GGGGCGGA-GCCCGCACGGG-CGGCGTCGCAAC-ACGTTATGTATAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTACCCC--AAC----GCCAACGGCCCCGCTTTTT----GTG-----GGCG-TTTGCTAGGGGG--TGAATGTTGGCCTCCCGTGGGC--TACGTCTCGCGGTTGGTTGAAAACTCGAGTGCATGGTGTTGGGCGTACCATGATGGATGGTGGTTT-GAGTGA----ATGCTCGGAGG-CCAA-TCATGCG--TAGCCTCACC----ATAGTCGTGCTCGGCGACCCACG--CGCATCC-------TCGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_axillaris TCATTGTCGATGACCCG-AAAAAGCAACAGACCCGCGAACATGTT--TTCA---CTACTCGGGG-TTGGC-TCGGGGTGCCTGGCACC-TCGA--------CCTCCCTTGGG--CAA-GGGGCGAGGCCACGTC--------GTG--TCCTCTCCTC--TTAGCCTTT--AACACAAA-CCCC-GGCGCGAAAAGCGTCAAGGAATCATAATTA------TCTCACGTGCTCGCGTCGACTCG---GGGGGCGTA-GCCCGTACGGG-TGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACACTGTTGCCCC--AAC----GCCAATCGCCTCACTCT------GTG----GGGCA-TTTGCCAGGGG---CGAATGTTGGCCTCCCGTGAGC--TCCGCCTCGCGGTTGGTTGAAAAATCGAGCGCGCGGTGTCGGGCGTACCATGATGGACGGTGG-TT-GAGTGA----ATGCTCGAAGA-CCAA-TCATGGG--CGACCTCACC----AGAATCGGGCTCGGCAACCCATG--TGCATCC-------TCGGATGCCCTCTCATGGAGACCTCAGGTCAGGCGG Coursetia_brachyrhachis TCATTGTCGATGACCCG-AAAAAACAACAGACCCGCGGACGTGTT--TTTA---CTACTTGGGG-CTGGC-TCGGGGTGCTAAGCACC-TGGA--------CCTCCCTTTGG--CAAGGGGGCGAGGGCACATT--------GTG--CCCTCTCCTC---TAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCATAATCA-----TTTTCACGTGCTCGCGTCGACCTG----GGGGCGTA-GCCCGCACGGG-TGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----GCCAATCGCCTCACTTGT-----GTG-----GGCG-TTTGCCAGGGGG--TGAATGTTGGCCTCCCGTGAGC--TGTGCCTCGCGGTTGGTTGAAAAATCGAGTGCATGGTGTCGGGCATACCATGATGGATGGTGG-TT-GAGTGA----ATGCTCGGAGA-CCAA-TCATGCG--TAACCTCACC----AGAGTCGTGCTCGGTGACCCACA--TGCATCC-------TCGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_caribaea_1064 TCATTGTCGATGACCCG-AAAAAACAATAGACCCGCGGACATGTT--TTTA---CTACTCGGGG-TTGGC-TCGGGGTGCCCAGCGCC-TCGA--------CCTCCCCTGGG--CAAGGGGGCGAGGCCACATC--------GTG--CCCTCTCCCT--TCAGCCTT---AACACAAA-CCCC-GGCGCGAAAAGCGTCAAGGAACCATAATCA-----TTTTCACGTGCTCGCGACGACCCG----GGGGCGGA-GCCCGCACGGG-CGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----GCCAAC?GCCTCGCTTTTT----GCG-----GGCG-TTTGCCAGGGGG--TGAATGTTGGCCTCCCGTGAGC--TTTGTCTCGCGGTTGGTTGAAAACTCGAGTGCATGGTGTTGGGCGTACCATGATGGATGGTGGTTT-GAGTGA----ATGCTCGGAGG-CCAA-TCATGCG--TAGCCTCACC----ATAGTCGTGCTCGGCGACCCACG--CGCATCC-------TCGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_caribaea_892 TCATTGTCGATGACCCG-AAAAAACAATAGACCCGCGGACATGTT--TTTA---CTACTCGGGG-TTGGC-TCGGGGTGCCCAGCGCC-TCGA--------CCTCCCCTGGG--CAAGGGGGCGAGGCCACATC--------GTG--CCCTCTCCCC--TCAGCCTT---AACACAAA-CCCC-GGCGCGAAAAGCGTCAAGGAACCATAATCA-----TTTTCACTGTCTCGCGTCGACCCG----GGGGCGGA-GCCCGCACGGG-CGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCTCC--AAC----GCCAATCGCCTCGCTTTTT----GCG-----GGCG-TTTGCCAGGGGG--TGAATGTTGGCCTCCCGTGAGC--TTCGTCTCGCGGTTGGTTGAAAACTCGAGCGCATGGTGTTGGGCGTACCATGATGGATGGTGGTTT-GAGTGA----ATGCTCGGAGG-CCAA-TCATGCG--TAGCCTCACC----ATAGTCGTGCTCGGCGACCCACG--CGCATCC-------TTGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_caribaea_chi_4514 TCATTGTCGATGACCCG-AAAAAACAACAGACCCGCGGACATGTT--TATA---CTACTCGGGG-TTGGC-TCGGGGCGCCCAGCGCC-TTGA--------CCTCCCCTGGG--CAAGGGGGCGAGGCCACATC--------GTG--CCCTCTCCCC--TCAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAACCATAATCA-----TTTTCACGTGCTCGCGTCGACCCG----GGGGCGGA-GCCCGCACGGG-CGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAA----GCCAACCGCCTCGCTTTTT----GCG-----GGCG-TTTGCCAGGGG---TGAATGTTGGCCTCCCGTGAGC--TTCGTCTCGCGGTTGGTTGAAAACTCGAGCGCATGGTGTCGGGCGTACCATGATGGATGGTGGTTT-GAGTGA----ATGCTCGGAGG-CCAA-TCATGCG--TAGCCTCATC----ATAGTCGTGCTCGGCGACCCACG--CGCATCC-------TCGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_caribaea_och_1063 TCATTGTCGATGACCCG-AAAAAACAACAGACCCGCGGACATGTT--TTTA---CTACTCGGGG-CTGGC-TCGGGGCGCTCGGCGCC-TCGA--------CCTCCCCTGGG--CAAGGGGGCGAGGCCACATC--------GTG--CCCTCTCCTC--TCAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAAACACAATCA-----TTTACACGTGCTCGCGTCGACCCG----GGGGCGGA-GCCCGCACGGG-CGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----TCCAACCGCCTCGCTTTT-----GCG-----GGCG-TTTGCCGGGGGG--TGAATGTTGGCCTCCCGTGAGC--TTCGTCTCGCGGTTGGTTGAAAACTCGAGCGCATGGTGTAGGGCGTACCATGATGGATGGTGGTTTTGAGTGA----ATGCTCGGAGA-CCAA-TCGTGCG--TAGCCTCACC--AAAGAGTCGTGCTCGGCGACCCACG--CGCATCC-------TCGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_caribaea_tri_5189 TCATTGTCGATGACCCG-AAAAAACAACAGACCCGCGGACATGTT--TCTA---CTACTTGGGG-TTGGC-TTGGGGCGCTCGGCGCC-TCGA--------CCTCCCCTGGG--CAAGGGGGCGAGGCCACATC--------GTG--CCCTCTCCCC--TCAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAACCATAATCA-----TTTTCACGTGCTCGCGTCGACC-G----GGGGCGGA-GCCCGCACGGG-CGGCGTTGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----CTCAACCGCCTCGCTTTTT----GCG-----GGCG-TTTGCCAGGGGG--TGAATGTTGGCCTCCCGTGAGC--TCCGTCTCGCGGTTGGTTGAAAACTCGAGCGCATGGTGTCGGGCGTACCATGATGGATGGTGGTTT-GAGTGA----ATGCTCGGAGG-CCAA-TCATGCG--TAGCCTCACC----ATAGTCGTGCTCGGCGACCCACG--GGCATCC-------TCGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_chiapensis TCATTGTCGATGACCCG-AAAAACCAACAGACCCGTGGACATGTT--TTTA---CAACTCGGGG-TTGGC-TCGGGGTGCTTAGCACC-TTGA--------CCTCCCTTTGG--CAA-GGGGTGCGGCCACATT--------GTG--CCCTCTCCTC--TAAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCATAATTA-----TTTCCACGTGCTCGCGTTGACCCG---GGGGGCGTA-GCCTGCATGGG-TGGCGTTGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATTAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTTCCCC--AAT----GCCAATCGCCTCACTTT------GTG-----GGTA-TTTGCTAGGGG---TGAATGTTGGCCTCCCGTGAGC--TTTGTCTCGCGGTTGGTTGAAAAATCGAGCGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGTTA----ATGCTCGGAGA-CCAA-TCATGGG--TAACCTCACT----AGAATTGTGCTTGACAACCCACA--TGCATCC-------TTGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_dubia TCATTGTCGATGACCCGAAAAAATAAATAGACCAGCGGACATGTT--TCTA---CTACTTGGGG-TTGGC-TCGGGGTGCTCAGCGCC-TCAA--------CCTCCCCTTGG-GCAAGGGGGCGAGGCCACATT--------GTG--CCCTCTCCTC--TCAGCCTT---AACAAAAA-CCCC-GGCGCGAAAAGCGTCAAGGAATCATAATCG-----TTTTCACGTGCTCGCGTCGACCCT--GGGGGGCACA-GCCCACACGGGGTGGCGTTGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----GCCAATTGCCTCACTTTT-----GTG-----GGCA-TTTGTTAGGGGG--TGAATGTTGGCCTCCCGTGAGC--TTTGTCTCGCGGTTGGTTGAAAACTGGAGTGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TC-GAGTGA----ATGCTCGAAGG-CCAA-TCATGTG--TAACCTCACC----AGAGTAGTGCTCGGTGACCCACA--TGCATTC-------TCGGATGCTTT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_elliptica TCATTGTCGATGACCCG-AAAAAAAAACAGACCCGTGGACATGTT--TTTA---CTACTCGGGG-TTGGC-TCGGGGTGCTTAGCACC-TTGA--------CCTCCCTTTGG--CAA-GGGGTGAGGCCACATT--------GTG--CCCTCTCCTC--TAAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCATAATTA-----TTTCCACGTGCTCGCGTTGACCCG---GGGGGCGTA-GCCTGCACGGG-TGGCGTTGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCTGAGGGCACGTCTGCCTGGGTGTCACACATTGTTTCCCC--AAT----GCCAATCGCCTCACTTT------GTG-----GGTA-TTTGCTAGGGG---TGAATGTTGGCCTCCCGTGAGC--TTTGTCTCGCGGTTGGTTGAAAAATCGAGCGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGTTA----ATGCTCGGAGA-CCAA-TCATGGG--TAACCTCACT----AGAATTGTGCTTGACAACCCACA--TGCATCC-------TTGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_ferruginea TCATTGTCGATGACCCG-AAAAAACAACAGACCCGCGGACTTGTA--TTTC---CTACTTGGGG-TTGGC-TCGGGGTGCTCAGCACC-TCGA--------CCAACCTAGGG--CAAAGGGGCGAGGCCACATC--------GTG--CCCTCTCCTC--TTAGCCTTCATAACACAAA-CCCC-GGCGCGAAAAGCGTCAAGGAATCATGATCA-----TTTTCACGTGCTCGCGTCGACCCG---AGGGGCGTA-GCCCACGAGGG-TGGCGTCGTGAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCGCACATTGTTGCCCC--AAC----GCCAATCGCCTCACTTTT-----GTG-----GGCG-TTTTGCAGGGGG--TGAATGTTGGCCTCCCGTGAGC--TCTGTCTCGCGGTTGGTTGAAATATCGAGTGCACGGTGTCGGGCGTACCGTGATGCATGGTGGTTT-GAGTGA----ATGCTCGGAGA-CCAA-TCACGCG--TAACCCCACC----AGCGTTGTGCTCGGGGACCCACG--TGCATCC-------TCGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_fruticosa TCATTGTCGATGACCCG-AAAAAACAATAGACCCGCGGACGTGTT--TTTA---CTACTTGGGG-CTGGC-TCGGGGTGCTCAACACC-TCGA--------CCTCCCTTGGG--CAAAGGGGCGAGGCCACATC--------GTG--CCCTCTCCTC--TTAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCATAATCA-----TTTTCACGTGCTCGCGTCGACCTG---GGGGGCCTA-GGCCGCACGGG-TGGCGTCGTAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----GCCAATCGCCTCACTTTT-----GTG-----GGCG-TTTGCCAGGGGG--TGAATGTTGGCCTCCCGTGAGC--TGTGCCTCGCGGTTGGTTGAAAAATCGAGCACATGGTGTCGGGCGTACCATGATGGATGGTGG-TT-GAGTGA----ATGCTCGGAGA-CCAA-TCATGCG--TAACCTCACC----AGAGTCGTGCTCGGCGACCCACA--TGCATCC-------TCGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_glabella TCATTGTCGATGACCCG-AAAAAACAATAGACCCGCGGACATGTT--TCTA---CTACTCGGGG--TGGC-TCGGGGCGCCCGGCGCC-GTGA--------CCTCCCCTGGG--CAAGGGGGCGAGGCCACATC--------GTG--CCCTCTCCCC--TTAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAACCATAATCA-----TTTTCACGTGCTCGCGTCGACCCG----GGGGCGGA-GCCCGCACGGG-CGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----CTCAACCGCCTCGCTTTTT----GCG-----GGCG-TTTGCCAGGGGG--TGAATGTTGGCCTCCCGTGAGC--TCTGTCTCGCGGTTGGTTGAAAACTCGAGCGCATGGTGTCGGGCGTACCATGATGGATGGTGGTTT-GAGTGA----ATGCTCGGAGG-CCAA-TCATGCG--TAGCCTCACC----ATAGTCGTGCTCGGCGACCCGCG--CGCATCC-------TCGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_glandulosa_4671 TCATTGTCGATGACCCG-AAAAAACAACAGACCCGCGGACTTGTT--TCTA---CTACTCGGGG-CTGGC-TCGGGGTGCTCAGCGCC-TCGA--------CCTCCCTTGGG--CAACGGGGCGAGGCCACATC--------GTG--CCCTCTCCTC--TCAGCCTC---AACACAAAACCCC-GGCGCGAAAAGCGTCAAGGAACCGTAATCA-----TTTTCACGTGCTCGCGTCGACCCG---GGGGGCGCA-GCCCGCACGGG-CGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCGCACATTGTTGCCCCCCAAC----GCCAATCGCCTCACTTTT-----GTG-----GGCG-TTTGCTCGGGGG--TGAATGTTGGCCTCCCGTGAGC--TCTGCCTCGCGGTTGGTTGAAAA-TCGAGCGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGTGA----ATGCTCGGAGA-CCAA-TCATGCG--TAACCTCACC----AGAGTCGCGCTCGGCGACCCACG--TGCATCC-------TCGGATGCCCT-CCATGGAGACCTCAGGTCAGGCGG Coursetia_glandulosa_5347 TCATTGTCGATGACCCG-AAAAAACAACAGACCCGCGGACATGTT--TCTA---CTACTCGGGG-CTGGC-TCGGGGTGCTCAGCGCC-TCGA--------CCTCCCTTGGG--CAACGGGGCGAGGCCACATC--------GTG--CCCTCTCCTC--TCAGCCTT---AACACAAAACCCC-GGCGCGGAAAGCGTCAAGGAACCATAATCA-----TTTTCACGTGCTCGCGTCGT??CC---GGAGGCGCA-GC--G?ACGGG-TGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCGCACATTGTTGCCCCCCAAC----GCCAATCGCCTCACTTTT-----GTC-----GGCG-TTTGCTTGGGG---TGAATGTTGGCCTCCCGTGAGC--TCTGCCTCGCGGTTGGTTGAAAA-TCGAGCGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGTGA----ATGCTCGGAGA-CCAA-TCATGCG--TAACCTCACC----AGAGTCGTGCTCGGCGACCCACG--CGCATCC-------TCGGATGCCCT-CCATGGAGACCTCAGCTCAGGCGG Coursetia_gracilis TCATTGTCGATGACCCGAGAAAATAA-CAGACCCGCGAACATGTT--TCCA---CTACTCGGGG-TTGGC-TCGGGGTGCTCAGCGCC-TCGA--------CCTCCCTTTGG--CAAGTGGGCGAGGCCACATC--------GTG--CCCTCTCCTC--TTAGCCTT---AACAAAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCATAATCA-----TTTTCACGTGCTCGCGTCGACCCG---GGGGGCACA-GCCCACACGGG-TGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----GCCAATTGCCTCACTTTT-----GTG-----GGCG-TTTGTCAGGGG---TGAACGTTGGCCTCCCGTGAGC--TTTGTCTCGCGGTTGGTTGAAAACTCGAGCGCATGGTGTCCGGTGTGCCGTGATGGATGGTGG-TC-GAGTTA----ACGCTCGAAGG-CCAA-TCATGTG--TAACCTCACC----AGAGTCGTGCTCGGCGACCCACA--TGCATTC-------TCGAATGCTCT-CCATGGAGACCTCAGGTCAGGCGG Coursetia_grandiflora TCATTGTCGATGACCCGAAAAAATAAATAGACCAGCGGACGTGTT--TCTA---CTACTTGGGG-TTGGC-TCGGGGTGCTCAGCGCC-TCAA--------CCTCCCCTTGG-GCAAGGGGGCGAGGCCACATT--------GTG--CCCTCTCCTC--TCAGCCTT---AACAAAAA-CCCC-GGCGCGAAAAGCGTCAAGGAATCATAATCG-----TTTTCACGTGCTCGCGTCGACCCT--GGGGGGCACA-GCCCACACGGGGTGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAT----GCCAATTGCCTCACTTTT-----GTG-----GGCG-TTTGTTAGGGGG--TGAATGTTGGCCTCCCGTGAGC--TTTGTCTCGTGGTTGGTTGAAAACTCGAGTGCATGGTGTCGAGTGTACCATGATGGATGGTGG-TC-GAGTGA----ATGCTCGAAGG-CCAA-TCATGTG--TAACCTCACC----AGAGTAGTGCTCGGTGACCCACA--TGCATTC-------TCGGATGCTTT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_hassleri_5805 TCATTGTCGATGACCC--AAAAAACAACAGACCCGCGGACATGTT--TCTA---CTACTCGGGG-TTGGC-TCGGGGCGCCTAGCGCC-TCGA--------CCTCCCCTGGG--CA-GGGGGCGAGGCCACATC--------GGG--CCCTCTCCTC--TCAGCCTG---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCACAATCA-----TTTTCGCGTGCTCGCGTCGACCCG----GGGGCGGA-GCCCGCACGGG-TGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----GCCAATCGCCTTGCTTTT-----GCG-----GGCG-TTTGCCAAGGGG--TGAATGTTGGCCTCCCGTGAGC--TCCGTCTCGCGGTTGGTTGAAAACTCGAGCGCATGGTGTCGGGCGTACCATGATGGATGGTGGTTT-GAGTGA----ATGCTCGGAGA-CCAA-TCATGCG--TTGCCTCACC----ATAGTCGCGCTCGGCGACCCACG--CGCATCC-------TCGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_hassleri_6937 TCATTGTCGATGACCCG-AAAAAACAA-AGACCCGCGGACATGTT--TCTA---CTACTCGGGG-TAGGC-TCGGTGCGCTCTGCGCC-TCGA--------CCTCCCTTGGG--CAAGGGGGCGGGGCCACATC--------GTG--TCCTCTCCTC--CAAGCCTTT--AACACAAA-CCC--GGCGCGAAAAGCGTCAAGGAATCACAATCA-----TTTTCGCGTGCTCGCGTGGACCCG----GGGGCGGA-GCCCGCACGGG-GGGCGTGGCAGC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAA----GCCAACCGCCTCGCTTTT-----GCG-----GGCG-TTTGCCAGGGGG--TGAATGTTGGCCTCCCGTGAGC--TCCGTCTCGCGGTTGGTTGAAAACTCGAGTGCATGGTGTCGGGCGTACCATGATGGATGGTGGTTT-GAGTGG----ATGCTCGGAGA-CCAA-TCATGCG--TAGCCTCGCC----ATAGGAGCGCTCGGCGACCCACG--GGCATCC-------TCGGATGCTCT-TCAAGGAGACCTCAGGTCAGGCGG Coursetia_hidalgoana TCATTGTCGATGACCC--AAAAAACAACAGACCCGCGGACATGTT--TCTA---CTACTCGGGG-TTGGC-TCGGGGCGCTCGACGCC-GCGA--------CCTCCCCTGGG--CAAGGGGGCGAGGCCACATC--------GTG--CCCTCTCCCC--TCAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAACCATAATCA-----TTTTCACGTGCTCGCGTCGACCCG----GGGGCGGA-GCCCGCACGGG-CGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----CTCAACCGCCTTGCTTTTT----GCG-----GGCG-TTTGCCAGGGGG--TGAATGTTGGCCTCCCGTGAGC--TTCGCCTCGCGGTTGGTTGAAAACTCGAGCGCATGGTGTCGGGCGTACCATGATGGATGGTGGTTT-GAGTGA----ATGCTCGGAGG-CCAA-TCATGCG--TAGCCTCACC----ATAGTCGTGCTCGGCGACCCGCG--CGCATCC-------TCGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_hintonii TCATTGTCGATGACTCG-AAAAAACAACAGACCCGCGGACGTGTT--TTGA---CTACTTGGGG-TTGGC-TCGGGGCGCTCAGCACC-TCGA--------CCTCCCTTGGG--CAA-GGGGCGAGGCCACATC--------GTG--CCCCCTCCCC--TTAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAACCATAATCA-----TTTTCACGTGCTCGTGTCGACCCGT--GGGGGCATA-GCCTGCACGGG-TGGCATAGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAGCGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTCGCCCC--AAC----GCCAATCGCCTCACTTTT-----GTG-----GGAACTTTGCTAGGGGG--TGAATGTTGGCCTCCCGTGAGC--TCCGCCTCGCGGTTGGTTGAAAAATCGAGCGCATGGTGTTGGGTGTACCATGATGGATGGTGG-TT-GAGTGA----ATGCTCGGAGG-CCAA-TCATGGG--TAGCCACACC----GGTGTTGTGCTCGACGACCCACA--TGCATCC-------TTGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_insomniifolia TCATTGTCGATGACCCA-AAAAAGCAACAGACCCGCGGACATGTT--TTTA---CTACTTGGGG-TTGGC-TCGGGGTGCCTGGCACC-TCGA--------CCTCCCTTGGG--CAA-GGGGCGAGGCCACGTC--------GTG--TCCTCTCCTC--TTAGCCTTT--AACACAAA-CCCC-GGCGCGAAAAGCGTCAAGGAATCATAATTA------TCTCACGTGGTCGCGTCGACTCG---GGGGGCGTA-GCCCGTACGGG-TGGCGTTGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGAAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACACTGTTGCCCC--AAT----GCCAATCGCCTCACTTT------GCG---GGGGCA-TTTGGCAGGGG---TGAATGTTGGCCTCCCGTGAGC--TCCGTCTCGCGGTTGGTTGAAAAATCGAGCGCGTGGTGTCGGTTGTACCATGATGGATGGTGG-TT-GAGTGA----ACGCTCGAAGA-CCAA-TCATGAG--CAACCTCACC----AGAATCGGGCTCGGGAACCCACG--TGCATCC-------TCGGATGCTCTCTCATGGAGACCTCAGGTCAGGCGG Coursetia_madrensis ACATTGTCGATGACC-G-AAAAAATAATAGACCCGTGGACATGTT--TTTA---CTACTCGGGG-TTGGC-TCGGGGTGCTTAGCACC-TTGG--------CCTCCCTTTGG--CAA-GGGGTGAGGCCACATT--------GTG--CCCTCTCCTC--TAAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCATAATTA-----TTTCCACGTGCTCACGTTGACCCG--GGGGGCCGTA-GCCTGCATGGG-TGGCGTTGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTTCCCC--AAT----GCCAATTGCCTCACTTT------GTG-----GGTA-TTTGCTAGGGG---TGAATGTTGGCCTCCCGTGAGC--TTTGTCTCGCGGTTGGTTGAAAAATCAAGCGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGTGA----ATGCTCGGAGA-CCAA-TCATGGG--TAACCTCACT----AGAATTGTGCTCGACAACCCACA--TGCATCC-------TTGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_maraniona_745 TCATTGTCGATGACCCG-AAAAAACAATAGACCCGTGGACGTTTT--TTTA---CTACTTGGGG-CTGGC-TCGGGGTGCTTAGGACC-TCGA--------CCTCCCTTGGG--CAAGGGGGTGAGGCCACATC--------GTG--CCCTCTCCTC--TTAGCCTT---AACATAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCATAATCA-----TTTTCACGTGCTGGCGTCAACCTA---GGGGGCCTA-GCCCGCATGGG-TGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATTGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----GCCAATCGCCTCACATTT-----GTG-----GGCG-TTTTCCAGGGG---TGAATGTTGGCCTCCCGTGAGC--TGTGCCTTGCGGTTGGTTGAAAAATCGAGCGCATGGTGTC-GGTGTACCATGATGGATGGTGG-TT-GAGTGA----ATGCTCGGAGA-CCAA-TCATGTG--TAACCCTACC----AGAGTCGTGCTCGGTGACCCATA--TGCATCC-------TTGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_maraniona_948 TCATTGTCGATGACCCG-AAAAAACAATAGACCCGTGGACGTTTT--TTTA---CTACTTGGGG-CTGGC-TCGGGGTGCTTAGGACC-TCGA--------CCTCCCTTGGG--CAAGGGGGTGAGGCCACATC--------GTG--CCCTCTCCTC--TTAGCCTT---AACATAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCATAATCA-----TTTTCACGTGCTGGCGTCAACCTA---GGGGGCCTA-GCCCGCATGGG-TGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATTGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----GCCAATCGCCTCACATTT-----GTG-----GGCG-TTTTCCAGGGG---TGAATGTTGGCCTCCCGTGAGC--TGTGCCTTGCGGTTGGTTGAAAAATCGAGCGCATGGTGTC-GGTGTAGGATGATGGATGGTGG-TT-GAGTGA----ATGCTCTGAGA-CCAA-TCATGTG--TAACCCTACC----AGAGTCGTGCTCGTTGACCCATA--TGCATCC-------TTGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_mollis_1039 TCATTGTCGATGACCCGAAAAAAACAAGAGACCCGCGGACATGTT--TCTA---CCACTGGGGG-TTGGC-TCGGGGCGCTCAGCTCC-TGGG--------CCTCCCCCGGG--CAAGGGGGCGAGGCCACACA--------GTG--CCCTCTCCTCTCTTAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCACGATCA-----TTTTCGCGTGCTTGCGTCGACCCG----GGGGCGGA-GCCCGCACGGG-TGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCTC--AA-----GCCAACCGCCTTGCCTTT-----GCG-----GGCG-TTTGCCAGGGGG--CGAATGTTGGCCTCCCGTGAGC--TTCGTCTCGCGGTTGGTTGAAAACTCGAGTGCATGGCGTCGGGCGTACCATGATGGATGGTGGTTT-GAGTGA----ATGCTCGGGGA-CCAAATCATGCG--TAGCCTCGCC----ATAGTCGTGCTCGGCGACCCACG--CGCATCC-------TCGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_mollis_1048 TCATTGTCGATGACCCGAAAAAAACAAGAGACCCGCGGACATGTT--TCTA---CCGCTGGGGG-TTGGC-TCGGGGCGCTCAGCTCC-TGGG--------CCTCCCCCGGG--CAAGGGGGCGAGGCCACACA--------GTG--CCCTCTCCTCTCTTAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCACGATCA-----TTTTCGCGTGCTTGCGTCGACCCG----GGGGCGGA-GCCCGCACGGG-TGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCTC--AA-----GCCAACCGCCTTGCCTTT-----GCG-----GGCG-TTTGCCAGGGGG--CGAATGTTGGCCTCCCGTGAGC--TTCGTCTCGCGGTTGGTTGAAAACTCGAGTGCATGGCGTCGGGCGTACCATGATGGATGGTGGTTT-GAGTGA----ATGCTCGGGGA-CCAAATCATGCG--TAGCCTCGCC----ATAGTCGTGCTCGGCGACCCACG--CGCATCC-------TCGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_oaxacensis TCATTGTCGATGACCCG-AAAAAACAATAGACCTGTGGACATGTT--TTTA---CTACTCGGGG-TTGGC-TCGGGGTGCTTAGCACC-TTGG--------CCTCCCTTTGG--CAA-GGGGTGAGGCCACATT--------GTG--CCCTCTCCTC--TAAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCATAATTA-----TTTCCACGTGCTCGCGTTGACCCG---GGGGGCGTA-GCCTGCATGGG-TGGCGTTGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTTCCCC--AAT----GCCAATTGCCTCACTTT------GTG-----GGTA-TTTGCTAGGGG---TGAATGTTGGCCTCCCGTGAGC--TTTGTTTCGCGGTTGGTTGAAAAATGAAGCGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGTGA----ATGCTCGGAGA-ACAA-TCATGGG--TAACCTCACT----AGAATTGTGCTCGACAACCCACA--TGCATCC-------TTGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_paniculata TCATTGTCGATGACCCG-AAAAAACAATAGACCCGTGGACATGTT--TTTA---CTACTCGGGG-TTGGC-TCGGGGTGCTTAGCACC-TTGG--------CCTCCCTTTGG--CAA-GGGGTGAGGCCACATT--------GTG--CCCTCTCCTC--TAAGCCTT---AACATAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCATAATTA-----TTTCCACGTGCTCGCGTTGACCCG---GGGGGCGTA-GCCTGCATGGG-TGGCGTTGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTTCCCC--AAT----GCCAATTGCCTCACTTT------GTG-----GGTA-TTTGCTAGGGG---TGAATGTTGGCCTCCCGTGAGC--TTTGTCTCGCGGTTGGTTGAAAAATCAAGCGCATGGTGTCCGGTGTACCATGATGGATGGTGG-TT-GAGTGA----ATGCTCGGAGA-CCAA-TCATGGG--TAACCTCACT----AGAATTGTGCTCGACAACCCACA--TGCATCC-------TTGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_planipetiolata TCATTGTCGATGACCCG-AAAAAACAATAGACCCGTGGACATGTT--TTTA---CTACTCGGGG-TTGGC-TCGGGGTGCTTAGCACC-TTGG--------CCTCCCTTTGG--CAA-GGGGTGAGGCCACATT--------GTG--CCCTCTCCTC--TAAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCTTAATTA-----TTTCCACGTGCTCGCGTTGACCCG---GGGGGCGTA-GCCTGCATGGG-TGGCGTTGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACACTGTTTGCCC--AAT----GCCAATTGCCTCACTTT------GTG-----GGTA-TTTGCTAGGGG---TGAATGTTGGCCTCCCGTGAGC--TTTGTCTCGCGGTTGGTTGAAAAATCAAGCGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGTGA----ATGCTCGGAGA-CCAA-TCATGGG--TAACCTCACT----AGAATTGTGCTCGACAACCCACA--TGCATCC-------TTGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_polyphylla TCATTGTCGATGACCCG-AAAAACCAACAGACCCGTGGACATGTT--TTTA---CAACTCGGGG-TTGGC-TCGGGGTGCTTAGCACC-TTGA--------CCTCCCTTTGG--CAA-GGGGTGCGGCCACATT--------GTG--CCCTCTCCTC--TAAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCATAATTA-----TTTCCACGTGCTCGCGTTGACCCG---GGGGGCGTA-GCCTGCACGGG-TGGCGTTGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTTCCCC--AAT----GCCAATCGCCTCACTTT------GTG-----GGTA-TTTGCTAGGGG---TGAATGTTGGCCTCCCGTGAGC--TTTGTCTCGCGGTTGGTTGAAAAATCGAGCGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGTTA----ATGCTCGGAGA-CCAA-TCATGGG--TAACCTCACT----AGAATTGTGCTTGACAACCCACA--TGCATCC-------TTGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_pumila TCATTGTCGATGACCC--AAAAAACAACAGACCCGCGGACATGTT--TATA---CTACTCGGGG-TTGGC-TCGGGGCGCCCGACGCC-GCGA--------CCTCCCCTGGG--CAAGGGGGCGAGGCCACATC--------GTG--CCCTCTCCCC--TCAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAACCATAATCA-----TTTTCACGTGCTCGCGTCGACCCG----GGGGCGGA-GCCCGCACGGG-CGGCGTCGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----CTCAACCGCCTCGCTTTTT----GCG-----GGCG-TTTGCCAGGGGG--TGAATGTTGGCCTCCCGTGAGC--TTCGCCTCGCGGTTGGTTGAAAACTCGAGCGCATGGTGTCGGGCGTACCATGATGGATGGTGGTTT-GAGTGA----ATGCTCGGAGG-CCAA-TCATGCG--TAGCCTCACC----ATAGTCGAGCTCGGCGACCCGCG--CGCATCC-------TCGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_rostrata_1062 TCATTGTCGATGACCCG-AAAAAGCAACAGACCCGCGAACTAGTT--TTTT---CCACTCGGGG-CTGGC-TCGGGGTGCTCGGCACC-TCGA--------CCTCCCTTGGG--CAA-GGGGCGAGGGCACATT--------GTG--CCCCCTCCTC--TTAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATAATAATCA-----TTCTCACGTGCTCGCGTCGACCCG---GGGGGCGTA-GCCCGAACGGG-TGGCGTTGGAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACACTGTTGCCCC--AAC----GCCAATCGCCTCACTTAT-----GTG-----GGTG-TTTGCTAGGGTG--CGAATGTTGGCCTCCCGTGAGC--TTTGGCTCGTGGTTGGTTGAAAAATCGAGCGCGTGGTGT-GGGTGTACCATGATGGATGGTGG-TT-GAGTGA----ATGCTCGGAGA-CCAA-TCATGGGTGTAACCTCACC----AGAGTCGTGCTCGACGACCCACG--GGCATCC-------TCGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_rostrata_930 TCATTGTCGATGACCCG-AAAAAGCGACAGACCCGCGAACTAGTT--TTTA---CTACTCGGGG-CTGGC-TCGGGGTGCTCAGCACC-TCGA--------CCTCCCTTGGG--CAA-GGGGCGAGGCCACATT--------GTG--CCCCCTCCTC--TTGGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCATAATCA-----TTCTCACGTGCTCGCGTCGACCCG---GGGGGCGTA-GCCCGAACGGG-TGGCGTTGCAAC-ACGTTACGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACACTGTTGCCCC--AAC----GCCAATCGCCTCACTTTC-----GTG-----GGTG-TTTGCCAGGGGG--CGAATGATGGCCTCCCGTGAGC--TTTGTCTCGTGGTTGGTTGAAAAATCGAGCGCGTGGTGT-GGGTGTACCATGATGGATGGTGG-TT-GAGTGA----ATGCTCGGAGA-CCAA-TCATGCGTGTAACCTGACC----AGAGTCGTGCTCGACGACCCACG--TGCATCC-------TCGGATGCTCT-TCATGGAGACCTCAGGTCAGGCGG Coursetia_vicioides TCATTGTCGATGACCCG-AAAAAGCAACAGACCCGCGGACCAGTT--TTTA---CTACTCGGGGGCTGGC-TCGGGGTGCTCAGCACC-TCGA--------CCTCCCTTGGG--CAA-GGGGCGAGGCCACACT--------GTG--CCCCCTCCTC--TTAGCCTT---AACACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCATAATCA-----TTCTCACGTGCTCGCGTCGACCCG---GGGGGCGTA-GCCCGAACGGG-TGGCGTTGCAAC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACACTGTTGCCCC--AAC----GCCAATCGCCTCACTTTT-----GTG-----GGTG-CTTGCCAGGGGG--CGAACGTTGGCCTCCCGTGAGC--TTTGTCTCGCGGTTGGTTGAAAAATCGAGCGCGCGGTGTCGGGCGCACCATGATGGATGGTGGTT--GAGTGA----ATGCTCGGGGA-CCAA-TCATGGGTGTAACCTCACC----AGAGTCGTGCTCGGCGACCCACG--GGCATCC-------TCGGATGCTCT-TCACGGAGACCTCAGGTCAGGCGG Genistidium_dumosum TCATTGTCG------CTA-AATCGGAATCGACTCGCGAACTTGTT--TTTACTACTATATGGGG-CAGGC-TCGGGGCGCTTCGGCACCTCGA--------CCTCCCTTGGG--CAAGGGGG-GTGGTCATGC---------GTG-CCCTCCT-CTC--TTAGCCTT---AACAAAAA-CCCC-GGCGCGGAACGCGTCAAGGAATCATAATTA------TTTCACGTGCTCGCGTC-------------------GCCCGTATGGG-TGGCGTCGCAGCAACGTTACCTAAAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACACTGTTGCCCC--GAC----GCCAATCGCATCACT-TAG----GTG-----GGCA-TTTGCGCGGGG---CGAATGTTGGCCTCCCGCGAGC--TCCGTCTCACGGTTGGTTGAAAA-CTGAGCGCGTGGTGTCGGGCGTACCATGATGGATGGAGG-CT-GAGCGA----ATGCTCGAAGA-CCAA-TCATGGG--TAACCCCACC----GGAATCGGGCTCGGAGACCCACACACGCATCC-------TTGGATGGTCG-TGAATGAGACCTCAGGTCAGGCGG Gliricidia_brenningii TCATTGTCGATGCCTCA---GAAGCGACCGACTCGTGAATCAGT---TTGA---CCGCTTAGGG-TTGGC-TTGGGGTGCTTGGCACC-TCAA--------CCTCCCC-AGG-TTAGGGGGG--AGGTCGTG--CTGCGTGCACG--CCCTCCTCTC--GTAGCCG---AAACACAAA-CCCC-GGCGCTAAACGCGTCAAGGAATCGAAATTT-----GTTCCACGTGCACCCGTCGGCCCT---GATGCGGGC-GCTCGTACGGG-TGGCGTCGCGAC-ACGCT-TGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----GCCAACCGCCTCACTTG------GTG-----GGTGCTTCGGTCGGGGGG-TGAATGCTGGCCTCCCGTGAGC--ACGGTCTCACGGTTGGTTGAAAA-CTGAGCTCGTGGTGTCGGGTGCGCCATGATGGATGGTGG-TT-GAGTGA-----TCCTC-GAGA-CCAA-TCATGGG--TGACCTCACC----GGGGACGGGCTTCGTGACCCACA--CGCATCC-------TCGGATGCTCC-TCAAGGAGACCTCAGGTCAGGCGG Gliricidia_ehrenbergii TCATTGTCGATGCCTCA---GAAGCGACCGACCCGTGAATCAGT---TTGA---CCGCTCAGGG-TTGGC-TTGGGGTGCTTGGCTCC-TCAA--------CCTCCCTCGGG-TTAGGGGGGG-AGGTGGTG--CTGCGCGCACG--CCCTCCTCTC--GTAGCCG---AAACAAAAA-CCCC-GGCGCTAAACGCGTCAAGGAATCGAAATTC-----GTTTCACGTGCACCCGTCGGCCCT---GATGCGGGC-GCTCGTACGGG-TGGCGTCGCGAC-ACGCA-TGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----GCCAATCGCCTCACTTG------GTG-----GGTGCTTTGGTCTGGGG--TGAATGTTGGCCTCCCGTGAGC--ACGGCCTCACGGTTGGTTGAAAA-CTGAGCTCGTGGTGTCGGGTGCGCCATGATGGATGGTGG-TT-GAGTGA-----TCCTC-GAGA-CCAA-TCATGGG--TGACCTCACC----GGAATCGGGCTCCGTGACCCACA--CGCATCC-------TTGGATGCTCC-TCAAGGAGACCTCAGGTCAGGCGG Gliricidia_maculata TCATTGTCGATGCCTCG---GAAGCGACCGACCCGCGAATCAGT---TTGA---CTGCTGGGGG-TTGGC-TTGGGGTGCTTGGCTCC-TCAA--------CCTCCCTCTGG-TTAGGTGGGG-AGGTCGTG--CTGCGCGCACG--CCCTCCTCTC--GTAGCCG---AATCAAAAA-CCCC-GGCGCAAAACGCGTCAAGGAATCGAAATTC-----GTTTCACGTGCACCCGTCGGCCCG---GATGCGGGC-GCTCGTACGGG-TGGCGTCGCGAC-ACGCT-TGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----GCCAATCGCCTCACTTG------GCG-----GGTGCTTTGGTCCGGGG--TGAATGTTGGCCTCCCGTGAGC--ACGGCCTCACGGTTGGTTGAAAA-CTGGGCTCGTGGTGTCGGGTGCGCCATGATGGATGGTGG-TT-GAGTGA-----TCCTC-GAGA-CCAA-TCATGGG--TGACCTCACC----GGAATCGGGCTCCGTGACCCACA--CGCATCC-------TCGGATGCTCC-TCAAGGAGACCTCAGGTCAGGCGG Gliricidia_robustum TCATTGTCGATGCCTCA---GAAGCGACCGACCCGTGAATCAGT---TTGA---CCGCTCAGGG-TTGGC-TTGGGGTGCTTGGCTCC-TCAA--------CCTCCCTCGGG-TTAGGGGGG--AGGTCGCG--CTGCGCGCACG--CCCTCCTCTC--GCAGCCG---AAACAAAAA-CCCC-GGCGCTAAACGCGTCAAGGAATCGGAATTC-----GTTTCACGTGCACCCGTCGGCCCG---GATGCGGGC-GCTCGTACGGG-TGGCGTCGCGAC-GCGAC-TGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----GCCAATCGCCTCACTTG------GCG-----GGTGTTTTGGTCGGGGG--TGAATGCTGGCCTCCCGTGAGC--ACGGCCTCACGGTTGGTCGAAAA-CTGAGCTCGTGGTGTCGGGTGCGCCATGATGGATGGTGG-TT-GAGTGA-----TCCTC-GAGA-CCAA-TCATGGG--TGACCTCACC----GGAATCGGGCTTCGTGACCCACA--CGCATC--------TCGGATGCTCC-TCAAGGAGACCTCAGGTCAGGCGG Gliricidia_sepium TCATTGTCGATGCCTCG---GAAGCGACCGACCCGTGAATCAGT---TTGA---CTGCTGGGGG-TTGGC-TTGGGGTGCTTGGCTCC-TCAA--------CCTCCCTCTGG-TTAGGTGGGG-AGGTCGTG--CTGCGCGCACG--CCCTCCTCTC--GTAGCCG---AATCAAAAA-CCCC-GGCGCAAAACGCGTCAAGGAATCGAAATTC-----GTTTCACGTGCACCCGTCGGCCCG---GATGCGGGC-GCTCGTACGGG-TGGCGTCGCGAC-ACGCT-TGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAC----GCCAATCACCTCACTTG------GCG-----GGTGCTTTGGTCGGGGG--TGAATGTTGGCCTCCCGTGAGC--ACGGCCTCACGGTTGGTTGAAAA-CTGGGCTCGTGGTGTCGGGTGCGCCATGATGGATGGTGG-TT-GAGTGA-----TCCTC-GAGA-CCAA-TCATGGG--TGACCTCACC----GGAATCGGGCTCCGTGACCCACA--CGCATCC-------TTGGATGCTCC-TCAAGGAGACCTCAGGTCAGGCGG Hebestigma_cubense TCATTGTCGATGCCCCG---CAAGCAACCGACCCGCGAACCCGTTGGACTA---CTTACTGGGGGTTGGC-TCGGGGCGTTCGGCCCC-TCGA--------CCTCCGCGGGG-TCAGGGGGGG-AGGTG-----GCGCCG-CGCG--CTCTCTCCTC--CTGGCCG---AAACACAAA-CCCC-GGCGCGGAACGCGTCAAGGAAGCTACGATTC----GTTTCACGTGCCCCCGTCGGCCCG---GAGGCGGG--TCTCGTACGGGGTGGCGTTGCGGC-ACATTGTGCACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACGTTGTTGCCCC--GAT----GCCAAGTGCCTCGCTGC------GCG----GGGTGC-TCGGTCGGGG---CGGATGCTGGCTTCCCGCGGGC--TTCGTCCCGCGGTTGGCTGAAAA-CCGAGCACATGGCGTCGGGTGTACCATGGTGGATGGTGG-TT-GGGTGA-----TGCTC-GAGA-CCAA-CCATGGG--CAACCTCGCC----GGGAATGGGCTCCGTGACCCACG--TGCATCC-------CCGGATGCTCC-TTCGGGAGACCTCAGGTCAGGCGG Lennea_melanocarpa TCATTGGCGATGCCTCG---AAAGCAACCGACCCGCGAACATGTT---TAA---CTACTCGGGG-ATGGC-CCGGGGCATTCAGCCCT-CGGA--------CCTCCCCTGGG-TCAGGGGGG-CAGG-------GCACGT-CGTG--CGCTCTCCTC--CTGGCCC---AAAAACGAA-CCCC-GGCGCGGAATGCGTCAAGGAATAATAAAATGACTTGTCGGACGTGCTCCCGTCGACCCG------AACGGG-TCTCGTACGGG-CGGCGTC?AGAC-CAAGCATATGCAAAAA--TGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACGCTGTTGCCCC--GGT----GCCAATCGCAC-----------------------------TCCGGGG---CGGAAGTTGGCTTCCCACGAGC--TTCGCCTCGTGGTTGGCTGAAAT-TTGAGCACGCGGCGTCGGGCGTCCCGTGATGGATGGTGG-TT-GAGCGA-----TGCTC-CGGA-CCAA-TCACGGG--CGGTCGCGTC----GGGA-CGGGCTCGAGAACCCTCG--CGCATCC-------TCGGATGCTCC-TTGAGGAGACCTCAGGTCAGGCGG Lennea_modesta TCATTGGCGATGCCTCG---AAAGCAACCGACCCGCGAACATGTT---TAA---CTACTCGGGG-ATGGCCCTTGGGCGTGCAGCCCT-CGGA--------CCTCCCCTGGG-TCAGGGGGG--AGG-------GCACGT-CGTG--CGCTCTCCTC--CTGGCCA---TAAAACGAA-CCCC-GGCGCGGAATGCGTCAAGGAATAATAAAATGACTTGTCGGACGTGCTCCCGTCGACCCG-----AACGGG--TCTCGTACGGG-CGGCGTCGAGAC-CAAGCATATGCAAAAA--TGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACGCTGTTGCCCC--GGT----GCCAATCGCAC-----------------------------TCCGGGG---CGGAAGTTGGCTTCCCACGAGC--TCCGCCTCGTGGTTGGCTTAAAT-TTGAGCACGCGGCGTCGGGCGTCCCGTGATGGATGGTGG-TT-GAGCGA-----TGCTC-CGGA-CCAA-TCACGGG--CGGTCGCGTC----GGGA-CGGGCTCGAGAACCCTCG--CGCATCC-------TCGGATGCTCC-TTGAGGAGACCTCAGGTCAGGCGG Lennea_viridiflora TCATTGGCGATGCCTCG---AAAGCAACCGACCCGCGAACATGTT---TGA---CTACTCGGGT-ACGGC-CCGGGGCGTTCAGCCCT-CGGA--------CCTCCCCTGGG-TCAGGGGGG--AGG-------GCACGT-CGTG--CACTCTCCTC--CTGGCCG---AAAAACGAA-CCCC-GGCGCGGAATGCGTCAAGGAATAATAAAATGACTTGTCGGGCGCGCTCCCGTCGACCCGAAGGAAGGCGGG-TCTCGTACGGG-CGGCGTCGTGGC-CAAGCATATGCAAAAA--TGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCCATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGCTGTTGCCCC--GGT----GCCAATCGCCTCCGTGC------GGA-----GGCATTT-GCCCGGGG---CGGAAGTTGGCTTCCCACGAGC--TTCGCCTCGTGGTTGGCTGAAAT-TTGAGCACGCGGCGTCGGGAGTCCCGTGATGGATGGTGG-TC-GAGCGA-----TGCTC-CGGA-CCAA-TCACGGG--CGGTCGCGTC----GGGA-CGGGCTCGAGAACCCTTT--GCGCATC-------TCGGATGCTCC-TTGAGGAGACCTCAGGTCAGGCGG Olneya_tesota TCATTGTCGACGCCCC---ACAAGCAACCGACCCGCGAATATGT---TTTA---CTACTTGGGG-TTGGC-TCGGGGTGTTTAGCACC-TCGA--------CCTCCCTTGGG--TTAGGGGG-GAGGTCACGTT-----AGCGTG-ACCCTCTCCCC--TTGGCCAT---AACACAAA-CCCC-GGCGCGGAATGCGTCAAGGAATAATAATTC-----ATTTCACGTGCCCGTGTCCGCCCA----GGGGTGATT-CCCGTACGGG-TGGGGACGCGGC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTATTTGAACGCAAGTTGCGCCCGAAACCACTAGGTCGAGGGCACGTCTGCCTGGGTGTCACGCATTGTTGCTCC--GAT----GCCAATCGCCTCACTTT------GTG-----GGCA-TTCGCTCGGGG---TGAATGTTGGCCTCCCGCGAGC--CTCGTCTCACGGTTGGTTGAAAA-TTGAGCGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGCGA-----TGCTC-GAGA-CCAA-TCATGGG--TAACCTCACC----GGAATCGCGCTCGGTAACCCACA--TGCATCC-------TTGGATGCTCC-CTAAGGAGACCTCAGGTCAGGCGG Peteria_glandulosa TCATTGTCGATGTCCCTA-AAAAGCAACCGACTCG{AG}GAACATGTT--TTTA---CTACTTGGGG-TTGGC-TTGGGGTGCTTTGCACC-TCGA--------CCTCCCTTGGG--CAAGGGGG-GAGGTCATGTC--------GTG--CCCTCTCCTC--TTAGCCTT---AACACAAA-CCCCCGGCGCGGAACGCGTCAAGGAATCATAATTA------TTTCACGTGCTCAAGTCAACCTG----GGGGCG-TAGCTCGTACGGG-TGGCGTTGCAGC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCTCC--AAC----GCCAATCGCCTCACCATGT----GTG-----GGCA-TTTGCTTGGGG---TGAATGTTGGCCTCCCGTGAGC--TTGGTCTCACGGTTGGTTGAAAA-TTGAGCACATGGTGTATGGTGTACCATGATGGATGGTGG-TT-GAGTGA----ATGCTCGAAGA-CCAA-TCATGGG--TCACCCCACC----AGAATCCTGCTCAGCAACCCACA--TGCATCC-------TTGGATGCTCG-TTAATGAGACCTCAGGTCAGGCGG Peteria_scoparia TCATTGTCGATGTCCCTA-AAAAGCAACCGACTCGCGAACATGTT--TTTA---CTACTTGGGG-TTGGC-TTGGGGTGCTTTGCACC-TCGA--------CCTCCCTTGGG--CAAGGGGG-GAGGTCATGTC--------GTG--CCCTCTCCTC--TTAGCCTT---AACACAAA-CCCCCGGCGCGGAACGCGTCAAGGAATCATAATTA------TTTCACGTGCTCAAGTCGACTTG----GGGGCA-TAGCCCGTACGGG-TGGTGTTGAAGC-ACGTAATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGCCTGCTTGGGTGTCACACATCGTTGCTCC--AAC----GCCAATCGCCTCACCATGT----GTG-----GGCA-TTTGCTTGGGG---TGAATGTTGGCCTCCCGTGAGC--TTGGTCTCACGGTTGGTTGAAAA-TTGAGCACATGGTGTATGGTGTACCATGATGGATGGTGG-TT-GAGTGA----ATGCTCGAAGA-CCAA-TCATGGG--TCACCCCACC----AGGATCTTGCTCAGCAACCCACA--TGCATCC-------CTGGATGCTCG-TTAATGAGACCTCAGGTCAGGCGG Peteria_thompsoniae_6157 TCATTGTCGATGTCCCTA-AAAAGCAACCGACTCGCGAACATGTT--TTTA---CTACTTGGGG-TTGGC-TTGGGGTGCTTTGCACC-TCGA--------CCTCCCTTGGG--CAAGGGGG-GAGGTCATGTT--------GTG--CCCTCTCCTC--TTAGCCTT---AACACAAA-CCCCCGGCGCGGAACGCGTCAAGGAATCATAATTA------TTTCACGTGCTCATGTCGACCTG----GGGGCG-TAGCCCGTACGGG-TGGCGTTGAAGC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCTCC--AAC----GCCAATCGCCTCACCATGT----GTG-----GGCA-TTTGCTTGGGG---TGAATGTTGGCCTCCCGTGAGC--TTGGTCTCACGGTTGGTTGAAAA-TTGAGCACATGGTGTATGGTGTACCATGATGGATGGTGG-TT-GAGTGA----ATGCTCGAAGA-CCAA-TCATGGG--TCACCCCACC----AGAATCCTGCTCAGCAACCCACA--TGCATCC-------TTGGATGCTCG-TTAATGAGACCTCAGGTCAGGCGG Peteria_thompsoniae_7048_2 TCATTGTCGATGTCCCTA-AAAAGCAACCGACTCGCGAACATGTT--TTTA---CTACTTGGGG-TTGGC-TTGGGGTGCTTTGCACC-TCGA--------CCTCCCTTGGG--CAAGGGGG-GAGGTCATGTT--------GTG--CCCTCTCCTC--TTAGCCTT---AACACAAA-CCCCCGGCGCGGAACGCGTCAAGGAATCATAATTA------TTTCACGTGCTCATGTCGACCTG----GGGGCG-TAGCCCGTACGGG-TGGCGTTGAAGC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCTCC--AAC----GCCAATCGCCTCACCATGT----GTG-----GGCA-TTTGCTTGGGG---TGAATGTTGGCCTCCCGTGAGC--TTGGTCTCACGGTTGGTTGAAAA-TTGAGCACATGGTGTATGGTGTACCATGATGGATGGTGG-TT-GAGTGA----ATGCTCGAAGA-CCAA-TCATGGG--TCACCCCACC----AGAATCCTGCTCAGCAACCCACA--TGCATCC-------TTGGATGCTCG-TTAATGAGACCTCAGGTCAGGCGG Poissonia_heterantha_5832 TCATTGTCAATG-CCTG--ACAAGCAATCGACCCGTGAACATGTT--TTTA---CTACTTGGGG-TTGGC-TCGGGGTGCTGCGTGCCCTCGA--------CCTCCCTTGGG--CTAGGGGG-GAGGTGCTGC---------GTG--CCCTTTCCTC--TAAGCCAT---AACACAAA-CCCC-GGCGCGGAATGCGTCAAGGAATCATAATTT-----GTTTCACGTGCTCGCGTCCACCTG--------------------CGGG-TGGCGTTGCAGC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACACTGTTGCCCC--GAT----GCAAATCGCCTCACTTC------GTG-----GGTA-TTTGCTCGGGG---TGAATGTTGGCCTCCCGTGAGC--TATGTCTCACGGTTGGTTGAAAA-TTGAGTGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGCGA-----TGCTCGAGGAACCAA-TCATGGG--TAACTCCACC----GGAATTGTGCTCGGCAACCCACA--TGCATCC-------TCGGATGCTCC-TCAAGGGGACCTCAGGTCAGGCGG Poissonia_heterantha_5860 TCATTGTCAATG-CCTG--ACAAGCAATCGACCCGTGAACATGTT--TTTA---CTACTTGGGG-TTGGC-TCGGGGTGCTGCGTGCCCTCGA--------CCTCCCTTGGG--CTAGGGGG-GAGGTGCTGC---------GTG--CCCTTTCCTC--TAAGCCAT---AACACAAA-CCCC-GGCGCGGAATGCGTCAAGGAATCATAATTT-----GTTTC?CGTGCTCGCGTCCACCTG--------------------TGGG-TGGCGTTGCAGC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACACACTGTTGCCCC--GAT----GCAAATCGCCTCACTTC------GTG-----GGTA-TTTGCTCGGGG---TGAATGTTGGCCTCCCGTGAGC--TATGTCTCACGGTTGGTTGAAAA-TGGAGTGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGCGA-----TGCTCGAGGAACCAA-TCATGGG--TAACTCCATC----GGAATTGTGCTCGGCAACCCACA--TGCATCC-------TCGGATGCTCC-TCTAGGGGACCTCAGGTCAGGCGG Poissonia_hypoleuca_121088 TCATTGTCAATG-CCCG--ACAAGCAATCGACCCGTGAACTTGT---TTAA---CTACTTGGGG-TTGGC-TCGGGGTGCTTTGCTCC-TCGA--------CCTCCCTTTGG--TTAGGGGG-GAGGTGCTGC---------GTG--CCCTCTCCTC--TTAGCCGT---AAAACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCATAATTT-----TTTTCACGTGGTGGCGTCCACCTG--------------------CGTGGTGGCGTTGCAGC-ACGTTAAGTACAGTACAATGACTCTCGGCAACGGATATCTCGGTTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--GAT----GCCAATCGCCTCACTTT------GTG-----GGAA-TTTGGTCGGGG---TGAATGTTGGCCTCCCGTGAGC--TATGTCTCGCGGTTGGTTGAAAA-TTGAGTGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGCGA-----TGCTC-GAGA-CCAA-TCATGAG--TAACTCCACC----AGAATTGCTCTCGGCAACCCACT--TGCATCC-------TTGGATGCTCA-TCAAGGGGACCTCAGGTCAGGCGG Poissonia_hypoleuca_5787 TCATTGTCAATG-CCCG--ACAAGCAATCGACCCGTGAACTTGT---TTAA---CTACTTGGGG-TTGGC-TCGGGGTGCTTTGCTCC-TCGA--------CCTCCCTTTGG--TTAGGGGG-GAGGTGCTGC---------GTG--CCCTCTCCTC--TTAGCCGT---AAAACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCATAATTT-----TTTTCACGTGGTGGCGTCCACCTG--------------------CGTGGTGGCGTTGCAGC-ACGTTAAGTACAGTACAATGACTCTCGGCAACGGATATCTCGGTTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--GAT----GCCAATCGCCTCACTTT------GTG-----GGAA-TTTGGTCGGGG---TGAATGTTGGCCTCCCGTGAGC--TATGTCTCGCGGTTGGTTGAAAA-TTGAGTGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGCGA-----TGCTC-GAGA-CCAA-TCATGAG--TAACTCCACC----AGAATTGCTCTCGGCAACCCACT--TGCATCC-------TTGGATGCTCA-TCAAGGGGACCTCAGGTCAGGCGG Poissonia_orbicularis TCATTGTCAATG-CCTG--ACAAGCAATCGACCCGTGAACTTGT---TAAA---CTACTTGGGG-TTGGC-TCGGGGTGCTTTGCTCC-TCGA--------CCTCCCTTTGG--TTAGGGGGGGAGGTGCTGC---------GTG--CCCTCTCCTT--TTAGCCGT---AAAACAAA-CCCC-GGCGCGGAAAGCGTCAAGGAATCATAATTT-----GTTTCACGTGCTCGCGTCCACCTG--------------------CGTGGTGGCGTTGCAGC-ACGTTAAGTACAA-----TGACTCTCGGCAACGGATATCTCGGTTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--GAT----GCCAATCGTCTCACTTT------GTG-----GGAA-TTTGCTCGGGG---TGAATGTTGGCCTCCCGTGAGC--TATGTCTGGCGGTTGGTTGAAAA-TCGAGTGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGCGA-----TGCTC-GAGA-CCAA-TCATGAG--TAACTCCACC----AGAATTGCTCTCTGTAACCCACT--TGCATCC-------TTGGATGCTCA-TCAAGGGGACCTCAGGTCAGGCGG Poissonia_weberbaueri_917 TCATTGTCAATG-CTTG--ACAAGCAATCGACCCGTGAACATGTT--TTTA---CTTCTTGGGG-TAGGC-TCGGGGTGCTGCGTGCCCTCGA--------CCTCCCTTGGG--TTAGGGGG-GAGGTGCTGT---------GTG--CCCTCTCCTC--TAAGCCGT---AACACAAA-CCCC-GGCGCGGAATGCGTCAAGGAATCATAATTC-----ATTTCACGTGCTCGTGTTCACCTG--------------------TGGGGTGGCGTTGCAGC-ATGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGTATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTACGGTGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--GAT----GCCAATCGCCTCACTTT------GTG-----GGTA-TTTGCTCGGGG---TGAATGTTGGCCTCCCATGAGC--TATGCCTCATGGTTGGTTGAAAA-TTGAGTGCATGGTGTTGGGTGTACCATGATGGATGGTGG-TT-GAGCGA-----TGCTCGAGGAACCAA-TCATGGG--TAACTCCACC----AAAATTGTGCTCGGTAACCCACA--TGAATCC-------TCGGATGCTCC-TCAAGGGGACCTCAGGTCAGGCGG Poissonia_weberbaueri_918 TCATTGTCAATG-CTTG--ACAAGCAATCGACCCGTGAACATGTT--TTTA---CTTCTTGGGG-TAGGC-TCGGGGTGCTGCGTGCCCTCGA--------CCTCCCTTGGG--TTAGGGGG-GAGGTGCTGT---------GTG--CCCTCTCCTC--TAAGCCGT---AACACAAA-CCCC-GGCGCGGAATGCGTCAAGGAATCATAATTC-----ATTTCACGTGCTCGTGTTCACCTG--------------------TGGGGTGGCGTTGCAGC-ATGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGTATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTACGGT?AGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--GAT----GCCAATCGCCTCACTTT------GTG-----GGTA-TTTGCTCGGGG---TGAATGTTGGCCTCCCATGAGC--TATGCCTCATGGTTGGTTGAAAA-TTGAGTGCATGGTGTTGGGTGTACCATGATGGATGGTGG-TT-GAGCGA-----TGCTCGAGGAACCAA-TCATGGG--TAACTCCACC----AAAATTGTGCTCGGTAACCCACA--TGAATCC-------TCGGATGCTCC-TCAAGGGGACCTCAGGTCAGGCGG Poitea_campanilla TCATTGTCGATGCCTCA---GAAGTGACTGACCCGTGAATCAGTCTGTTGA---CCGCTTTGGG-TTGGC-TTGGGGTGCCTGACTCC-TCAACCATCCTTCCTCCCTTGGG-TTAGGGGGGGCAGGTCGTG--CTGCGCGCGTG--CCCTCCCCTC--TCACCCT---AAACACAAA-CCCC-GGCGCTAAACGCGTCAAGGATTCGAAACAT-----GTTTCACGTGCACTTGTCGGCCCG---GATATGGGT-GCTCGTACGGG-TGGCGTCGCAAC-ACGCT-TGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTACCCC--AATGCCTGCCAATCGCCTCACCTG------GTG-----GGTGCTTTGGTCGGGGGG-TGAATGTTGGCCTCCCGTGAGC--GCGATCTCACGGTTGGTTGAAAA-CTGAGCTCGTGGTGTCGGGTGCGCCATGATGGATGGGGG-CT-GAGTGC-----TGCTC-GAGA-CCAA-TCATGGG--TGACCTCATC----GGAATCGGGTTCTGTGACCCACA--CGCATCC-------TTGGATGCTCC-TCAAGGGGACCTCAGGTCAGGCGG Poitea_carinalis TCATTGTCGATGCCTCA---GAAGCGACCAACCTGTGAATCAGTCTGCTGA---ATGCTCCGGG-TTGGC-TTGGGGTGCCTGGCTCC-TCAA--------CCTCCCTTGGGTTTTGGGGGG--AGGTCGTG--CTGCGCGCATG--CCTTACCCTC--GCGGCCT---AAACACAAA-CCCC-GGCGCTAAACGCGTCAAGGAATCGGAATAT-----GTTTCACGTGCACTTGTCGGCCCG---GATACGGGT-GCTCGTACGGG-TGGCGTCGCAAC-ATGCT-TGTGTAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAT----GCCAATCGCCTCACCTG------GTG-----GGTGCCTTGGTTGGGGGG-TGAATGTTGGCCTCCTGTGAGC--GCGGTCTCATGGTTGGTTGAAAA-CTAAGCTGGTGGCGTCGGGCGCGCCATGATGGATGGGGG-CT-GAGTGC-----TGCTC-GAGA-CCAA-TCATGGG--TGACCTCAAA----GGAACCCTGTTCCGTGACCCACA--CGCATCC-------TTGGATGCTCC-TCAAAGCGACCTCAGGTCAGGCGG Poitea_dubia TCATTGTCGATGCCTCA---GAAGCGACCAACCTGCGAATCAGTCTGCTGA---ACGCTCTGGG-TTGGC-TTGGGGTGCCTGGCTCC-TCAA--------CCTCCCTCGGGTTTGGGGGGTGGAGGTCGTG--CTGCGCGCATG--CCTTACCCTC--GCAGCCT---AAACACAAA-CCCC-GGCGCTAAACGCGTCAAGGAATCGGAATAT-----GTTTCACGTGCACTTGTCGGCCCG---GATACGGGT-GCTCGTATGGG-TGGCGTCGCAAC-ATGCT-TGTATAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTAGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAT----GCCAATCGCCTCACCCG------GTG-----GGTGCCTTGGTTGGGGGG-TGAATGTTGGCCTCCCGTGAGC--GCTGTCTCATGGTTGGTTGAAAA-CTAAGCTCGTGGTGTCGGGCGCGCCATGATGGATGGGGG-CT-GAGTGC-----TGCTC-GAGA-CCAA-TCATGGG--TGACCTCATT----GGAATCTGGTTCCGTGACCCACA--CGCGTCC-------TTGGATGCTCC-TCAAAGGGACCTCAGGTCAGGCGG Poitea_florida TCATTGTCGATGCCTCA---GAAGCGACCAACCTGCGAATCAGTCTGCTGA---ATGCTCCGGG-TTGGC-TTGGGGTGCCTGGCTCC-TCAA--------CCTCCCTTGGGTTTTGGGGGG--AGGTCGTG--CTGCGCGCATG--CCTTACCCTC--GCGGCCT---AAACACAAA-CCCC-GGCGCTAAACGCGTCAAGGAATCGGAATAT-----GTTTCACGTGCACTTGTCGGCCCG---GATACGGGT-GCTCGTATGGG-TGGCGTCGCAAC-ATGCT-TGTGTAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAT----GCCAATCGCCTCACCTG------GTG-----GGTGCCTTGGTTGGGGGG-TGAATGTTGGCCTCCTGTGAGC--GCGGTCTCATGGTTGGTTGAAAA-CTAAGCTGGTGGCGTCGGGCGCGCCATGATGGATGGGGG-CT-GAGTGC-----TGCTC-GAGA-CCAA-TCATGGG--TGACCTCAAA----GGAACCCTGTTCCGTGACCCACA--CGCATCC-------TTGGATGCTCC-TCAAAGCGACCTCAGGTCAGGCGG Poitea_galegoides TCATTGTCGATGCCTCA---GAAGTGACTGACCCGCGAATCAGTCTGTTGA---CCGCTTTGGG-TTGGC-TTGGGGTGCCTGGCTCC-TCAACCATCCTTGCTCCCTTGGG-TTAGGGGGGGCTGGTCGTG--CTGCGTGCGTG--CCCTCCCCTC--TCACCCT---AAACACAAA-CCCC-GGCGCTGAACGCGTCAAGGATTCGAAACAT-----GTTTCACGTGCACTCGTCGGCCCG---GATATGGGT-GCTCGTACGGG-TGGCGTCGCAAC-ACGCT-TGTACAA-----TGACTCTTGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTACCCC--AATGCCTGCCAATCGCCTCACCTG------GTG-----GGTGCTTTGGTCGGGGGG-TGAATGTTGGCCTCCCGTGAGC--GCGATCTCACGGTTGGTTGAAAA-CTGAGCTCGTGGTGTCGGGTGCGCCATGATGGATGGGGG-CT-GAGTGC-----TGCTC-GAGA-CCAA-TCATGGG--TGACCTCATC----GGAATCGGGTTCTGTGACCCACA--CGCATCC-------TTGGATGCTCC-TCAAGGGGACCTCAGGTCAGGCGG Poitea_glyciphylla TCATTGTCGATGCCTCA---GAAGTGACTGACCCGCGAATCAGTCTGTTGA---CCGCTTTGGG-TTGGC-TTGGGGTGCCTGGCTCC-TCAACCAT----CCTCCCTTGGG-TTAGGGGGGGCAGGTCGTG--CTGCGCGCGTG--CCCTCCCCTC--TCACCCT---AAACACAAA-CCCC-GGCGCTAAACGCGTCAAGGATTCGAAACAT-----GTTTCACGTGCACTCGTCGGCCCG---GATATGGGT-GCTCGTACGGG-TGGCGTCGCAAC-ACGCT-TGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGTCTGCCTGGGTGTCACACATTGTTACCCC--AATGCCTGCCAATCGCCTCACCTG------GTG-----GGTGCTTTGGTCGGGGGG-TGAATGTTGGCCTCCCGTGAGC--GCGATCTCACGGTTGGTTGAAAA-CTGAGCTCGTGGTGTCGGGCGCGCCATGATGGATGGGGG-CT-GAGTGC-----TGCTC-GAGA-CCAA-TCATGGG--TGACCTCATC----GGAATCGGGTTCTGTGACCCACA--CGCATCC-------TTGGATGCTCC-TCAAGGGGACCTCAGGTCAGGCGG Poitea_gracilis TCATTGTCGATGCCTCA---GAAGCGACCAACCTGCGAATCAGTCTGCTGA---ACGCTCTGGG-TTGGC-TTGGGGTGCCTGGCTCC-TCAA--------CCTCCCTTGGGTTTGGGGGGGGGAGGTCGTGTGCTGTGCGCATG--CCTTACCCTC--GCAGCCT---AAACACAAA-CCCC-GGCGCTAAACGCGTCAAGGAATCGGAATAT-----GTTTCACGTGCACTTGTCGGCCCG--GGATACGGGT-GCTCGTATGGG-TGGCGTCGCAAC-ATGCT-TGTATAA-----CGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTCGAGGGCACGTCTGCCTGGGTGTCACACATCGTTGCCCC--AAT----GCCAATCGCCTCACCTG------GTG-----GGTGCTTTGGTTGGGGGG-TGAATGTTGGCCTCCCATGAGC--GCGGTCTCATGGTTGGTTGAAAA-CTAAGCTCGTGGTGTCGGGCGCGCCATGATGGATGGGGG-CT-GAGTGC-----TGCTC-GAGA-CCAA-TCATGGG--TGACCTCATT----GGAATCTGGTTCCGTGACCCACA--CGCATCC-------TTGGATGCTCC-TCAAAGGGACCTCAGGTCAGGCGG Poitea_immarginata TCATTGTCAATGCCTCA---GAAGTGACCGACCCGCGAATGAGTCTGTTGA---CCGCTTTGGG-TTGGC-TTGGGGTGCCTGGCTCC-TCAA----CCTTCCTCCCTTGGG-TTGGGGGGG-----TCGTG--CTGCGCGCGTG--CCCTCCCCTC--TCACCCT---AAACACAAA-CCCC-GGCGCTAAACGCGTCAAGGAATCGGAACAT-----GTTTCACGTGCACTCGTCGGCCCG---GATATGGGT-GCTCGTACGGGGTGGCGTCGCGAC-ACGCT-TGTATAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTCGAAGGCACGTCTGCCTGGGTGTCACACATTGTTACCCC--AATGCCTGCCAATCGCCTCACCTG------GTG-----GGTGCTTTGGTCGGGGGGGTGAATGTTGGCCTCCCGTGGGC--GCGGTCTCACGGTTGGTTGAAAA-CTGAGCTCGTGGTGTCGGGCGCGCCATGATGGATGGGGG-CT-GAGTGC-----TGCTC-GAGA-CCAA-TCATGGG--TGGCCTCATC----GGAATCGGGTTCTGTGACCCACG--CGCATCC-------TTGGATGGTCC-TCAAGGTGACCTCAGGTCAGGCGG Poitea_multiflora TCATTGTCGATGCCTCA---GAAGTGACTGACCCGCGAATCAGTCTGTTGA---CCGCTTTGGG-TTGGC-TTGGGGTGCCTGGCTCC-TCAACCAT----CCTCCCTTGGG-TTAGGGGGGGCAGGTCGTG--CTGCGCGCGTG--CCCTCCCCTC--TCACCCT---AAACACAAA-CCCC-GGCGCTAAACGCGTCAAGGATTCGAAACAT-----GTTTCACGTGCACTCGTCGGCCCG---GATATGGGT-GCTCGTACGGG-TGGCGTCGCAAC-ACGCT-TGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGTCTGCCTGGGTGTCACACATTGTTACCCC--AATGCCTGCCAATCGCCTCACCTG------GTG-----GGTGCTTTGGTCGGGGGG-TGAATGTTGGCCTCCCGTGAGC--GCGATCTCACGGTTGGTTGAAAA-CTGAGCTCGTGGTGTCGGGCGCGCCATGATGGATGGGGG-CT-GAGTGC-----TGCTC-GAGA-CCAA-TCATGGG--TGACCTCATC----GGAATCGGGTTCTGTGACCCACA--CGCATCC-------TTGGATGCTCC-TCAAGGGGACCTCAGGTCAGGCGG Poitea_paucifolia TCATTGTCGATGCCTCA---GAAGCGACCAACCTGCGAATCAGTCTGCTGA---ACGCTCTGGG-TTGGC-TTGGGGTGCCTGGCTCC-TCAA--------CCTCCCTCGGGTTTGGGGGGCGGAGGTCGTG--CTGCGCGCATG--CCTTACCCTC--GCAGCCT---AAACACAAA-CCCC-GGCGCTAAACGCGTCAAGGAATCGGAATAT-----GTTTCACGTGCACTTGTCGGCCCG---GATACGGGT-GCTCGTATGGG-TGGCGTCGCAAC-ATGCT-TGTATAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAT----GCCAATCGCCTCACCCG------GTG-----GGTGCCTTGGTTGGGGGG-TGAATGTTGGCCTCCCGTGAGC--GCTGTCTCATGGTTGGTTGAAAA-CTAAGCTCGTGGTGTCGGGCGCGCCATGATGGATGGGGG-CT-GAGTGC-----TGCTC-GAGA-CCAA-TCATGGG--TGACCTCATT----GGAATCTGGTTCCGTGACCCACA--CGCGTCC-------TTGGATGCTCC-TCAAAGGGACCTCAGGTCAGGCGG Poitea_punicea TCATTGTCGATGCCTCA---GAAGCGACCAACCTGCGAATCAGTCTGCTGA---ATGCTCCGGG-TTGGC-TTGGGGTGCCTGGCTCC-TCAA--------CCTCCCTTGGGTTTTGGGGGG--AGGTCGTA--CTGCGCGCATG--CCTTACCCTC--GCGGCCT---AAACACAAA-CCCC-GGCGCTAAACGCGTCAAGGAATCGGAATAT-----GTTTCACGTGCACTTGTCGGCCCG---GATACGGGT-GCTCGTATGGG-TGGCGTCGCAAC-ATGCT-TGTGTAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTCGAGGGCACGTCTGCCTGGGTGTCACACATTGTTGCCCC--AAT----GCCAATCGCCTCACCTG------GTG-----GGTGCCTTGGTTGGGGGG-TGAATGTTGGCCTCCTGTGAGC--GCGGTCTCATGGTTGGTTGAAAA-CTAAGCTGGTGGCGTCGGGCGCGCCATGATGGATGGGGG-CT-GAGTGC-----TGCTC-GAGA-CCAA-TCATGGG--TGACCTCAAA----GGAACCCTGTTCCGTGACCCACA--CGCATCC-------TTGGATGCTCT-TCAAAGCGACCTCAGGTCAGGCGG Robinia_hispida TCATTGTCGATGCCCCTA-ACAAGCAACCGACCCGTGAATTCGT---TTAA---CTACTTAGGG-TTGGC-TCGGGGTGCTGAGCACC-TCGA--------CCTCCCTTGGG--TTAGGGGG-GAGGTCACGTC--------GTG--CCCTCTCCTC--TTAGCCGA---AACACAAA-CCCC-GGCGCGGAATGCGTCAAGGAATCATAAAAT----CGTTTCACGTGCTCTCGTCCACCTG----GGGGCTTTTGCTCGTACGGG-TGGCGTTGCAGC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC--TAT----GCCAATCGCCTCACTTT------GTA-----GGTA-TTTGCTTGGGG---TGAATGTTGGCCTCCCGTGAGC--TCTGTCTCACGGTTGGTTGAAAA-TCGAGTGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGTGA-----TGCTC-GAGA-CCAA-TCATGGG--TAACTCCACC----AGAATTGGGCTCGGTGACCCACA--TGCGTCCC------TTGGATGCTCC-CTAAGGAGACCTCAGGTCAGGCGG Robinia_neomexicana_190789 TCATTGTCGATGCCCCAA-ACAAGCAACCGACCCGTGAATTTGT---TCAA---CTACTTAGGG-TTGGC-TCGGGGTGCTTAGCACC-TCGA--------CCTCCCTTGGG--TTAGGGGG-GAGGTCACGTT--------GTG--CCCTCTCCTC--TTAGCCGA---AACACAAA-CCCC-GGCGCGGAATGCGTCAAGGAATCAAAATTT-----GTTTCACGTGCTCACGTCCACGTG----GGGGCTTTTGCTCGTACGGG------TTGCAGC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACATTGTTGCCCC--AAT----GCCAATCGCCTCTCTTT------GTA-----GGTA-TTTGCTTGGGG---TGAATGTTGGCCTCCCGTGAGC--TTTGTCTCACGGTTGGTTGAAAA-TCGAGTGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGTGA-----CGCTC-GAGA-CCAA-TCATGGG--TAACTCCACC----AGAATTGGGCTCGGTGACCCACA--TGCGTCCC------TTGGATGCTCC-CTAAGGAGACCTCAGGTCAGGCGG Robinia_neomexicana_717 TCATTGTCGATGTCCCAA-ACAAGCAACCGACCCGTGAATTTGT---TTAA---CTACTTAGGG-TTGGC-TCGGGGTGCTTAGCACC-TCGA--------CCTCCCTTGGG--TTAGGGGG-GAGGTCACGTT--------GTG--CCCTCTCCTC--TTAGCCGA---AACACAAA-CCCC-GGCGCGGAATGCGTCAAGGAATCATAATTT-----GTTTCACGTGCTCACGTCCACCTG----GGGGCTTTTGCTCGTACGGG-TGGCGTTGCAGC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACATTGTTGCCCC--AAT----GCCAATCGCCTCGCTTT------GTA-----GGTA-TTTGCTTGGGG---TGAATGTTGGCCTCCCGTGAGC--TTTGTCTCACGGTTGGTTGAAAA-TCGAGTGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGTGA-----CGCTC-GAGA-CCAA-TCATGGG--TAACTCCACC----AGAATTGGGCTCGGTGACCCACA--TGCGTCCC------TTGGATGCTCC-CTAAGGAGACCTCAGGTCAGGCGG Robinia_pseudoacacia TCATTGTCGATGCCCCTA-ACAAGCAACCGACCCGTGAATTTGT---TTGA---CTACTTAGGG-TTGGC-TCGGGGTGCTTAGCACC-TCGA--------CCTCCCTTGGG--TTA-GGGG-GAGGTCACGTT--------GTG--CCCTCTCCTC--TTAGCCGA---AACACAAA-CCCC-GGCGCGGAATGCGTCAAGGAATCATAAATC-----GTTTCACGTGCTCTCGTCCACCTG----GGGGCTTTTGCTCGTACGGG-TGGCGTTGCAGC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC--AAT----GCCAATCGCCTCACTTT------GTA-----GGTA-TTTGCTTGGGG---TGAATGTTGGCCTCCCGTGAGC--TTTGTCTCACGGTTGGTTGAAAA-TCGAGTGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGTGATG--ATGCTC-GAGA-CCAA-TCATGGG--TAACTCCACC----AGAATTGGGCTCGGTGACCCACA--TGCGTCCC------TTGGATGCTCC-CTAAGGAGACCTCAGGTCAGGCGG Robinia_viscosa TCATTGTCGATGCCCCTA-ACAAGCAACCGACCCGTGAATTTGT---TTAA---CTACTTAGGG-TTGGC-TCGGGGTGCTTAGCACC-TCGA--------CCTCCCTTGGG--TTA-GGGG-GAGGTCACGTT--------GTG--CCCTCTCCTC--TTAGCCGA---AACACAAA-CCCC-GGCGCGGAATGCGTCAAGGAATCATAAATC-----GTTTCACGTGCTCTCGTCCACCTG----GGGGCTTTTGCTCGTACGGG-TGGCGTTGCAGC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC--AAT----GCCAATCGCCTCACTTT------GTA-----GGTA-TTTGCTTGGGG---TGAATGTTGGCCTCCCGTGAGC--TTTGTCTCACGGTTGGTTGAAAA-TCGAGTGCATGGTGTCGGGTGTACCATGATGGATGGTGG-TT-GAGTGATG--ATGCTC-GAGA-CCAA-TCATGGG--TAACTCCACC----AGAATTGGGCTCGGTGACCCACA--TGCGTCCC------TTGGATGCTCC-CTAAGGAGACCTCAGGTCAGGCGG Sphinctospermum_5120 TCATTGTCAATGCCTC---AAAAGCAATCGACCCGTGGACCCGTC--CCTTCGGTTAATCGGGG-CTGGC-TCGGGGTGCTTAGCTCC-TCGA--------CCACCCCTGTG--CTAGGGGGTGTGGGTCACCT-------CGTGGCCCCCATCCTC--TCAGCCTCG--AACAAAAAACCCC-GGCGCGGAAAGCGTCAAGGAATCGAAATTC-----TTTACACGTGCTCGCGTCTACCCG----GGGGCGTT-GCCCGCACGGG-TGGCGTTGCAGC-ACGTTATGTACAA-----TGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACGCTGTTGCCCC--GAA----GCCAATCGCCTCACCGCGC----GTG-----GGCA-TTTGCCAGGGG---TGAATGTTGGCCTCCCGTGAGC--CTCGTCTCGCGGTTGGTTGAAAC-TCGAGTGCATGGTGTTGGGTG-GCCATGATGGATGGTGG-CT-GAGCGA-----TGCTC-GAGA-CCAA-TCATGTG--CGACCCCTCC----GTGATCGCGCTCGGAGACCCACA--TGCATCC-------CAGGATGCTCC-TAGATGAGACCTCAGGTCAGGCGG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Fabaceae) = N: 1-745; CODONPOSSET CodonPositions (CHARACTERS = Fabaceae) = N: 1-745; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M637] TITLE Ruprechtia; LINK TAXA = Taxa1; DIMENSIONS NCHAR=649; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Ruprechtia_albida_1_.4 TTTATCACCCTCAGGGAGGCAGGGATAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCTGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTGTCGCGTCCCGCCTCCCCCGGGCGACCGGGGAGCCGGCGATGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTTGCCCCCTCCTCCTCCATCTAGGACTTGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCT-GTGGCCGTGAATGCCGCGACGATTGGTGGTTTGACGCACGACACCACGAGCTTCGGTTTATGGCATCGTGAAGCATCGCGTCGCTTGCCCTAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCTGGGATCTCGTGATCCA-CCCTAACCCTTGCGACCCCA Ruprechtia_albida_2_.4 TTTATCACCCTCAGGGAGGCAGGGATAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCACCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCTGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTGTCGCGTCCCGCCTCCCCCGGGCGACCGGGGAGCCGGCGATGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTTGCCCCCTCCTCCTCCATCTAGGACTTGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCT-GTGGCCGTGAATGCCGCGACGATTGGTGGTTTGACGCACGACACCACGAGCTTCGGTTTATGGCATCGTGAAGCATCGCGTCGCTTGCCCTAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCTGGGATCCCGTGATCCA-CCCTAACCCTTGCGACCCCA Ruprechtia_aperta_1_.4 TTTATCACCCTCAGGGAGGCAGGGATAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCTGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTGTCGCGTCCCGCCTCCCCCGGGCGACCGGGGAGCCGGCGATGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTTGCCCCCTCCTCCTCCATCTAGGACTTGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCT-GTGGCCGTGAATGCCGCGACGATTGGTGGTTTGACGCACGACACCACGAGCTTCGGTTTATGGCATCGTGAAGCATCGCGTCGCTTGCCCTAGCGGACCACGTAAAGCTCGAAGGACCCTTAGGAAGGAGAGGGGCATCCCATCTGGGATGCTC???????????????????????????? Ruprechtia_aperta_2_.4 TTTATCACCCTCAGGGAGGCAGGGATAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCTGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTGTCGCGTCCCGCCTCCCCCGGGCGACCGGGGAGCCGGCGATGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTTGCCCCCTCCTCCTCCATCTAGGACTTGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCT-GTGGCCGTGAATGCCGCGACGATTGGTGGTTTGACGCACGACACCACGAGCTTCGGTTTATGGCATCGTGAAGCATCGCGTCGCTTGCCCTAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCTGGGATCCCGTGATCCA-CCCTAACCCTTGCGACCCCA Ruprechtia_aperta_3_.5 TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCTGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCGCCCCGCCTCCCCCGGGCGACCGGGGAGCCGGCGATGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTTGCCCCCTCCTCCTTCCTCTAGGACTTGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGAATGCCGCGACGATTGGTGGTTTGACGCACGACTCCACGAGCTTCGGTTCATGGCATCGTGAAGCATCGCGTCGCTTGCCCGAGCGGACCACGTAAAGCTCGAAGGACCCTAGGGAAGGAGAGGGGCATCCCATCTGGGATCCCGTGATCCA-CCCTAACCCTTGCGACCCCA Ruprechtia_apetala_1_.3._chaco TTTATCAACCTCAGGGAGGCAGGGCTAGTCTCTGTCCCTTGAAACCGACGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCTGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCGCCCCGCCTCCCTCGGGCGACCGGGGATCCGGCGATGGCGTGTTGATATATAGCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTTGCCCCCTCCTCCTCCATCCAGGACTGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGAATGCCGCGACGATTGGTGGTTTGACGCACGACTCCACGAGCTTCGGTTCATGGCATCGTGAAGCATCGCGTCGCTTGCCCGAGCGGACCACGTAAAGCTCGAAGGACCCTTAGGAAGGAGAGGGGCATCCCATCTGGGATCCCAGGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_apetala_2_.3._chaco TTTATCAACCTCAGGGAGGCAGGGCTAGTCTCTGTCCCTTGAAACCGACGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAACGTGTCGGCTGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCGCCCCGCCTCCCTCGGGCGACCGGGGATCCGGCGATGGCGTGTTGATATATAGCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTTGCCCCCTCCTCCTCCATCCAGGACTGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGAATGCCGCGACGATTGGTGGTTTGACGCACGACTCCACGAGCTTCGGTTCATGGCATCGTGAAGCATCGCGTCGCTTGCCCGAGCGGACCACGTAAAGCTCGAAGGACCCTTAGGAAGGAGAGGGGCATCCCATCTGGGATCCCAGGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_apetala_3_.3._chaco TTTATCAACCTCAGGGAGGCAGGGCTAGTCTCTGTCCCTTGAAACCGACGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCTGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCGCCCCGCCTCCCTCGGGCGACCGGGGATCCGGCGATGGCGTGTTGATATATAGCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTTGCCCCCTCCTCCTCCATCCAGGACTGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGAATGCCGCGACGATTGGTGGTTTGACGCACGACTCCACGAGCTTCGGTTCATGGCATCGTGAAGCATCGCGTCGCTTGCCCGAGCGGACCACGTAAAGCTCGAAGGACCCTTAGGAAGGAGAGGGGCATCCCATCTGGGATCCCAGGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_apurensis TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTTGGGGGCCGATGGGTGGGGGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATACAACAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGGATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAACGGACCACGTAAAGCTCGAAGGACCCTAAGGAGGAAGAGCGGCATCCCATCGGGGATCCCGTGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_brachysepala ?????????????????????GGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAACAACTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATACAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGGATGCTGCGACGATTGGTGGTTTGACGCACGACTCCACGAGCTTCGGCTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAACGGACCACGGAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCGGGGATCCCGTGATC??????????????????????? Ruprechtia_carina TTTAGCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGGGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATACAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGGATGCTGCGACGATTGGTGGTTTGACGCACGATTCCATGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCGGGGATCCCGTGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_chiapensis TTTATCACCCTCAGGGAGGCAGGGCTACCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCATGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGAATGCTGCGACGATTGGTGGTTTGACACACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCGGGGATCCCGTGATCCA-CCCTAACCGTTGCGAC???? Ruprechtia_costaricensis ????????CCTCAGGGAGGCAGGGCTAGCCTCTGTCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCAGGGGCCGATGGGTGGGAGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTACGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGAATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACAAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCGGGGATCCCGTGATC??????????????????????? Ruprechtia_cruegerii_1_wetamaz TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATACAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGTGGATGCTGCGACGATTGGTGGTTTGACGCACGACTCCACGAGCTTCGGTTTGTGGCATCTTGAGGCATCGCGTCGCTTGCC-AAACGGAC-ACGGAAGGCTCGAA-GACC--TAGGAAGGAGA-GGGCATCC-ATCG????????????????????????????????????? Ruprechtia_cruegerii_2_wetamaz TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATACAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCATCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGTGGATGCTGCGACGATTGGTGGTTTGACGCACGACTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAACGGACCACGGAAGGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCGGGGATCCCGTGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_curranii TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTTGGGGGCCGATGGGTGGGGGCGTGTCGGCCGTACCCCAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATACAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACTGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGGATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCGAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCGGGGATCCCGTGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_fagifolia TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCGTCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCTGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCGTCCCGCCTCCCTCGGGCATCCGGGGAGCCGGCGATGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACGGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGAATGCCGCGACGATTGGTGGTTGGACGCACGATTCCACGAGCGTCGGTTCGTGGCTTCGTGAGGCATCGCGTCGCTTGCCCAAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCGTCCCATCCGGGATCCCGTGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_fusca_1_.8 TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCTATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCTGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCTGCGAATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCA------------TCCCATGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_fusca_2_.8 TT-ATCA-CCTCAGGGAGGCAGG-CTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCTATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCTGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCTGCGAATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCAT----GATCC--------A--CCTAACCGTTGCGAC???? Ruprechtia_fusca_3_.8 ????????????AGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCTATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCTGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCTGCGAATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCA------------TGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_fusca_4_.8 TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCATGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGAATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCGGGGATCCCGTGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_laevigata_1_.8 TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCCCGTGGCCGCGAATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCGGGGATCCCGTGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_laevigata_2_.8 TTTATCACCCTCAGGGAG{GT}CAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGAATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCAT???????????????????????????????????????????? Ruprechtia_laevigata_3_.8 TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGAATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCC{AC}-TCGGGGATCCCGTGATCCA-CCCTAACCGTTGCGACC??? Ruprechtia_laevigata_4_.8 TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGAATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCGGGGATCCCGTGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_laxiflora_.1._.2._.3 TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCTGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCGTCCCGCCTCCCTCGGGCGACCGGGGAGTCGGCGATGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACCGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCC-TGCGCGCGGTCGGCCTAAATACG-AGCCC-GTGGCCGCCAATGCCGCGAC-ATTGGTGGTTTGACGCACGA-TCCAC-AGCTTCG-TTCTTGGCATCCTGAGGCATCGCGTCGCTTG??????????????????????????????????????????????????????????????????????????????????????????????? Ruprechtia_pallida_.8 ??????????????GGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCTATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGGATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCA------------TGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_ramiflora_1_.7._wetamaz_wetmeso TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTTGGGGGCCGATGGGTGGGGGCGTGTCGGCCGTACCCCAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATACAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACTGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGGATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCGAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCGGGGATCCCGTGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_ramiflora_2_.7._wetamaz_wetmeso TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTTGGGGGCCGATGGGTGGGGGCGTGTCGGCCGTACCCCAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATACAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACTGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGGATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCGAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCGGGGA-CCCGTGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_ramiflora_3_.7._wetamaz_wetmeso TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTTGGGGGCCGATGGGTGGGGGCGTGTCGGCCGTACCCCAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATACAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACTGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGGATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCGAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCGGGGA-CCCGTGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_ramiflora_4_.7._wetamaz_wetmeso TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTTGGGGGCCGATGGGTGGGGGCGTGTCGGCCGTACCCCAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATACAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACTGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGGATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCGAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCGGGGATCCCGTGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_ramiflora_5_.7._wetamaz_wetmeso ?????????CTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTTGGGGGCCGATGGGTGGGGGCGTGTCGGCCGTACCCCAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATACAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACTGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGGATGCTGCGACGATTGGTGGTTTGACG-ACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCGAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCGGGGATCCCGTGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_ramiflora_6_.7._wetamaz_wetmeso ????????????????????????????????????????????????????????????????????????????????????????????GCGTGTCGGCCGTACCCCAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATACAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACTGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGGATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCGAGCGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCGGGGATCCCGTGATCCA-CCCTTACCGTTGCGACCCCA Ruprechtia_tangarana_wetamaz ??????????????????????GGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGAGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAACAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATACAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTTTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGGATGCTGCGACGATTGGTGGTTTGACGCACGACTCCACGAGCTTCGGCTTATGGCATCGTGAGGCATCGCGTCGCTTGCCCAAACGGACCACGGAAAGCTCGAAGGACCCTAAGGAAGGAGAGGGGCATCCCATCGGGGATCCCGTGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_tenuiflora_1_wetamaz TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTTGGGGGCCGATGGGTGGGGGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATACAACAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGGATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAACGGACCACGTAAAGCTCGAAGGACCCTAAGGAGGAAGAGCGGCATCCCATCGGGGATCCCGTGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_tenuiflora_2_wetamaz TTTATCACCCTCAGGGAGGCAGGGCTAGCCTCTGCCCCTTGAAACCGGCGTGTTCCTTCCCCATCTCCCCCGTCGGGGGCCGATGGGTGGGGGCGTGTCGGCCGTACCCTAACACCGGCGCGGGTTGCGCCAAGGACCAATAATTCTATCGCTTCCCGCCTCCCTTGGGCGACCGGGGAGTCGGCGACGGCGTGTCGATATACAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCTCCTCCATCTAGGACAGGGAGAGGGGCGGATTCTGGCCCCCCGTGTGCCCTGCGCGCGGTCGGCCTAAATACGGAGCCC-GTGGCCGCGGATGCTGCGACGATTGGTGGTTTGACGCACGATTCCACGAGCTTCGGTTTGTGGCATCGTGAGGCATCGCGTCGCTTGCCCAAACGGACCACGTAAAGCTCGAAGGACCCTAAGGAAGAAGAGCGGCATCCCATCGGGGATCCCGTGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_triflora_1_chaco TTTATCAACCTCGGGGAGGCAGGGCTCGTCCCTGTCCCTCGAAACCGGCGTGTTCCTTCCCCATCTCCCTTGCAAGGGGGCGATGGGTGGGAGCACGTCGGC-GTACCCCAACACCGGCGCGGGTTGCGCCAAGGACCAACAATTCTATCGCGTCCCGCCTCCCTCGGGCGACCGGGGGGTCGGCGATGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCACCCCATCTGGGACTGG-AGAGGGGCGGATTCTGGCCCCCCGTGTGCCCCGCGCGCGGTCGGCCTAAATACGGAGCCTGGCGGCCGCAAATGCCGCGACGATTGGTGGTT--------------------------------------GAAGCATCGCGTCGCGTGCTCGAGCGGACTACCCAGAGCTCGGAGGACCCTAAGGAAGGAGAGGGGCGTG----------TCCCGGGATCCA-CCCTAACCGTTGCGACCCCA Ruprechtia_triflora_2_chaco TTTATAAACCTCGGGGAGGCAGGGCTCGTCCCTGTCCCTCGAAACCGGCGTGTTCCTTCCCCATCTCCCTTGCAAGGGGGCGATGGGTGGGAGCACGTCGGC-GTACCCCAACACCGGCGCGGGTTGCGCCAAGGACCAACAATTCTATCGCGTCCCGCCTCCCTCGGGCGACCGGGGGGTCGGCGATGGCGTGTCGATATATAACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG{CT}GTCGCCCCCTCCCACCCCATCTGGGACTGG-AGAGGGGCGGATTCTGGCCCCCCGTGTGCCCCGCGCGCGGTCGGCCTAAATACGGAGCCT-GCGGCCGCAAATGCCGCGACGATTGGTGGTT--------------------------------------GAAGCATCGCGTCGCGTGCTCGAGCGGACTACCCAGAGCTCGGAGGACCCTAAGGAAGGAGAGGGGCGTG----------TCCCGGGATCCA-CCCTAACCGTTGCGACCCCA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Ruprechtia) = N: 1-649; CODONPOSSET CodonPositions (CHARACTERS = Ruprechtia) = N: 1-649; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M635] TITLE Loxopterygium; LINK TAXA = Taxa2; DIMENSIONS NCHAR=659; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cardenasiodendron_brachypterum GAACCCGTATCTCAACGCCGGGGGCCTGCGGGCCTCGCGCCCGTGCGCCCCCGCCCGCCCCGCGTC---GGGTGTCGG---------ACGTTCGCTCCCGCGTGCCTCCGCCCCCTC-GCGG-CGC-TTCAACGAACCCCGGCGCGAATCGCGCCAAGGAAA-TCTTAAC--GAGAGGGCCCGCCCCCGT-CGCCCCGGACAC--GGGACGCGCGCGGGACGCGTGGCC-TTCTTT--CATTAT--CTATAACGACTCTCGGCAAC-GGATATCTCGGCTCTCGCATCGATTAAAAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGA-GTCTTTGAACGCAAGTTGCGCCCCAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGCCCCCCTCCC--GGATCCTTC--------GATCGCGCGGCTGT-GGGCGGAAGATGGCCTCCCGTGTGCGTGCGCACGCGGTTGGCCCAAACA-CGAGTCCTCGGCGACGCGTCCC-GCGACGATCGGTGGCGTTT-GAAACACGACCTAGTGATCCCGTCGCGCGGTCG-CGTCCTCCCCGGT----GCGGACTCCCCGACCCTCGAGAGCGGG-CGAGAGCCCGCTCGCGTCGCGA Loxopterygium_grisebachii GAACAAGTTCCT-AACACGGGGGGCCCGAGGGCCTCG?G???GAGTGCCCCCGCCCGCCCCGCGTC---GGG?GT?G?CGCGCGCGCGCCCCCGCGTGCGTGCGTGTCCGCGCCCTCCGCGGGTGCGTT-AACGAACCCCGGCGCGAATCGCGTCAAGGAAAATCTATAC--GGGAGAGCCTGCCCCCGTTCGCCCCGGACACACGGCGCGCGATCGGGACGCAAGGCC-TTCTTT--CACGGT--CTATAACGACTCTCGGCAAC-GGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGA-GTCTTTGAACGCAAGTTGCGCCCCAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAT?GTCGCCCCCCTCCCGCGT-CCCT?TCAA?TGAGGA-CCGGCGG-AGTCGGGCGGAGAATGGCCTCCCGTGCGCTCGCGCGCGCGGTTGGCCCAAACACGGAGCCCTGGGCGAAGCCCCCC-GCGACAATCGGTGGCGTTT-GAAACAGAACCTAGTGATCCCGTCGCGCGGGCGGCTTCTTCCCTTCT-AACAAAGACTCCTCGACCCTCGGGAGCCGGTCCCCGGACGGCTCGCATCG?GA Loxopterygium_huasango_137 GAACCAGTTCCG-AACACAGGGGGCCCGAGGGCCTCGCGCCCGAGTGCCCCCGCCCGCCCCGCGTC---GGGCGTCGG---------CCGCGCGC-TCCGCGTGCGTCCGCCCCCTCCGCGGGTGCGTT-AACGAACCCCGGCGCGAATCGCGTCAAGGAAA-TCTATAC--GGGAGAGCCTGCCCCCGT-CGCCCCGGACAC--GGCGTGCGATCGGGACGCAAGGCC-TTCTTT--CACAGT--CTATAACGACTCTCGGCAAC-GGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGA-GTCTTTGAACGCAAGTTGCGCCCCAAGCCATTA??CCGAGGGCACGTCTGC-TGGGTGTCACGCATCGTCGCCCCCCTCCCACGG-CCCTTTTGATCAAGGA-CCGGCGG-AGTCGGGCGGAGAATGGCCTCCCGTGCGCTCGCGTGCGCGGTTGGCCCAAACACGGAGTCCTGGGCGACGCCCCCC-GCGACAATCGGTGGCGTTC-GAAACAGAACCTAGTGATCCCGTCGCGCGGTCG-CGTCCGCCCTTCTGAAGAGAGACTCCTCGACCCTCGGGAGCCGATCCTCGGACGGC----------- Loxopterygium_huasango_138 GAACCAGTTCCG-AACACAGGGGGCCCGAGGGCCTCGCGCCCGAGTGCCCCCGCCCGCCCCGCGTC---GGGCGTCGG---------?CG?GCGC-T?CGAGTGCGT?CG?CCCCTCCGCGGGTGCGTT-AACGAACCCC?GCGCGAAT?GCGTCAAGGAAA-TCTATAC--GGGAGAGCCTGCCCCCGT-CGCCCCGGACAC--GGCGTGCGATCGGGACGCAAGGCC-TTCTTT--CACAGT--CTATAACGACTCTCGGCAAC-GGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGA-GTCTTTGAAC?CA?GTTGCGCCCCAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGCCCCCCTCCCACGG-CCCTTTTGATCAAGGA-CCGGCGG-AGTCGGGCGGAGAATGGCCTCCCGTGCGCTCGCGTGCGCGGTTGGCCCAAACACGGAGTCCTGGGCGACGCCCCCC-GCGACAATCGGTGGCGTTC-GAAACAGAACCTAGTGATCCCGTCGCGCGGTCG-CGTCCGCCCTTCTGAAGAGAGACTCCTCGACCCTCGGGAGCCGATCCTCGGACGGCTCGCATCGCGA Loxopterygium_sagotii GAAC{CT}AGT{GT}TAT-{AT}AC{AC}C{CT}GGG{GT}GCCCGCGGGCCTTGCGCCCGCGTGCCC?CGC{CG}?GC???GCGTT---???CGTCGG---------CCGCGCGCG-CCGCC{AG}??GGG?GG??CC????CGGGTGC?TT-AACAAACCC{CG}GGCGGGAATGG????-AGGA{AC}AAT?????C--?ATCGA??CGG?CCCC?TT?GCCC????AA?--GG?GGGTGCGCGGGAAGCCTG----?TC?TTT?CA?TAC--CTAT?ACGACTCTG{AG}G?TAC-GGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGA-GTCTTTGAACGCAAGTTGCGCCCCAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCCCTCCCGC--ATCCCCC------GGGATCCCGCGG-AGGGGGGCGGAGAATGGCCTCCCGTGTGCGCGGTCACGCGGCAGGCCCAAACACCGAGCCCCGGGCGACGCCCCGC-GCGACAATCGGTGGCGTTT-GAAACAGAACCTAGTGATCCTGTCGCGCGGTAG-CGTTCTCCCCCCC----ACGGGCTCCTCGACCCTCGGGAGCCGGTCCACGGCCGGCTCGCATCGCGA Loxostylis_alata GAACTTGT-CTT-AACACCGGGGGCCTGCGCGCCTCGTGCCCGTGCGCTCCCACCC-CGCGTCGCGTC-GGGTGTCGC---------TCGTACGCCTGTGCGTGCGTTCGCCCCCTT-GCGACGCG-TT-AACGAACCCCGGCGCGAATTGCGCCAAGGAAA-TCTCAAC--GAGAGAGCTCGCTCCCGT-CGCCCCGGACAC--GGCGTTCGTGCGGGATGCGTGGCC-TTCTTT--CATTATATCTATAACGACTCTCGGCAAC-GGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGA-GTCTTTGAACGCAAGTTGCGCCCCAAGCCGTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCCCTCCCAAA-ATCCTGT-GATC----TT-GTGTGG--GGCGGGCGGAAAATGGCCTCCCGTGTGCCTGCGCACGTGGTTGGCCCAAA-TCTGAGTTCTCGGTGACGCTTCCC-GCGACAATCGGTGGTGTTT-GAAACATAACCTAGTGATCCTGTTGTGCGGTTG-CGTCCTCCCGTGT----ACGGACTCTTCGACCCTCGGGAGTTGG-CGAAAGCTGGCTCGCACCGCGA Schinopsis_brasiliensis GAACTTGTGTTT-AACACCGGGGGCCTGCGGGCCTCGTGCCCGTGCGCTCTCGATCGCTCCGCGTC---GGGCGTCGG---------TCGCACGCTCTCGCGTGCGTCCTCCCCGTC-GTGG-TGCATT-AACGAACCCCGGCGCGAATCGCGCCAAGGAAA-TCTTAAC--GAGAGAGCTCGCTCCCGT-CGCCCCGAACAC--GGTGCGCGCGCGGGACGCGCGGCC-TTCTTT--CATTAT--CTATAACGACTCTCGGCAAC-GGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGA-GTCTTTGAACGCAAGTTGCGCCCCAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCC-TCCCAC---?TCTTA?-------GATCCTGTGG-AGGCGGGCGGAAAATGGCCTCCCGTGTGCACCCGCATGCGGTTGGCCCAAA-TCCGAGTTCTCGGTGACGCTTCCC-GCGACAATCGGTGGTGCTTCGAAACAGAACCTAGTGATCCTGTCGCGCGGTCG-CGTCCTCCCGTCT----ACGGACTCCTCGACCCTTCCGAGGCGA-CGAGAGTCGTCTCGCATCGCGA Schinus_areira -----------------------------------------------------------CCTCGTT---GGGTGTCGG---------TCGTGCGTTTCGGCGCGCGTCCGCCCCCATCGCGG-CGCATT-AACGAACCCCGGCGCGAATTGCGCCAAGGAAT-TCTCAAC--GAGAGAGCTCGCTCCCGT-CGCCCCGGACAC--GGTGTGCGTGCGGGATGCGTTGCC-TTCTTT--CATTAT--CTATAACGACTCTCGGCAAC-GGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATTCTTTGA?CGCAAGTTGCGCCCTAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCC-TCCC-CAGATCCTAT--------GATCTCGCGGGAGGCGGGCGGAGAATGGCCTCCCGTGTGCCTGCGCGCGCGGTTGGCCCAAA-TCCGAGTCCTCGGTGACGCTTCCC-GCGACAATCGGTGGCGTTTTGAAAAAGAACCTAGTGATCCTGTCGCGCGGTTG-CGCTCTCCGGCCT----ACGGACCCCTCGACCCTTGAGGGCGGG-CGAAAGCTCGCTCGCATCGCGA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Loxopterygium) = N: 1-659; CODONPOSSET CodonPositions (CHARACTERS = Loxopterygium) = N: 1-659; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M636] TITLE Chaetocalyx_&_Nissolia; LINK TAXA = Taxa4; DIMENSIONS NCHAR=354; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Chaetocalyx_blanchetiana TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCAAGGGCACGCCTGCCTGGGTGTCACCGATCGTTTCCGCC--CCC-CAAACCCCTCCGCGCGACGGGGAGGGG--CGCACGC---TGGCCTCCCGCGAGCCT-CGCCCCGCGGTTGGCTGAAAATCGGGTCCGTGGCCGAGCGCAGCGCCGCGACACGTGGTGGTTGAGCG-AAA--TCTCGAGGCCTCGTCGCGCGCGTGCCTCCGCCGTGTCCGGACCCCGTGACCCGTGAGCGCCAGAGAG---CGCCCGTGATGCGACCTCAGGTCAGGCGG Chaetocalyx_brasiliensis_744_.2_3 TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCCCAACCC-CCGGCGCCCCAGGGCAACGGGGAGGGG--CACATGA---TGGCCTCCCGTGAGCCT-TGCCTCGCGGCTGGCTGAAAATCGGGTTCGTGGCCGAGCGCAGCGTCGCGACACATGGTGGTTGAGCG-AAA--TCTCGAGGCCTTGCCGCGCGCCCGCCTCAGCCGTGCCCGGACCCCGTGACCCGTGAGTGCCAAAGCA---TGCTCGTGTTGCGACCTCAGGTCAGGCGG Chaetocalyx_brasiliensis_768_.2_3 TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCCCAACCC-CCGGCGCCCCAGGGCAACGGGGAGGGG--CACATGA---TGGCCTCCCGTGAGCCT-TGCCTCGCGGCTGGCTGAAAATCGGGTTCGTGGCCGAGCGCAGCGTCGCGACACATGGTGGTTGAGCG-AAA--CCTCGAGGCCTTGCCGCGCGCCCGCCTCAGCCGTGTCCGGACCCCGTGACCCGTGAGTGCCAAAGCA---TGCTCGTGTTGCGACCTCAGGTCAGGCGG Chaetocalyx_brasiliensis_912_.2_3 TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCCCAACCC-CCGGCGCCCCAGGGCAACGGGGAGGGG--CACATGA---TGGCCTCCCGTGAGCCT-TGCCTCGCGGCTGGCTGAAAATCGGGTTCGTGGCCGAGCGCAGCGTCGCGACACATGGTGGTTGAGCG-AAA--CCTCGAGGCCTTGCCGCGCGCCCGCCTCAGCCGTGTCCGGACCCCGTGACCCGTGAGTGCCAAAGCA---TGCTCGTGTTGCGACCTCAGGTCAGGCGG Chaetocalyx_brasiliensis_913_.2_3 TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACCAATGCTTTCCCCCAACCC-CCGGCGCCCCAGGGCAACGGGGAGGGG--CACATGA---TGGCCTCCCGTGAGCCT-TGCCTCGCGGCTGGCTGAAAATCGGGTTCGTGGCCGAGCGCAGCGTCGCGACACATGGTGGTTGAGCG-AAA--TCTCGAGGCCTTGCCGCGCGCCCGCCTCAGCCGTGTCCGGACCCCGTGACCCGTGAGTGCCAAAGCA---TGCTCGTGTTGCGACCTCAGGTCAGGCGG Chaetocalyx_glaziovii TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCCCAACCC-CCGGCGCCCCAAGGCAACGGGGAGGGG--CACATGA---TGGCCTCCCGCGAGCTT-GGCCTCGCGGCTGGCTGAAAATCGGGTTTGTGGCCGAGCGCAGCGTCGCGACACATGGTGGTTGGGCG-AAA--TCTCGAGGCCTTGCTGTGCGCGTGCCTCTGCCATGTCCAGACCTTGTGACCCGTGAGCACCAAAGCA---TGCTTGTGATGCGACCTCAGGTCAGGCGG Chaetocalyx_klugii_741_wetamaz TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCTGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCCCAACCCCTCGGCGCCCCAGGGCAACGGGGAGGGG--CACATGA---TGGCCTCCCGTGAGCCT-TGCCTCGCGGCTGGCTGAAAATCGGGTTCGTGGCTGAGCGCAGCGTTGCGACACATGGTGGTTGAGCG-AAA--TCTCGAGGCCTTGCCGCGCGCTCGCCTTTGCCGTGTCCGGACCCTATGACCCGTGAGCGCCAAAGCA---TGCTCCTGATGCGACCTCAGGTCAGGCGG Chaetocalyx_klugii_746_wetamaz TGCGATGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCTGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCCCAACCCCTCGGCGCCCCAGGGCAACGGGGAGGGG--CACATGA---TGGCCTCCCGTGAGCCT-TGCCTCGCGGCTGGCTGAAAATCGGGTTCGTGGCTGAGCGCAGCGTTGCGACACATGGTGGTTGAGCG-AAA--TCTCGAGGCCTTGCCGCGCGCTCGCCTTTGCCGTGTCCGGACCCTATGACCCGTGAGCGCCAAAGCA---TGCTCGTGATGCGACCTCAGGTCAGGCGG Chaetocalyx_latisiliqua_745_.5._wetmes TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCC-AACCC--CGGCGCCCCAGGGCAACGGGGAGGGGG-CACATGC---TGGCCTCCCGCGAGCTT-GGCCCCGCGGTTGGCTGAAAATTGGGCTCG-GGCCGAGCGTAGCGCG-CGACA-ATGGTGGTTGAGCG-AAA--TCTAGAGGCCTCGTCGTGCGCACGCCTCTGCCGTGTTCGGACCCCGTGACCCGTGAGCACCGAACCG---CGCTCGTGAAGCGACCTCAGGTCAGGCGG Chaetocalyx_latisiliqua_890_.5._wetmes ??CGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCC-AACCC--CGGCGCCCCAGGGCAACGGGGAGGGGG-GAGATGC---TGGCCTCCCGCGAGCTT-GGCCCCGCGGTTGGCTGAAAATTGGGCTCG-GGCCGAGCGTAGCGCG-CGACA-ATGGTGGTTGAGCG-AAA--TCTAGAGGCCTCGTCGTGCGCACGCCTCTGCCGTGTTCGGACCCCGTGACCCGTGAGCACCGAACCG---CGCTCGTGAAGCGACCTCAGGTCAGGCGG Chaetocalyx_latisiliqua_891_.5._wetmes TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCC-AACCC--CGGCGCCCCAGGGCAACGGGGAGGGGG-CACATGC---TGGCCTCCCGCGAGCTT-GGCCCCGCGGTTGGCTGAAAATTGGGCTCG-GGCCGAGCGTAGCGCG-CGACA-ATGGTGGTTGAGCG-AAA--TCTAGAGGCCTCGTCGTGCGCACGCCTCTGCCGTGTTCGGACCCCGTGACCCGTGAGCACCGAACCA---CGCTCGTGAAGCGACCTCAGGTCAGGCGG Chaetocalyx_longiflora_902_wetatl TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCCCAACCC-CCGGCGCCCCAGGGCAACGGGGAGGGG--CACATGA---TGGCCTCCCGTGAGCCT-TGCCTCGCGGCTGGCTGAAAATCGGGTTCGTGGCCGAGCGCAGCGTCGCGACACATGGTGGTTGAGCG-AAA--CCTCGAGGCCTTGCCGCGCGCCCGCCTCAGCCGTGTCCGGACCCCGTGACCCGTGAGTGCCAAAGCA---TGCTCGTGTTGCGACCTCAGGTCAGGCGG Chaetocalyx_longiflora_903_wetatl TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCCCAACCC-CCGGCGCCCCAGGGCAACGGGGAGGGG--CACATGA---TGGCCTCCCGTGAGCCT-TGCCTCGCGGCTGGCTGAAAATCGGGTTCGTGGCCGAGCGCAGCGTCGCGACACATGGTGGTTGAGCG-AAA--CCTCGAGGCCTTGCCGCGCGCCCGCCTCAGCCGTGTCCGGACCCCGTGACCCGTGAGTGCCAAAGCA---TGCTCGTGTTGCGACCTCAGGTCAGGCGG Chaetocalyx_longiflora_906_wetatl TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCCCAACCC-CCGGCGCCCCAGGCCAACGGGGAGGGG--CACATGA---TGGCCTCCCGCGAGCTT-GGCCTCGCGGCTGGCTGAAAATCGGGTTTGTGGCCTAGCGCAGCGTCGCGACACATGGTGGTTGGGCG-AAA--TCTCGAGGCCTTGCTGTGCGCGTGCCTCTGCCATGTCCAGACCTTGTGACCCGTGAGCACCAAAGCA---TGCTTGTGATGCGACCTCAGGTCAGGCGG Chaetocalyx_longiflora_944_wetatl TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCCCAACCC-CCGGCGCCCCAGGGCAACGGGGAGGGG--CACATGA---TGGCCTCCCGTGAGCCT-TGCCTCGCGGCTGGCTGAAAATCGGGTTCGTGGCCGAGCG?AGCGTCGCGACACATGGTGGTTGAGCG-AAA--CCTCGAGGCCTTGCCGCGCGCCCGCCTCAGCCGTCTCCGGACCCCGTGACCCGTGAGTGCCAAAGCA---TGCTCGTGTTGCGACCTCAGGTCAGGCGG Chaetocalyx_nigricans TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTAAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCCCAACCC-CCGGCGCCCCAGGGCAACGGGGAGGGG--CACATGA---TGGCCTCCCGTGAGCCT-TGCCTCGCGGCTGGCTGAAAATCGGGTTCGTGGCCGAGCGCAGCGTCGTGACACATGGTGGTTGAGCG-AAA--TCCCTCGGCCTTGCCGCGTGCGTGCCTCTGCCGT----GGACCCCGTGACCCGTGAGTGCCAAAGCG---TGCTCGTGATGCGACCTCAGGTCAGGCGG Chaetocalyx_scandens_666_.7_8_9 TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACCAATCGTTTCCCCCAACCC-TCGGTGCCCCAGGGCAACGAGTAGGGA--CACATGA--ATGGCCTCCCGCGAGCCTTGGCCTCGCGGCTGGCTGAAAATCGGGTTCGTGGCCGAGCGCAGCGTCGCGACACATGGTGGTTGAGCA-AAA--TCTCGAGGCCTCGCCGCGCGCGCGCCTTTGCCATGTCCGGACCCTATGACCCGTGAGCGCCAAAGCA---TGCTCGTGATGCGACCTCAGGTCAGGCGG Chaetocalyx_scandens_900_.7 TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGA????????????????????????????????????????????????????????????????????TTTCCCCCAACCC-CCGGTGCCCCAGGGCAACGGGGAGGGA--CACATGA---TGGCCTCCCGTGAGCCT-TGCCTCGCGGCTGGCTGAAAATCGGGTTCGTGGCCGAGCGCAGCGTCGCGACACATGGTGGTTGAGCG-AAA--TCTCGAGGCCTCGCCGCGCGCGCGCCTTTGCCGTGTCCGGACCCTATGACCCGTGAGCGCCAAAGCA---TGCTCGTGATGCGACCTCAGGTCAGGCGG Chaetocalyx_scandens_901_.7 TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTT?????????????????????????????????????????????????????????????GTTTCCCCCAACCC-TCGGTGCCCCAGGGCAACGAGGAGGGA--CACATGA---TGGCCTCCCGCGAGCCT-TGCCTCGCGGCTGGCTGAAAATCGGGTTCGTGGCCGAGCGCAGCGTCGCGACACATGGTGGTTGAGCA-AAA--TCTCGAGGCCTCGCCGCGCGCGCGCCTTTGCCATGTCCGGACCCTATGACCCGTGAGCGCCAAAGCA---TGCTCGTGATGCGACCTCAGGTCAGGCGG Nissolia_diversifolia TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCCCAGCCC-CCGGCGCCCCAGGGCGACGGGGAAGGGG-CACATGA---TGGCCTCCCGCGAGCCT-CGCCCCGCGGCTGGCTGAAAATCGGGTCCGTGGCCGAGCGCAGCGCCGCGACACATGGTGGTTGAGCG-AAA--TCTCGAGGCCTCGCCGCGCGCGCGCCTCGGCCGTGTCCGGACCCCGTGACCCGTGAGCGCCAAAGCA---CGCTCGTGATGCGACCTCAGGTCAGGCGG Nissolia_gentryi TGCGATACAAGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGCCTCCCTGGGTGTCACCAATCGTTTCCCCCAACCC-CCGGCGCCGCAGGGCGACGGGGAAGGGG-CACATGA---TGGCCTCCCGCGAGCCC-CGCCCCGCGGCTGGCTGAAAATCGGGTCCGTGGCCGAGCGCAGCGCCGCGGCACATGGTGGTTGAGCG-AAA--TCTCGAGGCCTCGCCGCGCGCGCGCCCCGGCCGTGTCTGGACCCCGTGACCCGTGAGCGCCAAAGCA---CGCTCGTGATGCGACCTCAGGTCAGGCGG Nissolia_hirsuta_466_.8 TGCGATACAAGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCC-AGCCC-CCGGCGCCCCAGGGCGACGGGGAAGGGG-CACATGA---TGGCCTCCCGCGAGCCT-CGCCCCGCGGCTGGCTGAAAATCGGGTCCGTGGCCGAGCGCAGCGCCGCGACACATGGTGGTTGAGCG-AAA--TCTCGAGGCCTCGCCGCGCGCGCGCCTCGGCCGTGTCCGGACCCCGTGACCCGTGAGCGCCAAAGCA---CGCTCGTGATGCGACCTCAGGTCAGGCGG Nissolia_hirsuta_774_.8 TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCC-AGCCC-CCGGCGCCCCAGGGCGACGGGGAAGGGG-CACATGA---TGGCCTCCCGCGAGCCT-CGCCCCGCGGCTGGCTGAAAATCGGGTCCGTGGCCGAGCGCAGCGCCGCGACACATGGTGGTTGAGCG-AAA--TCTCGAGGCCTCGCCGCGCGCGCGCCTCGGCCGTGTCCGGACCCCGTGACCCGTGAGCGCCAAAGCA---CGCTCGTGATGCGACCTCAGGTCAGGCGG Nissolia_leiogyne_776_.8 TGCGACACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGCCTGCCTGGGTGTCACCAGTCGTTTCCCCCAACCC-CCGGCGCCCCAGGGCGACGGGGAAGGGGC-ACATGATGATGGCCTCCCGCGAGCCT-CGCCCCGCGGCTGGCTGAAAATCGGGTCCGTGGCCGAGCGCAGCGCCGCGACACGTGGTGGTTGAGCG-AAA--TCTCGAGGCCTCGCCGCGCGCGCGCCTCGGCCGTGTCCGGACCCCGTGACCCGTGAGCGCCAAAGCA---CGCTCGTGATGCGACCTCAGGTCAGGCGG Nissolia_leiogyne_780_.8 T?CGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCC?GAA?CCATTCGGCCGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCCCAGCCC-CCGGCGCCCCAGGGCGACGGGGAAGGGGGCACATGA---TGGCCTCCCGCGAGCCT-CGCCCCGCGGCTGGCTGAAAATCGGGTCCGTGGCCGAGCGCAG?GCCGCGACACATGGTGGTTGAGCG-AAA--TCTCGAGGCCTCGCCGCGCGCGCGCCCCGGCCGTGTCCGGACCCCGCGACCCGTGAGCGCCAAAGCA---CGCTCGTGATGCGACCTCAGGTCAGGCGG Nissolia_microptera TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCC-AGCCC-CCGGCGCCCCAGGGCGACGGGGAAGGGG-CACATGA---TGGCCTCCCGCGAGCCT-CGCCCCGCGGCTGGCTGAAAATCGGGTCCGTGGCCGAGCGCAGCGCCGCGACACATGGTGGTTGAGCG-AAA--TCTCGAGGCCTCGCCGCGCGCGCGCCTCGGCCGTGTCCGGACCCCGTGACCCGTGAGCGCCAAAGCA---CGCTCGTGATGCGACCTCAGGTCAGGCGG Nissolia_platycalyx_467_mexdesert TGCGATACAAGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCCCAACCC-CCGGCGCCCCAGGGCGACGGGGAAGGGG-CACATGA---TGGCCTCCCGCGAGCCT-CGCCCCGCGGCTGGCTGAAAATCGGGTCCGTGGCCGAGCGCAGCGCCGCGACACGTGGTGGTTGAGCG-AAA--TCTCGAGGCCTCGCCGCGCGCGCGCCTCGGCCGTGTCCGGACCCCGTGACCCGTGAGCGCCAAAGCA---CGCTCGTGATGCGACCTCAGGTCAGGCGG Nissolia_platycalyx_779_mexdesert TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGCCTGCCTGGGTGTCACCAATCGTTTCCCCCAACCC-CCGGCGCCCCAGGGCGACGGGGAAGGGG-CACATGA---TGGCCTCCCGCGAGCCT-CGCCCCGCGGCTGGCTGAAAATCGGGTCCGTGGCCGAGCGCAGCGCCGCGACACGTGGTGGTTGAGCG-AAA--TCTCGAGGCCTCGCCGCGCGCGCGCCTCGGCCGTGTCCGGACCCCGTGACCCGTGAGCGCCAAAGCA---CGCTCGTGATGCGACCTCAGGTCAGGCGG Nissolia_shottii TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGCCTGCCTGGGCGTCACCAGTCGTTTCCCCCAACCC-CCGGCGCCCCAGGGCGACGGGGAAGGGG-CACATGA---TGGCCTCCCGCGAGCCT-CGCCCCGCGGCTGGCTGAAAATCGGGTCCGTGGCCGAGCGCAGCGCCGCGACACGTGGTGGTTGAGCG-AAATCTCTCGAGGCCTCGCCGCGCGCGCGCCTCGGCCGTGTCCGGACCCCGTGACCCGTGAGCGCCAAAGCA---CGCTCGTGATGCGACCTCAGGTCAGGCGG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Chaetocalyx_&_Nissolia) = N: 1-354; CODONPOSSET CodonPositions (CHARACTERS = Chaetocalyx_&_Nissolia) = N: 1-354; END; BEGIN TREES; TITLE Tb6584; LINK TAXA = Taxa1; TRANSLATE 1 Ruprechtia_triflora_2_chaco, 2 Ruprechtia_triflora_1_chaco, 3 Ruprechtia_tenuiflora_2_wetamaz, 4 Ruprechtia_tenuiflora_1_wetamaz, 5 Ruprechtia_tangarana_wetamaz, 6 Ruprechtia_ramiflora_6_.7._wetamaz_wetmeso, 7 Ruprechtia_ramiflora_5_.7._wetamaz_wetmeso, 8 Ruprechtia_ramiflora_4_.7._wetamaz_wetmeso, 9 Ruprechtia_ramiflora_3_.7._wetamaz_wetmeso, 10 Ruprechtia_ramiflora_2_.7._wetamaz_wetmeso, 11 Ruprechtia_ramiflora_1_.7._wetamaz_wetmeso, 12 Ruprechtia_pallida_.8, 13 Ruprechtia_laxiflora_.1._.2._.3, 14 Ruprechtia_laevigata_4_.8, 15 Ruprechtia_laevigata_3_.8, 16 Ruprechtia_laevigata_2_.8, 17 Ruprechtia_laevigata_1_.8, 18 Ruprechtia_fusca_4_.8, 19 Ruprechtia_fusca_3_.8, 20 Ruprechtia_fusca_2_.8, 21 Ruprechtia_fusca_1_.8, 22 Ruprechtia_fagifolia, 23 Ruprechtia_curranii, 24 Ruprechtia_cruegerii_2_wetamaz, 25 Ruprechtia_cruegerii_1_wetamaz, 26 Ruprechtia_costaricensis, 27 Ruprechtia_chiapensis, 28 Ruprechtia_carina, 29 Ruprechtia_brachysepala, 30 Ruprechtia_apurensis, 31 Ruprechtia_apetala_3_.3._chaco, 32 Ruprechtia_apetala_2_.3._chaco, 33 Ruprechtia_apetala_1_.3._chaco, 34 Ruprechtia_aperta_3_.5, 35 Ruprechtia_aperta_2_.4, 36 Ruprechtia_aperta_1_.4, 37 Ruprechtia_albida_2_.4, 38 Ruprechtia_albida_1_.4; TREE Fig._8 = [&R] (((((((25,24),(29,5)),(11,23,7,10,8,6,9),((4,30),3),28,12,18,14,15,27,17,16,26,(21,19,20)),13,22),((36,35,37,38),34)),(33,32,31)),(2,1)); END; BEGIN TREES; TITLE Tb6585; LINK TAXA = Taxa4; TRANSLATE 1 Nissolia_platycalyx_779_mexdesert, 2 Nissolia_platycalyx_467_mexdesert, 3 Nissolia_microptera, 4 Nissolia_leiogyne_780_.8, 5 Nissolia_leiogyne_776_.8, 6 Nissolia_hirsuta_774_.8, 7 Nissolia_hirsuta_466_.8, 8 Nissolia_gentryi, 9 Nissolia_diversifolia, 10 Chaetocalyx_scandens_901_.7, 11 Chaetocalyx_scandens_900_.7, 12 Chaetocalyx_scandens_666_.7_8_9, 13 Chaetocalyx_nigricans, 14 Chaetocalyx_longiflora_944_wetatl, 15 Chaetocalyx_longiflora_906_wetatl, 16 Chaetocalyx_longiflora_903_wetatl, 17 Chaetocalyx_longiflora_902_wetatl, 18 Chaetocalyx_latisiliqua_891_.5._wetmes, 19 Chaetocalyx_latisiliqua_890_.5._wetmes, 20 Chaetocalyx_latisiliqua_745_.5._wetmes, 21 Chaetocalyx_klugii_746_wetamaz, 22 Chaetocalyx_klugii_741_wetamaz, 23 Chaetocalyx_glaziovii, 24 Chaetocalyx_brasiliensis_913_.2_3, 25 Chaetocalyx_brasiliensis_912_.2_3, 26 Chaetocalyx_brasiliensis_768_.2_3, 27 Chaetocalyx_brasiliensis_744_.2_3, 28 Chaetocalyx_blanchetiana, 29 Nissolia_shottii; TREE Fig._9 = [&R] ((((((((26,16,17,14,25),27,24),13),((22,21),((12,10),11))),(15,23)),((((8,2),7),6,9,3,4),(1,(5,29)))),28),((20,19),18)); END; BEGIN TREES; TITLE Tb6586; LINK TAXA = Taxa2; TRANSLATE 1 Loxopterygium_sagotii, 2 Loxopterygium_huasango_138, 3 Loxopterygium_huasango_137, 4 Loxopterygium_grisebachii, 5 Schinus_areira, 6 Cardenasiodendron_brachypterum, 7 Schinopsis_brasiliensis, 8 Loxostylis_alata; TREE Fig._10 = [&R] (8,((7,(6,((4,(3,2)),1))),5)); END; BEGIN TREES; TITLE Tb6583; LINK TAXA = Taxa3; TRANSLATE 1 Poitea_immarginata, 2 Poitea_gracilis, 3 Poitea_glyciphylla, 4 Poitea_galegoides, 5 Poitea_florida, 6 Poitea_dubia, 7 Poitea_carinalis, 8 Poitea_campanilla, 9 Poissonia_weberbaueri_918, 10 Poissonia_weberbaueri_917, 11 Poissonia_orbicularis, 12 Poissonia_hypoleuca_5787, 13 Poissonia_hypoleuca_121088, 14 Sphinctospermum_5120, 15 Robinia_viscosa, 16 Robinia_pseudoacacia, 17 Robinia_neomexicana_717, 18 Robinia_neomexicana_190789, 19 Robinia_hispida, 20 Poitea_punicea, 21 Poitea_paucifolia, 22 Poitea_multiflora, 23 Poissonia_heterantha_5860, 24 Poissonia_heterantha_5832, 25 Peteria_thompsoniae_7048_2, 26 Peteria_thompsoniae_6157, 27 Peteria_scoparia, 28 Peteria_glandulosa, 29 Olneya_tesota, 30 Lennea_viridiflora, 31 Lennea_modesta, 32 Lennea_melanocarpa, 33 Hebestigma_cubense, 34 Gliricidia_sepium, 35 Gliricidia_robustum, 36 Gliricidia_maculata, 37 Gliricidia_ehrenbergii, 38 Gliricidia_brenningii, 39 Genistidium_dumosum, 40 Coursetia_vicioides, 41 Coursetia_rostrata_930, 42 Coursetia_rostrata_1062, 43 Coursetia_pumila, 44 Coursetia_polyphylla, 45 Coursetia_planipetiolata, 46 Coursetia_paniculata, 47 Coursetia_oaxacensis, 48 Coursetia_mollis_1048, 49 Coursetia_mollis_1039, 50 Coursetia_maraniona_948, 51 Coursetia_maraniona_745, 52 Coursetia_madrensis, 53 Coursetia_insomniifolia, 54 Coursetia_hintonii, 55 Coursetia_hidalgoana, 56 Coursetia_hassleri_6937, 57 Coursetia_hassleri_5805, 58 Coursetia_grandiflora, 59 Coursetia_gracilis, 60 Coursetia_glandulosa_5347, 61 Coursetia_glandulosa_4671, 62 Coursetia_glabella, 63 Coursetia_fruticosa, 64 Coursetia_ferruginea, 65 Coursetia_elliptica, 66 Coursetia_dubia, 67 Coursetia_chiapensis, 68 Coursetia_caribaea_tri_5189, 69 Coursetia_caribaea_och_1063, 70 Coursetia_caribaea_chi_4514, 71 Coursetia_caribaea_892, 72 Coursetia_caribaea_1064, 73 Coursetia_brachyrhachis, 74 Coursetia_axillaris, 75 Coursetia_andina; TREE Fig._7 = [&R] ((33,((31,32),30)),((((1,((4,8),(22,3))),((((5,20),7),(21,6)),2)),(((35,(36,34)),37),38)),(((((((65,(44,67)),((47,(52,45)),46)),((((64,(73,(63,(50,51)))),(((61,60),((((((43,55),62),68),(((72,71),75),70)),(57,(56,(49,48)))),69)),((66,58),59))),(40,(41,42))),54)),(74,53)),14),(39,((27,28),(25,26)))),(((((12,13),11),((23,24),(9,10))),(((19,15),16),(18,17))),29)))); END;