#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 11, 2021; 21:46 GMT TreeBASE (cc) 1994-2008 Study reference: Campbell J.A., Smith E., Streicher J.W., Acevedo M.E., & Brodie E.D. 2010. New Salamanders (Caudata: Plethodontidae) from Guatemala, with Miscellaneous Notes on Known Species. Miscellaneous Publications, Museum of Zoology, University of Michigan, 200: 60 pp. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10760] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=80; TAXLABELS Bolitoglossa_centenorum_MEA_1633_UTA_A58538 Bolitoglossa_centenorum_MEA_1634_UTA_A58539 Bolitoglossa_cuchumatana_ENS_7812_UTA_A51439 Bolitoglossa_cuchumatana_ENS_8116_UTA_A51462 Bolitoglossa_cuchumatana_ENS_8199_UTA_A51466 Bolitoglossa_cuchumatana_ENS_8306_UTA_A51440 Bolitoglossa_cuchumatana_JAC_19348_UTA_A51441 Bolitoglossa_cuchumatana_JAC_19352_UTA_A51445 Bolitoglossa_daryorum_ENS_11771_UTA_A58520 Bolitoglossa_daryorum_GAR_198_UTA_A59730 Bolitoglossa_daryorum_GAR_199_UTA_A59731 Bolitoglossa_dofleini_ENS_10604_UTA_A56788 Bolitoglossa_dunni_ENS_7825_UTA_A51488 Bolitoglossa_eremia_ENS_10113_UTA_A58552 Bolitoglossa_eremia_ENS_10114_UTA_A58553 Bolitoglossa_eremia_MEA_1975_UTA_A58429 Bolitoglossa_eremia_MEA_1999_UTA_A58430 Bolitoglossa_eremia_MEA_2019_UTA_A58387 Bolitoglossa_flavimembris_ENS_9377_UTA_A58686 Bolitoglossa_franklini_ENS_9378_UTA_A58687 Bolitoglossa_hartwegi_ENS_10302_UTA_A54816 Bolitoglossa_hartwegi_ENS_10303_UTA_A54817 Bolitoglossa_heiroreias_ENS_9847_UTA_A54712 Bolitoglossa_helmrichi_ENS_7802_UTA_A51457 Bolitoglossa_helmrichi_JAC_20487_UTA_A58432 Bolitoglossa_huehuetenaguensis_JAC_19220_UTA_A58699 Bolitoglossa_huehuetenaguensis_MEA_1635_UTA_A58540 Bolitoglossa_huehuetenanguensis_JAC_19170_UTA_A51320 Bolitoglossa_huehuetenanguensis_JAC_19171_UTA_A51321 Bolitoglossa_huehuetenanguensis_JAC_19197_UTA_A51324 Bolitoglossa_huehuetenanguensis_JAC_19198_UTA_A51325 Bolitoglossa_huehuetenanguensis_JAC_19219_UTA_A58698 Bolitoglossa_huehuetenanguensis_MEA_1276_UTA_A58689 Bolitoglossa_huehuetenanguensis_MEA_1277_UTA_A58690 Bolitoglossa_kaqchikelorum_ENS_10283_UTA_A58685 Bolitoglossa_kaqchikelorum_ENS_11770_UTA_A58568 Bolitoglossa_lincolni_ENS_7811_UTA_A51469 Bolitoglossa_lincolni_ENS_8055_UTA_A51474 Bolitoglossa_lincolni_ENS_8327_UTA_A51388 Bolitoglossa_lincolni_MEA_626_UTA_A51485 Bolitoglossa_lincolni_MEA_627_UTA_A51486 Bolitoglossa_meliana_ENS11773 Bolitoglossa_meliana_GAR_145_UTA_A58565 Bolitoglossa_mexicana_ENS_10307_UTA_A54810 Bolitoglossa_morio_ENS_10459_UTA_A53286 Bolitoglossa_morio_ENS_10469_UTA_A58521 Bolitoglossa_morio_ENS_10470_UTA_A58522 Bolitoglossa_morio_ENS_10471_UTA_A58523 Bolitoglossa_morio_ENS_10474_UTA_A58526 Bolitoglossa_morio_ENS_10475_UTA_A58527 Bolitoglossa_mulleri_MEA_1018_UTA_A50475 Bolitoglossa_ninadormida_MEA_1175_UTA_A58562 Bolitoglossa_ninadormida_MEA_1183_UTA_A58564 Bolitoglossa_nussbaumi_JAC_19792_UTA_A59197 Bolitoglossa_nympha_ENS_7147_UTA_A48662 Bolitoglossa_occidentalis_JAC_19896_UTA_A58554 Bolitoglossa_odonnelli_ENS_7862_UTA_A51493 Bolitoglossa_odonnelli_MEA_446_UTA_A48591 Bolitoglossa_rufescens_JAC_19278_UTA_A51491 Bolitoglossa_stuarti_JAC_19443_UTA_A58144 Bolitoglossa_stuarti_JAC_19518_UTA_A58145 Bolitoglossa_suchitanensis_MEA_1911_UTA_A58149 Bolitoglossa_suchitanensis_MEA_1926_UTA_A58150 Bolitoglossa_suchitanensis_MEA_1933_UTA_A58422 Bolitoglossa_suchitanensis_MEA_1936_UTA_A58423 Bolitoglossa_xibalba_ENS_8069_UTA_A51453 Bolitoglossa_xibalba_JAC_19347_UTA_A51456 Bolitoglossa_xibalba_MEA_633_UTA_A51424 Cryptotriton_veraepacis_GAR_063_UTA_A51395 Pseudoeuryce_brunnata_ENS_10467_UTA_A58530 Pseudoeurycea_brunnata_ENS_10458_UTA_A58567 Pseudoeurycea_brunnata_ENS_10468_UTA_A58531 Pseudoeurycea_rex_JAC_19205_UTA_A51408 Pseudoeurycea_rex_JAC_19206_UTA_A51409 Pseudoeurycea_rex_MEA_1182_UTA_A58563 Pseudoeurycea_rex_MEA_1626_UTA_A58532 Pseudoeurycea_rex_MEA_1627_UTA_A58533 Pseudoeurycea_rex_MEA_1628_UTA_A56667 Pseudoeurycea_werleri_ENS_10359_UTA_A54823 Pseudoeurycea_werleri_ENS_10360_UTA_A54824 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=99; TAXLABELS Bolitoglossa_adspersa_AF212984 Bolitoglossa_altamazonica_AY526160 Bolitoglossa_alvaradoi_AY526194 Bolitoglossa_biseriata_AY526161 Bolitoglossa_carri_AY526175 Bolitoglossa_carri_AY526176 Bolitoglossa_celaque_AY526177 Bolitoglossa_celaque_AY526178 Bolitoglossa_cerroensis_AF199195 Bolitoglossa_colonnea_AY526162 Bolitoglossa_conanti_AY526179 Bolitoglossa_decora_AY526180 Bolitoglossa_diaphora_AY526181 Bolitoglossa_dofleini_AF212988 Bolitoglossa_dofleini_ENS_10604_UTA_A56788 Bolitoglossa_dunni_AY526182 Bolitoglossa_dunni_ENS_7825_UTA_A51488 Bolitoglossa_engelhardti_AF212987 Bolitoglossa_epimela_AF212097 Bolitoglossa_eremia_ENS_10113_UTA_A58552 Bolitoglossa_eremia_MEA_1975_UTA_A58429 Bolitoglossa_eremia_MEA_1999_UTA_A58430 Bolitoglossa_eremia_MEA_2019_UTA_A58387 Bolitoglossa_flavimembris_AY526183 Bolitoglossa_flavimembris_ENS_9377_UTA_A58686 Bolitoglossa_flaviventris_AF212983 Bolitoglossa_franklini_AY526184 Bolitoglossa_franklini_ENS_9378_UTA_A58687 Bolitoglossa_gracilis_AF212067 Bolitoglossa_gracilis_AF212068 Bolitoglossa_hartwegi_AF212985 Bolitoglossa_hartwegi_ENS_10303_UTA_A54817 Bolitoglossa_heiroreias_ENS_9847_UTA_A54712 Bolitoglossa_helmrichi_UTA_A_51457_AY691755 Bolitoglossa_hermosa_AF416678 Bolitoglossa_kaqchikelorum_ENS_10283_UTA_A8685 Bolitoglossa_lincolni_AY526185 Bolitoglossa_lincolni_ENS_7811_UTA_A51469 Bolitoglossa_lincolni_ENS_8055_UTA_A51474 Bolitoglossa_lincolni_ENS_8327_UTA_A51388 Bolitoglossa_lincolni_MEA_626_UTA_A51485 Bolitoglossa_lincolni_MEA_627_UTA_A51486 Bolitoglossa_longissima_AY526186 Bolitoglossa_macrinii_AF416680 Bolitoglossa_marmorea_U89627 Bolitoglossa_medemi_AY526163 Bolitoglossa_meliana_GAR_145_UTA_A58565 Bolitoglossa_mexicana_AF212977 Bolitoglossa_mexicana_AF212978 Bolitoglossa_mexicana_AF212979 Bolitoglossa_mexicana_ENS_10307_UTA_A54810 Bolitoglossa_minutula_AF212098 Bolitoglossa_mombachoensis_AY133486 Bolitoglossa_morio_AF212986 Bolitoglossa_morio_AY526187 Bolitoglossa_morio_ENS_10459_UTA_A53286 Bolitoglossa_morio_ENS_10469_UTA_A58521 Bolitoglossa_morio_ENS_10471_UTA_A58523 Bolitoglossa_morio_ENS_10471A_UTA_A58523 Bolitoglossa_morio_ENS_10475_UTA_A58527 Bolitoglossa_mulleri_MEA_1018_UTA_A50475 Bolitoglossa_oaxacensis_AF416681 Bolitoglossa_occidentalis_AY526158 Bolitoglossa_odonnelli_MEA_446_UTA_A48591 Bolitoglossa_palmata_AY526164 Bolitoglossa_paraensis_AY526166 Bolitoglossa_paraensis_AY526167 Bolitoglossa_paraensis_AY526168 Bolitoglossa_peruviana_AY526169 Bolitoglossa_peruviana_AY526170 Bolitoglossa_pesrubra_AF212084 Bolitoglossa_platydactyla_AF212981 Bolitoglossa_platydactyla_AY133484 Bolitoglossa_porrasorum_AY526188 Bolitoglossa_riletti_AF416682 Bolitoglossa_robusta_EU448110 Bolitoglossa_rostrata_AY526189 Bolitoglossa_rostrata_AY526190 Bolitoglossa_rufescens_AY526159 Bolitoglossa_rufescens_JAC_19278_UTA_A51491 Bolitoglossa_schizodactyla_AY526171 Bolitoglossa_sima_AY526172 Bolitoglossa_sp._2_AY526174 Bolitoglossa_sp.1_AY526173 Bolitoglossa_sp.3_AY526191 Bolitoglossa_sp.3_AY526192 Bolitoglossa_striatula_AF212982 Bolitoglossa_stuarti_JAC_19518_UTA_A58145 Bolitoglossa_suchitanensis_MEA_1911_UTA_A58149 Bolitoglossa_suchitanensis_MEA_1926_UTA_A58150 Bolitoglossa_suchitanensis_MEA_1933_UTA_A58422 Bolitoglossa_suchitanensis_MEA_1936_UTA_A58423 Bolitoglossa_synoria_AY526193 Bolitoglossa_yucatana_AF212980 Bolitoglossa_zapoteca_AF416684 Pseudoeurycea_rex_MEA_1626_UTA_A58532 Pseudoeurycea_rex_MEA_1628_UTA_A56667 Psuedoeurycea_werleri_ENS_10359_UTA_A54823 Psuedoeurycea_werleri_ENS_10360_UTA_A54824 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M6353] TITLE Cyt_b_dataset; LINK TAXA = Taxa2; DIMENSIONS NCHAR=630; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=- GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Bolitoglossa_adspersa_AF212984 AAAATTATTAATAACTCGTTTATTGATCTACCTACACCATTGAATTTATCTTATCTCTGAAATTTTGGGTCCCTTCTTGGAGTATGCCTCATTTCACAAATCATTACCGGCCTATTCCTTGCAATACACTATACTGCAGACACAACATTAGCATTCTCATCAGTAACCCACATTTGTCGAGATGTCAATTATGGCTGAATAATACGAAATATTCATGCAAATGGAGCCTCACTATTTTTTATTTGCCTATATATACATATCGGACGAGGCATTTATTACGGCTCTTTCATATTTAAAGAAGCATGAAACATCGGAATTATTCTTCTACTCCTAGTAATAGCAACAGCATTTGTTGGATATGTCTTACCCTGAGGACAAATATCTTTCTGGGGGGCAACAGTCATTACTAATCTACTATCAGCAGTACCATATATAGGCAACACACTAGTACAATGAATTTGAGGCGGATTCTCAGTGGACAAAGCCACCCTTGTCCGATTTTTCGCCCTCCACTTTATTTTACCATTTATTATTGCAGGAATTAGTATTGTTCACCTACTATTTTTACACGAAACAGGATCAAACAACCCCACGGGCCTAAACACCAATTATGACAAAATCCAATTTCAT Bolitoglossa_altamazonica_AY526160 AAAATTATTAACAACTCATTTGTTGATTTGCCCGCACCATTAAATTTATCTTATTTATGAAATTTTGGATCCCTTCTCGGGGTATGCCTTATTTCACAAGTCATAACCGGCCTATTCCTCGCAATACACTATACTGCAGACACAACATTAGCATTTTCATCAGTAGCCCACATTTGTCGAGATGTTAATTATGGCTGAATAATACGAAATATTCATGCAAATGGAGCCTCACTATTTTTTATTTGCCTGTATATACACATTGGACGAGGTATTTACTATGGCTCTTTTATATTTAAAGAAACCTGAAACATTGGAATTATTCTACTACTACTAATAATAGCAACAGCATTTGTTGGATATGTTTTACCATGAGGACAAATGTCTTTTTGAGGTGCAACAGTAATTACTAACTTATTATCAGCAGTACCATATGTAGGCAATACACTAGTACAATGAATTTGAGGCGGCTTCTCAGTAGACAAAGCCACCATTACCCGATTTTTCGCTCTCCACTTTATCCTGCCATTTATTATTGCAGGGATCAGCATTGTTCACCTACTATTTTTACATGAAACAGGATCAAACAACCTTACC------------------------------------ Bolitoglossa_alvaradoi_AY526194 --------------CTCATT-AT-GACCTTCCCACACCATTAAACCTATCCTATCTCTGAAATTT-GGTTCTCTTCT-GGGGTCTGTCTTATT-CACAAATCCTAACAGGCTTATTCCTTGCAATGCATTACACCGCAAACACCACATCCGCATTTTCATCAGTAGCCCATATCTGCCGAGATGTAAATTACGGCTGAATAATTCGAAATGTTCACGCCAACGGAGCCTCCTTTTTTTTTATCTGCCTATATTTGCACATCGGACGCGGCATTTACTACGGCTCATACCTATTTAAAGAAACC-GAAATATTGGAGTTAT-CTCCTCCAAT-AGTAATAGCAACCGCAT-CGTAGGCTATGTCCTGCCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Bolitoglossa_biseriata_AY526161 ---------------------------------ACACCGTTAAACTTATCATATCTTTGAAATTTTGGATCTCTTCTCGGAGTGTGTCTAATTTCACAAATCATTACAGGCCTATTCCTTGCAATACACTACACCGCAGATACAACATCTGCATTCTCATCAGTAGCCCACATTTGCCGAGATGTCAACTATGGTTGAATGATACGAAGCATTCATGCAAACGGAGCCTCACTATTCTTTATTTGCCTGTATATACACATCGGACGGGGCATTTATTATGGCTCTTTTATGTTTAAAGAGACATGAAACATCGGAATCGTTCTACTTCTCCTAGTAATAGCAACAGCATTTGTTGGATACGTCTTGCCCTGAGGACAGATATCCTTCTGAGGCGCAACAGTAATTACTAATCTTCTATCAGCAGTACCATATGTTGGTAATACATTAGTACAGTGAATTTGAGGGGGGTTCTCAGTAGACAAAGCCACTCTCACCCGATTCTTCGCCCTCCACTTTATTTTACCGTTCATTGTTGCAGGAATTAGTATCGTTCACCTATTGTTTTTACATGAAACCGGGTCAAACAATC----------------------------------------- Bolitoglossa_carri_AY526175 --------------CTCATTTATTGATCTTCCCGCACCACTAAACCTGTCTTATTTTTGAAATTTTGGCTCACTTCTTGGAGTGTGTCTAATTTCACAAATTCTAACGGGCCTATTTCTTGCAATACATTACACTGCAGACACCACCTCCGCATTCTCATCAGTAGCCCACATTTGTCGAGATGTTAATTATGGTTGAATAACCCGAAATATCCACACTAACGGAGCTTCTTTCTTCTTTATCTGTCTGTATATACACATCGGACGAGGCATTTATTATGGCTCATTTATATTTAAAGAAACTTGAAATATTGGGATTATTTTACTACTACTAGTGATAGCAACTGCATTTGTGGGCTATGTTTTACCATGAGGACAAATATCCTTTTGAGGAGCAACCGTCATCACTAACCTTTTATCTGCAATCCCATATGTAGGAGATATACTCGTACACTGAATTTGAGGAGGGTTCTCAGTAGATAAAGCTACCCTTACCCGATTTTTTGCCTTTCACTTCATTCTCCCATTTATTATTGCAGGAACTAGCATTGCACACCTCCTCTTTCTTCATGAGACAGGATCTAACAACCCAACCGGCCTCAACCCC------------------------ Bolitoglossa_carri_AY526176 -------TTAATAACTCATTTATTGATCTTCCCGCACCACTAAACCTGTCTTATTTTTGAAATTTTGGCTCACTTCTTGGAGTGTGTCTAATTTCACAAATTCTAACGGGCCTATTTCTTGCAATACATTACACTGCAGACACCACCTCCGCATTCTCATCAGTAGCCCACATTTGTCGAGATGTTAATTATGGTTGAATAACCCGAAATATCCACACTAACGGAGCTTCTTTCTTCTTTATCTGTCTGTATATACACATCGGACGAGGCATTTATTATGGCTCATTTATATTTAAAGAAACTTGAAATATTGGGATTATTTTACTACTACTAGTGATAGCAACTGCATTTGTGGGCTATGTTTTACCATGAGGACAAATATCCTTTTGAGGAGCAACCGTCATCACTAACCTTTTATCTGCAATCCCATATGTAGGAGATATACTCGTACACTGAATTTGAGGAGGGTTCTCAGTAGATAAAGCTACCCTTACCCGATTTTTTGCCTTTCACTTCATTCTCCCATTTATTATTGCAGGAACTAGCATTGCACACCTCCTCTTTCTTCATGAGACAGGATCTAACAACCCAACCGGCCTCAACCCC------------------------ Bolitoglossa_celaque_AY526177 -------TTAATAACTCATTCATTGATCTTCCCGCACCATTAAATTTATCATATTTTTGAAATTTCGGCTCACTCCTTGGAGTATGTCTTATTTCACAAATTCTAACAGGCCTATTTCTTGCAATACACTATACTGCAGATACCTCCTCCGCATTTTCATCAGTAGCCCACATTTGCCGAGATGTTAACTACGGCTGAATAACCCGAAGTATTCACACCAACGGGGCTTCCCTATTCTTTATCTGCTTATATTTACACATCGGACGAGGTATTTATTATGGCTCATTTATATTTAAAGAAACTTGAAATATTGGAATCCTACTACTGCTACTAGTAATGGCAACTGCATTCGTGGGTTATGTCTTGCCATGGGGACAAATATCCTTTTGAGGAGCAACCGTTATCACCAACCTTTTATCCGCAATCCCATATGTAGGAGATATATTAGTACACTGAATTTGAGGGGGATTCTCAGTCGACAAAGCTACTTTAACCCGATTTTTTGCCTTTCACTTCATTCTTCCATTTATTATTGCAGGAGCTAGCATTGCACATCTTCTCTTTTTACACGAAACGGGATCTAATTACCCAACCGGCCTCAACCCCA----------------------- Bolitoglossa_celaque_AY526178 -------TTAATAACTCATTCATTGATCTTCCCGCACCATTAAATTTATCATATTTTTGAAATTTCGGCTCACTCCTTGGAGTATGTCTTATTTCACAAATTCTAACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCTCCTCCGCATTTTCATCAGTAGCCCACATTTGCCGAGATGTTAACTACGGCTGAATAACCCGAAGTATTCACACCAACGGGGCTTCCCTATTCTTTATCTGCTTATATTTACACATCGGACGAGGTATTTATTATGGCTCATTTATATTTAAAGAAACTTGAAATATTGGAATCCTACTACTGCTACTAGTAATGGCAACTGCATTCGTGGGTTATGTCTTGCCATGGGGACAAATATCCTTTTGAGGAGCAACCGTTATCACCAACCTTTTATCCGCAATCCCATATGTAGGAGATATATTAGTACACTGAATTTGAGGGGGATTCTCAGTCGACAAAGCTACTTTAACCCGATTTTTTGCCTTTCACTTCATTCTTCCATTTATTATTGCAGGAGCTAGCATTGCACATCTTCTCTTTTTACACGAAACGGGATCTAATTACCCAACCGGCCTCAACCCCA----------------------- Bolitoglossa_cerroensis_AF199195 AAAGTTGTTAATAATTCATTTATTGATTTACCTGCACCACTAAACCTATCATATTTATGAAATTTTGGGTCTCTCCTAGGAGTATGTCTCATTTCACAAATTCTTACAGGCCTATTTCTTGCAATACACTATACTGCAGATACAGCATCAGCATTCTCATCTGTAGCACACATTTGTCGAGATGTAAACTACGGCTGACTTATACGAAGTATTCATGCAAATGGAGCCTCACTATTCTTTATTTGCCTATATATACATATTGGCCGCGGCATTTATTATGGCTCCTTTATATTTAAAGAAACCTGAAACATCGGAATTATTCTATTATTTCTAGTAATAGCAACAGCGTTCGTCGGATATGTTTTACCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Bolitoglossa_colonnea_AY526162 --------------CTCACTCATTGATTTACCCACACCATTAAACCTGTCCTATTTATGAAATTTTGGATCCCTTCTCGGAGTATGCCTTATTTCACAAATCCTTACAGGCCTATTCCTTGCAATACACTATACTGCAGATACAACATTAGCATTTTCATCAGTAGCCCACATCTGTCGAGATGTAAATTATGGCTGACTAATACGAAGTATTCATGCAAATGGAGCCTCACTATTTTTCATCTGCTTATATATACATATTGGACGCGGCATCTATTACGGCTCTTTCATATTTAAAGAGACCTGAAACATCGGAATTGTTCTTTTACTCTTAGTGATAGCAACAGCATTTGTCGGATATGTATTACCCTGAGGACAAATGTCTTTCTGAGGGGCAACTGTTATTACTAATTTATTATCAGCAGTCCCATATTTGGGAGACATATTAGTACAATGGATTTGAGGGGGATTTTCAGTAGACAAAGCTACCCTTACCCGATTCTTTGCCATCCACTTTATTCTACCGTTTATTATTGCAGGGGCTAGCATTATCCACCTGCTATTCTTACACGAAACAGGATCCAACAACCCCACCGGCTTAAATACCAACTATGACAAAATTCAATTTCAC Bolitoglossa_conanti_AY526179 AAAATTATTAATAATTCATTTATTGACCTCCCTGCACCACTAAATCTATCCTATTTCTGAAATTTTGGTTCACTTCTCGGAATATGTCTAATTTCACAAATTCTGACGGGCCTATTTCTTGCAATACACTATACTGCAGACACCACCTCCGCGTTTTCATCAGTAGCTCACATTTGCCGAGATGTTAATTATGGCTGAATAACCCGAAACATTCATACTAACGGGGCTTCTTTCTTCTTTATCTGCCTCTATATACACATCGGACGAGGCATTTATTATGGCTCATTTATTTTTAAAGAAACTTGAAATATTGGAGTTATCTTATTACTACTAGTGATAGCAACTGCATTTGTAGGCTATGTCCTACCATGAGGACAAATATCCTTTTGAGGAGCAACTGTTATTACTAACCTTCTATCTGCAATCCCATATGTAGGAGACATGTTAGTACACTGAATTTGAGGCGGGTTCTCAGTAGATAAAGCTACTCTAACCCGATTTTTTGCTTTTCACTTCATTCTCCCATTTATTATTGCAGGGGCCAGCATTATACATCTCCTCTTTCTACATGAAACAGGATCTAATAATCCAACCGGCCTCAACTCCAACTATGACAAAATCCCATTTCAC Bolitoglossa_decora_AY526180 ------------AATTCATTTATTGATCTTCCCACACCATTAAACTTGTCATACTTTTGAAATTTCGGCTCGCTTCTTGGGGTATGTCTAATTTCACAAATTCTAACGGGCCTATTTCTTGCAATACATTATACTGCAGACACCACTTCCGCATTTTCATCAGTAGCCCATATTTGCCGAGATGTTAACTACGGTTGAATAGTCCGAAATATTCACACCAATGGGGCTTCTTTATTCTTTATTTGCTTATATATGCACATCGGACGAGGTCTTTACTATGGCTCATTCATATTTAAAGAGACTTGAAATATTGGAATTATCTTCTTCCTATTAGTGATAGCAACCGCATTCGTAGGCTATGTCCTGCCATGAGGACAAATATCCTTTTGAGGGGCAACCGTTATTACTAACCTTTTATCCGCAATCCCATATGTCGGAGATATGTTAGTACAGTGAATTTGGGGGGGATTTTCAGTAGACGAAGCTACTTTAACCCGATTTTTTGCCTTTCACTTCATTCTTCCATTTATTATTACAGGAGCCAGTATTGCACATCTCCTCTTCCTGCACGAGACAGGGTCTAATAATCCAACTGGC--------------------------------- Bolitoglossa_diaphora_AY526181 AAAATCATTAATAATTCATTTATTGACCTTCCAACACCCCTAAATCTATCCTATCTTTGAAATTTCGGCTCACTTCTTGGAGTGTGTCTAATTTTACAGGTTCTGACGGGCCTATTTCTCGCAATACACTATACTGCAGACACCACTTCTGCATTTTCATCAGTAGCCCACATTTGCCGAGATGTTAATTACGGCTGAATAGCCCGAAACATTCACGCCAATGGGGCTTCTTTATTCTTTATCTGCTTATATGTACACATTGGACGAGGCATTTATTATGGCTCATTTTTATTTAAAGAGACTTGAAATATTGGAATTATCTTACTTCTACTAGTGATAGCAACCGCATTCGTAGGTTACGTCCTGCCATGAGGACAAATATCCTTTTGAGGAGCAACCGTTATTACTAACCTTCTATCAGCAATCCCATATATTGGAGACACACTGGTACACTGAATTTGAGGGGGGTTTTCAGTAGATAAAGCTACTTTAACTCGATTTTTTGCCTTTCACTTCATTCTCCCATTTATTATCGCAGGAGCCAGCATTTTACACCTCCTCTTTCTACATGAAACAGGATCTAATAACCCAACCGGCCTCAACCCCAATCATGACAAAATCCCATTTCAC Bolitoglossa_dofleini_AF212988 -------TTAACAATTCATTTATTGATCTCCCCACACCATTAAACCTGTCATACTTATGAAACTCTGGTTCCCTTCTTGGAATGTGCCTAATTTTACAAATTTTAACAGGCCTAATTCTTGCAATACACTACACTGCAGACACCACCTCCGCATTTTCATCAGTAATTCATATCTGCCGAGATGTCAACTATGGTTGAATAGTCCGAAGTATTCACGCCAACGGAGCCTCTTTTTTCTTTATTTGTCTATACCTACATATCGGACGTGGTATCTACTATGGCTCATATATATTCAAACAAACTTGAAATATTGGAATTATTCTTCTGCTACTGATAATGGCAACTGCATTCATGGGCTACGTCTTACCATGAGGACAAATATCCTTCTGAGGAGCAACCGTCATCACTAACCTTTTATCCGCAATCCCATACGTAGGAAACTCATTAGTACAATGAACCTGAGGAGGATTTTCAGTAGACAATGCCACCCTAACCCGATTTTTCACGTTTCATTTTATTTTTCCATTCATTATTGTAGGAACCAGCATTGTGCACCTCATTTTCCTACACGAAACAGGATCCAACAACCCAACCGGCCTTAACT--AACTA-GAC--AATCAC------- Bolitoglossa_dofleini_ENS_10604_UTA_A56788 -----------------ATTTATTGATCTCCCCACACCATTAAACCTGTCATACTTGTGAAAGTCTGATTCCCTTCTTGGAATGTGTCTAATTTTACAAATTTTAACAGGCCTAATTCTTGCAATACACTACACTGCAGACACCACCTCCGCATTTTCATCAGTAATCCATATCTGCCGAGATGTCAACTATGGTTGAATAGTCCGAAGTATTCACGCCAACGGAGCCTCTTTTTTCTTTATTTGTCTATACTTACATATCGGACGTGGTATCTACTATGGCTCATATATGTTCAAACAAACTTGAAATATTGGAATTATTCTCCTGCTACTGATAATGGCAACTGCATTCATGGGCTACATCTTACCATGAGGACAAATATCCTTCTGAGGAGCAACCGTCATCACTAACCTTTTATCCGCAATCCCATACGTAGGAAACTCATTAGTACAATGAGCCTGAGGAGGATTTTCAGTAGACAATGCCACCCTAACCCGATTTTTCACGTTTCATTTTATTTTTCCATTCATTATTGTAGGAACCAGCATTGTGCACCTCATTTTCCTACACGAAACAGGATCCAACAACCCAACCGGCCTAACTCTAATTA-------------------- Bolitoglossa_dunni_AY526182 ---------------------------CTCCCAACACCACTAAATCTATCTTATTTTTGAAATTTTGGCTCGCTTCTTGGGGTATTTCTGATCTCACAAATCTTGACAGTTCTATTTCTTGCAATACATTACACTGCAGACACCACCTCCGCATTTTCATCAGTAGCCCACATTTGCCGAGATGTAAACTACGGCTGAATAACCCGAAACATTCACACCAATGGAGCTTCTTTATTCTTTATCTGCCTCTATATGCACATTGGACGAGGCATTTATTATGGCTCATTTATATTTAAAGAAACTTGAAATATTGGAATCATTTTATTACTACTAGTTATAGCAACTGCATTCATAGGCTATGTTTTACCGTGAGGACAAATATCCTTTTGAGGAGCAACCGTTATCACCAACCTTCTATCAGCAATTCCATATGTAGGAGATATACTAGTACATTGAATTTGAGGGGGGTTCTCAGTAGACAAAGCTACTTTAACCCGATTTTTTGCCTTTCACTTCATTCTTCCCTTTATCATCGCAGGAGCCAGCATTATACACCTCCTATTTCTACATGAAACAGGATCTAAT--------------------------------------------- Bolitoglossa_dunni_ENS_7825_UTA_A51488 ---AAATATTACAACTCATTTATTGATCTCCCTACACCACTAAATCTATCTTATTTTTGAAATTTTGGCTCGCTTCTTGGGGTATGTCTGATCTCACAAATCTTGACAGGTCTATTTCTTGCAATACATTACACTGCAGACACCACCTCCGCATTTTCATCAGTAGCCCACATTTGCCGAGATGTAAACTACGGCTGAATAACCCGAAACATTCACACCAATGGAGCTTCTTTATTCTTTATCTGCCTCTATATGCACATTGGACGAGGCATTTATTATGGCTCATTTATATTTAAAGAAACTTGAAATATTGGAATCATTTTATTACTACTAGTTATAGCAACTGCATTCATAGGCTATGTTTTACCGTGAGGACAAATATCCTTTTGAGGAGCAACCGTTATCACCAACCTTCTATCAGCAATTCCGTATGTAGGAGATATACTAGTACATTGAATTTGAGGGGGGTTCTCAGTAGACAAAGCTACTTTAACCCGATTTTTTGCCTTTCACTTCATT{CT}TTCCCTTTATCATCGCAGGAGCCAGCATTATACACCTCCTATTTTACATGAAACAGGATCTAATAATCCAGCTGGACTAACCTAAC------------------------ Bolitoglossa_engelhardti_AF212987 ---------AATAATTCATTTATTGATCTCCCGGCACCCTTAAAT-TATCTTATCTTTGAAATTT-GGCTCTCTTCTCGGAGTATGTTTAATTTCACAAATTTTAACAGGCCTATTTCTTGCAATACACTATACTGCAGATACTACCTCCGCATTTTCATCAGTAGCCCATATTTGCCGAGATGTTAATTATGGCTGAATAGTCCGAAATATTCACGCCAATGGAGCCTCACTATTTTTTATTTGTCTATATATACATATTGGACGTGGTATTTATTATGGCTCATTTATATTTAAAGAAACCTGAAATATTGGAATTATTCTTATATTGTTAGTAATAGCTACTGCATTTGTAGGCTACGTCCTACCATGAGGACAAATATCCTTTTGAGGGGCAACTGTTATTACTAACCTTTTATCAGCAATCCCATATATAGGAGATATGTTAGTACAGTGAATCTGAGGGGGTTTCTCAGTAGATAAGGCTACCCTCACCCGATTTTTTGCCTTTCACTTTATTCTTCCGTTTGTTATTGCAGGAGCTAGCATCGCCCACCTCCTCTTTCTTCATGAAACAGGGTCTAACAATCCAACCGGCC-------------------------------- Bolitoglossa_epimela_AF212097 ----------------------------------------------TATCTAATTTATGAAATTTTGGATCACTCCTTGGAGTATGCCTCATTTCACAAATTCTTACAGGATTATTTCTTGCGATACATTATACTGCAGACACATCTTCAGCATTTTCATCAGTAGCTCATATTTGCCGAGATGTTAATTATGGTTGACTAATACGAAGTATTCATGCAAACGGGGCCTCACTATTTTTTATTTGTTTATATATACATATTGGCCGAGGCATTTATTATGGCTCCTTTATATTTAAGGAAACCTGAAACAT-GGAATTATTC-ATTATTTTTAGTAATAGCAACGGCATTCGTCGGATATGTTTTACCATGAGGACAAATATCTTTCTGAGGAGCAACCGTTATTACCAACTTATTATCAGCAGTACCATATGCAGGAGACTCTTTAGTACAGTGAGTCTGAGGAGGATTCTCAGTAGATAAGGCCACCTTAACTCGATTTTTTGCTTTCCATTTTGTCCT-CCATTTATTATTGTAGGAACAAGCATTGCCCACCT-ATCTTCCTGCACGAAACAGGATCCA-CAATCCCACCGG---------------------------------- Bolitoglossa_eremia_ENS_10113_UTA_A58552 AAAATTATTAATAACTCATTCATTGATCTCCCTGCACCATTAAACCTATCTTATTTTTGAAATTTCGGCTCACTACTCGGAGTATGCCTAATTTCACAAATCCTAACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCACCTCTGCATTTTCATCAGTAGCTCATATTTGCCGAGATGTTAATTACGGCTGAATAGCCCGAAACATTCACGCCAATGGAGCTTCTTTCTTCTTTATTTGCTTATATATACACATTGGACGGGGCATCTATTACGGCTCATTTATATTTAAAGAAACTTGAAACATTGGAATCATCTTACTACTACTGGTAATAGCAACTGCATTCGTAGGCTATGTCTTACCATGAGGACAGATATCCTTCTGAGGAGCGACTGTTATCACCAATCTTCTATCCGCAATCCCGTACGTAGGAGATATATTAGTACACTGAATTTGAGGTGGCTTCTCAGTAGATAAAGCTACTCTAACCCGATTTTTCGCCTTTCACTTTGTTCTCCCGTTCATTATCTCAGGGGCTAGTATTGCTCACCTCCTATTTTTACACGAAACAGGGTCTAACAATCCAACTGGTTTAAACCCCAACTATGATAAAATTCCTTTCCAC Bolitoglossa_eremia_MEA_1975_UTA_A58429 AAAATTATTAATAACTCATTCATTGATCTCCCTGCACCATTAAACCTATCTTATTTTTGAAATTTCGGCTCACTACTCGGAGTATGCCTAATTTCACAAATCCTAACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCACCTCTGCATTTTCATCAGTAGCTCATATTTGCCGAGATGTTAACTATGGCTGAATAGCCCGAAACATTCACGCCAATGGAGCTTCTTTCTTCTTTATTTGCTTATATATACACATTGGACGGGGCATCTATTACGGCTCATTTATATTTAAAGAAACTTGAAACATTGGAATCATCTTACTACTACTGGTAATAGCAACTGCATTCGTAGGCTATGTCTTACCATGAGGACAGATATCCTTCTGAGGAGCGACTGTTATCACCAATCTTCTATCCGCAATCCCGTACATAGGAGATATATTAGTACACTGAATTTGAGGTGGCTTCTCAGTAGATAAAGCTACTTTAACCCGATTTTTCGCCTTTCACTTTGTTCTCCCGTTCATTATCTCAGGAGCTAGTATTGCTCACCTCCCTATTTTTACACGAAACAGGGTCTAATAATCCAACTGGTTTA----------------------------- Bolitoglossa_eremia_MEA_1999_UTA_A58430 AAAATTATTAATAACTCATTCATTGATCTCCCTGCACCATTAAACCTATCTTATTTTTGAAATTTCGGCTCACTACTCGGAGTATGCCTAATTTCACAAATCCTAACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCACCTCTGCATTTTCATCAGTAGCTCATATTTGCCGAGATGTTAATTACGGCTGAATAGCCCGAAACATTCACGCCAATGGAGCTTCTTTCTTCTTTATTTGCTTATATATACACATTGGACGGGGCATCTATTACGGCTCATTTATATTTAAAGAAACTTGAAACATTGGAATCATCTTACTACTACTGGTAATAGCAACTGCATTCGTAGGCTATGTCTTACCATGAGGACAGATATCCTTCTGAGGAGCGACTGTTATCACCAATCTTCTATCCGCAATCCCGTACGTAGGAGATATATTAGTACACTGAATTTGAGGTGGCTTCTCAGTAGATAAAGCTACTCTAACCCGATTTTTCGCCTTTCACTTTGTTCTCCCGTTCATTATCTCAGGGGCTAGTATTGCTCACCTCCTATTTTTACACGAAACAGGGTCTAACAATCCAACTGGTTTAAACCCCAACTATGATAAAATTCCTTTCCAC Bolitoglossa_eremia_MEA_2019_UTA_A58387 AAAATTATTAATAACTCATTCATTGATCTCCCTGCACCATTAAACCTATCTTATTTTTGAAATTTCGGCTCACTACTCGGAGTATGCCTAATTTCACAAATCCTAACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCACCTCTGCATTTTCATCAGTAGCTCATATTTGCCGAGATGTTAATTACGGCTGAATAGCCCGAAACATTCACGCCAATGGAGCTTCTTTCTTCTTTATTTGCTTATATATACACATTGGACGGGGCATCTATTACGGCTCATTTATATTTAAAGAAACTTGAAACATTGGAATCATCTTACTACTACTGGTAATAGCAACTGCATTCGTAGGCTATGTCTTACCATGAGGACAGATATCCTTCTGAGGAGCGACTGTTATCACCAATCTTCTATCCGCAATCCCGTACGTAGGAGATATATTAGTACACTGAATTTGAGGTGGCTTCTCAGTAGATAAAGCTACTCTAACCCGATTTTTCGCCTTTCACTTTGTTCTCCCGTTCATTATCTCAGGGGCTAGTATTGCTCACCTCCTATTTTTACACGAAACAGGGTCTAACAAGCCAAC------------------------------------- Bolitoglossa_flavimembris_AY526183 --------------------------------------------CCTATCCTATTTTTGAAACTTCGGCTCATTACTAGGAGTGTGTCTAATTTC---------------------------AATACACTATACTGCAGATACCACCTCCGCATTTTCATCAGTAGCCCATATTTGCCGAGATGTTAACTATGGCTGAATAGCC-GAAACATTCACGCCAATGGAGCTTCTTTCTTCTTTATCTGCTTGTATGTACACATTGGACGGGGCATCTATTACGGCTCATTTATATTTAAAGAAACTTGAAACATTGGAATCATTTTACTATTACTGGTAATAG-AACTGCATTCGTAGGCTAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Bolitoglossa_flavimembris_ENS_9377_UTA_A58686 -------------TATTCATTCTTGATCTTCCTGCACCATTAAACCTATCTTATTTTTGAAATTTCGGCTCACTACTTGGAGTATGTTTAATTTCACAAATCCTGACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCACCTCCGCATTTTCATCAGTTGCCCATATTTGCCGAGATGTTAACTACGGCTGAATAGCCCGAAACATTCACGCCAATGGAGCTTCTTTCTTCTTTATCTGCTTATACGCACACATTGGGCGTGGCATCTACTATGGCTCATTTATATTTAAAGAAACTTGAAACATCGGAATTATTTTACTACTACTGGTAATAGCAACTGCATTCGTGGGCTATGTCTTACCATGAGGACAGATATCCTTCTGAGGAGCGACTGTTATCACCAATCTTCTGTCCGCAATCCCATACGTGGGAGATATATTAGTACGCAGAATTTGAGGTGGCTTCTCAGTAGATAAAGCCACTTTAACCCGATTTTTCGCCTTTCACTTTGTTCTTCCATTCATTATTTCAGGGGTCAGCATT--------------------------------------------------------------------------------- Bolitoglossa_flaviventris_AF212983 AA-ATTATTAACAACTCATTCATTGATCTACCTACACCATTAAATTTATCTTACCTTTGAAATTTTGGATCGCTTCTTGGGGTATGTTTAATTTCACAAATCCTTACAGGCCTATTTCTTGCTATACATTACACTGCAGACACTACCTCCGCATTTTCATCAGTAGCTCACATCTGCCGAGATGTAAACTACGGATGAATAGTTCGAAACATACATGCTAATGGAGCTTCATTATTTTTTATTTGCCTATATATGCATATTGGACGTGGAATATATTATGGCTCATTTTTATTTAAAGAAACTTGAAATATTGGAGTTATTCTTCTCCTCTTAGTAATGGCAACAGCATTCGTAGGTTATGTACTACCATGAGGACAAATATCATTTTGAGGGGCAACTGTTATCACTAACCTCTTATCTGCCATCCCGTACTTAGGGGATATGTTAGTACAATGAATCTGGGGAGGTTTCTCAGTAGACAAGGCCACTCTAACCCGATTTTTTGCCTTCCATTTTATTCTCCCATTTGTTATTGCTGGGGCCAGCATGGCACACCTCCTTTTTTTACACGAAACAGGCTCTAATAATCCAACCGGAATCAACCCGAATTACGATAAAATCCCATTTCAT Bolitoglossa_franklini_AY526184 --------CAAGAATTCATTTATTGATCTTCCCACACCACTAAACCTATCGTACTTTTGAAATTTTGGTTCGCTTCTTGGAGTATGCCTAATCTCACAAATCTTAACAGGCCTATTTCTTGCAATACACTATAATGCAGACACCACCTCCGCATTTTCATCAGTAGCCCACATTTGCCGAGACGTAAACTACGGTTGAATAATCCGAAGTATTCACGCCAACGGGGGTTCCCTATTCTTTATTTGTTTATATATGCATATCGGACGCGGCATTTATTATGGCTCATTTATATTTAAAGAAACTTGAAATATTGGAATTATTCTTCTTCTACTAGTAATAGCAACTGCATTCGTAGGCTACGTCCTACCATGAGGACAAATATCCTTTTGAGGAGCAACCGTTATTACCAACCTCTTATCCGCAATCCCATATGTAGGAGACATATTAGTACAATGGATCTGAGGAGGCTTCTCAGTAGATAAAGCTACTTTAACCCGATTTTTTACTTTTCACTTCGTTCTTCCATTTATTATCGCAGGGGCTAGCATTATCCACCTCCTCTTTCTTCATGAAACAGGCTCCAACAACCCAACAGGCTTC------------------------------ Bolitoglossa_franklini_ENS_9378_UTA_A58687 ------------------TTTATTGATCTTCCCGCACCACTAAACCTATCGTACTTTTGAATTTTGGGTTCGCTTCTTGGAGTATGCCTAATTTCACAAATTTTAACAGGCCTATTTCTTGCAATACACTATAATGCAGACACCACCTCCGCATTTTCATCAGTAGCCCACATTTGCCGAGACGTAAACTACGGTTGAATAACCGGAAGTATTCACGCCAACGGGGGTTCCCTATTCTTTATTTGTTTATATATGCATATCGGACGCGGCATCTATTATGGCTCATTTATATTTAAAGAAACTTGAAATATTGGAATTATTCTTCTTCTACTAGTAATAGCAACTGCATTCGTAGGCTACGTCCTACCATGAGGACAAATATCCTTTTGAGGAGCAACCGTTATTACCAACCTCTTGTCCGCAATCCCGTATGTAGGAGACATATTAGTACAATGGATCTGAGGAGGCTTCTCAGTAGATAAAGCTACTTTAACCCGATTTTTTACTTTTCACTTCGTTCTTCCATTTATTATCGCAGGAGCTAGCAT---------------------------------------------------------------------------------- Bolitoglossa_gracilis_AF212067 AAAATTATTAATAACTCATTTATTGACCTGCCAGCACCATTAAACCTATCATATCTTTGAAATTTTGGGTCACTTCTCGGAGTATGCCTTATTTCACAAATTTTCACAGGCCTATTCCTTGCGATACATTACACTGCAGATACCACATCTGCATTCTCATCAGTAGCACACATTTGCCGTGATGTAAACTATGGCTGAATAATACGAAATATTCACGCAAACGGAGCCTCACTCTTTTTTATCTGCTTATATATACACATTGGCCGCGGCCTTTACCATGGCTCCTTCATATTTAAAGAGACCTGAAACATCGGAGTTGTTTTGTTACTCTTAGCAATAGCAACAGCATTCGTTGGATACGTTTTGCCATGAGGACAAATATCTTTCTGAGGAGCAACCGTCATTACTAACCTACTATCGGCTTTACCATATGTAGGAAACACAATAGTACAGTGGATCTGAGGCGGATTCTCAGTTGATAACGCCACCCTTACACGATTTTTTGCTTTCCACTTCATCTTACCATTTATCATTGCAGGGATAAGCATTACCCATCTCCTATTTTTACACGAAACAGGATCCAACAATCCAACCGGTCTAAACCCAAACCACGATAAAATCCCATTTCAC Bolitoglossa_gracilis_AF212068 AAAATTATTAATAACTCATTTATTGACCTGCCAGCACCATTAAACCTATCATATCTTTGAAATTTTGGGTCACTTCTCGGAGTATGCCTTATTTCACAAATTTTTACAGGCCTATTCCTTGCGATACATTACACTGCAGATACTACATCTGCATTCTCATCAGTAGCACACATTTGCCGTGATGTAAACTATGGCTGAATAATACGAAATATTCACGCAAACGGAGCCTCACTCTTTTTTATCTGCTTATATATACACATTGGCCGCGGCCTTTACCATGGCTCCTTCATATTTAAAGAGACCTGAAACATCGGAGTTGTTTTGTTACTCTTAGCAATAGCAACAGCATTCGTTGGATACGTTTTGCCATGAGGACAAATATCTTTCTGAGGAGCAACCGTCATTACTAACCTACTATCGGCTTTACCATATGTAGGAAACACAATAGTACAGTGGATCTGAGGCGGATTCTCAGTTGATAACGCCACCCTTACACGATTTTTTGCTTTCCACTTCATCTTACCATTTATCATTGCAGGGATAAGCATTGCCCATCTCCTATTTTTACACGAAACAGGATCCAACAATCCAACCGGTCTAAACCCAAACCACGATAAAATCCCATTTCAC Bolitoglossa_hartwegi_AF212985 -------------------------------------------ACTTGACCTACTTTTGAAACTTTGGTTCACTCCTTGGAGT----CTAATTTCACAAATTTTAACAGGCCTATTTCTTGCAATACACTATACCGCA-A--CCACCTCTGCATTCTCATCAGTGGCCCATATTTGCCGAGACGTAAGTTATGGATGAATAATGCGAAATGTGCACGCTAATGGGGCCTCATTCTTTTTTATTTGCCTATATATACATATCGGACGCGGCATTTATTACGGCTCATAT--ATTTAA--A-ACTTGAAACATTGGTATTATTCTTCTACTCTTAGT-ATAG---CAGCATT--TAGGCTAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Bolitoglossa_hartwegi_ENS_10303_UTA_A54817 AAAATTATCAATAACTCATTTATTGACCTTCCTACACCACTAAACCTATCCTACCTTTGAAATTTTGGCTCTCTCCTTGGAGTGTGCTTAATTTCACAAGTTTTAACAGGCCTATTTCTCGCAATACATTATACCGCAGACACCACCTCTGCATTCTCATCAGTAGCCCATATTTGCCGAGACGTAAATTATGGGTGAATAATTCGAAGTATGCATGCCAATGGCGCCTCATTCTTTTTCATTTGCCTATACATACACATCGGACGCGGCATTTATTACGGCTCATATTTGTTTAAAGAAACTTGAAACATTGGTATTATCCTTCTACTCTTGGTAATGGCAACAGCATTCATAGGCTATGTTCTTCCATGAGGACAAATATCATTTTGGGGTGCAACAGTAATTACGAATCTCTTGTCTGCTACCCCATACTTAGCAGATATATTAGTACAATGAATCTGAGGGGGATTCTCAGTAGATAAAGCCACCCTCACCCGATTTTTTGCCTTCCACTTTATTCTTCCATTTATTATTATTGGAGCTAGCATATTACACCTTCTTTTTCTCCACCAAACAGGCTCAAACAACCCTACAGGCCTAAGCTCAAATTTTGATAAAATCCC------- Bolitoglossa_heiroreias_ENS_9847_UTA_A54712 -AAATTATTAATAATTCATTCATTGATCTTCCCGCACCATTAAATTTATCTTATTTTTGAAATTTCGGCTCACTTCTCGGAGTATGTCTTATTTCACAAATTTTAACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCACCTCTGCATTTTCATCAGTGGCTCACATTTGCCGAGATGTTAATTTTGGCTGAATAACCCGAAATATTCATACCAATGGGGCTTCTTTATTTTTTATCTGCTTATATATACACATTGGACGAGGTATCTATTACGGCTCATTTATATTTAAAGAGACTTGAAACATTGGAATTCTACTACTACTACTAGTAATGGCAACTGCATTCGTAGGCTATGTCCTACCATGAGGACAGATATCCTTTTGAGGAGCAACCGTTATCACCAACCTTTTATCCGCAATCCCATATGTAGGAGATATATTAGTGCACTGAATCTGAGGGGGATTCTCAGTAGACAAAGCTACTCTTACCCGATTTTTCGCCTTTCACTTCATTCTTCCATTTATTATTGCAGGAACTAGCATTGCTCATCTTCTCTTTTTACACGAGACAGGATTAGTAACCCAACCGGTCTCAACCCCAATA--------------------- Bolitoglossa_helmrichi_UTA_A_51457_AY691755 AAAATTATTAATAACTCATTCATTGATCTCCCTGCACCATTAAACCTATCCTATTTCTGAAATTTTGGCTCTCTTCTCGGAGTATGCTTAATTTCACAAATTTTAACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCAACTCCGCATTTTCATCAGTAGCCCATATTTGTCGAGATGTTAATTATGGTTGAATAGTCCGAAATATTCACGCCAATGGAGCCTCAGTATTTTTTATCTGCTTATATATACATATTGGACGTGGTATTTATTATGGTTCATATATATTTAAAGAAACCTGAAACATCGGAATTATTCTTCTACTACTGGTAATAGCTACTGCATTTGTAGGTTACGTACTACCATGAGGACAAATATCCTTTTGAGGAGCAACTGTTATTACTAACCTTTTATCCGCAATCCCATACATAGGAGATATACTAGTACAGTGAATCTGAGGAGGCTTCTCAGTAGACAAGGCCACCCTCACCCGATTTTTTGCCTTTCACTTTATTTTTCCATTTATTATTGTAGGAGCTAGTATCGCTCACCTCCTCTTTCTTCATGAGACAGGATCTAATAATCCAACCGGCCTCAACTCCAAATATGATAAAATCCCATTTCAC Bolitoglossa_hermosa_AF416678 ------GTTAACAACTCATTTATTGACCTCCCCGCACCGCTAAACCTGTCTTATCTTTGAAACTTTGGCTCACTTCTTGGGGTGTGTCTTATTTCACAGATTCTAACAGGCCTATTCCTTGCCATACACTACACTGCTGACACCACTTCCGCATTCTCATCAGTAGCCCACATCTGCCGAGATGTAAATTATGGCTGAGTAATTCGAAGCTTTCACGCTAACGGAGCCTCGTTATTTTTTATTTGTCTGTATATACACATTGGACGCGGCATTTACTACGGCTCGTTTATATATAAAGAGACTTGAAACATCGGGGTTATACTTCTTCTGCTGGTAATAGCAACAGCATTCGTAGGCTATGTCCTGCCATGAGGACAAATATCCTTTTGAGGAGCAACCGTTATCACCAATCTCCTCTCCGCAATCCCATATGTAGGTGATACACTAGTGCAATGAATCTGAGGGGGATTTTCGGTAGACAAAGCCACCCTCACCCGATTTTTTGCATTTCATTTTGTCCTTCCATTTGTCATCACAGGAGCCAGCATCGCTCATCTTATTTTTCTACACGAAACAGGGTCAAACAACCCAATTGGCCTTAAC-CTTAGT-------------------- Bolitoglossa_kaqchikelorum_ENS_10283_UTA_A8685 ---------------CTCATTCTTGATCTTCCTGCGCCATTAAACCTATCTTATTTTTGAAACTTCGGCTCATTACTCGGAGTGTGTTTAATTTCACAAATTCTGACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCACCTCCGCATTTTCATCAGTAGCCCATATTTGCCGAGATGTTAATTATGGCTGAATAGCCCGAAACATTCACGCCAATGGAGCTTCTTTCTTCTTTATCTGCTTATATATACACATTGGACGGGGCATCTATTACGGCTCATTTATATATAAAGAAACTTGAAACATCGGAATCCT{AC}TTA{CT}TACTACTGGTAATAGCAACTGCATTCGTAGGTTATGTTTTACCG-GAGGACAAATATCCTTCTGAGGAGCAACTGTCATCACCAATCTTCTATCTGCAATCCCATACGTGGGGGATATATTAGTACACAGAATTTGAGGCGGCTTCTCAGTAGATAAAG{CT}TACT{CT}TCACCCGATTTTTCGCCTTTCACTTTTTTCTCCCATTCATTATT-CAGGAGT---------------------------------------------------------------------------------------- Bolitoglossa_lincolni_AY526185 -------CTAATAACTCATTCATTGATCTCCCCACACCACTAAACCTATCATACTTTTGAAATTTTGGCTCACTTCTTGGAGTATGTTTAATTTCACAAATTTTAACAGGCCTATTTCTTGCAATACACTATACTGCAGACACCACCTCTGCATTTTCATCAGTAGCCCACATTTGCCGAGATGTTAATTATGGCTGAATAATCCGAAATATTCACGCCAACGGAGGTTCTCTATTCTTTATCTGTTTATATATGCATATCGGACGAGGCATTTATTACGGCTCATTCATGTTTAAAGAAACTTGAAATATTGGAATTATTCTTCTACTACTAGTAATAGCAACTGCATTCGTAGGATATGTCCTACCATGAGGACAAATATCCTTTTGAGGAGCAACCGTTATCACCAACCTCTTATCTGCAATCCCGTATGTAGGAGACATACTAGTACAATGAATCTGAGGAGGCTTCTCAGTAGACAAAGCTACTTTAACCCGATTTTTTACTTTTCACTTCGTTCTTCCATTTATCATCGCAGGGACTAGCATTATCCACCTACTCTTCCTTCATGAAACAGGCTCCAACAACCCAACAGGCCTT------------------------------ Bolitoglossa_lincolni_ENS_7811_UTA_A51469 -AAAATCATCATAACTCATTCATTGATCTCCCCGCACCACTAAACCTATCATACTTTTGAAATTTTGGCTCACTTCTTGGAGTATGTTTAATCTCACAAATTTTAACAGGCCTATTTCTTGCAATACACTATACTGCAGACACCACCTCTGCATTTTCATCAGTAGCCCACATTTGCCGAGATGTTAATTATGGCTGAATAATCCGAAATATTCACGCCAACGGAGGTTCTCTATTCTTTATCTGTTTATATATGCATATCGGACGAGGCATTTATTACGGCTCATTCATGTTTAAAGAAACTTGAAATGTTGGAATTATTCTTCTACTACTAGTAATAGCAACTGCATTCGTAGGATATGTCCTACCATGAGGACAAATATCCTTTTGAGGAGCAACCGTTATCACCAACCTCTTATCTGCAATCCCATATGTAGGAGACATACTAGTACAATGAATCTGAGGAGGCTTCTCAGTAGACAAAGCTACTTTAACCCGATTTTTTACTTTTCACTTCGTTCTTCCATTTATCATCGCAGGGACTAGCATTATCCACCTACTCTTCCTTCATGAAACAGGCTCCAACAACCCAACAGGCCTCGCCCGTAAT--------------------- Bolitoglossa_lincolni_ENS_8055_UTA_A51474 --AAAATCATCATACTCATTCATTGATCTCCCCACACCACTAAACCTATCATACTTTTGAAATTTTGGCTCACTTCTTGGAGTATGTTTAATATCACAAATTTTAACAGGCCTATTTCTTGCAATACACTATACTGCAGACACCACCTCTGCATTTTCATCAGTAGCCCACATTTGCCGAGATGTTAATTATGGCTGAATAATCCGAAATATTCACGCCAACGGAGGTTCTCTATTCTTTATCTGTTTATATATGCATATCGGACGAGGCATTTATTACGGCTCATTCATGTTTAAAGAAACTTGAAATATTGGAATTATTCTTCTACTACTAGTAATAGCAACTGCATTCGTAGGATATGTCCTACCATGAGGACAAATATCCTTTTGAGGAGCAACCGTTATCACCAACCTCTTATCTGCAATCCCATATGTAGGAGACATACTAGTACAGTGAATCTGAGGAGGCTTCTCAGTAGACAAAGCTACTTTAACCCGATTTTTTACTTTTCACTTCGTTCTTCCATTTATCATCGCAGGGACTAGCATTATCCACCTACTCTTCCTTCATGAAACAGGCTCCAACAACCCAACAGGCTCGCCC--------------------------- Bolitoglossa_lincolni_ENS_8327_UTA_A51388 -------------------------------------------------------------------------------------------------------TAACAGGCCTATTTCTTGCAATACACTATACTGCAGACACCACCTCTGCATTTTCATCAGTAGCCCACATTTGCCGAGATGTTAATTATGGCTGAATAATCCGAAATATTCACGCCAACGGAGGTTCTCTATTCTTTATCTGTTTATATATGCATATCGGACGAGGCATTTATTACGGCTCATTCATGTTTAAAGAAACTTGAAATATTGGAATTATTCTTCTACTACTAGTAATAGCAACTGCATTCGTAGGATATGTCCTACCATGAGGACAAATATCCTTTTGAGGAGCAACCGTTATCACCAACCTCTTATCTGCAATCCCGTATGTAGGAGACATACTAGTACAATGAATCTGAGGAGGCTTCTCAGTAGACAAAGCTACTTTAACCCGATTTTTTACTTTTCACTTCGTTCTTCCATTTATCATCGCAGGGACTAGCATTATCCACCTACTCTTCCTTCATGAAACTA-------GGCTCCAACAACCCAACAGGCCTCGCCC------------------ Bolitoglossa_lincolni_MEA_626_UTA_A51485 TGAAATCATCATAACTCATTCATTGATCTCCCCGCACCACTAAACCTATCATACTTTTGAAATTTTGGCTCACTTCTTGGAGTATGTTTAATCTCACAAATTTTAACAGGCCTATTTCTTGCAATACACTATACTGCAGACACCACCTCTGCATTTTCATCAGTAGCCCACATTTGCCGAGATGTTAATTATGGCTGAATAATCCGAAGTATTCACGCCAACGGAGGTTCTCTATTCTTTATCTGTTTATATATGCATATCGGACGAGGCATTTATTACGGCTCATTCATGTTTAAAGAAACTTGAAATATTGGA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Bolitoglossa_lincolni_MEA_627_UTA_A51486 -AAAATCATCAATACTCATTCATTGATCTCCCCGCACCACTAAACCTATCATACTTTTGAAATTTTGGCTCACTTCTTGGAGTATGTTTAATCTCACAAATTTTAACAGGCCTATTTCTTGCAATACACTATACTGCAGACACCACCTCTGCATTTTCATCAGTAGCCCACATTTGCCGAGATGTTAATTATGGCTGAATAATCCGAAGTATTCACGCCAACGGAGGTTCTCTATTCTTTATCTGTTTATATATGCATATCGGACGAGGCATTTATTACGGCTCATTCATGTTTAAAGAAACTTGAAATATTGGAATTATTCTTCTACTACTAGTAATAGCAACTGCATTCGTAGGATACGTCCTACCATGAGGGCAAATATCCTTTTGAGGAGCAACCGTTATCACCAACCTCTTATCTGCAATCCCATATGTAGGAGACATACTAGTACAATGAATCTGAGGAGGCTTCTCAGTAGACAAAGCTACTTTAACCCGATTTTTTACTTTTCACTTCGTTCTTCCATTTATCATCGCAGGGACTAGCATTATCCACCTACTCTTCCTTCATGAAACAGGCTCCAACAACCCAACAGGCCTCGCCCGTAATAT------------------- Bolitoglossa_longissima_AY526186 AAAATTATTAATAACTCATTTATTGATCTTCCCACACCATTAAACCTATCATATTTTTGAAATTTTGGCTCGCTTCTTGGAGTGTGCCTGATCTCACAAATTTTAACAGGCCTATTTCTTGCAATACACTACACTGCAGACACCGCCTCCGCATTTTCATCAGTAGTTCACATTTGCCGAGATGTCAACTATGGTTGAACAATCCGAAACATTCACACCAACGGAGCCTCTTTATTCTTTATTTGCTTATATATACACATTGGACGAGGCATTTATTACGGCTCATTTATATTTAAAGAAACTTGAAACATTGGGATTATCCTCCTTCTACTAGTAATAGCAACTGCATTTGTAGGTTATGTTCTACCTGGGGGACAAATGTCCTTTTGAGGGGCAACCGTTATTACCAACCTTTTATCTGCAATCCCATATGTTGGAGACACATTAGTACAGTGGATTTGAGGGGGCTTCTCAGTAGACAAAGCCACCCTAACTCGATTTTTCGCCTTTCACTTTATTCTCCCATTCATCATTTCAGGGGCCAGTATCGCCCACCTCCTCTTCCTACACGAAACAGGATCCAATGATCCAATCGGCCTAAACCCCGACTAT------------------ Bolitoglossa_macrinii_AF416680 AAAATTATTAATAACTCATTTATTGACCTCCCCACACCATTAAACCTGTCCTATCTCTGAAACTTTGGTTCACTTCTTGGAGTATGCCTGATTTCACAAATTTTGACAGGTCTATTCCTTGCAATACATTATACTGCTGACACTACCTCCGCATTTTCATCAGTAGCCCACATCTGCCGAGATGTAAACTACGGTTGAATAGTCCGGAGCCTTCATGCCAATGGAGCCTCACTTTTTTTTATTTGCCTGTATATACACATCGGACGCGGCATCTACTATGGCTCATTTATATATAAAGAAACCTGAAACATCGGGATTGTACTTCTTCTGCTAGTAATAGCAACAGCATTCGTAGGCTATGTCCTGCCATGAGGACAAATATCCTTTTGGGGGGCAACCGTTATTACAAATCTTCTTTCTGCGATCCCTTATGTAGGAGATATACTGGTACAATGAATTTGAGGGGGCTTCTCAGTAGACAAAGCCACCCTTGTCCGATTTTTTGCATTTCATTTTATTCTTCCATTTATTATTGCAGGTACTAGTATTGCCCATCTCATTTTTTTACACGAAACAGGCTCTAATAACCCAACTGGCCTTAATCCCAATTATGACAAAATTCCATTTCAC Bolitoglossa_marmorea_U89627 -----TATTAATAATTCATTTATTGACCTACCTGCACCACTAAACCTGTCCTATTTATGAAATTTTGGGTCCCTTCTCGGAGTGTGTCTTATTTCACAAATTCTTACAGGCCTATTCCTTGCAATACACTACACCGCAGACACAACATCAGCATTTTCATCAGTAGCCCATATTTGCCGAGATGTAAACTATGGTTGACTAATACGAAATATTCATGCAAATGGAGCCTCGCTATTTTTTATTTGCTTATATATACATATTGGCCGCGGCCTTTATTATGGCTCATTTATATTTAAAGAAACCTGAAACATTGGAATTATTCTATTATTTCTAGTAATAGCAA--GCA-TCGTCGGATATGTTTTACCATGAGGACAAATATCATTCTGAGGAGCAACCGTTATTACCAACCTACTATCTGCAGTGCCATATGCAGGAGACACCCTAGTACGATGAGTCTGAGGAGGATTTTCAGTAGATAAAGCCACCC-AACCCGATTTTTTGCTTTCCATTTCATTCTACCGTTTATTATTACAGGAATTAGTATTGCTCACCTCAT---------------------------------------------------------------------- Bolitoglossa_medemi_AY526163 AAAATTATTAACAGTTCATTTATTGACCTGCCCACACCATTAAATTTATCTTATAACTGAAATTTTGGGTCCCTTCTCGGAGTATGCCTCATTTCACAAATCGTTACTGGCCTATTCCTGGCAATACACTATACTGCAGACACAACATTAGCATTTTCATCAGTAACTCATATTTGTCGAGATGTCAATTATGGCTGAATAATACGAAATATTCATGCAAATGGAGCCTCACTATTTTTTATCTGCCTCTTCATACATATCGGACGAGGCCTTTATTACGGCTCTTTCATGTTTAAAGAAACCTGAAATATTGGAATTATTCTGCTACTCCTAGTAATAGCAACGGCATTCGTCGGATATGTCTTACCTTGAGGACAGATATCATTCTGAGGAGCAACAGTCATCACCAACCTATTATCAGCAGTACCATATATTGGTAATACACTAGTACAATGAATTTGAGGCGGATTCTCAGTTGACAAGGCAACCCTTACCCGATTTTTTGCTCTACATTTCATTTTACCATTTATTATTGCAGGGGTTAGCATTGTCCACCTTTTATTCCTACACGAAACGGGATCAAATAACCCCACTGGCCTCAACACTAATTGTGACAAAATTCAATTTCAC Bolitoglossa_meliana_GAR_145_UTA_A58565 AAAATTATTAATAACTCATTCATTGATCTTCCCGCACCATTAAACCTATCTTATTTTTGAAATTTCGGCTCACTTCTTGGAGTATGTCTGATTTCACAAATCCTGACAGGCCTATTTCTTGCAATACATTACACTGCAGACACCACCTCCGCATTTTCATCAGTAGCCCACATTTGCCGAGATGTTAATTATGGCTGAATGACCCGAAACATTCATACCAATGGAGCTTCTTTATTCTTTATCTGCTTATATATGCACATCGGACGAGGCATTTATTATGGCTCATTCATATTTAAAGAGACCTGAAATATCGGAATTATCCTACTACTACTGGTGATAGCAACTGCATTCGTAGGCTATGTCCTACCATGGGGCCAAATATCTTTTTGAGGAGCAACCGTTATTACTAACCTTTTATCCGCTGTCCCCTACGTAGGGGACATACTAGTACATTGAATTTGAGGGGGCTTCTCAGTAGACAAAGCTACTTTAACCCGATTTTTCGCCTTTCACTTCATTCTTCCATTTATTATTGCAGGGGCCAGCATTGCACACCTCCTCTTTCTACACGAAACAGGATCTAATAACCCAACCGGCCT------------------------------- Bolitoglossa_mexicana_AF212977 -------------------------ACTTACCAACACCACTAAATCTATCTTATCTTTGAAATTTCGGCTCACTTCTTGGAGTGTGTTTAATTTCACAAATTCTAACAGGCCTATTTCTTGCAATACATTACACTGCAGATACTACCTCTGCATTCTCATCAGTTGCCCACATTTGTCGAGATGTAAACTATGGATGAATAGTTCGAAATATACACGCCAATGGAGCCTCATTCTTCTTTATTTGCCAATATATGCATATTGGACGCGGCATTTATTATGGCTCGTTTATATTTAAAGAGACTTGAAACATTGGGATTCTTCTTCTCCTCTTAGTAATAGCAACAGCATTTGTAGGTTATGTACTACCGTGGGGTCAAATGTCATTCTGAGGGGCAACTGTAATTACTAACCTTCTATCTGCCATCCCATACTTAGGAGATATATTAGTGCAATGAGTTTGGGGAGGGTTTTCAGTAGACAAAGCCACCCTTACCCGATTTTTTGCCTTTCACTTTATTCTTCCATTTGTCATTGCTGGAATAAGCATAGCACACCTCCTTTTTCTTCATGAAACAGGTTC------------------------------------------------- Bolitoglossa_mexicana_AF212978 AAAATTATTAATAACTCATTTATTGACCTGCCAACACCACTAAATTTATCTTACCTTTGAAATTTTGGTTCACTCCTTGGGGTATGTTTAATTTCACAAATTCTGACAGGCTTATTTCTTGCAATACATTACACTGCAGATACTATCTCCGCATTTTCATCAATCGCCCATATCTGTCGAGATGTAAACTACGGATGAATAATTCGAAACATACATGCCAACGGAGCTTCATTCTTCTTTATTTGTTTATATATACATATCGGACGTGGCATTTATTATGGCTCATTCATATTTAAAGAAACTTGAAACATTGGGGTTGTCCTTCTTCTCCTAGTAATGGCAACAGCATTTGTAGGCTATGTATTGCCGTGAGGTCAAATATCATTCTGAGGGGCAACCGTAATTACCAACCTTCTATCTGCTATCCCATACTTAGGAGATATGTTAGTACAATGAATTTGAGGAGGATTTTCAGTAGACAAAGCCACCCTTACCCGATTTTTTGCCTTTCACTTTATTCTCCCATTTATTATTACTGGAATAAGCATAGCGCACCTCCTTTTTCTTCATGAAACAGGCTCTAATAATCCAACCGGCCTTAACTCCAACTACGACAAAATCCCATTTCAC Bolitoglossa_mexicana_AF212979 AAAATTATTAATAACTCATTTATTGACCTACCAACACCACTAAATTTATCTTACCTTTGAAATTTTGGTTCACTCCTTGGGGTGTGTTTAATTTCACAAATTCTGACAGGCTTATTTCTTGCAATACATTACACTGCAGATACTATCTCTGCATTTTCATCAATCGCTCATATCTGTCGAGATGTAAACTATGGATGAATAATTCGAAATATACATACCAACGGAGCTTCATTTTTCTTTATTTGTTTATATATACATATCGGACGCGGCATTTATTATGGCTCATTCATATTTAAAGAGACTTGAAACATCGGGGTCGTCCTTCTTCTCCTAGTAATAGCAACAGCATTTGTAGGCTATGTACTGCCATGAGGTCAAATATCATTCTGAGGGGCAACCGTAATTACCAACCTTCTATCTGCTATCCCATACTTAGGAGATATGTTAGTACAATGAATTTGAGGAGGATTTTCAGTAGACAAAGCCACCCTTACCCGATTTTTTGCCTTTCACTTTATTCTCCCATTTATTATTACTGGAATAAGCATAGCGCACCTCCTTTTTCTTCATGAAACAGGCTCTAATAATCCAATCGGCTTTAACTCCAACTACGACAAAATCCCATTTCAC Bolitoglossa_mexicana_ENS_10307_UTA_A54810 AAAATTGTTAACAACTCATTTATTGATTTACCAACACCATTAAATTTATCCTACCTTTGAAATTTTGGCTCACTCCTTGGAGTCTGTTTAATTTCACAAATCCTAACAGGCTTATTTCTCGCAATACATTATACTGCAGATACTACCTCCGCATTTTCATCAGTCGCCCATATTTGTCGAGATGTAGACTACGGG{GT}GGATAATTCGAAGTATGCACGCCAACGGAGCCTCGTTCTTCTTTATTTGCCTTTATATACATATCGGACGTGGCATTTATTACGGCTCGTTTACATTTAAAGAGACTTGAAATATTGGGGTTATCCTTCTCCTCTTAGTCATAGCAACAGCATTTGTAGGCTATGTACTTCCATGAGGTCAAATATCATTCTGGGGGGCAACCGTGATTACCAACCTTCTATCTGCTATCCCATATTTAGGGGATACACTAGTACAGTGGGTTTGAGGGGGGTTTTCAGTGGACAAAGCTACTCTTACCCGATTTTTTGCCTTCCATTTTATTCTTCCATTTATTATTGCTGGAATAAGCATAGCACACCTCCTTTTTCTTCATGAAACAGGCTCTAATAACCCAACCGGTCTTAACT-------------------------- Bolitoglossa_minutula_AF212098 ------------AATTCATTTATTGACCTACCTGCACCATTAAATTTGTCCTA--TGTGAAATTTTGGATCCCTTCTCGGAGTGTGTCTTATTTCACAAATTCTTACAGGCCTATTTCTTGCAATACATTATACTGCAGATACAACATCAGCATTTTCATCAGTAGCCCATATTTGCCGAGATGTAAATTATGGTTGATTAATACGAAGTATTCATGCAAATGGAGCCTCACTATTT-TTATTTGCTTATATATACATATCGGCCGCGGCATTTATTATGGTTCCTTTATATTTAAAGAAACC-GAAACATTGGAGTCATTCT-TTACTACTAGTAATAGCAACGGCATTCGTCGGATATGTTT-ACCATGAGGACAAATATCTTTTTGAGGAGCAACCGTTATTACTAAT-TATCATCAGCAGTACCATATGCAGGAGACACCCTGGTACAATGAATCTGAGGGGGATTCTCAGTAGACGAAGCTACCCTAACTCGATTTTTTGCTTTCCATTTCATTACACCATTTATTATTGCGGGA-CTAGTTTTCCCCACTTCATTTTCCTACAAGAAACAGGTTCCAAT--------------------------------------------- Bolitoglossa_mombachoensis_AY133486 AAAATTATTAACAACTCATTTATTGATTTACCAACACCACTAAATTTATCTTACCTTTGAAACTTTGGCTCACTCCTTGGAGTATGTTTAGTTTCACAGATCCTAACAGGCTTATTTCTCGCAATACATTATACTGCGGATACTACCTCCGCATTTTCATCAGTTGCCCATATTTGTCGAGATGTAAACTACGGATGAACAGTTCGAAATATACACGCCAACGGGGCCTCATTCTTCTTTATTTGCCTTTATATGCATATCGGACGTGGCATTTATTATGGCTCATTTATATTTAAAGAGACTTGAAATATTGGCGTAATCCTTCTTCTCTTGGTTATAGCGACAGCATTTGTAGGTTACGTACTTCCATGAGGTCAAATATCATTCTGAGGAGCAACTGTAATTACCAACCTTCTATCTGCTATCCCATACTTAGGGAATATATTAGTAGAGTGAATTTGAGGGGGATTTTCAGTTGATAAAGCTACTCTTACCCGATTTTTTGCCTTTCACTTTATTCTTCCATTTATTATTGCTGGGATAAGCATAGCACACCTCCTTTTTCTTCATGAAACAGGATCTAATAACCCAACCGGCCTTAACTCCAACTATGATAAAATTCCATTTCAT Bolitoglossa_morio_AF212986 --------TAATAACTCATTCATGGATCTTCCTGCGCCATTAAACCTATCTTATTTTTGAAACTTCGGCTCATTACTCGGAGTGTGTTTAATTTCACAAATTCTGACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCACCTCCGCATTTTCATCAGTAGCCCATATTTGCCGAGATGTTAATTATGGCTGAATAGCCCGAAACATTCACGCCAATGGAGCTTCTTTCTTCTTTATCTGCTTATATATACACATTGGACGGGGCATCTATTACGGCTCATTTATATTTAAAGAAACTTGAAACATCGGAATCCTCTTACTACTACTGGTAATAGCAACTGCATTCGTAGGTTATGTTTTACCGTGAGGACAAATATCCTTCTGAGGAGCAACTGTCATCACCAATCTTCTATCTGCAATCCCATACGTGGGGGATATATTAGTACACTGAATTTGAGGCGGCTTCTCAGTAGATAAAGTTACTCTCACCCGATTTTTCGCCTTTCACTTTATTCTCCCATTCATTATTTCAGGAGCTAGCATTGCTCACCTCCTATTTTTACACGAAACAGGGTCTAACAATCCAACTGGTTTAAATCCC------------------------ Bolitoglossa_morio_AY526187 ----------------------------------CACCATTAAACCTATCTTATTTTTGAAATTTCGGCTCACTACTCGGAGTATGCCTAATTTCACAAATCCTAACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCACCTCTGCATTTTCATCAGTAGCTCATATTTGCCGAGATGTTAACTATGGCTGAATAGCCCGAAACATTCACGCCAATGGAGCTTCTTTCTTCTTTATTTGCTTATATATACACATTGGACGGGGCATCTATTACGGCTCATTTATATTTAAAGAAACTTGAAACATTGGAATCATCTTACTACTACTGGTAATAGCAACTGCATTCGTAGGCTATGTCTTACCATGAGGACAGATATCCTTCTGAGGAGCGACTGTTATCACCGATCTTCTATCCGCAATCCCGTACATAGGAGATATATTAGTACACTGAATTTGAGGTGGCTTCTCAGTAGATAAAGCTACTTTAACCCGATTTTTCGCCTTTCACTTTGTTCTCCCGTTCATTATCTCAGGAACTAGTATTGCTCACCTCCTATTTT-ACACGA-ACAG----------------------------------------------------- Bolitoglossa_morio_ENS_10459_UTA_A53286 AAAATTATTAATAACTCATTCATTGATCTTCCTGCGCCATTAAACCTATCTTATTTTTGAAACTTCGGCTCATTACTCGGAGTATGTCTAATCTCACAAATTCTAACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCACCTCCGCATTTTCATCAGTAGCCCATATTTGCCGAGATGTTAACTATGGCTGAATAGCCCGAAACATTCACGCCAATGGAGCTTCTTTCTTCTTTATCTGCTTATATATACACATTGGACGGGGCATCTATTACGGCTCATTTATATTTAAAGAAACTTGAAACATTGGAATCATCTTACTACTACTGGTAATAGCAACTGCATTCGTAGGTTATGTTTTACCGTGAGGACAAATATCCTTCTGAGGGGCAACTGTTATCACCAATCTTCTATCTGCAATCCCATACGTAGGGGATATATTAGTACACTGAATTTGAGGCGGCTTCTCAGTCGACAAAGCTACTCTCACCCGATTTTTCGCCTTTCACTTTGTTCTCCCATTCATTATTTCAGGGGCCAGCATTGCTCACCTCCTATTCTTACACGAAACAGGATCTAACAATCCAACTGG---------------------------------- Bolitoglossa_morio_ENS_10469_UTA_A58521 AAAATTATTTATAACTCATTCATTGATCTTCCTGCGCCATTAAACCTATCTTATTTTTGAAACTTCGGCTCATTACTCGGAGTATGTCTAATCTCACAAATTCTAACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCACCTCCGCATTTTCATCAGTAGCCCATATTTGCCGAGATGTTAACTATGGCTGAATAGCCCGAAACACTCACGCCAATGGAGCTTCTTTCTTCTTTATCTGCTTATATATACACATTGGACGGGGCATCTATTACGGCTCATTTATATTTAAAGAAACTTGAAACATTGGAATCATCTTACTACTACTGGTAATAGCAACTGCATTCGTAGGCTATGTTTTACCGTGAGGACAAATATCCTTCTGAGGGGCAACTGTTATCACCAATCTTCTATCTGCAATCCCATACGTAGGGGATATATTAGTACACTGAATTTGAGGCGGCTTCTCAGTCGACAAAGCTACTCTCACCCGATTTTTCGCCTTTCACTTTGTTCTCCCATTCATTATTTC{AT}GGGA{CT}CAGCATTGCTCACCTCCTATTTTACACGAAACAGGATCTAACAAGCCAACTGGGT--------------------------------- Bolitoglossa_morio_ENS_10471_UTA_A58523 --------------CTCATTCATTGATCTTCCTGCGCCATTAAACCTATCTTATTTTTGAAACTTCGGCTCATTACTCGGAGTATGTCTAATCTCACAAATTCTAACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCACCTCCGCATTTTCATCAGTAGCCCATATTTGCCGAGATGTTAACTATGGCTGAATAGCCCGAAACACTCACGCCAATGGAGCTTCTTTCTTCTTTATCTGCTTATATATACACATTGGACGGGGCATCTATTACGGCTCATTTATATTTAAAGAAACTTGAAACATTGGAATCATCTTACTACTACTGGTAATAGCAACTGCATTCGTAGGCTATGTTTTACCGTGAGGACAAATATCCTTCTGAGGGGCAACTGTTATCACCAATCTTCTAT{AC}TGCAATCCCATACGTAGGGGATATATTAGTACACTGAATTTGAGGCGGCTT{AC}TCAGT{CG}GACAAAG-------------------------------------------------------------------------------------------------------------------------------------------------- Bolitoglossa_morio_ENS_10471A_UTA_A58523 AAAATTATTAATAACTCATTCATTGATCTTCCTGCGCCATTAAACCTATCTTATTTTTGAAACTTCGGCTCATTACTCGGAGTATGTCTAATCTCACAAATTCTAACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCACCTCCGCATTTTCATCAGTAGCCCATATTTGCCGAGATGTTAACTATGGCTGAATAGCCCGAAACACTCACGCCAATGGAGCTTCTTTCTTCTTTATCTGCTTATATATACACATTGGACGGGGCATCTATTACGGCTCATTTATATTTAAAGAAACTTGAAACATTGGAATCATCTTACTACTACTGGTAATAGCAACTGCATTCGTAGGCTATGTTTTACCGTGAGGACAAATATCCTTCTGAGGGGCAACTGTTATCACCAATCTTCTATCTGCAATCCCATACGTAGGGGATATATTAGTACACTGAATTTGAGGCGGCTTCTCAGTCGACAAAGCTACTCTCACCCGATTTTTCGCCTTTCACTTTGTTCTCCCATTCATTATTTCAGGGACCAGCATTGCTCACCTCCTATTTTTACACGAAACAGGATCTAACAATCCAACTGGTTTAAATCCCAACTATGATAAAATTCCTTTCCAC Bolitoglossa_morio_ENS_10475_UTA_A58527 AAAATTATTAATAACTCATTCATTGATCTTCCTGCGCCATTAAACCTATCTTATTTTTGAAACTTCGGCTCATTACTCGGAGTGTGTTTAATTTCACAAATTCTGACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCACCTCCGCATTTTCATCAGTAGCCCATATTTGCCGAGATGTTAATTATGGCTGAATAGCCCGAAACATTCACGCCAATGGAGCTTCTTTCTTCTTTATCTGCTTATATATACACATTGGACGGGGCATCTATTACGGCTCATTTATATTTAAAGAAACTTGAAACATCGGAATCCTCTTACTACTACTGGTAATAGCAACTGCATTCGTAGGTTATGTTTTACCGTGAGGACAAATATCCTTCTGAGGAGCAACTGTCATCACCAATCTTCTATCTGCAATCCCATACGTGGGGGATATATTAGTACACTGAATTTGAGGCGGCTTCTCAGTAGATAAAGCTACTCTCACCCGATTTTTCGCCTTTCACTTTATTCTCCCATTCATTATTTCAGGAGCTAGCATTGCTCACCTCCTATTTTTACACGAAACAGGGTCTAACAATCCAACTGGTTTAAATCCCAACTATGATAAAATTCCTTTCCAC Bolitoglossa_mulleri_MEA_1018_UTA_A50475 ----------ACAATTCATTTATTGATTTACCAACACCATTAAATTTATCTTACCTTTGAAATTTTGGCTCACTCCTTGGAGTCTGTTTAATTTCACAAATCCTAACAGGCTTATTCCTCGCAATACATTATACTGCAGATACTACCTCCGCATTTTCATCAATTGCCCATATTTGTCGAGATGTAAACTACGGATGAATAATTCGAAACATGCACGCCAACGGAGCCTCGTTCTTCTTTATTTGCCTTTATATGCATATCGGACGTGGCATTTATTATGGCTCATTTACATTTAAAGAGACTTGAAATATTGGAGTTATCCTTCTCCTTTTAGTTATAGCAACTGCATTTGTAGGTTATGTACTTCCATGGGGTCAAATATCATTTTGAGGGGCAACCGTAATTACCAACCTTCTATCTGCCATCCCATACTTAGGAGATATACTAGTACAGTGAATTTGAGGAGGGTTTTCAGTAGACAAAGCTACTCTTACCCGATTTTTTGCCTTTCACTTTATTCTTCCATTTATTATTGCTGGAGTAAGCATAGCACATCTCCT-TTTTTTCATGAAACAGGCT-TAATAACCCAGCCGGTCTCAACTCCAACTATGATATGCC---------- Bolitoglossa_oaxacensis_AF416681 AAAATTATCAACAACTCATTTATTGACCTTCCCACACCATTAAACCTGTCCTACCTCTGAAACTTTGGCTCACTTCTTGGAGTATGCTTGATTTCACAAATTCTGACAGGCCTATTCCTTGCAATACATTATACTGCTGACACCACCTCCGCATTTTCATCAGTAGCCCACATCTGCCGAGACGTAAACTACGGTTGAATAGTCCGGAGCCTTCATGCCAATGGAGCCTCACTTTTTTTTATTTGCCTATATATACATATCGGACGCGGCATTTACTATGGCTCATTTATATATAAAGAAACCTGAAACATCGGGATTGTTCTTCTTCTACTAGTAATGGCAACAGCATTCGTAGGCTATGTCTTGCCATGAGGACAAATATCCTTTTGGGGGGCAACCGTTATTACAAATCTTCTTTCTGCTATTCCATATGTAGGAGATATACTAGTGCAATGGATCTGAGGAGGATTCTCAGTAGACAAGGCCACCCTTATCCGATTTTTTGCATTTCACTTTATTCTTCCATTTATTATTGCGGGCACTAGTATTGCCCATCTCATTTTTTTGCACGAAACAGGCTCTAATAATCCAACTGGCCTTAACCCCAACTACGACAAAATTCCATTCCAC Bolitoglossa_occidentalis_AY526158 AAACTTTTAAATAATTCATTTATTGATTTACCCACTCCATTAAATTTATCCTACTTATGGAATTTTGGCTCCCTTCTTGGAATATGTCTAATCTCACAAATCCTAACAGGACTATTTCTTGCAATACATTATAATGCAGATACAAGTTCTGCATTCTCATCAGTATCCCATATCTGCCGAGATGTGAATTATGGATGATTAATTCGAAATATACATGCAAACGGAGCCTCACTATTTTTTATTTGCTTATATATACATATCGGCCGTGGCATTTATTACGGATCATTTATACTTAAAGAGACTTGAAACATTGGCACTGTACTCCTACTCCTAACAATAGCAACAGCATTTGTAGGATATGTCTTACCATGAGGACAGATATCGTTTTGAGGTGCAACAGTTATTACTAACCTTCTATCCGCTTTACCTTATTTAGGAGACACGCTAGTAAAGTGAGTTTGGGGAGGGTTTTCTGTCGATAATGCTACTCTTACTCGGTTTTTCACATTTCATTTTATTTTACCATTTATTATTATTGGGGTTAGTATAATTCACCTACTCTTTCTTCATCAAACAGGTTCTAATAATCCATTAGGATTAAATT--AATTATGATAAAAT-GTATTCCAC Bolitoglossa_odonnelli_MEA_446_UTA_A48591 AAAATTATTAACAACTCATTCGTTGACTTACCAACACCACTAAATCTATCTTATCTTTGAAATTTCGGCTCACTTCTTGGAGTGTGTTTAATTTCACAAATTCTAACAGGCCTATTTCTTGCAATACATTACACTGCAGATACTACCTCTGCATTCTCATCAGTTGCCCACATTTGTCGAGATGTAAACTATGGATGAATAGTTCGAAATATACACGCCAATGGAGCCTCATTCTTCTTTATTTGCCTATATATGCATATTGGACGCGGCATTTATTATGGCTCGTTTATATTTAAAGAGACTTGAAACATTGGGGTTCTTCTTCTCCTCTTAGTAATAGCAACAGCATTTGTAGGTTATGTACTACCGTGGGGTCAAATGTCATTCTGAGGGGCAACTGTAATTACTAACCTTCTATCTGCCATCCCATACTTAGGGGACATATTAGTGCAATGAATTTGGGGAGGGTTTTCAGTAGACAAAGCCACCCTTACCCGATTTTTTGCCTTTCACTTTATTCTTCCATTTGTCATTGCTGGAATAAGCATAGCACACCTCCTTTTTTTCATGAAACAGGTTCTAATAACCCAATGGCTTAGTCA---------------------------- Bolitoglossa_palmata_AY526164 AAAATTATTAATAACTCATTTATTGATTTGCCAGCACCATTAAATTTATCCTATCTCTGAAACTTTGGATCCCTTCTCGGAGTATGCCTCATCTCACAAATCATTACTGGTCTATTCCTCGCAATACACTATACTGCAGACACAACATCAGCATTTTCATCAGTAGCCCACATTTGTCGAGATGTCAATTATGGCTGAATAATACGAAATATTCATGCAAACGGAGCCTCACTATTTTTTATTTGCCTATATATACATATTGGACGAGGCATTTATTATGGCTCTTTCATATTTAAAGAAACCTGAAACATCGGAATTGTCCTACTACTTCTAATAATAGCAACAGCATTTGTCGGATATGTTTTACCCTGAGGTCAAATATCTTTCTGAGGAGCAACAGTCATTACTAATTTACTTTCAGCAGTACCATATGCAGGTAACACACTAGTACAATGAATCTGAGGCGGATTCTCAGTGGACAAAGCCACCCTTACCCGATTTTTCGCCCTCCACTTTATTTTACCCTTTATTATTACAGGGGTTAGCATTGTTCACCTTCTATTTTTACATGAAACAGGATCAAACAACCCCACCGGCCTTAATACCAACTATGACAAAGTCCAATTTCAC Bolitoglossa_paraensis_AY526166 AAAATTATTAATAACTCATTCATCGACCTACCCGCACCATTAAACCTATCCTACCTGTGAAATTTTGGATCCCTCCTCGGAGTATGCCTCATCTCACAAATTATCACAGGCCTATTCCTCGCAATACACTATACTGCAGACACAACACTAGCATTTTCATCAGTAACTCATATTTGTCGAGATGTCAACTATGGTTGAATAATACGAAACATTCATGCAAACGGAGCTTCACTATTCTTTATCTGTTTGTATATACATGTTGGACGAGGCATTTATTATGGCTCATTTATATTTAAAGAAACCTGAAACATCGGAATTATTTTACTGCTTCTAACAATGGCAACAGCATTTGTTGGCTATGTTTTACCTTGAGGACAGATATCTTTCTGAGGGGCAACAGTCATTACTAATCTACTATCAGCAGTACCATACGTAGGAAATACATTAGTGCAATGAATTTGAGGCGGATTCTCAGTAGACAAAGCTACCCTTACCCGATTTTTCGCCATCCACTTTATTTTACCGTTCATCATTGCAGGAGTTAGTATTATCCACCTTCTATTTCTACATGAAACAGGATCAAATAACCCAACTGGCCTTAATACCAACTATGACAAAATCCAATTTCAT Bolitoglossa_paraensis_AY526167 AAAATGATTAACAACTCATTCATCGACTTACCTACACCACTAAACCTATCCTACCTGTGGAATTTTGGATCCCTCCTCGGAGTATGCCTCATTTCACAAATTATTACTGGCCTATTCCTCGCAATACACTATACTGCAGATACAACACTAGCATTTTCATCAGTAACCCACATTTGTCGAGATGTCAATTACGGCTGGATAATACGAAATATTCATGCAAACGGAGCTTCACTATTTTTTATCTGCTTGTATATACATGTTGGACGAGGTATATATTATGGCTCCTTTATATTTAAGGAAACCTGAAACATCGGAATTATCTTATTACTTCTAACAATAGCAACAGCATTTGTTGGTTATGTCTTACCATGAGGACAAATATCTTTCTGAGGAGCAACAGTTATTACTAACCTACTATCAGCAGTACCATACATAGGAAATACACTGGTACAATGAATTTGAGGCGGATTCTCGGTAGACAAGGCTACCCTGACCCGATTTTTTGCCATCCACTTCATTTTACCGTTTATCATTGCGGGACTCAGCATTCTCCACCTACTATTCCTACATGAAACAGGATCAAATAACCCAACCGGCCTTAATACCAACTATGACAAAA----------- Bolitoglossa_paraensis_AY526168 AAAATCATTAATAATTCATTTATTGACCTGCCCACACCATTAAACTTATCCTATCTCTGAAATTTTGGATCGCTTCTTGGAGTGTGCCTAATCTCACAGGTCATTACAGGCCTATTTCTCGCAATACATTATACTGCAGATACAACATCAGCATTTTCATCAGTAGCCCACATTTGCCGAGATGTCAACTATGGCTGAATAATACGAAATATTCATGCAAACGGAGCCTCACTATTTTTTATTTGCTTATATATACACGTTGGACGAGGCATTTATTATGGATCCTTTATATTTAAAGAGACCTGAAACATTGGGATTATTTTACTACTCCTAGCAATAGCTACAGCATTTGTTGGTTATGTTTTACCATGAGGACAAATATCTTTCTGAGGAGCAACAGTCATTACTAATTTATTATCGGCAGTACCATATGTAGGCAATACACTAGTACAGTGAATTTGAGGTGGATTCTCAGTAGATAAAGCCACCCTCACCCGATTTTTTGCTCTACACTTTATTCTACCATTTATTATTGCAGGGATTAGTATTATTCACCTTCTATTATTACATGAAACAGGGTCAAGTAACCCTACTGGCCTTAATGCAAGCCATGACAAAATCCA------- Bolitoglossa_peruviana_AY526169 -----------------ATTTATTGACCTGCCTACGCCATTAAATTTATCTTATTTGTGAAACTTCGGATCCCTTCTCGGAATTTGCTTCATCTCACAAATCATTACTGGCTTATTCCT-GCAATACATTATATTGCAGACACAACATTAGCATTTTCATCAGTAGCTCATATTTGTCGAGATGTTAACTATGGTTGAATAATACGAAATATTCATGCAAACGGAGCCTCACTGGTTTTTATTTGCTTGTATATACATGTAGGACGAGGCATTTACTATGGCTCTTTCATATATAAAGAGACCTGAAACATTGGAATCATCTTACTACTTTTAATGATGGCAACAGCGTTTGTTGGATATGTTTTGCCATGAGGACAAATATCTTTCTGAGGAGCAACAGTTATTACTAA-TTACTATCAGCAGTACCATATGTGGGTAACACATTAGTACAATGAATCTGAGGCGGATTCTCAGTGGACAAAGCCACCCTTACCCGATTTTTTGCCCTCCATTTTATTTTACCCTTTATCATTGCAGGAGTAAGCATTGTTCATCTTTTATTTTTACACGAGACAGGATCAAGTAATCCTACTGGACTTAA---------------------------- Bolitoglossa_peruviana_AY526170 AAAATTATTAACAACTCATTTATTGACCTACCTACACCATTAAACTTATCTTATCTCTGAAATTTCGGGTCCCTTCTCGGAGTATGCCTTATTTCACAAATCATTACCGGCCTATTCCTCGCAATACATTATACTGCAGACACAACATTAGCATTTTCATCAGTAGCCCACATTTGCCGAGATGTTAACTATGGCTGAATAATACGGAATATTCATGCAAATGGAGCCTCGCTATTTTTTATTTGCTTATATATACATATTGGACGAGGTATTTATTATGGTTCTTTCATATTTAAAGAGACCTGAAACATTGGAATTATTTTATTACTACTAATAATAGCAACAGCATTTGTTGGATATGTTCTACCCTGAGGACAAATATCTTTCTGAGGGGCAACAGTAATTACTAATCTTCTATCAGCAGTACCATATATAGGCAATACACTAGTACAATGGATTTGAGGTGGCTTCTCAGTAGATAAAGCTACCCTCACCCGATTTTTTGCTCTCCATTTTATTTTACCATTTATTATTACAGGAATTAGCATTGTCCACCTACTATTCTTACATGAAACAGGGTCAAACAACC----------------------------------------- Bolitoglossa_pesrubra_AF212084 AAAGTCATTAATAACTCATTTATCGACCTGCCAGCACCATTAAACCTATCATATCTTTGAAATTTTGGGTCACTTCTCGGAGTATGCCTTATCTCACAGGTTTTTACAGGCCTATTTCTTGCAATACATTACACTGCAGATACAACATCTGCATTCTCATCAGTAGCACACATCTGCCGTGATGTAAACTACGGCTGAATAATACGAAACATTCATGCAAACGGAGCCTCCCTATTTTTTATCTGTTTATACATACATATTGGCCGAGGCCTTTACCACGGCTCCTTCATGTTTAAAGAGACCTGAAACATCGGAATTGTTTTGTTACTCTTAACAATAGCAACAGCATTCGTCGGATATGTTTTGCCATGAGGACAAATATCTTTCTGAGGAGCAACCGTTATTACCAACCTATTATCAGCTCTACCATATGTAGGCAATACACTAGTACAATGGATCTGAGGCGGATTCTCAGTTGATAGCGCCACCCTTACCCGATTTTTTGCCTTCCACTTCATCTTACCGTTCATTATTGCAGGGGTAAGTGTTGCCCACCTCCTATTTTTACACGAAACAGGATCTAACAACCCAACCGGTCTAGACCCAAACCACGATAAAATCCCATTTCA- Bolitoglossa_platydactyla_AF212981 -------------------------ATTTACCTACACCATTAAATTTATCTTACCTTGGAAATTTTGGTTCACTTCTTGGAGTATGTCTAATTTCACAAATTCTAACAGGCCTATTTCTGGCAATGCATTATACTGCAGATACTACCTCCGCATTTTCATCAGTAGCCCACATCTGTCGAGATGTAAACTACGGATGAGTAATTCGAAATATACATGCTAATGGGGCCTCATTTTTCTTTATCTGCCAATATATACACATTGGACGCGGCATTTACTACGGCTCATTTATATTTAAAGAAACCTGAAATATTGGTATTATCCTTCTCCTTTTAGTGATGGCAACAGCATTCGTAGGTTATGTATTACCATGAGGACAAATATCATTTTGAGGAGCAACTGTAATTACAAACCTCCTATCTGCCATCCCATACCTAGGAGACATGTTAGTACAATGGATCTGAGGAGGATTTTCAGTAGACAAAGCCACCCTTACCCGATTCTTTGCCTTCCATTTTATTCTCCCATTTATTATTGCTGGAGCAAGTGTAGCTCACCTTCTCTTTCTTCATGAAACAGGCTCCAATAACCCAACCGGCCTCAACCC------------------------- Bolitoglossa_platydactyla_AY133484 AAAATTATTAATAACTCATTTATTGATTTACCTACACCATTAAATTTATCTTACCTTTGAAATTTTGGCTCACTTCTCGGAGTATGTCTAATTTCACAAATTCTGACAGGCCTATTTCTTGCAATACATTATACTGCAGATACTACCTCCGCATTTTCATCAGTAGCCCACATCTGTCGAGATGTAAACTACGGATGAATAATTCGAAATATACATGCTAATGGGGCCTCATTTTTCTTTATCTGCCTATATATACACATTGGACGCGGCATTTATTATGGCTCATTTATATTTAAAGAAACCTGAAACATTGGTATCATCCTTCTCCTTTTAGTGATGGCAACAGCATTCGTAGGCTATGTATTACCATGAGGACAAATATCATTCTGAGGAGCAACTGTAATTACAAACCTCCTATCTGCCATCCCATACCTAGGAGACATGTTAGTACAATGAATCTGAGGAGGATTTTCAGTAGACAAGGCCACCCTTACCCGATTCTTTGCCTTCCATTTTATTCTTCCATTTATTATCGCTGGAGCAAGTATAGCTCACCTTCTTTTTCTTCATGAAACAGGCTCCAATAACCCAACCGGCCTCAACCCTAACTATGATAAAATCCCTTTTCAT Bolitoglossa_porrasorum_AY526188 AAAATTAT-AATAACTCATTTATTGATCTTCCCACACCATTAAACCTATCATATTTTTGAAATTTTGGCTCACTTCTTGGAGTATGTCTAATTTCACAAATCTTGACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCGCCTCCGCCTTTTCATCAGTAGCCCATATCTGCCGAGATGTTAATTACGGCTGGGTAATCCGAAATATCCACACCAACGGGGCTTCTTTATTTTTTATTTGCTTATATATACATATCGGACGAGGCATTTATTATGGTTCATTTATATTTAAAGAAACCTGAAATATCGGAATTATCCTCCTACTTCTAGTAATAGCAACCGCATTCGTAGGCTATGTTTTACCATGAGGACAGATATCCTTTTGAGGGGCAACAGTTATCACCAACCTTCTGTCCGCAGTCCCATATGTAGGAGATATCTTAGTACAATGAATCTGGGGGGGATTCTCGGTAGATAAAGCTACCCTAACCCGATTCTTTGCCTTTCACTTTGTCCTCCCATTTATTATTGCAGGAGCCAGTATCGTACACCTCCTCTTTCTACACGAGACAGGATCTAATAACCCAACTGGCCTCAACCCCAATTATGATAAAATCCCATTCCAC Bolitoglossa_riletti_AF416682 AAAATTATTAACAACTCATTTATCGACCTTCCCACACCATTAAACCTGTCCTATCTCTGAAACTTTGGCTCACTTCTTGGGGTTTGTCTTATTTCACAGATTCTAACAGGCCTATTCCTTGCCATACACTACACTGCTGACACCACTTCCGCATTCTCATCAGTAGCCCATATCTGTCGAGATGTAAATTATGGCTGGATAGTTCGAAGCCTTCACGCTAACGGAGCCTCATTATTTTTTATTTGTCTCTATATACACATTGGACGCGGCATTTACTACGGCTCGTTTACATACAAAGAGACTTGAAACATCGGGATTTTACTTCTTCTGCTAGTAATAGCAACAGCATTCGTAGGTTACGTCCTGCCATGAGGACAAATATCCTTCTGAGGAGCAACTGTTATCACCAACCTTCTCTCCGCAATTCCGTATGTGGGCGATACACTGGTACAGTGAATCTGAGGGGGGTTTTCAGTAGACAAAGCTACCCTCACCCGATTTTTTGCATTTCATTTTATCCTTCCATTTGTCATTGCAGGGGCCAGCATCGCTCATCTTATTTTTCTACACGAAACAGGATCAAACAACCCAATTGGCCTTAATCCTAGTTATGATAAAATTCCATTTCAC Bolitoglossa_robusta_EU448110 AAAATTATTAATAACTCATTTATTGACCTACCCACACCATTAAATTTATCCTATCTCTGAAACTTCGGATCACGTCTTGGAGTGTGCCTTATCTCACAAATCCTTACAGGCCTATTCCTTGCAATACACTACACTGCAGACACAACATTAGCATTCTCATCAGTAGCCCACATCTGTCGAGATGTTAATTATGGCTGAATAATACGAAATATTCATGCAAATGGAGCCTCATTATTTTTTATCTGCTTATATATACATATTGGACGAGGCATTTACTATGGCTCCTTTATATTTAAAGAAACCTGAAACATTGGTATTATTCTGTTACTTTTAGTAATAGCAACAGCATTTGTCGGATATG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Bolitoglossa_rostrata_AY526189 ---------------TCATTCATCGATCTCCCCG-A-CATTAAACCTATCTTATCTTTGAAATTT-GGCTCTCTCCTCGGAGTATGCTTAATCTCACAAATTTTAACGGGCTTATTTCTTGCAATACACTACACTGCAGATACTAGCTCCGCATTTTCATCAGTAGCCCATATTTGTCGAGATGTTAATTATGGTTGAATAATCCGAAATATCCACGCCAACGGAGCCTCAGTATTTTTTATCTGCTTATATATACATATTGGACGTGGTATTTACTATGGCTCATTCATATTCAAAGAAACCTGAAACATTGGAATTAT-CTCCTACTACTAGTAATAGCCACTGCATTTGTAGGTTA-GTCTTACCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Bolitoglossa_rostrata_AY526190 ---------------------------------------------------------------------------------------------------------------------------------------------------TC-GCATTTTCATCAGTAGCCCATATTTGTCGAGATATTAATTATGGTTGAATAATCCGAAATATCCACGCCAACGGAGCCTCAGTATTTTTTATCTGCTTATATATACATATCGGACGTGG-ATTTACTATGGCTCATTCATATTCAAAGAAACCTGAAACATTGGAATTATTCTTCTACTACTAGTAATAGC-ACTGCATTTGTAGGTTACGTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Bolitoglossa_rufescens_AY526159 AAATTTTTAAATAATTCATTTATTGATTTACCTGCTCCCCTAAATTTATCTTATATGTGAAATTTTGGTTCCCTTCTTGGTTTATGTTTAATTTCACAAACCATGACAGGACTATTTCTTGCTATACACTACACTGCGGATACAGCTTCCGCTTTTTCATCAGTGGCTCATATCTGTCGAGATGTAAATTACGGGTGACTAATTCGTAATGTTCATGCTAATGGTGCTTCATTCTTTTTCATTTGTTTATATATGCATATCGGACGCAGCATTTATTACGGATCATTTATATTTAAACAAACTTGAAATATAGGAATAACCCTTTTAGTTTTAACAATAGCAACAGCATTTGTAGGTTATGTCCTACCGTGAGGACAGATATCATTTTGGGGCGCAACAGTTATTACTAACCTTTTATCCGCTTTTCCATACTCAGGAGACATCCTAGTACAGTGAGTATGGGGAGGGTTTTCTGTAGATAGTGCTACTCTTACTCGATTTTTCACATTTCATTTTACCTTGCCATTCGTAATTATTGGGACAAGCATGATCCACCTTCTTTTCCTCCATGAAACTGGTTCAAATAACCCTACAGGTTTAAATTCCTATTATGATAAAATTCCATTCCA- Bolitoglossa_rufescens_JAC_19278_UTA_A51491 ----------------------------TACCAACTCCATTAAATTTATCCTACTTATGAAATTTTGGTTCTCTTCTTGGAATCTGTCTAATTTCACAAATTTTAACAGGACTATTTCTTGCAATACATTATAATGCAGATACAAGTTCTGCATTTTCATCAGTATCCCATATCTGCCGAGATGTGAATTATGGGTGATTAATCCGAAATATACATGCAAACGGAGCTTCATTATTTTTTATTTGCTTATATATACATATCGGACGAGGCATTTATTATGGATCATTTATACTTAAAGAGACTTGAAACATTGGCACAGTACTTTTACTCCTAACAATAGCAACAGCATTTGTAGGATACGTTCTACCATGAGGACAGATATCATTCTGAGGTGCAACAGTTATTACTAACCTTTTATCCGCTTTACCTTATTTAGAAAACACGCTAGTAAAGTGAGTTTGGGGAGGGTTTTCTGTCGATAATGCTACTCTTACTCGGTTTTTCACATTTCATTTTATCTTACCATTTGTCATTATTGGGGTTAGTATAATTCACCTTCTCTTTCTTCATCAAACATGGTTCTAATAATCCATTAGGATTAAATTCCAATTATGATAAAATCCCATTTCA Bolitoglossa_schizodactyla_AY526171 -----TATTAATAACTCGTTTATTGACTTACCTACACCATTAAATTTATCTTATCTCTGAAATTTCGGATCACTCCTTGGAGTATGCCTTATCTCACAAATCCTTACAGGCCTATTTCTTGCTATACATTACACCGCAGACACAACATCAGCATTTTCATCAGTAGCCCACATCTGCCGAGATGTTAATTATGGCTGAATAATACGAAGCATTCATGCAAATGGAGCCTCACTATTCTTTATTTGCTTATACATACATATTGGACGCGGCATCTATTACGGCTCTTTTATATTTAAAGAAACCTGAAATATTGGTATTATTCTCTTACTGTTAGTAATAGCAACAGCATTTGTTGGGTATGTATTGCCATGAGGACAGATATCTTTCTGAGGAGCAACCGTTATTACTAACTTATTATCAGCAGTACCTTACCTAGGCAACACTTTAGTACAATGAATTTGAGGCGGATTCTCAGTAAACAAAGCCACCCTCACCCGATTTTTCGCCATCCACTTTATTTTACCGTTTATTATTGCAGGGGCCAACATTGTCCACTTACTATTTTTACACGAAACAGGA-CAAACAACCCTACTGGCCTTAATACTTATCATGACAAAATCCAATTTCAC Bolitoglossa_sima_AY526172 -----------------------------------------------------------AAATCTTGGATCCCTTCTCGGAG---------------------TTACAGGTCTATTCCTTACGATACACTATACTGCAGACACAACATCAGCATTCTCATCAGTAGCCCATATCTGTCGAGATGTCAACTATGGTTGAATAATACGAAGTGTTCATGCAAA-GGAGCCTCACTATTCTTCATTTGCCTGTACATACACATTGGGCGTGGCATCTACTACGGCTCTTTTATGTTCAAAGAAACATGAAACATCGGAATTGTTCTTCTTCTCCTAGTCATAG---CAGCATTTGTTGGATATGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Bolitoglossa_sp._2_AY526174 -------TTAATAACTCGTTTATCGACCTGCCAACACCATTAAACTTGTCCTATGTCTGAAACTTTGGATCACTTCTCGGAGTATGTCTTATTTCGCAGATCCTTACAGGCCTATTTCTTGCAATACATTATACTGCAGATACAACATTAGCATTCTCATCAGTAGCCCACATCTGTCGAGATGTTAACTATGGCTGAATAATACGAAGTATCCATGCAAATGGAGCCTCACTGTTTTTTATTTGCTTATATATACACATTGGACGCGGCATCTACTATGGCTCCTTTATGTTTAAAGAGACCTGAAACATTGGAGTTATTCTTCTACTCTTAGTAATAGCAACAGCATTTGTTGGGTATGTACTACCATGAGGACAAATATCTTTCTGAGGAGCAACAGTTATTACCAACCTGTTGTCCGCAGTACCATACTTAGGCAATATACTAGTACAGTGAATTTGAGGAGGATTCTCAGTAGATAAAGCTACCCTCACCCGATTTTTTGCCATCCATTTTATCTTACCTTTTATTATTGCAGGAGTTAGCATTGTTCACCTACTATTTTTGCACGAAACAGGGTCCAACAATCCTACGGGCCTTAACA--AATTATGAC-AAATCCAATTTC-- Bolitoglossa_sp.1_AY526173 AAAATTATTAATAATTCATTTATTGATTTACCTACACCATTAAATTTATCTTACCTCTGAAATTTTGGGTCCCTTCTTGGAGTGTGTCTTATTTCACAAATCATTACAGGCCTATTCCTTGCAATACACTATACTGCAGACACAACACTAGCATTTTCATCAGTAGCCCACATTTGTCGAGATGTCAATTATGGTTGAATAATACGAAATACTCATGCAAATGGAGCCTCACTATTTTTTATTTGCCTATATATACATATTGGACGAAGCATTTATTATGGCTCTTTCATATTTAACGAAACATGAAACATCGGAATTATTCTTCTACTTCTAGTAATAGCAACAGCATTTGTTGGGTATGTCTTACCCTGAGGACAAATATCTTTCTGAGGAGCAACAGTCATTACTAACCTACTATCGGCAGTACCATATGTAGGCAATACACTAGTACAATGGATTTGAGGCGGATTCTCAGTGGACAAGGCCACCCTTACTCGATTCTTCACCCTCCACTTTATTTTACCATTTATTATTGCAGGAATTAGCATTGTTCACCTACTATTCTTACATGAAACAGGATCAAACAACCCTACCGGTCTTAGCACCAACCATGACAAAATCCAATTTCAC Bolitoglossa_sp.3_AY526191 AAAATTATTAATAATTCATTCATTGATCTTCCCGCACCATTAAATTTATCTTATTTTTGAAATTTCGGCTCACTTCTCGGAGTATGTCTTATCTCACAAATTTTAACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCACCTCTGCATTTTCATCAGTGGCTCACATTTGCCGAGATGTTAATTTTGGTTGAATAACCCGAAATATTCATACCAATGGGGCTTCTTTATTTTTTATCTGCTTATATATACACATTGGACGAGGTATCTATTACGGCTCATTTATATTTAAAGAGACTTGAAACATTGGAATTCTACTACTACTACTAGTAATGGCAACTGCATTCGTAGGCTATGTCCTACCATGAGGACAGATATCCTTTTGAGGAGCAACCGTTATCACCAACCTTTTATCCGCAATCCCATATGTAGGAGATATATTAGTGCACTGAATCTGAGGGGGATTCTCAGTAGACAAAGCTACTCTTACCCGATTTTTCGCCTTTCACTTCATTCTTCCATTTATTATTGTAGGAACTAGCATTGCTCATCTTCTCTTTTTACACGAGACAGGATCTAGTAACCCAACCGGTCTCAATCCCAATTATGACAAAATTCCATTCCAC Bolitoglossa_sp.3_AY526192 AAAATTATTAATAATTCATTCATTGATCTTCCCGCACCATTAAATTTATCTTATTTTTGAAATTTCGGCTCACTTCTCGGAGTATGTCTTATTTCACAAATTTTAACAGGCCTATTTCTTGCAATACACTACACTGCAGATACCACCTCTGCATTTTCATCAGTGGCTCACATTTGCCGAGATGTTAATTTTGGCTGAATAACCCGAAATATTCATACCAATGGGGCTTCTTTATTTTTTATCTGCTTATATATACACATTGGACGAGGTATCTATTACGGCTCATTTATATTTAAAGAGACTTGAAACATTGGAATTCTACTACTACTACTAGTAATGGCAACTGCATTCGTAGGCTATGTCCTACCATGAGGACAGATATCCTTTTGAGGAGCAACCGTTATCACCAACCTTTTATCCGCAGTCCCATATGTAGGAGATATATTAGTGCACTGAATCTGAGGGGGATTCTCAGTAGACAAAGCTACTCTTACCCGATTTTTCGCCTTTCACTTCATTCTTCCATTTATTATTGCAGGAACTAGCATTGCTCATCTTCTCTTTTTACACGAGACAGGATCTAGTAACCCAACCGGTCTCAACCCCAATTATGACAAAATTCCATTCCAC Bolitoglossa_striatula_AF212982 ------------------------------------------------------------------------------------------------------------------------------------------------------GCACTTTCATCAGTTGCCCATATTTGCCGAGA-GTAAACTACGGATGAACAGTTCGAAATATACACACCAACGGGGCCTCATTCTTCTTTATTTGCCTTTATATGCATATCGGACGTGGCATTTATTATGGCTCATTTATATTTAAAGAGACTTGAAACATTGG-GTAATCCTTCTTCTCTTGGTTATAGCGACAGCATTTGTAGGTTATGTAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Bolitoglossa_stuarti_JAC_19518_UTA_A58145 AAATTATTAGTAATTCATTTATTGAC{CT}T{CT}CCCAACACCACTAAACCTATCTTACTTTTGAAACTTTGGCTCACTTCTAGGAGTATGTTTAATTTCACAAATTTTAACAGGTCTATTCCTCGCAATACTTTATACTGCAGATACCGCTTCTGCATTCTCATCAGTAGCCCACATCTGTCGAGATGTAAATTATGGATGAATAATTCGAAATATCCACGCTAATGGAGCCTCATTCTTTTTTATTTGTTTATATATACACATTGGACGCGGCATTTATTATGGATCATACATTTTTAAAGAAACTTGAAATATCGGTATTGTTCTTTTATTTTTAATAATAGCAACAGCATTCATAGGCTATGTTCTGCCATGAGGACAAATATCATTTTGAGGTGCAACAGTAATTACTAACCTCCTGTCTGCTACCCCATACCTGGGAGATATATTAGTGCAATGAATCTGAGGAGGATTCTCAGTAGATAAAGCTACCCTCACTCGATTCTTTGCCTTCCACTTCATTCTTCCATTCATTATTGCCGGCATCAGCATATTACACCTTCTATTTCTTCACGAAACGGGCTC{AG}AACAACCCTACAGGTCTCAACTCCAACTATGACAAAATCCCATTCCAC Bolitoglossa_suchitanensis_MEA_1911_UTA_A58149 AAAATCATTAATAACTCATTCATTGATCTCCCTGCGCCACTAAACCTATCTTATTTTTGAAACTTCGGCTCACTACTCGGAGTATGCCTAATTTTACAAATCCTAACAGGCCTATTTCTTGCAATACATTACACTGCAGATACCACCTCTGCATTTTCATCAGTAGCTCATATTTGCCGAGATGTTAACTATGGCTGAATAGCCCGAAACATTCACGCCAATGGAGCTTCTTTCTTCTTTATTTGCTTATATATACACATTGGACGGGGCATCTATTACGGCTCATTTATATTTAAAGAAACTTGAAACATTGGAATCATCTTACTACTACTAGTAATAGCAACTGCATTCGTAGGCTATGTCTTACCATGAGGACAGATATCCTTCTGAGGAGCCACTGTTATCACCAATCTTCTATCCGCAATCCCATACGTAGGAGATATATTAGTACACTGAATTTGAGGTGGCTTCTCAGTAGATAAAGCTACTCTAACCCGATTTTTCGCCTTTCACTTTGTCCTTCCGTTCATTATCTCAGGGGCTAGTATTGCCCACCTCCTATTTTTACACGAAACAG----------------------------------------------------- Bolitoglossa_suchitanensis_MEA_1926_UTA_A58150 AAAATCATTAATAACTCATTTATTGATCTCCATGC{AG}CCATTAAACCTATCTTATTTTTGAAATTTCGGCTCACTACTCGGAGTATG{CT}{CT}TAATTTCACAAATCCTGACAGGCCTATTTCTTGCAATACATTACACTGCAGATACCACCTCTGCATTTTCATCAGTAGCTCATATTTGCCGAGATGTTAACTATGGCTGAATAGCCCGAAACATTCACGCCAATGG{AG}GCTTCTTTCTTCTTTAT{CT}TG{CT}TTATATATACA{CT}ATTGGACG{GT}GGCATCTATTACGGCTCATTTATATTTAAAGAAACTTGAAA{CT}ATTGGA{AG}T{CT}ATCTTA{CT}TA{CT}TACT{AG}GTAATAGCAACTGC{AG}TTCGTAGGCTATGT{AC}TTACCATGAGGACA{AG}ATATCCTTCTGAGGAGC{CG}ACTGTTATCACCAATCTTCTATCCGCAATCCC{AG}TACGTAGG{AG}GA{CT}ATATTAGTACA{AC}TGAAT{CT}TGAGG{CT}GGCTTCTCAGTAGATAAAGC{CT}ACT{CT}TAACCCGATT{CT}TTCGCCTTTCACTTTGT{CT}CT{CT}CC{AG}TTCATTAT{CT}TCAGGG{AG}CCAG{CT}ATTGC{CT}CACCTCCTATTTTTACACGAAAC{AG}GG{AG}TCTAACAATCCAACTGGTTTAAACCCCAACTAT{AG}ATAAAAT{CT}CCTTTCCA{CT} Bolitoglossa_suchitanensis_MEA_1933_UTA_A58422 AAAATCATTAATAACTCATTCATTGATCTCCCTGCGCCACTAAACCTATCTTATTTTTGAAACTTCGGCTCACTACTCGGAGTATGCCTAATTTTACAAATCCTAACAGGCCTATTTCTTGCAATACATTACACTGCAGATACCACCTCTGCATTTTCATCAGTAGCTCATATTTGCCGAGATGTTAACTATGGCTGAATAGCCCGAAACATTCACGCCAATGGAGCTTCTTTCTTCTTTATTTGCTTATATATACACATTGGACGGGGCATCTATTACGGCTCATTTATATTTAAAGAAACTTGAAACATTGGAATCATCTTACTACTACTAGTAATAGCAACTGCATTCGTAGGCTATGTCTTACCATGAGGACAGATATCCTTCTGAGGAGCCACTGTTATCACCAATCTTCTATCCGCAATCCCATACGTAGGAGATATATTAGTACACTGAATTTGAGGTGGCTTCTCAGTAGATAAAGC{CT}ACTCTAACCCGATTTTTCGCCTTTCACTTTGTCCTTCCGTTCATTATCTCAGGGACTAGTATTGCCCACCTCCTATTTTTACACGAAACAGGGTCTAACAATCCAACTGGTTTAAACCCCAACTATGATAAAATTCCTTTCCAC Bolitoglossa_suchitanensis_MEA_1936_UTA_A58423 AAAATCATTAATAACTCATTCATTGATCTCCCTGCGCCACTAAACCTATCTTATTTTTGAAACTTCGGCTCACTACTCGGAGTATGCCTAATTTTACAAATCCTAACAGGCCTATTTCTTGCAATACATTACACTGCAGATACCACCTCTGCATTTTCATCAGTAGCTCATATTTGCCGAGATGTTAACTATGGCTGAATAGCCCGAAACATTCACGCCAATGGAGCTTCTTTCTTCTTTATTTGCTTATATATACACATTGGACGGGGCATCTATTACGGCTCATTTATATTTAAAGAAACTTGAAACATTGGAATCATCTTACTACTACTAGTAATAGCAACTGCATTCGTAGGCTATGTCTTACCATGAGGACAGATATCCTTCTGAGGAGCCACTGTTATCACCAATCTTCTATCCGCAATCCCATACGTAGGAGATATATTAGTACACTGAATTTGAGGTGGCTTCTCAGTAGATAAAGCTACTCTAACCCGATTTTTCGCCTTTCACTTTGTCCTTCCGTTCATTATCTCAGGGGCTAGTATTGCCCACCTCCTATTTTTACACGAAACAGGGTCTAACAATCCAACTGGTTTAAACCCCAACTATGATAAAATTCCTTTCCAC Bolitoglossa_synoria_AY526193 -------TTAATAATTCATTTATTGATCTTCCCGCACCATTAAATCTATCATATTTTTGAAATTTCGGCTCACTCCTTGGAGTATGTCTTATTTCACAAATTCTAACAGGACTATTTCTTGCAATACACTACACTGCAGATACCACCTCCGCATTTTCATCGGTAGCCCACATTTGCCGAGATGTTAACTACGGCTGAATAACCCGAAGTATTCATACCAACGGAGCTTCTTTATTCTTTATCTGCTTATATATACACATTGGACGAGGCATTTATTATGGCTCATTTATATTTAAAGAAACTTGAAATATTGGAATCCTACTACTGCTACTAGTAATGGCAACTGCATTCGTGGGTAATGTATTACCATGAGGACAAATATCCTTTTGAGGAGCAACCGTTATCACCAACCTTTTATCAGCAATCCCATATATAGGAGATATATTAGTACACTGAATTTGAGGGGGATTCTCAGTCGACAAGGCTACTCTAACCCGATTTTTTGCCTTTCACTTCATTCTTCCATTTATTATTGTGGGAGCTAGCATTGCACATCTTATCTTTTTACACGAAACGGGATCTAATTATCCAACCGGCCTCAACCCCA----------------------- Bolitoglossa_yucatana_AF212980 AAAATTATTAACAACTCATTTATTGACCTACCAACACCATTAAATTTATCTTACCTTTGAAATTTTGGCTCCCTCCTTGGAGTGTGCTTAATTTCACAAATTCTAACAGGCTTATTTCTTGCAATACATTATACTGCAGATACTGCCTCTGCATTTTCATCAGTTGCTCATATCTGTCGAGATGTAAACTACGGATGAATAGTTCGAAATGTACACGCCAACGGGGCCTCATTTTTCTTTATTTGCCTATATATGCATATTGGACGCGGTATTTATTATGGCTCATTTATATTTAAAGAGACCTGAAATATTGGAGTTATTCTTCTTCTCTTAGTAATAGCAACAGCATTTGTAGGCTATGTACTACCATGAGGTCAAATATCATTCTGAGGGGCAACCGTGATTACTAACCTCCTATCTGCTATCCCATACTTAGGAAACATATTAGTAGAGTGAATTTGAGGGGGGTTTTCAGTAGACAAGGCTACTCTTACCCGATTTTTTGCCTTTCATTTTATTCTTCCATTTATTGTTGTTGGAATAAGCATCGCACACCTCCTCTTTCTTCATCAAACAGGCTCTAATAACCCAACCGGACTCAACCCTAACTACGACAAAATTCCATTTCAC Bolitoglossa_zapoteca_AF416684 AAAATTATTAATAATTCATTTATTGATCTTCCTACACCACTAAACCTGTCCTACCTATGAAACTTTGGCTCACTTCTTGGAGTATGCCTGATTTCACAAATTCTAACAGGCCTATTCCTTGCCATGCACTACACCGCTGACACAACTTCTGCATTTTCATCAGTTGCCCACATCTGCCGAGATGTAAACTATGGCTGGACAGTCCGGAACCTTCACGCCAATGGAGCCTCACTATTTTTTATCTGTCTTTATATGCATATTGGACGTGGCATTTACTACGGCTCATTTATATATAAAGAAACTTGAAACATCGGAATTATACTTCTTCTGCTAGTAATAGCAACAGCATTCGTAGGCTATGTCCTGCCATGAGGACAAATATCCTTTTGAGGGGCAACCGTTATTACCAATCTTCTCTCCGCAATCCCGTATATTGGTGATACACTCGTGCAGTGAATCTGGGGAGGTTTCTCAGTAGACAAGGCCACCCTCACCCGATTTTTCGCATTTCATTTTATTCTTCCATTTATCGTTGCAGGAGCTAGCATCGCCCACCTCATTTTTTTGCATGAAACAGGGTCCAATAACCCAACTGGCCTTAACCCCAACTATGATAAAATCCCATTTCAC Pseudoeurycea_rex_MEA_1626_UTA_A58532 AAAATTATTAACAACTCCTTCATCGACCTGCCCGCACCACTAAACCTATCATATCTTTGAAACTTTGGCTCATTATTAGGAGTATGTCTTATTTCACAAATCCTGACAGGACTATTCCTGGCAATACATTACACCGCAGATACATCTTCTGCATTTTCATCAATTGCCCACATCTGCCGAGATGTTAACTACGGCTGAGTAATTCGAAATATTCACGCCAACGGAGCCTCATTTTTCTTCATCTGCATATATATACACATCGGACGAGGAATCTATTACGGCTCCTTCATATATAAAGAAACCTGAAGTATTGGGGTTATTCTCCTGCTTCTTGTAATAGCAACAGCATTCGTAGGTTATGTCTTGCCATGAGGACAAATATCATTCTGAGGCGCAACCGTTATTACAAATTTATTATCAGCAATCCCATATATTGGAGATATACTAGTGCAGTGGGTTTGAGGGGGGTTCTCAA{GT}TGACAAAGCCACCCTAACCCGATTCT{CT}TGCCT{AT}TCACTTTATCTTACCATTCATTATTTCAGGAGCCAGTATCGCCCACTTAATTTCGTACACGAAACAGGCTCTAACAACCCCACCGGC---------------------------------- Pseudoeurycea_rex_MEA_1628_UTA_A56667 AAAATTATTAACAACTCCTTCATCGACCTGCCCGCACCACTAAACCTATCATATCTTTGAAACTTTGGCTCATTATTAGGAGTATGTCTTATTTCACAAATCCTGACAGGACTATTCCTGGCAATACATTACACCGCAGATACATCTTCTGCATTTTCATCAATTGCCCACATCTGCCGAGATGTTAACTACGGCTGAGTAATTCGAAATATTCACGCCAACGGAGCCTCATTTTTCTTCATCTGCATATATATACACATCGGACGAGGAATCTATTACGGCTCCTTCATATATAAAGAAACCTGAAGTATTGGGGTTATTCTCCTGCTTCTTGTAATAGCAACAGCATTCGTAGGTTATGTCTTGCCATGAGGACAAATATCATTCTGAGGCGCAACCGTTATTACAAATTTATTATCAGCAATCCCATATATTGGAGATATACTAGTGCAGTGAGTTTGAGGGGGGTTCTCAATTGACAAAGCCACCCTAACCCGATTCTTTGCCTTTCACTTTATCTTACCATTCATTATTTCAGGAGCCAGTATCGCCCACTTAATTTTCCTACACGAAACAGGCTCTAACAACCCCACCGGCCTAAGCTC------------------------- Psuedoeurycea_werleri_ENS_10359_UTA_A54823 --------------CTCATTTATTGATCTGCCCGCACCACTAAACCTCTCATACCTTTGAAACTTTGGCTCATTATTAGGAGTATGTTTAATTTCACAAATCTTAACAGGCTTATTCCTTGCAATACACTATACCGCAGACACATCCTCTGCATTCTCATCCATCGCCCATATTTGTCGAGATGTAAACTATGGCTGAATAATTCGAAATATTCTCGCCAACGGAGCTTCATTTTTTTTCATCTGTATATATCTACATATTGGACGGGGAATCTATTACGG{CT}TCATTTATATATAAGGAAGCTTGAAATATTGGAGTAGTACTCCTACTTCTAGTGATAGCAACAGCATTCGTAGGCTATGTACTACCATGAGGACAAATATCATTTTGAGGAGCAACCGTCATTACAAATTTATTGTCAGCAATCCCATATATTGGGGACACACTAGTACAGTGAATTTGAGGAGGATTTTCAGTTGACAAGGCCACTCTCACCCGATTCTTCGCT{AT}TTCACTTTATTTTACCATTTATTATCTCAGGAATTAGCATTGCCCACCTCATTTTTTTACATGAAACAGGCT-TAATAATCCAACAGGCTCAACT--------------------------- Psuedoeurycea_werleri_ENS_10360_UTA_A54824 -------------------------------------------------------------------------TATTAGGAGTATGTTTAATTTCACAAATCTTAACAGGTTTATTCCTTGCAATACACTATACCGCAGACACATCCTCTGCATTCTCATCCATCGCCCATATTTGTCGAGATGTAAACTATGGCTGAATAATTCGAAATATTCACGCCAACGGAGCTTCATTTTTTTTCATCTGTATATATCTACATATTGGACGGGGAATCTATTACGGCTCATTTATATATAAGGAAGCTTGAAATATTGGAGTAGTACTCCTACTTCTAGTGATAGCAACAGCATTCGTAGGCTATGTACTACCATGAGGACAAATATCATTTTGAGGGGCAACCGTTATTACAAATTTATTGTCAGCAATCCCATATATTGGGGACACACTAGTACAGTGAATTTGAGGAGGATTTTCAGTTGACAAGGCCACTCTCACCCGATTCTTCGCTTTTCACTTTATTTTACCATTTATTATTTCAGGAA----------------------------------------------------------------------------------------- ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Cyt_b_dataset) = 1: 1-628\3, 2: 2-629\3, 3: 3-630\3; CODONPOSSET CodonPositions (CHARACTERS = Cyt_b_dataset) = 1: 1-628\3, 2: 2-629\3, 3: 3-630\3; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M6355] TITLE 12S_dataset; LINK TAXA = Taxa1; DIMENSIONS NCHAR=419; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=- GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Bolitoglossa_centenorum_MEA_1633_UTA_A58538 AAACTGGGATTAGATACCCCACTATGCTAGCCCTAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATTTACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAACAGTAGGCTAAACAATCTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATTTATGAAAAAAATATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGCGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_centenorum_MEA_1634_UTA_A58539 AAACTGGGATTAGATACCCCACTATGCTAGCCCTAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATTTACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAACAGTAGGCTAAACAATCTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATTTATGAAAAAAATATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGCGTTCTTTTTAAATTGGCAATAGGTGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_cuchumatana_ENS_7812_UTA_A51439 AAACTGGGATTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATCTACCTCACCACCTCTTGCAACACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAATAGTAGGCTAAACAATCTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATCTATGAAAAGAGTATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_cuchumatana_ENS_8116_UTA_A51462 AAACTGGGATTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATCTACCTCACCACCTCTTGCAACACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAATAGTAGGCTAAACAATCTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATCTATGAAAAGAGTATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACA----------- Bolitoglossa_cuchumatana_ENS_8199_UTA_A51466 AAACTGGGATTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATCTACCTCACCACCTCTTGCAACACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAATAGTAGGCTAAACAATCTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATCTATGAAAAGAGTATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCAC- Bolitoglossa_cuchumatana_ENS_8306_UTA_A51440 AAACTGGGATTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATCTACCTCACCACCTCTTGCAACACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAATAGTAGGCTAAACAATCTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATCTATGAAAAGAGTATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_cuchumatana_JAC_19348_UTA_A51441 ---------TTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATCTACCTCACCACCTCTTGCAACACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAATAGTAGGCTAAACAATCTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATCTATGAAAAGAGTATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATG--------- Bolitoglossa_cuchumatana_JAC_19352_UTA_A51445 --------ATTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATCTACCTCACCACCTCTTGCAACACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAATAGTAGGCTAAACAATCTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATCTATGAAAAGAGTATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATG--------- Bolitoglossa_daryorum_ENS_11771_UTA_A58520 ---------TTAGATACCCCACTATGCTAGCCATTAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTCCTATAATTGATATTCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTTAAATTTTAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATGTCTATGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACA----------- Bolitoglossa_daryorum_GAR_198_UTA_A59730 AAACTGGGATTAGATACCCCACTATGCTAGCCATTAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTCCTATAATTGATATTCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTTAAATTTTAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATGTCTATGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_daryorum_GAR_199_UTA_A59731 AAACTGGGATTAGATACCCCACTATGCTAGCCATTAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTCCTATAATTGATATTCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTTAAATTTTAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATGTCTATGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTT--------------------------------------------------------------------- Bolitoglossa_dofleini_ENS_10604_UTA_A56788 AAACTGGGATTAGATACCCCACTATGCCGGCCATAAACTTCGGCCGCCCGAGCATTACGAGCCATCGCTTAAAACTCAAAGGACTTGGCGGCGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACCCCCCAATAAACCTCACCGCCTTTTGCAATACAGCCTATATACCACCGTCGCCCGCCTCCTAGAGCAGTAGCAGGCTAAACAATTTTAAATAAAAAAGTCAGGTCAAGGTGTAGCAAATAAGTCGGAAGAAATGGGCTACATTTTCTTAAAAAACACAATGTATATGAAAACAGCATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATAGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_dunni_ENS_7825_UTA_A51488 AAACTGGGATTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGTAACAGTAGGCTAAATAATTTTAAATAAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTCGGAAGAGATGGGCTACATTTTCTTTAAAAACACAATGTTCATGAAAAAAGCATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATCGGCAATAGGCAAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_eremia_ENS_10113_UTA_A58552 AAACTGGGATTAGATACCCCACTATGCTAGCCATTAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATATTTATGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAGAGTAGAGTGTTCTTTTTAAACTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_eremia_ENS_10114_UTA_A58553 AAACTGGGATTAGATACCCCACTATGCTAGCCATTAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATATTTATGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAGAGTAGAGTGTTCTTTTTAAACTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_eremia_MEA_1975_UTA_A58429 AAACTGGGATTAGATACCCCACTATGCTAGCCATTAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTCAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATATTTATGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAGAGTAGAGTGTTCTTTTTAAACTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_eremia_MEA_1999_UTA_A58430 AAACTGGGATTAGATACCCCACTATGCTAGCCATTAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATATTTATGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAGAGTAGAGTGTTCTTTTTAAACTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_eremia_MEA_2019_UTA_A58387 AAACTGGGATTAGATACCCCACTATGCTAGCCATTAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATATTTATGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAGAGTAGAGTGTTCTTTTTAAACTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_flavimembris_ENS_9377_UTA_A58686 AAACTGGGATTAGATACCCCACTATGCTAGCCACTAACTTCGGCCGCCAGAGCATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTCCTATAATTGATATCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTAAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATGTTTATGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAAAGTAGAGTGTTCTTTTTAAACTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_franklini_ENS_9378_UTA_A58687 AAACTGGGATTAGATACCCCACTATGCTGGCCATAAACTTCGGCCGCCAGAATATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTTTAATTGATACCCCCCAATAAACCTCACCACCTCTTGTAATTCAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTAAATAATTTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAACGAGTTGGAAGAAATGGGCTACATTTTCTTTAAAAATACAATGTTCGTGAAAAGAACATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGAGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_hartwegi_ENS_10302_UTA_A54816 AAACTGGGATTAGATACCCCACTATGCAGGCCATAAACTTTGGCCGCCAGAACATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGCGCCTCACACCACTAGAGGAGCCTGTTCTATAATTGATAACCCCCAATAAACCTCACCATCTCTTGCAATACAGCCTATATACCACCGTCGCCAACCTCACAGAGTAATAGTAGGCTTAATAATTTAAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAACACAATATTCATGAAAAAAAAACAAGGAGGATTTAATAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_hartwegi_ENS_10303_UTA_A54817 AAACTGGGATTAGATACCCCACTATGCAGGCCATAAACTTTGGCCGCCAGAACATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGCGCCTCACACCACTAGAGGAGCCTGTTCTATAATTGATAACCCCCAATAAACCTCACCATCTCTTGCAATACAGCCTATATACCACCGTCGCCAACCTCACAGAGTAATAGTAGGCTTAATAATTTAAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAACACAATATTCATGAAAAAAAAACAAGGAGGATTTAATAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_heiroreias_ENS_9847_UTA_A54712 AAACTGGGATTAGATACCCCACTATGCTAGCCATAAACTTAGGCCGCCAGAATATTACGAGCTACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTTATAGAGTAACAGTAGGCTAAATAATTTTAAATTTAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTTAAAAATACAATGTTTATGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGTAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_helmrichi_ENS_7802_UTA_A51457 AAACTGGGATTAGATACCCCACTATGCTAGCCATAAACTTAGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATCTACCTCACCACCTCTTGCAACACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAATAGTAGGCTAAACAATCTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATTTATGAAAAGAATATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_helmrichi_JAC_20487_UTA_A58432 AAACTGGGATTAGATACCCCACTATGCTAGCCATAAACTTAGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATCTACCTCACCACCTCTTGCAACACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAATAGTAGGCTAAACAATCTTAGATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATTTATGAAAAGAATATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_huehuetenaguensis_JAC_19220_UTA_A58699 AAACTGGGATTAGATACCCCACTATGCTAGCCCTAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATTTACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAGTAGTAGGCTAAACAATCTTGAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATTTATGAAAAAAATATAAGGAGGATTTAGTAGTAAAAAGAAAGTAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_huehuetenaguensis_MEA_1635_UTA_A58540 AAACTGGGATTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATTTACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAGTAGTAGGCTAAACAATCTTGAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATTTATGAAAAAAATATAAGGAGGATTTAGTAGTAAAAAGAAAGTAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_huehuetenanguensis_JAC_19170_UTA_A51320 ---------TTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATTTACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAGTAGTAGGCTAAACAATCTTGAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATTTATGAAAAAAATATAAGGAGGATTTAGTAGTAAAAAGAAAGTAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATG--------- Bolitoglossa_huehuetenanguensis_JAC_19171_UTA_A51321 ---------TTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATTTACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAGTAGTAGGCTAAACAATCTTGAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATTTATGAAAAAAATATAAGGAGGATTTAGTAGTAAAAAGAAAGTAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACA----------- Bolitoglossa_huehuetenanguensis_JAC_19197_UTA_A51324 ---------TTAGATACCCCACTATGCTAGCCCTAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATTTACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAGTAGTAGGCTAAACAATCTTGAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATTTATGAAAAAAATATAAGGAGGATTTAGTAGTAAAAAGAAAGTAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATG--------- Bolitoglossa_huehuetenanguensis_JAC_19198_UTA_A51325 ---------TTAGATACCCCACTATGCTAGCCCTAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATTTACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAGTAGTAGGCTAAACAATCTTGAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATTTATGAAAAAAATATAAGGAGGATTTAGTAGTAAAAAGAAAGTAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATG--------- Bolitoglossa_huehuetenanguensis_JAC_19219_UTA_A58698 AAACTGGGATTAGATACCCCACTATGCTAGCCCTAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATTTACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAGTAGTAGGCTAAACAATCTTGAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATTTATGAAAAAAATATAAGGAGGATTTAGTAGTAAAAAGAAAGTAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_huehuetenanguensis_MEA_1276_UTA_A58689 AAACTGGGATTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATATTCCCCAATTTACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAACAGTAGGCTAAACAATCTTGAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATTTATGAAAAAAATATAAGGAGGATTTAGTAGTAAAAAGAAAGTAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCAC- Bolitoglossa_huehuetenanguensis_MEA_1277_UTA_A58690 AAACTGGGATTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATTTACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAACAGTAGGCTAAACAATCTTGAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATTTATGAAAAAAATATAAGGAGGATTTAGTAGTAAAAAGAAAGTAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_kaqchikelorum_ENS_10283_UTA_A58685 AAACTGGGATTAGATACCCCACTATGCTAGCCATTAACTTCGGCCGCCAGAGTATTACGAGCTACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGGGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATGTTTATGAAAAAAGCATAAGGAGGATTTAGTAGTAAAAAGAGAATAGAGTGTTCTTTTAAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_kaqchikelorum_ENS_11770_UTA_A58568 ---------TTAGATACCCCACTATGCTAGCCATTAACTTCGGCCGCCAGAGTATTACGAGCTACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGGGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATGTTTATGAAAAAAGCATAAGGAGGATTTAGTAGTAAAAAGAGAATAGAGTGTTCTTTTAAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATG--------- Bolitoglossa_lincolni_ENS_7811_UTA_A51469 AAACTGGGATTAGATACCCCACTATGCTGGCCATAAACTTCGGCCGCCAGAATATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTTTAATTGATACCCCCCAATAAACCTCACCACCTCTTGTAATTCAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTAAATAATTTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAACGAGTTGGAAGAAATTGGCTACATTTTCTTTAAAAATACAATGTTCGTGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_lincolni_ENS_8055_UTA_A51474 AAACTGGGATTAGATACCCCACTATGCTGGCCATAAACTTCGGCCGCCAGAATATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTTTAATTGATACCCCCCAATAAACCTCACCACCTCTTGTAATTCAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTAAATAATTTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAACGAGTTGGAAGAAATTGGCTACATTTTCTTAAAAAATACAATGTTCGTGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATGTAGCGCAC- Bolitoglossa_lincolni_ENS_8327_UTA_A51388 AAACTGGGATTAGATACCCCACTATGCTGGCCATAAACTTCGGCCGCCAGAATATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTTTAATTGATACCCCCCAATAAACCTCACCACCTCTTGTAATTCAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTAAATAATTTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAACGAGTTGGAAGAAATTGGCTACATTTTCTTTAAAAATACAATGTTCGTGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_lincolni_MEA_626_UTA_A51485 AAACTGGGATTAGATACCCCACTATGCTGGCCATAAACTTCGGCCGCCAGAATATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTTTAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATTCAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTAAATAATTTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAACGAGTTGGAAGAAATGGGCTACATTTTCTTTAAAAATACAATGTTCGTGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_lincolni_MEA_627_UTA_A51486 AAACTGGGATTAGATACCCCACTATGCTGGCCATAAACTTCGGCCGCCAGAATATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTTTAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATTCAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTAAATAATTTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAACGAGTTGGAAGAAATGGGCTACATTTTCTTTAAAAATACAATGTTCGTGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_meliana_ENS11773 AAACTGGGATTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCCAGAATATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATAACCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGAAATAGTAGGCTAGATAATTTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATGTTCGTGAAAAAAGCATAAGGAGGATTTAGTAGTAAAAAGAGAGTAGAGTGTTCTTTTTAAGTCGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_meliana_GAR_145_UTA_A58565 AAACTGGGATTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCAAGAATATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGAAATAGTAGGCTAGATAATTTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATGTTCGTGAAAAAAGCATAAGGAGGATTTAGTAGTAAAAAGAAAGTAGAGTGTTCTTTTTAAGTCGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_mexicana_ENS_10307_UTA_A54810 AAACTGGGATTAGATACCCCACTATGCAGGTCATAAACTTCGGCCGCCAGAACATTACGAGCTACAGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATAAACCTCACCATCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGTAACAGTAGGCTTAAAAATTTAAAATTAAAAAGTCAGGTCAAGGTGTAGCAAACGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAACACAAGATTTATGAAATAAGTCTAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_morio_ENS_10459_UTA_A53286 AAACTGGGATTAGATACCCCACTATGCTAGCCATTAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTCAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGGGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATGTTTATGAAAAAAGCATAAGGCGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTAAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_morio_ENS_10469_UTA_A58521 AAACTGGGATTAGATACCCCACTATGCTAGCCATTAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTCAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGGGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATGTTTATGAAAAAAGCATAAGGCGGATTTAGTAGTAAGAAGAAAATAGAGTGTTCTTTTAAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_morio_ENS_10470_UTA_A58522 AAACTGGGATTAGATACCCCACTATGCTAGCCATTAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTCAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGGGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATGTTTATGAAAAAAGCATAAGGCGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTAAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_morio_ENS_10471_UTA_A58523 AAACTGGGATTAGATACCCCACTATGCTAGCCATTAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTCAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGGGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATGTTTATGAAAAAAGCATAAGGCGGATTTAGTAGTAAGAAGAAAATAGAGTGTTCTTTTAAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_morio_ENS_10474_UTA_A58526 AAACTGGGATTAGATACCCCACTATGCTAGCCATTAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTCAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGGGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATGTTTATGAAAAAAGCATAAGGCGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTAAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_morio_ENS_10475_UTA_A58527 AAACTGGGATTAGATACCCCACTATGCTAGCCATTAACTTCGGCCGCCAGAGTATTACGAGCTACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGGGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATGTTTATGAAAAAGGCATAAGGAGGATTTAGTAGTAAAAAGAGAATAGAGTGTTCTTTTAAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_mulleri_MEA_1018_UTA_A50475 AAACTGGGATTAGATACCCCACTATGCAGGTCATAAACTTCGGCCGCCAGAACATTACGAGCTACAGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATAAACCTCACCATCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGTAACAGTAGGCTTAAAAATTAAAAATTAAAAAGTCAGGTCAAGGTGTAGCAAACGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAACACAAGATTTATGAAACAAGTCTAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_ninadormida_MEA_1175_UTA_A58562 ---------TTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTCCACCACTAGAGGAGCCTGTTCTATAATTGATATTCCCCAATTTACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAACAGTAGGCTAAACAATCTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATTTATGAAAAGAATATAAGGAGGATTTAGTAGTAAAAAGAAAGTAGAGTGCTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATG--------- Bolitoglossa_ninadormida_MEA_1183_UTA_A58564 ---------TTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATATTCCCCAATTTACCTCGCCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAACAGTAGGCTAAACAATCTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATTTATGAAAAGAATATAAGGAGGATTTAGTAGTAAAAAGAAAGTAGAGTGCTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATG--------- Bolitoglossa_nussbaumi_JAC_19792_UTA_A59197 AAACTGGGATTAGATACCCCACTATGCTAGCCATAAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATAATCCCCAATTTACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAAAGTAACAGTAGGCAAAATAATCTTAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATATATGAAAAAAATATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_nympha_ENS_7147_UTA_A48662 AAACTGGGATTAGATACCCCACTATGCTAGCCATAAACTTAGGCCGCCAGAGTATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTTCTATAATTGATAGTCCCCAATAAACCTCACCATCCCTTGCATTTCAGCCTATATATCACCGTCGCCAACCTTATAGGGTAATAGTAGGCTAAATAATTTAAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGATGGAAGAAATGGGCTACATTTTCTAAAAAAACACAATATTCATGAAAAAATAATAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCAAGCACACACCGCCCGTCACCCTCTAGCAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_occidentalis_JAC_19896_UTA_A58554 AAACTGGGATTAGATACCCCACTATGCGAGCCGTAAACTTTGGCCGCCCGAGTATTACGAGCCATAGCTTAAAACTCAAAGGACTTGGCGGTGCCTTACACCACTAGAGGAGCCTGTTCTATAATTGATAACCCCCAATAAACCTCACCCCCTCTTGCAATACAGCCTATATACCACCGTCGCCAACCTCATAGAGTAATAGTAGGCCAAATAATTAAAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGCCGGAAGAAATGGGCTACATTTCCTTAAGAAACACAATATTTATGAAAAAGGAACAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_odonnelli_ENS_7862_UTA_A51493 AAACTGGGATTAGATACCCCACTATGCAGGTCATAAACTTCGGCCGCCAGAACATTACGAGCTACAGCTTAAAACTCAAAGGACTTGGCGGTGCTTTACACCACTAGAGGAGCCTGTTCTATAATTGATACCCCCCAATAAACCTCACCATCCCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCATAGAGTAACAGTAGGCTTAAAAATTTAAAATTAAAAAGTCAGGTCAAGGTGTAGCAAACGGGTTGGAAGAAATGGGCTACATTTTCTTAAAAAACACAAGATTTATGAAACAAATCTAAGGAGGATTTAATAGTAAAAAGAAAATAGAGCGTTCTTTTTAAATTGGCAATAAGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACA----------- Bolitoglossa_odonnelli_MEA_446_UTA_A48591 AAACTGGGATTAGATACCCCACTATGCAGGTCATAAACTTCGGCCGCCAGAACATTACGAGCTACAGCTTAAAACTCAAAGGACTTGGCGGTGCTTTACACCACTAGAGGAGCCTGTTCTATAATTGATACCCCCCAATAAACCTCACCATCCCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCATAGAGTAACAGTAGGCTTAAAAATTTAAAATTAAAAAGTCAGGTCAAGGTGTAGCAAACGGGTTGGAAGAAATGGGCTACATTTTCTTAAAAAACACAAGATTTATGAAACAAATCTAAGGAGGATTTAATAGTAAAAAGAAAATAGAGCGTTCTTTTTAAATTGGCAATAAGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_rufescens_JAC_19278_UTA_A51491 ----------------------TATGCTAGCCCTAAACTTTGGCCGCCAGAGTATTACGAGCTACAGCTTAAAACTCAAAAGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTTCTATAATTGATAATCCCCAATAAACCTCACCACCTCTTGTAATACAGCCTATATACCACCGTCGCAAACCTCCCAGAGTAATAGTAGGCCCAATAATTTAAAATAAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATATCAATGAAAAGGGAACAAGGAGGATTTAGTAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGTAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTC----------------- Bolitoglossa_stuarti_JAC_19443_UTA_A58144 AAACTGGGATTAGATACCCCACTATGCAGGCCATAAACTTAGGCCGCCAGAACATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGCGCCTCACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATAAACCTCACCATCTCTCGCAATACAGCCTATATACCACCGTCGCCAACCTCACAGGGTAATAGTAGGCTTAATAATTTAAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTCGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATTTTAATGAAAACGGAACAAGGAGGATTTAATAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAAAAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_stuarti_JAC_19518_UTA_A58145 AAACTGGGATTAGATACCCCACTATGCAGGCCATAAACTTAGGCCGCCAGAACATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGCGCCTCACACCACTAGAGGAGCCTGTTCTATAATTGATACTCCCCAATAAACCTCACCATCTCTCGCAATACAGCCTATATACCACCGTCGCCAACCTCACAGGGTAATAGTAGGCTTAATAATTTAAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTCGGAAGAAATGGGCTACATTTTCTTAAAAAATACAATTTTAATGAAAACGGAACAAGGAGGATTTAATAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAAAAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_suchitanensis_MEA_1911_UTA_A58149 --------------------------------------------------AGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCCCTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTCAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATATTTATGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAGAGTAGAGTGTTCTTTTTAA------------------------------------------------------------------- Bolitoglossa_suchitanensis_MEA_1926_UTA_A58150 AAACTGGGATTAGATACCCCACTATGCTAGCCACTAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTCAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATATTTATGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAGAGTAGAGTGTTCTTTTTAAACTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_suchitanensis_MEA_1933_UTA_A58422 AAACTGGGATTAGATACCCCACTATGCTAGCCACTAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTCAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATATTTATGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAGAGTAGAGTGTTCTTTTTAAACTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_suchitanensis_MEA_1936_UTA_A58423 AAACTGGGATTAGATACCCCACTATGCTAGCCACTAACTTCGGCCGCCAGAGTATTACGAGCCACAGCTTAAAATTCAAAGGACTTGGCGGTGCCTTATACCACTAGAGGAGCCTGTCCTATAATTGATACCCCCCAATAAACCTCACCACCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCTCACAGAGCAATAGTAGGCTTGATAATTTCAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAGATGGGCTACATTTTCTTTAAAAATACAATATTTATGAAAAAAACATAAGGAGGATTTAGTAGTAAAAAGAGAGTAGAGTGTTCTTTTAAAACTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAATAAGAAAGTCGTAACATGTAGCGCACA Bolitoglossa_xibalba_ENS_8069_UTA_A51453 AAACTGGGATTAGATACCCCACTATGCAGGCCATAAACTTTGACCGCCAGAACATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGCGCCTCACACCACTAGAGGAGCCTGTTCTATAATTGATAACCCCCAATAAACCTCACCATCTCTTGCAACACAGCCTATATACCACCGTCGCCAACCTCACAGAGTAATAGTAGGCTTAATAATTTAAAATTTAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAACACAATATTCATGAAAAAAAAACAAGGAGGATTTAATAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAAC-------------------------- Bolitoglossa_xibalba_JAC_19347_UTA_A51456 ---------TTAGATACCCCACTATGCAGGCCATAAACTTTGACCGCCAGAACATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGCGCCTCACACCACTAGAGGAGCCTGTTCTATAATTGATAACCCCCAATAAACCTCACCATCTCTTGCAACACAGCCTATATACCACCGTCGCCAACCTCACAGAGTAATAGTAGGCTTAATAATTTAAAATTTAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAACACAATATTCATGAAAAAAAAACAAGGAGGATTTAATAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATG--------- Bolitoglossa_xibalba_MEA_633_UTA_A51424 AAACTGGGATTAGATACCCCACTATGCAGGCCATAAACTTTGACCGCCAGAACATTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGCGCCTCACACCACTAGAGGAGCCTGTTCTATAATTGATAACCCCCAATAAACCTCACCATCTCTTGCAACACAGCCTATATACCACCGTCGCCAACCTCATAGAGTAATAGTAGGCTTAATAATTTAAAATTAAAAAGTCAGGTCAAGGTGTAGCAAATGAGTTGGAAGAAATGGGCTACATTTTCTTAAAAAACACAATATTCATGAAAAAAAAACAAGGAGGATTTAATAGTAAAAAGAAAATAGAGTGTTCTTTTTAAATTGGCAATAGGCGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATGTAGCGCACA Cryptotriton_veraepacis_GAR_063_UTA_A51395 AAACTGGGATTAGATACCCCACTATGCTGACCATAAACTTTGGCCGCCCGAGTACTACGAGCCACAGCTTAAAACCCAAAGGACTTGGCGGTGCCCCACACCACTAGAGGAGCCTGTTCTATAATTGATAACCCCCAATAAACCTCACCACCCCTTGCACCACAGCCTATATACCACCGTCGCTTACC-CAAAAAGTAATAGTGAACCCAATAACCTTAAGTTAAAAAGTCAGGTCAAGGTGCAGCACACGAGTGGGAAGAAATGGGCTACACTTTCTCAAAAAATGCAATATAAATGAAAAAAATATAAGAAGGATTTAGCAGTAAAAAGAAAAAAGAGTGTTCTCTTTAATTAGGCAATGGACAAGCACACACCGCCCGTCACCCTCTCACAAGAAAGTCGTAACA----------- Pseudoeuryce_brunnata_ENS_10467_UTA_A58530 ----------TAGATACCCCACTATGCAGGCCATAAACTTCGGCCGCCAGAGCACTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCCTATACCACTAGAGGAGCCTGTTCTATAATTGATAATCCCCAATATACCTCACCGCCCCTTGCAATACAGCCTATATACCACCGTCGCCCACCCCATAAAGTAATAGTAGGCTAAACAATTAAAAATAAAAAAGTCAGGTCAAGGTGTAGCACACGAGTCGGAAGAAATGGGCTACATTTTCTAAAAAAATACGATGTTTATGAAAAAAACATAAGGAGGATTTAGCAGTAAAAAGGGAATAGAGAGCCCTTTTAAAATTGGCAATGGACGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATG--------- Pseudoeurycea_brunnata_ENS_10458_UTA_A58567 ---------TTAGATACCCCACTATGCAGGCCATAAACTTCGGCCGCCAGAGCACTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCCTATACCACTAGAGGAGCCTGTTCTATAATTGATAATCCCCAATATACCTCACCGCCCCTTGCAATACAGCCTATATACCACCGTCGCCCACCCCATAAAGTAATAGTAGGCTAAACAATTAAAAATAAAAAAGTCAGGTCAAGGTGTAGCACACGAGTCGGAAGAAATGGGCTACATTTTCTAAAAAAATACGATGTTTATGAAAAAAACATAAGGAGGATTTAGCAGTAAAAAGAGAGTAGAGAGCCCTTTTAAAATTGGCAATGGACGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATG--------- Pseudoeurycea_brunnata_ENS_10468_UTA_A58531 ---------TTAGATACCCCACTATGCAGGCCATAAACTTCGGCCGCCAGAGCACTACGAGCCACAGCTTAAAACTCAAAGGACTTGGCGGTGCCCTATACCACTAGAGGAGCCTGTTCTATAATTGATAATCCCCAATATACCTCACCGCCCCTTGCAATACAGCCTATATACCACCGTCGCCCACCCCATAAAGTAATAGTAGGCTAAACAATTAAAAATAAAAAAGTCAGGTCAAGGTGTAGCACACGAGTCGGAAGAAATGGGCTACATTTTCTAAAAAAATACGATGTTTATGAAAAAAACATAAGGAGGATTTAGCAGTAAAAAGGGAATAGAGAGCCCTTTTAAAATTGGCAATGGACGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATG--------- Pseudoeurycea_rex_JAC_19205_UTA_A51408 ---------TTAGATACCCCACTATGCAGGCCATAAACTTCGGCCGCCAGAGCACTACGAGCCACGGCTTAAAACTCAAAGGACTTGGCGGTGCCCTATACCACTAGAGGAGCCTGTTCTATAATTGATAATCCCCAATATACCTCACCGCCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCCCACAAAGTAATAGTAGGCTAAACAATTAAAAATAAAAAAGTCAGGTCAAGGTGTAGCACACGAGTCGGAAGAAATGGGCTACATTTTCTAAAAAAATACAATGTTCATGAAAAAAACATAAGGAGGATTTAGCAGTAAAAAGAGAATAGAGAGCTCTTTTAAAATTGGCAATGGACGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACA----------- Pseudoeurycea_rex_JAC_19206_UTA_A51409 ---------TTAGATACCCCACTATGCAGGCCATAAACTTCGGCCGCCAGAGCACTACGAGCCACGGCTTAAAACTCAAAGGACTTGGCGGTGCCCTATACCACTAGAGGAGCCTGTTCTATAATTGATAATCCCCAATATACCTCACCGCCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCCCACAAAGTAATAGTAGGCTAAACAATTAAAAATAAAAAAGTCAGGTCAAGGTGTAGCACACGAGTCGGAAGAAATGGGCTACATTTTCTAAAAAAATACAATGTTCATGAAAAAAACATAAGGAGGATTTAGCAGTAAAAAGAGAATAGAGAGCTCTTTTAAAATTGGCAATGGACGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATG--------- Pseudoeurycea_rex_MEA_1182_UTA_A58563 ---------TTAGATACCCCACTATGCAGGCCATAAACTTCGGCCGCCAGAGCACTACGAGCCACGGCTTAAAACTCAAAGGACTTGGCGGTGCCCTATACCACTAGAGGAGCCTGTTCTGTAATTGATAACCCCCAATATACCTCACCGCCCCTTGCAATACAGCCTATATACCACCGTCGCCCACCCCACAAAGTAATAGTAGGCTAAACAATTAAAAATAAAAAAGTCAGGTCAAGGTGTAGCATATGAGTCGGAAGAAATGGGCTACATTTTCTAAAAAAATACAATGTTCATGAAAAAAACATAAGGAGGATTTAGCAGTAAAAAGAGAATAGAGAGCTCTTTTAAAATTGGCAATGGACGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATG--------- Pseudoeurycea_rex_MEA_1626_UTA_A58532 AAACTGGGATTAGATACCCCACTATGCAGGCCATAAACTTCGGCCGCCAGAGCACTACGAGCCACGGCTTAAAACTCAAAGGACTTGGCGGTGCCCTATACCACTAGAGGAGCCTGTTCTATAATTGATAATCCCCAATATACCTCACCGCCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCCCACAAAGTAATAGTAGGCTAAACAATTAAAAATAAAAAAGTCAGGTCAAGGTGTAGCACACGAGTCGGAAGAAATGGGCTACATTTTCTAAAAAAATACAATGTTCATGAAAAAAACATAAGGAGGATTTAGCAGTAAAAAGAGAATAGAGAGCTCTTTTAAAATTGGCAATGGACGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATGTAGCGCACA Pseudoeurycea_rex_MEA_1627_UTA_A58533 AAACTGGGATTAGATACCCCACTATGCAGGCCATAAACTTCGGCCGCCAGAGCACTACGAGCCACGGCTTAAAACTCAAAGGACTTGGCGGTGCCCTATACCACTAGAGGAGCCTGTTCTATAATTGATAATCCCCAATATACCTCACCGCCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCCCACAAAGTAATAGTAGGCTAAACAATTAAAAATAAAAAAGTCAGGTCAAGGTGTAGCACACGAGTCGGAAGAAATGGGCTACATTTTCTAAAAAAATACAATGTTCATGAAAAAAACATAAGGAGGATTTAGCAGTAAAAAGAGAATAGAGAGCTCTTTTAAAATTGGCAATGGACGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATGTAGCGCACA Pseudoeurycea_rex_MEA_1628_UTA_A56667 AAACTGGGATTAGATACCCCACTATGCAGGCCATAAACTTCGGCCGCCAGAGCACTACGAGCCACGGCTTAAAACTCAAAGGACTTGGCGGTGCCCTATACCACTAGAGGAGCCTGTTCTATAATTGATAATCCCCAATATACCTCACCGCCTCTTGCAATACAGCCTATATACCACCGTCGCCCACCCCACAAAGTAATAGTAGGCTAAACAATTAAAAATAAAAAAGTCAGGTCAAGGTGTAGCACACGAGTCGGAAGAAATGGGCTACATTTTCTAAAAAAATACAATGTTCATGAAAAAAACATAAGGAGGATTTAGCAGTAAAAAGAGAATAGAGAGCTCTTTTAAAATTGGCAATGGACGAGCACACACCGCCCGTCACCCTCTAACAAGAAAGTCGTAACATGTAGCGCACA Pseudoeurycea_werleri_ENS_10359_UTA_A54823 AAACTGGGATTAGATACCCCACTATGCAGGCCATAAACTTTGACCGCCCGAGCACTACGAGCTACAGCTTAAAACTCAAAGGACTTGGCGGTGCCCTATACCACTAGAGGAGCCTGTTCTATAATTGATAATCCCCAATAAACCTCACCGCCTCTCGTAATACAGCCTATATACCACCGTCGCCCACCCCACAAAGTAACAGCAGGCTAAACAATTTAAAATAAAAAAGTCAGGTCAAGGTGTAGCATATGAGTCGGAAGAAATGGGCTACATTTTCTTAAAAAATACGATATTTATGAAAATAATATAAGGAGGATTTAGCAGTAAAAAAAGAACAGAGAGCTCTTTTTAAATTGGCAATGGACGAGCACACACCGCCCGTCACCCTCTTATAAGAAAGTCGTAACATG--------- Pseudoeurycea_werleri_ENS_10360_UTA_A54824 AAACTGGGATTAGATACCCCACTATGCAGGCCATAAACTTTGACCGCCCGAGCACTACGAGCTACAGCTTAAAACTCAAAGGACTTGGCGGTGCCCTATACCACTAGAGGAGCCTGTTCTATAATTGATAATCCCCAATAAACCTCACCGCCTCTCGTAATACAGCCTATATACCACCGTCGCCCACCCCACAAAGTAACAGCAGGCTAAACAATTTAAAATAAAAAAGTCAGGTCAAGGTGTAGCATATGAGTCGGAAGAAATGGGCTACATTTTCTTAAAAAATACGATATTTATGAAAATAATATAAGGAGGATTTAGCAGTAAAAAAAGAACAGAGAGCTCTTTTTAAATTGGCAATGGACGAGCACACACCGCCCGTCACCCTCTTATAAGAAAGTCGTAACATGTAGCGCACA ; END; BEGIN TREES; TITLE Bolitoglossa_12S_Final; LINK TAXA = Taxa1; TRANSLATE 1 Bolitoglossa_xibalba_MEA_633_UTA_A51424, 2 Bolitoglossa_daryorum_GAR_199_UTA_A59731, 3 Bolitoglossa_xibalba_ENS_8069_UTA_A51453, 4 Bolitoglossa_odonnelli_ENS_7862_UTA_A51493, 5 Bolitoglossa_cuchumatana_ENS_8116_UTA_A51462, 6 Cryptotriton_veraepacis_GAR_063_UTA_A51395, 7 Pseudoeurycea_werleri_ENS_10359_UTA_A54823, 8 Bolitoglossa_huehuetenanguensis_MEA_1276_UTA_A58689, 9 Bolitoglossa_huehuetenanguensis_MEA_1277_UTA_A58690, 10 Bolitoglossa_eremia_ENS_10114_UTA_A58553, 11 Bolitoglossa_kaqchikelorum_ENS_10283_UTA_A58685, 12 Bolitoglossa_cuchumatana_ENS_8199_UTA_A51466, 13 Bolitoglossa_lincolni_ENS_8055_UTA_A51474, 14 Bolitoglossa_stuarti_JAC_19443_UTA_A58144, 15 Bolitoglossa_dofleini_ENS_10604_UTA_A56788, 16 Bolitoglossa_mulleri_MEA_1018_UTA_A50475, 17 Bolitoglossa_mexicana_ENS_10307_UTA_A54810, 18 Bolitoglossa_occidentalis_JAC_19896_UTA_A58554, 19 Bolitoglossa_eremia_MEA_2019_UTA_A58387, 20 Bolitoglossa_eremia_ENS_10113_UTA_A58552, 21 Bolitoglossa_suchitanensis_MEA_1933_UTA_A58422, 22 Bolitoglossa_meliana_ENS11773, 23 Bolitoglossa_morio_ENS_10471_UTA_A58523, 24 Bolitoglossa_cuchumatana_ENS_7812_UTA_A51439, 25 Bolitoglossa_lincolni_MEA_627_UTA_A51486, 26 Bolitoglossa_lincolni_ENS_7811_UTA_A51469, 27 Bolitoglossa_flavimembris_ENS_9377_UTA_A58686, 28 Bolitoglossa_morio_ENS_10469_UTA_A58521, 29 Bolitoglossa_odonnelli_MEA_446_UTA_A48591, 30 Bolitoglossa_morio_ENS_10470_UTA_A58522, 31 Bolitoglossa_hartwegi_ENS_10302_UTA_A54816, 32 Bolitoglossa_centenorum_MEA_1634_UTA_A58539, 33 Bolitoglossa_morio_ENS_10475_UTA_A58527, 34 Bolitoglossa_stuarti_JAC_19518_UTA_A58145, 35 Bolitoglossa_suchitanensis_MEA_1936_UTA_A58423, 36 Bolitoglossa_nussbaumi_JAC_19792_UTA_A59197, 37 Bolitoglossa_eremia_MEA_1975_UTA_A58429, 38 Bolitoglossa_huehuetenanguensis_JAC_19219_UTA_A58698, 39 Bolitoglossa_helmrichi_ENS_7802_UTA_A51457, 40 Bolitoglossa_helmrichi_JAC_20487_UTA_A58432, 41 Bolitoglossa_huehuetenaguensis_MEA_1635_UTA_A58540, 42 Bolitoglossa_huehuetenaguensis_JAC_19220_UTA_A58699, 43 Bolitoglossa_hartwegi_ENS_10303_UTA_A54817, 44 Bolitoglossa_centenorum_MEA_1633_UTA_A58538, 45 Bolitoglossa_lincolni_MEA_626_UTA_A51485, 46 Bolitoglossa_franklini_ENS_9378_UTA_A58687, 47 Bolitoglossa_nympha_ENS_7147_UTA_A48662, 48 Bolitoglossa_lincolni_ENS_8327_UTA_A51388, 49 Bolitoglossa_suchitanensis_MEA_1926_UTA_A58150, 50 Pseudoeurycea_rex_MEA_1626_UTA_A58532, 51 Pseudoeurycea_rex_MEA_1627_UTA_A58533, 52 Bolitoglossa_meliana_GAR_145_UTA_A58565, 53 Bolitoglossa_dunni_ENS_7825_UTA_A51488, 54 Pseudoeurycea_rex_MEA_1628_UTA_A56667, 55 Pseudoeurycea_werleri_ENS_10360_UTA_A54824, 56 Bolitoglossa_cuchumatana_ENS_8306_UTA_A51440, 57 Bolitoglossa_morio_ENS_10474_UTA_A58526, 58 Bolitoglossa_daryorum_GAR_198_UTA_A59730, 59 Bolitoglossa_morio_ENS_10459_UTA_A53286, 60 Bolitoglossa_heiroreias_ENS_9847_UTA_A54712, 61 Bolitoglossa_eremia_MEA_1999_UTA_A58430, 62 Bolitoglossa_cuchumatana_JAC_19352_UTA_A51445, 63 Bolitoglossa_daryorum_ENS_11771_UTA_A58520, 64 Pseudoeurycea_rex_JAC_19205_UTA_A51408, 65 Bolitoglossa_huehuetenanguensis_JAC_19171_UTA_A51321, 66 Pseudoeurycea_rex_JAC_19206_UTA_A51409, 67 Bolitoglossa_huehuetenanguensis_JAC_19197_UTA_A51324, 68 Pseudoeurycea_rex_MEA_1182_UTA_A58563, 69 Bolitoglossa_kaqchikelorum_ENS_11770_UTA_A58568, 70 Bolitoglossa_xibalba_JAC_19347_UTA_A51456, 71 Bolitoglossa_ninadormida_MEA_1175_UTA_A58562, 72 Bolitoglossa_huehuetenanguensis_JAC_19170_UTA_A51320, 73 Bolitoglossa_huehuetenanguensis_JAC_19198_UTA_A51325, 74 Bolitoglossa_cuchumatana_JAC_19348_UTA_A51441, 75 Pseudoeurycea_brunnata_ENS_10468_UTA_A58531, 76 Pseudoeurycea_brunnata_ENS_10458_UTA_A58567, 77 Bolitoglossa_ninadormida_MEA_1183_UTA_A58564, 78 Pseudoeuryce_brunnata_ENS_10467_UTA_A58530, 79 Bolitoglossa_rufescens_JAC_19278_UTA_A51491, 80 Bolitoglossa_suchitanensis_MEA_1911_UTA_A58149; TREE TREE1 = [&R] (((((15:0.313927,((((22:0.045697,52:0.044797):0.174629,(25:0.02587,(45:0.019947,(46:0.027227,(26:0.045124,(13:0.019074,48:0.005103):0.007761):0.018802):0.031931):0.039696):0.18743):0.131349,60:0.168488):0.081411,(53:0.159342,(((((37:0.002627,(80:0.09256,((35:0.022812,49:0.080017):9.67E-4,21:0.018054):0.018043):0.041047):0.026527,(61:0.042864,((19:0.00187,10:0.014691):9.92E-4,20:0.018951):0.017697):0.062359):0.111912,27:0.151762):0.021005,((11:0.007898,(33:0.026207,69:0.101118):4.43E-4):0.009203,(59:0.017011,(((23:0.005738,28:0.028075):0.007783,30:0.048648):0.020322,57:0.017166):0.010071):0.038905):0.064729):0.049145,((63:0.003161,58:0.009698):0.002433,2:0.039174):0.123615):0.118485):0.001132):0.135112):0.011334,(((((((72:0.034449,41:0.009736):0.0141,(65:0.037373,((67:0.013509,42:0.029399):0.004654,(38:0.069382,73:0.047647):0.079032):0.036486):0.009524):0.036524,(9:0.003068,8:0.046964):0.026684):0.05067,(71:0.034151,77:0.02363):0.058738):0.112903,(32:0.040968,44:0.013119):0.07731):0.036179,((40:0.081346,39:0.021149):0.120513,(24:0.0107,(62:0.016665,(((12:0.02878,74:0.034177):0.005179,5:0.007875):0.041231,56:0.049638):0.00963):0.034327):0.079181):0.06426):0.003081,36:0.105813):0.207644):0.063206,((4:0.003033,29:0.034819):0.257599,(16:0.024592,17:0.035362):0.018863):0.482736):0.067097,(47:0.607631,((18:0.436035,79:0.632287):0.196972,((34:0.013808,14:0.003865):0.42588,(((3:5.59E-4,70:0.00819):0.03682,1:0.101636):0.043324,(31:0.005902,43:0.027323):0.065804):0.112403):0.356538):0.0234):0.166721):0.194071,((7:0.023705,55:4.61E-4):0.613334,(((78:0.031192,75:0.010951):0.051478,76:0.037485):0.091031,(68:0.128852,(50:0.009648,((64:0.007469,66:0.001735):0.034705,(51:0.013242,54:0.00509):0.030174):0.021954):0.020804):0.171419):0.361496):0.622608,6:1.178875); END; BEGIN TREES; TITLE Bolitoglossa_cytochrome_b_master_test; LINK TAXA = Taxa2; TRANSLATE 1 Bolitoglossa_suchitanensis_MEA_1911_UTA_A58149, 2 Bolitoglossa_morio_ENS_10475_UTA_A58527, 3 Bolitoglossa_eremia_MEA_2019_UTA_A58387, 4 Bolitoglossa_morio_ENS_10459_UTA_A53286, 5 Pseudoeurycea_rex_MEA_1626_UTA_A58532, 6 Bolitoglossa_morio_ENS_10469_UTA_A58521, 7 Bolitoglossa_eremia_MEA_1975_UTA_A58429, 8 Bolitoglossa_odonnelli_MEA_446_UTA_A48591, 9 Bolitoglossa_mexicana_ENS_10307_UTA_A54810, 10 Pseudoeurycea_rex_MEA_1628_UTA_A56667, 11 Bolitoglossa_hartwegi_ENS_10303_UTA_A54817, 12 Bolitoglossa_suchitanensis_MEA_1926_UTA_A58150, 13 Bolitoglossa_eremia_MEA_1999_UTA_A58430, 14 Bolitoglossa_suchitanensis_MEA_1936_UTA_A58423, 15 Bolitoglossa_morio_ENS_10471A_UTA_A58523, 16 Bolitoglossa_suchitanensis_MEA_1933_UTA_A58422, 17 Bolitoglossa_cerroensis_AF199195, 18 Bolitoglossa_peruviana_AY526170, 19 Bolitoglossa_longissima_AY526186, 20 Bolitoglossa_paraensis_AY526168, 21 Bolitoglossa_rufescens_AY526159, 22 Bolitoglossa_pesrubra_AF212084, 23 Bolitoglossa_mombachoensis_AY133486, 24 Bolitoglossa_gracilis_AF212067, 25 Bolitoglossa_gracilis_AF212068, 26 Bolitoglossa_occidentalis_AY526158, 27 Bolitoglossa_adspersa_AF212984, 28 Bolitoglossa_palmata_AY526164, 29 Bolitoglossa_medemi_AY526163, 30 Bolitoglossa_yucatana_AF212980, 31 Bolitoglossa_flaviventris_AF212983, 32 Bolitoglossa_platydactyla_AY133484, 33 Bolitoglossa_mexicana_AF212978, 34 Bolitoglossa_paraensis_AY526166, 35 Bolitoglossa_mexicana_AF212979, 36 Bolitoglossa_diaphora_AY526181, 37 Bolitoglossa_oaxacensis_AF416681, 38 Bolitoglossa_conanti_AY526179, 39 Bolitoglossa_porrasorum_AY526188, 40 Bolitoglossa_macrinii_AF416680, 41 Bolitoglossa_zapoteca_AF416684, 42 Bolitoglossa_robusta_EU448110, 43 Bolitoglossa_sp.1_AY526173, 44 Bolitoglossa_helmrichi_UTA_A_51457_AY691755, 45 Bolitoglossa_altamazonica_AY526160, 46 Bolitoglossa_lincolni_MEA_626_UTA_A51485, 47 Bolitoglossa_sp.3_AY526191, 48 Bolitoglossa_sp.3_AY526192, 49 Bolitoglossa_paraensis_AY526167, 50 Bolitoglossa_meliana_GAR_145_UTA_A58565, 51 Bolitoglossa_eremia_ENS_10113_UTA_A58552, 52 Bolitoglossa_lincolni_ENS_8055_UTA_A51474, 53 Bolitoglossa_lincolni_ENS_7811_UTA_A51469, 54 Bolitoglossa_lincolni_MEA_627_UTA_A51486, 55 Bolitoglossa_riletti_AF416682, 56 Bolitoglossa_stuarti_JAC_19518_UTA_A58145, 57 Bolitoglossa_heiroreias_ENS_9847_UTA_A54712, 58 Bolitoglossa_dunni_ENS_7825_UTA_A51488, 59 Bolitoglossa_marmorea_U89627, 60 Bolitoglossa_schizodactyla_AY526171, 61 Bolitoglossa_lincolni_AY526185, 62 Bolitoglossa_hermosa_AF416678, 63 Bolitoglossa_carri_AY526176, 64 Bolitoglossa_celaque_AY526178, 65 Bolitoglossa_synoria_AY526193, 66 Bolitoglossa_celaque_AY526177, 67 Bolitoglossa_dofleini_AF212988, 68 Bolitoglossa_sp._2_AY526174, 69 Bolitoglossa_franklini_AY526184, 70 Bolitoglossa_morio_AF212986, 71 Bolitoglossa_engelhardti_AF212987, 72 Bolitoglossa_mulleri_MEA_1018_UTA_A50475, 73 Bolitoglossa_flavimembris_ENS_9377_UTA_A58686, 74 Bolitoglossa_minutula_AF212098, 75 Bolitoglossa_decora_AY526180, 76 Bolitoglossa_alvaradoi_AY526194, 77 Bolitoglossa_morio_ENS_10471_UTA_A58523, 78 Bolitoglossa_kaqchikelorum_ENS_10283_UTA_A8685, 79 Psuedoeurycea_werleri_ENS_10359_UTA_A54823, 80 Bolitoglossa_carri_AY526175, 81 Bolitoglossa_colonnea_AY526162, 82 Bolitoglossa_rostrata_AY526189, 83 Bolitoglossa_peruviana_AY526169, 84 Bolitoglossa_dofleini_ENS_10604_UTA_A56788, 85 Bolitoglossa_franklini_ENS_9378_UTA_A58687, 86 Bolitoglossa_mexicana_AF212977, 87 Bolitoglossa_platydactyla_AF212981, 88 Bolitoglossa_dunni_AY526182, 89 Bolitoglossa_rufescens_JAC_19278_UTA_A51491, 90 Bolitoglossa_biseriata_AY526161, 91 Bolitoglossa_morio_AY526187, 92 Bolitoglossa_hartwegi_AF212985, 93 Bolitoglossa_flavimembris_AY526183, 94 Bolitoglossa_epimela_AF212097, 95 Bolitoglossa_sima_AY526172, 96 Psuedoeurycea_werleri_ENS_10360_UTA_A54824, 97 Bolitoglossa_lincolni_ENS_8327_UTA_A51388, 98 Bolitoglossa_rostrata_AY526190, 99 Bolitoglossa_striatula_AF212982; TREE cytochrome_b_Phylo = [&R] (1:0.003893,14:0.003307,16:0.006824,(((((2:0.003356,70:0.010308,78:0.038409)0.63:0.036757,(4:0.010286,((6:0.055974,77:0.004941)0.89:0.052057,15:0.003664)0.98:0.010983)0.98:0.026324,93:0.069631)0.63:0.044196,((((((((((5:0.104322,10:0.007951)1.00:0.215892,(79:0.026401,96:0.010779)1.00:0.283142)1.00:0.308156,((17:0.221007,59:0.10596,74:0.195231,94:0.24382)1.00:0.170873,(((18:0.152563,45:0.155974)0.98:0.05681,(((20:0.213964,(34:0.092313,49:0.162751)1.00:0.15191)0.66:0.038531,83:0.270125)0.81:0.042367,28:0.110844)0.55:0.033678,(27:0.094185,(43:0.103102,(90:0.150853,95:0.227186)1.00:0.202231)0.53:0.026349)0.90:0.038441,29:0.270904)1.00:0.105368,42:0.12512,(60:0.213702,68:0.205009,81:0.219401)0.70:0.061517)1.00:0.108701,(22:0.120992,(24:0.011815,25:0.004757)1.00:0.081819)1.00:0.226071)1.00:0.179251)0.86:0.066419,(((((8:0.082834,86:0.015195)1.00:0.206572,((((9:0.079922,72:0.089753)1.00:0.047085,(23:0.019841,99:0.070581)1.00:0.0876)1.00:0.062736,30:0.135637)0.76:0.030036,(33:0.026939,35:0.0425)1.00:0.122662)0.59:0.029076)1.00:0.093326,(32:0.015401,87:0.079113)1.00:0.152976)0.79:0.046362,31:0.233833)0.78:0.050383,(((11:0.161332,92:0.135683)0.61:0.058703,56:0.423767)0.98:0.128824,(21:0.421973,(26:0.059741,89:0.315549)1.00:0.272951)1.00:0.397005)0.97:0.101627)1.00:0.141569,((37:0.078271,40:0.070087)1.00:0.110333,(41:0.133007,(55:0.090018,62:0.100774)1.00:0.12931)0.99:0.057151)1.00:0.115862,76:0.355164)0.92:0.044083,((44:0.068905,(82:0.029969,98:0.040274)1.00:0.136472)1.00:0.071803,71:0.106248)1.00:0.143827)0.98:0.063294,(19:0.203387,(67:0.010184,84:0.064032)1.00:0.431452)0.51:0.04313,((((46:0.016684,54:0.017331)0.95:0.011603,53:0.007985)0.99:0.031391,(52:0.03336,97:0.086982)0.83:0.03921,61:0.00677)1.00:0.104892,(69:0.012721,85:0.04833)1.00:0.096754)1.00:0.196526)0.58:0.031177,39:0.199534)0.66:0.029755,75:0.189411)1.00:0.052267,(((36:0.168419,(58:0.112398,88:0.017181)1.00:0.263035)0.67:0.033435,38:0.132826)0.65:0.038779,(63:0.003438,80:0.003574)1.00:0.14993)0.78:0.037906,((47:0.017422,48:0.007181,57:0.07721)1.00:0.115863,((64:0.00378,66:0.006856)1.00:0.037915,65:0.073773)1.00:0.069431)1.00:0.085604)0.52:0.036327,50:0.106621)1.00:0.23027,73:0.184256)0.99:0.047166,((3:0.006526,13:0.003453,51:0.003517)0.68:0.010338,(7:0.104298,91:0.012496)0.99:0.032305)0.79:0.014669)0.74:0.02002,12:0.017614)1.00:0.032158); TREE cytochrome_b_PP = [&R] (1:0.003893,14:0.003307,16:0.006824,(((((2:0.003356,70:0.010308,78:0.038409):0.036757,(4:0.010286,((6:0.055974,77:0.004941):0.052057,15:0.003664):0.010983):0.026324,93:0.069631):0.044196,((((((((((5:0.104322,10:0.007951):0.215892,(79:0.026401,96:0.010779):0.283142):0.308156,((17:0.221007,59:0.10596,74:0.195231,94:0.24382):0.170873,(((18:0.152563,45:0.155974):0.05681,(((20:0.213964,(34:0.092313,49:0.162751):0.15191):0.038531,83:0.270125):0.042367,28:0.110844):0.033678,(27:0.094185,(43:0.103102,(90:0.150853,95:0.227186):0.202231):0.026349):0.038441,29:0.270904):0.105368,42:0.12512,(60:0.213702,68:0.205009,81:0.219401):0.061517):0.108701,(22:0.120992,(24:0.011815,25:0.004757):0.081819):0.226071):0.179251):0.066419,(((((8:0.082834,86:0.015195):0.206572,((((9:0.079922,72:0.089753):0.047085,(23:0.019841,99:0.070581):0.0876):0.062736,30:0.135637):0.030036,(33:0.026939,35:0.0425):0.122662):0.029076):0.093326,(32:0.015401,87:0.079113):0.152976):0.046362,31:0.233833):0.050383,(((11:0.161332,92:0.135683):0.058703,56:0.423767):0.128824,(21:0.421973,(26:0.059741,89:0.315549):0.272951):0.397005):0.101627):0.141569,((37:0.078271,40:0.070087):0.110333,(41:0.133007,(55:0.090018,62:0.100774):0.12931):0.057151):0.115862,76:0.355164):0.044083,((44:0.068905,(82:0.029969,98:0.040274):0.136472):0.071803,71:0.106248):0.143827):0.063294,(19:0.203387,(67:0.010184,84:0.064032):0.431452):0.04313,((((46:0.016684,54:0.017331):0.011603,53:0.007985):0.031391,(52:0.03336,97:0.086982):0.03921,61:0.00677):0.104892,(69:0.012721,85:0.04833):0.096754):0.196526):0.031177,39:0.199534):0.029755,75:0.189411):0.052267,(((36:0.168419,(58:0.112398,88:0.017181):0.263035):0.033435,38:0.132826):0.038779,(63:0.003438,80:0.003574):0.14993):0.037906,((47:0.017422,48:0.007181,57:0.07721):0.115863,((64:0.00378,66:0.006856):0.037915,65:0.073773):0.069431):0.085604):0.036327,50:0.106621):0.23027,73:0.184256):0.047166,((3:0.006526,13:0.003453,51:0.003517):0.010338,(7:0.104298,91:0.012496):0.032305):0.014669):0.02002,12:0.017614):0.032158); END;