#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 19:43 GMT TreeBASE (cc) 1994-2008 Study reference: Ito Y., Ohi-toma T., Murata J., & Tanaka N. 2010. Hybridization and polyploidy of an aquatic plant, Ruppia (Ruppiaceae) inferred from plastid and nuclear DNA phylogenies. American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10485] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=14; TAXLABELS Potamogeton_maackianus_Pm052 Ruppia_maritima_ART01 Ruppia_maritima_DUB02 Ruppia_maritima_FAL01 Ruppia_maritima_MAR01 Ruppia_maritima_SKA02 Ruppia_maritima_UTA01 Ruppia_maritima_YHO01 Ruppia_megacarpa_MED01 Ruppia_polycarpa_DEV01 Ruppia_polycarpa_POB01 Ruppia_tuberosa_TUA01 Ruppia_tuberosa_TUE01 Syringodium_isoetifolium_Sis03 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=20; TAXLABELS Potamogeton_maackianus_Pm052 Ruppia_maritima_ANA01 Ruppia_maritima_DUB0201 Ruppia_maritima_DUB0202 Ruppia_maritima_FAL0111 Ruppia_maritima_FAL0113 Ruppia_maritima_GRA01 Ruppia_maritima_MAH02 Ruppia_maritima_MAR01 Ruppia_maritima_SKA0202 Ruppia_maritima_UTA01 Ruppia_maritima_YHO01 Ruppia_megacarpa_MED01 Ruppia_polycarpa_DEV01 Ruppia_polycarpa_POB01 Ruppia_tuberosa_TUA0100 Ruppia_tuberosa_TUA0114 Ruppia_tuberosa_TUE0101 Ruppia_tuberosa_TUE0102 Syringodium_isoetifolium_Sis03 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M5521] TITLE Ruppia_PhyB_38Fdw; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1050; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=- GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Potamogeton_maackianus_Pm052 AGGTTGCAGGCGCTGCCTGGTGGGGATATCAATCTTTTATGTGACACAGTTGTGGACCATGTTAGGGAACTCACAGGATATCACAGGGTCATGGTCTACAAGTTCCATGAGGATGAACATGGCGAGGTTGTTGCAGAGAGTAAAAGGGACGACTTAGAACCATATATGGGTCTTCACTACCCTGCCACAGATATACCCCAAGCCTCAAGATTCTTGTTCAAACAAAATAGAGTTAGGATGATAGCAGATTGTCGTGCAACCCCTGTTCGAGTCATACAAGATGAGAATCTGATGCAACCACTTTGCCTTGTGGGTTCCACTCTACGAGCTCCCCATGGTTGCCATGCACAGTATATGGCCAACATGGGATCAATTGCATCTCTTGCCATGGCTGTAATTATCAATGGAGGTGAAGAAGAGGGTACGAAGAACTCGATGAAGTTATGGGGTCTCGTTGTTTGTCACCACACTTCTCCGAGGTTCATACCCTTCCCATTGCGGTATGCATGCGAGTTCCTTATGCAGGCTTTTGGCCTTCAGTTGAATATGGAACTCCAGTTGGCCTCCCAAATGTCTGAGAAGCATATCTTGAGAACCCAGACCCTTTTGTGCGATATGATCCTTCGAGATTCACCTACTGGAATTGTCACACAAAGCCCTAGCATAATGGATCTTGTGAAGTGTGACGGCGCAGCGCTTTATTACCATGGAAAGTATTGGCCACTAGGTGTAACTCCTTCAGAATCACAAATTAAGGATATCGTGGAATGGCTGTTGGCAACCCACGGAGACTCCACAGGCCTGAGCACAGATAGTTTGGCTGATGCCGGATACCCTAGTGCTGCATCACTTGGTGATGCTGTTTGTGGTATGGCTGTGGCTTACATCACATCAAGAGATTTCTTGTTTTGGTTTAGATCCCACACAGCTAAAGAGGTTAAGTGGGGTGGTGCAAAACATCACCCTGAAGACAAGGATGATGGGCAGCGGATGCATCCTCGGACATCTTTTAATGCTTTCCTCGAAGTAGTGAAAAGTGAGAGCCTTCCG Ruppia_maritima_ANA01 CGTTTACAGGCTTTGCCGGGTGGGGATATTAAGTTCCTGTGTGACACGGTTGTTGACCATGTTAGGGAGCTCACTGGATATGACAGGGTTATGGTGTATAAATTCCATGAGGATGAGCATGGGGAAGTTCTCGCCGAGAGTAAAAGAAGTGACTTGGAACCCTATATAGGTCTCCATTACCCTGCCACAGACATACCCCAAGCCTCAAGGTTCTTGTTTAAACAGAACAGAGTTAGGATGATAGCTGACTGTCGTGCAACTCCAGTTAGCATGATACAAGATGAGAACCTGATGCAGCCGCTTTGCCTTGTAGGATCCACACTACGAGCTCCTCATGGCTGCCATGCACAATACATGGCTAACATGGGCTCAATTGCTTCTCTTGTCATGGCTGTTATCATCAATGGGGGTGAAGAAGACGGCACAAGGAACTCTATGAAGCTATGGGGCCTTGTTGTTTGCCACCATACTTCTCCCAGATGCATTCCATTTCCATTGCGCTATGCCTGTGAGTTCCTCATGCAGGCCCTAGGCCTTCAGCTTAATATGGAAGTTCAGTTGGCTGCCCAGATGTCTGAAAAGCACATATTGAGAACTCAAACCCTTCTATGTGATATGCTTCTTAGGGATTCTCCTACTGGAATTGTTACACAAAGTCCTAGTATAATGGACCTTGTGAAGTGTGATGGCGCGGCACTCTATTACCATGGTAAGTATTGGCCACTCGGTGTTGCCCCCTCCGAGGAAAAGATTAAAGATATTATCGGCTGGTTATTGGCAACTCATGGAGACTCCACAGGCTTGAGCACAGACAGTTTGGCGGATGCTAGCTACCCAGCTGCCGCTTCCCTTGGGGATGCAGTTTGTGGCATGGCAGTGGCATATATCACCTCAAGAGATTTTTTGTTTTGGTTTAGATCCCACACTGCAAAAGAAATAAAGTGGGGTGGTGCTAAACATCATCCTGAAGACAAGGATGATGGACAGCGTATGCATCCACGCACGTCTTTTAATGCCTTCCTGGAAGTTGTGAAGAGTAGGAGCCTTCCA Ruppia_maritima_DUB0201 CGTTTACAGGCTTTGCCGGGTGGGGATATTAAGTTTCTGTGTGACACGGTTGTTGACCATGTTAGGGAGCTCACTGGATATGACAGGGTTATGGTGTACAAGTTCCATGAGGATGAGCATGGGGAAGTTCTCGCCGAGAGTAAAAGAAGCGACTTGGAACCTTATATAGGTCTTCACTACCCTGCCACAGATATACCCCGAGCCTCAAGGTTCTTGTTTAAACAGAACAGAGTTAGAATGATAGCTGACTGTCGTGCAACGCCTGTTAGCATGATACAAGATGAGAACCTGATGCAGCCGCTTTGCCTTGTAGGATCCACACTACGAGCTCCTCATGGATGCCATGCGCAATACATGGCTAACATGGGCTCAGTTGCTTCTCTTGTCATGGCTGCTATCATCAATGGGGGCGAAGAAGACGGCACAAGGAACTCTATGAAGCTATGGGGCCTTGTTGTTTGCCACCATACTTCTCCCAGATGCATTCCATTTCCATTGCGCTATGCCTGTGAGTTCCTCATGCAGGCTCTAGGCCTTCAGCTTAATATGGAAGTTCAGTTGGCTGCCCAGATGTCTGAAAAGCACATATTAAGAACTCAAACCCTTCTATGTGATATGCTTCTTCGGGATTCTCCTACTGGAATTGTTACACAAAATCCTAGTATAATGGACCTTGTGAAGTGTGATGGTGCAGCGCTCTATTACCATGGTAAGTATTGGCCACTCGGTGTTGCCCCTTCCGAGGAAAAGATTAAAGATATTATTGGCTGGTTATTGGCAAGTCATGGAGACTCCACGGGCTTGAGCACGGACAGTTTGGCGGATGCTAGCTACCCGGCTGCCGCTTCACTTGGGGATGCAGTTTGTGGCATGGCAGTGGCATATATCACCTCAAGAGATTTTTTGTTTTGGTTTAGATCCCATACTGCAAAAGAAATAAAGTGGGGTGGTGCTAAACATCATCCGGAAGACAAGGACGATGGACAGCGTATGCATCCCCGCACATCGTTTAATGCCTTCCTGGAAGTTGTGAAGAGTAGGAGCCTTCCA Ruppia_maritima_DUB0202 CGTTTACAGGCTTTGCCGGGTGGGGATATTAAGTTTCTGTGTGACACGGTTGTTGACCATGTTAGGGAGCTCACTGGATATGATAGGGTTATGGTGTATAAATTCCATGAGGATGAGCATGGGGAAGTTCTCGCCGAGAGTAAAAGAAGTGACTTGGAACCCTATATAGGTCTCCATTACCCTGCCACAGACATACCCCAAGCCTCAAGGTTCTTGTTTAAACAGAACAGAGTTAGGATGATAGCTGACTGTCGTGCAACTGCAGTTAGCATGATACAAGATGAGAACCTGATGCAGCCGCTTTGCCTTGTAGGATCCACACTACGAGCTCCTCATGGCTGCCATGCACAATACATGGCTAACATGGGCTCAATTGCTTCTCTTGTCATGGCTGTTATCATCAATGGGGGTGAAGAAGACGGCACAAGGAACTCTATGAAGCTATGGGGCCTTGTTGTTTGCCACCATACTTCTCCCAGATGCATTCCATTTCCATTGCGCTATGCCTGTGAGTTCCTCATGCAGGCCCTAGGCCTTCAGCTTAATATGGAAGTTCAGTTGGCTGCCCAGATGTCTGAAAAGCACATATTGAGAACTCAAACCCTTCTATGTGATATGCTTCTTAGGGATTCTCCTACTGGAATTGTTACACAAAGTCCTAGTATAATGGACCTTGTGAAGTGTGATGGTGCGGCACTCTATTACCATGGTAAGTATTGGCCACTCGGTGTTGCCCCCTCCGAGGAAAAGATTAAAGATATTATCGGCTGGTTATTGGCAACTCATGGAGACTCCACAGGCTTGAGCACAGACAGTTTGGCGGATGCTAGCTACCCAGCTGCCGCTTCCCTTGGGGATGCAGTTTGTGGCATGGCAGTGGCATATATCACCTCAAGAGATTTTTTGTTTTGGTTTAGATCCCACACTGCAAAAGAAATAAAGTGGGGTGGTGCTAAACATCATCCTGAAGACAAGGATGATGGACAGCGTATGCATCCCCGCACATCTTTTAATGCCTTCCTGGAAGTTGTGAAGAGTAGGAGCCTTCCA Ruppia_maritima_FAL0111 CGTTTACAGGCTTTGCCGGGTGGGGATATTAAGTTTTTGTGTGACACGGTTGTTGACCATGTTAGGGAGCTCACTGGATATGACAGGGTTATGGTGTATAAGTTCCATGAGGATGAGCATGGGGAAGTTCTGGCCGAGAGTAAAAGAAATGACTTGGAACCTTATATAGGTCTCCATTACCCTGCCACAGACATACCCCAAGCCTCAAGGTTCTTGTTTAAACAGAACAGAGTTAGGATGATAGCTGACTGCCATGCAACTCCTGTTAGCATGATACAAGATGAGAACCTGATGCAGCCGCTTTGCCTTGTAGGATCCACACTAAGAGCTCCTCATGGCTGCCATGCGCAATACATGGCTAACATGGGCTCAGTTGCTTCTCTTGTCATGGCTGTTATCATCAATGGGGGCGAAGAAGACGGCACAAGGAACTCTATGAAGCTATGGGGCCTTGTTGTTTGCCACCATACTTCTCCCAGATGCATTCCATTTCCACTGCGCTATGCCTGTGAGTTCCTCATGCAGGCTTTAGGCCTTCAGCTTAATATGGAAGTTCAGTTGGCTGCCCAGATGTCCGAAAAGCACATATTAAGAACTCAAACCCTTCTATGTGATATGCTTCTTCGGGATTCTCCTATTGGAATTGTTACACAAAGTCCTAGTATAATGGACCTTGTGAAGTGTGATGGCGCGGCACTCTATTACCATGGTAAGTATTGGCCGCTCGGTGTTGCCCCGTCTGAGGAAAAGATTAAAGATATTATTGGCTGGTTATTGGCAAGTCATGGAGACTCCACGGGCTTGAGCACGGACAGTTTGGCGGATGCTAACTACCCAGCTGCCGCTTCCCTTGGGGATGCAGTTTGTGGCATGGCTGTGGCATATATCACCTCAAGAGATTTTTTGTTTTGGTTTAGATCCCATACTGCAAAAGAAATCAAGTGGGGTGGTGCTAAACATCATCCGGAAGACAAGGACGATGGACAGCGTATGCATCCCCGCACATCTTTTAATGCCTTCCTAGAAGTTGTGAAGAGTAGGAGCCTTCCG Ruppia_maritima_FAL0113 CGTTTACAGGCTTTGCCGGGTGGGGATATTAAGTTTCTGTGTGACACGGTTGTTGACCATGTTAGGGAGCTCACTGGATATGACAGGGTTATGGTGTATAAATTCCATGAGGATGAGCATGGGGAAGTTCTCGCCGAGAGTAAAAGAGGTGACTTGGAACCCTATATAGGTCTCCATTACCCTGCCACAGACATACCCCAAGCCTCAAGGTTCTTGTTTAAACAGAACAGAGTTAGGATGATAGCTGACTGTCGTGCAACTCCTGTTAGCATGATACAAGATGAGAACCTGATGCAGCCGCTTTGCCTTGTAGGATCCACACTACGAGCTCCTCATGGCTGCCATGCGCAATACATGGCTAACATGGGCTCAATTGCTTCTCTTGTCATGGCTGTTATCATCAATGGGGGTGAAGAAGACGGCACAAGGAACTTTATGAAGCTATGGGGCCTTGTTGTTTGCCACCATACTTCTCCCAGATGCATTCCATTTCCACTGCGCTATGCCTGTGAGTTCTTCATGCAGGCTCTAGGCCTTCAGCTTAATATGGAAGTTCAGTTGGCTGCCCAGATGTCTGAAAAGCACATATTGAGAACTCAAACCCTTCTATGTGATATGCTTCTTAGGGATTCTCCTACTGGAATTGTTACACAAAGTCCTAGTATAATGGACCTTGTGAAGTGTGATGGTGCGGCACTCTATTACCATGGTAAGTATTGGCCACTCGGTGTTGCCCCCTCCGAGGAAAAGATTAAAGATATTATCGGCTGGTTATTGTTAACTCATGGAGACTCCACAGGCTTGAGCACAGACAGTTTGGCGGATGCTAGCTACCCAGCTGCCTCTTCCCTTGGGGATGCAGTTTGTGGCATGGCAGTGGCATATATCACCTCAAGAGATTTTTTGTTTTGGTTTAGATCCCACACTGCAAAAGAAATAAAGTGGGGTGGTGCTAAACATCATCCTGAAGACAAGGATGATGGACAGCGTATGCATCCCCGCACATCTTTTAATGCCTTCCTGGAAGTTGTGAAGAGTAGGAGCCTTCCA Ruppia_maritima_GRA01 CGTTTACAGGCTTTGCCGGGTGGGGATATTAAGTTTCTGTGTGACACGGTTGTTGACCATGTTAGGGAGCTCACTGGATATGATAGGGTTATGGTGTATAAATTCCATGAGGATGAGCATGGGGAAGTTCTCTCCGAGAGTAAAAGAAGTGACTTGGAACCCTATATAGGTCTCCATTACCCTGCCACGGACATACCCCAAGCCTCAAGGTTCTTGTTTAAACAGAACAGAGTTAGGATGATAGCTGACTGTCGTGCAACTCCAGTTAGCATGATACAAGATGAGAACCTGATGCAGCCGCTTTGCCTTGTAGGATCCACACTACGAGCTCCTCATGGCTGCCATGCACAATACATGGCTAACATGGGCTCAATTGCTTCTCTTGTCATGGCTGTTATCATCAATGGGGGTGAAGAAGACGGCACAAGGAACTCTATGAAGCTATGGGGCCTTGTTGTTTGCCACCATACTTCTCCCAGATGCATTCCATTTCCATTGCGCTATGCCTGTGAGTTCCTCATGCAGGCCCTAGGCCTTCAGCTTAATATGGAAGTTCAGTTGGCTGCCCAGATGTCTGAAAAGCACATATTGAGAACTCAAACCCTTCTATGTGATATGCTTCTTAGGGATTCTCCTACTGGAATTGTTACACAAAGTCCTAGTATAATGGACCTTGTGAAGTGTGATGGTGCGGCACTCTATTACCATGGTAAGTATTGGCCACTCGGTGTTGCCCCCTCCGAGGAAAAGATTAAAGATATTATCGGCTGGTTATTGGCAACTCATGGAGACTCCACAGGCTTGAGCACAGACAGTTTGGCGGATGCTAGCTACCCAGCTGCCGCTTCCCTTGGGGATGCAGTTTGTGGCATGGCAGTGGCATATATCACCTCAAGAGATTTTTTGTTTTGGTTTAGATCCCACACTGCAAAAGAAATAAAGTGGGGTGGTGCTAAACATCATCCTGAAGACAAGGATGATGGACAGCGTATGCATCCCCGCACATCTTTTAATGCCTTCCTGGAAGTTGTGAAGAGTAGGAGCCTTCCA Ruppia_maritima_MAH02 CGTTTACAGGCTTTGCCGGGTGGGGATATTAAGTTTCTGTGTGACACGGTTGTTGACCATGTTAGGGAGCTCACTGGATATGACAGGGTTATGGTGTATAAATTCCATGAGGATGAGCATGGGGAAGTTCTCGCCGAGAGTAAAAGAAGTGACTTGGAACCCTATATAGGTCTCCATTACCCTGCCACAGACATACCCCAAGCCTCAAGGTTCTTGTTTAAACAGAACAGAGTTAGGATGATAGCTGACTGTCGTGCAACTCCAGTTAGCATGATACAAGATGAGAACCTGATGCAGCCGCTTTGCCTTGTAGGATCCACACTACGAGCTCCTCATGGCTGCCATGCACAATACATGGCTAACATGGGCTCAATTGCTTCTCTTGTCATGGCTGTTATCATCAATGGGGGTGAAGAAGACGGCACAAGGAACTCTATGAAGCTATGGGGCCTTGTTGTTTGCCACCATACTTCTCCCAGATGCATTCCATTTCCATTGCGCTATGCCTGTGAGTTCCTCATGCAGGCCCTAGGCCTTCAGCTTAATATGGAAGTTCAGTTGGCTGCCCAGATGTCTGAAAAGCACATATTGAGAACTCAAACCCTTCTATGTGATATGCTTCTTAGGGATTCTCCTACTGGAATTGTTACACAAAGTCCTAGTATAATGGACCTTGTGAAGTGTGATGGCGCGGCACTCTATTACCATGGTAAGTATTGGCCACTCGGTGTTGCCCCCTCCGAGGAAAAGATTAAAGATATTATCGGCTGGTTATTGGCAACTCATGGAGACTCCACAGGCTTGAGCACAGACAGTTTGGCGGATGCTAGCTACCCAGCTGCCGCTTCCCTTGGGGATGCAGTTTGTGGCATGGCAGTGGCATATATCACCTCAAGAGATTTTTTGTTTTGGTTTAGATCCCACACTGCAAAAGAAATAAAGTGGGGTGGTGCTAAACATCATCCTGAAGACAAGGATGATGGACAGCGTATGCATCCCCGCACGTCTTTTAATGCCTTCCTGGAAGTTGTGAAGAGTAGGAGCCTTCCA Ruppia_maritima_MAR01 CGTTTACAGGCTTTGCCGGGTGGGGATATTAAGTTTCTGTGTGACACGGTTGTTGACCATGTTAGGGAGCTCACTGGATATGATAGGGTTATGGTGTATAAATTCCATGAGGATGAGCATGGGGAAGTTCTCGCCGAGAGTAAAAGAAGTGACTTGGAACCCTATATAGGTCTCCATTACCCTGCCACGGACATACCCCAAGCCTCAAGGTTCTTGTTTAAACAGAACAGAGTTAGGATGATAGCTGACTGTCGTGCAACTCCAGTTAGCATGATACAAGATGAGAACCTGATGCAGCCGCTTTGCCTTGTAGGATCCACACTACGAGCTCCTCATGGCTGCCATGCACAATACATGGCTAACATGGGCTCAATTGCTTCTCTTGTCATGGCTGTTATCATCAATGGGGGTGAAGAAGACGGCACAAGGAACTCTATGAAGCTATGGGGCCTTGTTGTTTGCCACCATACTTCTCCCAGATGCATTCCATTTCCATTGCGCTATGCCTGTGAGTTCCTCATGCAGGCCCTAGGCCTTCAGCTTAATATGGAAGTTCAGTTGGCTGCCCAGATGTCTGAAAAGCACATATTGAGAACTCAAACCCTTCTATGTGATATGCTTCTTAGGGATTCTCCTACTGGAATTGTTACACAAAGTCCTAGTATAATGGACCTTGTGAAGTGTGATGGTGCGGCACTCTATTACCATGGTAAGTATTGGCCACTCGGTGTTGCCCCCTCCGAGGAAAAGATTAAAGATATTATCGGCTGGTTATTGGCAACTCATGGAGACTCCACAGGCTTGAGCACAGACAGTTTGGCGGATGCTAGCTACCCAGCTGCCGCTTCCCTTGGGGATGCAGTTTGTGGCATGGCAGTGGCATATATCACCTCAAGAGATTTTTTGTTTTGGTTTAGATCCCACACTGCAAAAGAAATAAAGTGGGGTGGTGCTAAACATCATCCTGAAGACAAGGATGATGGACAGCGTATGCATCCCCGCACATCTTTTAATGCCTTCCTGGAAGTTGTGAAGAGTAGGAGCCTTCCA Ruppia_maritima_SKA0202 CGTTTACAGGCTTTGCCGGGTGGGGATATTAAGTTTCTGTGTGACACGGTTGTTGACCATGTTAGGGAGCTCACTGGATATGACAGGGTTATGGTGTACAAGTTCCATGAGGATGAGCATGGGGAAGTTCTCGCCGAGAGTAAAAGAAGCGACTTGGAACCTTATATAGGTCTTCACTACCCTGCCACAGATATACCCCAAGCCTCAAGGTTCTTGTTTAAACAGAACAGAGTTAGAATGATAGCTGACTGTCATGCAACGCCTGTTAGCATGATACAAGATGAGAACCTGATGCAGCCGCTTTGCCTTGTAGGATCCACACTACGAGCTCCTCATGGATGCCATGCGCAATACATGGCTAACATGGGTTCAGTTGCTTCTCTTGTCATGGCTGTTATCATCAATAGGGGCGAAGAAGACGGCACAAGGAACTCTATGAAGCTATGGGGCCTTGTTGTTTGCCACCATACTTCTCCCAGATGCATTCCATTTCCATTGCGATATGCCTGTGAGTTCCTCATGCAGGCTCTAGGCCTTCAGCTTAATATGGAAGTTCAGTTGGCTGCCCAGATGTCTGAAAAGCACATATTAAGAACTCAAACCCTTCTATGTGATATGCTTCTTCGGGATTCTCCTACTGGAATTGTTACACAAAGTCCTAGTATAATGGACCTTGTGAAGTGTGATGGTGCAGCGCTCTATTACCATGGTAAGTATTGGCCACTCGGTGTTGCCCCTTCCGAGGAAAAGATTAAAGATATTATTGGCTGGTTATTGGCAAGTCATGGAGACTCCACGGGCTTGAGCACGGACAGTTTGGCGGATGCTAGCTACCCGGCTGCCGCTTCACTTGGGGATGCAGTTTGTGGCATGGCAGTGGCATATATCACCTCAAGAGATTTTTTGTTTTGGTTTAGATCCCATACTGCAAAAGAAATAAAGTGGGGTGGTGCTAAACATCATCCGGAAGACAAGGACGATGGACAGCGTATGCATCCCCGCACATCGTTTAATGCCTTCCTGGAAGTTGTGAAGAGTAGGAGCCTTCCA Ruppia_maritima_UTA01 CGTTTACAGGCTTTGCCGGGTGGGGATATTAAGTTTCTGTGTGACACGGTTGTTGACCATGTTAGGGAGCTCACTGGATATGACAGGGTTATGGTGTACAAATTCCACGAGGATGAGCATGGGGAAGTTCTCGCCGAGAGTAAAAGAGGTGACTTGGAACCCTATTTAGGTCTCCATTACCCTGCCACAGACATACCCCAAGCCTCAAGGTTCTTGTTTAAACAGAACAGAGTTAGGATGATAGCTGACTGTCGTGCAACTCCTGTTAGCATGATACAAGATGAGAACCTGATGCAGCCGCTTTGCCTTGTAGGATCCACATTACGAGCTCCTCATGGCTGCCATGCGCAATACATGGCTAACATGGGCTCAATTGCTTCTCTTGTCATGGCTGTTATCATCAATGGGGGTGAAGAAGACGGCACAAGGAACTCTATGAAGCTATGGGGCCTTGTTGTTTGCCACCATACTTCTCCCAGATGCATTCCATATCCATTGCGCTATGCCTGTGAGTTCCTCATGCAGGCTCTAGGCCTTCAGCTAAATATGGAAGTTCAGTTGGCTGCCCAGATGTCTGAAAAGCACATATTGAGAACTCAAACCCTTCTATGTGATATGCTTCTTAGGGATTCTCCTACTGGAATTGTTACACAAAGTCCTAGTATAATGGACCTTGTGAAGTGTGATGGTGCGGCACTCTATTACCATGGTAAGTATTGGCCACTCGGTGTTGCCCCCTCCGAGGAAAAGATTAAAGATATTATCGGCTGGTTATTGGCAACTCATGGAGACTCCACAGGCTTGAGCACAGACAGTTTGGCGGATGCTAGCTACCCAGCTGCCGCTTCCCTTGGGGATGCAGTTTGTGGCATGGCAGTGGCATATATCACCTCGAGAGATTTTTTGTTTTGGTTTAGATCCCACACTGCAAAAGAAATAAAGTGGGGTGGTGCTAAACATCATCCTGAAGACAAGGATGATGGACAGCGTATGCATCCCCGCACATCTTTTAATGCCTTCCTGGAAGTTGTGAAGAGTAGGAGCCTTCCA Ruppia_maritima_YHO01 CGTTTACAGGCTTTGCCGGGTGGGGATATTAAGTTCCTGTGTGACACGGTTGTTGACCATGTTAGGGAGCTCACTGGATATGACAGGGTTATGGTGTATAAATTCCATGAGGATGAGCATGGGGAAGTTCTCGCCGAGAGTAAAAGAAGTGACTTGGAACCCTATATAGGTCTCCATTACCCTGCCACAGACATACCCCAAGCCTCAAGGTTCTTGTTTAAACAGAACAGAGTTAGGATGATAGCTGACTGTCGTGCAACTCCAGTTAGCATGATACAAGATGAGAACCTGATGCAGCCGCTTTGCCTTGTAGGATCCACACTACGAGCTCCTCATGGCTGCCATGCACAATACATGGCTAACATGGGCTCAATTGCTTCTCTTGTCATGGCTGTTATCATCAATGGGGGTGAAGAAGACGGCACAAGGAACTCTATGAAGCTATGGGGCCTTGTTGTTTGCCACCATACTTCTCCCAGATGCATTCCATTTCCATTGCGCTATGCCTGTGAGTTCCTCATGCAGGCCCTAGGCCTTCAGCTTAATATGGAAGTTCAGTTGGCTGCCCAGATGTCTGAAAAGCACATATTGAGAACTCAAACCCTTCTATGTGATATGCTTCTTAGGGATTCTCCTACTGGAATTGTTACACAAAGTCCTAGTATAATGGACCTTGTGAAGTGTGATGGCGCGGCACTCTATTACCATGGTAAGTATTGGCCACTCGGTGTTGCCCCCTCCGAGGAAAAGATTAAAGATATTATCGGCTGGTTATTGGCAACTCATGGAGACTCCACAGGCTTGAGCACAGACAGTTTGGCGGATGCTAGCTACCCAGCTGCCGCTTCCCTTGGGGATGCAGTTTGTGGCATGGCAGTGGCATATATCACCTCAAGAGATTTTTTGTTTTGGTTTAGATCCCACACTGCAAAAGAAATAAAGTGGGGTGGTGCTAAACATCATCCTGAAGACAAGGATGATGGACAGCGTATGCATCCCCGCACGTCTTTTAATGCCTTCCTGGAAGTTGTGAAGAGTAGGAGCCTTCCA Ruppia_megacarpa_MED01 CGGTTACAGGCTTTGCCAGGTGGAGATATTAAGTTTCTGTGTGACACAGTTGTGGACCATGTTAGGGAACTCACTGGATATGATAGGGTTATGGTCTACAAGTTCCATGAGGATGAGCATGGGGAAGTTCTTGCTGAGAGTAAAAGAAGTGACTTGGAACCGTATATAGGTCTCCATTACCCTGCCACAGACATACCCCAAGCCTCAAGGTTCTTATTTAAACAGAACAGAGTTAGGATGATAGCTGATTGTCGTGCAACTCCTGTTAGCATGATACAAGATGAGAACCTGATGCAGCCACTTTGCCTTGTAGGATCCACACTACGAGCTCCTCATGGCTGCCATGCACAATACATGGCTAACATGGGGTCAGTTGCTTCTCTTGTTATGGCTGTTATCATTAATGGGGGAGAAGAAGACGGCACAAGGAACTCTATGAAGCTATGGGGCCTTGTTGTTTGCCACCATACTTCTCCCAGATGCATTCCATTTCCATTGCGCTATGCCTGTGAGTTCCTCATGCAGGCTCTAGGCCTTCAGCTTAATATGGAAGTTCAGTTGGCTGCCCAGATGTCTGAAAAACACATATTAAGAACTCAAACCCTTTTATGTGATATGCTTCTTCGTGATTCTCCTACTGGAATTGTTACACAAAGTCCGAGTATAATGGACCTTGTGAAGTGTGATGGCGCGGCACTCTATTACCATGGTAAGTATTGGCCACTCGGTGTTGCCCCTTCTGAGGAAAAAATTAAAGATATCATTGGCTGGTTATTGGCAAGTCATGGAGACTCCACGGGCTTGAGCACAGATAGTTTGGCGGATGCTAGCTACCCAGGTGCCGCTTCCCTTGGGGATGCAGTTTGTGGCATGGCAGTGGCATATATCACCTCAAGAGATTTTTTGTTTTGGTTTAGATCCCATACTGCAAAAGAAATAAAGTGGGGTGGTGCTAAACATCATCCTGAAGACAAAGACGATGGACAGCGTATGCATCCCCGCACATCTTTTAATGCCTTCCTGGAAGTTGTGAAAAGTAGGAGCCTTCCA Ruppia_polycarpa_DEV01 CGTTTACAGGCTTTGCCGGGTGGGGATATTAAGTTTCTGTGTGACACGGTTGTTGACCATGTTAGGGAGCTCACTGGATATGACAGGGTTATGGTGTATAAATTCCATGAGGATGAGCATGGGGAAGTTCTCGCCGAGAGTAAAAGAGGTGACTTGGAACCCTATATAGGTCTCCATTACCCTGCCACAGACATACCCCAAGCCTCAAGGTTCTTGTTTAAACAGAACAGAGTTAGGATGATAGCTGACTGTCGTGCAACTCCTGTTAGCATGATACAAGATGAGAACCTGATGCAGCCGCTTTGCCTTGTAGGATCCACACTACGAGCTCCTCATGGCTGCCATGCGCAATACATGGCTAACATGGGCTCAATTGCTTCTCTTGTCATGGCTGTTATCATCAATGGGGGTGAAGAAGACGGCACAAGGAACTCTATGAAGCTATGGGGCCTTGTTGTTTGCCACCATACTTCTCCCAGATGCATTCCATTTCCATTGCGCTATGCCTGTGAGTTCCTCATGCAGGCTCTAGGCCTTCAGCTTAATATGGAAGTTCAGTTGGCTGCCCAGATGTCTGAAAAGCACATATTGAGAACTCAAACCCTTCTATGTGATATGCTTCTTAGGGATTCTCCTACTGGAATTGTTACACAAAGTCCTAGTATAATGGACCTTGTGAAGTGTGATGGTGCGGCACTCTATTACCATGGTAAGTATTGGCCACTCGGTGTTGCCCCCTCCGAGGAAAAGATTAAAGATATTATCGGCTGGTTATTGGCAACTCATGGAGACTCCACAGGCTTGAGCACAGACAGTTTGGCGGATGCTAGCTACCCAGCTGCCGCTTCCCTTGGGGATGCAGTTTGTGGCATGGCAGTGGCATATATCACCTCAAGAGATTTTTTGTTTTGGTTTAGATCCCACACTGCAAAAGAAATAAAGTGGGGTGGTGCTAAACATCATCCTGAAGACAAGGATGATGGACAGCGTATGCATCCCCGCACATCTTTTAATGCCTTCCTGGAAGTTGTGAAGAGTAGGAGCCTTCCA Ruppia_polycarpa_POB01 CGTTTACAGGCTTTGCCGGGTGGGGATATTAAGTTTCTGTGTGACACTGTTGTTGACCATGTTAGGGAGCTCACTGGGTATGACAGGGTTATGGTGTACAAGTTCCATGAGGATGAGCATGGGGAAGTTCTTGCTGAGAGTAAAAGAAGTGACTTGGAACCTTACATAGGTCTCCATTACCCTGCCACAGACATACCCCAAGCCTCAAGGTTCTTGTTTAAACAGAACAGAGTTAGGATGATAGCTGACTGTCGTGCAACTCCTGTTAGCATGATACAAGATGAGAACCTGATGCAGCCACTTTGCCTTGTAGGATCCACACTACGTGCTCCTCATGGCTGCCATGCACAATACATGGCTAACATGGGCTCAGTTGCTTCTCTTGTCATGGCTGTTATCATTAATGGGGGTGAAGAAGATGGCACACGGAACTCTATGAAGCTATGGGGCCTTGTTGTTTGCCACCATACTTCTCCCAGATGCATTCCATTTCCATTGCGCTATGCCTGTGAGTTCCTAATGCAGGCTCTAGGCCTCCAGCTTAATATGGAAGTTCAGTTGGCTGCCCAGATGTCTGAAAAGCACATATTGAGAACTCAAACCCTTCTATGTGATATGCTTCTTAGGGATTCTCCTACTGGAATTGTTACACAAAGTCCTAGTATAATGGACCTTGTGAAGTGTGATGGCGCGGCGCTCTATTACCATGGTAAGTATTGGCCACTCGGTGTTGCCCCGTCTGAGGAAAAGATTAAAGATATTATTGGCTGGTTATTGGCAAGTCATGGAGACTCCACAGGCTTGAGCACAGACAGTTTGGCGGATGCTAGCTACCCAGCTGCCGCTTCCCTTGGGGATGCAGTTTGTGGCATGGCAGTGGCATATATCACCTCAAGAGATTTTTTGTTTTGGTTTAGATCCCATACTGCAAAAGAAATAAAGTGGGGTGGAGCTAAACATCACCCGGAAGACAAGGACGATGGACAGCGTATGCATCCCCGCACATCTTTTAACGCCTTCCTGGAAGTTGTGAAAAGTAGGAGCCTTCCA Ruppia_tuberosa_TUA0100 CGGTTGCAGGCTCTGCCTGGGGGAGATATTAAGTTCCTGTGTGATACTGTTGTGGATCATGTTAGGGAGCTTACTGGTTATGATAGAGTTATGGTTTATAAGTTTCATGAGGATGAGCATGGGGAGGTGCTTGCTGAGAGTAAGAGGAGTGATTTGGAGCCGTATATTGGGCTCCATTATCCTGCGACGGATATTCCCCAGGCGTCGAGGTTCTTGTTTAAGCAGAATAGAGTTAGGATGATCGCTGATTGTCGTGCGACTCCGGTTAGTATGATACAGGATGAGAATCTTATGCAGCCTCTTTGCCTTGTCGGATCGACGCTACGAGCGCCTCATGGTTGTCATGCGCAGTACATGGCTAACATGGGGTCGATTGCTTCGCTTGTTATGGCTGTTATCATTAATGGGGGTGAGGAGGATGGGACTAGGAACTCTATGAAGCTTTGGGGGCTTGTTGTTTGCCACCATACTTCTCCGAGATGCATTCCGTTTCCGTTGCGCTATGCTTGTGAGTTTCTTATGCAGGCTTTGGGTCTTCAGCTTAATATGGAAGTTCAGTTGGCTGCCCAGATGTCTGAGAAGCACATATTGAGAACTCAGACGCTTCTGTGTGATATGCTTCTTCGGGATTCTCCTACTGGGATTGTTACACAGAGTCCTAGTATAATGGACCTTGTAAAGTGTGATGGTGCGGGGCTCTGTTACCATGGGAAGTATTGGCCACTCGGTGTTGCCCCTTCTGAGGAGAAGATTAAGGATATTATTGGGTGGTTGTTGACGAGTCATGGAGACTCCACGGGGTTGAGCACAGACAGTTTGGCGGATGCTAGCTACCCTGGTGCTGCTTCCCTTGGGGATGCAGTTTGTGGCATGGCAGTGGCGTATATCACCACGAGAGATTTTTTGTTTTGGTTTAGATCCCATACTGCAAAAGAGATAAAGTGGGGTGGTGCTAAACATCATCCTGAAGACAAGGACGACGGACAGCGTATGCATCCCCGCACATCTTTTAACGCCTTCCTGGAAGTTGTGAAAAGTAGGAGCCTTCCA Ruppia_tuberosa_TUA0114 CGGTTGCAGGCTCTGCCTGGGGGAGATATTAAGTTTCTGTGTGATACTGTTGTGGATCATGTTAGGGAGCTCACTGGGTATGATAGAGTTATGGTGTATAAGTTTCATGAGGATGAGCATGGGGAGGTGCTTGCTGAGAGTAAGAGGAGTGATTTGGAGCCGTATATTGGGCTCCATTATCCTGCGACGGATATTCCCCAGGCGTCGAGGTTCTTGTTCAAGCAGAATAGAGTTAGGATGATTGCTGATTGTCGTGCGACTCCGGTTAGTATGATACAGGATGAGAATTTGATGCAGCCGCTTTGCCTTGTCGGATCGACGCTGCGAGCACCTCATGGTTGTCATGCGCAGTACATGGCGAACATGGGGTCGATTGCTTCGCTTGTTATGGCTGTTATTATTAATGGGGGTGAGGAGGATGGGTCAAGGAACTCTATGAAGCTGTGGGGGCTTGTTGTTTGCCACCATACTTCTCCGAGATGCATTCCGTTCCCATTGCGCTATGCTTGTGAGTTTCTTATGCAGGCTTTGGGTCTTCAGCTTAATATGGAGGTTCAGTTGGCTGCCCAGATGTCTGAGAAGCACATATTGAGAACTCAGACGCTTCTGTGTGATATGCTTCTTAGGGATTCTCCTACTGGGATTGTTACACAGAGTCCTAGTATAATGGATCTTGTGAAGTGTGATGGTGCGGCGCTCTATTACCATGGTAAGTATTGGCCACTTGGGGTTGCCCCTTCTGAGGAGAAGATTAAGGATATTATTGGCTGGTTGTTGACGAGTCATGGAGACTCCACGGGGTTGAGCACAGACAGTTTGGCGGATGCTAGCTACCCTGGTGCTGCTTCCCTTGGGGATGCAGTTTGTGGCATGGCAGTGGCGTATATCACCTCGAGAGATTTTTTGTTTTGGTTTAGATCCCATACTGCAAAAGAGGTAAAGTGGGGTGGTGCTAAACATCATCCTGAAGACAAGGACGACGGACAGCGTATGCATCCCCGCGCATCTTTTAACGCCTTCCTGGAAGTTGTGAAAAGTAGGAGCCTTCCA Ruppia_tuberosa_TUE0101 CGCTTGCAGGCTTTGCCTGGGGGAGATATTAAGTTTCTGTGTGATACTGTTGTGGATCATGTTAGGGAGCTGACTGGGTATGATAGGGTTATGGTTTATAAGTTTCATGAGGATGAGCATGGGGAGGTGCTTGCTGAGAGTAAGAGGAGTGACTTGGAACCGTATATTGGGCTCCATTATCCTGCGACGGATATTCCCCAGGCGTCGAGGTTCTTGTTTAAGCAGAATAGAGTTAGGATGATTGCTGATTGTCGTGCGACTCCGGTTAGTATGATACAAGATGAGAATTTGATGCAGCCGCTTTGCCTTGTTGGATCGACGCTACGAGCACCTCATGGGTGCCACGCGCAGTACATGGCGAACATGGGGTCGATTGCTTCGCTTGTTATGGCTGTTATTATTAATGGGGGTGAGGAGGATGGGACAAGGAACTCTATGAAGCTTTGGGGGCTTGTTGTTTGCCACCATACTTCTCCGAGATGCATTCCGTTTCCGTTGCGCTATGCTTGTGAGTTTCTTATGCAGGCTTTGGGTCTTCAGCTTAATATGGAGGTTCAGTTGGCTGCCCAGATGTCTGAGAAGCACATATTGAGAACTCAGACGCTTCTGTGTGATATGCTTCTTAGAGATTCTCCTACTGGGATTGTTACACAGAGTCCTAGTATAATGGACCTTGTGAAGTGTGATGGTGCTGCGCTCTATTATCATGGTAAGTATTGGCCACTCGGTGTTGCCCCTTCTGAGGAGAAGATTAAGGATATCATTGGCTGGTTGTTGACAAGTCATGGAGACTCCACGGGGTTGAGCACAGACAGCTTGGCGGATGCTAGCTACCCTGGTGCTGCTTCCCTTGGGGATGCAGTTTGTGGCATGGCAGTGGCGTATATCACCTCGAGAGATTTTTTGTTTTGGTTTAGATCACATACTGCAAAAGAGGTAAAGTGGGGTGGTGCTAAACATCATCCTGAAGACAAGGACGACGGACAGCGTATGCATCCCCGCACATCTTTTAACGCCTTCCTGGAAGTTGTGAAAAGTAGGAGCCTTCCA Ruppia_tuberosa_TUE0102 CGCTTGCAGGCTTTGCCTGGGGGAGATATTAAGTTTCTGTGTGATACTGTTGTGGATCATGTTAGGGAGCTGACTGGGTATGATAGGGTTATGGTTTATAAGTTTCATGAGGATGAGCATGGGGAGGTGCCTGCTGAGAGTAAGAGGAGTGACTTGGAACCGTATATTGGGCTCCATTATCCTGCGACGGATATTCCCCAGGCGTCGAGGTTCTTGTTTAAGCAGAATAGAGTTAGGATGCTTGCTGATTGTCGTGCGACTCCGGTTAGTATGATACAAGATGAGAATTTGATGCAGCCGCTTTGCCTTGTTGGATCGACGCTACGAGCACCTCATGGGTGCCACGCGCAGTACATGGCGAACATGGGGTCGATTGCTTCGCTTGTTATGGCTGTTATTATTAATGGGGGTGAGGAGGATGGGACAAGGAACTCTATGAAGCTTTGGGGGCTTGTTGTTTGCCACCATACTTCTCCGAGATGCATTCCGTTTCCGTTGCGCTATGCTTGTGAGTTTCTTATGCAGGCTTTGGGTCTTCAGCTTAATATGGAGGTTCAGTTGGCTGCCCAGATGTCTGAGAAGCACATATTGAGAACTCAGACGCTTCTGTGTGATATGCTTCTTAGAGATTCTCCTACTGGGATTGTTACACAGAGTCCTAGTATAATGGACCTTGTGAAGTGTGATGGTGCTGCGCTCTGTTATCATGGTAAGTATTGGCCACTCGGTGTTGCCCCTTCTGAGGAGAAGATTAAGGATATCATTGGCTGGTTGTTGACAAGTCACGGAGACTCCACGGGGTTGAGCACAGACAGCTTGGCGGATGCTAGCTACCCTGGTGCTGCTTCCCTTGGGGATGCAGTTTGTGGCATGGCAGTGGCGTATATCACCTCGAGAGATTTTTTGTTTTGGTTTAGATCACATACTGCAAAAGAGATAAAGTGGGGTGGTGCTAAACATCATCCTGAAGACAAGGACGACGGACAGCGTATGCATCCCCGCACATCTTTTAACGCCTTCCTGGAAGTTGTGAAAAGTAGGAGCCTTCCA Syringodium_isoetifolium_Sis03 CGGCTGCAAGCTCTACCTGGTGGAGACATCAAGCTTCTCTGTGACACGGTTGTGAACCACGTCAGGGAGCTCACGGGCTACGACAGGGTCATGGTCTACAGGTTCCATGAGGATGAGCATGGGGAGGTTGTCGCAGAGAGCAAAAGGGGCGACTTGGAGCCGTATATAGGACTCCATTATCCTGCCACCGACATACCTCAGGCCGCAAGGTTCTTGTTTAAACAGAACAGAGTTAGGATGATAGCTGATTGCCGGGCAACGCCCGTCCGAATGGTACAAGATGAGAATCTAATGCAGCCCCTCTGCCTTGTTGGATCCACTTTGCGAGCTCCACATGGTTGCCATGCACAATACATGGCCAACATGGGCTCAATTGCTTCGCTTGTTATGGCTGTAATCATTAATGGAGGTGAAGAGGAGAGCTCCAGGAAATCCATGAAGCTATGGGGCCTAGTTGTCTGTCATCACACTTCCCCTAGATGCATTCCATTTCCACTGCGATATGCCTGCGAGTTCCTCATGCAGGCCTTTGGGCTTCAGCTAAATATGGAACTTCATTTGGCATCTCAGCTGTCCGAGAAGCACATCTTGCGGACTCAGACACTTTTGTGTGACATGCTTCTTCGTGATTCTCCCACTGGAATTGTCACACAGAGTCCTAGCATAATGGATCTTGTTAAGTGTGATGGGGCTGCGCTCTATTACCAGGGTAGTTATTGGCCACTTGGTGTTACTCCTTCTGAGGCAGAGATTAAGGATATTATTGGGTGGCTGTTGGAAAGTCATGGAGACTCCACAGGCTTGAGCACAGACAGTTTGGCTGATGCTGGCTATCCAGGAATTGCTTCCTTTGGTGATGCAGTTTGTGGTATTGCGGTGGCCTACATCGCCCCAGGGGACTTCTTGTTTTGGTTCAGATCACATACAGAAAAAGAGATAAAATGGGGTGGTGCAAAGCACCATCCTGAAGACAAGGATGATGGGCAGCGTATGCACCCACGCACATCTTTCAATGCCTTCCTGGAAGTAGTGAAAAGTAGAAGCCTTCCA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M5520] TITLE Ruppia_PtDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2108; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=- GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Potamogeton_maackianus_Pm052 GTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGACAACGGCTTACTTCTTCACATTCACCGCGCAATGCATGCGGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGGGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTAGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGCCGCGGTATTTTCTTCACTCAGGATTGGGTCTCTATGCCAGGTGTTTTACCCGTGGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCCTAACCGAGATCTTTGGAGATGATTCCGTACTACAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCAGGTGCTGTAGCTAATCGAGTGGCTTTAGAAGCATGTGTACAAGCTCGTAATGAGGGGCGTGATCTAGCTAGTGAAGGTAAGCTTTCTCGATCCGAAAAGTGCATTGTTGGAACCGGACTGGAAGGCCAAGCGGCCTTGGATTCGGGAGTTTCCGCTATAGCCGAACACGAGGGAAAGGTCATTTATACGGATACTCACAAAATGATTTTCTTGAGTAATGGGAAGACTAGAAGTATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCACCAAAAATCCCGGGTTCCGCGGGGTAAATACATTAAAAAAGGGCAAATTTTAGCGGATGGCGCGGCTACTGTTGATGGGGAACTCGCTTTGGGAAAAAACGTATTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGACGCGGTACTTATCAGTGAACGTCTGGTATATCATGAGATTTATACTTCTTTTCACATACGGAAATATGAAATTCAGACTCATATGACAAGTCAAGGCCCGGAAAGAATTACTAAGGAAATACCCCATTTAGAGGATCATTTACTCCGAAATTTAGACAGAAATGATTCGCGGACAACCAATGAGGGACGGTCATAATAAAGTTTACAAGTCCTTTTCAGATGTAATTGAAGGCAAAGAGGGAAGATTTCGCGAGACTCTGCTTGGTAAACGAGTCGATTATTCGGGACGTTCCGTTATTGTTGTGGGCCCTTCACTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTTTTCCAGACATTTGTAATTCGGGGTCTAATCAGACAACATATTGCTTCCAACATAGGAATTGCGAAAAGTAAAATTAGAGAAAAAGAACTGATTGTATGGGAAATACTTCAAGAAGTTATGCAGGGACATCCAGTATTGCTGAATAGAGCACCCACTCTGCATAGATTAGGAATACAGGCATTCCAACCTATTTTAGTGGAGGGACGCGCTATTTGTTTACATCCATTAGTTTGTAAGGGCTTTAATGCAGATTTTGATGGGGATCAAATGGCTGTTCATGTACCTTTATCCTTGGAAGCTCAAGCAGAGGAAAAATAGAACGTCTTGCAGTAGTTTTTCGTAACGATTTTCAAAAAACTCTACAATTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGAAAAATCCATTTTGGCTTCAAGGGGAGCCCATCTTATAATGAAGAAATGGAAATATTACCTTGTGAATTTTTGGCAATGGAATTTTTCTTTTTGGTCTCAACCATATAGGATTCATATAAACCCATTATCAAAAAATTCCCTCCATTTTTTGGGTTATCTTTCAAGTGTATTAGTAAATCCTTTAACAGTAAGTAGTAAAATGCTAGAGTATTCTTTTCTAATAGACGCTGCTACTAAGAAATTCGATACTAGAGTTCCCATAATTCCTCTGATTGGATCATTATCTAAAGCGAAATTTTGTAAAGTATCTGGATATCCCATTAGTAAGCCAATTTGGACCGATTTATCGGATGCCGATATTATTGATCGATTTGGTCGTATATGTAGGAATCTTTCTCATTATCACAGCGGATCCTCAAAAAAACAGACTTTGTATCGAATGAAGTATATACT Ruppia_maritima_ART01 GTCCCTATTGTAATGCATGACTACATAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCAATATTGCCGGGACAATGGGTTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCACGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATCCACTCCGGGACAGTAGTAGGTAAACTAGAGGGTGAACGTGAGATGACTTTGGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGCCGTGGTATTTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCGTTGACCGAGATCTTTGGAGATGATTCTGTACTACAATTTGGCGGAGGAACCTTGGGACACCCTTGGGGAAATGCGCCGGGCGCAGTAGCTAATCGTGTGGCTTTGGAAGCGTGTGTACAAGCTCGTAATGAAGGGCGTGATCTGGCTAGTGAAGGTAAGCTTTTTCGGTCCGAGAAGTGCATTGTCGGAACCGGGATAGAACGCCAAGCGGCCTTGGATTCGGGAGTTTCCGCTATAGCGGAACACAAGGGAAAGATCATTTATACCGATACTCATCAAATGATTTTATCAAGTAATGGGAATATTATAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCACCAAAAACCCCGGGCTCCTCTGGGTAAATACATTAAAAAGGGTCAAATTTTAGCAGATGGCGCGGCTACTGTTGGTGGGGAACTCGCTTTGGGAAAAAACATATTAGTAGCTTATATGCCATGGGAAGGCTACAATTTTGAAGACGCGGTACTTATCAGTGAACGTTTGGTATATAATGATATTTATACTTCTTTTCATATACGGAAATATGAAATTCAGACTCATATAACAAGTCAAGGTCCCGAAAGAATTACTAAGGAAATACCTCATTTAGAAGATCATTTACTCCGAAATTTAGACAGAAATGATTCGCGGACAACCAATGAGGGACGGTCATAATAAAGTTTACAAGTCCTTTTCAGATGTAATTGAAGGCAAAGAGGGAAGATTTAGGGAGACTCTGCTTGGTAAACGAGTTGATTATTCGGGACGTTCCGTTATTGTTGTGGGCCCTTCACTTTCATTACATCAATGCGGATTACCTCGAGAAATAGCAATAGAGCTTTTCCAGACATTTGTAATTCGTGGTCTAATCAGACAACATGTTGCTTCTAACATAGGGATTGCTAAAAGTAAAATTCGCGAAAAAGAACGGATTGTATGGGAAATACTTCAAGAAGTTATGCAGGGGCATCCTGTATTGCTGAATAGAGCACCCACCCTGCATAGATTAGGAATACAGGCATTTCAACCTATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAAGGCTTTAATGCAGACTTTGATGGGGATCAAATGGCTGTTCATGTACCTTTATCCTTGGAAGCTCAAGCCGAGGAAAAATCGAGCATATTGCAATAGTTTTTCGTAATGATTTTCATAAAACCCTACGATTGTTCAAGGATCCTTTCATGCATTATGCTAGATATCAAGGAAAATCCCTTCTGGCTTCAAAAGGAACTCATCTTATAATGAAGAAATGGAAATATCACCATATTAATTTTTGGCAATGGAATTTTTATTTTTGGTCTCAACCATATAGGATTCCTATAAAACAACTATTAAAAAATTCCTTCTATTTTTTGGGTTATTTTTCTAGTGTATTAATGAATCCTTTGACAGTAAAAAGTAAAATGCTAGAGTATTCTTTTATAATTGATACTTTTACTAATAAATTTGATACTATAGTTCCGATTAGTCCTCTCATTGGATCTTTGTCTAAAGCCAAATTTTGTAATGTATCTGGGTATCCCATTAGTAAGCCAATTTGGACTGATTTATCTGATTCTGATATTATTGATCGGTTTGGTCGTATATGTAGAAACCTTTCTCATTATCAAAGTGGATCCTCAAAAAAACATAGTTTGTATCGAATGAAATATATACT Ruppia_maritima_DUB02 GTCCCTATTGTAATGCATGACTACATAACAGGGGGATTCACTGCAAATACTAGCTTGTCTCAATATTGCCGAGACAATGGGTTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCACGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATCCACTCCGGGACAGTAGTAGGTAAACTAGAGGGTGAACGTGAGATGACTTTGGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGCCGTGGTATTTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCGTTGACCGAGATCTTTGGAGATGATTCTGTACTACAATTTGGCGGAGGAACCTTGGGACACCCTTGGGGAAATGCGCCGGGCGCAGTAGCTAATCGTGTGGCTTTGGAAGCGTGTGTACAAGCTCGTAATGAAGGGCGTGATCTGGCTAGTGAAGGTAAGCTTTTTCGGTCCGAGAAGTGCATTGTCGGAACCGGGATAGAACGCCAAGCGGCCTTGGATTCGGGAGTTTCCGCTATAGCGGAACACAAGGGAAAGATCATTTATACTGATACTCATCAAATGATTTTATCAAGTAATGGGAATATTATAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCACCAAAAACCCCGGGCTCCTCTGGGTAAATACATTAAAAAGGGTCAAATTTTAGCAGATGGCGCGGCTACTGTTGGTGGGGAACTCGCTTTGGGAAAAAACATATTAGTAGCTTATATGCCATGGGAAGGCTACAATTTTGAAGACGCGGTACTTATCAGTGAACGTTTGGTATATAATGATATTTATACTTCTTTTCATATACGGAAATATGAAATTCAGACTCATATAACAAGTCAAGGTCCCGAAAGAATCACTAAGGAAATACCTCATTTAGAAGATCATTTACTCCGAAATTTAGACAGAAATGATTCGCGGACAACCAATGAGGGACGGTCATAATAAAGTTTACAAGTCCTTTTCAGATGTAATTGAAGGCAAAGAGGGAAGATTTAGGGAGACTCTGCTTGGTAAACGAGTCGATTATTCGGGACGTTCCGTTATTGTTGTGGGCCCTTCACTTTCATTACATCAATGCGGATTACCTCGAGAAATAGCAATAGAGCTTTTCCAGACATTTGTAATTCGTGGTCTAATCAGACAACATGTTGCTTCTAACATAGGGATTGCTAAAAGTAAAATTCGCGAAAAAGAACGAATTGTATGGGAAATACTTCAAGAAGTTATGCAGGGCCATCCTGTATTGCTGAATAGAGCACCCACCCTGCATAGATTAGGAATACAGGCATTTCAACCTATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAAGGCTTTAATGCAGACTTTGATGGGGATCAAATGGCTGTTCATGTACCTTTATCCTTGGAAGCTCAAGCCGAGGAAAAATCGAGCATATTGCAATAGTTTTTCGTAATGATTTTCATAAAACCCTACGATTGTTCAAGGATCCTTTGATGCATTATGCTAGATATCAAGGAAAATCCCTTCTGGCTTCAAAAGGAACTCATCTTATAATGAAGAAATGGAAATATCACCTTATTAATTTTTGGCAATGGAATTTTTATTTTTGGTCTCAACCATATAGGATTCATATAAAACAACTATTAAAAAATTCCTTCTATTTTTTGGGTTATTTTTCTAGTGTATTAATGAATCCTTTGACAGTAAAAAGTAAAATGCTAGAGTATTCTTTTATAATTGATACTGTTACTAATAAATTTGATACTCTAGTTCCGATTAGTCCTCTCATTGGATCTTTGTCTAAAGCCAAATTTTGTAATGTATCTGGGTATCCCATTAGTAAGCCAATTTGGACCGATTTATCTGATTCTGATATTATTGATCGGTTTGGTCGTATATGTAGAAACCTTTCTCATTATCAAAGTGGATCCTCAAAAAAACATAGTTTGTATCGAATGAAATATATACT Ruppia_maritima_FAL01 GTCCCTATTGTAATGCATGACTACATAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCAATATTGCCGGGACAATGGGTTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCACGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATCCACTCCGGGACAGTAGTAGGTAAACTAGAGGGTGAACGTGAGATGACTTTGGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGCCGTGGTATTTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCGTTGACCGAGATCTTTGGAGATGATTCTGTACTACAATTTGGCGGAGGAACCTTGGGACACCCTTGGGGAAATGCGCCGGGCGCAGTAGCTAATCGTGTGGCTTTGGAAGCGTGTGTACAAGCTCGTAATGAAGGGCGTGATCTGGCTAGTGAAGGTAAGCTTTTTCGGTCCGAGAAGTGCATTGTCGGAACCGGGATAGAACGCCAAGCGGCCTTGGATTCGGGAGTTTCCGCTATAGCGGAACACAAGGGAAAGATCATTTATACCGATACTCATCAAATGATTTTATCAAGTAATGGGAATATTATAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCACCAAAAACCCCGGGCTCCTCTGGGTAAATACATTAAAAAGGGTCAAATTTTAGCAGATGGCGCGGCTACTGTTGGTGGGGAACTCGCTTTGGGAAAAAACATATTAGTAGCTTATATGCCATGGGAAGGCTACAATTTTGAAGACGCGGTACTTATCAGTGAACGTTTGGTATATAATGATATTTATACTTCTTTTCATATACGGAAATATGAAATTCAGACTCATATAACAAGTCAAGGTCCCGAAAGAATCACTAAGGAAATACCTCATTTAGAAGATCATTTACTCCGAAATTTAGACAGAAATGATTCGCGGACAACCAATGAGGGACGGTCATAATAAAGTTTACAAGTCCTTTTCAGATGTAATTGAAGGCAAAGAGGGAAGATTTAGGGAGACTCTGCTTGGTAAACGAGTCGATTATTCGGGACGTTCCGTTATTGTTGTGGGTCCTTCACTTTCATTACATCAATGCGGATTACCTCGAGAAATAGCAATAGAGCTTTTCCAGACATTTGTAATTCGTGGTCTAATCAGACAACATGTTGCTTCTAACATAGGGATTGCTAAAAGTAAAATTCGCGAAAAAGAACGGATTGTATGGGAAATACTTCAAGAAGTTATGCAGGGCCATCCTGTATTGCTGAATAGAGCACCCACCCTGCATAGATTAGGAATACAGGCATTTCAACCTATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAAGGCTTTAATGCAGACTTTGATGGGGATCAAATGGCTGTTCATGTACCTTTATCCTTGGAAGCTCAAGCCGAGGAAAAATCGAGCATATTGCAATAGTTTTTCGTAATGATTTTCATAAAACCCTACGATTGTTCAAGGATCCTTTCATGCATTATGCTAGATATCAAGGAAAATCCCTTCTGGCTTCAAAAGGAACTCATCTTATAATGAAGAAATGGAAATATCACCTTATTAATTTTTTGCAATGGAATTTTTATTTTTGGTCTCAACCATATAGGATTCATATAAAACAACTATTAAAAAATTCCATCTATTTTTTGGGTTATTTTTCTAGTGTATTAAGGAATCCTTTGACAGTAAAAAGTAAAATGCTAGAGTATTCTTTTATAATTGATACTGTTACTAATAAATTTGATACTCTAGTTCCGATTAGTCCTCTCATTGGATCTTTGTCTAAAGCCAAATTTTGTAATGTATCTGGGTATCCCATTAGTAAGCCAATTTGGACCGATTTATCTGATTCTGATATTATTGATCGGTTTGGTCGTATATGTAGAAACCTTTCTCATTATCAAAGTGGATCCTCAAAAAAACATAGTTTGTATCGAATGAAATATATACT Ruppia_maritima_MAR01 GTCCCTATTGTAATGCATGACTACATAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCAATATTGCCGGGACAATGGGTTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCACGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATCCACTCCGGGACAGTAGTAGGTAAACTAGAGGGTGAACGTGAGATGACTTTGGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGCCGTGGTATTTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCGTTGACCGAGATCTTTGGAGATGATTCTGTACTACAATTTGGCGGAGGAACCTTGGGACACCCTTGGGGAAATGCGCCGGGCGCAGTAGCTAATCGTGTGGCTTTGGAAGCGTGTGTACAAGCTCGTAATGAAGGGCGTGATCTGGCTAGTGAAGGTAAGCTTTTTCGGTCCGAGAAGTGCATTGTCGGAACCGGGATAGAACGCCAAGCGGCCTTGGATTCGGGAGTTTCCGCTATAGCGGAACACAAGGGAAAGATCATTTATACCGATACTCATCAAATGATTTTATCAAGTAATGGGAATATTATAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCACCAAAAACCCCGGGCTCCTCTGGGTAAATACATTAAAAAGGGTCAAATTTTAGCAGATGGCGCGGCTACTGTTGGTGGGGAACTCGCTTTGGGAAAAAACATATTAGTAGCTTATATGCCATGGGAAGGCTACAATTTTGAAGACGCGGTACTTATCAGTGAACGTTTGGTATATAATGATATTTATACTTCTTTTCATATACGGAAATATGAAATTCAGACTCATATAACAAGTCAAGGTCCCGAAAGAATTACTAAGGAAATACCTCATTTAGAAGATCATTTACTCCGAAATTTAGACAGAAATGATTCGCGGACAACCAATGAGGGACGGTCATAATAAAGTTTACAAGTCCTTTTCAGATGTAATTGAAGGCAAAGAGGGAAGATTTAGGGAGACTCTGCTTGGTAAACGAGTTGATTATTCGGGACGTTCCGTTATTGTTGTGGGCCCTTCACTTTCATTACATCAATGCGGATTACCTCGAGAAATAGCAATAGAGCTTTTCCAGACATTTGTAATTCGTGGTCTAATCAGACAACATGTTGCTTCTAACATAGGGATTGCTAAAAGTAAAATTCGCGAAAAAGAACGGATTGTATGGGAAATACTTCAAGAAGTTATGCAGGGGCATCCTGTATTGCTGAATAGAGCACCCACCCTGCATAGATTAGGAATACAGGCATTTCAACCTATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAAGGCTTTAATGCAGACTTTGATGGGGATCAAATGGCTGTTCATGTACCTTTATCCTTGGAAGCTCAAGCCGAGGAAAAATCGAGCATATTGCAATAGTTTTTCGTAATGATTTTCATAAAACCCTACGATTGTTCAAGGATCCTTTCATGCATTATGCTAGATATCAAGGAAAATCCCTTCTGGCTTCAAAAGGAACTCATCTTATAATGAAGAAATGGAAATATCACCATATTAATTTTTGGCAATGGAATTTTTATTTTTGGTCTCAACCATATAGGATTCATATAAAACAACTATTAAAAAATTCCTTCTATTTTTTGGGTTATTTTTCTAGTGTATTAATGAATCCTTTGACAGTAAAAAGTAAAATGCTAGAGTCTTCTTTTATAATTGATACTTTTACTAATAAATTTGATACTATAGTTCCGATTAGTCCTCTCATTGGATCTTTGTCTAAAGCCAAATTTTGTAATGTATCTGGGTATCCCATTAGTAAGCCAATTTGGACTGATTTATCTGATTCTGATATTATTGATCGGTTTGGTCGTATATGTAGAAACCTTTCTCATTATCAAAGTGGATCCTCAAAAAAACATAGTTTGTATCGAATGAAATATATACT Ruppia_maritima_SKA02 GTCCCTATTGTAATGCATGACTACATAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCAATATTGCCGAGACAATGGGTTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCACGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATCCACTCCGGGACAGTAGTAGGTAAACTAGAGGGTGAACGTGAGATGACTTTGGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGCCGTGGTATTTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCGTTGACCGAGATCTTTGGAGATGATTCTGTACTACAATTTGGCGGAGGAACCTTGGGACACCCTTGGGGAAATGCGCCGGGCGCAGTAGCTAATCGTGTGGCTTTGGAAGCGTGTGTACAAGCTCGTAATGAAGGGCGTGATCTGGCTAGTGAAGGTAAGCTTTTTCGGTCCGAGAAGTGCATTGTCGGAACCGGGATAGAACGCCAAGCGGCCTTGGATTCGGGAGTTTCCGCTATAGCGGAACACAAGGGAAAGATCCTTTATACCGATACTCATCAAATGATTTTATCAAGTAATGGGAATATTATAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCACCAAAAACCCCGGGCTCCTCTGGGTAAATACATTAAAAAGGGTCAAATTTTAGCAGATGGCGCGGCTACTGTTGGTGGGGAACTCGCTTTGGGAAAAAACATATTAGTAGCTTATATGCCATGGGAAGGCTACAATTTTGAAGACGCGGTACTTATCAGTGAACGTTTGGTATATAATGATATTTATACTTCTTTTCATATACGGAAATATGAAATTCAGACTCATATAACAAGTCAAGGTCCCGAAAGAATCACTAAGGAAATACCTCATTTAGAAGATCATTTACTCCGAAATTTAGACAGAAATGATTCGCGGACAACCAATGAGGGACGGTCATAATAAAGTTTACAAGTCCTTTTCAGATGTAATTGAAGGCAAAGAGGGAAGATTTAGGGAGACTCTGCTTGGTAAACGAGTCGATTATTCGGGACGTTCCGTTATTGTTGTGGGCCCTTCACTTTCATTACATCAATGCGGATTACCTCGAGAAATAGCAATAGAGCTTTTCCAGACATTTGTAATTCGTGGTCTAATCAGACAACATGTTGCTTCTAACATAGGGATTGCTAAAAGTAAAATTCGCGAAAAAGAACGAATTGTATGGGAAATACTTCAAGAAGTTATGCAGGGCCATCCTGTATTGCTGAATAGAGCACCCACCCTGCATAGATTAGGAATACAGGCATTTCAACCTATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAAGGCTTTAATGCAGACTTTGATGGGGATCAAATGGCTGTTCATGTACCTTTATCCTTGGAAGCTCAAGCCGAGGAAAAATCGAGCATATTGCAATAGTTTTTCGTAATGATTTTCATAAAACCCTACGATTGTTCAAGGATCCTTTGATGCATTATGCTAGATATCAAGGAAAATCCCTTCTGGCTTCAAAAGGAACTCATCTTATAATGAAGAAATGGAAATATCACCTTATTAATTTTTGGCAATGGAATTTTTATTTTTGGTCTCAACCATATAGGATTCATATAAAACAACTATTAAAAAATTCCTTCTATTTTTTGGGTTATTTTTCTAGTGTATTAATGAATCCTTTGACAGTAAAAAGTAAAATGCTAGAGTATTCTTTTATAATTGATACTGTTACTAATAAATTTGATACTCTAGTTCCGATTAGTCCTCTCATTGGATCTTTGTCTAAAGCCAAATTTTGTAATGTATCTGGGTATCCCATTAGTAAGCCAATTTGGACCGATTTATCTGATTCTGATATTATTGATCGGTTTGGTCGTATATGTAGAAACCTTTCTCATTATCAAAGTGGATCCTCAAAAAAACATAGTTTGTATCGAATGAAATATATACT Ruppia_maritima_UTA01 GTCCCTATTGTAATGCATGACTACATAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCAATATTGTCGGGACAATGGGTTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCACGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATCCACTCCGGGACAGTAGTAGGTAAACTAGAGGGTGAACGTGAGATGACTTTGGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGCCGTGGTATTTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCGTTGACCGAGATCTTTGGAGATGATTCTGTACTACAATTTGGCGGAGGAACCTTGGGACACCCTTGGGGAAATGCGCCGGGCGCAGTAGCTAATCGTGTGGCTTTGGAAGCGTGTGTACAAGCTCGTAATGAAGGGCGTGATCTGGCTAGTGAAGGTAAGCTTTTTCGGTCCGAGAAGTGCATTGTCGGAACCGGGATAGAACGCCAAGCGGCCTTGGATTCGGGAGTTTCCGCTATAGCGGAACACAAGGGAAAGATCATTTATACCGATACTCATCAAATGATTTTATCAAGTAATGGGAATATTATAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCACCAAAAACCCCGGGCTCCTCTGGGTAAATACATTAAAAAGGGTCAAATTTTAGCAGATGGCGCGGCTACTGTTGGTGGGGAACTCGCTTTGGGAAAAAACATATTAGTAGCTTATATGCCATGGGAAGGCTACAATTTTGAAGACGCGGTACTTATCAGTGAACGTTTGGTATATAATGATATTTATACTTCTTTTCATATACGGAAATATGAAATTCAGACTCATATAACAAGTCAAGGTCCCGAAAGAATTACTAAGGAAATACCTCATTTAGAAGATCATTTACTCCGAAATTTAGACAGAAATGATTCGCGGACAACCCATGAGGGACGGTCATAATAAAGTTTACAAGTCCTTTTCAGATGTAATTGAAGGCAAAGAGGGAAGATTTAGGGAGACTCTGCTTGGTAAACGAGTCGATTATTCGGGACGTTCCGTTATTGTTGTGGGCCCTTCACTTTCATTACATCAATGCGGATTACCTCGAGAAATAGCAATAGAGCTTTTCCAGACATTTGTAATTCGTGGTCTAATCAGACAACATGTTGCTTCTAACATAGGGATTGCTAAAAGTAAAATTCGCGAAAAAGAACGGATTGTATGGGAAATACTTCAAGAAGTTATGCAGGGGCATCCTGTATTGCTGAATAGAGCACCCACCCTGCATAGATTAGGAATACAGGCATTTCAACCTATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAAGGCTTTAATGCAGACTTTGATGGGGATCAAATGGCTGTTCATGTACCTTTATCCTTGGAAGCTCAAGCCGAGGAAAAATCGAGCATATTGCAATAGTTTTTCGTAATGATTTTCATAAAACCCTACGATTGTTCAAGGATCCTTTCATGCATTATGCTAGATATCAAGGAAAATCCCTTCTGGCTTCAAAAGGAACTCATCTTATAATGAAGAAATGGAAATATCACCATATTAATTTTTGGCAATGGAATTTTTATTTTTGGTCTCAACCATATAGGATTCATATAAAACAACTATTAAAAAATTCTTTCTATTTTTTGGGTTATTTTTCTAGTGTATTAATGAATCCTTTGACAGTAAAAAGTAAAATGCTAGAGTATTCTTTTATAATTGATACTGTTACTAATCAATTTGATACTATAGTTCCGATTAGTCCTCTCATTGGATCTTTGTCTAAAGCCAAATTTTGTAATGTATCTGGGTATCCCATTAGTAAGCCAATTTGGACCGATTTATCTGATTCTGATATTATTGATCGGTTTGGTCGTATATGTAGAAACCTTTCTCATTATCAAAGTGGATCCTCAAAAAAACATAGTTTGTATCGAATGAAATATATACT Ruppia_maritima_YHO01 GTCCCTATTGTAATGCATGACTACATAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCAATATTGCCGGGACAATGGGTTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCACGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATCCACTCCGGGACAGTAGTAGGTAAACTAGAGGGTGAACGTGAGATGACTTTGGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGCCGTGGTATTTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCGTTGACCGAGATCTTTGGAGATGATTCTGTACTACAATTTGGCGGAGGAACCTTGGGACACCCTTGGGGAAATGCGCCGGGCGCAGTAGCTAATCGTGTGGCTTTGGAAGCGTGTGTACAAGCTCGTAATGAAGGGCGTGATCTGGCTAGTGAAGGTAAGCTTTTTCGGTCCGAGAAGTGCATTGTCGGAACCGGGATAGAACGCCAAGCGGCCTTGGATTCGGGAGTTTCCGCTATAGCGGAACACAAGGGAAAGATCATTTATACCGATACTCATCAAATGATTTTATCAAGTAATGGGAATATTATAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCACCAAAAACCCCGGGCTCCTCTGGGTAAATACATTAAAAAGGGTCAAATTTTAGCAGATGGCGCGGCTACTGTTGGTGGGGAACTCGCTTTGGGAAAAAACATATTAGTAGCTTATATGCCATGGGAAGGCTACAATTTTGAAGACGCGGTACTTATCAGTGAACGTTTGGTATATAATGATATTTATACTTCTTTTCATATACGGAAATATGAAATTCAGACTCATATAACAAGTCAAGGTCCCGAAAGAATTACTAAGGAAATACCTCATTTAGAAGATCATTTACTCCGAAATTTAGACAGAAATGATTCGCGGACAACCAATGAGGGACGGTCATAATAAAGTTTACAAGTCCTTTTCAGATGTAATTGAAGGCAAAGAGGGAAGATTTAGGGAGACTCTGCTTGGTAAACGAGTTGATTATTCGGGACGTTCCGTTATTGTTGTGGGCCCTTCACTTTCATTACATCAATGCGGATTACCTCGAGAAATAGCAATAGAGCTTTTCCAGACATTTGTAATTCGTGGTCTAATCAGACAACATGTTGCTTCTAACATAGGGATTGCTAAAAGTAAAATTCGCGAAAAAGAACGGATTGTATGGGAAATACTTCAAGAAGTTATGCAGGGGCATCCTGTATTGCTGAATAGAGCACCCACCCTGCATAGATTAGGAATACAGGCATTTCAACCTATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAAGGCTTTAATGCAGACTTTGATGGGGATCAAATGGCTGTTCATGTACCTTTATCCTTGGAAGCTCAAGCCGAGGAAAAATCGAGCATATTGCAATAGTTTTTCGTAATGATTTTCATAAAACCCTACGATTGTTCAAGGATCCTTTCATGCATTATGCTAGATATCAAGGAAAATCCCTTCTGGCTTCAAAAGGAACTCATCTTATAATGAAGAAATGGAAATATCACCATATTAATTTTTGGCAATGGAATTTTTATTTTTGGTCTCAACCATATAGGATTCATATAAAACAACTATTAAAAAATTCCTTCTATTTTTTGGGTTATTTTTCTAGTGTATTAATGAATCCTTTGACAGTAAAAAGTAAAATGCTAGAGTATTCTTTTATAATTGATACTTTTACTAATAAATTTGATACTATAGTTCCGATTAGTCCTCTCATTGGATCTTTGTCTAAAGCCAAATTTTGTAATGTATCTGGGTATCCCATTAGTAAGCCAATTTGGACTGATTTATCTGATTCTGATATTATTGATCGGTTTGGTCGTATATGTAGAAACCTTTCTCATTATCAAAGTGGATCCTCAAAAAAACATAGTTTGTATCGAATGAAATATATACT Ruppia_megacarpa_MED01 GTCCCTATTGTAATGCATGACTACATAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCAATATTGCCGGGACAATGGGTTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCACGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATCCACGCCGGGACAGTAGTGGGTAAACTAGAGGGTGAACGTGAGATGACTTTGGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGCCGTGGTATTTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCGTTGACCGAGATCTTTGGAGATGATTCTGTACTACAATTTGGCGGAGGAACCTTGGGACACCCTTGGGGAAATGCGCCGGGCGCAGTAGCTAATCGTGTGGCTTTGGAAGCGTGTGTACAAGCTCGTAATGAAGGGCGTGATCTGGCTAGTGAAGGTAAGCTTTTTCGGTCCGAGAAGTGCATTGTTGGAACCGGGATAGAACGCCAAGCGGCCTTGGATTCGGGAGTTTCCGCTATAGCGGAACACAAGGGAAAGATCATTTATACCGATACTCACCAAATGATTTTATCAAGTAATGGGAATACTATAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCACCAAAAACCCCGGGCTCCTCTGGGTAAATACATTAAAAAGGGTCAAATTTTAGCAGATGGCGCGGCTACTGTTGGTGGGGAACTCGCTTTGGGAAAAAACATATTAGTAGCTTATATGCCATGGGAAGGCTACAATTTTGAAGACGCGGTACTTATCAGTGAACGTTTGGTATATAATGATATTTATACTTCTTTTCACATACGGAAATATGAAATTCAGACTCATATAACAAGTCAAGGTCCCGAAAGAATCACTAAGGAAATACCTCATTTAGAAGATCATTTACTCCGAAATTTAGACAGAAATGATTCGCGGACAACCAATGAGGGACGGTCATAATAAAGTTTACAAGTCCTTTTCAGATGTAATTGAAGGCAAAGAGGGAAGATTTAGGGAGACTCTGCTTGGTAAACGAGTCGATTATTCGGGACGTTCCGTTATTGTTGTGGGCCCTTCACTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTTTTCCAGACATTTGTAATTCGTGGTCTAATCAGACAACATGTTGCTTCTAACATAGGGATTGCTAAAAGTAAAATTCGCGAAAAAGAACGGATTGTATGGGAAATACTTCAAGAAGTTATGCAGGGTCATCCTGTATTGCTGAATAGAGCACCTACCCTGCATAGATTAGGAATACAGGCATTTCAACCTATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAAGGCTTTAATGCAGACTTTGATGGGGATCAAATGGCTGTTCATGTACCTTTATCCTTGGAAGCTCAAGCCGAGGAAAAATCGAGCATATTGCAATAGTTTTTCGTAATGATTTTCATAAAACCCTACAATTGTTCAAGGATCCTTTCATGCATTATGCTAGATATCAAGGAAAATCCCTTCTGGCTTCAAAAGGAACTCATCTTATAATGAAGAAATGGAAATATCACCTTATTAATTTTTGGCAATGGAATTTTTATTTTTGGTCTCAACCATATAGGATTCCTATAAAACAACTATTAAAAAATTCCTTCTATTTTTTGGGTTATTTTTCTAGTGTATTAATGAATCCTTTGACAGTAAAAAGTAAAATGCTAGAGTATTCTTTTATAATTGATACTGTTACTAATAAATTTGATACTCTAGTTCCGATTAGTCCTCTCATTGGATCTTTGTCTAAAGCCAAATTTTGTAATGTATCTGGGTATCCCGTTAGTAAGCCGGTTTGGACCGATTTATCTGATTCTGATATTATTGATCGGTTTGGTCGTATATGTAGAAACCTTTCTCATTATCAAAGTGGATCCTCAAAAAAACATAGTTTGTATCGAATGAAGTATATACT Ruppia_polycarpa_DEV01 GTCCCTATTGTAATGCATGACTACATAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCAATATTGTCGGGACAATGGGTTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCACGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATCCACTCCGGGACAGTAGTAGGTAAACTAGAGGGTGAACGTGAGATGACTTTGGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGCCGTGGTATTTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCGTTGACCGAGATCTTTGGAGATGATTCTGTACTACAATTTGGCGGAGGAACCTTGGGACACCCTTGGGGAAATGCGCCGGGCGCAGTAGCTAATCGTGTGGCTTTGGAAGCGTGTGTACAAGCTCGTAATGAAGGGCGTGATCTGGCTAGTGAAGGTAAGCTTTTTCGGTCCGAGAAGTGCATTGTCGGAACCGGGATAGAACGCCAAGCGGCCTTGGATTCGGGAGTTTCCGCTATAGCGGAACACAAGGGAAAGATCATTTATACCGATACTCATCAAATGATTTTATCAAGTAATGGGAATATTATAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCACCAAAAACCCCGGGCTCCTCTGGGTAAATACATTAAAAAGGGTCAAATTTTAGCAGATGGCGCGGCTACTGTTGGTGGGGAACTCGCTTTGGGAAAAAACATATTAGTAGCTTATATGCCATGGGAAGGCTACAATTTTGAAGACGCGGTACTTATCAGTGAACGTTTGGTATATAATGATATTTATACTTCTTTTCATATACGGAAATATGAAATTCAGACTCATATAACAAGTCAAGGTCCCGAAAGAATTACTAAGGAAATACCTCATTTAGAAGATCATTTACTCCGAAATTTAGACAGAAATGATTCGCGGACAACCCATGAGGGACGGTCATAATAAAGTTTACAAGTCCTTTTCAGATGTAATTGAAGGCAAAGAGGGAAGATTTAGGGAGACTCTGCTTGGTAAACGAGTCGATTATTCGGGACGTTCCGTTATTGTTGTGGGCCCTTCACTTTCATTACATCAATGCGGATTACCTCGAGAAATAGCAATAGAGCTTTTCCAGACATTTGTAATTCGTGGTCTAATCAGACAACATGTTGCTTCTAACATAGGGATTGCTAAAAGTAAAATTCGCGAAAAAGAACGGATTGTATGGGAAATACTTCAAGAAGTTATGCAGGGGCATCCTGTATTGCTGAATAGAGCACCCACCCTGCATAGATTAGGAATACAGGCATTTCAACCTATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAAGGCTTTAATGCAGACTTTGATGGGGATCAAATGGCTGTTCATGTACCTTTATCCTTGGAAGCTCAAGCCGAGGAAAAATCGAGCATATTGCAATAGTTTTTCGTAATGATTTTCATAAAACCCTACGATTGTTCAAGGATCCTTTCATGCATTATGCTAGATATCAAGGAAAATCCCTTCTGGCTTCAAAAGGAACTCATCTTATAATGAAGAAATGGAAATATCACCATATTAATTTTTGGCAATGGAATTTTTATTTTTGGTCTCAACCATATAGGATTCATATAAAACAACTCTTAAAAAATTCTTTCTATTTTTTGGGTTATTTTTCTAGTGTATTAATGAATCCTTTGACAGTAAAAAGTAAAATGCTAGAGTATTCTTTTATAATTGATACTGTTACTAATCAATTTGATACTATAGTTCCGATTAGTCCTCTCATTGGATCTTTGTCTAAAGCCAAATTTTGTAATGTATCTGGGTATCCCATTAGTAAGCCAATTTGGACCGATTTATCTGATTCTGATATTATTGATCGGTTTGGTCGTATATGTAGAAACCTTTCTCATTATCAAAGTGGATCCTCAAAAAAACATAGTTTGTATCGAATGAAATATATACT Ruppia_polycarpa_POB01 GTCCCTATTGTAATGCATGACTACATAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCAATATTGCCGGGACAATGGGTTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCACGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATCCACTCCGGGACAGTAGTAGGTAAACTAGAGGGTGAACGTGAGATGACTTTGGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGCCGTGGTATTTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCGTTGACCGAGATCTTTGGAGATGATTCTGTACTACAATTTGGCGGAGGAACCTTGGGGCACCCTTGGGGAAATGCTCCGGGCGCAGTAGCTAATCGTGTGGCTTTGGAAGCGTGTGTACAAGCTCGTAATGAAGGGCGTGATCTGGCTAGTGAAGGTAAGCTTTTTCGGTCCGAGAAGTGCATTGTCGGAACCGGGATAGAACGCCAAGCGGCCTTGGATTCGGGAGTTTCCGCTATAGCGGAACACAAGGGAAAGATCATTTATACCGATACTCATCAAATGATTTTATCAAGTAATGGGAATATTATAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCACCAAAAACCCCGGGCTCCTCTGGGTAAATACATTAAAAAGGGTCAAATTTTAGCAGATGGCGCGGCCACTGTTGGTGGGGAACTCGCTTTGGGAAAAAACATATTAGTAGCTTATATGCCATGGGAAGGCTACAATTTTGAAGACGCGGTACTTATCAGTGAACGTTTGGTATATAATGATATTTATACTTCTTTTCATATACGGAAATATGAAATTCAGACTCATATAACAAGTCAAGGTCCCGAAAGAATCACTAAGGAAATACCTCATTTAGAAGATCATTTACTCCGAAATTTAGACAGAAATGATTCGCGGACAACCAATGAGGGACGGTCATAATAAAGTTTACAAGTCCTTTTCAGATGTAATTGAAGGCAAAGAGGGAAGATTTAGGGAGACTCTGCTTGGTAAACGAGTCGATTATTCGGGACGTTCCGTTATTGTTGTGGGCCCTTCACTTTCATTACATCAATGCGGATTACCTCGAGAAATAGCAATAGAGCTTTTCCAGACATTTGTAATTCGTGGTCTAATCAGACAACATGTTGCTTCTAACATAGGGATTGCTAAAAGTAAAATTCGCGAAAAAGAACGGATTGTATGGGAAATACTTCAAGAAGTTATGCAGGGCCATCCTGTATTGCTGAATAGAGCACCCACCCTGCATAGATTAGGAATACAGGCATTTCAACCTATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAAGGCTTTAATGCAGACTTTGATGGGGATCAAATGGCTGTTCATGTACCTTTATCCTTGGAAGCTCAAGCCGAGGAAAAATCGAGCATATTGCAATAGTTTTTCGTAATGATTTTCATAAAACCCTACGATTGTTCAAGGATCCTTTCATGCATTATGCTAGATATCAAGGAAAATCCCTTCTGGCTTCAAAAGGAACTCATCTTATAATGAAGAAATGGAAATATCACCTTATTAATTTTTGGCAATGGAATTTTTCTTTTTGGTCTCAACCATATAGGATTCATATAAAACAACTATTAAACAATTCCTTCTATTTTTTGGGTTATTTTTCTAGTGTATTAATGAATCCTTTGACAGTAAAAAGTAAAATGCTAGAGTATTCTTTTATAATTGATACTGTTACTAATAAATTTGATACTCTAGTTCCAATTAGTCCTCTCATTGGATCTTTGTCTAAAGCCAAATTTTGTAATGTATCTGGGTATCCCATTAGTAAGCCAATTTGGACCGATTTATCTGATTCTGATATTATTGATCGGTTTGGTCGTATATGTAGAAACCTTTCTCATTATCAAAGTGGATCCTCAAAAAAACATAGTTTGTATCGAATGAAATATATACT Ruppia_tuberosa_TUA01 GTCCCTATTGTAATGCATGACTACATAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCAATATTGCCGGGACAATGGGTTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCACGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATCCACTCCGGGACAGTAGTAGGTAAACTAGAGGGTGAACGTGAGATGACTTTGGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGCCGTGGTATTTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCGTTGACCGAGATCTTTGGAGATGATTCTGTACTACAATTTGGCGGAGGAACCTTGGGACACCCTTGGGGAAATGCGCCGGGCGCAGTAGCTAATCGTGTGGCTTTGGAAGCGTGTGTACAAGCTCGTAATGAAGGGCGTGATCTGGCTAGTGAAGGTAAGCTGTTTCGGTCTGAGAAGTGCATTGTCGGAACCGGGATAGAACGCCAAGCGGCCTTGGATTCGGGAGTTTCCGCTATAGCGGAACACAAGGGAAAGATCGTTTATACCGATACTCACCAAATGATTTTATCAAGTAATGGGAATACTATAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCACCAAAAACCCCGGGCTCCTCTGGGTAAATACATTAAAAAGGGTCAAATTTTAGCAGATGGCGCGGCTACTGTTGGTGGGGAACTCGCTTTGGGAAAAAACATATTAGTAGCTTATATGCCATGGGAAGGCTACAATTTTGAAGACGCGGTACTTATCAGTGAACGTTTGGTATATAATGATATTTATACTTCTTTTCACATACGGAAATATGAAATTAAGACTCATATAACAAGTCAAGGTCCCGAAAGAATCACTAAGGAAATACCTCATTTAGAAGATCATTTACTCCGAAATTTAGACAGAAATGATTCGCGGACAACCAATGAGGGACGGTCATAATAAAGTTTACAAGTCCTTTTCAGATGTAATTGAAGGCAAAGAGGGAAGATTTAGGGAGACTCTGCTTGGTAAACGAGTCGATTATTCGGGACGTTCCGTTATTGTTGTGGGCCCTTCACTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTTTTCCAGACATTTGTAATTCGTGGTCTAATCAGACAACATGTTGCTTCTAACATAGGGATTGCTAAAAGTAAAATTCGCGAAAAAGAACGGATTGTATGGGAAATACTTCAAGAAGTTATGCAGGGCCATCCTGTATTGCTGAATAGAGCACCCACCCTGCATAGATTAGGAATACAGGCATTTCAACCTATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAAGGCTTTAATGCAGACTTTGATGGGGATCAAATGGCTGTTCATGTACCTTTATCCTTGGAAGCTCAAGCCGAGGAAAAATCGAGCATATTGCAATAGTTTTTCGTAATGATTTTCATAAAACCCTACGATTGTTCAAGGATCCTTTCATGCATTATGCTAGATATCAAGGAAAATCCCTTCTGGCTTCAAAAGGAACTCATCTTATAATGAAGAAATGGAAATATCACCTTATTAATTTTTGGCAATGGAATTTTTATTTTTGGTCTCAACCATATAGGATTCATATAAAACAACTATTAAAAAATTCCTTCTATTTTTTGGGTTATTTTTCTAGTGTCTTAATGAATCCTTTGACAGTAAAAAGTAAAATGCTAGAGTCTTCTTTTATAATTGATACTGTTACTAATAAATTTGATACTATAGTTCCGATTAGTCCTCTCATTGGATCTTTGTCTAAAGCCAAATTTTGTAATGTATCTGGGTATCCCATTAGTAAGCCAATTTGGACCGATTTATCTGATTCTGATATTATTGATCGGTTTGGTCGTATATGTAGAAACCTTTCTCATTATCCAAGTGGATCCTCAAAAAAACATAGTTTGTATCGAATGAAGTATATACT Ruppia_tuberosa_TUE01 GTCCCTATTGTAATGCATGACTACATAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCAATATTGCCGGGACAATGGGTTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCACGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATCCACTCCGGGACAGTAGTAGGTAAACTAGAGGGTGAACGTGAGATGACTTTGGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGCCGTGGTATTTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCGTTGACCGAGATCTTTGGAGATGATTCTGTACTACAATTTGGCGGAGGAACCTTGGGACACCCTTGGGGAAATGCGCCGGGCGCAGTAGCTAATCGTGTGGCTTTGGAAGCGTGTGTACAAGCTCGTAATGAAGGGCGTGATCTGGCTAGTGAAGGTAAGCTTTTTCGGTCTGAGAAGTGCATTGTCGGAACCGGGATAGAACGCCAAGCGGCCTTGGATTCGGGAGTTTCCGCTATAGCGGAACACAAGGGAAAGATCATTTATACCGATACTCACCAAATGATTTTATCAAGTAATGGGAATACTATAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCACCAAAAACCCCGGGCTCCTCTGGGTAAATACATTAAAAAGGGTCAAATTTTAGCAGATGGCGCGGCTACTGTTGGTGGGGAACTCGCTTTGGGAAAAAACATATTAGTAGCTTATATGCCATGGGAAGGCTACAATTTTGAAGACGCGGTACTTATCAGTGAACGTTTGGTATATAATGATATTTATACTTCTTTTCACATACGGAAATATGAAATTAAGACTCATATAACAAGTCAAGGTCCCGAAAGAATCACTAAGGAAATACCTCATTTAGAAGATCATTTACTCCGAAATTTAGACAGAAATGATTCGCGGACAACCAATGAGGGACGGTCATAATAAAGTTTACAAGTCCTTTTCAGATGTAATTGAAGGCAAAGAGGGAAGATTTAGGGAGACTCTGCTTGGTAAACGAGTCGATTATTCGGGACGTTCCGTTATTGTTGTGGGCCCTTCACTTTCATTACATCAATGTGGATTACCTCGAGAAATAGCAATAGAGCTTTTCCAGACATTTGTAATTCGTGGTCTAATCAGACAACATGTTGCTTCTAACATAGGGATTGCTAAAAGTAAAATTCGCGAAAAAGAACGGATTGTATGGGAAATACTTCAAGAAGTTATGCAGGGCCATCCTGTATTGCTGAATAGAGCACCCACCCTGCATAGATTAGGAATACAGGCATTTCAACCTATTTTAGTGGAGGGACGTGCTATTTGTTTACACCCATTAGTTTGTAAAGGCTTTAATGCAGACTTTGATGGGGATCAAATGGCTGTTCATGTACCTTTATCCTTGGAAGCTCAAGCCGAGGAAAAATCGAGCATATTGCAATAGTTTTTCGTAATGATTTTCATAAAACCCTACGATTGTTCAAGGATCCTTTCATGCATTATGCTAGATATCAAGGAAAATCCCTTCTGGCTTCAAAAGGAACTCATCTTATAATGAAGAAATGGAAATATCACCTTATTAATTTTTGGCAATGGAATTTTTATTTTTGGTCTCAACCATATAGGATTCATATAAAACAACTATTAAAAAATTCCTTCTATTTTTTGGGTTATTTTTCTAGTGTCTTAATGAATCCTTTGACAGTAAAAAGTAAAATGCTAGAGTCTTCTTTTATAATTGATACTGTTACTAATAAATTTGATACTCTAGTTCCGATTAGTCCTCTCATTGGATCTTTGTCTAAAGCCAAATTTTGTAATGTATCTGGGTATCCCATTAGTAAGCCAATTTGGACCGATTTATCTGATTCTGATATTATTGATCGGTTTGGTCGTATATGTAGAAACCTTTCTCATTATCCAAGTGGATCCTCAAAAAAACATAGTTTGTATCGAATGAAGTATATACT Syringodium_isoetifolium_Sis03 GTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGTCTTATTATTGCCGGGACAATGGCTTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCGTTACGTATGTCCGGTGGAGATCATATTCACGGGGGTACAGTAGTGGGTAAACTAGAGGGTGAACGTGAGATGACTTTGGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGCCGCGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTTTGCCAGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACCGAGATCTTTGGAGATGATTCTGTACTACAGTTTGGTGGAGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGTGTGGCTTTGGAAGCGTGTGTACAAGCTCGTAATGAAGGGCGTGATCTGGCTACTGAGGGTAAGCTTTCTCGGTCCGAGAAGTGCATTGTTGGAACCGGGCTGGAACGCCAAGTGGCCCTGGATTCGGGAGTTTCCGCTATAGCAGAAGGCGAGGGAAAGATCATTTATACTGATACTCAAAAAATGATTTTATCAAGTAATAGGAACACTATAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCACCAAAAACCCCGGGTTCCACGAGGTAAATACATTAAAAAAGGGCAAATTTTAGCAGACGGTGCGGCTACTGTTGGTGGAGAACTCGCTTTGGGAAAAAACGTATTAGTAGCTTATATGCCATGGGAAGGCTACAATTTTGAAGACGCGGTACTTATCAGTGAACGTCTGGTATATAATGATATCTATACTTCTTTTCACATACGGAAATATGAAATTCAGACTCATATGACAAGTCAAGGTCCCGAAAGAATAACTAAGGAAATACCTCATTTAGAGGATCATTTACTCCGAAATTTAGACAGAAATGATTCGCGGACAACCAATGAAGGACGGTCATAATAAAGTTTACAAGTCCTTTTCAGATGTAATTGAGGGCAAAGAAGGAAGATTTCGCGAGACTCTGCTTGGTAAACGAGTCGATTATTCGGGACGTTCCGTTATTGTCGTGGGCCCCTCACTTTCATTACATCAATGTGGATTACCTAGAGAAATAGCAATAGAGCTTTTCCAGACATTTGTAATTCGTGGTCTAATCAGACGACATGTGGCTTCCAACATAGGGATTGCTAAAAGTAAAATTCGAGAAAAAGAACTGATTGTATGGGAAATACTTCAAGAAGTTATGCAGGGACATCCTGTATTGCTGAATAGAGCACCCACCCTGCATAGATTAGGAATACAGGCATTTCAACCTATTTTAGTGGAGGGGCGCGCTATTTGTTTACACCCATTAGTTTGTAAGGGCTTTAATGCGGACTTTGATGGGGATCAAATGGCTGTTCATTTACCTTTATCTTTGGAAGCTCAAGCCGAGGAAAAATAGAACATCTTGCAGTAGTTTTTCGTAATGATTTTCAGAAAACCCTACGATTGCTCAAAGATCCTTTCCTGCATTATGTTAGATATCAAGGAAAATCAATCTTGGCGTCAAAGGGAACTCATCTTATAATGAAGAAATGGAAATATTACCTTGTCCATTTTTGGCAATGGAATTTTTATTTTTGGTCTCAACCACATAGGATTCATATAAACCAATTATCAAATAATTCCCTCTATTTTATGGGTTATCTTTCCAGTGTATTGATAAATCCTTTGACAGTAAAGAGTAAAATGTTAGAGTATTCTTTTATAATAGACATTGTTAGTAATAAATTCGATACTCTAGTTCCGATTATTCCTCTCATTGGATCTTTATCTAAAGCAAAATTTTGTAATGTATCCGGATATCCCATTAGTAAGCCAGTTTGGACCGATTTATCTGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATCACAGTGGTTCCTCAAAAAAACAGAATTTGTATCGAATCAAGTATATACT ; END; BEGIN TREES; TITLE RuppiaPhyB_38Fdw_ML_TB; LINK TAXA = Taxa2; TRANSLATE 1 Ruppia_tuberosa_TUE0101, 2 Ruppia_tuberosa_TUE0102, 3 Ruppia_maritima_ANA01, 4 Ruppia_polycarpa_DEV01, 5 Ruppia_maritima_DUB0201, 6 Ruppia_maritima_DUB0202, 7 Ruppia_polycarpa_POB01, 8 Syringodium_isoetifolium_Sis03, 9 Ruppia_maritima_MAR01, 10 Ruppia_maritima_SKA0202, 11 Ruppia_tuberosa_TUA0100, 12 Ruppia_tuberosa_TUA0114, 13 Ruppia_megacarpa_MED01, 14 Ruppia_maritima_UTA01, 15 Ruppia_maritima_YHO01, 16 Ruppia_maritima_GRA01, 17 Potamogeton_maackianus_Pm052, 18 Ruppia_maritima_FAL0111, 19 Ruppia_maritima_FAL0113, 20 Ruppia_maritima_MAH02; TREE RuppiaPhyB_38Fdw_ML = [&R] ((8:0.1329,17:0.1526):0.03415,((((((((3:0.001,15:0.0):0.001,20:0.0):0.0019,(6:0.001,(9:0.0,16:0.001):0.001):0.001):0.0028,(4:0.0,14:0.0068,19:0.0058):0.0011):0.0121,((5:0.003,10:0.0037):0.0135,18:0.0189):0.0039):0.0069,7:0.0144):0.0135,13:0.0133):0.0178,((11:0.0203,12:0.0112):0.0071,(1:0.0,2:0.0048):0.0114):0.0795):0.03415); END; BEGIN TREES; TITLE Ruppia_PtDNA_ml; LINK TAXA = Taxa1; TRANSLATE 1 Ruppia_maritima_DUB02, 2 Ruppia_megacarpa_MED01, 3 Ruppia_maritima_UTA01, 4 Ruppia_polycarpa_DEV01, 5 Ruppia_maritima_SKA02, 6 Ruppia_polycarpa_POB01, 7 Ruppia_maritima_YHO01, 8 Ruppia_maritima_ART01, 9 Ruppia_maritima_MAR01, 10 Syringodium_isoetifolium_Sis03, 11 Ruppia_tuberosa_TUA01, 12 Ruppia_tuberosa_TUE01, 13 Potamogeton_maackianus_Pm052, 14 Ruppia_maritima_FAL01; TREE PAUP_1 = [&R] ((2:0.0036,((11:0.0014,12:0.0):0.0024,(((3:0.0,4:5.0E-4):0.0019,(7:0.0,8:5.0E-4,9:5.0E-4):0.0014):0.0019,6:0.0034,14:0.0019,(1:0.001,5:5.0E-4):0.0014):0.0024):0.0017):0.02105,(10:0.0317,13:0.0559):0.02105); END; BEGIN TREES; TITLE RuppiaPhyB_38Fdw_Bayes; LINK TAXA = Taxa2; TRANSLATE 1 Ruppia_tuberosa_TUE0101, 2 Ruppia_tuberosa_TUE0102, 3 Ruppia_maritima_ANA01, 4 Ruppia_polycarpa_DEV01, 5 Ruppia_maritima_DUB0201, 6 Ruppia_maritima_DUB0202, 7 Ruppia_polycarpa_POB01, 8 Syringodium_isoetifolium_Sis03, 9 Ruppia_maritima_MAR01, 10 Ruppia_maritima_SKA0202, 11 Ruppia_tuberosa_TUA0100, 12 Ruppia_tuberosa_TUA0114, 13 Ruppia_megacarpa_MED01, 14 Ruppia_maritima_UTA01, 15 Ruppia_maritima_YHO01, 16 Ruppia_maritima_GRA01, 17 Potamogeton_maackianus_Pm052, 18 Ruppia_maritima_FAL0111, 19 Ruppia_maritima_FAL0113, 20 Ruppia_maritima_MAH02; TREE con_50_majrule = [&R] ((8:0.141469,17:0.160044)1.00:0.037196,((((((((3:0.002097,15:9.73E-4)0.98:0.00199,20:9.74E-4)1.00:0.003047,(6:0.00204,(9:9.41E-4,16:0.002007)0.97:0.001995)0.93:0.002042)1.00:0.004293,(4:0.00105,14:0.008044,19:0.007155)0.68:0.002361)1.00:0.014078,((5:0.004053,10:0.004939)1.00:0.015238,18:0.020757)0.86:0.00534)0.98:0.008339,7:0.016107)1.00:0.015315,13:0.01509)0.99:0.020081,((11:0.020435,12:0.013267)0.71:0.008528,1:0.016506,2:0.020951)1.00:0.083612)1.00:0.037196); END; BEGIN TREES; TITLE Ruppia_PtDNA; LINK TAXA = Taxa1; TRANSLATE 1 Ruppia_maritima_DUB02, 2 Ruppia_megacarpa_MED01, 3 Ruppia_maritima_UTA01, 4 Ruppia_polycarpa_DEV01, 5 Ruppia_maritima_SKA02, 6 Ruppia_polycarpa_POB01, 7 Ruppia_maritima_YHO01, 8 Ruppia_maritima_ART01, 9 Ruppia_maritima_MAR01, 10 Syringodium_isoetifolium_Sis03, 11 Ruppia_tuberosa_TUA01, 12 Ruppia_tuberosa_TUE01, 13 Potamogeton_maackianus_Pm052, 14 Ruppia_maritima_FAL01; TREE PAUP_2 = [&R] ((2:5.0,((11:3.0,12:0.0):6.0,(6:6.0,(((3:0.0,4:1.0):4.0,(7:0.0,8:1.0,9:1.0):3.0):4.0,14:4.0,(1:2.0,5:1.0):3.0):1.0):5.0):6.0):38.0,(10:54.0,13:93.0):38.0); TREE PAUP_1 = [&R] ((10:54.0,13:93.0):38.0,(2:5.0,((11:3.0,12:0.0):5.0,(((3:0.0,4:1.0):4.0,(7:0.0,8:1.0,9:1.0):3.0):4.0,6:7.0,14:4.0,(1:2.0,5:1.0):3.0):5.0):7.0):38.0); END; BEGIN TREES; TITLE Ruppia_PtDNA_bayes; LINK TAXA = Taxa1; TRANSLATE 1 Ruppia_maritima_DUB02, 2 Ruppia_megacarpa_MED01, 3 Ruppia_maritima_UTA01, 4 Ruppia_polycarpa_DEV01, 5 Ruppia_maritima_SKA02, 6 Ruppia_polycarpa_POB01, 7 Ruppia_maritima_YHO01, 8 Ruppia_maritima_ART01, 9 Ruppia_maritima_MAR01, 10 Syringodium_isoetifolium_Sis03, 11 Ruppia_tuberosa_TUA01, 12 Ruppia_tuberosa_TUE01, 13 Potamogeton_maackianus_Pm052, 14 Ruppia_maritima_FAL01; TREE con_50_majrule = [&R] ((2:0.004299,((11:0.00201,12:4.98E-4)1.00:0.003004,(((3:4.92E-4,4:0.001035)1.00:0.002407,(7:4.71E-4,8:0.001039,9:0.001005)1.00:0.001957)1.00:0.002502,6:0.003917,14:0.00248,(1:0.001431,5:9.73E-4):0.001953)1.00:0.002989)1.00:0.002299)0.91:0.022159,(10:0.033449,13:0.058349)1.00:0.022159); TREE con_50_majrule = [&R] ((2:0.004299,((11:0.00201,12:4.98E-4):0.003004,(((3:4.92E-4,4:0.001035):0.002407,(7:4.71E-4,8:0.001039,9:0.001005):0.001957):0.002502,6:0.003917,14:0.00248,(1:0.001431,5:9.73E-4):0.001953):0.002989):0.002299):0.022159,(10:0.033449,13:0.058349):0.022159); END; BEGIN TREES; TITLE RuppiaPhyB_38Fdw_TB; LINK TAXA = Taxa2; TRANSLATE 1 Ruppia_tuberosa_TUE0101, 2 Ruppia_tuberosa_TUE0102, 3 Ruppia_maritima_ANA01, 4 Ruppia_polycarpa_DEV01, 5 Ruppia_maritima_DUB0201, 6 Ruppia_maritima_DUB0202, 7 Ruppia_polycarpa_POB01, 8 Syringodium_isoetifolium_Sis03, 9 Ruppia_maritima_MAR01, 10 Ruppia_maritima_SKA0202, 11 Ruppia_tuberosa_TUA0100, 12 Ruppia_tuberosa_TUA0114, 13 Ruppia_megacarpa_MED01, 14 Ruppia_maritima_UTA01, 15 Ruppia_maritima_YHO01, 16 Ruppia_maritima_GRA01, 17 Potamogeton_maackianus_Pm052, 18 Ruppia_maritima_FAL0111, 19 Ruppia_maritima_FAL0113, 20 Ruppia_maritima_MAH02; TREE PAUP_1 = [&R] (((((((((3:1.0,15:0.0):1.0,20:0.0):2.0,(6:1.0,(9:0.0,16:1.0):1.0):1.0):3.0,((4:0.0,19:6.0):0.0,14:7.0):1.0):9.0,((5:4.0,10:3.0):14.0,18:17.0):6.0):9.0,7:12.0):15.0,13:13.0):20.0,((11:15.0,12:16.0):7.0,(1:1.0,2:4.0):17.0):63.0):27.5,(8:85.0,17:103.0):27.5); TREE PAUP_4 = [&R] (1:1.0,2:4.0,((((((((((3:1.0,15:0.0):1.0,20:0.0):2.0,(6:1.0,(9:0.0,16:1.0):1.0):1.0):4.0,4:0.0,19:6.0):1.0,14:6.0):10.0,((5:4.0,10:3.0):13.0,18:18.0):6.0):8.0,7:12.0):15.0,13:13.0):20.0,(8:85.0,17:103.0):55.0):63.0,(11:15.0,12:16.0):7.0):17.0); TREE PAUP_3 = [&R] (((((((((3:1.0,15:0.0):1.0,20:0.0):2.0,(6:1.0,(9:0.0,16:1.0):1.0):1.0):3.0,(4:0.0,14:7.0,19:6.0):1.0):9.0,((5:4.0,10:3.0):14.0,18:17.0):6.0):9.0,7:12.0):15.0,13:13.0):20.0,((11:15.0,12:16.0):7.0,(1:1.0,2:4.0):17.0):63.0):27.5,(8:85.0,17:103.0):27.5); TREE PAUP_2 = [&R] ((((((((((3:1.0,15:0.0):1.0,20:0.0):2.0,(6:1.0,(9:0.0,16:1.0):1.0):1.0):4.0,(4:0.0,19:6.0):0.0):1.0,14:6.0):10.0,((5:4.0,10:3.0):13.0,18:18.0):6.0):8.0,7:12.0):15.0,13:13.0):20.0,((11:15.0,12:16.0):7.0,(1:1.0,2:4.0):17.0):63.0):27.5,(8:85.0,17:103.0):27.5); END;