#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 17:54 GMT TreeBASE (cc) 1994-2008 Study reference: Ota Y. 2010. The phylogenetic position of an Armillaria species from Amami-Oshima, a subtropical island of Japan, based on elongation factor and ITS sequences. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10511] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=64; TAXLABELS 'Armillari sp. Nag.E 2003-71-13' Armillari_sp._Nag.E_NE4 'Armillaria cepistipes 04-16-1' 'Armillaria cepistipes 2000-07-04' 'Armillaria cepistipes 2000-08-14' 'Armillaria cepistipes 90-10-12' 'Armillaria cepistipes 94-33-01' 'Armillaria cepistipes 94-39-04b' 'Armillaria cepistipes 94-46-01' 'Armillaria cepistipes 96-19-01' Armillaria_cepistipes_ND1 Armillaria_cepistipes_ND11 'Armillaria ectypa Je-2' 'Armillaria ectypa Je-4' 'Armillaria ectypa Je-7' 'Armillaria ectypa Je-9' Armillaria_gallica_NA13 Armillaria_gallica_NA17 Armillaria_gallica_NA4 'Armillaria mellea 94-10-1' 'Armillaria mellea 94-5' 'Armillaria mellea 94-68' 'Armillaria mellea 94-7' 'Armillaria mellea 97-6' 'Armillaria mellea A-10' 'Armillaria mellea A-12' 'Armillaria nabsnona 00-16-4' 'Armillaria nabsnona 00-3-1' 'Armillaria nabsnona 00-4-4' Armillaria_nabsnona_NB3 Armillaria_nabsnona_NB4 'Armillaria navae-zelandiae CMW4722' 'Armillaria novae-zelandiae Arg49' 'Armillaria novae-zelandiae Arg55' 'Armillaria novae-zelandiae CMW4964' 'Armillaria novae-zelandiae RP2560' 'Armillaria novae-zelandiae RP2615' 'Armillaria novae-zelandiae RP8306' 'Armillaria ostoyae 2002-66-03' 'Armillaria ostoyae 88-01-19b' 'Armillaria ostoyae 89-03B-09b' 'Armillaria ostoyae 91-01-10' 'Armillaria ostoyae 94-75-07b' 'Armillaria ostoyae 94-8-2' Armillaria_ostoyae_NC8 'Armillaria sinapina 05-13-2' 'Armillaria sinapina 05-46-1' 'Armillaria sinapina 05-7-1' 'Armillaria sinapina 96-7-1b' 'Armillaria sinapina 96-8-1' 'Armillaria sp. 00-13' 'Armillaria sp. 00-14' Armillaria_sp._CMW3951 Armillaria_sp._CMW4143 'Armillaria sp. Nag.E 2000-23-02b' 'Armillaria sp. Nag.E 94-2-1' 'Armillaria sp. Nag.E 94-35-01' 'Armillaria sp. Nag.E 94-43-08' 'Armillaria sp. Nag.E 96-37-1' Armillaria_sp._PNZ87.54.1 'Armillaria tabescens 2002-06-03' 'Armillaria tabescens 2006-20-01b' 'Armillaria tabescens 96-1-8' 'Armillaria tabescens 96-3-3b' ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=61; TAXLABELS 'Armillaria cepistipes 04-16-1' 'Armillaria cepistipes 2000-07-04' 'Armillaria cepistipes 2000-08-14' 'Armillaria cepistipes 90-10-12' 'Armillaria cepistipes 94-33-01' 'Armillaria cepistipes 94-39-04' 'Armillaria cepistipes 94-46-01' 'Armillaria cepistipes 96-19-01' Armillaria_cepistipes_ND1 Armillaria_cepistipes_ND11 'Armillaria ectypa Je-2' 'Armillaria ectypa Je-4' 'Armillaria ectypa Je-7' 'Armillaria ectypa Je-9' Armillaria_gallica_NA13 Armillaria_gallica_NA17 Armillaria_gallica_NA4 Armillaria_hinnulea_CMW4980 Armillaria_hinnulea_CMW4981 'Armillaria mellea 89-07' 'Armillaria mellea 94-10-1' 'Armillaria mellea 94-5' 'Armillaria mellea 94-68' 'Armillaria mellea 94-7' 'Armillaria mellea 97-6' 'Armillaria mellea A-10' 'Armillaria mellea A-12' 'Armillaria nabsnona 00-16-4' 'Armillaria nabsnona 00-3-1' 'Armillaria nabsnona 00-4-4' Armillaria_nabsnona_NB3 Armillaria_nabsnona_NB4 'Armillaria novae-zelandiae CMW4722' 'Armillaria novae-zelandiae CMW4967' 'Armillaria ostoyae 2002-66-03' 'Armillaria ostoyae 88-01-19' 'Armillaria ostoyae 89-03B-09' 'Armillaria ostoyae 91-01-10' 'Armillaria ostoyae 94-75-07' 'Armillaria ostoyae 94-8-2' Armillaria_ostoyae_NC8 'Armillaria sinapina 05-13-2' 'Armillaria sinapina 05-46-1' 'Armillaria sinapina 05-7-1' 'Armillaria sinapina 96-7-1' 'Armillaria sinapina 96-8-1' 'Armillaria sp. 00-13' 'Armillaria sp. 00-14' Armillaria_sp._CMW4143 'Armillaria sp. Nag.E 2000-23-02' 'Armillaria sp. Nag.E 2003-71-13b' 'Armillaria sp. Nag.E 94-2-1' 'Armillaria sp. Nag.E 94-35-01' 'Armillaria sp. Nag.E 94-43-08' 'Armillaria sp. Nag.E 96-37-1' Armillaria_sp._Nag.E_NE4 Armillaria_sp._PNZ87.54 'Armillaria tabescens 2002-06-03' 'Armillaria tabescens 2006-20-01' 'Armillaria tabescens 96-1-8' 'Armillaria tabescens 96-3-3' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M5646] TITLE Fig.2_ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=995; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Armillari sp. Nag.E 2003-71-13' GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACCTGATT----------------------------------------------------------------------------------------------------------AACATTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGATG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGGAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGACCTTAGGGTCTGGCTTAGGATTGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCAATTCTAAGAGAGGAGTTGCTTAGCGCAAGCTTAGCTTTCCTTGATTT---TTCCCTCTGACTTCGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA Armillari_sp._Nag.E_NE4 GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACATTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGATG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGTGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGGAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGACCTTAGGGTCTGGCTTAGGATTGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCAATTCTAAGAGAGGAGTTGCTTAGCGCAAGCTTAGCTTTCCTTGATTT---TTCCCTCTGACTTCGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria cepistipes 04-16-1' GAAACTTGAA-TCGTAGCATCGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCTAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGGGTCTGGCTTAAAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTA?CGCGAGCTTAGCTTTCCTTGATAT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria cepistipes 2000-07-04' GAAACTTGAA-TCGTAGCATCGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTT-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGGGTCTGGCTTAGAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGAAACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATAT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria cepistipes 2000-08-14' GAAACTTGAA-TCGTAGCATCGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGGGTCTGGCTTAGAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGAAACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATAT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria cepistipes 90-10-12' GAAACTTGAA-TCGTAGCATCGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGGGTCTGGCTTAGAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATAT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria cepistipes 94-33-01' GAAACTTGAA-TCGTAGCATCGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TATGGGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACCGGTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGGGTCTGGCTTAGAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATAT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria cepistipes 94-39-04b' GAAACTTGAA-TCGTAGCATCGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGAGTCTGGCTTAGAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATAT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria cepistipes 94-46-01' GAAACTTGAA-TCGTAGCATCGAGAACTGTTGCTGACCTG---TTAAAAGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGGGTTTGGCTTAAAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-TGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATAT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria cepistipes 96-19-01' GAAACTTGAA-TCGTAGCATCGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGGGTCTGGCTTAGAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATAT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA Armillaria_cepistipes_ND1 GAAACTTGAA-TCGTAGCATCGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGGGTCTGGCTTAGAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAAATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATAT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGTGGAGGA Armillaria_cepistipes_ND11 GAAACTTGAA-TCGTAGCATCGGGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGACCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGGGTCTGGCTTAGAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATAT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria ectypa Je-2' TGAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTTGTAAT-AAGGGTATGTGCACGTTCAAAGTGTTGCGTG--TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGGTT----------------------------------------------------------------------------------------------------------AGCTTTCGCCTTAGGACGGATAGGAAGGG---------TTGCTTTAGGGCT-CCC--T-TTGTG-TACCAAGTCTATGTCTATATAATCTCTTGTATGTCTTAGAATGTT-TTGTTTATAGGACGGCAAGTCCTTTAAAATCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTCCCTTCTTTTGTTAGGAGTGCGGCGGATTGGATTAT-GGGGGTTTGCTGG--TCTCTAACGAGATCAGCTCCTCTGAAATGTATTAGCAGAAACC-GTTTGACA-TTGGCTGC-TAGGCTGTGATAATGTATCTACGCTTT-GTAGTCAAGTCGGAATAC-GAGTCATATA----TA------------------TAATAACTCTGGCTTAGCATTGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTTCCTTAG-AGAAGATACTTGTCCGATACTAAGTAAGAGAGGGAGTTGC-----TTAGGCTTTTCTTGATTA---------TCGACTTTGTAGAAGGGTTCAGCTTCTAACCGTCCATTGAGTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAC-TAT---------------- 'Armillaria ectypa Je-4' TGAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTTGTAAT-AAGGGTATGTGCACGTTCAAAGTGTTGCGTG--TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGGTT----------------------------------------------------------------------------------------------------------AGCTTTCGCCTTAGGACGGATAGGAAGGG---------TTGCTTTAGGGCT-CCC--T-TTGTG-TACCAAGTCTATGTCTATATAATCTCTTGTATGTCTTAGAATGTT-TTGTTTATAGGACGGCAAGTCCTTTAAAATCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTCCCTTCTTTTGTTAGGAGTGCGGCGGATTGGATTAT-GGGGGTTTGCTGG--TCTCTAACGAGATCAGCTCCTCTGAAATGTATTAGCAGAAACC-GTTTGACA-TTGGCTGC-TAGGCTGTGATAATGTATCTACGCTTT-GTAGTCAAGTCGGAATAC-GAGTCATATA----TA------------------TAATAACTCTGGCTTAGCATTGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTTCCTTAG-AGAAGATACTTGTCCGATACTAAGTAAGAGAGGGAGTTGC-----TTAGGCTTTTCTTGATTA---------TCGACTTTGTAGAAGGGTTCAGCTTCTAACCGTCCATTGAGTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAC-TAT---------------- 'Armillaria ectypa Je-7' TGAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTTGTAAT-AAGGGTATGTGCACGTTCAAAGTGTTGCGTG--TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGGTT----------------------------------------------------------------------------------------------------------AGCTTTCGCCTTAGGACGGATAGGAAGGG---------TTGCTTTAGGGCT-CCC--T-TTGTG-TACCAAGTCTATGTCTATATAATCTCTTGTATGTCTTAGAATGTT-TTGTTTATAGGACGGCAAGTCCTTTAAAATCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTCCCTTCTTTTGTTAGGAGTGCGGCGGATTGGATTAT-GGGGGTTTGCTGG--TCTCTAACGAGATCAGCTCCTCTGAAATGTATTAGCAGAAACC-GTTTGACA-TTGGCTGC-TAGGCTGTGATAATGTATCTACGCTTT-GTAGTCAAGTCGGAATAC-GAGTCATATA----TA------------------TAATAACTCTGGCTTAGCATTGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTTCCTTAG-AGAAGATACTTGTCCGATACTAAGTAAGAGAGGGAGTTGC-----TTAGGCTTTTCTTGATTA---------TCGACTTTGTAGAAGGGTTCAGCTTCTAACCGTCCATTGAGTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAC-TAT---------------- 'Armillaria ectypa Je-9' TGAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTTGTAAT-AAGGGTATGTGCACGTTCAAAGTGTTGCGTG--TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGGTT----------------------------------------------------------------------------------------------------------AGCTTTCGCCTTAGGACGGATAGGAAGGG---------TTGCTTTAGGGCT-CCC--T-TTGTG-TACCAAGTCTATGTCTATATAATCTCTTGTATGTCTTAGAATGTT-TTGTTTATAGGACGGCAAGTCCTTTAAAATCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTCCCTTCTTTTGTTAGGAGTGCGGCGGATTGGATTAT-GGGGGTTTGCTGG--TCTCTAACGAGATCAGCTCCTCTGAAATGTATTAGCAGAAACC-GTTTGACA-TTGGCTGC-TAGGCTGTGATAATGTATCTACGCTTT-GTAGTCAAGTCGGAATAC-GAGTCATATA----TA------------------TAATAACTCTGGCTTAGCATTGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTTCCTTAG-AGAAGATACTTGTCCGATACTAAGTAAGAGAGGGAGTTGC-----TTAGGCTTTTCTTGATTA---------TCGACTTTGTAGAAGGGTTCAGCTTCTAACCGTCCATTGAGTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAC-TAT---------------- Armillaria_gallica_NA13 GAAACTTGAA-TCGTAGCATCGAAAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGCCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGTATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGGGTCTGGCTTAGAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTA-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATAT---TGCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA Armillaria_gallica_NA17 GAAACTTGAA-TCGTAGCAT?GAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGATG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGGGTCTGGCTTAGAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTTCCTTTG-CGGAGATACTTGTCCGAATCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGAT?T---TTCCCTTTGACTCTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA Armillaria_gallica_NA4 GAAACTTGAA-TCGTAGCATCGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTTTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGATG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTGGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGGGTCTGGCTTAGAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCTTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATAT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria mellea 94-10-1' GAATCTTGAACTTGTAACATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCAAACTGTTACGGGTTCTGTTCTTATCCACCTGTGAAC-CTTTGTAGACTTGGTT----------------------------------------------------------------------------------------------------------AAGCTTCGCTTTCAAGCGGTTTGAAGGG------TTGCTTGCTTGCGAGCT-CCC--T-TTGTCTTACCGAGTCTATGTCTATATAAACTTTTGTATGTT-TAGAATGTCTTTGTTTATGGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTGTCTTGTTTTATTACAAGTGCGATGGATTGGATTAT-GGGGGCTTGCTGG--TCTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTTGGTAGTTGGGTTGGAATACAAAGTGTTAGAGTGATAAGGAACTATTACTCAGGCTTTCGAGTCTGGCTTAGGATCGGTTTGGAGGGT-TGCTTAACGGCTCCTTCTGCTTTCTCCCTTTGTTGGAGATACTTGTCTGATTGTAAGAGAGGAATTGC---------GTTTAGCTTTCCAAGAGTTCTGTTTCGCTTGACTTTGTAGAAGGATTCAGCTTCTAACGGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGTGGAGGA 'Armillaria mellea 94-5' GAATCTTGAACTTGTAACATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCAAACTGTTACGGGTTCTGTTCTTATCCACCTGTGAAC-CTTTGTAGACTTGGTT----------------------------------------------------------------------------------------------------------AAGCTTCGCTTTCAGGCGGTTTGAAGGG------TTGCTTGCTTGCGAGCT-CCC--T-TTGTCTTACCGAGTCTATGTCTATATAAACTTTTGTATGTT-TAGAATGTCTTTGTTTATGGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCGCCTTGTTTTATTACAAGTGCGATGGATTGGATTAT-GGGGGTTTGCTGG--TCTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTTGGTAGTTGGGTTGGAATACAAAGTGTTAGAGTGATAAGGAACTATTACTCAGGCTTTCGAGTCTGGCTTAGGATCGGTTTGGAGGGT-TGCTTAACGGCTCCTTCTGCTTTCTCCCTTTGTTGGAGATACTTGTCCGATTGTAAGAGAGGAATTGC---------GCTTAGCTTTCCAAGAGTTCTGTTTCACTTGACTTTGTAGAAGGATTCAGCTTCTAACGGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria mellea 94-68' GAATCTTGAACTTGTAACATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCAAAGTGTTATGGGTTCTGTTCTTATCCACCTGTGAAC-CTTTGTAGACTTGGTT----------------------------------------------------------------------------------------------------------AAGCTTCGCTTTCAAGCGGTTTGAAGGGTTGC--TTGCTTGCTTGCGAGCT-CCC--T-TTGTCTTACCGAGTCTATGTCTATATAAACTTTTGTATGTT-TAGAATGTCTTTGTTTATGGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCGCCTTGTTTTATTACAAGTGCGATGGATTGGATTAT-GGGGGCTTGCTGG--TCTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTTGGTAGTTGGGTTGGAATACAAAGTGTTAGAGTGATAAGGAACTATTACTCAGGCTTTCGAGTCTGGCTTAGGATCGGTTTGGAGGGT-TGCTTAACGGCTCCTTCTGCTTTCTCCCTTTGTTGGAGATACTTGTCTGATTGTAAGAGAGGAATTGC---------GTTTAGCTTTCCTTGAGTTCTGTTTCGCTTGACTTTGTAGAAGGATTCAGCTTCTAACGGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria mellea 94-7' GAATCTTGAACTTGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCAAAGTGTTACGGGTTCTGTTCTTATCCACCTGTGAAC-CTTTGTAGACTTGGTT----------------------------------------------------------------------------------------------------------AAGCTTCGCTTTCGAGCGGTTTGAAGGGTTGC--TTGCTTGCTTGTGAGCT-CCC--T-TTGTCTTACCGAGTCTATGTCTATATAAACTTTTGTATGTT-TAGAATGTCTTTGTTTATGGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCGCCTTGTTTTATTACAAGTGGGATGGATTGGATTAT-GGGGGTTTGCTGG--TCTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTTGGTAGTCAGGTTGGAATACAAAGTGTTAGAGTGATAAGGAACTATTACTCAGGCTTTCGAGTCTGGCTTAGGATCGGTTTGGAGGGT-TGCTTAACGGCTCCTTCTGCTTTCTCCCTTTGTTGGAGATACTTGTCCGATTGTAAGAGAGGAATTGC---------GCTTAGCTTTCCAAGAGTTCTATTTCGCTTGACTTTGTAGAAGGATTCAGCTTCTAACGGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria mellea 97-6' GAATCTTGAACTTGTAACATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCAAACTGTTACGGGTTCTGTTCTTATCCACCTGTGAAC-CTTTGTAGACTTGGTT----------------------------------------------------------------------------------------------------------AAGCTTCGCTTTCAAGCGGTTTGAAGGG------TTGCTTGCTTGCGAGCT-CCC--T-TTGTCTTACCGAGTCTATGTCTATATAAACTTTTGTATGTT-TAGAATGTCTTTGTTTATGGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCCATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCATTGAATCATC?AGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTGTCTTGTTTTATTACAAGTGCGATGGATTGGATTAT-GGGGGCTTGCTGG--TCTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGTTGC-TCGGCTGTGATAAT--ATCTACGCCTTGGTAGTTGGGTTGGAATACAAAGTGTTAGAGTGATAAGGAACTATTACTCAGGCTTTCGAGTCTGGCTTAGGATCGGTTTGGAGGGT-TGCTTAACGGCTCCTTCTGCTTTCTCCCTTTGTTGGAGATACTTGTCTGATTGTAAGAGAGGAATTGC---------GTTTAGCTTTCCAAGAGTTCTGTTTCGCTTGACTTTGTAGAAGGATTCAGCTTCTAACGGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGTGGAGGA 'Armillaria mellea A-10' GAATCTTGAACTTGTAACATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCAAACTGTTACGGGTTCTGTTCTTATCCACCTGTGAAC-CTTTGTAGACTTGGTT----------------------------------------------------------------------------------------------------------AAGCTTCGCTTTCAAGCGGTTTGAAGGG------TTGCTTGCTTGCGAGCT-CCC--T-TTGTCTTACCGAGTCTATGTCTATATAAACTTTTGTATGTT-TAGAATGTCTTTGTTTATGGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTGTCTTGTTTTATTACAAGTGCGATGGATTGGATTAT-GGGGGCTTGCTGG--TCTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTTGGTAGTTGGGTTGGAATACAAAGTGTTAGAGTGATAAGGAACTATTACTCAGGCTTTCGAGTCTGGCTTAGGATCGGTTTGGAGGGT-TGCTTAACGGCTCCTTCTGCTTTCTCCCTTTGTTGGAGATACTTGTCTGATTGTAAGAGAGGAATTGC---------GTTTAGCTTTCCAAGAGTTCTGTTTCGCTTGACTTTGTAGAAGGATTCAGCTTCTAACGGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGTGGAGGA 'Armillaria mellea A-12' GAATCTTGAACTTGTAACATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCAAACTGTTACGGGTTCTGTTCTTATCCACCTGTGAAC-CTTTGTAGACTTGGTT----------------------------------------------------------------------------------------------------------AAGCTTCGCTTTCAAGCGGTTTGAAGGG------TTGCTTGCTTGCGAGCT-CCC--T-TTGTCTTACCGAGTCTATGTCTATATAAACTTTTGTATGTT-TAGAATGTCTTTGTTTATGGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTGTCTTGTTTTATTACAAGTGCGATGGATTGGATTAT-GGGGGCTTGCTGG--TCTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTTGGTAGTTGGGTTGGAATACAAAGTGTTAGAGTGATAAGGAACTATTACTCAGGCTTTCGAGTCTGGCTTAGGATCGGTTTGGAGGGT-TGCTTAACGGCTCCTTCTGCTTTCTCCCTTTGTTGGAGATACTTGTCTGATTGTAAGAGAGGAATTGC---------GTTTAGCTTTCCAAGAGTTCTGTTTCGCTTGACTTTGTAGAAGGATTCAGCTTCTAACGGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGTGGAGGA 'Armillaria nabsnona 00-16-4' GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGCTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCCCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGAGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAATGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCCTTAGGGTCTGGCTTAGAATCGGTTTGGAAGGT--GCTTAACGGCTCCCTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATTT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria nabsnona 00-3-1' GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGCTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCCCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCGTTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCCTTAGGGTCTGGCTTAAAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATTT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria nabsnona 00-4-4' GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGCTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCCCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAAGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCCTTAGGGTCTGGCTTAAAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGCTTT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA Armillaria_nabsnona_NB3 GAAACTTGAA-TCGTAGCATTGTGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGCTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCCTTAGGGTCTGGCTTAGAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGAATCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGTTTTCCTTGATTT---TTCCCTTTGACTTCGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA Armillaria_nabsnona_NB4 GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGCAGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCCCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCCTTAGGGTCTGGCTTAGAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATTT---TTCCCATTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria navae-zelandiae CMW4722' ---------------------GAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTGTGAGTGTTGCG--TTTTATTCTTTTTTCCCTGTGCAC-GTTTGTAGACTTGGTT-----------GTTGAGTGGTTAGAAGGGTTGCTGGAAAGCTCTCTTTGCTTAGGATT-----------------GAAGGGTT------------------GCTGCAAAGCTCCCTTTGCCTAGGATTTCA-------------CTTGTGCAAAGCT-CGCGCT-TTGTG-TACCAGGTCTATGTCTATA--ATCTCTTGTATGTA-TAGAATGTC-TTGGTTATAGGACG-CAAGTC-TTTAAA-TGGTATACAACTTTCAACAACCGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAGCCTTTGCACTT---------GTGCTAAGGATTGGAT-AT--GGGGGTTGCTGGTCTC--TAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACG-CTGAGTGC-TAGGCTGTGATAAT--ATCTACAGCTTGGTAGTCGTGTCGGAATAC-AAGTCAA-------------------------------------------GGATCGGTTTGGAGGG--TGCTTAACGGCTCCTTCTACTT------------------------------GTCCGAAATTG--------------------------CTT----------------ACTT-GTATAAGGATTCAGCTTCTAACGGTCCATTGAGTTGGACAATTTATTGAG------------------------------------------------------------- 'Armillaria novae-zelandiae Arg49' GAGACATGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTGTGAGTGTTGCG--TTTTATTCTTTTTTCCCTGTGCAC-GTTTGTAGACTTGGTT-----------GTTGAGTGGTTAGAAGGGTTGCTGAAAAGCTCTCTTTGCTTAGGATTT------------------CGC---------------------TCTTGAAGGGTTGCT--GCAAAGCTCCCT---------------TTGCCTAGGATTTCAC--T-AAGCT-TGTCAGGTCTATGTCTATA--ATCTCTTGTATGTA-TAGAATGTG-TTGTTTATAGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAGCCTTTGCATTT---------GTGCTAAGGATTGGAT-AT--GGGGGTTGCTGGTCTC--TAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACG-TTGAGTGC-TAGGCTGTGATAAT--ATCTACAGCTTGGTAGTCGTGTCAGAATAC-AAGTCAA-------------------------------------------GGATCGGTTCGGAGGG--TGCTTAACGGCTCCTTCTGCTTTCTCTCTTTG-CGGGGAGAT------AGTTGTCCGATTTTT--------------------------GTT----------------ACTT-GTAGAAGGATTCAGCTTCTAACGGTCCATTGAGTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCCGCTGAACT---------------------- 'Armillaria novae-zelandiae Arg55' GAGACATGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTGTGAGTGTTGCG--TTTTATTCTTTTTTCCCTGTGCAC-GTTTGTAGACTTGGTT-----------GTTGAGTGGTTAGAAGGGTTGCTGAAAAGCTCTCTTTGCTTAGGATTT------------------CGC---------------------TCTTGAAGGGTTGCT--GCAAAGCTCCCT---------------TTGCCTAGGATTTCAC--T-AAGCT-TGTCAGGTCTATGTCTATA--ATCTCTTGTATGTA-TAGAATGTG-TTGTTTATAGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAGCCTTTGCATTT---------GTGCTAAGGATTGGAT-AT--GGGGGTTGCTGGTCTC--TAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACG-TTGAGTGC-TAGGCTGTGATAAT--ATCTACAGCTTGGTAGTCGTGTCAGAATAC-AAGTCAA-------------------------------------------GGATCGGTTCGGAGGG--TGCTTAACGGCTCCTTCTGCTTTCTCTCTTTG-CGGGGAGAT------AGTTGTCCGATTTTT--------------------------GTT----------------ACTT-GTAGAAGGATTCAGCTTCTAACGGTCCATTGAGTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCC-GCTGAACTTAAGCATATCAAA?AAAG?GGA 'Armillaria novae-zelandiae CMW4964' ---------------------GAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTGTGAGTGTTGCG--TTTTATTCTTTTTTCCCTGTGCAC-GTTTGTAGACTTGGTT-----------GTTGAGTGGTTAGAAGGGTTGCTGAAAAGCTCTCTTTGCTTAGGATTTCGCTCTTGAGCGGATTGAAGGGTT------------------GCTGTAAAGCTCCCTTTGCCTAGGATTTCA-------------CTTGTGCAAAGCT-CGCT-T-TGTG--TACCAGGTCTATGTCTATA--ATCTCTTGTATGTA-TAGAATGTG-TTGTTTATAGGATG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAGCCTTTGCATTT---------ATGCTAAGGATTGGAT-AT--GGGGGTTGCTGGTGTC--TAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACG-TTGAGTGC-TAGGCTGTGATAAT--ATCTACAGCTTGGTAGTCGGGTCGGAATAC-AAGTCAA-------------------------------------------GGATCGGTTTGGAGGG--TGCTTAACGGCTCCTTCTGCTTTCTCTCTTTG-TGGGGAGAT------ACTTGTCCGATTTTT--------------------------GTT----------------ACTT-GTAGAAGGATTCAGCTTCTAACGGTCCATTGAGTTGGACAATTTATTGAC------------------------------------------------------------- 'Armillaria novae-zelandiae RP2560' GAGACATGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTGTGAGTGTTGCG--TTTTATTCTTTTTTCCCTGTGCAC-GTTTGTAGACTTGGTT-----------GTTGAGTGGTTAGAAGGGTTGCTGGAAAGCTCTCTTTGCTTAGGATT-----------------GAAGGGTT------------------GCTGCAAAGCTCCCTTTGCCTAGGATTTCA-------------CTTGTGCAAAGCT-CGCGCT-TTGTG-TACCAGGTCTATGTCTATA--ATCTCTTGTATGTA-TAGAATGTC-TTGTTTATAGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAGCCTTTGCACTT---------GTGCTAAGGATTGGAT-AT--GGGGGTTGCTGGTCTC--TAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACG-CTGAGTGC-TAGGCTGTGATAAT--ATCTACAGCTTGGTAGTCGTGTCGGAATAC-AAGTCAA-------------------------------------------GGATCGGTTTGGAGGG--TGCTTAACGGCTCCTTCTACTT------------------------------GTCCGATTTTG--------------------------CTT----------------ACTT-GTATAAGGATTCAGCTTCTAACGGTCCATTGAGTTGGACAATTTATTGACTATT-GACCTCAAATCAGGAGA--------------------------------------- 'Armillaria novae-zelandiae RP2615' GAGACATGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTGTGAGTGTTGCG--TTTTATTCTTTTTTCCCTGTGCAC-GTTTGTAGACTTGGTT-----------GTTGAGTGGTTAGAAGGGTTGCTGGAAAGCTCTCTTTGCTTAGGATT-----------------GAAGGGTT------------------GCTGCAAAGCTCCCTTTGCCTAGGATTTCA-------------CTTGTGCAAAGCT-CGCGCT-TTGTG-TACCAGGTCTATGTCTATA--ATCTCTTGTATGTA-TAGAATGTC-TTGTTTATAGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAGCCTTTGCACTT---------GTGCTAAGGATTGGAT-AT--GGGGGTTGCTGGTCTC--TAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACG-CTGAGTGC-TAGGCTGTGATAAT--ATCTACAGCTTGGTAGTCGTGTCGGAATAC-AAGTCAA-------------------------------------------GGATCGGTTTGGAGGGGGTGCTTAACGGCTCCTTCTACTT------------------------------GTCCGATTTTG--------------------------GTT----------------ACTT-GTATAAGGATTCAGCTTCTAACGGTCCATTGAGTTGGACAATTTATTGAGTATTTGACCTCAAATCAGGTAGGACTACC-------------------------------- 'Armillaria novae-zelandiae RP8306' GAGACATGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTGTGAGTGTTGCG--TTTTATTCTTTTTTCCCTGTGCAC-GTTTGTAGACTTGGTT-----------GTTGAGTGGTTAGAAGGGTTGCTGAAAAGCTCTCTTTGCTTAGGATTT------------------CGC---------------------TCTTGAAGGGTTGCT--GCAAAGCTCCCT---------------TTGCCTAGGATTTCAC--T-AAGCT-TGTCAGGTCTATGTCTATA--ATCTCTTGTATGTA-TAGAATGTG-TTGTTTATAGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAGCCTTTGCATTT---------GTGCTAAGGATTGGAT-AT--GGGGGTTGCTGGTCTC--TAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACG-TTGAGTGC-TAGGCTGTGATAAT--ATCTACAGCTTGGTAGTCGTGTCAGAATAC-AAGTCAA-------------------------------------------GGATCGGTTCGGAGGG--TGCTTAACGGCTCCTTCTGCTTTCTCTCTTTG-CGGGGAGAT------AGTTGTCCGATTTTT--------------------------GTT----------------ACTT-GTAGAAGGATTCAGCTTCTAACGGTCCATTGAGTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCC-GCTGAACTTAAGCATATCATAAA------- 'Armillaria ostoyae 2002-66-03' GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAAATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACC-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTTGGTAGTTGGGTCGGAATAC-TAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGAGTCTGGCTTAGGATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGAT-T---TTTCCCTTGACATTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria ostoyae 88-01-19b' GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTTGGTAGTTGGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGAGTCTGGCTTAGGATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATTT---TTCCCCTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria ostoyae 89-03B-09b' GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TCGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTTGGTAGTTGGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGACTTTCGAGTTTGGCTTAGGATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATTT---TTCCCCTTGACTTTGTAGAAGGATTCAGCTTCTAACTGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria ostoyae 91-01-10' GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGCGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTTGGTAGTTGGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGAGTCTGGCTTAGGATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATTT---TTCCCCTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria ostoyae 94-75-07b' GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTTGGTAGTTGGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGACTTTCGAGTTTGGCTTAGGATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATTT---TTCCCCTTGACTTTGTAGAAGGATTCAGCTTCTAACTGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria ostoyae 94-8-2' GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGGACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCCTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAAATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACC-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTTGGTAGTTGGGTCGGAATAC-TAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGAGTCTGGCTTAGGATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATTT---TT-CCCTTGACATTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA Armillaria_ostoyae_NC8 GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCCTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAAATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACC-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTTGGTAGTTGGGTCGGAATAC-TAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGAGTCTGGCTTAGGATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGAT-T---TTTCCCTTGACATTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria sinapina 05-13-2' GAAACTTGAA-TCGTAGCATCGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAT-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGGGTCTGGCTTAGAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTATAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATAT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria sinapina 05-46-1' GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTTTCGAGCGGTTAGAAGGG----------CTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGTGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGGGTCTGGCTTAAAATCGGTTGGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTGTTGGAGATACTTGTCCGATTTTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATTT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria sinapina 05-7-1' GAAACTTGAA-TCGTAGCATCGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCTCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------AGTAATCAGGCTTTCGGGTCTGGCTTAGAAACGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATAT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria sinapina 96-7-1b' GAAACTTGAA-TCGTAGCATCGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTTATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGGGTCTGGCTTAAAATCGGTTTGGAAGGT--GCCTAACGGCTCCTTCTGATTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATAT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria sinapina 96-8-1' GAAACTTGAA-TCGTAGCATCGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACTTTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCCTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTTATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGGCTTTCGGGTCTGGCTTAGAATCGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCGATTCTAAGAGAGGAGTTGCTTAGCGCGAGCTTAGCTTTCCTTGATAT---TTCCCTTTGACTTTGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria sp. 00-13' GAGACATGAATTCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTTTGAGTGTTGCG--TTTTATTGTTTTTTCCCTGTGCAC-TTTTGTAGAGTTGGTTAGGAAATCGTTGTTGAGTGGTTTGAAGGGTTGCTGCAAAGCTCTCTTTGTCTAAGCT-------------------AA-----------------------GCTTAGGATTTCACTCCTCAGCGGTCAGAAGGG----------TTGCTGTGAAGCT-CTC--T-TTGTC-TACCAAGTCTATGTCTATA--AACTCTTGTATGTG-TAGAATGTT-TTGTTTATAGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAGCCTTTGACTTT---------GTGCTAAGGATGGGAT-AT--GGGGGTTGCTGGTCTCTTTGTTGAGATCAGCTCCTCTGAAATGTATTAGCAGAAACC-GTTTGACT-AAGAGTGC-TAGGTTGTGATAAT--ATCTACAGCTTGGTAGTCTGGTCGGAATAC-AAGT----------------------------------------------GAATCGGTTTGGAGGG--TGCTTAACGGCTCCTTCTACTT------------------------------GTCCGA-------------------------------TTT-----------------CTT-GTAGAAGA--TCAGCTTCTAACGGTCCATTAAA--GGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria sp. 00-14' GAGACATGAATTCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTTTGAGTGTTGCG--TTTTATTGTTTTTTCCCTGTGCAC-TTTTGTAGAGTTGGTTAGGAAATCGTTGTTGAGTGGTTTGAAGGGTTGCTGCAAAGCTCTCTTTGTCTAAGCT-------------------AA-----------------------GCTTAGGATTTCACTCCTCAGCGGTCAGAAGGG----------TTGCTGTGAAGCT-CTC--T-TTGTC-TACCAAGTCTATGTCTATA--AACTCTTGTATGTG-TAGAATGTT-TTGTTTATAGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAGCCTTTGACTTT---------GTGCTAAGGATGGGAT-AT--GGGGGTTGCTGGTCTCTTTGTTGAGATCAGCTCCTCTGAAATGTATTAGCAGAAACC-GTTTGACT-AAGAGTGC-TAGGTTGTGATAAT--ATCTACAGCTTGGTAGTCTGGTCGGAATAC-AAGT----------------------------------------------GAATCGGTTTGGAGGG--TGCTTAACGGCTCCTTCTACTT------------------------------GTCCGA-------------------------------TTT-----------------CTT-GTAGAAGA--TCAGCTTCTAACGGTCCATTAAA--GGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA Armillaria_sp._CMW3951 ---------------------GAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTTTGAGTGTTGCG--TTTTATTGTTTTTTCCCTGTGCAC-TTTTGTAGAGTTGGTTAGGAAATCGTTGTTGAGTGGTTTGAAGGGTTGCTGAAAAGCTCTCTTTGTCTAAGCT-------------------AA-----------------------GCTTAGGATTTCACTCCTCAGCGGTCAGAAGGG----------TTGCTGTGAAGCT-CTC--T-TTGTC-TGCCAAGTCTACGTCTATA--AACTCTTGTATGTG-TAGAATGTT-TTGTTTATAGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAAAGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAGCCTTTGACTTT---------GTGCTAAGGATTGGATTGT--GGGGGTTGCTGGTCTCTTTGTTGAGATCAGCTCCTTTGAAATGTATTAGCAGAAACC-GTTTGACT-AAGAGTGC-TAGGTTGTGATAAT--ATCTACAGCTTGGTAGTCCAGTCGGAATAC-AAGT----------------------------------------------GAATCG-TTTGGAGGG--TGCATAACGGCTCCTTCTACTT------------------------------GTCCGA-------------------------------TTT----------------TCTT-GTAGAAGGATTCAGCTTCTAACGGTCCATTAAATTGGACAATTTATTGAC------------------------------------------------------------- Armillaria_sp._CMW4143 ---------------------GAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTTAAAGTGTTGCG--TTTTATTCTTTTTTCCCTGTGCAC-GTTTGTAGAGTTGGTT-----------------------AGGAAATCGTTGTTGAGTGTTAATTCT----------------------------------------------------CTTAGGATTTCACTCTGAAGCGGTCAGAAGGG----------TTGCTGTGAAGCT-CTCTTTGTCCTG-TACCAAGTCTATGTCTATA--AACTCTTGTATGTG-TAGAATGTT-TTGTTTATAGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAGCCTAAGACTTT---------GTTCTAAGGATTGGAT-AT--GGGGGTTGCTGGTCTCT-TGTAGAGATCAGCTCCTCTTAAATGGATTAGCAGAAACC-GTTTGACTTAAGAGTGC-TAGGCTGTGATAAT--ATCTACAGCTTGGTAGTCAGGTCGGAATAC-AAGTGAAT-------------------------------------CGTTGGGATCGGTTTGGAGGG--TGCTTAACGGCTCCTTCTGCTTTCTCTCTTTT-GAGAGATACTTGTCCGATTTTCCAAGTGGG--------------------------TTG----------------ACTTTGTAGAAGGATTCAGCTTCTAACGGTCCATTGAATTGGACAATTTATTGAC------------------------------------------------------------- 'Armillaria sp. Nag.E 2000-23-02b' GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACATTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGATG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGGAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGACCTTAGGGTCTGGCTTAGGATTGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATATTTGTCCAATTCTAAGAGAGGAGTTGCTTAGCGCAAGCTTAGCTTTCCTTGATTT---TTCCCTCTGACTTCGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria sp. Nag.E 94-2-1' GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACATTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGATG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCTGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGACCTTAGGGTCTGGCTTAGGATTGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCAATTCTAAGAGAGGAGTTGCTTAGCGCAAGCTTAGCTTTCCTTGATTT---TTCCCTCTGACTTCGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria sp. Nag.E 94-35-01' GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACATTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGATG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGACCTTAGGGTCTGGCTTAGGATTGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCAATTCTAAGAGAGGAGTTGCTTAGCGCAAGCTTAGCTTTCCTTGATTT---TTCCCTCTGACTTCGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria sp. Nag.E 94-43-08' GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACATTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGATG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGACCTTAGGGTCTGGCTTAGGATTGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCAATTCTAAGAGAGGAGTTGCTTAGCGCAAGCTTAGCTTTCCTTGATTT---TTCCCTCTGACTTCGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria sp. Nag.E 96-37-1' GAAACTTGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGATT----------------------------------------------------------------------------------------------------------AACATTCGCTCTCGAGCGGTTAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTC-TATCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATGGGATG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGA-TAT-GGGGGTTTGCTGG--TTTCTAACGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTAGGTCGGAATAC-GAGTCATACAGTGGTA-------ACTAATCAGACCTTAGGGTCTGGCTTAGGATTGGTTTGGAAGGT--GCTTAACGGCTCCTTCTGCTTTCTCCCTTTG-CGGAGATACTTGTCCAATTCTAAGAGAGGAGTTGCTTAGCGCAAGCTTAGCTTTCCTTGATTT---TTCCCTCTGACTTCGTAGAAGGATTCAGCTTCTAACCGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA Armillaria_sp._PNZ87.54.1 GAGACATGAA-TCGTAGCATTGAGAACTGTTGCTGACCTG---TTAAAGGGTATGTGCACGTTTGGAGTGTTGCG--TTTTATTCTTTTTTCCCTGTGCAC-GTTTGTAGAGTTGGTTAGGAAATCGTTGTTGAGTGGTTCGAAGGGTTGCTGCAAAGCTCTCTTTGCCTAAGATTTTGCTTTCGAGCAGTGAGAACGGTTGCTGCAAAGCTCTGTTT-GCTTAGGATTTCACTCTGAAGCGGTCAGAAGGG----------TTGCTGTAAAGCT-CTC--T-TTGTC-TACCAAGTCTATGTCTATA--AACTCTTGTATGTG-TAGAATGAT-TTGTTTATAGGACG-CAAGTCCTTTAAA-TGTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAGCCTTTGACTTT---------GCGCTAAGGATTGGAT-AT--GGGGGTTGCTGGTCTCTTTGTTGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-AGGAGTGC-TAGGCTGTGATAAT--ATCTACAGCTTGGTAGTCTAGTCGGAATAC-AAGT----------------------------------------------GAATCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Armillaria tabescens 2002-06-03' GAAACTTGAA-TCGTAGCATCGAAAACTGTTGCTGACCCG---T--AAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGGTT----------------------------------------------------------------------------------------------------------AACTTTCGCCTTAGGGCGGATAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTCTTACCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATAGGATG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGATTAT-GGGGGCTTGCTGGA-CTCTTAGCGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTGAGTCGGAATAC-GAGTCAT------------------TACTCAGGCTTTCGAGTCTGGCTTAGGATCGGTTTGGAGGGT-AGCTTAACGGCTCCTTCTGCTTTCTCCCTTAG-AGGAGAAACTTGTCCGATGCTTAGAGAGGA----------TCGCGTTAAGCTTTCCTTGAT---------TCTTGACTTTGTAGAAGGATTCAGCTTCTAACGGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria tabescens 2006-20-01b' GAAACTTGAA-TCGTAGCATCGAAAGCTGTTGCTGACCCG---T--AAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGGTT----------------------------------------------------------------------------------------------------------AACTTTCGCCTTAGGGCGGATAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTCTTACCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATAGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGATTAT-GGGGGCTTGCTGGA-CTCTTAGCGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTGAGTCGGAATAC-GAGTCAT------------------TACTCAGGCTTTCGAGTCTGGCTTAGGATCGGTTTGGAGGGT-AGCTTAACGGCTCCTTCTGCTTTCTCCCTTAG-AGGAGATACTTGTCCGATGCTTAGAGAGGA----------TCGCGTTAAGCTTTCCTTGAT---------TCTTGACTTTGTAGAAGGATTCAGCTTCTAACGGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria tabescens 96-1-8' GAAACTTGAA-TCGTAGCATCGAAAGCTGTTGCTGACCCG---T--AAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGGTT----------------------------------------------------------------------------------------------------------AACTTTCGCCTTAGGGCGGATAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTCTTACCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATAGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGATTAT-GGGGGCTTGCTGGA-CTCTTAGCGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTGAGTCGGAATAC-GAGTCAT------------------TACTCAGGCTTTCGAGTCTGGCTTAAGATCGGTTTGGAGGGT-AGCTTAACGGCTCCTTCTGCTTTCTCCCTTAG-AGGAGATACTTGTCCGATGCTTAGAGAGGA----------TCGCGTTAAGCTTTCCTTGAT---------TCTTGACTTTGTAGAAGGATTCAGCTTCTAACGGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA 'Armillaria tabescens 96-3-3b' GAAACTTGAA-TCGTAGCATCGAAAGCTGTTGCTGACCCG---T--AAGGGTATGTGCACGTTCGACGTGTTGCG----TTCTATTCATCCACCTGTGCAC-CTTTGTAGACTTGGTT----------------------------------------------------------------------------------------------------------AACTTTCGCCTTAGGGCGGATAGAAGGG----------TTGCTTTCGAGCT-CCC--T-TTGTCTTACCAAGTCTATGTCTATATAATCTCTTGTATGTC-TAGAATGTC-TTGTTTATAGGACG-CAAGTCCTTTAAA-TCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCCCCTTCTTTCATTAGGAGTGCGGCGGATTGGATTAT-GGGGGCTTGCTGGA-CTCTTAGCGAGATCAGCTCCTCTGAAATGCATTAGCAGAAACC-GTTTGACT-TTGGCTGC-TAGGCTGTGATAAT--ATCTACGCCTT-GTAGTTGAGTCGGAATAC-GAGTCAT------------------TACTCAGGCTTTCGAGTCTGGCTTAGGATCGGTTTGGAGGGT-AGCTTAACGGCTCCTTCTGCTTTCTCCCTTAG-AGGAGATACTTGTCCGATGCTTAGAGAGGA----------TCGCGTTAAGCTTTCCTTGAT---------TCTTGACTTTGTAGAAGGATTCAGCTTCTAACGGTCCATTGACTTGGACAATTTATTGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M5563] TITLE Fig.1_EF; LINK TAXA = Taxa2; DIMENSIONS NCHAR=465; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Armillaria cepistipes 04-16-1' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTTTCCTTAGGCACATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAATGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCCCTTACTCAA-CTATGACTAGG-CTGCTTCTTAATGTTATCTATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria cepistipes 2000-07-04' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTTAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACCGTTTTACTTTTTT-CCTTAGGCACATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTTGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGTCCTTTACCCAA-CTATGACTAGGGCTGCTTCTTAATGTTTTCTATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria cepistipes 2000-08-14' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTTTCCTTAGGCACATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAATGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCCCTTACTCAA-CTATGACTAGG-CTGCTTCTTAATGTTATCTATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria cepistipes 90-10-12' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTT-CCTTAGGCACATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAATGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCCCTTATTCAA-CTATGACTAGGGCTGCTTCTTAATGTTATCTATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria cepistipes 94-33-01' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTT-CCTTAGGCACATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAATGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCCCTTATTCAA-CTATTACTAGGGCTGCTTCTTAATGTTATCTATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria cepistipes 94-39-04' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTTAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACCGTTTTACTTTTTT-CCTTAGGCACATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGTCCTTTACCCAA-CTATGACTAGGGCTGCTTCTTAATGTTTTCTATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria cepistipes 94-46-01' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTT-CCTTAGGCACATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAATGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCCCTTACTCAA-CTATGACTAGGGTTGCTTCTTAATGTTATCTATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria cepistipes 96-19-01' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTT-CCTTAGGCACATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAATGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCCCTTACTCAA-CTATGACTAGGGCTGCTTCTTAATGTTATCTATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG Armillaria_cepistipes_ND1 GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTT-CCTTAGGCACATCTGACTGGTATTTCAGTGGAGCGAGGACCGGTTCAATGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCCCTTACTCAA-CTATGACTAGGGCTGCTTCTTAATGTTATCTATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG Armillaria_cepistipes_ND11 GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTTAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACCGTTTTACTTTTTT-CCTTAGGCACATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGTCCTTTACCCAA-CTATGACTAGGGCTGCTTCTTAATGTTTTCTATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria ectypa Je-2' GGAACTGGTGAATTCGAAGCTGGTATTTCCAAGGATGGCCAGACCC-GAGAGCACGCCCTTCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATTGTTGCCGTTAACAAGATGGACACCACCAAGGCACGAAACTTGCTTCTTTGCTTTTT--CTTTCGCGAAGTCTGATTTCTATCTTAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAAGTCGGCTACAACCCCAAGTCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCGGCTAAGTAAGTCA-TTCTCACA-TTACGTACAGTGCTAAGTCCTAATATTCTCTATAGCATGCCATGGTACAAGGGCTGGACAAAGGAGACCAAGGCCGGTGTTGTCAAGGGCAAGACTCTCCTCGACGCCATTGACGCCATCGAGCCCCCTG 'Armillaria ectypa Je-4' GGAACTGGTGAATTCGAAGCTGGTATTTCCAAGGATGGCCAGACCC-GAGAGCACGCCCTTCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATTGTTGCCGTTAACAAGATGGACACCACCAAGGCACGAAACTTGCTTCTTTGCTTTTT--CTTTCGCGAAGTCTGATTTCTATCTTAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAAGTCGGCTACAACCCCAAGTCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCGGCTAAGTAAGTCA-TTCTCACA-TTACGTACAGTGCTAAGTCCTAATATTCTCTATAGCATGCCATGGTACAAGGGCTGGACAAAGGAGACCAAGGCCGGTGTTGTCAAGGGCAAGACTCTCCTCGACGCCATTGACGCCATCGAGCCCCCTG 'Armillaria ectypa Je-7' GGAACTGGTGAATTCGAAGCTGGTATTTCCAAGGATGGCCAGACCC-GAGAGCACGCCCTTCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATTGTTGCCGTTAACAAGATGGACACCACCAAGGCACGAAACTTGCTTCTTTGCTTTTT--CTTTCGCGAAGTCTGATTTCTATCTTAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAAGTCGGCTACAACCCCAAGTCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCGGCTAAGTAAGTCA-TTCTCACA-TTACGTACAGTGCTAAGTCCTAATATTCTCTATAGCATGCCATGGTACAAGGGCTGGACAAAGGAGACCAAGGCCGGTGTTGTCAAGGGCAAGACTCTCCTCGACGCCATTGACGCCATCGAGCCCCCTG 'Armillaria ectypa Je-9' GGAACTGGTGAATTCGAAGCTGGTATTTCCAAGGATGGCCAGACCC-GAGAGCACGCCCTTCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATTGTTGCCGTTAACAAGATGGACACCACCAAGGCACGAAACTTGCTTCTTTGCTTTTT--CTTTCGCGAAGTCTGATTTCTATCTTAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAAGTCGGCTACAACCCCAAGTCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCGGCTAAGTAAGTCA-TTCTCACA-TTACGTACAGTGCTAAGTCCTAATATTCTCTATAGCATGCCATGGTACAAGGGCTGGACAAAGGAGACCAAGGCCGGTGTTGTCAAGGGCAAGACTCTCCTCGACGCCATTGACGCCATCGAGCCCCCTG Armillaria_gallica_NA13 GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTACCTTTT--GTTTAGCCAAATCTAACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATTGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCT-TTACCCAA-CTATGATCAGTGCTGTTTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG Armillaria_gallica_NA17 GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTACCTTTT--GTTTAGCCAAATCTAACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATTGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCT-TTACCCAA-CTATGATCAGTGCTGTTTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG Armillaria_gallica_NA4 GGAACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTATCTTTT--GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCT-TTACTCAA-CTATGACCAATGCTGTTTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG Armillaria_hinnulea_CMW4980 GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCC-GAGAGCATGCCCTCCTTGCCTTTACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACAAGATTTGCTGTTTCACCTTTT--CTTTAGCCAAATCTGACTGTTATATCAGTGGAGCGAGGACCGATTCAATGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCC-TTATCCAAGTTATGATCAGTACTATCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGACACCAAGGGCGGTGTCGTCAAGGGCAAGACTCTCCTTGACGCCATCGACGCTATTGAGCCCCCTG Armillaria_hinnulea_CMW4981 GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCCTGAGAGCATGCCCTCCTTGCCTTTACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACAAGATTTGTTGTTTCACCTTTT--CTTTAGCCAAATCTGACTGTTATATCAGTGGAGCGAGGACCGATTCAATGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCC-TTATCCAA-TTATGATCAGTACTATCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGACACCAAGGGCGGTGTCGTCAAGGGCAAGACTCTCCTTGACGCCATCGACGCTATTGAGCCCCCTG 'Armillaria mellea 89-07' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTAC-GGATCTGCTGTTTCAGTTTTT-----TAGTCAAATATGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGG-TACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTACGTCC-TTACTTAA-CTATGATCCGTATTG-ATCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGA-TAAGGCCGGTGTCG-CAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTG 'Armillaria mellea 94-10-1' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGGGATCTGCTGTTTCAGTTTTT-----TAGTCAAATATGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTACGTCC-TTACTTAA-CTATGATCCGTACTGTATCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACTAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTG 'Armillaria mellea 94-5' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGGGATCTGCTGTTTCAGTTTTT-----TAGTCAAATATGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATTTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAGGTCC-TTACTTAA-CTATGATCCGTACTGTATCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACTAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTG 'Armillaria mellea 94-68' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGGGATCTGCTGTTTCAGTTTTT-----TAGTCAAATATGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTACGTCC-TTACTTAA-CTATGATCCGTACTGTAACTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACTAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTG 'Armillaria mellea 94-7' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGGGATCTGCTGTTTCAGTTTTT-----TAGTCAAATATGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGG-TACAACCCCAAGGCTGTTGCTTTCGTCCCCATTTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAGGTCC-TTACTTAA-CTATGATCCGTACTG-ATCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACTAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTG 'Armillaria mellea 97-6' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGGGATCTGCTGTTTCAGTTTTT-----TAGTCAAATATGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGG-TACAACCCCAAGGCTGTTGCTTTCGTCCCCAT-TCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTACGTCC-TTACTTAA-CTATGATCCGTA-TG-ATCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGA-TAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCAT-GACGCCATTGAACCCCCTG 'Armillaria mellea A-10' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGGGATCTGCTGTTTCAGTTTTT-----TAGTCAAATATGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGG-TACAACCCCAAGGCTGTTGCTTTCGTCCCCAT-TCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTA-GTCC-TTACTTAA-CTATGATCCGTACTG-ATCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACTAAGGCCGGTGTCG-CAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTG 'Armillaria mellea A-12' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTAC-GGATCTGCTGTTTCAGTTTTT-----TAGTCAAATATGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGG-TACAACCCCAAGGCTGTTGCTTTCGTCCCCAT-TCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTA-GTCC-TTACTTAA-CTATGATCCGTACTG-ATCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGG-TGGACCAAGGAGA-TAAGGCCGGTGTCG-CAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTG 'Armillaria nabsnona 00-16-4' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCTTTT--GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGCCT-TTACCCAA-CTATGATCAGTGCTGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTTGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria nabsnona 00-3-1' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCTTTT--GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGCCT-TTACCCAA-CTATGATCAGTGCTGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTTGTCAAGGGCAAGACTCTCCTCGATGCCATTGATGCCATTGAGCCCCCTG 'Armillaria nabsnona 00-4-4' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAGAACTGCTGCTTTGCCTTTT--GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGCCT-TTACCCAA-CTATGATCAGTGCTACCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTTGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG Armillaria_nabsnona_NB3 GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCTTTT--GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGCCT-TTACCCAA-CTATGATCAGTGCTACCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTTGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG Armillaria_nabsnona_NB4 GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCTTTT--GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGCCT-TTACCCAA-CTATGATCAGTGCTGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTTGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria novae-zelandiae CMW4722' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCC-GAGAGCATGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAACTCATTGTCGCCGTCAATAAGATGGACACCACCAAGGTACGAGATCTGCTTTCTCACCATTT--CTTGAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTTC-TTATCCAA-CCATGATCAGTACCACCTCTTAACCTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGAACAAGTCCGGTGCGGTCAAGGGAAAGACTCTCCTTGATGCCATCGACGCCATTGAGCCACCTG 'Armillaria novae-zelandiae CMW4967' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCC-GAGAGCATGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAACTCATTGTCGCCGTCAATAAGATGGACACCACCAAGGTACGAGATCTGCTTTCTCACCATTT--CTTGAGCTAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTTC-TCATCCAA-CCATGATCAGTACCACCTCTTAACCTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGAACAAGTCCGGTGCGGTCAAGGGAAAGACTCTCCTTGATGCCATCGACGCCATTGAGCCACCTG 'Armillaria ostoyae 2002-66-03' GGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTT-CCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAA-GTATGACCAGTGCTGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria ostoyae 88-01-19' GGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTT-CCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAA-GTATGACCAGTGCTGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria ostoyae 89-03B-09' GGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTT-CCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAA-GTATGACCAGTGCTGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria ostoyae 91-01-10' GGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTT-CCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAA-GTATGACCAGTGCTGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria ostoyae 94-75-07' GGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTT-CCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAA-GTATGACCAGTGCTGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria ostoyae 94-8-2' GGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTT-CCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAA-GTATGACCAGTGCTGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG Armillaria_ostoyae_NC8 GGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTT-CCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAA-GTATGACCAGTGCTGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria sinapina 05-13-2' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTC--CTTGGGCAAATCTGACTGGTATGTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAA-CTATGATCAGTACTGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGAATAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria sinapina 05-46-1' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTC--CTTGGGCAAATCTGACTGGTATGTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAA-CTATGATCAGTGCTGCCTCTTAACGTTATCTGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGAATAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria sinapina 05-7-1' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTC--CTTGGGCAAATCTGACTGGTATGTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAA-CTATGATCAGTGCTGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGAATAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria sinapina 96-7-1' GGAACTGGTGAGTTGGAAGCCGGTATCTCCAAGGACGGCCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTC--CTTGGGCAAATCTGACTGGTATGTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAA-CTATGATCAGTGCTGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGAATAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria sinapina 96-8-1' GGAATTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTC--CTTGGGCAAATCTGACTGGTATGTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAA-CTATGATCAGTGCTGCCTCTTAATGTTCTCTGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGAATAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria sp. 00-13' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGATGGTCAGACCC-GAGAGCATGCCCTCCTAGCCTTCACCCTCGGTGTCAGGCAACTCATTGTCGCCGTCAATAAGATGGACACCACCAAGGTACAAGATCTGCTTTCTCACCATTA--CTTTAGCCGAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACGTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCTATCTCTGGATGGCACGGTGATAACATGTTGGAAGAGTCCGCCAAGTAAGTTC-TTATCCAA-CCATGATCAGTACCATCTCTTAACCTTCTTTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCTGGTGTGGTCAAGGGAAAGACTCTCCTTGATGCCATCGACGCCATTGAGCCCCCTG 'Armillaria sp. 00-14' GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGATGGTCAGACCC-GAGAGCATGCCCTCCTAGCCTTCACCCTCGGTGTCAGGCAACTCATTGTCGCCGTCAATAAGATGGACACCACCAAGGTACAAGATCTGCTTTCTCACCATTA--CTTTAGCCGAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACGTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCTATCTCTGGATGGCACGGTGATAACATGTTGGAAGAGTCCGCCAAGTAAGTTC-TTATCCAA-CCATGATCAGTACCATCTCTTAACCTTCTTTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCTGGTGTGGTCAAGGGAAAGACTCTCCTTGATGCCATCGACGCCATTGAGCCCCCTG Armillaria_sp._CMW4143 GGAACTGGTGAGTTCGAAGCGGGTATCTCCAAGGACGGTCAGACCC-GAGAGCATGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAACTCATTGTCGCCGTCAATAAGATGGACACCACCAAGGTACAAGATCTGCTTTTTCACCATTC--CTTAAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACGTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCCTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAAGAGTCCGCCAAGTAAGTTC-TTATCCAA-CCATGATCAGTACCACCTCTTAACTTTCTTTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGATACCAAGGCTGGTGTGGTCAAGGGAAAGACTCTCCTTGATGCCATCGACGCCATTGAGCCCCCTG 'Armillaria sp. Nag.E 2000-23-02' GGAACTGGTGAGTTCGAAGCCGGTATCTCTAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTATGAGATCTGCTGCTTTGCCCTTT--GTTTAGCTAAATTTGACTGTTATCTCAGTGGAGCGAGGATCGATTCAATGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTTC-TTA-CCATGGTATGATCAGTGCCGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria sp. Nag.E 2003-71-13b' GGAACTGGTGAGTTCGAAGCCGGTATCTCTAAGGACGGTCAGACCC-GAGAACACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCCTTT--GTTTAGCCAAATTTGACTGTTATCTCAGTGGAGCGAGGATCGATTCAATGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTTC-TTA-CCATGGTATGATCAGTGCCGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria sp. Nag.E 94-2-1' GGAACTGGTGAGTTCGAAGCCGGTATCTCTAAGGACGGTCAGACCC-GAGAACACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCCTTT--GTTTAGCCAAATTTGACTGTTATCTCAGTGGAGCGAGGATCGATTCAATGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTTC-TTA-CCATGGTATGATCAGTGCCGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria sp. Nag.E 94-35-01' GGAACTGGTGAGTTCGAAGCCGGTATCTCTAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCCTTT--GTTTAGCTAAATTTGACTGTTATCTCAGTGGAGCGAGGATCGATTCAATGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTTC-TTA-CCATGGTATGATCAGTGCCGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria sp. Nag.E 94-43-08' GGAACTGGTGAGTTCGAAGCCGGTATCTCTAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCCTTT--GTTTAGCTAAATTTGACTGTTATCTCAGTGGAGCGAGGATCGATTCAATGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTTC-TTA-CCATGGTATGACCAGTGCCGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG 'Armillaria sp. Nag.E 96-37-1' GGAACTGGTGAGTTCGAAGCCGGTATCTCTAAGGACGGTCAGACCC-GAGAACACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCCTTT--GTTTAGCCAAATTTGACTGTTATCTCAGTGGAGCGAGGATCGATTCAATGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTTC-TTA-CCATGGTATGATCAGTGCCGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG Armillaria_sp._Nag.E_NE4 GGAACTGGTGAGTTCGAAGCCGGTATCTCTAAGGACGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCCTTT--GTTTAGCTAAATTTGACTGTTATCTCAGTGGAGCGAGGATCGATTCAATGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTTC-TTA-CCATGGTATGACCAGTGCCGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG Armillaria_sp._PNZ87.54 GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGATGGTCAGACCC-GAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAACTCATTGTCGCCGTCAATAAGATGGACACCACCAAGGTACAAGATCTGCTTTCTCACTATTC--CTTTAGCCAAATCTGACTGTTATCT-AGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTTCCCATCTCTGGATGGCACGGTGATAACATGTTGGAAGAGTCCGCCAAGTAAGTTC-TTATCCAA-CCATGATCAGTACCACCTCTCAACCTTCTTTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTGACCAAGGGAAAGACTCTCCTTGATGCCATCGACGCCATTGAGCCCCCTG 'Armillaria tabescens 2002-06-03' GGTACTGGTGAATTCGAAGCCGGTATCTCCAAGGATGGTCAGACCC-GAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT--CTTTCGCGAAGTCCGACATTTGTCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAATCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTAAGTCA-TTACCATA-TTATGAGCGATGCGGCGGCTTAACGTTATTGAAAGCATGCCATGGTACAAGGGCTGGACGAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCTATTGATGCCATTGAGCCCCCTG 'Armillaria tabescens 2006-20-01' GGTACTGGTGAATTCGAAGCCGGTATCTCCAAGGATGGTCAGACCC-GAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT--CTTTCGCGAAGTCCGACATTTGTCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAATCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTAAGTCA-TTACCATA-TTATGAGCGATGCGGCGGCTTAACGTTATTGAAAGCATGCCATGGTACAAGGGCTGGACGAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCTATTGATGCCATTGAGCCCCCTG 'Armillaria tabescens 96-1-8' GGTACTGGTGAATTCCAAGCCGGTATCTCCAAGGATGGTCAGACCC-GAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT--CTTTCGCGAAGTCCGACATTTGTCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAATCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTAAGTCA-TTACCATA-TTATGAGCGATGCGGCGGCTTAACGTTATTGAAAGCATGCCATGGTACAAGGGCTGGACGAAGGAGACCAAGGCCGGTGTCGTCAAGGGCACGACTCTCCTCGATGCTATTGATGCCATTGAGCCCCCTG 'Armillaria tabescens 96-3-3' GGTACTGGTGAATTCGAAGCCGGTATCTCCAAGGATGGTCAGACCC-GAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT--CTTTCGCGAAGTCCGACATTTGTCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAATCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTAAGTCA-TTACCATA-TTATGAGCGATGCGGCGGCTTAACGTTATTGAAAGCATGCCATGGTACAAGGGCTGGACGAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCTATTGATGCCATTGAGCCCCCTG ; END; BEGIN TREES; TITLE Fig1_EF100517_TB; LINK TAXA = Taxa2; TRANSLATE 1 'Armillaria sp. Nag.E 2003-71-13b', 2 'Armillaria cepistipes 04-16-1', 3 'Armillaria cepistipes 2000-07-04', 4 'Armillaria cepistipes 2000-08-14', 5 'Armillaria cepistipes 90-10-12', 6 'Armillaria cepistipes 94-33-01', 7 'Armillaria cepistipes 94-39-04', 8 'Armillaria cepistipes 94-46-01', 9 'Armillaria cepistipes 96-19-01', 10 Armillaria_cepistipes_ND1, 11 Armillaria_cepistipes_ND11, 12 'Armillaria ectypa Je-2', 13 'Armillaria ectypa Je-4', 14 'Armillaria ectypa Je-7', 15 'Armillaria ectypa Je-9', 16 Armillaria_gallica_NA13, 17 Armillaria_gallica_NA17, 18 Armillaria_gallica_NA4, 19 Armillaria_hinnulea_CMW4980, 20 Armillaria_hinnulea_CMW4981, 21 'Armillaria mellea 89-07', 22 'Armillaria mellea 94-10-1', 23 'Armillaria mellea 94-5', 24 'Armillaria mellea 94-68', 25 'Armillaria mellea 94-7', 26 'Armillaria mellea 97-6', 27 'Armillaria mellea A-10', 28 'Armillaria mellea A-12', 29 'Armillaria nabsnona 00-16-4', 30 'Armillaria nabsnona 00-3-1', 31 'Armillaria nabsnona 00-4-4', 32 Armillaria_nabsnona_NB3, 33 Armillaria_nabsnona_NB4, 34 'Armillaria novae-zelandiae CMW4722', 35 'Armillaria novae-zelandiae CMW4967', 36 'Armillaria ostoyae 2002-66-03', 37 'Armillaria ostoyae 88-01-19', 38 'Armillaria ostoyae 89-03B-09', 39 'Armillaria ostoyae 91-01-10', 40 'Armillaria ostoyae 94-75-07', 41 'Armillaria ostoyae 94-8-2', 42 Armillaria_ostoyae_NC8, 43 'Armillaria sinapina 05-13-2', 44 'Armillaria sinapina 05-46-1', 45 'Armillaria sinapina 05-7-1', 46 'Armillaria sinapina 96-7-1', 47 'Armillaria sinapina 96-8-1', 48 'Armillaria sp. 00-13', 49 'Armillaria sp. 00-14', 50 Armillaria_sp._CMW4143, 51 'Armillaria sp. Nag.E 2000-23-02', 52 'Armillaria sp. Nag.E 94-2-1', 53 'Armillaria sp. Nag.E 94-35-01', 54 'Armillaria sp. Nag.E 94-43-08', 55 'Armillaria sp. Nag.E 96-37-1', 56 Armillaria_sp._Nag.E_NE4, 57 Armillaria_sp._PNZ87.54, 58 'Armillaria tabescens 2002-06-03', 59 'Armillaria tabescens 2006-20-01', 60 'Armillaria tabescens 96-1-8', 61 'Armillaria tabescens 96-3-3'; TREE Fig._1 = [&R] (((60:2.0,61:0.0):0.0,58:0.0,59:0.0):27.0,(((12:0.0,13:0.0):0.0,14:0.0):0.0,15:0.0):25.0,((((19:0.0,20:1.0):11.0,((35:2.0,34:0.0):6.0,(57:6.0,(50:7.0,(49:0.0,48:0.0):5.0):2.0):5.0):12.0):7.0,((((55:0.0,1:0.0):0.0,52:0.0):1.0,((53:0.0,51:1.0):0.0,(56:0.0,54:0.0):1.0):1.0):11.0,((18:6.0,(17:0.0,16:0.0):3.0):3.0,((31:1.0,32:0.0):1.0,(30:1.0,(33:0.0,29:0.0):0.0):3.0):3.0):2.0):5.0):1.0,((28:0.0,((27:0.0,(25:0.0,23:0.0):0.0):2.0,(21:1.0,(26:0.0,(22:0.0,24:1.0):0.0):0.0):0.0):0.0):18.0,((((((39:0.0,42:0.0):0.0,36:0.0):0.0,38:0.0):0.0,40:0.0):0.0,(41:0.0,37:0.0):1.0):9.0,((46:1.0,(43:1.0,(47:2.0,(45:0.0,44:1.0):0.0):0.0):0.0):8.0,(((11:0.0,3:1.0):0.0,7:0.0):4.0,(10:1.0,((6:1.0,5:0.0):1.0,((2:0.0,(9:0.0,8:1.0):0.0):0.0,4:0.0):0.0):0.0):4.0):8.0):5.0):4.0):3.0):23.0); END; BEGIN TREES; TITLE Fig2_100520_ITS_TB; LINK TAXA = Taxa1; TRANSLATE 1 'Armillaria cepistipes 94-39-04b', 2 'Armillaria ostoyae 94-75-07b', 3 'Armillaria ostoyae 94-8-2', 4 'Armillaria mellea 97-6', 5 'Armillaria mellea 94-10-1', 6 'Armillaria mellea 94-68', 7 'Armillaria ostoyae 88-01-19b', 8 'Armillaria mellea A-10', 9 'Armillaria ostoyae 89-03B-09b', 10 'Armillaria cepistipes 90-10-12', 11 'Armillaria mellea 94-7', 12 'Armillaria mellea A-12', 13 'Armillaria ostoyae 91-01-10', 14 'Armillaria cepistipes 94-33-01', 15 'Armillaria tabescens 96-1-8', 16 'Armillaria tabescens 96-3-3b', 17 'Armillaria ectypa Je-2', 18 'Armillaria ectypa Je-4', 19 'Armillaria ectypa Je-7', 20 'Armillaria ectypa Je-9', 21 Armillaria_cepistipes_ND11, 22 'Armillaria cepistipes 2000-07-04', 23 'Armillari sp. Nag.E 2003-71-13', 24 Armillaria_gallica_NA17, 25 'Armillaria sinapina 96-7-1b', 26 Armillari_sp._Nag.E_NE4, 27 'Armillaria cepistipes 2000-08-14', 28 'Armillaria nabsnona 00-4-4', 29 'Armillaria cepistipes 04-16-1', 30 'Armillaria sinapina 96-8-1', 31 'Armillaria sp. Nag.E 2000-23-02b', 32 'Armillaria mellea 94-5', 33 Armillaria_gallica_NA4, 34 'Armillaria cepistipes 96-19-01', 35 'Armillaria nabsnona 00-16-4', 36 'Armillaria sinapina 05-13-2', 37 Armillaria_cepistipes_ND1, 38 'Armillaria sinapina 05-7-1', 39 'Armillaria tabescens 2006-20-01b', 40 'Armillaria sp. Nag.E 94-2-1', 41 'Armillaria sinapina 05-46-1', 42 Armillaria_gallica_NA13, 43 'Armillaria sp. Nag.E 94-35-01', 44 'Armillaria tabescens 2002-06-03', 45 'Armillaria sp. Nag.E 96-37-1', 46 Armillaria_nabsnona_NB3, 47 'Armillaria sp. Nag.E 94-43-08', 48 'Armillaria ostoyae 2002-66-03', 49 Armillaria_ostoyae_NC8, 50 'Armillaria cepistipes 94-46-01', 51 'Armillaria nabsnona 00-3-1', 52 Armillaria_nabsnona_NB4, 53 Armillaria_sp._CMW3951, 54 'Armillaria sp. 00-13', 55 'Armillaria sp. 00-14', 56 Armillaria_sp._PNZ87.54.1, 57 'Armillaria novae-zelandiae Arg55', 58 'Armillaria novae-zelandiae RP8306', 59 'Armillaria novae-zelandiae CMW4964', 60 'Armillaria novae-zelandiae RP2615', 61 'Armillaria novae-zelandiae RP2560', 62 'Armillaria novae-zelandiae Arg49', 63 Armillaria_sp._CMW4143, 64 'Armillaria navae-zelandiae CMW4722'; TREE Fig._2 = [&R] (((((((((((1:1.0,((((10:0.0,(34:0.0,37:2.0):0.0):0.0,((14:0.0,38:3.0):0.0,21:2.0):0.0):0.0,(22:1.0,27:0.0):1.0):0.0,42:5.0):0.0):0.0,36:2.0):0.0,((25:2.0,30:2.0):1.0,(29:1.0,50:3.0):0.0):1.0):2.0,(24:3.0,33:3.0):3.0):1.0,41:8.0):4.0,((((23:1.0,31:1.0):0.0,26:1.0):1.0,(((40:1.0,43:0.0):0.0,45:0.0):0.0,47:0.0):0.0):7.0,(((28:2.0,51:1.0):1.0,(35:3.0,52:2.0):0.0):2.0,46:3.0):2.0):7.0):20.0,(((2:0.0,9:1.0):3.0,(7:0.0,13:1.0):0.0):1.0,((3:1.0,49:0.0):1.0,48:0.0):4.0):20.0):18.0,((15:1.0,(16:0.0,39:0.0):0.0):1.0,44:2.0):33.0):27.0,((((((4:4.0,5:0.0):0.0,8:0.0):0.0,12:0.0):3.0,6:4.0):3.0,32:2.0):5.0,11:3.0):55.0):34.0,(((17:0.0,18:0.0):0.0,19:0.0):0.0,20:0.0):74.0):10.0,((((53:11.0,54:0.0):0.0,55:0.0):11.0,56:6.0):11.0,63:26.0):35.0,(((57:1.0,58:0.0):0.0,62:0.0):24.0,(59:8.0,(60:0.0,(61:2.0,64:5.0):4.0):10.0):11.0):58.0); END;