#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 5:30 GMT TreeBASE (cc) 1994-2008 Study reference: Sultan A., Johnston P., Park D., & Robertson A. 2010. Two new pathogenic ascomycetes in Guignardia and Rosenscheldiella on New Zealand’s pygmy mistletoes (Korthalsella: Viscaceae). Studies in Mycology, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10523] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=22; TAXLABELS Botryosphaeria_dothidea_AY259092 Guignardia_aesculi_AB095504 Guignardia_bidwellii_AB095509 Guignardia_citricarpa_AF374364 Guignardia_citricarpa_AY042917 Guignardia_gaultheriae_AB095506 Guignardia_mangiferae_AB041233 Guignardia_mangiferae_AY277711 Guignardia_philoprina_AB095507 Guignardia_philoprina_AF312014 Phyllosticta_beaumarisii_AY042927 Phyllosticta_eugeniae_AY042925 Phyllosticta_hypoglossi_AY042923 Phyllosticta_owaniana_AF312011 Phyllosticta_podocarpi_AF312013 Phyllosticta_pyrolae_AB041242 Phyllosticta_pyrolae_AF312010 Phyllosticta_spinarum_AF312009 Phyllosticta_spinarum_AY042907 Phyllosticta_telopeae_AY042909 Phyllosticta_vaccinii_AB095508 Rosenscheldiella_korthalsellae_PDD94884 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=23; TAXLABELS Cercospora_beticola_CBS116456 Davidiella_tassiana_STE.U.5101 Mycosphaerella_aurantia_CBS110500 Mycosphaerella_buckinghamiae_CBS112175 Mycosphaerella_colombiensis_CMW11255 Mycosphaerella_communis_CBS110976 Mycosphaerella_fori_CMW9096 Mycosphaerella_graminicola_CBS100335 Mycosphaerella_grandis_CMW8554 Mycosphaerella_heimii_CPC15429 Mycosphaerella_lateralis_CBS111169 Mycosphaerella_pini_ATCC28973 Mycosphaerella_punctata_CBS113315 Mycosphaerella_walkeri_CMW20333 Phaeocryptopus_gaeumannii_CBS267.37 Pseudocercospora_natalensis_CBS111069 Pseudocercospora_paraguayensis_CBS111286 Pseudocercospora_vitis_CPC11595 Readeriella_novaezelandiae_CBS114357 Rosenscheldiella_brachyglottidis_PDD94939 Rosenscheldiella_korthalsellae_PDD94885 Teratosphaeria_mexicana_CBS110502 Teratosphaeria_nubilosa_CBS116005 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M5815] TITLE Guignardia_Matrix_F6; LINK TAXA = Taxa1; DIMENSIONS NCHAR=600; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Botryosphaeria_dothidea_AY259092 TTACCGAGTTGATTC------------------------------------------------------GGGCTCCGGCCCGATCC-TCCCACCCTTTGT-GTACCT-ACCTCTGTTGCTTTGGCGGGCCG---CGGTCC----TCCG---CGGCCGGCCCCCCTCCCCGGGGG---GTGGCCAG--CGCCCGCCAGAGGACC---------ATCAAACTCCAGTCAGTAAACGATGCA-GTC-TGAA-AAA-CATTTAATAAACT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAAGCTCTGCTTGGTATTGGGCACCGTCCT---TTGCGGGCGCGCCTCAAAGACCTCGGCGGTGGCGTCTT-GCCTCAAGCGTAGTAG-AACATACATCTCGCTTCGGAGC-GCAGGGCGTC-GCCCGCC-GGACGA----ACCTTCTG-AACTTT-----TCTCAA Guignardia_aesculi_AB095504 TTACTGACCT--A-TAA----T-CTCTTT---GAAAGGTCGCCGGTACCCGGTCCCCCCCCAAAAAGGGGGGCCGGGGAAGGTCCTCTCACACCCCTTGT-GTACCTTACCA-TGTTGCTTTGGCGGGCCGACCCGGTTT-CGACCCGGG-CGGCCGGCGCCCCCAGCCTAC-----GGGGCCAGGACGTCCGGCTAAGCGCCCGCCAGTACATAAAACTCCAGCGATCATTTCGTGTC-GTCCTGATGAAATTATTCAATTAATC-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGACGTCCG--CTGCCGGACGCGCCTCGAAGACCTCGGCGACGGCGTCACGGCCTCGAGCGTAGTAGTAAAAT--T-CTCGCTTTGGAGC-GCTGGACGACGGCC-GCC-GGACAA-TCGACCTTCGGTCTAAACAAC--TTCCAA Guignardia_bidwellii_AB095509 TTACTGAAAT-TAGTAA----CCTTC------GAAAGG--ATCG--AGTAGGCCGGCCCT--CGAAAGCCGGCCGAAAGAGCCCTTCTCACCC---TTGT-GTACCTTACCA-CGTTGCTTTGGCGGGCCGACCCGGTTT-CGACCCGGG-CGGCCGGCGCCCCCAGCCCCGCG-----GGCCAGGACGTCCGGCCAAGCGCCCGCCAGTATACAAAACTCAAGCGATTATCTTGTGAA-GTCCTGACGC-ATCATTCAATTGATT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGCATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGACGTCCG--CCGTCGGACGCGCCTCGAAGACCTCGGCGACGGCGTCCCAGCCTCGAGCGTAGTAGTAAC----ATCTCGCTTTGGAGC-GCTGGGCGACGGCC-GCC-GGACAA-CCGACCTACGGTCT-AATTTT--TCCAAA Guignardia_citricarpa_AF374364 ----TGAAAT-ACGTAAT----CCT-------GAAAGGTGATGGAAGGGAGGCCTT-----AAAAAAGCCGCCCGAC--CT--ACCTTCACACCC-TTGT-GTATCT-ACCA-TGTTGCTTTGGCGGGCCGACCCGGTTT-TGACCCGGG-CGGTCGGCGCCCCCAGCCTAGTC-TCTAGGCCAGGACGCCTGGCTAAGTGCCCGCCAGTATACAAAACTCCAGCGATTATTCTGTGTA-GTCCTGAGAA-TTCATTTAATGAAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGACGTCCG--CTGCCGGACGCGCCTGGAAGACCTCGGCGACGGCGTCTCAGCCTCGAGCGTAGTAGTAAAAT--ATCTCGCTTTGGAGG-AGGGGGGCGCTGGCCGCC-GGACAA-TCGACCTTCGGTCACTATTT---TTCCAA Guignardia_citricarpa_AY042917 ---CTGAAAT-ACGTAAT----CCT-------GAA-GGTGATGGAAGGGAGGCCTT-----AAAAAAGCCGCCCGAC--CT--ACCTTCACACCC-TTGT-GTATCT-ACCA-TGTTGCTTTGGCGGGCCGACCCGGTTT-TGACCCGGG-CGGTCGGCGCCCCCAGCCTAGTC-TCTAGGCCAGGACGCCTGGCTAAGTGCCCGCCAGTATACAAAACTCCAGCGATTATTCTGTGTA-GTCCTGAGAA-TTCATTTAATGAAAT-AA-------------------------------------------------------------------------------------------------CTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGACGTCCG--CTGCCGGACGCGCCTGGAAGACCTCGGCGACGGCGTCTCAGCCTCGAGCGTAGTAGTAAAAT--ATCTCGCTTTGGAGG-AGGGGGGCGCTGGCCGCC-GGACAA-TCGACCTTCGGTCACTATTT---TTCCAA Guignardia_gaultheriae_AB095506 TTACTGAACT--AGTA-----TTCTCT-----GAAAGGTCGCCGGTACCCGGTCCCCCCT-AAACAAGGGGGCCGGGGAAGGTCCTCTCACACCC-TTGTTGTACCTTACCA-TGTTGCTTTGGCGG-CCGACCCGGTTT-CGACCCGGG-CGGCCGGCGCCCCCAGCC-TC----ACCGGCCAGGACGTCAGGCTAAGCGCCCGCCAGTATACAAAACTCCAGCGATTATTTCGTGCA-GTTCTGAT-AAATTATTCAATTAATT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGACGTCCG--CTGCCGGACGCGCCTCGAAGACCTCGGCGACGGCGTCTTAGCCTCGAGCGTAGTAGTAACAT----CTCGCTTTGGAGT-GCTAGGCGTTGGCC-GCC-GGACAA-TCGACCTTTGGTCTATT--AC--TTCCAA Guignardia_mangiferae_AB041233 TTACTGAAAT---GTAATAACTTCTATT----GAAAGGTTCCAG--AGTAGGCGCT------ACAACGCCGAAATGA-------CCTTCTCACCC-TTGT-GTA-CTCACTA-TGTTGCTTTGGCGGGTCGACCTGGTTC-CGACCCAGG-CGGCCGGCGCCCCCAGCCTTAACT----GGCCAGGACGCCCGGCTAAGTGCCCGCCAGTATACAAAACTCAAGAATTCATTTTGTGAA-GTCCTGAT-ATATCATTTAATTGATT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCAACGTCCG--CTGCCGGACGTGCCTTGAAGACCTCGGCGACGGCGTCCTAGCCTCGAGCGTAGTAGTAAAAT--ATCTCGCTTTGGAGT-GCTGGGCGACGGCC-GCC-GGACAA-TCGACCTTCGGTCTATTT-----TTCCAA Guignardia_mangiferae_AY277711 TTACTGAAAT---GTAATAACTTCTATT----GAAAGGTTCCAG--AGTAGGCGCT------ACAACGCCGAAATGA-------CCTTCTCACCC-TTGT-GTA-CTCACTA-TGTTGCTTTGGCGGGTCGACCTGGTTC-CGACCCAGG-CGGCCGGCGCCCCCAGCCTTAACT----GGCCAGGACGCCCGGCTAAGTGCCCGCCAGTATACAAAACTCAAGAATTCATTTTGTGAA-GTCCTGAT-ATATCATTTAATTGATT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCAACGTCCG--CTGCCGGACGTGCCTTGAAGACCTCGGCGACGGCGTCCTAGCCTCGAGCGTAGTAGTAAAAT--ATCTCGCTTTGGAGC-GCTGGGCGACGGCC-GCC-GGACAA-TCGACCTTCGGTCTATTT-----TTCCAA Guignardia_philoprina_AB095507 TTACTGAACT--AGTAA----TTCTCT-----GAAAGGTCGCCGGTAGGGGGTCCCCCTT-AAACAAGGGGCCCCCCGAAGGTCCTCTCACACCC-TTGT-GTACCTTACCA-CGTTGCTTTGGCGGGCCGACCCGGTTT-CGACCCGGG-CGGCCGGCGCCCCCAGCC-TCC----GGGGCCAGGACGTCAGGCTAAGCGCCCGCCAGTAAACAAAACTCCAGCGATTATTTTGTGTA-GTCCTGACG-AATTATTCAATTAATTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGATTTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGACGTCCG--CTGCCGGACGCGCCTCGAAGACCTCGGCGACGGCGTCCCAGCCTCGAGCGTAGTAGTAACAT--ATCTCGCTCTGGAGT-GCTGGGCGTTGGCC-GCC-GGACAA-TCGACCTTCGGTC-ACTATTT--TTCCAA Guignardia_philoprina_AF312014 TTACTGAACT--AGTAA----TTCTCT-----GAAAGGTCGCCG-TAGGGGGCCCCCCCT-AAACAAGGGGCCCCC-GAAGGTCCT-TCACACCC-TTGT-GTACCTTACCA-CGTTGCTTTGGCGGGCCGACCCGGTTT-CGACCCGGG-CGGCCGGCGCCCCCAGCCCTCC----AGGGCCAGGACGTCAGGCCAAGCGCCCGCCAGTAAACAAAACTCCAGCGATTATTTCATGCG-GTCCTGAT-AAATTATTCAATTAATT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGATTTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGACGTCCG--CTGCCGGACGCGCCTCGAAGACCTCGGCGACGGCGTCCCAGCCTCGAGCGTAGTAGTAAAAT--ATCTCGCTCTGGAGT-GCTGGGCGTTGGCC-GCC-GGACAA-CCGACCTTCGGTC-ACTATTT--TTCCAA Phyllosticta_beaumarisii_AY042927 ---CTGAGATGAAGTAA----TTCCCTC----GAAAGGCCTTCG--ATTAGGCCGGCCCC--TCGG-GCCGGCCGAAAGAACCTCTCGCACCC---TTGCCGTACCTCACCG-TGTTGCTTTGGCGGGCCGACCCGGTTT-CGACCCGGG-CGGCCGGCGCCCCCAGCCCTCAGC----GGCCAGGACGCCTGGCCAAGTGCCTGCCAGTACACAAAACTCCAGCGATTATCCCGTGCA-GTCCTGAAAC-ATCATTAAATTGAATCAA-------------------------------------------------------------------------------------------------CTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGGCGTCCG--CTGCCGGACGCGCCTCGAAGACCTCGGCGACGGCGCCACAGCCTCGAGCGTAGTAGTGAAAT--ATCTCGCTCTGGAGCCGCTGGGCGACGGCC-GCC-GGACAA-TCGACCTTCGGTCTGAATTTT---TCCAA Phyllosticta_eugeniae_AY042925 ---CTGAAAT-ATGTAA----TTCTCA------AAAGGTCCCTCG-AGTAGGCCGGCCCT--AAAAAGCCGGTCGAAAGAGCCCTTCTCACCC---TTG?TGTACCTTACCA-TGTTGCTTTGGCGGGCCGACCCGGTTT-CGACCCGGG-CGGCCGGCGCCCCCAGCCCCTTAC-CG-GGCCAGGACGCCCGGCTAAGTGCCCGCCAGTATACAAAACTCAAGCGATTATTTTGTGAA-GTCCTGACAT-ATCATTCAATTGATT-AA-------------------------------------------------------------------------------------------------CTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCTCTGCTTGGTATTGGGCGACGTCCG--CTGCCGGACGCGCCTTGAAGACCTCGGCGACGGCGTCTCAGCCTCGAGCGTAGTAGTTAA-T--ATCTCGCTTTGGAGT-GTTGGGCGACGGCC-GCC-GGACAA-TCGACCTTCGGTCC--ATTTT--TCCGAA Phyllosticta_hypoglossi_AY042923 ---CTGAAA--ATGTAATAA-CCCT---TTAGGATCT??AAG----GGGGAGCCGT-----CGAACGCTCCCCTGT?--ACTGTGCCTCACACCC-TTGT-GTTT?T-ACCA-TGTCGCTTTGGCGGGCCGACCCGGCTT-TGACCCGGG-CGGCCGGCGCCCCCAGCCTAGTCTT?TAGGCCAGGACGCCCGGCTAAGTGCCCGCCAGTATACAAAACTCCAGCGATTATTCTGTGTAAGTCCTGAGAA-T?TATTCAATGAATT-AA-------------------------------------------------------------------------------------------------CTTTGAACGCACATTGCGCCCTCTGGCATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGACGTCTG--CCGTCAGACGCGCCTGGAAGACCTCGGCGACGGCATCCCAGCCTCGAGCGTAGTAGTAAAAC--ATCTCGCTTTGGAGG-ATGGGGTGACGGCTTGCC-GGACAA-CCGACCTCTGGTCATTTTTTTTTTTCCAA Phyllosticta_owaniana_AF312011 ---CTGAATT-TACCAGTAT--CCT---TTAGGAGAGAGGCCCC--GGGGAGCCGT-----GAAAAGCTCCCCGGGCTGCCCACCCTCCACACCC-TTGT-GTACCT-TCTA-TGTTGCTTTGGCGGGCCGACCCGGTTT-CGACCCGGG-CGGCCGGCGCCCCCAGCCCCCTAAACAGGGCCAGGACGTCTGGCTAAGTGCCCGCCAGTATACAAAACTCGAACTATGATCTT-CGCG-GTTCTGAATAAATTTTTTAATGAATT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGACGTCCGGTCAAACGGACGCGCCTGGAAGACCTCGGCGACGGCGTCTCAGCCTCGAGCGTAGTAGAATCTTTCATCTCGCTCTGGAGG-AGGGGACGGC-GCCTGCC-GGACAA-TCGACCTTCAGTCTATTTTTT--T-CTAA Phyllosticta_podocarpi_AF312013 TTACTGAACT-TAACAGTAT--CCT---TTAGGAGAGAGGCCCCCCGGGAAGCCGT-----AAAAAGCTTCTCGGGTGGCCCACCCTCCACACCC-TTGT-GTACCT-TCTA-TGTTGCTTTGGCGGGCCGACCCGGTTT-CGACCCGGG-CGGCCGGCGACCCCAGCCCC-TAAACAGGGCCAGGACGTCTGGCTAAGCGCCCGCCAGTATACAAAACTCGAACTATGATCTT-TGTG-GTTCTGAATAAATTTTTTAATAAATT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGACGTCCGGTCAAACGGACGCGCCTGGAAGACCTCGGCGACGGCGTCTCAGCCTCGAGCGTAGTAGAATCTTTTATCTCGCTTTGGAGG-AGGGGACGGC-GCCTGCC-GGACAA-TCGACCTTCAGTCTATTTTTT--TTCTAA Phyllosticta_pyrolae_AB041242 TTACTGAACT--AGTAA----TTCTCT-----GAAAGGTCGCCGGTACCCGGTCCCCCCC-AAACAAGGGGGTCGGGGAAGGTCCTCTCACACCC-TTGT-GTACCTTACCA-TGTTGCTTTGGCGGGCCGACCCGGTTT-CGACCCGGG-CGGCCGGCGCCCCCAGCCCTC----ACCGGCCAGGACGTCAGGATAAGCGCCCGCCAGTATACAAAACTCGAGCGATTATTTCGTGTA-GTTCTGAT-AAATTATTCAATTAATT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGACGTCCG--CTGCCGGACGCGCCTCGAAGACCTCGGCGACGGCGTCTTAGCCTCGAGCGTAGTAGTAACGT----CTCGCTTTGGAGT-GCTAGGCGTCGGCC-GCC-GGACAA-TCGACCTTTGGTCCATT--AC--TTCCAA Phyllosticta_pyrolae_AF312010 TTACTGAACT--AGTAA----TTCTCT-----GAAAGGTCGCCGGTACCCGGTCCCCCCT-AAACAAGGGGGCCGGGGAAGGTCCTCTCACACCC-TTGT-GTACCTTACCA-TGTTGCTTTGGCGGGCCGACCCGGTTT-CGACCCGGG-CGGCCGGCGCCCCCAGCCCTC----ACCGGCCAGGACGTCAGGCTAAGCGCCCGCCAGTATACAAAACTCCAGCGATTATTTCGTGCA-GTTCTGAT-AAATTATTCAATTAATT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGACGTCCG--CTGCCGGACGCGCCTCGAAGACCTCGGCGACGGCGTCTTAGCCTCGAGCGTAGTAGTAACAT----CTCGCTTTGGAGT-GCTAGCCGTTGGCC-GCC-GGACAA-TCGACCTTTGGTCTATT--AC--TTCCAA Phyllosticta_spinarum_AF312009 TTACTGAAA--ATGTAATAAACCCT---TCAGGTTTTGGAAG----GGGGAGCCGT-----CAAAAGCTTCCCTGGT--AC-ATGCCTCAC-CCC-TTGT-ATATCT-ACCA-TGTTGCTTTGGCGGGCCGACCCGGTTT-CGACCCGGG-CGGCCGGCGCCCCCAGCCTGCT-TGCCAGGCCAGGACGCCCGGCCAAGTGCCCGCCAGTATACAAAACTCCAGCGATTATTTTGTGTA-GTCCTGAGAA-TTTATTCAATAAATT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGCATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGACGTCTG--CTGTCAGACGCGCCTGGAAGACCTCGGCGACGGCATTCCAGCCTCGAGCGTAGTAGTAAAAT--ATCTCGCTTTGGAGG-ATGGGGTGACGGCTTGCC-GGACAA-CCGACCTCTGGTCATTTT-----TTCCAA Phyllosticta_spinarum_AY042907 ---CTGAAA--ATGTAATAA-CCCT---C-AGGTTTTGGAAG----GGAGAGCCGT-----CAAAAGCTCTCCTGGT--AC-ATGCCTCACACCC-TTGT-GTATCT-ACCA-TGTTGCTTTGGCGGGCCGACCCGGTTT-CGACCCGGG-CAGCCGGCGCCCCCAGCCTAGTCTCCTAGGCCAGGACGCCCGGCTAAGTGCCCGCCAGTATACAAAACTCCAGCGATTATTTTGTGTA-GTCCTGAGAA-TTTATTCAATAAATT-AA-------------------------------------------------------------------------------------------------CTTTGAACGCACATTGCGCCCTCTGGCATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGACGTCTG--CTGTCAGACGCGCCTGGAAGACCTCGGCGACGGCATTCCAGCCTCGAGCGTAGTAGTAAAAT--ATCTCGCTTTGGAGG-ATGGGGTGACGGCTTGCC-GGACAA-CCGACCTCTGGTCATTTT-----TTCCAA Phyllosticta_telopeae_AY042909 ---CTGAACT--AGTAA----TTCTCT-----GAA-GGTCGCCGGTACCCGGTCCCCCCT--AAAAAGGGGGCCGGGGAAGGTCCTCTCACACCCCTTGT-GTACCTTACCACTGTTGCTTTGGCGGGCCGACCCGGTTT-CGACCCGGG-CGGCCGGCGCCCCCAGCCCCCTAGCGGGGGCCAGGACGTCTGGCTAAGTGCCCGCCAGTATACAAAACTCCAGCGATTATTTCGTGTA-GTCCTGAT-AAATTATTCAATTAATT-AA-------------------------------------------------------------------------------------------------CTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGACGTCCG--CTGCCGGACGCGCCTCGAAGACCTCGGCGACGGCGTCCTAGCCTCGAGCGTAGTAGTAAAAT--T-CTCGCTTTGGAGT-GCTGGGCGTTGGCC-GCC-GGACAA-TCGACCTTCGGTCTATTCAAT--CTCCAA Phyllosticta_vaccinii_AB095508 TTACTGAA--------TTATACCCT---CAAGGTTTTGGAAG----GGGGAGCCGT-----CAAAAGCTCCCCTGGT--AC-ATGCCCCACACCC-TTGC-GTATCT-ACCA-TGTTGCTTTGGCGG-CCGACCCGGTTT-CGACCCGGGGCGGCCGGCGCCCCCAGCC-AGCCTTCTGGGCCAGGACGCCCGGCTAAGTGCCCGCCAGTACACAAAACTCCTGCGATTATTTCGTGTA-GTCCTGAGAA-TTTATTCAATAAATT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGCATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCGACGTCTG--CTGTCAGACGCGCCTGGAAGACCTCGGCGACGGCATTCCAGCCTCGAGCGTAGTAGTAAAAC--ATCTCGCTTTGGAGG-ATGGGGTGACGGCTTGCCAGGACAAACCGACCTCTGGTCACTTTTTTTTTCACAA Rosenscheldiella_korthalsellae_PDD94884 TTATTGAAAC-ACGCAA----CTCTT-GTTGTGAAAGGTCTCTCG-AGTACGTCGGCCCC--AAGAAGCCGGCAGAAAGAGCCCTCATCACCCCTTTTGT-GTACCTTACCA-CGTTGCTTTGGCGGGCCGACCCGGTTTTCGACCCGGG-CGGCCGGCGCCCCCAGCCCCCAAC-CGGGGCCAGGACGTCCGGCTAAGTGCCCGCCAGTATACCAAACTCAAGCGATTATTTCGTGAA-GTCCTGACACTATCATTCAATTGATTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCACCGCTCAAGCTCTGCTTGGTGTTGGGCGACGTCCG--CCGCCGGATGCGCCTCGAAGACCTCGGAGACGGCGTCCCAGCCTCGAGCGTAGTAGTAAAAT--ATGTCGCTTTGGAGC-GCTAGACGACGGCC-GCC-GGACAAATCGACCTTGGGTCTATATTCT--TCCAAA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M5814] TITLE Rosenscheldiella_Matrix_F7; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1642; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cercospora_beticola_CBS116456 -------------------------------------------------------------------------------------CCTGCGGAGGGATCATTACTGA-------GTGAGGGC-CTTCGGGCTCGACC-T-CCAACCCTTT-GTGAACACAACT--TGTTGCTTCGGGGGCGACCCTGCCG----TTTCGACGGCGAGCGCCCCCGGAGGCCTTC----AAACACTGCATCT--TTG-CGTCGGAGTTT---AAGTAAATT-AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTCGCTTGGTATTGGGCGCC-----GCGGTGT--------TCCGCGCGCCTCAAAGTCT-CCGGCTG-----AGCT-GTCCGTCTCTAA-GCGTTGTGATTT--CATTAAT-CGCTTCGGAGCGC--GGGCGGTCGCG-GCCGTT-----AAATCT-----TTCACAAGGTTGACCTCGGATCA-----------------------------------?????----------------------------------------------------------------------------------------------------GCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGACCGATCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGGCCCG-CACCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTTCATTCTCTGT-CGCGAGGCCATCATCGTCTGGGCCCGCCGGATAA-GACCTGAGGAATGTGGCTCCCCCTCGGGGGAGTGTTATAGCCT--CTGGTGATGCGGCGTGGCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAA--CCGCAAGGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- Davidiella_tassiana_STE.U.5101 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATT-AATAAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTCGCTTGGTATTGGGCAAC-----GCGGTCC--------GCCGCGTGCCTCAAATCGT-CCGGCTG-----GGTCTTCTGTCCCCTAA-GCGTTGTGGAA-----ACTATTCGCTAAAGGGTGTTCGG--GAGGCTACGCCGTA-----AAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAG------------------------------?????CATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCTCTAGTAACGGCGAGTGAAGCAGCAATAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGTAGAGGATGCTTCTGAGTAACCACCGACCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGTCGGAAAGGTGCTCTATACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTAAAAGGGAAGGGATTGCAACCAGACTTGCTCGCGGTGTTCCGCCGGTCTTCTGACCGGTCTACTCGCCGCGTTGCAGGCCAGCATCGTCTGGTGCCGCTGGATAA-GACTTGAGGAATGTAGCT--CCCTC--GGGAGTGTTATAGCCT--CTTGTGATGCAGCGAGCGCCGGGCGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTAATCCGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GAGAACC--GCAAGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATC---------------------------------------- Mycosphaerella_aurantia_CBS110500 --------------------------------------------------------------------------------------------AGGGATCATTACTGA-------GTGAGGGC---TCACGCCCGACC-T-CCAACCCTTT-GTGAACCAACTC--TGTTGCTTCGGGGGCGACCCCGCCGTTT----CGGCG-ACGGCGCCCCCGGAGGTCATC----AAACACTGCATCT--TTG-CGTCGGAGTCTT-AAAGTAAATTTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTAGCTTGGTATTGGGCGTC-----GCGGTT----------CCGCGCGCCTTAAAGTCT-CCGGCTG-----AGCA-GTTCGTCTCTAA-GCGTTGTGGCAT----ATATTTCGCTGAAGAGTTC--GGACGGCTTTTGGCCGTT-----AAATCT-----TTCTTAAGGTTGACCTCGGATCAGGTAGGGATA-------------------------?????----------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGCCAGCGGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGGCGCG-CAGCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTCGTAGCGATGTTCCGCTGGTCTTCTGACCGGTCTACTCATCGT-CGCGAGGCCAACATCGTCTGGGCCCGCTGGATAA-GACCTAAGGAATGTGGCTTCTCTTCGGGGAAGTGTTATAGCCT--GTGGTGATGCAGCGTGGCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAA--GCGCAAGCTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- Mycosphaerella_buckinghamiae_CBS112175 ----------------------------------------------------------------------------------GAACCTGCGGAGGGATCATTACTGA-------GTGAGGGC---TCACGCCCGACC-T-CCAACCCTTT-GTGAACCAACTC--TGTTGCTTCGGGGGCGACCCCGCCGTTT----CGGCG-ACGGCGCCCCCGGAGGTCATC----AAACACTGCATCT--TTG-CGTCGGAGTCTT-AAAGTAAATTTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTAGCTTGGTATTGGGCGTC-----GCGGTT----------CCGCGCGCCTTAAAGTCT-CCGGCTG-----AGCA-GTTCGTCTCTAA-GCGTTGTGGCAT----ATATTTCGCTGAAGAGTTC--GGACGGCTTTTGGCCGTT-----AAATCT-----TTCTTAAGGTTGACCTCGGATC------------------------------------?????-------------------GGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGCCAGCGGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGGCGCG-CAGCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTCGTAGCGATGTTCCGCTGGTCTTCTGACCGGTCTACTCATCGT-CGCGAGGCCAACATCGTCTGGGCCCGCTGGATAA-GACCTAAGGAATGTGGCTTCTCTTCGGGGAAGTGTTATAGCCT--GTGGTGATGCAGCGTGGCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAA--GCGCAAGCTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- Mycosphaerella_colombiensis_CMW11255 --------------------------------------------------------------------------------------CTGCGGAGGGATCATTACTGA-------GTGAGGGC-CTCCGGGTCCGACC-T-CCAACCCTTT-GTGAACCAATCT--TGTTGCTTCGGGGGCGACCCTGCCGCTT-CGGCGGT--GCGGCGCCCCCGGAGGCCATC----AAACACTGCATCA--TTG-CGTCGGAGTAAA---AGTAAATG-AAACAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTGGCTTGGTATTGGGCGTC-----GCGGT----------GCCGCGCGCCTTAAAGTCTTCCGGCTG-----AGCT-GTCCGTCTCTAA-GCGTTGTGGCAAC----TAT-TCGCTTCGGAGGCC--GGGCGGCCGCG-GCCGTT-----AAATCT-----TTCACAAGG-------------------------------------------------?????----------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCGAGGCAGCGGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGGCCCG-CACCTCATACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTACAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTTCATTCTCTGT-CGCGAGGCCATCATCGTCTGGGGCCGCCGGATAA-GACTGGAGGAATGTAGCT-CCCTTC-GGGGTGTGTTATAGCTT--CCAGTGATGCGGCGCGTCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAA---CTTTTTGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- Mycosphaerella_communis_CBS110976 ----------------------------------------------------------------------------GTAGGTGAACCTGCGGAGGGATCATTACCAGAAGACGCTCTGGCGGAAACGCCGGGGCCTTCGTCCAACCCTTT-GTGAACGTATCT-CTATTGCCCCGGGGGAACCCCGCCTGTCA---TGGG---CGTGGGCCCCCGGCGGCCACTTC--AAACTCTGTTTTT-ATTGCCGTCTGAGTAA--CAAACAAATTAAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCAACCAATCCAGCCCCGCTGGGTATTGGGCGTC-----GCGGCCT--------GCCGCGCGCCTCAAAGTCTA-CGGCGG-----AAGCCGCCCGTTCCTCT-GCGTGATGACACA-TCG----TCGCTTGGGACACGGGGGTGAGCGCCCGGAAAACATCGGCGGAGACGTCGATTTCAAGGTTGACCTCGGATCAGGTAGGGATA-------------------------?????----------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATCGGCCCG-CGCCCTCTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGGGCTTGCAACCAGACTTGACGGCGGTGTTCCCCCGGGCTTCTGCCCGGGTTATTCACCGT-CGGCAGGCCATCATCGTCTGGGGCCGCTGGAGAA-ACCGTCAGGAATGTGGCT--CCCTC--GGGAGTGTTATAGCCT--GTCGACATGCAGCGTGCCCCGGGCGAGGTCCGCGCTTAGGCAAGGATGATGGCGTAATGGTTGTCAGCCGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAG---CTT-CGGCGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- Mycosphaerella_fori_CMW9096 -------------------------------------------------------------------------TCCGTAGGTGAACCTGCGGAGGGATCATTACTGA-------GTGAGGGC---TCACGCCCGACC-T-CCAACCCTTT-GTGAACACATCT--TGTTGCTTCGGGGGCGACCCTGCCGGC-CCTGCGTCGCCGGGCGCCCCCGAAGGTCTCC----AAACACTGCATCT--TTG-CGTCGGAGTTT--AAAACAAATT-AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTGGCTTGGTATTGGGCGTC-----GCGGC----------TCCGCGCGCCTTAAAGTCT-CCGGCTG-----AGCC-ATTCGTCTCTAA-GCGTTGTGGATT--TTTCAATTCGCTTCGGAGTGC--GGGTGGCCGCG-GCCGTT-----AAATCT---TTATTCAAAGGTTGACCTCGGATCAGGTAGGGATA-------------------------?????----------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGCTTG-CACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCCGCAACCAGACTTTGCGGCAGTGTTCGGCCGGTCTTCTGACCGGTTTACTCGCTGT-CGTGAGGCCATCATCGTCTGGGACCGCTGGATAA-GACCTTAGGAATGTGGCT-CCCTTC-GGGGAGTGTTATAGCCT--CTGGTGATGCAGCGCGTCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAA---CTTTTTGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- Mycosphaerella_graminicola_CBS100335 ---------------GAGCCGGAAAGTTGGTCAAACTCGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACCGA-------GCGAGGGC-CTCCGGGTCCGACC-T-CCAACCCTTT-GTGAACACATCC--CGTTGCTTCGGGGGCGACCCTGCCG---------------GGCGCCCCCGGAGGACCACCAAAAAACACTGCATCT--CTG-CGTCGGAGTTTA-CGAGTAAATCGAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCCGTTCGAGCGTCATTACA-CCACTCCAGCCTCGCTGGGTATTGGGCGTCTTTTCGCGGGGGATCACTCCCCCGCGCGCCTCAAAGTCT-CCGGCTG-----AGCGGTCTCGTCTCCCA-GCGTTGTGGCAT--CA-CGTCTCGCCGCGGAGTTC-ACGAGCCCTCACGGCCGTT-----AAATCA-----CACCTCAGGTTGACCTCGGAT-------------------------------------?????---------------------------------------------------------------GGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCC---GGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGACCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGGCCCG-CGCCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTTGGGGCGGTGTTCCGCCGGTCTTCTGACCGGTCTACTCTCCGT-CCCGAGGCCAACATCATCTGGGACCGCCGGACAA-GACCTCAGGAATGTAGCTCCCCCTCGGGGGAGTGTTATAGCCT--GTGGTGATGCGGCGCGTCCCGGGTGAGGTCCGCGCTTCGGCAAGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGGAATGAAAGTGAACGGAGGT-GGGAAGGGGCAACCCTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- Mycosphaerella_grandis_CMW8554 -------------------------------------------------------------------------TCCGTAGGTGAACCTGCGGAGGGATCATTACCGA-------GTGAGGGC-CTCCGGGCTCGACC-T-CCAACCCCATTGTATTCCGACCTCTTGTTGCCTCGGGGGCGACCCGGCCTTCG----GGCG--TCGGGGCCCCCGGTGGACCATC---AAACTCTGCATCT--TTGACGTCTGAGTA---AATATTGAATCAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTGGCTTGGTATTGGGCGCC-----GCGGTTT--------GCCGCGCGCCTCAAAGTCT-CCGGCTG-----AGCC-AACTGTCTCTAA-GCGTTGTGGTT---TAATCATCCGCTTGTGAGATCGAA-G-GCGACG--GCCGTT-----AAAC-----TTATTCAAAGGTTGACCTCGGATCAGGTAGGGATA-------------------------?????----------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGCAGAGGATGCTTCGAGGCAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGATTGGCTCG-CACCTCACACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTAAAAGGGAAGGGCATGCAACCAGACTTGCCGGTGGTGTTCCGCCGGTCTTCTGACCGGTCTACTCGCCGC-TGGCAGGCCAACATCGTCTGGGTGCGCCGGATAAAGGTGTCGGGAATGTGGCC---CCTC---GGGGTGTTATAGCTCGACACACAATACGGCGCCGCTCGGGCGAGGTCCGCGCTTCGGCTAGGATGTTGGCGTAATGGTTGTATGCCGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGGAATGAAAGTGAACGGAGGTGGGGAACC--GCAAGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- Mycosphaerella_heimii_CPC15429 GGCAACGACCACCCAGGGCCGGAAAGTTGGTCAAACTCGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACTGA-------GTGAGGGC-TAC--GGTCCGACC-T-CCAACCCTTT-GTGAACCAA-CT--TGTTGCTTCGGGGGCGACCCTGCCGCTT-CGGCGGT--GCGGCGCCCCCGGAGGCCATT----AAACACTGCATCA--TTG-CGTCGGAGTAAA---AGTAAATT-AAACAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTGGCTTGGTATTGGGCGTC-----GCGGC----------TCCGCGCGCCTTAAAGTCTTCCGGCTG-----AGCT-GTCCGTCTCTAA-GCGTTGTGGCAAC----TAT-TCGCTTCGGAGGTC--GGGTGGCCGCG-GCCGTT-----AAATCT-----TTCACAAGGTTGACCTCGGATCAGGTAGGGATA-------------------------?????----------------------------------------------------------------------------------------------------------GAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTAGGCAGCGGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGGCACG-CACCTTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGTGGCAGTGTTCCGCCGGTCTTCTGACCGGTCTATTCTCTGT-CGCGAGGCCATCATCGTCTGGGGCCGCCGGATAA-GACTGGAGGAATGTAGCT-CCCCTC-GGGGAGTGTTATAGCTT--CCAGTGATGCGGCGTGTCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAA---CTTTTTGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTA------------------------------------------- Mycosphaerella_lateralis_CBS111169 --------------------------------------------------------------------------------------------AGGGATCATTACCAGAAGACGCCTCGGCGGAAACGCCGGGGCCTTCGTCCAACCCTTT-GTGAACGTATCT-CTATTGCCCCGGGGGAACCCCGCCTGTCA---TGGG---CGTGGGCCCCCGGTGGCCAACTC--AAACTCTGTTTTT-ATTGCCGTCTGAGTAA--CAAACAAATCAAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACAACCAATCCAGCCCCGCTGGGTATTGGGCGTC-----GCGGCCT--------GCCGCGCGCCTCAAAGTCTT-CGGCGG-----AAGCCGCCCGTTCCTCT-GCGTGATGACACA-TCG----TCGCTTGGGACACGGGGGTGAGCGCCCGGAAAACATCGGCGGAGACGTCGATTTCAAGGTTGACCTCGGATCAGGTAGG-----------------------------?????----------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATCGGCCCG-CGCCCTCTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGACGGCGGTGTTCCCCCGGGCTTCTGCCCGGGTTATTCACCGT-CTTCAGGCCATCATCGTCTGGGGCCGCCGGAGAA-ACCGTCAGGAATGTGGCT--CCCTC--GGGAGTGTTATAGCCT--GTCGACATGCGGCGTGCCCCGGGCGAGGTCCGCGCTTAGGCAAGGATGATGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAG---CTT-CGGCGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- Mycosphaerella_pini_ATCC28973 ------------------------------------------------------------------------------------------------ATCATTACTGA-------GTGAGGGC---GAAAGCCCGACC-T-CCAACCCTTT-GTGAACCAACTC--TGTTGCTTCGGGGGCGACCCCGCCGTTT----CGGCG-ACGGCGCCCCCGGAGGTCATC----AAACACTGCATCT--TTG-CGTCGGAGTCTT-AAAGTAAATTTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTGGCTTGGTATTGGGCGTC-----GCGGTT----------CCGCGCGCCTTAAAGTCT-CCGGCTG-----AGCA-GTTCGTCTCTAA-GCGTTGTGGCAT----ATATTTCGCTGAAGAGTTC--GGACGGCTTTTGGCCGTT-----AAATCT-----TTTACAAGGTTGACC-------------------------------------------?????-----------------------------------------------------------------------------------------------TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGCCAGCGGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGGCGCG-CAGCCTTTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTCGTAGCGATGTTCCGCCGGTCTTCTGACCGGTCTACTCATCGT-CGCGAGGCCAACATCGTCTGGGGCCGCTGGATAA-GACCTAAGGAATGTAGCTT-CCCTC-GGGAAGTGTTATAGCCT--GTGGTGATGCAGCGTGTCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAA--GCGCAAGCTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACC----------------------------------- Mycosphaerella_punctata_CBS113315 -----------------------------------------------GAGGAAGTAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACTGA-------GTGAGGGT-TCACG--CCCGACC-T-CCAACCCTTT-GTGAACAAATCT--TGTTGCTTCGGGGGCGACCCTGCCGGCACTT-TGTCGCCGGGCGCCCCCGGAGGTCTTCC----AACACTGCATCT--CTG-CGTCGGAGTTT---AAGTCAATT-AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTCGCTTGGTATTGGGCGTC-----GCGGTCT--------GCCGCGCGCCTTAAAGTCTTCCGGCTG-----AGCT-GTCCGTCTCTAA-GCGTTGTGGAATT-TAACTATTCGCTTCGGAGGGT--GGGTGGCCGCG-GCCGTT-----AAATCT---TTATTCAAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA?????-----------------------------------------------------------------AGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGATTGGCTTG-CACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCCGCAACCAGACTTTGCGGCGGTGTTCCGCCGGTCTTCTGACCGGTTTACTCGCCGC-CGTGAGGCCATCATCGTCTCGGACCGCTGGATAA-GACCTTAGGAATGTAGCTT-CCCTC-GGGAAGTGTTATAGCCT--CTGGTGATGCAGCGAGTCTGGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAA---CTTTTTGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTT---------------------------------------------------------------- Mycosphaerella_walkeri_CMW20333 -------------------------------------------------------------------------TCCGTAGGTGAACCTGCGGAGGGATCATTACCGA-------GTGAGGGC-CCC--GGCCCGACC-T-CCAACCCTTT-GTGGACCCAACT--TGTTGCTTCGGGGGCGACCCTGCCGTCT-CGGCGGC--GCGGCGCCCCCGGAGGCCCTC----AAACACTGCATCC--TCG-CGTCGGAGTCTC---AGTAAATG-AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTGGCTTGGTATTGGGCGTC-----GCGGT----------GCCGCGCGCCTCAAAGTCTTCCGGCTG-----AGCT-GCCCGTCTCCAA-GCGTTGTGGCGAC----TAT-TCGCTTCGGGGCGC--GGGCGGCCGCG-GCCGTT-----AAATCT-----TTCACAAGGTTGACCTCGGATCAGGTAGGGATA-------------------------?????----------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGACCGGCGCG-CACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTTCACTCTCTGC-CGCGAGGCCATCATCGTCTGGGGCCGCCGGATAA-GACTGGAGGAATGTAGCT-CCCCTC-GGGGAGTGTTATAGCCT--CCGGTGATGCGGCGCGCCCCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAA---CTTTTTGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- Phaeocryptopus_gaeumannii_CBS267.37 ------------------------------------------------------------------------------------------------ATCATTACTGA-------GTGAGGGC-TTC--GGTCCGACC-T-CCAACCCTTT-GTGAACCAAACT--TGTTGCTTCGGGGGCGACCCTGCCGCCA-CGGCGGC--GCGGCGCCCCCGAAGGCCATC----AAACACTGCATCA--TTG-CGTCGGAGTTAA---AGTAAATC-AAATAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTGGCTTGGTATTGGGCGTC-----GCGGC----------TCCGCGCGCCTTAAAGTCTTCCGGCTG-----AGCT-GTCCGTCTCTAC-GCGTTGTGGCAAC----TAT-TCGCGTGGGAGGTC--GGGTGGCCGCG-GCCGTT-----AAATCC-----TTCA-AAGGTTGACC-------------------------------------------?????-----------------------------------------------------------------------------------------------TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTAGGTAGCGGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGGCACG-CACCTTCTACGCAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTTCATTCTCTGT-CGCGAGGCCATCATCGTCTGGGGCCGCCGGATAA-GACTGGAGGAATGTAGCT-CCCCTC-GGGGCGTGTTATAGCTT--TCAGTGATGCGGCGTGTCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAA---CTTTTTGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- Pseudocercospora_natalensis_CBS111069 --------------------------------------------------------------------------------------------AGGGATCATTACTGA-------GTGAGGGC---TCACGCCCGACC-T-CCAACCCTTT-GTGAACACATCT--TGTTGCTTCGGGGGCGACCCTGCCGGC-ACTTCGTCGCCGGGCGCCCCCGAAGGTCTCC----AAACACTGCATCT--TTG-CGTCGGAGTTT--AAA-CAAATT-AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTGGCTTGGTATTGGGCGTC-----GCGGC----------TCCGCGCGCCTTAAAGTCT-CCGGCTG-----AGCC-ATTCGTCTCTAA-GCGTTGTGGATT--TTTCAATTCGCTTCGGAGTGC--GGGTGGCCGCG-GCCGTT-----AAATCT---TTATTCAAAGGTTGACCTCGGATCAGGTAGGGATA-------------------------?????----------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGCTTG-CACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCCGCAACCAGACTTTGCGGCAGTGTTCGGCCGGTCTTCTGACCGGTTTACTCGCTGT-CGTGAGGCCATCATCGTCTGGGACCGCTGGATAA-GACCTTAGGAATGTGGCT-CCCCTC-GGGGAGTGTTATAGCCT--CTGGTGATGCAGCGCGTCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAA---CTTTTTGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- Pseudocercospora_paraguayensis_CBS111286 -------------------------------------------------------------------------TCCGTAGGTGAACCTGCGGAGGGATCATTACTGA-------GTGAGGGC---TCACGCCCGACC-T-CCAACCCTTT-GTGAACCAAACT--TGTTGCTTCGGGGGCGACCCTGCCGACGACTCCGTCGCCGGGCGCCCCCGGAGGTCTTCT---AAACACTGCATCT--TTG-CGTCGGAGTTT--AAA-CAAATT-AAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTGGCTTGGTATTGGGCGTC-----GCGGTGT--------TCCGCGCGCCTTAAAGTCTTCCGGCTG-----AGCT-GTCCGTCTCTAA-GCGTTGTGGATT--TTTCAATTCGCTTCGGAGTGC--GGATGGCCGCG-GCCGTT-----AAATCT---TTATTCAAAGGTTGACCTCGGATCAGGTAGGGATA-------------------------?????----------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGCTTG-CACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCCGCAACCAGACTTTGCGGCGGTGTTCGGCTGGTCTTCTGACCGGTTTACTCGCCGC-CGTGAGGCCATCATCGTCTGGGACCGCTGGATAA-GACCTGAGGAATGTAGCT-CCCTTC-GGGGTGTGTTATAGCCT--CTGGTGATGCAGCGCGTCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAA---CTTTTTGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- Pseudocercospora_vitis_CPC11595 -------------------------------------------TTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACTGA-------GTGAGGGC---TCGCGCCCGACC-T-CCAACCCTTT-GTGAACCAAATC-CTGTTGCTTCGGGGGCGACCCTGCCGGCA-CACCGTCGCCGGGCGCCCCCGGAGGTCTTC----AAACACTGCATCT--TTG-CGTCGGAGTTT---AAATCAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTAGCTTGGTATTGGGCGTC-----GCGGCT----------CCGCGCGCCTTAAAGTCT-CCGGCTG-----AGCT-GTCCGTCTCTAA-GCGTTGTGGAAATTCAACTATTCGCTTCGGAGTGC--GGGCGGCCGCG-GCCGTT-----AAATCT---TTATT-CAAGGTTGACCTCGGATCAGGTAGGGATA-------------------------?????----------------------------------------TGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGCTTG-CACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCCGCAACCAGACTTTGCGGCAGTGTTCCGCCGGTCTTCTGACCGGTCTACTCGCTGT-CGTGAGGCCATCATCGTCTGGGACCGCTGGATAA-GACCTTAGGAATGTAGCT-CCCTTC-GGGGAGTGTTATAGCCT--CTGGTGATGCAGCGCGTCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAA---CTTTTTGTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- Readeriella_novaezelandiae_CBS114357 -------------------------------------------------------------------------TCCGTAGGTGAACCTGCGGAGGGATCATTACTGA-------GTGAGGGCCCTCGCGGTCCGACC-T-CCAACCCTTT-GTTGTCCGACCA--TGTTGCCTCGGGGGCGACCCGGCCCTAC----GGC---CGCGGGCCCCCGGTGGACTACT---CAACTCTGCATCT--TAG-CGTCTGAGTTT--AATGATAAATCAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACA-CCAATCAAGCCTGGCTTGGTATTGGGCGCC-----GTGGTTCTCCG--GAGCCGCGCGCCCTAATGTCC-TCGGCTG-----GGCC-GTCCGCCTCGAA-GCGTTGTGATT---ATACAGATCGCTTGTGGGTGTGGACG-GTCGCG-CGCCGTT-----AAACCT---TTCATTCAAGGTTGACCTCGGATCAGGTAGGGATA-------------------------?????----------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGGTTTG-CACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAATCAGACTTGTCGGCGGTGTTCCACCGGTCTTCTGACCGGCACACTCGCCGC-CGGCAGGCCAACATCATCTGGGTGCGCCGGATAAAGACGTGAGGAATGTGGCC--CCCTC--GGGGGTGTTATAGCCTCGCGTGCAATACGGTGTCGCCCGGGTGAGGTCCGCGCTTCGGCTAGGATGTTGGCGTAATGGTTGTTTGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAA----CGAAAGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- Rosenscheldiella_brachyglottidis_PDD94939 ---------------------------------------------TAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACTGA-------GTGGAGGGCTCACGCGCCCGACC-T-CCAACCCTCT-GTGAACGCCTCT--TGTTGCTTCGGGGGCGACCCTGCCGTCA----CGGC---GGGCGCCCCCGGAGGTCATCA---AAACACTGCATCT--ATG-CGTCGGAGTCA---AAGTTAATAGAA-CAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTTGCTTGGTATTGGGCGTC-----GCGGCC---------GCCGCGCGCCTTAAAGTCT-CTGGCTG-----AGCT-GTCCGTCTCCGA-GCGTTGTGATCC----ATATT-CGCTCCGGAGCGC-GGGCGGTCTCGCGGCCGTT-----AAATCG-----TTTTTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA?????----------------------------------------------TAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGTGATTGGCCCG-CACCCTCCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCCCGCAACCAGACTTTGCGGCGGTGTTCCACCGGTCTTCTGACCGGTCTACTCTCCGT-CGCGAGGCCATCATCGTCTGGGGCCGCCGGATAA-GACTTGAGGAATGTAGCA-CCCTTT-GGGGTGTGTTATAGCCT--TCTGTGATGCGGTGAGTCCCGGGCGAGGTCCGCGCTCCGGCAAGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGCGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAG---CTT-CGGCGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGT--------- Rosenscheldiella_korthalsellae_PDD94885 ---------------------------------------------TAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACTGA-------GTGAGGGC---GAAAGCCCGACC-T-CCAACCCTTT-GTGAACCAACCC--TGTTGCTTCGGGGGCGACCCCGCCGTTT----CGGCGACGGTGCCCCCCGGAGGTCATC----AAACACTGCATCT--CTG-CGTCGGAGTAAC-GAAGTAAATTTAAATAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTAGCTTGGTATTGGGCGTC-----GCGGCT----------CCGCGCGCCTCAAAGTCT-CCGGCTG-----AGCG-GTTCGTCTCTTAAGCGTTGTGGCAC----ATATTTCGCTGAAGAGTTC--GGATGGCTTTTGGCCGTT-----AAATCT-----TTTACAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA?????-------------------------------------------------------CAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGCCAGCGGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGGCGCG-CAGCCTTTGCGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTCGTAGCGATGTTCCGCCGGTCTTCTGACCGGTCTACTCATCGT-CGCGAGGCCAACATCGTCTGGGACCGCTGGATAA-GACCTAAGGAATGTAGCTT-CCCTC-GGGAAGTGTTATAGCCT--GTGGTGATGCAGCGCGTCTCGGGCGAGGTCCGCGCTTCGGCAAGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAA--GCGCAAGCTGCACCATCGACCGATCCTGATGTCCTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAG Teratosphaeria_mexicana_CBS110502 --------------------------------------------------------------------------------------------AGGGATCATTACCGA-------GTGAGGGC-CCC--GGCCCGACC-T-CCTACCCCAT-GTGACCTCACTA--TGTTGCCTCGGGGGCGACCCGGCCTTCG----GGC---TGTTTGCCCCCGGCGGACACCT---CAACTCTGCATCT--TTG-CGTCGGAGTCT--TATGATAAATCAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCAAGCCTCGCTTGGTATTGGGCGCC-----GCGGCCT--------TCCGCGCGCCCCAATGTCT-CCGGCTG-----AGCC-ATCTATCTCAGA-GCGTTGTGGTA----AACGTTCCGCTTGCGAGTGCGAT-G-GCTGTG-CGCCGTT-----AAACCCTTTTCTATCAAAGGTTGACCTCGGATCAGGTAGGGATA-------------------------?????----------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGTAGAGGATGCTTCAGGGCAGCGGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGGTTGG-CACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGTGGTGTTCCACCGGTCTTTTGACCGGTCTACTCGCCGC-CGGCAGGCCAGCATCGCTTGGGAGCGCCGGATAAAGGTGGGAGGAATGTGGCC---CCTC---GGGGTGTTATAGCCTCCTATGCAATACGGCGCCTCCCGAGTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCTGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGT-GGGAA---CTTTTTGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- Teratosphaeria_nubilosa_CBS116005 -------------------------------------------------------------------------TCCGTAGGTGAACCTGCGGAGGGATCATTACTGA-------GTGCGGGC---GCCAGCCCGACC-T-CCTACCCCAT-GTTTTCCCACCA--CGTTGCCTCGGGGGCGACCCGGCCCCCG----CGC----CGGGGCCCTCGCAGGACCCCT---CAACGCTGCATCT--GTG-CGTCGGAGTAA--TACAACCAATCAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCA-CCACTCCAGCCCCGCTGGGTCTTGGGCGCC-----GCGGCCT---------CCGCGCGCCTCAATGTCT-CCGGCCG-----AGCC-GACCGTCTCTCA-GCGTTGTGGCAC--TACTGTTTCGCTGACGGGGACCGGTCTGGCGGCGCGCCGTT-----AAACCC--TTTCACCAAAGGTTGACCTCGGATCAGGTAGGGATA-------------------------?????-----------TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCA-----AGCCCGAGTTGTAATTTGCAGAGGATGCTTCAGGGCAGCGACCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGACCGGTTGG-CACCCGTCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGCGGTGTTCCGCCGGTCTTCTGACCGGTCCACTCGCCGC-CGGCAGGCCAGCATCATCTGGGCGCGCCGGACAAAGGCGCGGGGAATGTAGCT---CCTC---GGAGTGTTATAGCCCCGCGCACAATACGGCGCCGCTCGGGTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCTGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGGAATGAAAGTGAACGGAGGT-GGGAA--GCGCAAGCTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT--------------------------------- ; END; BEGIN SETS; CHARSET LSU (CHARACTERS = Rosenscheldiella_Matrix_F7) = 671-1642; CHARSET ITS (CHARACTERS = Rosenscheldiella_Matrix_F7) = 1-665; CHARSET variable (CHARACTERS = Rosenscheldiella_Matrix_F7) = 1-95 122-130 190-205 258-270 548-588 620-670 1610-1642; END; BEGIN TREES; TITLE Rosenscheldiella_TB_F7; LINK TAXA = Taxa2; TRANSLATE 1 Mycosphaerella_lateralis_CBS111169, 2 Mycosphaerella_communis_CBS110976, 3 Mycosphaerella_colombiensis_CMW11255, 4 Mycosphaerella_heimii_CPC15429, 5 Phaeocryptopus_gaeumannii_CBS267.37, 6 Mycosphaerella_walkeri_CMW20333, 7 Mycosphaerella_fori_CMW9096, 8 Pseudocercospora_natalensis_CBS111069, 9 Pseudocercospora_paraguayensis_CBS111286, 10 Cercospora_beticola_CBS116456, 11 Pseudocercospora_vitis_CPC11595, 12 Mycosphaerella_punctata_CBS113315, 13 Rosenscheldiella_brachyglottidis_PDD94939, 14 Mycosphaerella_aurantia_CBS110500, 15 Mycosphaerella_buckinghamiae_CBS112175, 16 Mycosphaerella_pini_ATCC28973, 17 Rosenscheldiella_korthalsellae_PDD94885, 18 Mycosphaerella_graminicola_CBS100335, 19 Teratosphaeria_nubilosa_CBS116005, 20 Readeriella_novaezelandiae_CBS114357, 21 Teratosphaeria_mexicana_CBS110502, 22 Mycosphaerella_grandis_CMW8554, 23 Davidiella_tassiana_STE.U.5101; TREE Fig_7 = [&R] (((1:0.003476,2:0.012973):0.171442,(((((3:0.009119,(4:0.005993,5:0.010403):0.003921):0.020602,6:0.015396):0.006239,((((7:0.0,8:0.001107):0.010998,(9:0.007022,12:0.019306):0.00447):0.00205,11:0.004928):0.016381,13:0.060379):0.012482):0.010876,10:0.024277):0.013125,((((14:0.0,15:0.0):0.010546,16:6.56E-4):0.003303,17:0.013238):0.030066,18:0.081153):0.005478):0.021598):0.013332,(((19:0.049717,21:0.051061):0.01303,20:0.062949):0.013795,22:0.054431):0.039718,23:0.150883); END; BEGIN TREES; TITLE Guignardia_TB_F6; LINK TAXA = Taxa1; TRANSLATE 1 Guignardia_gaultheriae_AB095506, 2 Phyllosticta_pyrolae_AF312010, 3 Phyllosticta_pyrolae_AB041242, 4 Phyllosticta_telopeae_AY042909, 5 Guignardia_aesculi_AB095504, 6 Guignardia_philoprina_AB095507, 7 Guignardia_philoprina_AF312014, 8 Phyllosticta_beaumarisii_AY042927, 9 Phyllosticta_eugeniae_AY042925, 10 Guignardia_bidwellii_AB095509, 11 Rosenscheldiella_korthalsellae_PDD94884, 12 Phyllosticta_hypoglossi_AY042923, 13 Phyllosticta_spinarum_AY042907, 14 Phyllosticta_spinarum_AF312009, 15 Phyllosticta_vaccinii_AB095508, 16 Guignardia_citricarpa_AY042917, 17 Guignardia_citricarpa_AF374364, 18 Phyllosticta_podocarpi_AF312013, 19 Phyllosticta_owaniana_AF312011, 20 Guignardia_mangiferae_AB041233, 21 Guignardia_mangiferae_AY277711, 22 Botryosphaeria_dothidea_AY259092; TREE Fig_6 = [&R] (((((((1:0.0,2:0.002481):0.002018,3:0.01299):0.023856,5:0.052776):0.002824,4:0.010034):0.016197,(6:0.005656,7:0.018352):0.019855):0.007262,(((8:0.093206,((9:0.030136,11:0.05639):0.007571,10:0.049415):0.008552):0.015241,(20:1.898E-6,21:0.002503):0.064761):0.014418,(((12:0.018704,(13:0.004738,14:0.015149,15:0.029909):0.004713):0.029595,(16:0.0,17:0.0):0.053734):0.04303,(18:0.012462,19:0.012417):0.117734):0.027209):0.010502):0.326631,22:0.0); END;