#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on January 27, 2020; 3:47 GMT TreeBASE (cc) 1994-2008 Study reference: Nylander J., Ronquist F., Huelsenbeck J., & Nieves-aldrey J. 2004. Bayesian Phylogenetic Analysis of Combined Data. Systematic Biology, 53(1): 47-67. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1070] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=32; TAXLABELS Andricus Antistrophus Aulacidea Aylax Barbotinia Biorhiza Ceroptres Diastrophus Diplolepis Eschatocerus Gonaspis Hedickiana Ibalia Iraella Isocolus Liposthenes_gle Liposthenes_ker Neaylax Neuroterus Panteliella Paramblynotus Parnips Pediaspis Periclistus Phanacis_1 Phanacis_2 Plagiotrochus Rhodus Synergus Synophromorpha Timaspis Xestophanes ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M703] TITLE LWRh; LINK TAXA = Taxa1; DIMENSIONS NCHAR=481; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Andricus TCTTGGTCCATTTATGTGTGAGATCTACGCAATGCTTGGCTCCCTATTCGGATGTGTCTCCATTTGGACAATGTGTATGATTGCTTTTGATCGATACAATGTCATTGTAAAGGGTTTAGCTGGCAAGCCACTAACTATCAGTGGTGCAATTCTGCGCATTGTTGGTCTCTGGGTCTGGGCAATAATTTGGACCATTGCACCAATGTTGGGCTGGAATCGGTATGTTCCCGAGGGCAACATGACAGCATGTGGAACTGACTATCTGTCTAAGGATTGGTTCTCGAGGTCTTACATTATTGTATACAGCATCTTTGTATACTTTATGCCACTTTTCCTCATCATATACAGTTACTATTTTATCATTGCTGCTGTAACTGCTCACGAAAAAGCAATGCGCGAACAGGCCAAAAAGATGAACGTGGCTTCCCTACGATCATCTGACAATCAAAATACGAGTGCCGAACACAAGCTCGCTAAGGTT Antistrophus TCTTGGTCCATTTTTATGTGAGATGTACGCAATGCTTGGCTCCCTATTCGGATGCGGCTCCATTTGGACAATGTGTATGATTGCTTTCGATCGATACAATGTTATTGTAAAAGGCTTAGCAGGCAAGCCCTTAACTATCACTGGTGCAATTCTGCGGATTGTTGGTCTCTGGGTTTGGGCAGTCGTTTGGACTATTGCACCAATGATAGGATGGAATCGGTACGTTCCCGAAGGTAACATGACAGCTTGTGGAACTGACTATCTAACTAAAGATTGGTTCTCGAGGTCTTATATAATTATATACAGTGTCTTCGTATACTTCATGCCACTTTTTCTCATCATATACAGTTACTATTTTATCATTGCTGCTGTATCTGCTCACGAAAAAGCAATGCGTGAACAAGCCAAAAAGATGAATGTAGCTTCTCTACGATCCTCCGATAACCAAAATACGAGTGCTGAACATAAGCTCGCAAAGGTA Aulacidea TCTTGGTCCATTTTTATGTGAGATGTACGGAATGTT{CT}GGCTCCCTATTCGGATGTGGCTCCATTTGGACAATGTGTATGATTGCTTTTGACCGATATAATGTTATCGTAAAAGGCTTAGCTGGCAAGCCCTTAACTATCACTGGTGCAATTCTGCGGATTGTTGGTCTCTGGGTTTGGGCAGTTGTTTGGACCATTGCACCAATGATAGGATGGAATCGGTATGTTCCCGAGGGTAACATGACAGCTTGTGGAACTGACTATCTAACTAAGGATTGGTTCTCCAGGTCCTTCATACTTGTATACAGTATCTTCGTATACTTCATGCCACTTTTTCTCATCATATACAGCTACTATTTCATCATTGCTGCTGTATCTGCTCACGAAAAAGCAATGCGTGAGCAAGCCAAAAAGATGAATGTAGCTTCTCTACGATCCTCTGACAACCAAAACACGAGTGCTGAACATAAGCTGGCAAAGGTA Aylax TCTTGGTCCATTTATATGTGAGATGTACGGAATGTTTGGCTCTCTATTTGGATGTGGATCCATTTGGACAATGAGTATGATTGCTTTCGACCGATACAATGTTATCGTAAAAGGTTTAGCTGGCAAGCCATTAACTATCAGTGGTGCAATTCTGCGTATTG?TTTCCTCTGGCTCTGGGCGGTAATT?GGACCATTGCACCAATGATAGGATGGAATCGGTACGT?CCCGAGGGTAACATGACAGCTTGTGGAACTGACTATCTA?CTAAGGATTGGTTCTCGAGGT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Barbotinia TCTTGGTCCATTTATATGTGAGATATATGCAATGCTTGGCTCCCTATTTGGATGTGGCTCCATTTGGACAATGTGTATGATTGCTTTCGACCGATACAATGTTATCGTAAAAGGTTTAGCTGGCAAGCCATTAACTATCAGTGGTGCAATTCTGCGTATTGTTTTTCTCTGGGTCTGGGCGGTAGTTTGGACCATTGCACCAATGATAGGATGGAATCGGTACGTTCCCGAGGGCAACATGACAGCTTGTGGAACTGACTATCTAACTAAGGATTGGTTCTCGAGGTCTTACATTCTTGTATACAGCGTCTTCGTATACTTCATGCCACTTTTCCTCATCATCTACAGTTACTATTTCATCATTGCTGCTGTATCTGCTCATGAAAAAGCTATGCGTGAACAGGCCAAAAAGA{AT}GAATGTAGCTTCTCTACGATCATCCGACAATCAAAATACGAGTGCTGAACATAAACTCGCCAAGGCA Biorhiza TCTTGGTCCATTTATATGTGAGATCTACGCAATGCTTGGCTCCTTATTCGGATGTGCCTCCATTTGGACAATGTGTATGATTGCTTTCGACCGATACAATGTCATTGTAAAGGGTTTAGCTGGAAAGCCACTCACTATCAGTGGTGCAATTCTGCGTATTGCTGGTCTCTGGGTATGGGCAGTAATTTGGACCATTGCACCAATGTTGGGCTGGAATCGGTATGTTCCTGAGGGCAACATGACAGCATGTGGAACTGACTATCTGTCTAAGGATTGGTTCTCAAGGTCTTACATTCTTGTATACAGCATCTTTGTATACTTTATGCCACTTTTCCTTATAATATACAGTTACTATTTCATCATTGCTGCTGTAACTGCTCACGAAAAAGCAATGCGTGAACAGGCCAAAAAAATGAACGTCGCTTCCCTTCGATCATCCGACAATCAAAATACGAGTGCTGAGCATAAGCTCGCCAAGGTT Ceroptres TCTTGGACCATTTATATGCGAGATTTACGCAATGCTTGGCTCCCTATTCGGATGTGCCTCCATTTGGACGATGTGTATGATTGCTTTCGACCGATACAATGTCATCGTGAAAGGTTTAGCTGGAAAGCCGCTAACTATCAGTGGTGCAATTCTGCGTATTATTGGTCTCTGGGCCTGGGCAATAGTTTGGACCGTTGCCCCAATGTTAGGATGGAATCGGTACGTTCCCGAAGGCAACATGACAGCTTGTGGAACTGACTATCTGACTAAGGATTGGTTCTCGAGATCTTACATTATTATATATAGCGTCTTCGTATACTTTGCGCCACTTTTCCTCATCATATACAGTTACTATTTCATCATTGCTGCTGTATCTGCTCACGAAAAAGCAATGCGTGAACAGGCCAAAAAGATGAATGTAGCATCGCTACGATCATCCGACAATCAAAATACGAGCGCTGAACATAAACTCGCCAAGGTA Diastrophus ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Diplolepis ????GGTCCATTCTTGTGTGAGATATACGCTTTACTTGGTTCTCTATTTGGATGTGGCTCCATTTGGACAATGTGTATGATTGCTTTTGATAGGTACAATGTAATAGTGAAAGGTTTGGCTGGGAAGCCCTTAACAATCACCGGTGCAATTATACGCATAATTGGCCTTTGGGTCTGGGCCATTATTTGGACTATTGCGCCAATGTTTGGATGGAATCGGTATGTACCTGAAGGTAACATGACAGCTTGCGGAACTGATTATTTAAGTAAAGACTGGTTCTCGAGGTCTTACATCCTTGTATACAGTATCTTCGTATACTATATGCCGCTTTTCCTTATCATATACAGTTACTATTTTATCATCTCAGCTGTATCTGCTCACGAAAAAGCAATGCGCGAACAGGCCAAAAAGATGAACGTAGCTTCTCTACGTTCATCTGACAATGCAAACACAAGTGCTGAGCATAAACTCGCAAAGGTA Eschatocerus ATTTGGACCACTCTTCTGTCAAATATACGCATTGCTCGGCTCACTTTTTGGCTGTGCTTCAATCTGGACAATGTGTTTGATTGCCTTCGACAGGTACAATGTCATTGTCAAGGGTCTAGCTGGAAAACCTTTGACCATAACCGGTGCAGTCTTGCGTATATTTGCTCTCTGGATCTGGGCATTGATTTGGACAGTTGCACCAATGTTTGGATGGAATCGGTATGTACCTGAAGGTAATCTGACAGCATGTGGTACTGATTATTTGAGCAAGGACTGGCTCTCAAGATCCTACCTCCTCGTATATGGTTTCTTCGTATACTTCATGCCGCTTTTCCTGATCATCTATAGCTATTATTTTATAATCGCAGCCGTATCTGCCCATGAGAAAGCCATGCGAGAACAGGCCAAAAAGATGAATGTAGCTTCCCTGAGATCATCAGATAATCAGAATACAAGCACTGAACACAAACTTGCAAAAGTA Gonaspis ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hedickiana TCTTGGTCCATTTTTATGTGAGATGTACGGAATGTTTGGCTCCCTGTTTGGATGCGGCTCCATTTGGACAATGTGTATGATTGCTTTCGATCGATACAATGTTATTGTAAAAGGCTTAGCAGGCAAGCCCTTAACTATCACTGGTGCAATTCTGCGGATTGTTGGTCTATGGGTTTGGGCAGTCGTTTGGACCATTGCACCAATGATAGGATGGAATCGGTACGTTCCCGAAGGCAACATGACAGCTTGTGGAACTGACTATCTAACTAAAGACTGGTTCTCGAGGTCTTATATACTTATATACAGTGTCTTCGTATACTTTATGCCACTTTTTCTCATCATATACAGCTACTATTTTATCATTGCTGCTGTATCTGCTCACGAAAAAGCAATGCGTGAACAAGCCAAAAAGATGAATGTAGCTTCTCTACGATCCTCCGATAACCAAAATACG--------------------------- Ibalia ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Iraella ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Isocolus TCTTGGTCCGTTTTTATGTGAGATGTACGCAATGCTTGGCTCCCTATTCGGATGTGGCTCCATTTGGACAATGTGTATGATTGCTTTTGACCGATATAATGTTATCGTAAAAGGTTTAGCTGGCAAGCCCTTGACTATCACTGGTGCAATTCTGCGGATTGTTGGTCTCTGGATTTGGGCAGTCGTTTGGACCATTGCACCAATGATAGGATGGAATCGGTACGTTCCCGAGGGCAACATGACAGCTTGTGGAACTGACTACTTGACTAAGGATTGGTTCTCGAGGTCCTATATACTTATATACAGTGTCTTCGTATATTTCATGCCACTTTTTCTCATCATATACAGCTACTATTTCATCATTGCTGCTGTATCTGCTCACGAAAAAGCAATGCGTGAGCAAGCCAAAAAGATGAATGTAGCTTCTCTACGATCCTCCGACAATCAAAACACGAGTGCTGAACATAAGCTCGCAAAAGTA Liposthenes_gle TCTTGGTCCATTTTTATGTGAAATATACGCAATGCTTGGCTCCCTATTTGGATGCGGCTCCATTTGGACAATGTGTATGATTGCTTTCGATCGATACAATGTTATCGTAAAGGGCTTAGCAGGCAAGCCCTTAACTATCACTGGTGCAATTCTGCGGATTGTTGGTCTCTGGGTTTGGGCAGTTGTTTGGACCATTGCACCAATGATAGGATGGAATCGGTACGTTCCCGAGGGTAACATGACAGCTTGTGGAACTGATTATCTAACCAAAGATTGGTTCTCAAGGTCTTATATACTTATATACAGTGTCTTTGTATACTTCATGCCACTTTTTCTCATCATATACAGCTACTATTTTATCATTGCTGCTGTATCTGCTCACGAAAAAGCAATGCGTGAACAAGCCAAAAAGATGAATGTAGCTTCTCTCCGATCCTCCGACAACCAAAATACGAGTGCTGAACATAAGCTCGCAAAGGTA Liposthenes_ker TCTTGGCCCATTTTTATGTGAGATGTACGGAATGTTTGGTTCCCTATTCGGATGCGGCTCCATTTGGACAATGTGTATGATTGCTTTCGATCGATATAATGTTATCGTAAAAGGCTTAGCAGGCAAGCCCTTAACTATCACTGGTGCAACTCTGCGGATTATTGGTCTCTGGGCTTGGGCAGTCGTTTGGACCATTGCACCAATGATAGGATGGAATCGGTACGTTCCCGAGGGTAACATGACAGCTTGTGGAACTGACTATCTAACCAAAGATTGGTTCTCGAGGTCTTATATACTTATATACAG{CT}GTCTTTGTATACTTCATGCCACTTTTTCTCATCATATACAGCTACTATTTTATCATTGCTGCTGTATCTGCTCACGAAAAAGCAATGCGTGAACAAGCCAAAAAGATGAATGTAGCTTCTCTACGATCCTCCGACAACCAAAATACGAGTGCTGAACATAAGCTCGCAAAGGTA Neaylax TCTTGGTCCATTTTTATGTGAGATGTACGGAATGTTTGGCTCCCTATTAGGATGCGGCTCCATCTGGACAATGTGTATGATTGCTTTCGATCGATACAATGTTATTGTAAAAGGCTTAGCAGGCAAGACCTTAACTATCACTGGCGCAATTCTGCGGATTGTTGGTCTCTGGGTTTGGGCAGTCGTTTGGACCATTGCACCAATGATAGGATGGAATCGGTACGTTCCCGAAGGCAACATGACAGCTTGTGGAACTGACTATCTAACTAAAGACTGGTTCTCGAGGTCTTATATACTTATATACAGTGTCTTCGTATACTTCATGCCACTTTTTCTCATCATATACAGCTACTATTTTATCATTGCTGCTGTATCTGCTCACGAAAAAGCAATGCGTGAACAAGCCAAAAAGATGAATGTAGCTTCTCTACGATCCTCCGACAACCAAAATACGAGTGCTGAACATAAGCTCGCAAAGGTA Neuroterus ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Panteliella TCTTGGTCCATTTTTATGTGAGATGTACGGAATGTTTGGCTCCCTTTTCGGATGTGGCTCCATTTGGACAATGTGTATGATTGCTTTCGACCGATACAATGTTATCGTAAAAGGCTTGGCTGGCAAGCCCTTAACTATCACTGGTGCAATTCTGCGGATTGTTGGTCTCTGGGTTTGGGCAGTCATTTGGACCATTGCCCCAATGATAGGATGGAATCGGTACGTTCCCGAGGGCAATATGACAGCTTGTGGAACTGACTATCTGAATAAAGATTGGTTCTCGAGGTCTTATATACTTATATACAGTGTCTTTGTATACTTTATGCCACTTTTTCTCATTATATACAGTTACTATTTCATCATTGCTGCTGTATCTGCCCACGAAAAAGCAATGCGTGAACAAGCCAAAAAGATGAATGTAGCTTCTCTACGATCCTCCGACAACCAAAATACGAGTGCAGAACATAAGCTCGCAAAGGTT Paramblynotus ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Parnips ATTGGGGCCATTTATGTGTGAAATGTATGGACTAACTGGCTCTCTATTCGGATGTGGGTCCATTTGGACAATGTGCATGATTGCGTTCGACAGATACAACGTAATAGTAAAAGGTTTGGCAGGAAAACCTTTAACCATCAGTGGTGCAATTCTTCGCATAGTTGGTCTCTGGGTCTGGGCCGTTATTTGGACCATTGCACCAATGATAGGATGGAATCGGTACGTACCCGAAGGTAACTTGACAGCTTGTGGAACTGACTATCTGACACAGGATTGGTTCTCCAAGTCTTATATCCTTGTATACAGTGTTTTCGTATATTTCATGCCACTTTTCCTCATCATATACAGCTATTATTTCATCATCGCAGCTGTATCTGCTCACGAAAAAGCTATGCGTGAACAGGCCAAAAAGATGAACGTAGCTTCTCTACGATCATCCGATAATCAAAATTCAAGTGCTGAACATAAGCTCGCGAAGGTA Pediaspis GTTTGGGCCATTTATATGTGAGCTGTATGCATTGTTCGGTTCCCTATTCGGATGTGGCTCCATTTGGACAATGTGTATGATTGCTTTCGACAGATACAACGTAATCGTAAAAGGCTTAGCTGGAAAGCCCTTAACCATAAGCGGTGCAATTATTCGTATAATTGGTCTCTGGGTCTGGGCCGTGATTTGGACCGTTGCACCAATATTTGGATGGAATCGGTATGTACCCGAGGGTAACATGACAGCTTGCGGAACTGACTATCTCAGTAAGGACTGGTTTTCGAGGTCTTACATCATTGTTTACAGTATCTTCGTGTACTACATGCCACTTTTCCTCATCATATACAGCTACTACTTTATCATCTCAGCTGTATCTGCTCACGAAAAAGCAATGCGTGAACAGGCCAAAAAGATGAACGTAGCTTCTCTACGATCATCAGACAATGCAAATACGAGTGCAGAGCATAAACTCGCAAAAGTA Periclistus TCTTGGTCCATTTATGTGTGAGATCTACGCAATGCTTGGCTCCCTATTCGGATGTGGCTCCATTTGGACAATGTGTATGATTGCTTTCGATCGATACAATGTTATCGTAAAGGGTCTGGCTGGCAAACCGCTATCTATCAGTGGTGCAATTCTGCGCATTGTTGGACTCTGGGTCTGGGCAGTAATTTGGACCATTGCACCAATGATAGGATGGAATCGGTATGTTCCTGAAGGCAATTTGACAGCTTGCGGAACTGACTATCTGAGTAAGGATTGGTTGTCGAGGTCTTACATTCTTGTATACAGCGTCTTCGTATACTTCATGCCACTTTTCCTCATCATATACAGTTACTATTTCATCATCGCTGCTGTATCTGCTCACGAAAAAGCAATGCGTGAACAGGCCAAAAAGATGAATGTAGCTTCTCTACGATCATCCGATAATCAAAATACGAGTGCTGAACATAAACTCGCCAAGGTA Phanacis_1 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Phanacis_2 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Plagiotrochus ACATGGACCTTTTATGTGCGAGATGTACGCAATGTTTGGCTCCCTATTCGGATGCGGCTCCATTTGGACGATGTGTATGATAGCTTTCGACCGATACAATGTTATCGTGAAGGGATTAGCTGGAAAGCCGTTAACTATCAGTGGTGCAATTCTGCGCATTGTTGGACTCTGGGTTTGGGCAGTAATTTGGACAATTGCACCAATGTTAGGATGGAATCGGTACGTTCCCGAGGGCAACATGACAGCTTGTGGAACTGACTATTTGACTAAGGATTGGTTCTCGAGGTCTTACATACTTGTATATAGCGTCTTTGTATACTTCATGCCACTTTTCCTTATCATATACAGTTACTATTTCATCATTGCTGCTGTAACAGCTCATGAAAAAGCAATGCGTGAGCAGGCCAAAAAGATGAATGTGGCTTCCTTACGATCATCGGACAATCAAAATACAAGTGCTGAACATAAACTTGCCAAGGTA Rhodus TCTTGGTCCATTTTTATGTGAGATGTACGCAATGTTTGGCTCCCTATTTGGATGCGGCTCCATTTGGACAATGTGTATGATTGCTTTCGATCGATACAATGTTATTGTAAAAGGCTTAGCAGGCAAGCCCTTAACTATCACTGGTGCAGTTCTGCGGATTGTTGGTCTCTGGGTTTGGGCAGTCGTTTGGACCATTGCACCAATGATAGGATGGAATCGGTACGTTCCCGAAGGCAATATGACAGCTTGTGGAACTGACTATCTAACTAAAGACTGGTTCTCGAGGTCTTATATACTTATATACAGTGTCTTCGTATACTTCATGCCACTTTTTCTCATTATATACAGCTACTATTTTATCATTGCTGCTGTATCTGCTCACGAAAAAGCAATGCGTGAACAAGCCAAAAAGATGAATGTAGCTTCTCTACGATCCTCCGACAACCAAAATACGAGTGCTGAACATAAGCTCGCAAAGGTA Synergus TCTAGGTCCATTTATATGTGAGATGTACGGAATGTTTGGCTCCCTATTCGGATGTGGCTCTATTTGGACAATGTGTATGATTGCTTTCGACCGATACAACGTTATCGTAAAAGGTTTAGCTGGCAAGCCCTTAACTATCAGTGGTGCAATTCTGCGCATTGCTTTTCTCTGGATCTGGGCAGTAATTTGGACAGTTGCACCAATGATAGGATGGAATCGGTACGTTCCGGAGGGTAACATGACAGCTTGCGGAACTGACTACCTGACTAAGGATTGGTTATCGAGGTCTTACATCATTGTATACAGCGTCTTCGTATACTTCATGCCACTTTTCCTCATCATATACAGTTACTATTTCATCATTGCTGCTGTATCTGCCCATGAAAAGGCTATGCGTGAACAGGCCAAAAAGATGAATGTAGCTTCTCTACGATCATCTGACAATCAAAATACGAGTGCTGAACATAAACTTGCCAAGGTA Synophromorpha ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Timaspis TCTTGGTCCATTTTTATGTGAGATATATGCAATGCTTGGCTCCCTATTCGGATGTGGCTCCATTTGGACAATGTGTATGATTGCTTTTGATCGATACAATGTTATTGTAAAAGGTTTAGCTGGCAAGCCATTAACTATCAGTGGTGCAATTCTACGCATTGTTGGTCTCTGGGTCTGGGCTGTCATTTGGACCATTGCACCAATGCTAGGATGGAATCGGTATGTTCCTGAAGGTAACATGACAGCTTGTGGGACTGACTATTTGACTAAGAACTGGTTCTCGAGGTCTTACATCCTTATATACAGCATTTTCGTGTATTTCATGCCACTTTTCCTCATAATATACAGTTACTATTTCATCATTGCTGCTGCATCTGCTCACGAAAAAGCAATGCGTGAACAAGCAAAAAAGATGAATGTAGCTTCTCTACGATCGTCCGATAATCAGAATACGAGTGCTGAGCATAAGCTCGCAAAGGTA Xestophanes ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M701] TITLE COI; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1078; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Andricus AATATTATATTTTATATTTGGTATTTGATCAGGAATAATTGGATCAGGATTGAGAATAATTATTCGAATAGAGTTAGGGATACCTTTACAATTAATTGGAAATGACCAAATTTATAATTCTATTGTTACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCAATTATAGTTGGGGGGTTTGGAAATTATTTAGTTCCATTAATATTAACTGCTCCTGATATAGCTTTTCCTCGATTAAATAATATAAGATATTGACTTTTAATTCCTTCTTTATTTTTATTATTAGCAGGGATATTAGTTGATCAAGGGGCTGGAACAGGATGAACTGTTTATCCTCCTTTATCTTCAAATTTAGGACACCCAGGAATTTCTGTTGATTTAACTATTTATTCTTTACATTTAACTGGGATTTCCTCAATTTTAGGTTCAATTAATTTTATTACAACAATTTTAAATATACGACCTAATTTAATAGATATAGATAAAATCCCTTTATTTGTTTGATCAATTTTTTTAACAACTATTTTATTATTATTATCTTTACCTATTTTAGCTGGTGCAATTACTATATTATTATTTGATCGTAATATAAATACTTCATTTTTTGATCCTATAGGAGGAGGGGATCCAATTTTATACCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGCTTTTGGTATAATTTCTCATATAATTTATATAGAATGTGGGAAAAAAAATACTTTTGGTTCATTAGGAATAATATATGCTATAATTTCAATTGGTATATTAGGATTTATTGTTTGGGGTCATCATATATTTACTGTAGGTATAGATATTGATACACGAGCTTATTATACATCAGTAACAATAATTATTGCTATTCCTACAGGAATTAAAATTTTTAGGTGGTTAGCAACTATATATGGATCAAAAATTAATTTTAATTTATCAATTATATGATCTTTAGGATTTATTTTTTTATTTTCTATTGGAGGAATAACTGGAGTTACATTAGCTAATTCATCTATTGATATTGTTATACATGATACTTATTATGTTGTTGC? Antistrophus TATATTATACTTTTTATTTGGAATTTGATCTGGATTAATTGGATCAGCTTTAAGTATACTTATTCGAATAGAACTAGGAACCCCTTCTCAATTAATTGGTAATGATCAAATTTATAATTCAGTAGTTACTTCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCAATTATAGTAGGGGGATTTGGTAATTATTTAATTCCTTTAATATTATCAGCTCCTGATATAGCTTTCCCACGTTTAAATAATATAAGATTTTGATTATTAATTCCTTCTATATTATTAATATTATCAAGAATTTTTATTGATAGAGGAGCAGGGACTGGATGAACAATTTACCCCCCACTTTCTTCATTAAATGGTCATTCAGGTATTTCTGTAGATTTAACTATTTATTCATTACATATAAGAGGAATTTCATCAATTTTAGGTTCAATTAATTTTATTACAACAATTTTAAATATACGACCTAATTTAATGTCTATAGATAAAATTACATTATTTTCTTGATCAATTATATTAACAACTATTTTATTATTATTATCTTTACCAGTTTTAGCTGGAGGAATTACAATATTACTCTTTGATCGAAATATAAATACATCTTTTTTTGATCCTTTAGGGGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCACCCAGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCCCATATAATTTATTCAGAATGTGGTAAAAAAACAACATTTGGTGTATTAGGAATAATTTATGCTTTAATTTCAATTGGTATATTAGGATTTATTGTATGAGGACATCATATATTTACAGTTGGCATAGATGTAGATACACGAGCCTATTACACATCAGCAACTATAATTATTGCTATTCCTACAGGTATTAAAATTTTTAGTTGATTGGCAACAATATATGGAATAAAGATTAATTATAATTTATCAATAATTTGAGCTTTAGGATTTATCTTTTTATTTTCTTTTGGAGGATTAACAGGAATTACTTTATCAAATTCTTCAATTGATATTTCTTTACGTGATACATATTATGTAGTTGCT Aulacidea AATATTATATTTTTTATTTGGAATTTGATCTGGAATAATTGGATCAGCATTAAGAATAATTATTCGTTTAGAATTAGGGACCTCTGGACAATTAATTGGAGATGATCAAGTTTATAACTCTATTGTTACAGCTCATGCATTCGTAATAATTTTTTTTATAGTTATACCAATTATAGTAGGTGGATTTGGTAATTATTTAATTCCTTTAATATTGACAGCACCTGATATGGCATTTCCACGATTAAATAATATAAGATACTGATTATTACTTCCAGCTTTATTATTAATAATAACTAGGATATTTATTGATCAAGGGGCCGGTACTGGGTGGACAGTTTATCCACCCTTATCTTCAAATATAGGTCATTCTGGAATTTCAGTTGATCTTGTTATTTATTCATTACACATAAGAGGTATTTCTTCAATTTTAGGGTCCATTAATTTTATTACCACTATTTTAAATATACGACCAAATATATTATCTATAGATAAGATTTCATTATTTATATGGTCAATTTCTTTAACAACAATTTTATTATTATTATCATTGCCTGTATTAGCTGGAGGAATTACAATATTATTATTTGATCGAAATATAAATACTTCATTTTTTGACCCTATAGGAGGAGGAGACCCTGTGTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAGGTTTATATTTTAATTTTACCAGGATTTGGGATAATTTCACATATAATTTATATAGAATGTGGTAAAAGAATTACTTTTGGAGCTTTAGGGATAATATATGCAATAATTTCCATTGGAATATTAGGATTTATTGTTTGAGGCCATCACATATTTACTGTAGGGATAGATGTTGATACACGAGCTTATTATACTTCAGCAACGATAGTAATTGCTATCCCTACAGGAATTAAAATTTTTAGGTGACTTGCAACTATATATGGATCTAAAATTAATTTTAATTTATCAATTATATGATCATTAGGTTTTATTTTTTTATTTTCTTTAGGTGGTTTGACAGGAGTCACATTATCAAATTCTTCACTTGATATTATTTTACATGATACTTATTATGTAGTGGCT Aylax TATATTATATTTTATATTTGGAATTTGATCTGGAATAATTGGATCTGCTTTAAGTATATTAATTCGAATAGAATTAGGAACACCTAATCAATTAATTGGAAATGATCAAGTTTATAATTCAATTGTTACTACTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAGTTAGAGGATTTGGTAATTATTTAGTACCTTTAATATTAACAGCTCCTGATATAGCTTTCCCTCGATTAAATAATATAAGATATTGATTATTAATCCCCTCTATATTATTATTATTATCAAGATTATTTATTGATGAAGGGGCAGGGACAGGATGAACAGTTTATCCTCCTTTATCTACAGAAGTTAGACATTCAGGTATATCTGTTGATTTAATTATTTATTCTTTACATTTAAGAGGAATTTCTTCTATTTTAGGTTCTATTAATTTTATTACAACAATTTTAAATATACGTCCAAATATATTAACAATAGATAAAATTCCTTTATTTATTTGATCTATTTTTTGAACAACAATTTTATTATTATTATCTTTACCAGTTTTAGCTGGGGGAATTACAATATTATTATTTGATCGGAATATAAATACATCTTTTTTTGACCCTATAGGGGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGTATAATTTCTCATATAATTTATAGTGAAAGAGGAAAAAAAACTACTTTTGGATCTTTAGGAATAATTTATGCTATAATTTCAATTGGATTATTAGGATTTATTGTATGAGGGCATCATATATTTACTGTTGGTATAGATGTAGATACTCGTGCTTATTATACTTCTGCTACAATAGTAATTGCTATCCCCACAGGAATTAAAATTTTTAGATGACTTGCTACTATATATGGATCAAAAATTGATTTTAATTTATCTATAATTTGATCATTAGGATTTATTTTTTTATTTTCAATTGGAGGTATTACAGGAGTAACCTTATCAAATTCTTCAATTGATATTGTTTTGCATGATACATATTATGTTGTAGCT Barbotinia AATATTATATTTTATATTTGGAATCTGATCAGGAATAATTGGGTCAGCTTTAAGAATATTAATTCGAATGGAATTAGGTACTCCAGGTCAATTAATTGGTAATGATCAAATTTACAATTCAATTGTTACTATTCATGCATTTATTATAATTTTTTTTATAGTTATACCTCTTATATTAGGAGGGTTTGGTAATTATTTAATTCCATTAATATTATCAGCTCCTGATATAGCTTTCCCTCGATTAAATAATATAAGATATTGATTATTAATCCCACCATTATTATTATTATTATCAAGAATATTAGTAGATCAAGGGGCAGGGACAGGATGAACGGTTTATCCTCCTTTATCTTCAAATATTGGGCATCCAGGAATTTCAGTAGATTTAACAATTTACTCTTTACATTTAACAGGAATTTCATCGATTTTAGGATCAATTAATTTTATTACAACAATTTTAAATATACGACCAGAAATATTAACTATAGATAAGATTTCTTTATTTATTTGATCAATTTTTTTAACAACTATTTTACTATTACTTTCTTTACCTGTTTTAGCTGGAGGAATTACAATATTATTATTTGATCGTAATATAAATACTTCATTTTTTGATCCAATAGGAGGGGGTGACCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGGTTTGGAATAATTTCTCATATAATTTATAGAGAATGTGGAAAAAAAACTACTTTTGGATCATTAGGTATAATATATGCAATAATTTCAATTGGTTTACTAGGATTTATTGTTTGAGGTCATCATATATTTACTGTTGGGATAGATGTAGATACACGAGCTTATTATACATCAGCAACAATGGTAATTGCTATTCCTACAGGAATTAAAATTTTTAGGTGATTAGCAACTATATATGGATCAAAAATTAATTTTAATTTATCAATAATTTGATCATTAGGATTTATTTTTTTATTTTCTCTTGGAGGAATTACAGGAATTACTTTATCTAATTCTTCAATTGATGTTATTTTACATGATACATATTATGTCGTAGC? Biorhiza TATAATATATTTTATATTTGGAATTTGATCAGGAATAATTGGATCTAGTTTAAGAATAATTATTCGAATAGAATTAGGGACTCCATTACAATTAATTATAAATGATCAAATTTATAATTCAATTGTTACAGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCTATTATAGTTGGAGGATTTGGAAACTATTTAGTGCCTTTAATGTTAGTAATTCCTGATATATCTTTCCCTCGATTAAATAATATAAGATATTGACTTTTAATTCCTTCATTATTTTTATTATTATCTGGTATATTAGTTGATCAGGGAGCTGGAACAGGATGAACTGTTTACCCTCCTTTATCTTCAAATTTAGGACATTCAGGAATTTCTGTTGATTTAACAATTTATTCTTTACATTTAACTGGAATTTCTTCAATTTTAGGATCAATTAATTTTATTACTACAATTTTAAATATACGATCTAATTTAATAACAATAGATAAAATTCCTTTATTTGTATGATCAATTTTTTTAACTACAATTTTATTATTATTATCTTTACCAATTTTAGCCGGAGCAATTACAATATTATTATTTGATCGTAATATAAATACTTCTTTTTTTGACCCTATAGGAGGAGGAGACCCAATTTTATATCAACATTTATTTTGATTTTTTGGGCACCCAGAAGTTTATATTTTAATTTTACCTGCTTTTGGAATAGTTTCTCATATAATTTATATAGAATGTGGAAAAAAAAATACTTTTGGATCTTTGGGAATAATATATGCAATAATTTCAATTGGTATATTAGGATTTATTGTTTGAGGACATCATATATTTACTGTAGGGATAGATATTGATACACGAGCTTATTATACTTCAGTTACAATAATTATTGCAATTCCTACAGGTATTAAAATTTTTAGATGATTAGCTACTATATATGGGTCAAAAATTAATTTTAATTTATCTACTATATGAGCTTTAGGATTTATTTTTTTATTTTCTATTGGAGGAATAACTGGTGTAACATTAGCTAATTCATCAATTGATATTATTATACATGATACTTATTATGTTGTTGCT Ceroptres TATATTATATTTTATATTTGGGGTATATTCTGGAATAATTGGATCATCCTTAAGAATAATTATTCGAATAGAATTAGGAACTCCTACTCAGTTAATTAATAATGACCAAATTTATAATTCAATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAGTAGGTGGATTTGGAAATTATATGATTCCTTTAATATTAATTTCTCCTGATATAGCATATCCTCGTTTAAATAATATAAGGTTTTGATTATTAATTCCTTCTTTAATTTTATTGATCATGGGAATATTTATTGATCAAGGGGCGGGGACAGGATGAACAGTGTATCCCCCTTTATCTTCTAGGTTAGGGCATTCAGGGTTATCTGTAGATTTAACTATTTATTCATTACATTTAAGAGGAATTTCTTCTATTTTAGGATCCATTAATTTTATTTCTTCTATTATAAATATACGCCCTAAATTAATATTAATAGATAAAATTTCTTTATTTATTTGATCAATTTTATTAACTACTATTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGGAATTACAATATTATTATTTGATCGAAATATAAATACTTCATTTTTTGATCCTATAGGAGGAGGTGACCCAATTTTATATCAACATTTATTTTGATTTTTTGGACATCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCTCATATAATTTATTTAGAAACTGGAAAAAAAATTACTTTTGGATCTTTAGGAATAATTTATGCAATAATTTCTATTGGAATGTTAGGTTTTATTGTATGAGGACATCATATATTTACAGTAGGAATAGATGTAGATACTCGAGCTTATTATACTTCAGCTACTATAATTATTGCAATTCCCACAGGAATCAAAATTTTTAGATGATTGGCTACAATATATGGATCAAAATTAGACATTAATATTTCAATAATATGATCTTTAGGATTTATTTTTTTATTTTCAATAGGAGGAATAACAGGAGTAACTTTATCTAATTCTTCTATTGATATTATTTTGCATGATACTTATTATGTAGTAGCT Diastrophus AATATTATATATAGTTTTTGGTATTTGATCTGGAATAATTGGATCAAGATTAAGAATAATTATTCGTACAGAACTTGGAACTCCTACACAATTAATTGGTAATGATCAAATTTATAACTCAATTGTTACAATTCATGCATTTATTATAATTTTTTTTATAGTAATACCAATTATAGTAGGAGGATTTGGAAATTATTTAATTCCTTTAATATTATCAGTACCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGACTTTTAGTCCCTTCTTTATTATTAATAATTTCTAGTATATGTGTAGATCAAGGGTCTGGTACAGGTTGAACTGTTTATCCCCCTTTATCTTCAACTTTAGGACATAATGGTATTTCAGTAGATTTAGTAATTTATTCATTACATTTAAGAGGCATTTCATCTATTATAGGGTCAATTAATATTATTACAACAATTTTAAATATACGACCATATTTATTATCTATAGATAAAATTAGTTTATTTACTTGATCTATCTTTTTAACTACTATTTTATTATTATTATCTTTACCAGTGTTAGCCGGAGGAATTACTATATTATTAATAGATCGAAATATAAATTCTTCTTTTTTTGACCCTTTAGGAGGAGGGGATCCTATTCTTTATCAACATTTATTTTGATTTTTTGGACACCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATAATTTATACAGAATGTGGAAAAAAAATTACTTTTGGTTCTTTAGGAATAATATATGCAATAATTTCTATTGGAATATTAGGATTTATTGTATGAGGACATCATATATTTACTGTAGGGATAGATATTGATACACGAGCTTATTATACTTCAGTAACTATAATTATTGCTATTCCAACAGGAATTAAAATTTTTAGATGGTTAGCAACAATATATGGTACAAAAATTAATTTTAATCCTTCAATTATTTGATCATTAGGCTTTATTTTTTTATTTTCAATTGGGGGAATAACAGGGGTAACTTTAGCTAATTCATCAATTGATATTATTTTACATGATACTTATTATGTAGTGGCT Diplolepis TGTATTATATTTTATATTTGGTATTTGGTGTGGGATGGTTGGGGCAGCTTTAAGAATAATTATTCGTATTGAGTTAGGAATAACAGGGCAGTTAATTGGTAATGATCAAATTTATAATTCTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTTTAATATTAGGGGGATTTGGTAATTATTTAATTCCATTAATATTATCTTCTCCAGATATATCTTTTCCTCGATTAAATAATATAAGATTTTGATTATTAGTTCCTTCTTTTATTTTGTTAATTATAAGTATATTTATTGATCAAGGAGCAGGTACAGGGTGAACTGTTTATCCTCCATTATCATTAAATATTGGGCATGAAGGGGTTTCTGTTGATTTAGTAATTTTTTCATTACATTTAAGTGGGATTTCATCAATTTTAGGTTCAATTAATTTTATTACTACAATTTTAAATATACGTCCTGTAATAATAAGAATAGAAAAAATTACTTTATTTTCTTGATCAATTTTATTAACTACTATTTTATTATTATTGTCTTTACCTGTTTTAGCTGGGGGTATTACTATATTATTATTTGATCATAATTTAAATACTTCTTTCTTTGATCCTATAGGGGGCGGGGATCCAGTTTTATATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTGCCAGGATTTGGTATAATTTCTCATATAATTTATTCTGAATGTGGTAAAAAATTTACTTTTGGTTCATTAGGTATGATATATGCTATAATTTCAATTGGTATATTAGGGTTTATTGTATGAGGACATCATATATTTACTGTTGGTATAGATATTGATACACGGGCTTATTATACATCAGTTACTATAATTATTGCTGTTCCTACAGGTATTAAAATTTTTAGGTGATTGGCTACTATATATGGAGCAAAAATTGATTATAATTTGGCTATAATTTGATCATTAGGATTTATTTTTTTATTTTCTTTAGGAGGATTAACAGGAGTTTTATTATCTAATTCATCCATTGATATTATTTTACATGATACATATTATGTTGTTGC? Eschatocerus AATCATATATTTTATTTTAGGAATTTGATCAGGAATTTTAGGGGCATCATTAAGTATACTTATTCGAATAGAATTAGGTACCCCTAATCAATTTATTGGAAATGATCAAATTTATAATTCTATTGTAACAGCTCATGCATTTATCATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTATTTAATTCCTTTAATACTTGGGGTTCCAGATATATGCTTTCCACGATTAAATAATTTAAGATTTTGGTTACTTCTACCTTCTTTAGGTTTATTATTAAGAAGAATGCTTTTAGATTCTGGTGCGGGTACAGGATGAACAGTTTATCCTCCTTTATCTTCTCTTATTGGACATCCTGGAGTATCTGTTGATTTTGCAATTTTTTCTTTACATTTAAGGGGAGCATCCTCTATTTTAGGATCTATTAACTTTATTTCCACAATTATTAATATACGGACAATGAAATTTTCAATAGATAAAATTTCTTTGTTTGTTTGATCTATTTTATTAACTACTATTTTATTATTATTATCTTTACCTGTATTAGCAGGAGGAATTACAATACTTTTATTTGATCGAAATCTAAATACTTCTTTCTTTGACCCTATTGGAGGTGGGGACCCCATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATAATTTTTACTGAATGTGGTAAAAAATCTACTTTTGGTTCTTTAGGAATATTATATGCTATAATTTCTATTGGAGCTTTAGGATTTATGGTTTGAGGTCATCATATATTTACAGTAGGTATAGATGTTGATACTCGAGCTTATTTTACTTCTGTAACTATAATTATTGCTATTCCTACTGGAATTAAAATTTTTAGATGATTAGCTACTATATATGGATCAAAAATAAAATTTAGATTACCTATATTATGATCTTTAGGATTTGTATTTTTATTTACTCTTGGTGGTCTAACTGGAGTTACTTTATCAAATTCATCAATTGATATTATCTTACATGATACATATTATGTAGTAGCT Gonaspis TATATTATATATAATTTTTGGTGTTTGATCTGGCATAATTGGGTCTAGATTAAGAATAATTATTCGGACAGAACTTGGTACACCATTACAATTAATTGGTAATGATCAAATTTATAATTCAATTGTTACAACTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAGTTGGGGGATTTGGAAATTATTTAATTCCTCTTATATTAAGGGTTCCTGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGGCTTTTAATTCCTTCTTTAATATTAATATTATCTAGAATATATGTTGATCAAGGATCAGGGACAGGATGAACGGTTTATCCTCCTTTATCTTCAATTTTGGGTCATAATGGTATTTCTGTTGATTTAGTAATTTATTCTTTACATTTAAGAGGAGTTTCTTCTATTTTAGGATCTATTAATATTATCACAACAATTTTAAATATACGTCCATATTTATTAAGAATAGATAAAATTAGGTTATTTATTTGATCTATTTTATTAACAACTATTTTATTATTATTATCTTTACCAGTTTTAGCAGGAGGAATTACTATATTATTAATAGATCGAAATATAAATTCTTCTTTTTTCGATCCGTTAGGTGGAGGAGATCCTATTCTTTATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCTCATATAATTTATACAGAATGTGGAAAAAAAATTACTTTTGGATCTTTAGGTATAATATATGCTATAATTTCTATTGGAATATTAGGATTTATTGTTTGAGGTCATCATATATTTACTGTAGGTATAGATATTGATACTCGAGCTTATTATACGTCAGTAACTATAATTATTGCAATTCCTACAGGGATTAAAATTTTTAGATGATTAGCTACTATATATGGATCAAAAATTAATTTTAATCCCTCAATTATTTGATCATTAGGCTTTATTTTTTTATTTTCAATTGGGGGAATAACAGGAGTAACTTTATCTAATTCATCAATTGATATTATTTTACATGATACTTATTATGTAGTTGCT Hedickiana TATATTATATTTTTTATTTGGTGCATGATCTGGGACTATTGGATCTGCATTAAGTATACTTATTCGTAGAGAATTAGGGACTCCAAATCAATTTATTGGAAATGATCAAATTTATAATTCAATTGTCACATCTCATGCATTTGTAATAATTTTTTTTATAGTTATACCTATTATAGTTGGTGGATTTGGCAATTATTTAATTCCTTTAATAATTTCAGCTCCTGATATAGCTTTCCCTCGATTAAATAATTTAAGATATTGGTTACTTGCCCCAGCTTTATTATTATTATTATCAAATTTATTTATTGATCAGGGGGCTGGGACTGGATGAACAGTTTATCCTCCATTATCTTCTTCTATTGGACATGAAGGAATTTCAGTAGATTTAATTATTTATGCATTACATTTAAGAGGGATCTCTTCAATTTTAGGGTCAATTAATTTTATTACCACTATTTTAAATATACGACCTGAAAAAGTTTCTATAGATAAAATTTCATTATTTTCATGATCTATTTTATTAACAACAATTTTACTTTTACTTTCTTTACCTGTATTAGCAGGAGGTATTACAATATTACTTTTTGATCGTAATTTAAATACATCTTTTTTTGACCCAATAGGAGGGGGGGATCCAATTTTATACCAACATTTATTTTGATTTTTTGGTCACCCAGAAGTTTATATTTTAATTCTTCCAGGATTTGGAATAATTTCTCATATAATTTATTCAGAATGTGGTAAAAAAACAACATTTGGTTCATTAGGGATATTATATGCAATAATTTCTATTGGAATATTAGGTTTTATTGTTTGAGGCCATCATATATTTACTGTGGGTATAGATGTAGATACACGAGCTTATTACACATCAGCAACTATAATTATTGCAGTTCCTACTGGTATTAAAGTATTTAGTTGATTGGCATCAATATATGGAGCAAAAGTTAATTTTAATTTATCAATTCTTTGATCATTAGGATTTATTTTTTTATTTTCACTTGGAGGAGTGACAGGTGTTACTTTATCTAATTCATCAATTGATATTGTTATACATGATACTTATTATGTTGTTGCA Ibalia GCTGCTATATTTTATTTTTGGGATTTGATCCGGAATAATTGGATCTAGACTAAGAATAATTATTCGAATAGAATTAGGAGCCCCTTCCCAATTAATTGGGAATGATCAAATTTATAATTCTATTGTAACAATTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAGTAGGGGGATTTGGAAATTATTTAATTCCTTTAATATTAGCAATACCAGATATGGCTTTCCCTCGTTTAAATAATATAAGATTTTGGTTATTAATTCCTGCCCTAATATTTTTAATATCTGGAATATTCATTGATCAGGGAGCAGGGACGGGATGAACAGTTTATCCTCCTTTATCTTCTTATTTAGGCCACCCTAGGATTTCAGTTGATTTAACTATTTTTTCTTTACATTTAAGGGGAGTTTCTTCTATTTTAGGTTCTATTAATTTTATTACAACTATTTTAAATATACGA------ATTATAATAATAGATAAAATTACTTTATTTATTTGATCTATTTTATTGACTACAATTTTATTATTATTATCTTTACCTGTATTAGCAGGAGGAATTACAATATTATTGTTTGATCGTAATTTAAATACTTCATTTTTTGACCCCATAGGGGGAGGGGACCCTATTTTATACCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATAATTTATACAGAATGTGGTAAAAAAAGAACTTTTGGGGCATTAAGAATAATATATGCAATAATTTCTATTGGGATATTAGGATTTATCGTATGAGGACATCATATATTTACTGTAGGGATAGATGTAGATACTCGAGCTTATTATACTTCTGTAACTATAATTATTGCTATCCCAACAGGAATTAAAATTTTTAGATGATTAGCTAGGATATATGGGTCTAAAATTAAATTTAATTTATCTATTATTTGATCAATTGGATTTATTTTTTTATTTTCTTTTGGGGGAATAACTGGAGTTACTTTATCAAACTCTTCTATTGACATTATTCTTCATGATACTTATTATGTAGTAGC? Iraella AATAATATATTTTATTTTTGGTATTTGATCAGGAATAATTGGATCAGCCTTAAGAATATTAATTCGAATAGAATTAGGTACTCCAGGTCAATTAATTGGAAATGATCAAATTTATAATTCAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAGTTGGAGGATTTGGAAATTATTTAATTCCTTTAATACTAACAGCACCTGACATAGCTTTTCCACGATTAAATAATATAAGATATTGATTATTAATTCCTTCTTTATTATTATTATTATTAAGAATATTTGTTGATCAGGGAGCTGGAACAGGTTGAACAGTTTATCCTCCTTTATCTTCAAATATAGGTCATCCAGGGATCTCTGTAGATCTTACAATTTATTCTTTACATTTAAGAGGGA{CT}TTCTTCAATTTTAGGGTCAATTAACTTTATTACAACTATTTTAAATATACGACCTTATATAGTTACTATAGATAAAATTTCTTTATTTATTTGATCAATTTTTTTAACAACAATTTTATTATTATTATCTTTACCAGTATTAGCAGGTGGAATTACAATATTATTATTTGATCGTAATATAAATACTTCATTTTTTGACCCAATAGGAGGAGGAGATCCAGTATTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTATATATTTTAATTTTACCAGGATTTGGGATAATTTCTCATATAATTTATAATGAATGTGGGAAAAAAACTACTTTTGGATCTTTAGGAATAATATATGCAATAATTTCTATTGGAATATTAGGATTTATTGTTTGAGGTCATCATATGTTTACTGTAGGAATAGATGTTGATACACGAGCTTATTACACTTCAGCAACAATAGTTATTGCAATTCCTACAGGTATTAAAATTTTTAGTTGATTAGCAACTATATATGGATCAAAAATTGATTTAAATTTATCAATAATTTGATCTTTAGGTTTCATTTTTTTATTTTCAGTTGGGGGAATTACAGGAGTAACTTTATCAAATTCATCTATTGATATTATTTTACATGATACTTATTATGTAGTGGCT Isocolus AATATTATATTTTTTATTTGGTATTTGATCAGGGATAATTGGGTCTGCTTTGAGAGTAATTATTCGAATAGAGTTAGGGACTCCTGGGCAATTAATTGGAAATGATCAAATTTATAATTCAATTGTTACAGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCAATTATAGTTGGAGGATTTGGGAATTATTTAGTTCCTTTAATGTTAACTGCCCCAGATATAGCATTCCCTCGATTAAATAATATAAGATATTGGCTTTTAATCCCTTCTTTATTATTAATAATAACAAGAATATTTATTGACCAAGGAGGGGGTACTGGATGAACAGTTTACCCCCCTTTATCTTCAAATATTGGGCATTTAGGAGTTTCAGTAGATTTAATTATTTATTCATTACATATAAGAGGGGTTTCTTCAATTTTAGGGTCAATTAATTTTATTACAACTATTTTAAATATGCGACCTAATAATTTATCAATAGATAAAATTTCTTTATTTATTTGATCAATTTTATTAACAACAATTTTATTATTATTATCTTTACCTGTGTTAGCTGGAGGAATTACTATATTATTATTTGACCGAAATTTAAATACTTCTTTTTTTGACCCTATAGGAGGAGGAGACCCAATTTTATACCAACATTTATTTTGATTTTTTGGTCACCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATAATTTATAGTGAGTGTGGGAAAAAAACTACATTTGGATCTTTAGGAATAATATATGCTATAATTTCAATTGGTGTTTTAGGGTTTCTTGTTTGAGGTCATCATATATTTACAGTAGGGATAGATGTAGATACACGAGCTTATTATACTTCAGTAACAATAATTATTGCAATCCCTACAAGTATTAAAATTTTTAGATGATTAGCTACTATACATGGTACAAAAATTAATTTTAACCTATCTATTTTATGATCTTTAGGATTTGTATTTTTATTTTCATTAGGGGGGATAACAGGAGTAACATTAGCAAATTCATCTATTGACATTATTTTACATGATACTTATTATGTAGTTGCA Liposthenes_gle AATTTTATATTTTATTTTTGGTATATGATCAGGTATATTAGGTTCAGCTTTAAGAATGATTATTCGTATAGAGTTAGGGACTCCCTCTCAATTAATTGGAAATGATCAAATTTATAATACAATTGTTACAGCTCATGCTTTTGTAATAATTTTTTTTATGGTTATACCAATTATAGTAGGAGGATTTGGAAATTATTTAATTCCATTAATATTATCAGTACCTGATATAGCTTTCCCTCGTTTAAATAATTTAAGATATTGAATATTAGTCCCTGCATTATTATTATTATCATCAAGAATGTTTATTGATCAAGGGGCGGGTACAGGTTGAACAGTATATCCCCCATTGTCATCTAATTTAGGCCATGCAGGGATATCAGTAGATTTAACTATTTATTCTTTACATATAAGAGGAATTTCTTCAATTTTAGGGTCAATTAATTTTATTACAACAATTTTAAATTTACGACCAAATATAGTTAGAATAGATAAAATTTCTTTATTTATATGATCAATTTTTTTAACTACTATTTTACTTTTATTATCTTTACCAGTGTTAGCGGGAGGAATTACAATATTATTATTTGACCGAAATTTAAATACTTCGTTTTTTGACCCCTTAGGAGGAGGAGACCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTGCCCGGATTTGGAATAATTTCTCATATAATTTATTTAGAATGTGGGAAAAAAATTACATTTGGGTCTTTAGGTATAATATATGCAATAATTTCAATTGGAATATTAGGATTTATTGTATGGGGTCATCATATATTTACTGTAGGAATAGATGTAGATACACGGGCATACTACACTTCAGCTACAATAATTATTGCAGTCCCTACAGGTATTAAAATTTTTAGATGATTGGCAACAATATATGGGTCAAGAATTAATTTAAATTTATCAATTATATGATCTTTAGGGTTTATTTTTTTATTTTCTATTGGTGGATTAACAGGTGTGACTCTTTCTAATTCATCGATTGATATTATTTTACATGACACTTATTATGTAGTGGCT Liposthenes_ker AATATTATACTTTATATTTGGAATCTGATCTGGAATAATTGGATCAGGATTAAGAATAATTATCCGTATAGAACTAGGATCCCCCGGCCAACTAATTGGAAATGATCAAATCTATAACTCTATCGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAGTTGGAGGTTTTGGAAACTATTTAATTCCATTAATAATAACGGCCCCTGATATAGCTTTCCCTCGATTAAATAATATAAGATACTGAATATTAATCCCAGCCTTATTATTATTAATTTCAAGAATATTTATTGATGAAGGTGCTGGAACTGGATGAACAGTTTACCCACCTTTATCATCTTTATTAAGACATAGAGGAATCTCCGTAGATTTAACAATTTATTCCCTTCATATAAGAGGAATTTCATCAATTTTAGGATCAATTAATTTTATCTCAACTATCTTAAACATACGACCCAATAATTTGTCAATAGATAAAATTTCTTTATTTTCCTGATCAATTTTACTAACGACAACTTTATTATTATTATCATTGCCAGTATTAGCAGGAGGAATTACAATACTTCTTTTTGACCGTAATATAAATACTTCTTTTTTTGACCCTATAGGAGGAGGAGACCCAATTTTATATCAACATCTATTTTGATTCTTTGGTCATCCTGAAGTTTATATTTTAATTCTTCCAGGATTTGGAATAGTCTCTCACTTAATTTATTCTGAATGTGGAAAAAAAAACACTTTTGGATCCTTAGGGATAACATATGCTATAATCTCTATTGGATTATTAGGATTTATTGTCTGAGGACATCATATATTTACTGTAGGAATGGATGTCGACACCCGAGCTTATTATACTTCTGCAACTATAATTATTGCAATTCCACCAGGAATCAAAATTTTTAGATGATTAGCTACAATATATGGATCTAAAATTTACATAAATTTATCAATTTTATGATCCTTAGGATTTATTTTTCTATTTTCTATTGGAGGAATTACTGGTATTACCTTAGCAAATTCTTCTCTAGACATTATCCTTCATGACACTTACTATGTTGTAGCA Neaylax TATATTATACTTTTTATTTGGGATTTGGTCAGGAATTATTGGATCTGCATTAAGAATAATTATTCGAATAGAATTAGGGTCACCCTCCCCATTAATTGGTAATGACCAAATTTATAATTCAATTGTTACTGCTCATGCATTTGTAATAATTTTTTTTATAGTCATGCCTATTATAGTAGGGGGGTTTGGAAATTATTTAATTCCTTTAATATTAACAGCCCCAGATATAGCTTTCCCACGATTAAATAATATAAGATATTGATTACTACCCCCAGCATTATTTTTATTACTTTCTAGTATATTTATTGATCAAGGGGCAGGGACAGGATGAACAATTTATCCTCCTTTATCTTCAAGATTAGGCCATATAGGGGTTTCTGTTGATTTAGTGATTTACTCTTTACACTTAAGAGGAGTATCTTCAATTTTAGGGTCAATTAATTTCATTACTACAATTTTAAACATACGCCCAAATATAATTACTATAGATAAAATTTCTTTATTTCTATGATCAATTTTTTTAACTACAATTTTACTATTACTTTCATTACCTGTATTAGCCGGGGGGATTACAATATTATTATTTGATCGAAACTTAAACACATCTTTCTTTGACCCAATAGGAGGAGGAGACCCTATTTTATTCCAGCATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATAATTTTTTTAGAGTGTGGGAAAAAAACAACATTTGGGTCATTAGGAATAATATACGCCATAATTTCAATTGGAATACTAGGATTTATTGTATGAGGCCATCATATATTTACTGTTGGGATAGATGTTGATACACGTGCATATTATACTTCAGCAACAATAATTATTGCAATTCCTACTGGTATTAAAATTTTTAGATGATTAGCAACTATTTATGGAACAAAAATTAATTTTAATCCATCAATTATTTGATCTTTAGGGTTTATTTTTTTATTTTCAATTGGGGGGATGACAGGAGTTACACTATCTAATTCTTCAATTGATATTATTATACATGATACTTATTATGTCGTAGCT Neuroterus AATATTATATTTTATATTTGGAATTTGAGCAGGAATAATTGGATCAGGATTAAGAATAATTATTCGAATAGAATTAGGGATACCTTTACAATTAATTGGAAATGATCAAATTTATAACTCTATTGTTACAGCCCATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTATAGTAGGAGGGTTTGGTAATTATTTAGTTCCTTTAATATTAGCTGCTCCAGATATAGCTTTTCCTCGATTAAATAACATAAGATATTGATTATTAATCCCTTCATTATTATTATTATTAGCCGGAATATTAGTGGACCAAGGGGCAGGAACAGGATGAACTGTTTATCCTCCTTTATCCTCAAATTTAGGGCATCCAGGTATCTCTGTAGACTTAACTATTTATTCTTTACATTTAACAGGAATTTCTTCAATTTTAGGTTCAATTAATTTTATTACTACAATTTTAAATATACGTCCTAATTTAATAGAAATAGATAAAATTCCTTTATTTGTTTGATCTATTTTTTTAACTACAATTTTATTACTTTTATCTTTACCAATTTTAGCAGGAGCAATTACAATATTATTATTTGATCGAAATATAAATACCTCATTTTTTGATCCTATAGGAGGGGGGGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGGCATCCAGAAGTTTATATTTTAATTTTACCAGCATTTGGTATAATTTCACATATAATTTATATAGAATGTGGAAAAAAAAATACTTTTGGGTCTTTAGGAATAATATATGCAATAATTTCAATTGGTATATTAGGATTTATTGTTTGAGGTCATCATATATTTACTGTAGGAATAGATATTGACACACGAGCTTATTATACTTCAGTAACAATAATTATTGCGATTCCTACAGGAATTAAAATTTTTAGATGATTAGCTACAATATATGGATCAAAAATTAATTTTAATTTATCAATTATATGAGCTTTAGGGTTTATTTTTTTATTTTCAATTGGAGGAATAACAGGTGTAACATTAGCAAATTCATCAATTGATATTGTTATACATGATACTTATTATGTTGTTGCT Panteliella ATTATTATATTTTATATTTGGTATTTGAGCAGGAATAATTGGGCCAGCTTTAAGAATAATTATTCGTATAGAGTTAGGGTTGCCTTCCCAATTAATTGGAAATGATCAAATTTATAATTCTATTGTTACGGCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAGTTGGTGGGTTTGTAAATTATTTAGTTCCATTAATGTTATCAGCCCCTGATATAGCTTTCCCTCGTTTAAATAACATAAGATATTGATTATTAATCCCTTCATTATTACTATTGTTATCTAGAATTTTTATTGATCAGAGGGCAGGGACGGGGTGAACAGTCTACCCTCCATTATCATCAAATTTAGGGCATAGAGGAATATCAGTTGACCTAACAATTTATTCATTACATATAAGAGGGGTATCGTCAATTTTACGATCAATTAATTTTATTACTACAATTTTAAATATGCGTCCTTTATACATATCAATAGATAAAATTTCATTATTCATGTGAACTATTCTATTAACTACTATTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGGAATTACAATATTATTATTTGATCGTAATTTAAATACCTCATTTTTTGATCCTGTAGGCGGGGGAGAGCCAGTATTATACCAACATTTATTTTGATTTTTTTGTCACCCTGAAGTTTATATTCCAATTTTAGCTGGATTTGGGATAGTGTCTCATATAATTTATTTAGAATGTGGGGAAAAAATTACATTTGGGTCTTTAGGAATAATATACGCAATAATTTCAATTGGTATATTAGGTTTTATTGTATGAGGACATCATATATTTACTGTTGGGATAGATGTAGATACACGAGCTTATTACACTTCAGCCACTATAATTATTGCAATTTCTACAGGAATTATAATTTTTAGATGATTAGCTACTATATATGGATCAAAGATTGATTTTAATTTATCTATATTATGATCTTTAGGATTTATTTTTTTATTTTCAATTGGAGGATTAACTGGAGTAACTTTATCAAATTCATCAATTGATATTGTTATACATGACACTTATTATGTTGTGGC? Paramblynotus TATCTTATATTTTATTTTTGGAATATGAGCAGGAATAATTGGAGCATCAATAAGAATAATTATTCGTATAGAATTAGGTACACCAAATCAATTAATTAATAATGATCAAATTTATAATTCTATTGTAACTGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAGTTGGAGGGTTTGGAAATTATTTAATTCCAATTATATTAATTTTACCTGATATATCATATCCACGTTTAAATAATATAAGATATTGATTATTACCCCCTTCTTTATTTTTATTAATTTCAAGAATAATAATTGATCAAGGAGCAGGAACTGGATGAACTGTTTATCCTCCTCTTTCATCAAATTTAGGTCATAGAGGAATTTCTGTAGATTTAACAATTTTTTCTTTACATTTAAGTGGTGTATCTTCAATTTTAGGATCAATTAATTTTATTACTACAATTTTAAATATACGATTAAATAATATAAGTATAGATAAAATTACATTATTTATTTGATCTATTTATTTAACAACAATTTTATTATTATTATCTTTACCAGTTTTAGCAGGAGGAATTACAATATTATTATTTGATCGTAATTTAAATACTTCATTTTTTGATCCAATAGGTGGAGGAGATCCAATTCTTTACCAACATTTATTTTGGTTTTTTGGCCATCCAGAAGTTTACATTTTAATTTTATCAGGATTTGGTATAATTTCTCATATGATTTATACTGAATGTGGGAAAAAAAATACTTTTGGTTCATTAGGAATAATTTATGCAATAATTTCTATTGGTATGTTAGGATTTATTGTTTGAGGTCATCATATATTTACTGTTGGAATAGATGATGATACCCGTGCCTATTATACTTCTGTAACTATAATTATTGCAATCCCAACTGGTATTAAAATTTTTAGATGATTAGCAACAATATATGGATCAAAAATTTTAATAAATTTATCAATAATTTGATCATTAGGATTTATTTTTTTATTTTCAATAGGTGGAGTTACAGGAATTACTTTATCTAATTCTTCTATTGATGTAATTTTACATGATACTTACTATGTAGTAGCT Parnips AATATTATATTTTATTTTTGGAATTTGATCAGGAATTATTGGGTCAGCATTAAGAATAATTATTCGAATAGAATTAGGGACTCCTGAACAATTAATTGGGAATGACCAAATTTATAATTCTATTGTGACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAGTAGGAGGGTTTGGAAATTATTTAGTTCCATTAATATTATCTGCCCCTGATATGGCTTTTCCTCGATTAAATAATATAAGATATTGATTATTAATCCCTTCTTTAATTTTATTAATAATAGGTATATTTGTTGATCAAGGAGCTGGGACTGGGTGAACTGTTTACCCTCCTTTATCAGCAAATTTAGGTCATCCAGGAGTTTCAGTTGATTTAACTATTTTTTCTTTACATTTAAGTGGAATTTCATCTATTTTAGGATCAATTAATTTTATTTCAACTATTTTAAATATACGACCTAATTATGTATCTATAGATAAAATTTCTTTATTTATTTGATCTATTTTATTAACAACTATTTTACTTTTATTGTCATTACCTGTATTGGCTGGAGGGATTACTATATTATTGTTTGATCGGAATTTAAATACTTCATTTTTTGATCCTTTAGGAGGTGGGGACCCTGTTTTATATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTATATATTTTAATTTTACCAGGATTTGGTATAATTTCCCATATAATTTATACAGAATGTGGAAAAAAAACTACATTTGGATCTTTAGGAATAATATATGCTATAATTTCTATTGGAATATTAGGGTTTATTGTTTGAGGCCATCATATATTTACGGTAGGTATAGATGTAGATACACGAGCTTATTATACTTCTGCTACTATGATTATTGCAGTTCCTACAGGAATTAAAATTTTTAGATGATTAGCAACAATATATGGATCAAAAATTAAATATAATTTATCAATAATATGAGCTATTGGATTTGTATTTTTATTTTCTATTGGAGGTATGACTGGAGTAACATTATCAAATTCTTCAATTGATATTATTTTACATGATACTTATTATGTAGTTGCT Pediaspis AATATTATATTTTATTTTTGGAACATGATCTGGAATAATAGGAAGTTCATTAAGAATAATTATTCGAATAGAATTAGGAATACCTGGACAATTAATTAGAAATGATCAAATTTATAATATAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATATTAGGAGGATTTGGTAATTATTTAATTCCTTTAATATTAATAAGACCAGATATATCTTTTCCTCGATTAAATAATTTAAGATTTTGATTATTAATTCCTTCTTTAATTTTATTAACATCAAGAATATTTATTGATCAAGGAGCTGGAACTGGTTGAACTATTTACCCTCCTTTATCTTCAAATATAGGTCATATAGGAATTTCTATGGATTTAATTATTTTTTCTTTACATATAAGTGGAATATCTTCAATTTTAGGTTCAATTAATTTTATTACTACTATTTTAAATATACGTCCATTAAATTTAACTATAGATAAAATTTCATTATTTACATGATCAATTTTATTAACAACAATTTTATTATTATTATCATTACCTGTTTTAGCTGGAGGAATTACAATATTATTATTTGATCGTAATTTAAATACTACTTTTTTTGATCCTATAGGAGGCGGAGATCCAATTTTATTTCAACATTTATTTTGATTTTTTGGACACCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATAATTACAAATGAATGTGGAAAAAAAACTACTTTTGGTTCTTTAGGAATAATATATGCTATAATTTCAATTGGTATATTAGGTTTTATTGTATGAGGACATCATATATTTACTGTAGGAATAGACATTGATACACGAGCTTATTATACATCAGCTACTATAATTATTGCAGTTCCAACAGGAATTAAAATTTTTAGATGATTAGCAACAATATATGGATCAAAAATTAAATTAAATATAATTATAATTTGATCTTTAGGTTTTATTTTTTTATTTTCAATTGGAGGAATAACAGGAGTAACTTTATCAAATTCATCAATTGATATTATTTTACATGATACATATTATGTTGTAGCT Periclistus ATTAATATATTTTATTTTAGGGATTTGATCAGGTATAATTGGGTCAAGATTAAGAATAATTATTCGATTAGAACTTGGTAATCCTTTACAATTAATTGGAAATGATCAAATTTATAATTCAATTGTAACTGTTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAGTTGGAGGATTTGGTAATTATTTAATTCCTATTATATTAATTACTCCTGATATGGCTTTTCCTCGATTAAATAATATAAGTTATTGACTTTTAATTCCCTCTTTATTATTAATATTATCTACAATATTTATTGATCAGGGTGCAGGAACAGGATGAACTGTTTATCCTCCTTTATCCTCAAATTTAGGTCATAATACAATTTGTGTAGATTTAATTATTTTTTCATTACATTTGACTGGTATTTCTTCAATTTTAGGAGGGATTAATTTTATCACTACAATTTTAAATATACGACCAAATTTAATATCTATAGATAAAATTACTTTATTTGTTTGATCTATTTTTTTAACAGTAATTTTATTAGTAGTTTCTCTCCCAGTATTAGCTGGTGGTATTACAATATTATTATTTGATCGAAATATAAATACTTCTTTTTTTGATCCATTAGGAGGTGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAGTATCTCATATAATTTATACTGAGTGTGGTAAAAAAGGTACTTTTGGATCTTTAGGAATAATATATGCAATAATTTCAATTGGATTATTAGGATTTGTTGTTTGAGGGCATCATATATTTACTATTGGTATAGATATTGACACGCGAGCTTATTATACTTCTGTAACAATAGTTATTGCTATTCCTACAGGAATAAAAATTTTTAGATGACTAGCAACAATATATGGTTCAAAAATTAATTGTAGGGTTCCTATATTTTGATCATTAGGTTTTATTTTTTTATTTTCATTTGGAGGATTAACAGGAATTACATTATCTAATTCTACTATTGATATTATATTACATGATACTTATTATGTAGTTGC? Phanacis_1 TATATTATATTTTGTATTTGGGATTTGATCAGGAATAATTGGGTCTGCTTTAAGTATAATTATTCGGATAGAATTAGGTACACCTTCCCAATTAATTGGGAATGATCAGATTTATAATGCTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAGTTGGAGGATTTGGGAATTATTTAGTCCCTTTAATATTAAGAGTTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATATTGATTATTAATCCCAGCTTTATTATTATTATTATCTAGAATAGTAGTTGATCAAGGGGCTGGGACAGGATGAACTGTGTATCCACCTTTATCTTCAAATATTGGTCATTTAGGTATTTCAGTAGATTTAACAATTTATTCATTACATATAAGAGGAATTTCATCAATTTTAGGATCAATTAATTTTATTACTACAATTTTAAATATACGACCTTTAAAAATAATAATAGATAAAGTTACTTTATTTGTTTGATCAATTTTTTCAACAACTATTTTATTATTATTATCTTTACCAGTTCTTGCTGGAGGTATTACTATATTATTATTTGATCGAAATTTAAATACTTCATTTTTTGACCCTATAGGAGGAGGAGACCCAGTATTATACCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATCTCTCATATAATTTATAATGAATGTGGTAAAAAAATTACTTTTGGATCATTAGGAATAATATACGCTATAATTTCAATTGGTATATTAGGATTTATTGTATGAGGTCACCATATATTTACTGTAGGGATAGATGTAGACACCCGAGCTTATTACACATCAGCTACAATAATTATTGCTATCCCTACTGGGATTAAAATTTTTAGTTGGTTAGCAACAATATATGGGGCTAAAGTAGATTTTAATTTATCAATAATATGAGCTTTAGGGTTTATTTTTTTATTTTCAATAGGGGGATTAACTGGAGTTACTTTATCAAATTCTTCTATTGATTTGATTTTACATGATACTTATTATGTAGTTGCT Phanacis_2 GGTATTATATTTTATTTTTGGGATTTGATCTGGTATAATTGGAACAGGATTAAGATTAATTATTCGTATAGAATTAGGGTCTCCTTCACAATTAATTGGGAATGATCAGATTTATAACTCAGTTGTTACTGCTCATGCATTTATTATAATTTTTTTTATGGTTATACCTATTATAGTAGGGGGGTTTGGGAATTATTTAATTCCATTAATATTAAGAATTCCTGATATAGCATTTCCTCGAATAAATAATATAAGATATTGATTATTAATCCCTTCATTAATGTTATTATTATCTAGGATAATTGTTGATCAAGGGGCTGGGACAGGATGAACTGTTTATCCTCCTTTATCTTCTAATATAGGGCATTTAGGAATATCAGTTGATTTAACTATTTACTCTTTACATATAAGGGGGGTTTCTTCTATTTTAGGATCAATTAATTTTATTACTACTATTTTAAATATACGACCCATAAAAATAACTATAGATAAAATTGCTTTATTTGTTTGATCGATTTTTTTAACAACAATTTTACTATTATTATCTTTACCTGTATTAGCGGGAGGAATTACAATATTATTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCTATAGGAGGGGGGGACCCTGTATTATACCAACATTTATTTTGATTTTTTGGGCATCCTGAAGTGTATATTTTAATTCTTCCAGGATTTGGGATAGTGTCTCATATAATTTTTACTGAATGTGGACAAAAAACTACTTTTGGATCATTAGGGATAATATATGCTATAATTTCAATTGGAATATTAGGATTTATTGTTTGAGGTCATCATATATTTACTGTTGGAATAGATGTAGATACACGAGCTTATTACACTTCAGCAACAATAGTAATTGCTATCCCAACTGGTATTAAAATTTTTAGATGGTTAGCTACTATATATGGATCAAAAGTAGAATTTAACCCTTCAATTATATGGGCTTTAGGGTTTATTTTTTTATTTTCAGTAGGGGGTTTAACAGGAGTAACTTTGGCTAATTCTTCAATTGATTTAATTATACATGATACATATTATGTAGTGGCT Plagiotrochus TATATTATATTTTATATCTGGAATCTGATCAGGATTAATTGGATCAAGATTAAGAATAATTATTCGAATAGAATTAGGAACCCCTTCACAATTAATTGGAAATGATCAACTCTATAACTCAATCGTAACTGCACATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAGTTGGAGGATTTGGTAATTATTTAATTCCTCTAATATTAATTGCTCCGGATATAGCATTCCCTCGTTTAAATAATATAAGATATTGATTATTAACTCCTGCTCTATTACTATTAATATCAAGAATATTTATTGATCAAGGAGCAGGAACAGGATGAACCATTTACCCCCCATTATCATCCAATTTAGGACATTCAGGAATTTCAGT?GATTTGACTATTTATTCTCTTCATATAAGAGGAATTTCTTCAATTTTAGGATCAATTAATTTCATTACAACAATTTTAAATATACGCCCTTATTTAATATCTATAGATAAAATTCCTCTTTTTGTATGATCAATTTTTTTAACTACAATTTTATTATTATTATCATTACCAGTATTAGCAGGTGCAATTACTATGTTACTTTTTGATCGAAATATAAATACTTCTTTTTTTGACCCAACTGGAGGAGGAGATCCTATCTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGGTTTGGAATAATTTCTCATATAATTTATTTGGAATGTGGAAAAAAAAATACTTTTGGATCATTAGGAATAATATATGCTATAAATTCAATTGGTATATTAGGATTTATTGTATGAGGTCATCATATATTAACTGTAGGCATAGATATTGATACACGAGCTTATTACACATCTGTAACTATAATTATTGCTATTCCTACAGGAATTAAAATTTTTAGATGATTAGCAACAATATATGGAACTAAAATAAATTTTAACTTATCAATTATATGAGCTCTAGGGTTTATCTTTTTATTTTCAATTGGAGGTATAACAGGAGTAACATTAGCAAATTCTTCTATTGATATTATTATACATGATACATATTATGTTGTAGC? Rhodus ATTACTTTATTTTTTATTCGGTATATGATCAGGAATAGTTGGAGCAAGATTAAGAGTTATTATCCGTATAGAACTAGGAACCCCCTCTCAACTACTTGAAAATGACCAAGTTTATAATTCAATTGTAACTGCTCATGCATTTATCATAATCTCCTTTATAGTCATACCAATTATAGTAGGAGGATTTGGTAATTATTTAACTCCTCTAATATTATCCTCACCAGACATAGCTTTCCCTCGATTAAATAATATAAGATTCTGATTATTAATCCCAGCATTATTATTATTATTATCTAGAATACTTATTGATCAAGGGGCTGGAACAGGATGAACAATTTACCCCCCATTATCTTCAACCATAGGCCATAATAGAATCTCTATAGATTTAGTTATTTACTCTCTTCATATAAGTGGAATTTCCTCTATTTTAAGATCTATCAATTTTATTACAACTATTTTAAATATACGCCCCCCTATAATCAGAATAGATAAATTATCATTATTTTTATGGTCCATTTTATTAACTACTATTTTATTATTACTTTCCTTACCCGTCTTAGCTGGTGGAATTACAATATTACTTTTTGATCGAAATTTTAATACCTCCTTTTTTGACCCTATAGGAGGTGGAGACCCAATCTTATTCCAACATTTATTTTGATTCTTTGGTCACCCTGAAGTCTATATCTTAATTTTACCTGGATTTGGTATAATCTCTCATATAATTTATATAGAATGTGGAAAACCCACAACCTTTGGTTCATTAGGTATAATATACGCAATAATTTCAATTGGAATATTAGGATTTATCGTATGAGGACATCATATATTTACTGTAGGAATAGATGTAGACACCCGAGCATATTACACATCCGCTACCATAATTATTGCAATTCCTACTGGAATTAAAATTTTTAGGTGATTAGCTACAATATACGGATCAAAAATTAATTTTAATTTATCCATTATATGATCCTTAGGATTTATTTTTTTATTTTCTTTAGGAGGATTAACAGGGGTTACTTTAGCAAATTCTTCAATTGACATTATTTTACATGATACTTACTATGTAGTAGCC Synergus TATACTATACTTTATATTTGGTATTTGAACTGGAATAATTGGATCAGCATTAAGATTAATTATTCGTATAGAATTAAGATCAACATTACAATTAATTAATAATGATCAAATTTATAATTCAATTGTAACTGCTCATGCATTTATCATAATTTTTTTTATAGTAATACCAATTACAATTGGAGGATTTAGAAATTACCTAATTCCATTAATATTAAGAACTCCTGATATAGCTTTCCCACGACTTAATAATATAAGATTTTGATTATTAATCCCATCTTTAATTTTATTAACATCAAGTATATTTATTGACCAAGGAGCTGGAAGAGGTTGAACAGTTTATCCACCTTTATCTTCAAATTTAGGACATCCAGGAATTTCAGTAGATTTAGCTATTTATTCATTACATATATCAGGAATTTCATCAATTTTAGGTTCAATTAATTTTATTACCACAATTTTAAATATACGTCCTAATTTTATAATAATAGATAAAATTTCACTATTTATTTGATCAATTTTACTAACTACAATCTTATTATTATTATCATTACCTGTTCTAGCTGGAGGAATTACAATATTATTATTCGATCGTAATATAAACACATCATTTTTTGACCCTATAGGAGGAGGAGACCCTATCTTATATCAACACTTATTTTGATTTTTTGGTCACCCCGAAGTATATATTTTAATTTTACCAGGTTTTGGAATAATTTCACATATAATTTACATAGAATCAGGAAAAAAAATAACTTTTGGATCTTTAGGAATAATATATGCAATAATTTCAATTGGAATTTTAGGATTTATTGTATGAGGGCATCATATATTTACAGTAGGTATAGATGTAGATACTCGAGCTTATTACACATCTGCGACTATAATTATTGCTATCCCAACAGGTATTAAAATTTTTAGTTGATTAGCAACTATATATGGGTCAAAAATTAAATTTAATTTATCTATAATTTGATCTATAGGATTTATTTTTTTATTTTCATTTGGAGGAATAACAGGAATTACTTTAGCAAATTCTTCGATTGATATTATAATACATGATACTTATTATGTAGTAGCC Synophromorpha AATACTATATTTTATTTTTGGAATTTGATCTGGTATAATTGGATCTAGATTAAGAATAATTATTCGAATAGAACTTGGTAATCCATCTCAATTAATTGGAAATGATCAAATTTATAATTCAATTGTTACAATTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAGTTGGTGGATTTGGAAATTATTTAATTCCTTTAATATTATCAGTTCCTGATATAGCTTTTCCACGAATAAATAATATAAGGTATTGACTTTTAATTCCTTCATTATTATTAATAGTATCAAGAATATTTATTGATCAAGGAGCAGGAACAGGATGAACTGTGTATCCTCCTTTATCTTCAAATTTAGGTCATAATGGAATATCAGTTGATTTAGTAATTTTTTCTTTACATTTAAGAGGTATTTCTTCAATTTTAGGTTCAATTAATATTATTACTACAATTTTAAATATACGACCTTATTTAATATGTATAGATAAAATTACTTTATTTATTTGATCTTTTATTTTAACAACAATTTTATTATTATTATCATTACCTGTATTAGCAGGAGGAATTACAATATTATTATTTGATCGAAATATAAATTCTTCTTTTTTTGATCCATTAGGAGGTGGTGATCCTATTCTTTATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATAATTTGTGTAGAATGTGGAAAAAAAAATACTTTTGGTTCATTAGGAATAATATATGCTATAATTTCTATTGGTATATTAGGATTTATTGTTTGAGGACATCATATATTTACTGTAGGAATAGATATTGATACACGAGCTTATTATACATCTGTAACTATAATTATTGCAATTCC{CT}ACGGGAATTAATATTTTTAGATGATTAGCTACAATATATGGATCAAAAATTAATTTTAATTTATCAATTATATGATCATTAGGTTTTATTTTTTTATTTTCAATTGGAGGAATAACAGGAGTAACTTTACCTAATTCTTCAATTGATATTATTTTACATGATACTTATTATGTAGTGGCT Timaspis AATATTATATTTTATTTTTGGTATTTGATCTGGAATAATTGGATCAGCTTTAAGAATAATTATTCGTATAGAATTAGGGACTCCTTCACAATTAATTGGTAATGATCAAATTTATAATTCAGTAGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAGTAGGAGGATTTGGTAATTATTTAATTCCTTCAATATTAAGAATTCCCGATATAGCTTTCCCTCGAATAAATAATATAAGTTATTGGTTATTAATCCCTTCTTTATTTTTATTATTATCAGGGATATTTATTGATCAAGGGGCTGGAACAGGATGAACTGTATATCCTCCTTTATCTTCAAATATAGGTCATTTAGGTTTATCAGTAGATTTAACTATTTATTCTTTACATATAAGAGGGGTATCTTCAATTTTAGGGTCTATTAATTTTATTACAACAATTTTAAATATACGACCTTTAATAATATCAATAGATAAAATTTCTTTATTTGTATGATTTATTTTTTTAACAACTATTTTATTACTATTATCTTTACCTGTTTTAGCAGGAGGGATTACAATATTATTATTTGATCGAAATTTAAATACTTCTTTTTTTGACCCTATAGGAGGAGGAGATCCTGTATTATATCAACATTTATTTTGATTTTTTGGCCATCCAGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCACATATAATTTACACAGAATGTGGGAAAAAAATTACTTTTGGATCTTTAGGAATAATATATGCAATAATTTCTATTGGAATATTAGGGTTTATTGTATGAGGCCATCATATATTTACTGTAGGCATAGATGTTGATACTCGAGCTTATTACACTTCTGCAACTATAATTATTGCTATTCCAACAGGTATTAAAATTTTTAGATGATTAGCAACAATATATGGATCAAAATTAAATTTTAGTTTATCTATAATTTGATCTTTAGGTTTTATTTTTTTATTTTCTATAGGAGGATTAACTGGTGTAACATTATCAAATTCATCAATTGATTTAATATTACATGATACTTATTATGTTGTAGCT Xestophanes AATATTATATTTTATTTTTGGAATTTGATCTGGTATAATTGGATCTAGATTAAGAATAATTATTCGAATAGAACTTGGAATTCCTACACAATTAATTGGTAATGACCAAATTTATAATTCAATTGTAACAATTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAGTAGGAGGATTTGGAAATTATTTAATTCCTTTAATATTATCTGTACCTGATATAGCTTTTCCTCGAATAAATAATATAAGATATTGACTTTTAGTCCCTTCTTTATTATTAATAATATCTAGAATATTTATTGATCAAGGAGCAGGTACAGGATGAACTATTTATCCTCCTTTATCTTCAAATTTAGGACATAATGGTATTTCAGTTGATTTAGTAATTTTTTCTTTACATTTAAGAGGAATTTCATCAATTATAGGATCAATTAATATTATTACTACAATTTTAAATATACGACCATATTTAATATATATAGATAAAATTACTTTATTTATTTGATCTTTATTTTTAACTACAATTTTATTATTATTATCATTACCTGTATTAGCTGGGGGAATTACAATATTATTATTTGATCGAAATATAAATTCTTCTTTTTTTGATCCATTAGGAGGAGGAGACCCTATTCTTTATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCGGGATTTGGTATAATTTCTCATATAATTTTTATAGAATGTGGAAAAAAAAATACTTTTGGTTCTTTAGGAATAATTTATGCTATAATTTCTATTGGAATATTAGGATTTATTGTTTGAGGGCATCATATATTTACTGTAGGAATAGATATTGATACACGAGCTTATTATACTTCTGTAACTATAATTATTGCAATTCCTACTGGAATTAAAATTTTTAGATGATTAGCTACAATATATGGATCAAAAATTAATTTTAATTTATCAATTAAATGATCATTAGGATTTATTTTTTTATTTTCAATTGGAGGAATAACAGGAGTAACTTTATCTAATTCTTCTATTGATATTATTTTACATGATACTTATTATGTAGTAGCT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M137] TITLE EF1aF1; LINK TAXA = Taxa1; DIMENSIONS NCHAR=367; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Andricus AATCGACATTGCTCTCTGGAAATTTGAAACAGCGAAATATTACGTGACCATCATTGATGCACCAGGACATCGTGATTTCATCAAAAACATGATCACTGGAACGAGTCAAGCTGATTGTGCTGTGCTGATCGTAGCAGCTGGAATTGGAGAATTCGAGGCTGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACTCTGGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATGGATATGACCGATCCACCATATTCTGAAAGTCGTTTTGAAGAAATCAAGAAAGAGGTTTCCTCATACATCAAGAAAATTGGTTACAATACTTCTTCGGTTGCATTTGTTCCAATTTCT Antistrophus TATCGACATTGCTCTGTGGAAATTTGAAACTGCCAGGTACTACGTGACCATCATTGATGCTCCAGGACATCGTGATTTCATAAAAAACATGATCACTGGTACGAGTCAAGCTGATTGTGCTGTGCTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCTAAAAATGGTCAAACTCGAGAGCATGCTTTATTGGCTTTCACCCTCGGAGTAAAGCAGTTGATTGTGGGAGTCAATAAGATGGATATGACTGATCCACCGTACTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAAGTTTCTTCATACATCAAGAAAATTGGTTATAATACTGCGTCAGTTGCATTTGTTCCAATTTCT Aulacidea TATCGACATTGCTCTGTGGAAATTTGAAACTGCCAAGTACTACGTGACCATCATTGATGCACCAGGACATCGTGATTTCATAAAGAACATGATTACTGGTACGAGTCAAGCTGATTGCGCTGTGCTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCAAAAAATGGTCAAACTCGAGAGCATGCTTTATTGGCTTTCACCCTCGGAGTGAAGCAATTGATTGTCGGAGTCAATAAGATGGATATGACTGATCCACCATACTCTGAGAGCCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTATAATACTGCATCGGTTGCATTTGTTCCAATTTCT Aylax GATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTAACCATCATCGATGCACCAGGACATCGTGATTTCATCAAAAACATGATCACTGGAACGAGTCAAGCTGATTGTGCAGTACTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGTATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTTACTCTAGGAGTGAAGCAATTGATTGTAGGGGTCAACAAGATGGATATGACTGATCCTCCATATTCTGAAAGTCGATTTGAAGAAATAAAGAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTACAATACTGCTTCGGTTGCATTTGTTCCAATTTCT Barbotinia GATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTAACCATCATCGATGTACCAGGACATCGTGATTTCATCAAAAATATGATCACTGGAACGAGTCAAGCTGATTGTGCAGTGCTGATTGTAGCGGCTGGAATTGGAGAATTCGAAGCTGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACTCTGGGAGTGAAGCAGTTGATTGTAGGGGTCAACAAGATGGATATGACTGATCCTCCATATTCTGAAAGTCGATTTGAAGAAATAAAGAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTACAATACTGCTTCGGTTGCATTTGTTCCAATTTCT Biorhiza AATCGATATTGCTCTCTGGAAATTTGAAACGGCGAAATATTATGTTACCATAATTGATGCACCAGGACATCGTGATTTCATCAAAAACATGATCACTGGAACGAGTCAAGCTGATTGTGCTGTACTGATAGTAGCAGCTGGAATTGGAGAATTCGAGGCTGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACTCTGGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATGGATATGACTGATCCACCATATTCTGAGAGTCGATTTGAAGAAATAAAAAAAGAGGTTTCCTCATACATCAAGAAAATTGGTTACAATACTTCTTCGGTTGCATTTGTTCCAATTTCT Ceroptres ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Diastrophus GATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTATGTGACTATCATTGATGCACCAGGACATCGTGATTTCATCAAAAACATGATCACTGGAACAAGTCAGGCTGACTGTGCAGTGCTGATCGTAGCTGCTGGAATTGGAGAATTTGAAGCTGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACACTGGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATGGGCATGACTGATCCACCATATTCTGAGAGTCGATTTGAAGAAATCAAGAAAGAGGTGTCTTCATACATCAAGAAAATTGGTTTCAATACTGCTTCGGTTGCATTTGTTCCAATTTCT Diplolepis CATTGATATCGCTCTTTGGAAATTCGAAACAGCCAAATATTACGTGACCATCATCGATGCACCAGGACATCGTGATTTTATAAAAAACATGATTACTGGAACAAGTCAAGCTGATTGTGCAGTGTTAATAGTAGCAGCTGGAATAGGAGAATTCGAAGCTGGAATTTCAAAAAATGGCCAAACTCGTGAACATGCTCTACTTGCTTTTACCTTGGGAGTAAAGCAATTGATTGTCGGAGTCAATAAAATGGATATGACTGACCCACCATATTCAGAGAGCCGATTTGAAGAAATCAAAAAAGAAGTTTCTTCATACATCAAGAAAATTGGTTACAATACAGCTTCAGTTGCATTTGTTCCCATTTCT Eschatocerus AATCGATATTGCTCTCTGGAAATTTGAAACGGCGAAATATTATGTTACCATAATTGATGCACCAGGACATCGTGATTTCATCAAAAACATGATCACTGGAACGAGTCAAGCTGATTGTGCTGTACTGATAGTAGCAGCTGGAATTGGAGAATTCGAGGCTGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACTCTGGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATGGATATGACTGATCCACCATATTCTGAGAGTCGATTTGAAGAAATAAAAAAAGAGGTTTCCTCATACATCAAGAAAATTGGTTACAATACTTCTTCGGTTGCATTTGTTCCAATTTCT Gonaspis GATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTGACCATCATTGATGCACCAGGACATCGTGATTTCATCAGAAACATGATCACTGGAACAAGTCAGGCTGACTGTGCAGTGCTGATCGTAGCTGCTGGAATTGGAGAATTTGAAGCTGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACACTGGGAGTTAAGCAATTGATTGTGGGAGTCAATAAGATGGACATGACTGATCCACCATATTCTGAGAGTCGATTTGAAGAAATCAAGAAAGAGGTGTCATCATACATCAAGAAAATTGGTTACAATACTGCTTCGGTTGCATTTGTTCCAATTTCT Hedickiana TATCGACATTGCTCTGTGGAAGTTTGAAACTGCCAAGTACTACGTGACCATAATTGATGCACCAGGACATCGTGATTTTATAAAAAACATGATCACTGGTACGAGTCAAGCTGATTGTGCTGTGCTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCCAAAAATGGTCAAACTCGAGAGCATGCTTTATTGGCTCTCACCCTTGGAGTAAAGCAGTTGATTGTGGGAGTCAATAAGATGGATATGATTGATCCACCATACTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTATAATACTGCGTCGGTTGCATTTGTTCCAATTTCT Ibalia CATCGACATTGCTCTCTGGAAATTTGAAACAGCCAAATATTACGTAACCATTATCGATGCACCAGGACATCGTGATTTCATAAAAAACATGATCACTGGAACAAGTCAAGCTGATTGTGCAGTTTTGATAGTAGCAGCAGGAATTGGAGAATTCGAAGCAGGAATTTCAAAGAATGGTCAAACTCGTGAACATGCTCTTTTAGCTTTCACCCTGGGAGTGAAACAATTGATTGTTGGAGTCAACAAGATGGATATGACTGATCCACCATATTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAGGTATCTTCATACATCAAGAAAATTGGCTACAATACTGCTTCAGTTGCATTTGTTCCCATTTCT Iraella GATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTAACCATCATCGATGCACCAGGACATCGTGATTTCATCAAAAACATGATCACTGGAACGAGTCAAGCTGATTGTGCAGTGCTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGTATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACTCTGGGAGTAAAGCAATTGATTGTAGGGGTCAATAAGATGGATATGACTGATCCTCCATATTCTGAAAGTCGATTTGAAGAAATTAAGAAAGAAGTTTCTTCATACATCAAGAAAATTGGTTACAATACTGCTTCGGTCGCATTTGTTCCAATTTCT Isocolus TATCGACATTGCTCTGTGGAAATTTGAAACTGCCAAGTACTACGTGACCATCATTGATGCACCAGGACATCGTGATTTCATAAAAAACATGATCACTGGTACTAGTCAAGCTGATTGTGCTGTGCTGATTGTAGCAGCTGGAATTGGGGAATTCGAAGCTGGAATATCCAAAAATGGTCAAACTCGAGAGCATGCTTTATTAGCTTTCACCCTGGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATGGATATGACTGATCCACCATACTCCGACAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTATAATACTGCGTCGGTTGCATTTGTTCCAATTTCT Liposthenes_gle TATCGACATTGCTCTGTGGAAATTTGAAACAGCCAAGTACTACGTGACCATCATTGATGCACCAGGACACCGTGATTTCATAAAAAACATGATCACTGGTACGAGTCAAGCTGATTGTGCTGTGCTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCCAAAAATGGTCAAACTCGGGAGCATGCTTTATTGGCTTTCACCCTTGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATGGATATGACTGATCCACCATACTCTGAGAGTCGATTCGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTATAATACTGCGTCGGTTGCATTTGTTCCAATTTCT Liposthenes_ker TATTGACATTGCTCTGTGGAAATTTGAAACTGCCAAGTACTACGTGACCATCATTGATGCACCAGGACATCGTGATTTCATAAAAAACATGATCACTGGTACGAGTCAAGCTGACTGTGCTGTGCTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATATCCAAAAATGGTCAAACTCGAGAACATGCTTTATTGGCTTTCACCCTCGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATGGATATGACTGATCCACCATACTCTGAGAGTCGCTTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGCTATAATACTGCGTCGGTTGCATTTGTTCCAATTTCT Neaylax TATCGACATTGCTCTGTGGAAGTTTGAAACTGCCAAGTACTACGTGACCATAATTGATGCACCAGGACATCGTGATTTCATAAAAAACATGATCACTGGTACGAGTCAAGCTGATTGTGCTGTACTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGGATTTCCAAAAATGGTCAAACTCGGGAGCATGCTTTATTAGCTTTCACCCTCGGTGTAAAGCAGTTGATTGTGGGAGTCAATAAGATGGATATGACTGATCCACCATACTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTATAATACTGCGTCGGTTGCATTTGTTCCAATTTCT Neuroterus AATCGACATCGCTCTCTGGAAATTTGAAACGGCGAAATATTATGTGACCATAATTGATGCACCAGGACATCGTGATTTTATCAAAAACATGATCACTGGAACGAGTCAAGCTGATTGTGCTGTACTGATCGTAGCAGCTGGAATTGGAGAATTCGAGGCTGGGATTTCGAAAAATGGTCAAACTCGTGAGCATGCTTTATTGGCTTTCACTCTGGGAGTGAAACAATTGATTGTAGGAGTCAATAAGATGGATATGACCGATCCACCATATTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCCTCGTACATCAAGAAGATTGGTTACAATACTTCTTCGGTTGCATTTGTTCCAATTTCT Panteliella TATCGACATTGCTCTGTGGAAATTTGAAACTGCCAAGTACTACGTAACCATCATTGATGCACCAGGGCATCGTGATTTCATAAAAAACATGATCACTGGTACGAGTCAAGCTGATTGTGCTGTGCTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCCAAAAATGGTCAAACTCGAGAACATGCTTTATTGGCCTTCACCCTTGGAGTGAAGCAATTGATTGTGGGAGTTAATAAGATGGATATGACTGATCCACCATACTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTATAATACTGCGTCGGTTGCATTTGTTCCAATTTCT Paramblynotus CATAGACATCGCTCTCTGGAAATTCGAAACAGCCAAGTATTACGTAACCATCATCGATGCACCGGGACATCGTGATTTCATAAAGAACATGATTACTGGAACTAGTCAGGCTGACTGTGCAGTTTTGATAGTAGCTGCAGGAATTGGAGAATTCGAGGCTGGAATTTCAAAGAATGGCCAAACTCGTGAACATGCCCTTTTGGCGTTCACCTTAGGAGTGAAGCAATTGATTGTTGGAGTCAACAAGATGGACATGACTGATCCACCTTATTCTGAAAGTCGTTTTGAGGAGATCAAGAAAGAGGTTTCCTCATACATCAAGAAGATTGGCTACAATACAGCATCAGTTGCATTTGTACCAATTTCT Parnips CATTGACATTGCTCTTTGGAAATTCGAAACAGCCAAGTATTACGTTACCATCATCGATGCACCAGGTCATCGTGATTTCATAAAAAACATGATCACTGGAACGAGTCAAGCTGATTGTGCAGTTTTAATAGTAGCAGCAGGAATTGGAGAATTCGAAGCTGGAATTTCAAAGAATGGTCAAACTCGTGAACATGCTCTTTTGGCTTTCACCCTAGGAGTGAAGCAATTGATCGTTGGAGTCAATAAGATGGATATGACTGACCCACCATATTCTGAGAGCCGATTTGAGGAAATAAAAAAGGAAGTTTCTTCATACATCAAGAAAATTGGCTACAATACTGTTTCGGTTGCATTTGTTCCCATTTCT Pediaspis TATCGACATTGCCCTCTGGAAATTCGAGACAGCCAAGTATTACGTAACCATCATCGATGCACCAGGACATCGTGATTTCAT?AAAAATATGATTACTGGGACGAGTCAAGCTGATTGTGCAGTTCTGATAGTAGCAGCTGGAATAGGAGAATTCGAAGCTGGAATTTCCAAAAATGGTCAAACTCGTGAACATGCTCTACTGGCCTTCACCTTGGGAGTGAAGCAATTGATCGTTGGAGTCAATAAGATGGATATGACTGACCCACCATATTCTGAAAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAAAAAATTGGTTACAATACAGCTTCGGTTGCATTTGTTCCCATTTCT Periclistus GATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTGACCATCATTGATGCACCAGGACATCGTGATTTCATCAAAAACATGATCACTGGAACAAGTCAGGCTGACTGTGCAGTGCTGATCGTAGCTGCTGGAATTGGAGAATTTGAAGCTGGAATCTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACCTTGGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATGGATATGACTGATCCGCCATATTCTGAGACTCGATTTGAAGAAATCAAGAAAGAGGTGTCTTCATACATCAAGAAAATTGGTTACAATACTGCTTCGGTAGCATTTGTTCCAATTTCT Phanacis_1 AATCGACATTGCTCTGTGGAAATTTGAAACTGCCAAGTATTACGTGACAATCATTGATGCACCAGGGCATCGTGATTTTATTAAAAACATGATCACTGGAACAAGTCAAGCCGATTGTGCAGTGCTGATCGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCAAAAAATGGCCAAACTCGAGAACATGCTTTATTGGCTTTCACTCTGGGAGTGAAGCAACTGATTGTAGGTGTCAATAAGATGGACATGACTGATCCACCATATTCTGAAAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAAAAAATTGGATACAATACTGCTTCGGTTGCATTTGTTCCAATTTCT Phanacis_2 AATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTATGTAACGATCATTGATGCACCAGGCCATCGTGATTTTATTAAAAACATGATCACTGGAACAAGTCAAGCTGACTGTGCAGTGCTGATCGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCCAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACTCTGGGAGTGAAGCAACTGATTGTGGGTGTCAATAAGACGGACATGACTGACCCACCATATTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAAAAAATTGGATACAATACTGCTTCGGTTGCATTTGTTCCAATTTCT Plagiotrochus GATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTCACCATCATTGATGCACCAGGACATCGTGATTTCATCAAAAACATGATCACTGGAACGAGTCAAGCTGATTGTGCAGTGCTGATTGTGGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTCTCACTCTTGGAGTGAAGCAATTAATTGTAGGAGTTAATAAGATGGATATGACTGATCCGCCATATTCTGAGAGTCGATTTGAAGAAATCAAGAAAGAGGTGTCTTCATACATAAAGAAAATTGGTTACAATACTGCCTCGGTTGCATTTGTTCCAATTTCA Rhodus TATCGACATTGCTCTGTGGAAGTTTGAAACTGCCAAGTACTACGTGACCATAATTGATGCACCAGGACATCGTGATTTCATAAAAAACATGATCACTGGTACGAGTCAAGCTGATTGTGCTGTGTTGATTGTAGCAGCTGGAATTGGAGAATTCGAAGCTGGAATTTCCAAAAATGGTCAAACTCGAGAGCATGCTTTATTGGCTTTCACCCTCGGAGTAAAGCAGTTGATTGTGGGAGTCAATAAGATGGATATGACTGATCCACCATACTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTATAATACTGCGTCGGTTGCATTTGTTCCAATTTCT Synergus GATCGACATTGCTCTCTGGAAATTCGAAACCGCCAAGTACTACGTAACCATCATTGATGCACCAGGTCATCGTGATTTCATAAAAAACATGATTACGGGAACGAGTCAAGCTGATTGTGCAGTGCTGATTGTAGCAGCTGGAATTGGTGAATTCGAAGCTGGAATTTCGAAAAATGGTCAGACTCGTGAACATGCTTTATTGGCTTTCACCCTGGGAGTGAAGCAATTGATTGTGGGAGTCAACAAGATGGATATGACTGATCCACCATATTCTGAGAGTCGATTCGAAGAAATAAAAAAAGAGGTTTCTTCATACATCAAGAAAATTGGTTACAATACCGCTTCAGTTGCATTTGTTCCAATTTCT Synophromorpha GATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTGACCATCATTGATGCACCAGGACATCGTGATTTCATCAAAAACATGATCACTGGAACAAGTCAGGCTGACTGTGCTGTGCTGATCGTAGCAGCTGGAATTGGAGAATTTGAAGCCGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCATTATTGGCTTTCACCCTGGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATGGATATGACTGATCCACCATATTCTGAGAGTCGATTTGAAGAAATCAAGAAAGAGGTGTCTTCATACATCAAGAAAATTGGTTACAATACTGCTTCGGTTGCATTTGTTCCAATTTCT Timaspis AATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTGACAATCATTGATGCACCAGGGCATCGTGATTTTATCAAAAACATGATCACTGGAACAAGTCAAGCTGACTGTGCAGTGCTAATCGTAGCAGCTGGAATTGGAGAATTTGAAGCTGGAATTTCAAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACTCTGGGAGTGAAGCAACTGATTGTGGGTGTCAATAAGATGGACATGGCTGATCCATCATATTCTGAGAGTCGATTTGAAGAAATCAAAAAAGAGGTTTCTTCATACATCAAAAAAATTGGATACAATACTGCTTCGGTTGCATTTGTACCAATTTCT Xestophanes GATCGACATTGCTCTCTGGAAATTTGAAACTGCCAAGTATTACGTGACAATCATTGATGCACCAGGACATCGTGATTTCATCAAAAACATGATCACTGGAACAAGTCAGGCTGACTGTGCTGTGCTGATCGTAGCAGCTGGAATTGGAGAATTTGAAGCTGGAATTTCGAAAAATGGTCAAACTCGTGAACATGCTTTATTGGCTTTCACTCTGGGAGTGAAGCAATTGATTGTGGGAGTCAATAAGATGGATATGACTGATCCACCATATTCTGAGAGTCGATTTGAAGAAATCAAGAAAGAGGTGTCTTCATACATCAAGAAAATTGGTTACAATACTGCTTCGGTTGCATTTGTTCCAATTTCT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M700] TITLE 28S; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1154; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Andricus -----------------------------------ATACAACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-ACGATGTT--CGAGACTTT----GGTCTTG-CG--CACGCGTCCACTGCGGT-ATGTCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTCCGTCGCAT--TTTATGCGC--ACGGAGCAGACCCCCGTGT--ACCCGACCAACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTTA---CGTGCGTCGGGCCCGTCGCAAGCGAGATCA-GTGTT-ACCCGGAGGTGCGGACCTAGTGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCGGACAGGCTCAT--CCAAAAT---------GATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGATGGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Antistrophus CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GTGATGCT--CGAGATTTT----TGTCTCGTAG--CACATGTCCACTGCGTT-ATGTCTGGAGTC-GTCGGTGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTTCGTCGCAT--TT-ATGCGT--ACGGTTCAGACCCCCGGGTT-TCCTGACCAACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCATTA----TGTGCGTCGGTCCCGCCGCAAGCGAGATCAG-TGTT-TCCCGGAGGTGCGGACCTAGAGCCGTCCCCGGGCCTGGTCAGCTGTTGGTT-GGCGGTGT-TCTTAGACAGGCTCA---TA-GAAAA-------TGATACCGGTCGACGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGATGGGTT-GCGTTACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACACATTACGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAAAA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Aulacidea ---------------------------------------------ACAACTGGCGCTG--AAG?TACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTAT-GCGATGTT--CGGGATTTC----GGTCTCGTAG--CACGCGTCCACTGCGGT-ATGTCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTAG-GTG-GTTGCCTGTTCCGTCACAT--TT-ATGCGT--ACGGTGCAGACCCCTGGCT--ACCTGACCAACTGCCCGGCGGTACTCGCACGGTA-TTGGGCCGCACTA----TGTGCGTCGGACCCGCCGCAAGCGAGATCAG-TGTTTTCCCGGAGTTACGGAGCTAGTGCCGTTCCCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCAGACAGGCTCAT--CAAAATATTA-----TGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACAG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGATGGGTT-ACGTTACGATGTAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTATGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Aylax CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAT-AACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAACGGCTTTGGCTTTCGTGTGGTTC-GCGATGTT--CGGGTCTTC----GGTCTCGCAG--CACGCGTCCACTGCGGT-ATGTCTGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTTCGTCGCAT--TTTATGCGT--ACGGAGCAGACCCCTGGTA--ACCCGACCAACTGCTCGGCGGTACTCGCACGGTA-TCGAGCCGCACTA----TGTGCGTCGGGCCCGTCGCAAGCGAGATCAG-TGTT-ACCCGGATGTGCGGACTTAGTGCCGTCACCGGGCCTGGTCAGCTGTTGGCC-GACGGTGT-TCTCGGACTGGCTCAT--TT---ATA-------TGATACCGGTCAGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGATGGGTT-GCGTTACGATGTAACCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCATTTTT Barbotinia ------------------------------------------CACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAACGGCTTTGGCTTTCGTGTGGTTC-GCGATGTT--CGGGACTTC----GGTCTCGCAG--CACGCGTCCACTGCGGT-ATGTCTGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTCCGTCGCAT--TTTATGCGT--ACGGAGCAGACCCCTGGTA--ACCCGACCAACTGCTCGGCGGTACTCGCACGGTA-TCGAGCCGCACTA----TGTGCGTCGGGCCCGTCGCAAGCGAGATCAG-TGAT-ACCCGGATGTGCGGACCTAGTGCCGTCACCGGGCCTGGTCAGCTGTTGGCC-GACGGTGT-TCTCGGACAGGCTCAT--TC---ATA-------TGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTACGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGATGGGTT-ACGTTACGATGTAACCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCATTTTT Biorhiza ----------------------------------------------AGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTCTGGCTTTCGTGTGGTTC-ACGATGTT--TGAGACTTT----GGTCTTA-GG--CACGCGTCCACTGCGGT-ATGTCTGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTACGTCGCAT--TTTATGCGC--ACGGAGCAGACCCCCGTGT--ACCCGACCAACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTTA---CGTGCGTCGGGCCCGTCGCAAGCGAGATCA-GTGTT-ACCCGGAGGTGCGGACCTAGTGCCGTCCCTGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCGGACAGGCTCAT--CCAAAAT---------GATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGATGGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Ceroptres CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCCTTGGCTTTCGTGTGGTTT-GCGATGTT--CGGGGCTTC----GGTCTCGCGA--CACGCGTCCACTGCGGT-ATGTTCTTGGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGCCTGGTGTG-GTTGCCTGTTTCGTCGCACAATTTATTTGTGCACGGAGCAGACCCCCGGAT--ACCCGACCAACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTTT---TGTGCGTCGGGCCCGTCGCAAGCGAGATCAG-TGTT-ACCCGGATGTGCGGACCTAGTGCCGTCGCCGGGCCTGCTCAGCTGTTGGTC-GGCGGTGT-TCTCGGACTGGCTCAA--AATTAT----------GTTACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGATGGGTT-GCGTTACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCTAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Diastrophus ------------------------------------------------ACCGAT?GCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGACTCTGGCTTGCGTGTGGTTC-GCGATGCT--CGGGACTTC----GGTCTCGCAG--CACGCGTCCACTGCGGT-ATGTCTAGGGCC-GTCGGCGTGCACTTCTCCTCTAGTAGGACGTTACGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGCTTTGTCGCAC--TCTGT--GTGTACGGAGTAGACCCCCGGTT--ACCTAACCAACTGCCCGGCGGTCCTCGTACGGTA-TCGGGCCGCACTCT----GTGCGTCGGGCCCGTCGCAAGCGCGAGCAG-TGTT-ACCTGGATGTGCGGACCTAGTGCCGTCACCGGGCCTGATCAGCTGTTGGTC-GACGGTGT-TCTCGGACTGGCTCAA--------------------TACCGGTCAGTGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCATGCGTCCACTAAGGGAGGATGGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAATA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Diplolepis ----------------------------------ATAT-AACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGGTCGAATGG-GAGACTCATCGTCAATAACTTTGGCTTTCGTGTGATTA-GTGATGTT--CGTAATTTC----GATTACGTGG--CACACTGTCACTGCGGT-ATGTCTGAAGTTTGTCGGCGTGCATTTCTCCCTT-GTAGGACGTCGCGACCCGTTGGG-TGTCGGTTT--ACGGTCTAG-GTG-GTTGACTGTTTTGTCAAAA--TTTTTTTGT--ATAAAGCAGACCCCTGGAT--ACCTGACCGACTGCCCGGCGGTATTTGAACGGTAATCGAGCCGCACATA---AGTGCGTCAGGCCCACTGCAAGCGAGATCAG-TGTTAACCTGGAGGTGCGGACCTAGTGCCGTCCCCAGGCCTGGTCAGCTGTTGGTC-GGTGGTGT-TCTCGGACTGGCTCAT--AATTATA----------ATACCGGTCAGCGACGCTATTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACTT--GAAAACCTAAAGGCATAATGAAAGTGAAGGTCGGCCTTGCGTCGACTGAGGGAGGATGGACT-GTATTACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTACGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGAGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-TTGAAGCCATGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Eschatocerus CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAT-AACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGAGGAGATTCATCGTCAATGTTTTTGGCTTTCCTGTGATTTAGTGATGTTT-TATAATCTTTTTAGATTATATGATACACACAATCACTGCGGT-ATGTCTAAATTCTGTCGGCGTGCACTTCTCCTCTAGTAGGACGTCGCGACCCGTTAGAATATTGATTT--ACGGCATAAATTTGATTGTTTGTATTAT-ATATA-TTTATTTATATATAATATATATCATAAATTT-GT?TAATCAATTGTCTGACGGTACTAATAAGGGTATTGGGCCGCATTTTTAATATGCGTCTAATCCGTTACAAGCTAGAATTAGTGTT-ACTTAGTTTTACGAACCAAGTTTCGTTTCTGAGCCTAATCAGCTGTTGGTTTAGCGGTTAATCTTAGACTGGCTCAAAACATACAATTTTTGTATGATACCTGTCAGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCAAGTCATTGGGATTTAATAAAACCTAAAGGCGTAATGAAAGTAAAGGTCGATCTTGTGTCGATTGAGGGAGGATGGGTT-ACATTACGATGTTTCCTCGCACTCCCGGGGCGTTTTATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTTGCATTAAGCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAATTTATGAAGCCATGAGATATAATTGGATCAGAGTGCCAAGTGGGCCAATTTT Gonaspis CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-GACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGACTCTGGCTTGCGTGTGGTTT-GCGATGCT--CGGGGCTTC----GGTCTCGTAG--CACGCGTCCACTGCGGT-ATGTCTAGGGCC-GTCGGCGTGCACTTCTCCTCTAGTAGGACGTTACGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTTCGTCACAC--TCTGT--GTGTACGGAGTAGACCCCCGGTT--ACCTAACCAACTGCCCGGCGGTCCTCGTACGGTA-TCGGGCCGCACTTT----GTGCGTCGGGCCCGTCGCAAGCGCGAGCAG-TGTT-ACCCGGATGTGCGGACCTAGTGCCGTCACCGGGCCTGATCAGCTGTTGGTC-GACGGTGT-TCTCGGACTGGCTCAA--------------------TACCGGTCAGTGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTAAAGGTCGACCATGCGTCGACTAAGGGAGGATGGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAATA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Hedickiana CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GCGATGCT--CGGGATTTC----GGTCTCGTAG--CACGCGTCCACTGCGTT-ATGTCTGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTCCGTCGTAT--TT-ATGCGT--ACGGAGCAGACCCCCGG-TA-TCCTGACCAACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTA----TGTGCGTCGGGCCCGCCGCAAGCGAGATCAG-TGTT-TCCCGGAGGTACGGACCTAGCGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCAGACAGGCTCA---TCCAAAAA-------TGATACCGGTCGACGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGATGGGTT-GCATTACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCAAGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Ibalia ------------------------CTAA?GCTAAATAC-AACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTTTGTGATGTTT-CGGGATTTC----GGTCTCGTAG--CACGCGGCCACTGCGGT-ATGTCTGGAGTC-GTCGGCGTGCACTTCTCCTCTAGTAGGACGTCGCGACCCGTTGGG-TGTCGGTTT--ACGGTCTGG-GTGCGTTGCCTGTTCCCTCGCATT-TACGTGCGC-TTGGGACCAGACCCCCGGTACTAACTGACCGACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTAA---GGTGCGTCGGACCCGCTGCAAGCGAGATCAG-TGAT-ACCCGGAGGTGCGGACCTAGTGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCAGACTGGCTCGT--TTGAATGAAT-----CATTACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGATCG--CAAAACCTAAAGGCATAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGATGGGCT-TCATCACGATGAAGCCCCGCACTCCCGGGGCGTCTCGTACTCAATGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACG-ATGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Iraella ------------------------------------------------------------CAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAACGGCTTTGGCTTTCGTGTGGTTC-GCGATGTT--CGGGACTTC----GGTCTCGCAG--CACGCGTCCACTGCGGT-ATGTCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTAG-GTG-GTTGCCTGTTCCGTCACAT--TTTATGCGT--ACGGAGCAGACCCCTGGTA--ACCCGACCAACTGCTCGGCGGTACTCGCACGGTA-TCGAGCCGCACTA----TGTGCGTCGGACCCGTCGCAAGCGAGATCAG-TGTT-ACCCGGAGGTGCGGACCTAGTGCCGTCCCCGGGCCTGGTCAGCTGTTGGCC-GGCGGTGT-TCTCGGACAGGCTCAT--TTTGAATA-------TGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACTG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGATGGGTT-ACGTTACGATGTAACCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCATTTTT Isocolus ---------------------------------AATATGAC?CACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GCGATGTT--CGGGATTTC----GGTCTCGCAG--CACACGTCCACTGCGTT-ATGTCTGAAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTAGG-TGTTGGTCT--ACGGTCTGG-GTG-GTTGCCTGTACCGTCACAT--TT-ATGCGC--ACGGGACAGACCCCCAGATTTACCTGACCAACTGCCTGGCGGTACTCGCACGGTA-TCGGGCCGCACTAA---TGTGCGTCGGGCCCACCGCAAGCGAGATCAG-TGCT-TCCCGGAGGTTCGGACTTAGCGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GGTGGTGT-TCTCAGACAGGCTCA---TCGAACA--------TGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCAAGTCATTGGGACTG--AAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGTGTCGACTG-GGGAGGATGGGCT-GCGTTACGATGCAGCCTCGCACTCCCGGGGCGTCTCGTACTCATTACGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Liposthenes_gle CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GCGATGTT--CGAGATTCC----GATCTCGTAG--CACACGTCCACTGCGTT-ATGTCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-ATG-GTTGCCTGTTCCGTTGCAT--TT-ATGCGC--ACGGGACAGACCTCCGGTT--ACCTGACCAACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTTA---TGTGCGTCGGACTCGCCGCAAGCGAGATCAG-TGTT-ACCCGTAGGTATGGACATAGTGCCGTCCCCGGGCCTGATCAGCTGTTGGTC-GGCGATGT-TCTTAGACAGGCTCA---CCTAAAAATT-----TGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGCAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGATGGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Liposthenes_ker CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCACCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GCGATGTT--CGAGACTTC----GGTCTCGCAG--CACGCGTCCACTGCGTT-ATGTCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTCCGTCGCAT--TT-ATGCGC--ACGGGGCAGACCCCCGGTT--ACCTGACCAACTGCCCGGCGGTACTCGCATGGTA-TCGGGCCGCACT-A---TGTGCGTCGGGCCCGCCGCAAGCGAGATCAG-TGTT-TCCCGGAGGTGCGGACCTAGCGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCAGACAGGCTCA---TCTAAAA--------TGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGATGGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Neaylax CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GCGATGCT--CGGGATTTC----GGTCTCGTAG--CACGCGTCCACTGCGTT-ATGTCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTCCGTCGTAT--TT-ATGCGC--ACGGAGCAGACCCCCGG-TT-TCCTGACCAACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTA----TGTGCGTCGGGCCCGCCGCAAGCGAGATCAG-TGTT-TCCCGGAGGTACGGACCTAGCGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCAGACAGGCTCA---TCTAAAAA-------TGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGATGGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Neuroterus ------------------------------------------CACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-ACGATGTT--CGAGACTTT----GGTCTTG-GG--CACGCGTCCACTGCGGT-ATGTCTGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTCCGTCGCAT--TTTATGCGC--ACGGAGCAGACCCCCGTGT--ACCCGACCAACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTTA---CGTGCGTCGGGCCCGCCGCAAGCGAGATCAAGTGTT-TCCCGGAGGTGCGGACCTAGTGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCGGACAGGCTCAT--CCAAAAT---------GATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGATGGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Panteliella -------------------------------GAGATATCAACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GCGATGTT--CGGGATTTC----GATCTCGTAG--CACGCGACCACTGCGTT-ATGTCTGGAGTC-GTCGGCGTGCACTTCTCCTCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTCT--ACGGTCTGG-GTG-GTTGCCTGTTCCGTCGCAT--TT-ATGCGC--ACGGGGCAGACCCCTGGGT--ACCTGAC-AACTGCCCGGCGGTACTCGCACGGTA-TCGGGCCGCACTA----TGTGCGTCGGGCTCGCCACAAGCGAGATCAG-TGTT-TCCCGGAGGTTCGGACCTAGCGCCGTCCCCGGGCCTGGTCAGCTGTTGGTT-GGCGATGT-TCTCAGACAGGCTCA---TCAAAAA--------TGATACCGGTCGACGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGATGGGTT-GCATCACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GT?AAGCCAC--------------------------------------- Paramblynotus CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-ACCCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAATCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTTTGTGATGTT--CGAGACCTC----GGTCCTGTGA--CACACGATCACTGCGGT-ATGTCTGAAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGCGACCCGTTGGG-TGTCGGTTT--ACGATCTAG-GTG-GTTGCCTGTTCCGTCACACA-TTACTGTGT--ACGGAGTAGACCCCTGGTT--ATCTGACCGACTGCCCGGCGGTACTCGCACGGTA-TCGAGTCGCACTA----TGTGCGTCCGGCCCGCTGCAAGCGAGATCAG-TGTT-ACCCGGAGGTGCGGACCTGGTGCCGTCCCCGGGCCTGCTCAGCTGTTGGTT-AGCGGTGT-TCTCGGACTGACTCGT--CTCAGTTACT-----GAATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGATTTTGTGTCGACTAAGGGAGGATGGGTT-GTGTTACGATGCAATCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACT-GTGAAGCCATGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Parnips --------------------------------------------------C?ATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GCGATGCT--CGTGACTTCT---GGTCACGTGG--CACACGTCCACTGCGGT-ATGCCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGCGACCCGTTGGG-TGTCGGTTT--ACGAACTGG-GTG-GTTGCCTGTTCCGTCGCATGAATAATGTGT--ATGGTGCAGACCCCTGGAT--ATCTGACCGACTGCCTGGCGGTACTCGCACGGTA-TCGAGCCGCACTA----CGTGCGTCGGGCCCGCCGCAAGCGAGATCAG-TGAT-ACCCGGAGGTGCGGACCTAGTGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCGGACTGGCTCAT--CTCAATTATT-----GAATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACTG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGATGGGTT-GCGTTACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAATCCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACG-GTGAAGCCATGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Pediaspis ----------------------------------ATAT-AACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCATTGGCTTTCGTGTGGTTC-ACGATGTTTGCAGGACCCTCGCGGGTCTTGTTT--CACGCGTCCACTGCGTT-ATGTCCGGTGTC-GTCGGCGTGCACTTCTCCTCTAGTAGGACGTCGCGACCCGTTGGG-TGTCGGTTT--ACGGTCCGG-GTG-GTTGCCTGTTCTATCGTAC---TTGTTTACGTATAGAGCAGACCCTCGGTA--ATCTGACCGACTGCTCGGCGGTACTCGTAAGGTA-TCGGGCCGCACTTG---TGTGCGTCGGGCCCGCTGCAAGCCGGATCAG-TGTT-ACCCGGAGGTGCGGACCTAGTGCCGTCCCCGGGCCTGATCAGCTGTTGGTC-GGCGGTGT-TCTCGGACTGGCTCAT--CGAAATGTTGTTATATGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACTG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGATCTTGCGTCGACTGAGGGAGGATGGGTT-GCGTTACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGTGTGA-TTGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Periclistus ------------------------------------------------------------AAGGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGACTTTGGCTTTCGTGTGTGTC-GCGATGTT--CGGGGCTTC----GGTCTCGCAG--CACGCGTCCACTGCGGT-ATGTCTAGGGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTTACGACCCGTTAGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGCCTGTTTCGTTGCAC--TTTGT--GCGTACGGAGCAGACCCCCGGTA--ACCTGACCAACTGCCCGACGGTACTCGTACGGTA-TCGGGCCGCACTTT----GTGCGTCGGGCCCGTCGCAAGCTTGAGCAG-TGTTATCCCGGATGTGCGGACCTAGTGCCGTCACCGGGCCTGGTCAGCTGTTGGTC-GACGGTGT-TCTCGGACTGGCTCAA--AACAATTAATA----TGATACCGGTCAGTGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGATGGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Phanacis_1 CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GTGATGTT--CAAGACTTC----GGTTTTGCAG--CACACGTCCACTGCGGT-ATGTCCAGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGAACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCCTAGGTC-GTTGTCTGTTTCGTCGCAT---TTATGCGC--ACGAAGCATACCCCAGGTT--ACCTGACCAACTGCCCGGCGGTACTCGCACGGTA-TCGAGCCGCA-TTA---TGTGCGTCGGGCCCGTCGCAAGTGAGATCAG-CGTTA-CCCGGAGGTGCGGACCTAGCGCCGTCCCCGGGCCTGATCAGCTGTTGGTC-GGCGGTGT-TCTCTGACAGGCTCAT--C---AAAAAT------GATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCAAGTCATTGGGATTG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGATGGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Phanacis_2 -------------------------------------------------CCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GTGATGTT--CGTGACTTT----GGTCTTGCAG--CACACGTCCACTGCGGT-ATGTCCGGGGTC-GTCGGCGTGCACTTCTCCCCTAGTAGAACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGTTC-TGGGTG-GTTGCCTGTTCCGTTGTAT---TTATACGT--ACGGAGCATACTCCCGGTT--AACTGACCAACTGCCCGGCGGTACTCGTATGGTA-TCGAGCCGCACTTA---TGTGCGTCGGGCCCGTCGCAAGCGAGATCAG-TGTTTACCCGGAGGTGCGGACCTAGCGCCGTCCCCGGGCCTGGTCAGCTGTTGGCC-GTCGGTGT-TCTCTGACAGGCTCAT--T----AAAAG------GATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCAAGTCATTGGGACTGG-TAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGATGGGTT-ATATCACGATGTAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Plagiotrochus --------------------------------------GGTAAACCGAACTGGCGCTG--TTGGCGC-GTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTAC-GCGATGCGA-TGGGATTTC----GGTCACATAG--CACGCGTCCACTGCGTA-ATGTCCGGAGAC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTCT--ACGGTCCGG-GTG-GTTGCCTGTTCCGTCGCAT--TTTATGCGTT-GCGGAGCAGACCCCCGGTA--ACCCGACCAACTGCCCGGCGGTACTCGCAAGGTA-TCGGGCCGCACAT----TGTGCGTCGGGCCCGTCGCAAGCGAGATCAG-TGTTATCCTGGAGGTGCGGACCTAGTGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GACGGTGT-TCTCGGACTGGCTC----TAAACAATTG-----AAATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTTCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGAAATGAAAGTGAAGGTCGACCTCGCGTCGACTGAGGGAGGATGGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGCCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTAGGAGCTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGAAGCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTTT-TCGGATCAGAGTGCCAAGTGGGCCAATTTT Rhodus ---------------------------------------------ACCACTAGCGA?---CAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGATTC-GCGATGCT--TGAGATTTC----GGTCTCGTAG--CACACGTCCACTGCGTTTATGTCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTTTTACGGTCTGG-GTGTGTTGCCTGTTCCGTCGTAT--TTTATACGC--ACGGGGCAGACCCCCGGTT--TCCTGACCAACTGCCTGACGGTACTCGCACGGTA-TCGGGCCGCACTA----TGTGCGTCGGGCCCGCCGCAAGCGAGATCAG-TGTT-TCCCGGTGGTACGGACCTAGCGCCGTCACCGGGCCTGGTCAGCTGTTGGTC-GGCGGTGT-TCTCAGACAGGCTCA---TACAAAAATG-----ATATACCGGTCGGCGACGCTATTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTGAGGGAGGATGGGTT-GTGTCACGATGCAGCTCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Synergus CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-ACCCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCTAAAAGATCGAATGGGGAGATTCATCGTCAGCGACTTTGGCTTTCGTGTGGTGC-GTGATGCT--CGAGATTTC----GGTCTCGCGG--TACACGTCCACTGCGTT-ATGTCTAGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGTGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GCG-GTTGCCTGTTCTATTGCAT---TTAT--GTATATGGAGCAGACCCCCGGTT--ACCTGACCAACTGCCTGGCGGTACTCGTATGGTA-TCGGGCCGCACTTT----GTGCGTCGGGCCCGTCGCAAGCTAGATCAG-TGTT-TCTCGGAGGTGCGGACCTAGTGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GACGGTGT-TCTCGGACAGGCTCAT--TATGA-------------TACCGGTCGGCGACGCTACTGCTTTAGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGATCTTGCGTCGACTAAGGGAGGATGGGTT-GTGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTGCGAGTTGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAACA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Synophromorpha CTCTAAGTGGGTGGTAAACTCCATCTAAGGCTAAATAC-AACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGACTCTGGCTTTCGTGTGGTTC-GCGATGTT--CGGGGCTTC----GGTCTCGCAG--CACGCGTCCACTGCGGT-ATGTCTAGGGCC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTTACGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGACTGTTTCGTCGCAC--TCTGTGCGTGTACGGAGCAGACCCCCGATC--ACCTGACCAACTGCCCGACGGTACTCGTACGGTA-TCGGGCCGCACTTT----GTGCGTCGGGCTCGTCGCAAGCGCGAGCAGGTGTTTATCCGGATGTACGGACCTAGTGCCGTCACCGGGCCTGATCAGCTGTTGGTC-GACGGTGTACCTCGGACTGGCTCAA--AATAAATGA---------TACCGGTCAGTGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAA-CCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGATGGGTT-GCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAATA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Timaspis ------------------------------------------------ACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGAGAGATTCATCGTCAGCGGCTTTGGCTTTCGTGTGGTTC-GTGATGTT--CATGACTTC----GGTCTTGTAG--CACACGTCCACTGCGGT-ATGTCCGGAGTC-GTCGGCGTGCACTTCTCCCCTAGTAGAACGTCGTGACCCGTTGGA-TGTTGGTTT--ACGGTC-TGGGTG-GTTGCCTGTTCCATTGCAT---TTATGCGC--ATGGAGCATACCCCTGGTT--ACCTGACCAACTGCCCGGCGGTACTCACACGGTA-TCGGGCCGCACTTA---CGTGCGTCAGGCCCGTCGCAAGCGAGATCAG-TGTTT-CCCGGAGGTGCGGACCTAGCGCCGTCCCCGGGCCTGGTCAGCTGTTGGTC-GACGGTGT-TCTCTGACAGGCTCAT--TGAAAAAAAT------GATACCGGTCAGCGACGCTATTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTACGCAAGTCATTGGGACTG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGATGAGCT-GCGTCACGATGCAGCTCCGCACTCCCGGGGCGTCTCATACTCATTGCGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGGTGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAATA-GTGAAGCCACGAGATTT---CGGATCAGAGTGCCAAGTGGGCCAATTTT Xestophanes ------------------------------------------------ACCGATAGCGAACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGTACGTGAAACCGTTCAGGGGTAAACCTGAGAAACCCAAAAGATCGAATGGGGAGATTCATCGTCAGCGACTCTGGCTTTCGTGTGGTTC-GCGATGTT--CGGGACTTT----GGTCTTGCAG--CACGCGTCCACTGCGGTTATGTCTAGGGAC-GTCGGCGTGCACTTCTCCCCTAGTAGGACGTTACGACCCGTTGGG-TGTTGGTTT--ACGGTCTGG-GTG-GTTGACTGTTTCGTCGCAC--TTTGTGCGTGTACGGAGCAGGCCCCCGGTC--ACCTGACCAACTGCCCGACGGTACTCGTACGGTA-TCGGGCCGCACTTT----GTGCGTCGGGCCCGTCGCAAGCGCGAGCAGGTGTTTATCCGGATGTACGGACCTAGTGCCGTCACCGGGCCTGATCAGCTGTTGGTC-GACGGTGT-TCTCGGACTGGCTCAA--AATAAATGAA--------TACCGGTCAGTGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGACCG--CAAAACCTAAAGGCGTAATGAAAGTGAAGGTCGACCTTGCGTCGACTAAGGGAGGATGGGTTTGCGTCACGATGCAGCCCCGCACTCCCGGGGCGTCTCGTACTCATTAAGAGTAGAGGCGCACCCAGAGCGTACACGTTGGGACCCGAAAGATGGTGAACTATGCCTGGTCAGGACGAAGTCAGGGGAAACCCTGATGGAGGTCCGTAGCGATTCTGACGTGCAAATCGATCGTCGGAACTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCACTCGCGTGA-GCGAGTCTCATCTGGTAAAGCGAATGATTAGAGGCCTTGGGGCCGAAACGACCTCAACCTATTCTCAAACTTTAAATGGGTGAGATCTCTGGCTTGCTTGAATA-------------------------------------------------- ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M699] TITLE Morphology; LINK TAXA = Taxa1; DIMENSIONS NCHAR=166; FORMAT DATATYPE=Standard SYMBOLS= "0 1 2 3 4 5 6 7" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 ] [ . . . . . . . . . . . . . . . . . . . ] Andricus 0{01}00002001{01}01202200100001012011{01}1000111000{01}0{12}100003111-1101110101010000110{12}1{01}000011020001100000{01}010010{01}0001010110100110110010100{01}2120111110210{01}01110-01111110010011015 Antistrophus 1-010120000?01001010000110110001000001020000101???001011111100210000000002210011101210101110200001001100021000000000110000100000011210011-1201000112000000000120????00 Aulacidea 00000000000001001002000110100001000000000000101???01101010110000000000000021000000000000112010000100010001001000000011000010000001010011110100100111000001001100????00 Aylax 0100002000100101101000010010100110010200000020010021101010110000000003000021001010100000110010000100110000000000001011010010010001120111110200100010-10000000110001101 Barbotinia 1-010100000?0100002000000011000100010200000020010021101010111001000000000021001000100000111000000100110000101000000011000010000001110111110100001012010000100011001101 Biorhiza 010000310211120220200010001201101110121110202100103111-110111011101101011001200001101000110000010100101100100011010001111001020012120011100210000000-01111100020010015 Ceroptres 1-1-1000100002021002010111101001000000000111000???10101010010000000000100021001000111000100000000200010010101001010111000011100000100111100000101112101001100111????05 Diastrophus 011-10101000021-10-210001011010100000100000011101000100010012000000000001101201100101000110000000100100000000000000011000011100001120011100100000012000000100120001002 Diplolepis 000000300010120220020000001011111100120000202110013011-11021100110111201002101001001200011000100000010010001-110001011001000000111010111100210000010-01000000010????02 Eschatocerus 000010310-1012002002000100101-110?101-0---20112101311--1112100011011120-0021-1001--321-012102110-00010--0011-1-1001001-0-000010001131--01-1200001-10-010-00?0120010106 Gonaspis 1-1-10001000011-10-210001011010100000100000021101000100010012000000000000101201000100000110000000200110000000000000111000011100101120011100101000010-00000100120001002 Hedickiana 1-01010000000000?????0??10101??????1???0????0010000110101111000000??00000121001100121010111010000???11000100000??????1?000100000011200111012010001??00?001?00??0????03 Ibalia 000000000000002-000000000000??00000000000000100{01}0100001-00100000-0000000000010000-000000000011010000-0000000000-0---000000000200---01010000100000000-000000??00000000- Iraella 0100003000100100101100010010100110010200000020{01}???21101010110001100000000021000010110010121020000100111000000000001011000000020001120111110100100010-00000000020????01 Isocolus 0100001000000100100100011110000100000000000010110001101010110000000000000020000010002000112010000100010001001000000010000010001001020011011100000111000001001100000100 Liposthenes_gle 01000030000101022020000010110111000001001000101100001000100120000000010000112011001010001120100001001110000000000000100000100010011210111-0201100012000000000120000003 Liposthenes_ker 0000102000000101????????????????????????????110???0?10001001000000??00000011101100101000112010000????1000000000??????1?1?0100000011210111-01011000???0?000?001?1????03 Neaylax 1-01010000000000100000011010000100010000000000{01}???0110001111000000000000002100110010201011{12}010000100111001000000000011000010000001120011100101000110-00001000110????03 Neuroterus 00001031021112022020001000121110111012121020310???3011-0102110101011010110012100010320001200011000001011001001-1011001111001020002120011000200000000-01110110000????15 Panteliella 0000003000100200??1?000????0??010?00????????200???1?101010111020?0??000001210010101200001{12}2110010???11?01100?????00????0?010?000021210111-020000?1?????000100120????03 Paramblynotus 0100000002000000100000000000110100000100000010{01}10000001000-0000000000000000000000--00000000001000200100-1-001000000-010000100000000111100-01000000020000000001000???0- Parnips 1-00000000000100???????????????1????????????11110001111000101000?-??00000021001000021000112000000?0??00100000000?????0?00010?001000001010002110001???-?00??001?1????01 Pediaspis 000000201011021-20100000001111111100121000{012}021010111100?101101011110010110011011011001-1110001001100101100000010000011001100010001120011100210000010-01010100020001117 Periclistus 1-1-100000000202110201011110110100000000010100101000101010011000000001100021001000111000112010000211010010000001110111000011100000100111010000111112100001001111100002 Phanacis_1 00011000001001011011000110101001010000000010201???0110201021000010000300012101100012100012102100000011011000000000101100001001000011011111021000001000001000000200??00 Phanacis_2 00000020001002000002010110101001110000000000111???01102010210001100003000021010000122000121021100000110010000010001011000010010000010111100110000010-00000100020????00 Plagiotrochus 000000000110120120010000001201101100121000102000013011-01021001110100001101120001111100012{01}0010011001011001001110110?1011000010002120011100210000000-010-0110120011015 Rhodus 1-01000000000000????????????0??????????0????1010000?10101111000000??00000121001110121010112010000????1000200001??????1?000100010011211011-12010000?200?001?001?0????03 Synergus 1-1-100000000202110201011010110100000000010121001120101010101000000001100020000000111000102010000211010010001001110110000011100000100111000000011112100001001101100005 Synophromorpha 1-1-00001000021-100101001111110100000000010100101000100010010000000000100001200000111000110000000200010010001001000111000011100001120011110000111112100001001101100002 Timaspis 0000002000100201001100010010100101000000000021100120102010201001100003000021011000111000121001100000111100000100001011000010010000010101100210000010-01000000120000100 Xestophanes 1-1-00001000011-10-110001011010100000000010110101000100010010101000000100001201000121000110000000100111010001000000111000011100000110011100000010012100000100120001002 ; END; BEGIN TREES; TITLE Tb6658; LINK TAXA = Taxa1; TRANSLATE 1 Synergus, 2 Periclistus, 3 Ceroptres, 4 Synophromorpha, 5 Xestophanes, 6 Diastrophus, 7 Gonaspis, 8 Liposthenes_gle, 9 Liposthenes_ker, 10 Antistrophus, 11 Rhodus, 12 Hedickiana, 13 Neaylax, 14 Isocolus, 15 Aulacidea, 16 Panteliella, 17 Barbotinia, 18 Aylax, 19 Iraella, 20 Timaspis, 21 Phanacis_1, 22 Phanacis_2, 23 Eschatocerus, 24 Diplolepis, 25 Pediaspis, 26 Plagiotrochus, 27 Andricus, 28 Neuroterus, 29 Biorhiza, 30 Parnips, 31 Paramblynotus, 32 Ibalia; TREE Fig.4d = [&R] (32,((((14,15),(16,((10,(11,(12,13))),(8,9)))),((21,(20,22)),((19,(17,18)),((26,(27,(28,29))),(1,(3,(2,((6,7),(4,5))))))))),(23,(24,25))),(30,31)); END;