#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 18:59 GMT TreeBASE (cc) 1994-2008 Study reference: Thiv M., Niet T., Rutschmann F., Thulin M., Brune T., & Linder H. 2011. Old–New World And Trans-African Disjunctions of Thamnosma (Rutaceae): Intercontinental Long-Distance Dispersal and Local Differentiation in the Succulent Biome. American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10797] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=16; TAXLABELS Ruta_macrophylla_Sn Thamnosma_africana_21900 Thamnosma_africana_8927 Thamnosma_crenata_224 Thamnosma_hirschii_10000 Thamnosma_hirschii_3187 Thamnosma_hirschii_6164 Thamnosma_montana_4252 Thamnosma_montana_9022 Thamnosma_pailensis_369 Thamnosma_rhodesica_104 Thamnosma_socotrana_3176 Thamnosma_somalensis_9489 Thamnosma_stanfordii_9545 Thamnosma_texana_Sn Thamnosma_trifoliata_7577 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=38; TAXLABELS Acronychia_acidula_U38862 Adenandra_uniflora_AF066803 Chorilaena_quercifolia_AF066810 Citrus_japonica_AF066799 Citrus_trifoliata_AJ235806 Citrus_x_paradisi_AJ238407 Cneoridium_dumosum Coleonema_pulchellum_L12567 Correa_pulchella_AF066816 'Dictamnus sp. M.W.Chase-1820K AF066801' Dictyoloma_vandellianum_AF066823 Diplolaena_dampieri_AF066807 Eremocitrus_glauca_AF066819 Eriostemon_brevifolius_AF156883 Euodia_hupehensis Flindersia_australis_U38861 Glycosmis_pentaphylla_AF066820 Harrisonia_perforata_U38863 Lunasia_amara_AF066814 Melicope_ternata_AF116271 Neochamaelea_pulverulenta_AF206752 Phellodendron_amurense_AF066804 Ruta_graveolens_U39281 Sarcomelicope_simplicifolia_AF066817 Schinus_molle_U39270 Severinia_buxifolia_AF066806 Simarouba_glauca_U38927 Spathelia_excelsa_AF066798 Swietenia_macrophylla_U39080 Thamnosma_hirschii_3187b Thamnosma_montana_4351 Thamnosma_montana_9022b Thamnosma_pailensis_369b Thamnosma_socotrana_2495 Thamnosma_texana_S.N. Thamnosma_trifoliata_7577b Zanthoxylum_monophyllum_U39282 Zanthoxylum_sp._Chase_1348 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7294] TITLE Rutaceae_rbcL; LINK TAXA = Taxa2; DIMENSIONS NCHAR=811; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Acronychia_acidula_U38862 CTT?TTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAGCTGTGTGGACCGATG?GCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAA?ATCAA?ATATAT?TTATGTAGCTTACCGTT?AGACCTTTT?GAAGAAGGTTCTGTTACTAAC{AG}TGTTTACTTCCATTGTGGGTAATGTATTTGG?TTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTTTCAAGGCCCGCCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGACGTCCCCTGTT{GT}GGATGTACTATTAAACCGAAATTGGGGTTATCCGCTAAGAATTACGGTAGGGCGGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCGTATTTTGTGCGGAAGC??TT?ATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGC????????????????GGGCCGTCTTTGCCAGAGAGCTGGGAGTTCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Adenandra_uniflora_AF066803 CTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACCGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGGGCAGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCTATTTATAAATCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATGAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Chorilaena_quercifolia_AF066810 ---ATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCCGAGGAAGCGGGGGCTGCAGTAGCTGCGGAATCTTCTACCGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGACGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAGTCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGGAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTTCCAAGGCCCGCCTCACGG{CG}ATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCCTGTTAGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGGGCTGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCGTTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCACTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGCTGGGAGTTCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Citrus_japonica_AF066799 CTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACCTGGACAGCTGTGTGGACCGATGGGCTTACCAGTCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAGAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATCGTGGGTAATGTATTTGGTTTCAAAGCACTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCTGCGTATACTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGG{AC}CGTCCCCTGTTGGGATGTACTATTAAACCTAAACTGGGGTTATCCGCGAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCTCTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGCTAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTACCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Citrus_trifoliata_AJ235806 CTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAAGTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACCTGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAGAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCACTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCTGAGTATACTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTGGGATGTACTATTAAACCTAAACTGGGGTTATCCGCGAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGCGGTGGACTTGACTTTACTAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCACTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGCTAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTACCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Citrus_x_paradisi_AJ238407 CTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAAGTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACCTGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAGAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCACTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCTGAGTATACTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTGGGATGTACTATTAAACCTAAACTGGGGTTATCCGCGAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGCGGTGGACTTGACTTTACTAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCACTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGCTAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTACCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Cneoridium_dumosum CTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAGGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCTGCGTATGTTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGGGCGGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCACTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Coleonema_pulchellum_L12567 CTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCAGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACCGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAACATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGGGCAGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAACGAATTTATAAATCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Correa_pulchella_AF066816 -TTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCCGAGGAAGCGGGGGCTGCAGTAGCTGCGGAATCTTCTACCGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAACATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCCTGTTAGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGGGCAGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCGATTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATGAAAAGGGCTGTCTTTGCCAGAGAGCTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCGTTATTGCCGAGATAATGGTCTACTTCTTCACAT 'Dictamnus sp. M.W.Chase-1820K AF066801' ---ATTATACTCCAGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAAGTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTACCGCGTATGTTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAGGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCTTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAAAATTACGGTAGGGCAGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCAATTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Dictyoloma_vandellianum_AF066823 CTTATTATACTCCTGAGTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAGGAAGCAGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTGGATCGTTACAAAGGACGATGCTACAACATTGAGCCTGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCT?CGCCTAGAGGATCTACGAATCCCTACCGCATATACTAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTAAACTCCCAACCCTTTATGCGTTGGAGGGATCGTTTCTTATTTTGTGCGGAAGCGCTTTATAAAGCGCAGACTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATGAAAAGAGCTATCTTTGCCCGAGAGCTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAACGGTCTACTTCTTCACAT Diplolaena_dampieri_AF066807 -TTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCCGAGGAAGCGGGGGCTGCAGTAGCTGCGGAATCTTCTACCGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAACATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGGAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGCCCCCTGTTAGGATGTACTATTAAACCTAAACTGGGGTTATCCGCTAAGAATTACGGTAGGGCAGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCTCTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAGGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCTAGAGAGCTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCCCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Eremocitrus_glauca_AF066819 CTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACCTGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAGCATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCACTGCGCGCTATACGTCTAGAGGATCTACGAATCCCTCCTGCGTATTCTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTGGGATGTACTATTAAACCTAAACTGGGGTTATCCGCGAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCTCTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTACCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Eriostemon_brevifolius_AF156883 CTTATTATACTCCTGAATATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCAGTAGCTGCGGAATCTTCTACCGGCACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGT{AT}TTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCCTGTTAGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTATGGTAGGGCAGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGCTTCTTATTTTGTGCGGAAGCACTTTATAAGGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGCTGGGAGTTCCTATCG{CT}AATGCATGACTACTTAACAGGGGGATTCACC{GT}CAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Euodia_hupehensis CTTATTATACTCCTGACTATGTAACCAAAGCTACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAATAAGTATGGACGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGGGCAGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCAATTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGCTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCT---------------------------------------- Flindersia_australis_U38861 CT?AT?ATACTC?TGACTATGTAA?CAA?GATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCCGAGGAAGCGGGG?CTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACGGTGTGGACCGATGG?CTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAACATCAATATA??TGT?ATGTAGCTTACC?GTTAGACCTTT??GAAGAAG?TTCTGTTACTAACATGTTTATGTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCCTGCGCGC{GT}CTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGAC{CG}TCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTAC{CG}GTAGGGCAGTTTATGAATGTCTACGCGGTGGGCTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCACTTTATAAAGCCCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGCTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGC??????????????????????????????????????????????????? Glycosmis_pentaphylla_AF066820 CTCATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACGGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCG{AT}TACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAACATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTTTTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTGGGATGTACTATTAAACCTAAACTGGGGTTATCCGCTAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTG?TTTTGTGCGGAAGCACTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCGGGGACATCCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAAGAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Harrisonia_perforata_U38863 CTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAGGAAGCAGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAGCTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGACGATGCTACAACATTGAGCCTGTTGCTGGAGAAGACAATCAATATATATGTTATGTAGCTTACCCTTTAGACCTTTTT?AAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATATTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTATGGTAGAGCAGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTTTTATTTTGTGCGGAACGACTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCGGTCTTTGCCAGAGAGCTGGGAGCTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Lunasia_amara_AF066814 -TTATTATACTCCTGACTATGTAACCAAAGATACTGATATATTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAACATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGCAGGGCAGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCAGAAGCAATTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTG{AG}CAGAGAGCTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTG{CG}CGAGATAATGGTCTACTTCTTCACAT Melicope_ternata_AF116271 CTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAAGTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTTTCAAGGCCCGCCTCATGGTATCCAAGTTGATAGAGATAAATTGAACAAGTATGGACGTCCCCTGTTGGGATGTACCATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGGGCGGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCGTATTTTGTGCGGAAGCAATTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGCTGGGAGTTCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Neochamaelea_pulverulenta_AF206752 CTTATTATACTCCTG?GTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGAAAGCAGGGGCAGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAAC{GT}GTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACAACATTGAGCCTGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTACGGGGTATATTAAAACTTTCCAAGGCCCGTTGCACGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGAGCTGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCAGAAGCAATTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACCGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGCTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Phellodendron_amurense_AF066804 CTTATTATACTCCTGACTATGCAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAAGTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTACCGCGTATTCTAAAACTTTCCAAGGCCCGCCTCACGG?ATCCAAGTTGAGAGAGATAAAT{CT}GAATAAGTATGGACGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGGGCAGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCAATTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATGAAAAGGGCTATCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Ruta_graveolens_U39281 CTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACGACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTTAAAGCCCTGCGCGCGCTACGTCTAGAGGATCTACGAATCCCTACTGCGTATGTTAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTACGGCCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCACTTTATAAAGCACAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Sarcomelicope_simplicifolia_AF066817 CTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAGCTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGGAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTT{CT}CAAGGCCCGCCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGACGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGGGCGGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCGTATTTTGTGCGGAAGCGCTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGCTGGGAGTTCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Schinus_molle_U39270 CTTATTATACTCCTGAATATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCAGGAGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGACGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTACCGCGTATACAAAAACTTTCCAAGGACCACCGCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCTAAATTAGGTTTATCCGCTAAGAACTACGGTAGAGCTGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCGGAAGCAATTTTTAAAGCGCAGGCTGAAACAGGTGAAATTAAAGGTCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGCTAAAAAGGGCTGTATTTGCAAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACGGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Severinia_buxifolia_AF066806 CTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACCTGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAGAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTGACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCACTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCTGCGTATACTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCCTGTTGGGATGTACTATTAAACCTAAACTGGGGTTATCCGCTAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCACTTTATAAAGCGCAAGATGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTTTTTGCCAGAGAGTTGGGAGCTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Simarouba_glauca_U38927 CTTATTATACTCCTGAATATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGGGTAACTCCTCAACCCGGAGTTCCGCCCGAGGAAGCGGGGGCAGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGACGATGCTACAACATTGAGCCTGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCGATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATTTACGAATCCCTCCCGCGTATTCTAAAACTTTCCAAGGGCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTATTGGGATCTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGAGCTGTTTATGAATGTCTGCGTGGTGGACTTGACTTTACCAAAGATGATGAAAACGTGAACTCCCAACCATTTATGCGCTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCATCT?ATAAAGGCCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGGGCCGTTTGTGCCAGAGAGCTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACCGCGAATACCAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACAT Spathelia_excelsa_AF066798 CGTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGGGTTCCGCCTGAGGAAGCAGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGACGATGCTACAACATTGAGCCTGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCGCTGCGCGCTCTACGCCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCCTTTATGCGTTGGAGGGACCGTTTCGTATTTTGTGCGGAAGCGCTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCCGAGAGCTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAACGGTCTACTTCTTCACAT Swietenia_macrophylla_U39080 CTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCCGAGGAAGCAGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACTAGCCTTGATCGTTACAAAGGACGATGCTACAACATTGAGCCAGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACGTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTTCCAAGGCCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCGGAAGCACTCTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCCGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACTGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Thamnosma_hirschii_3187b CTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGAGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACGACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTTAAAGCCCTGCGCGCACTACGTCTAGAGGATCTACGAATCCCTCCTGCGTATTCTAAAACTTTCCAAGGCCCCCCTCACGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGCCGTCCCCTATTGGGATGTACTATTAAACCCAAATTGGGGTTATCCGCTAAGAATTATGGTAGGGCAGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCTATTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACGGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGA----------------------- Thamnosma_montana_4351 CTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACGACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTTAAAGCCCTGCGCGCGCTACGTCTAGAGGATCTACGAATCCCTCCTGCGTATTCTAAAACTTTCCAAGGCCCCCCTCACGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGCCGTCCCCTGTTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCTAAGAATTATGGTAGGGCAGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCTCTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACGGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTTTACTTCTTCACAT Thamnosma_montana_9022b CTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACGACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTTAAAGCCCTGCGCGCGCTACGTCTAGAGGATCTACGAATCCCTCCTGCGTATTCTAAAACTTTCCAAGGCCCCCCTCACGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGCCGTCCCCTGTTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCTAAGAATTATGGTAGGGCAGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCTCTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACGGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTTTACTTCTTCACAT Thamnosma_pailensis_369b CTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACGACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTTAAAGCCCTGCGCGCGCTACGTCTAGAGGATCTACGAGTCCCTCCTGCGTATTCTAAAACTTTCCAAGGCCCTCCTCACGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGCCGTCCCCTGTTGGGATGTACTATTAAACCCAAATTGGGGTTATCCGCTAAGAATTATGGTAGGGCAGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCTATTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACGGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATA------------------- Thamnosma_socotrana_2495 CTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACGACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTTAAAGCCCTGCGCGCGCTACGTCTAGAGGATCTACGAATCCCTCCTGCGTATTCTAAAACTTTCCAAGGCCCCCCTCACGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGCCGTCCCCTATTGGGATGTACTATTAAACCCAAATTGGGGTTATCCGCTAAGAATTATGGTAGGGCAGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCTATTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACGGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGA----------------------- Thamnosma_texana_S.N. CTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACGACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTTAAAGCCCTGCGCGCGCTACGTCTAGAGGATCTACGAGTCCCTCCTGCGTATTCTAAAACTTTCCAAGGCCCTCCTCACGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGCCGTCCCCTGTTGGGATGTACTATTAAACCCAAATTGGGGTTATCCGCTAAGAATTATGGTAGGGCAGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCTATTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACGGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTTTACTTCTTCAC-- Thamnosma_trifoliata_7577b CTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACGACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTTAAAGCCCTGCGCGCGCTACGTCTAGAGGATCTACGAATCCCTCCTGCGTATTCTAAAACTTTCCAAGGCCCCCCTCACGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGCCGTCCCCTGTTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCTAAGAATTATGGTAGGGCAGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCTCTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACGGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTTTACTTCTTCAC-- Zanthoxylum_monophyllum_U39282 CTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGACGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTACCGCGTATACTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCCTGTTGGGATGTACTATTAAACCGAAATTGGGGTTATCCGCTAAGAATTACGGTAGGGCAGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCACTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATAAAAAGGTCTGTCTTTGCCAGAGAGTTGGGAGCTCCTATCGTAATGCATGACTACTTAACAGGGGGGTTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT Zanthoxylum_sp._Chase_1348 CTTATTATACTCCTGACTATGCAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGGGCAGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCACTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGGTTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACAT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7295] TITLE 'Thamnosma ITS, matK, rbcL-atpB sp.'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2113; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Ruta_macrophylla_Sn GACTAAGGCGCGGTTTTGTAATGCATTAGGGCATCCCATCAGTAAGTCGTCCTGGGCCGATTTCTCTGATTCTCATCTTATCGACCGGTTTGTGCGTATATGCAGAAATCTTTCTCATTATCATAGCGGATCCTCAAAAAACAAAAGTTTGTATCGAATAAAATATATACTTCGCCTTTCCTGTGTTAAAAGTTTGGTTCGTAAACATAAAAGTACTGTACGCGCTTTTTTAAAAAGATCAGGTTCGGGATTTTTGGAAGAATTCCTTATGGAGGAAGAACACGTTCTTTCTTTAATCTTTCCAAGGGCTTCGTCTACTTCGCGGGGGTTCTAT------AGAGGGCAGATTTGGTATTTGGATATTTTTTTTATCAACGATCTGGTTAATTATGACTGATCGGGCACGAGACTGTGGACCTGGAATTTAGAACTAAGTTCTAAATAATCAATCA-TAACTAAAAAA-TTCCTTCATTTCTATTAAATGTTCATACAAAAAGAATAATAAAA--------------AAA-GGTTGATCAACCGAGTATTCAACTTTTTTAACGTCTTCGTTAGGGATTTGATAAGAAAGGGAGTTTTCGATGTTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCATGCACGGCTTGGGGAGGGATTTTTTTTTTTTTTTCGAACGCGATGGTATCCAAAAAAAAAAATCTTCGATAGCACGGGGATCGGTTAATTCAATAAGAAAGGGGAGTTCGCGCTCGATTTCGTTGGTCCGGCCCAACCGAAGGCAATTCAATGGTTTTCTGATGCTTAGGCATTTATGCAATTTCAATGAGGGAATTTTCAAGTTCAACCAACCGCCTTTCAAGGGATGAATAAAAATCTTGAGAAAGTTGTTCATTTATCTATCATTATAGACAATACCCGTCCTATTATCTATGGAGTTCGAACCTGAACTCTCTGTTTCGATTCATTATTTCTAGCTCAGGGGACCTTATTTCTTATTTTAGCATATCGATTTCGGCCTAGTCGATTCTTTTTTTATATATAGACCCCGCCTTTCTTTCCTCGACGAATTATGCCTATTTTCTTTGCCCATCTAGGATTTACGTATACAACATATATTACTGTCAAGAGTCAATTTATTAGTATTTAGATATTTCGATGGAAAAAAAAAAAAA---------TAATAATAATAAATAATAA-TAAGGGATTAAAAACTTGAAAGGCGCTGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGTAAATCAAATACCGTGGTCTAAAAAAACAAAAACAAGGAATCGTTCTGAGTAGTTGATAATATTAATTGAAAATCTTGTGAAAGATTCCTGTGAAGGGGTTTCATTAACTCCTGATTTATGTCGAGTAGACCTTGTTCTTGCGAGACTTCTTAATTCATGAGTTGTAGGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTC?????????????TCGAAACCTGCCTAGCAGAACGACCCGCGAACAAGTTAATTCACTGGCGG--AGGGGGGTGGAAGCCTCCCCCCGCCCCGGCTCCAGGAGGG-CGCTGGATACGTCTTGTGT-CCCTCCTGAGCCCTAACGAACCCCCGGCGCGGAATGCGCCAAGGAAAACCAACGAGAGAGCGAGCTCTGCGGGTTCGCCCGTCGGATGCGCCGCCTTCTTTCACTTATCCAATCATTGCCCCCAC-CCC-TCCCCCTTCG-GGG-GGTGCGGACTGT-GGGGGCGGACAATGGCCTCCCGTTGGCTCTCTGCCTGCGGCTGGTTGAAATTTGAGTCTCCGGCTGCACGAGCCGCGACAATCGGTGGTGAAAACAAAGCCTCTCGAGTTCCTGTCGCGTGCATGCGCTGCCCTGC-GA-GGGCTC-ATGACCCAT-GCGTTGTATTTTTGGCGCTCGCTTTGC Thamnosma_africana_21900 GACTAAGGCGCGGTTTTGTAATCCATTAGGGCATCCCATCAGTAAGCCGGCCTGGGCCGATTTCTCAGATTCTCATCTTATCGACCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATCATAGCGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTGTTAAAAGTTTGGTTCGTAAACATAAAAGTACTGTACGCGCTTTTTTAAAAAGATGGGGTTCGGGATTTTTGGAAGAATTCCTTATGGAGGAAGAACACGTTCTTTCTTTCATTTTTCCAAGGGCTTCGTCTACTTCGCGTAGGTTCTATTTATATAGAGGACGGATTTGGTATTTGGATATTTTTTGTATCAACGATCTGGTTAATTATGACTGAGTGGGTACGAGACCACGGACCCGGAATTTATAACTCAGTTCTAAATAATTAATCGCTAATTAAAAAAATTCCTTCATTTCTATTAAATGTTCATACAATAAGAATAATAAAAT-------------AAAGGGTTGATCGACTGAGTATTCAACTTTTTTAATGCCTTCATTAGGGATTTGGTTTCAAAGGGAGTTTTCGGTGTTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCATGCACGGCTTGGGGAGGGATTTTTTTTTTTTTTTCGAACTTGATGGTATCAAAAAAAA----TCTTCAATAGCACGCGGATCGGTTAATTCAATAAGAAATGGGAGTTCGCGCTCGATTTCGTTGGGACCGTCCAACCGAATGCAATTCAATTGTTTCCTGATGCTTAGGCATTTCTGCAATTTCAATGAGGGAATTTTCAAGTTCAACCAACCGCCTTTCAATGGATGAATAAAAATCTTGAGAAAGCTGTTCCTTTATCTATCATTATAGACAATACCCGTCCTATTATCTATCGAGTTTGAACCTGAACTCTCTGTTTCGATTCATTATTTCGAGCTCATTGGACCTTATTTCTTATTTTAGTATATCGATTTAGGCCTAGTCTATTCTTTATATATATATTGATCCTGCCTTTCTTTCCTCGACGAATTATGCCTATTTTCTTTGCACATCTAGGATTTACGTATACAACATATATTACTGTCAAGAGTCAATTTAGTAGTATTTAGATATTTCGATTGAAAAAAAAAAAAAAAAAAAA---------------------GTAAAGGATTAGAAACTTGAAAGGCGCTGATCGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGTAAATCAAATACCGTGGTCTAAAAAAACAAAAACAAGGAATCGTTCTGAGTAGTTGATAATATTAATTGAAAATCTTGTGAAAGATTCCTGTGAAGGGGTTTCATTAACTCCTGATTTATGTCGAGTAGACCTTGTTCTTGCGAGACTTCTTAATTCATGAGTTGTAGGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGTCGAAACCTGCCTAGCAGAACGACCCGCGAA{AC}GAGTGAAATCACCGGTGC---GGGGGAGCCTCGTCTCCTCCCCGCCACCGTCGCAGGGAG-TGTGGGACTCGTCCTGCATCCCCCGCGGCGCCCTAACGAACCCCCGGCGCGGAATGCGCCAAGGAAACTTAA{CT}GAGAGAGCGAGCCCCGCGGGTTCGCCCGCCGGCGGCGCCGCCTTCTTTTACATATACAATCGTCGCCCCCACCCCC-TCCCCCCTCGCGGG-GCTGCGGGACGT-GGGGGCGGATATTGGCCTCCCGTGCGCTTCCCGCTCGCGGTTGGCCCAAATTCGAGTTCCCGGCAATGTTGGCCGCGACGATCGGTGGTGAAAGCTAA-----TCGAG---CTG--CCGTC-----GCACGCCTGCAGAAGGGCTCAAGGACCCCC-GCGCT-CGCACAAGGCGCTCGCATTGC Thamnosma_africana_8927 GACTAAGGCGCGGTTTTGTAATCCATTAGGGCATCCCATCAGTAAGCCGGCCTGGGCCGATTTCTCAGATTCTCATCTTATCGACCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATCATAGCGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTGTTAAAAGTTTGGTTCGTAAACATAAAAGTACTGTACGCGCTTTTTTAAAAAGATGGGGTTCGGGATTTTTGGAAGAATTCCTTATGGAGGAAGAACACGTTCTTTCTTTCATTTTTCCAAGGGCTTCGTCTACTTCGCGTAGGTTCTATTTATATAGAGGACGGATTTGGTATTTGGATATTTTTTGTATCAACGATCTGGTTAATTATGACTGAGTGGGTACGAGACCACGGACCCGGAATTTATAACTCAGTTCTAAATAATTAATCGCTAATTAAAAAAATTCCTTCATTTCTATTAAATGTTCATACAATAAGAATAATAAAAT-------------AAAGGGTTGATCGACTGAGTATTCAACTTTTTTAATGCCTTCATTAGGGATTTGGTTTCAAAGGGAGTTTTCGGTGTTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCATGCACGGCTTGGGGAGGGATTTTTTTTTTTTTTTCGAACTTGATGGTATCAAAAAAAA----TCTTCAATAGCACGCGGATCGGTTAATTCAATAAGAAATGGGAGTTCGCGCTCGATTTCGTTGGGACCGTCCAACCGAATGCAATTCAATTGTTTCCTGATGCTTAGGCATTTCTGCAATTTCAATGAGGGAATTTTCAAGTTCAACCAACCGCCTTTCAATGGATGAATAAAAATCTTGAGAAAGCTGTTCCTTTATCTATCATTATAGACAATACCCGTCCTATTATCTATCGAGTTTGAACCTGAACTCTCTGTTTCGATTCATTATTTCGAGCTCATTGGACCTTATTTCTTATTTTAGTATATCGATTTAGGCCTAGTCTATTCTTTATATATATATTGATCCTGCCTTTCTTTCCTCGACGAATTATGCCTATTTTCTTTGCACATCTAGGATTTACGTATACAACATATATTACTGTCAAGAGTCAATTTAGTAGTATTTAGATATTTCGATTGAAAAAAAAAAAAAAAA-------------------------GTAAAGGATTAGAAACTTGAAAGGCGCTGATCGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGTAAATCAAATACCGTGGTCTAAAAAAACAAAAACAAGGAATCGTTCTGAGTAGTTGATAATATTAATTGAAAATCTTGTGAAAGATTCCTGTGAAGGGGTTTCATTAACTCCTGATTTATGTCGAGTAGACCTTGTTCTTGCGAGACTTCTTAATTCATGAGTTGTAGGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGTCGAAACCTGCCTAGCAGAACGACCCGTGAACGAGTGAAATCACCGGTGC---GGGGGAGCCTCGTCTCCTCACCGCCACCGTCGCAGGGAG-TGTGGGACTCGTCCCGCATCCCCCGCGGCGCCCTAACGAACCCCCGGCGCGGAATGCGCCAAGGAAACTTAACGAGAGAGCGAGCCCCGCGGGTTCGCCCGCCGGCAGCGCCGCCTTCTTTCACATATACAATCGTCGCCCCCACCCCC-TCCCCCCTTGCGGG-GCTGCGGGACGT-GGGGGCGGATATTGGCCTCCCGTGCGCTTCCCGCTCGCGGTTGGCCCAAATTCGAGTCCCCGGCAATGTTGGCCGCGACGATCGGTGGTGAAAGCTAA-----TCGAG---CTG--CCGTC-----GCACGCCTGCAGAAGGGCTCAAGGACCCCC-GCGCC-CGCACAAGGCGCTCGCATTGC Thamnosma_crenata_224 GACTAAGGCGCGGTTTTGTAATCCATTAGGGCATCCCATCAGTAAGCCGGCCTGGGCCGATTTCTCAGATTCTCATCTTATCGACCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATCATAGCGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTGTTAAAAGTTTGGTTCGTAAACATAAAAGTACTGTACGCGCTTTTTTAAAAAGATGGGGTTCGGGATTTTTGGAAGAATTCCTTATGGAGGAAGAACACGTTCTTTCTTTCATTTTTCCAAGGGCTTCGTCTACTTCGCGTAGGTTCTATTTATATAGAGGACGGATTTGGTATTTGGATATTTTTTGTATCAACGATCTGGTTAATTATGACTGAGTGGGTACGAGACCACGGACCCGGAATTTAGAACTCAGTTCTAAATAATTAATCGCTAATTAAAAAAATTCCTTCATTTCTATTAAATGTTCATACAATAAGAATAATAAAAT-------------AAAGGGTTGATCGGCTGAGTATTCAACTTTTTTAATGCCTTCATTAGGGATTTGGTTTCAAAGGGAGTTTTCGGTGTTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCATGCACGGCTTGGGGAGGGATTTTTTTTTTTTTTTCGAACTTGATGGTATCAAAAAAAA----TCTTCAATAGCACGCGGATCGGTTAATTCAATAAGAAATGGGAGTTCGCGCTCGATTTCGTTGGGACCGTCCAACCGAATGCAATTCAATTGTTTCCTGATGCTTAGGCATTTCTGCAATTTCAATGAGGGAATTTTCAAGTTCAACCAACCGCCTTTCAATGGATGAATAAAAATCTTGAGAAAGCAGTTCCTTTATCTATCATTATAGACAATACCCGTCCTATTATCTATCGAGTTTGAACCTGAACTCTCTGTTTCGATTCATTATTTCGAGCTCATTGGACCTTATTTCTTATTTTAGTATATCGATTTAGGCCTAGTCTATTCTTTTTATATATATGGA{CT}CCTGCCTTTCTTTCCTCGACGAATTATGCCTATTTTCTTTGCACATCTAGGATTTACGTATACAACATATATTACTGTCAAGAGTCAATTTAGTAGTATTTAGATATTTCGATTGAAAAAAAAAAAA-----------------------------GTAAAGGATTAGAAACTTGAAAGGCGCTGATCGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGTAAATCAAATACCGTGGTCTAAAAAAACAAAAACAAGGAATCGTTCTGAGTAGTTGATAATATTAATTGAAAATCTTGTGAAAGATTCCTGTGAAGGGGTTTCATTAACTCCTGATTTATGTCGAGTAGACCTTGTTCTTGCGAGACTTCTTAATTCATGAGTTGTAGGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGTCGAAACCTGCCTAGCAGAATGACCCGCGAACGAGTGAAATCACCGTTGC--GGGGGGAGCCTCGTCTCCTCCCCGCCACCGTCGCATGGAG-TGCGGGACTCGTCCTGCATTCCCCGTGGCGCCCTAACGAACCCCCGGCGCGGAACGCGCCAAGGAAACTTAACGAGAGAGCGAGCCCCGCGGGTTTGCCTGCCGGTGGCGCCGCCTTCTTTCACATATCCAATCGTCGCCCCCACCCCC-TCCCCCCTCGCGGG-GCTGCAGGACGT-GGGGGCGGATATTGGCCTCCCGTGCGCTTCCCGCTCGCGGTTGGCCCAAATTCGAGTCCCTGGCAATGCTGGCCGCGACGATCGGTGGTGAAAGCTAA-----TCGAG---CTG--CCGTC-----GCACGCCTGCAGAAGGGCTCAAGGACCCCC-GCGCC-CGAACAAGGCGCTCGCATTGC Thamnosma_hirschii_10000 GACTAAGGCGCGGTTTTGTAATCCATTAGGGCATCCCATCAGTAAGCCGGCCTGGGCCGATTTCTCAGATTCTCATCTTATCGACCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATCATAGCGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTGTTAAAAGTTTGGTTCGTAAACATAAAAGTACTGTACGCGCTTTTTTAAAAAGATGGGGTTCGGGATTTTTGGAAGAATTCCTTATGGAGGAAGAACACGTTCTTTCTTTCACTTTTCCAAGGGCTTCGTCTACTTCGCGTAGGTTCTATTTATATAGAGGACGGATTTGGTATTTGGATATTTTTTGTATCAACGATCTGGTTAATTATGACTGAGTGGGTACGAGACCACGGACCCGGAATTTAGAACTCAGTTCTAAATAATTAATCCCTAATTAAAAAAATTCCTTCATTTCTATTAAATGTTCATACAATAAGAATAATAAAAT-------------AAAGGGTTGATCGACTGAGTATTCAACTTTTTTAATGCCTTCATTAGGGATTTGGTTTCAAAGGGAGTTTTCGGTGTTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCATGCACGGCTTGGGGAGGGATTTTTTTTTTTTTTTCGAACTTGATGGTATCAAAAAAAA----TCTTCAATAGCACGCGGATCGGTTAATTCAATAAGAAATGGGAGTTCGCGCTCGATTTCGTTGGGACCGTCCAACCGAATGCAATTCAATTGTTTCCTGATGCTTAGGCATTTCTGCAATTTCAATGAGGGAATTTTCAAGTTCAACCAACCGCCTTTCAATGGATGAATAAAAATCTTGAGAAAGCTGTTCCTTTATCTATCATTATAGACAATACCCGTCCTATTATCTATCGAGTTTGAACCTGAACTCTCTGTTTCGATTCATTATTTCGAGCTCATTGGACCTTATTTCTTATTTTAGTATATCGATTTAGGCCTAGTCTATTCTTTTTATATATATTGATCCTGCCTTTCTTTCCTCGACGAATTATGCCTATTTTCTTTGCACATCTAGGATTTACGTATACAACATATATTACTGTCAAGAGTCAATTTAGTAGTATTTAGATATTTCGATTGAAAAAAAAAAAAAAAAAA-----------------------GTAAAGGATTAGAAACTTGAAAGGCGCTGATCGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGTAAATCAAATACCGTGGTCTAAAAAAACAAAAACAAGGAATCGTTCTGAGTAGTTGATAATATTAATTGAAAATCTTGTGAAAGATTCCTGTGAAGGGGTTTCATTAACTCCTGATTTATGTCGAGTAGACCTTGTTCTTGCGAGACTTCTTAATTCATGAGTTGTAGGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGAGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGTCGAAACCTGCCTAGCAGAACGACCAGCGAACGAGTGAAATCACCGGCGC---GGGGGAGCCTCGTCTCCTCCCTGCCACCGTCGCAGGGAG-CGCAGGACTCTTCCTGCGCCCCCCGCGGCGCCCTAACGAACCCCCGGCGCGGAACGCGCCAAGGAAACTTAACGAGAGAGCGAGCCCCGCGGGTTAGCCCG-CGGCGGCGCCGCCTTCTTTCACATATCCAATCGTCGCCCCCACCCCC-TCCCCCCTCGCGGG-GCTGCGGGACGT-GGGGGCGGATATTGGCCTCCCGTGCGCTTCCCGCTCGCGGTTGGCCCAAATTCGAGTCCCCGGCAATGCTGGCCGCGACGATCGGTGGTGAAAGCTAA-----TCGAG---CTC--CCGTC-----GCGCGCCTGCAGAAGGGCTCAAGGACCCCCCGCGCC-CGCACAAGGCGCTCGCATTGC Thamnosma_hirschii_3187 GACTAAGGCGCGGTTTTGTAATCCATTAGGGCATCCCATCAGTAAGCCGGCCTGGGCCGATTTCTCAGATTCTCATCTTATCGACCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATCATAGCGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTGTTAAAAGTTTGGTTCGTAAACATAAAAGTACTGTACGCGCTTTTTTAAAAAGATGGGGTTCGGGATTTTTGGAAGAATTCCTTATGGAGGAAGAACACGTTCTTTCTTTCACTTTTCCAAGGGCTTCGTCTACTTCGCGTAGGTTCTATTTATATAGAGGACGGATTTGGTATTTGGATATTTTTTGTATCAACGATCTGGTTAATTATGACTGAGTGGGTACGAGACCACGGACCCGGAATTTAGAACTCAGTTCTAAATAATTAATCCCTAATTAAAAAAATTCCTTCATTTCTATTAAATGTTCATACAATAAGAATAATAAAAT-------------AAAGGGTTGATCGACTGAGTATTCAACTTTTTTAATGCCTTCATTAGGGATTTGGTTTCAAAGGGAGTTTTCGGTGTTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCATGCACGGCTTGGGGAGGGATTTTTTTTTTTTTTTCGAACTTGATGGTATCAAAAAAAA----TCTTCAATAGCACGCGGATCGGTTAATTCAATAAGAAATGGGAGTTCGCGCTCGATTTCGTTGGGACCGTCCAACCGAATGCAATTCAATTGTTTCCTGATGCTTAGGCATTTCTGCAATTTCAATGAGGGAATTTTCAAGTTCAACCAACCGCCTTTCAATGGATGAATAAAAATCTTGAGAAAGCTGTTCCTTTATCTATCATTATAGACAATACCCGTCCTATTATCTATCGAGTTTGAACCTGAACTCTCTGTTTCGATTCATTATTTCGAGCTCATTGGACCTTATTTCTTATTTTAGTATATCGATTTAGGCCTAGTCTATTCTTTTTATATATATTGATCCTGCCTTTCTTTCCTCGACGAATTATGCCTATTTTCTTTGCACATCTAGGATTTACGTATACAACATATATTACTGTCAAGAGTCAATTTAGTAGTATTTA?ATATT?C??T?GAAAAAAAAAAAAAAAAAA-----------------------GTAAAGGATTAGAAACTTGAAAGGCGCTGATCGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGTAAATCAAATACCGTGGTCTAAAAAAACAAAAACAAGGAATCGTTCTGAGTAGTTGATAATATTAATTGAAAATCTTGTGAAAGATTCCTGTGAAGGGGTTTCATTAACTCCTGATTTATGTCGAGTAGACCTTGTTCTTGCGAGACTTCTTAATTCATGAGTTGTAGGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGAGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGTCGAAACCTGCCTAGCAGAACGACCAGCGAACGAGTGAAATCACCGGCGC---GGGGGAGCCTCGTCTCCTCCCTGCCACCGTCGCAGGGAG-CGCAGGACTCTTCCTGCGCCCCCCGCGGCGCCCTAACGAACCCCCGGCGCGGAACGCGCCAAGGAAACTTAACGAGAGAGCGAGCCCCGCGGGTTAGCCCG-CGGCGGCGCCGCCTTCTTTCACATATCCAATCGTCGCCCCCACCCCC-TCCCCCCTCGCGGG-GCTGCGGGACGT-GGGGGCGGATATTGGCCTCCCGTGCGCTTCCCGCTCGCGGTTGGCCCAAATTCGAGTCCCCGGCAATGCTGGCCGCGACGATCGGTGGTGAAAGCTAA-----TCGAG---CTC--CCGTC-----GCGCGCCTGCAGAAGGGCTCAAGGACCCCCCGCGCC-CGCACAAGGCGCTCGCATTGC Thamnosma_hirschii_6164 GACTAAGGCGCGGTTTTGTAATCCATTAGGGCATCCCATCAGTAAGCCGGCCTGGGCCGATTTCTCAGATTCTCATCTTATCGACCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATCATAGCGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTGTTAAAAGTTTGGTTCGTAAACATAAAAGTACTGTACGCGCTTTTTTAAAAAGATGGGGTTCGGGATTTTTGGAAGAATTCCTTATGGAGGAAGAACACGTTCTTTCTTTCACTTTTCCAAGGGCTTCGTCTACTTCGCGTAGGTTCTATTTATATAGAGGACGGATTTGGTATTTGGATATTTTTTGTATCAACGATCTGGTTAATTATGACTGAGTGGGTACGAGACCACGGACCCGGAATTTAGAACTCAGTTCTAAATAATTAATCCCTAATTAAAAAAATTCCTTCATTTCTATTAAATGTTCATACAATAAGAATAATAAAAT-------------AAAGGGTTGATCGACTGAGTATTCAACTTTTTTAATGCCTTCATTAGGGATTTGGTTTCAAAGGGAGTTTTCGGTGTTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCATGCACGGCTTGGGGAGGGATTTTTT??????????????????????????AAAAAAA----TCTTCAATAGCACGCGGATCGGTTAATTCAATAAGAAATGGGAGTTCGCGCTCGATTTCGTTGGGACCGTCCAACCGAATGCAATTCAATTGTTTCCTGATGCTTAGGCATTTCTGCAATTTCAATGAGGGAATTTTCAAGTTCAACCAACCGCCTTTCAATGGATGAATAAAAATCTTGAGAAAGCTGTTCCTTTATCTATCATTATAGACAATACCCGTCCTATTATCTATCGAGTTTGAACCTGAACTCTCTGTTTCGATTCATTATTTCGAGCTCATTGGACCTTATTTCTTATTTTAGTATATCGATTTAGGCCTAGCCTATTCTTTTTATATATATTGATCCTGCCTTTCTTTCCTCGACGAATTATGCCTATTTTCTTTGCACATCTAGGATTTACGTATACAACATATATTACTGTCAAGAGTCAATTTAGTAGTATTTAGATATT?CGATTGAAAAAAAAAAAAAAAAAAAAAA-------------------GTAAAGGATTAGAAACTTGAAAGGCGCTGATCGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGTAAATCAAATACCGTGGTCTAAAAAAACAAAAACAAGGAATCGTTCTGAGTAGTTGATAATATTAATTGAAAATCTTGTGAAAGATTCCTGTGAAGGGGTTTCATTAACTCCTGATTTATGTCGAGTAGACCTTGTTCTTGCGAGACTTCTTAATTCATGAGTTGTAGGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGTCGAAACCTGCCTAGCAGAACGACCAGCGAACGAGTGAAATCACCGGCGC---GGGGGAGCCTCGTCTCCTCCCTGCCACCGTCGCAGGGAG-CGCAGGACTCTTCCTGCGCCCCCCGCGGCGCCCTAACGAACCCCCGGCGCGGAACGCGCCAAGGAAACTTAACGAGAGAGCGAGCCCCGCGGGTTAGCCCG-CGGCGGCGCCGCCTTCTTTCACATATCCAATCGTCGCCCCCACCCCC-TCCCCCCTCGCGGG-GCTGCGGGACGT-GGGGGCGGATATTGGCCTCCCGTGCGCTTCCCGCTCGCGGTTGGCCCAAATTCGAGTCCCCGGCAATGCTGGCCGCGACGATCGGTGGTGAAAGCTAA-----TCGAG---CTC--CCGTC-----GCGCGCCTGCAGAAGGGCTCAAGGACCCCCCGCGCC-CGCACAAGGCGCTCG-ATT-C Thamnosma_montana_4252 GACTAAGGCGCGGTTTTGTAATCCATTAGGGCATCCCATCAGTAAGCCGGCCTGGGCCGATTTCTCTGATTCTCATCTTATCGACCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATCATAGCGGATCCTCAAAAAAAGAAGGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTGTTAAAAGTTTGGTTCGTAAACATAAAAGTACTGTACGCGCTTTTTTAAAAAGAGGGGGTTCGGGATTTTTGGAAGAATTCCTTATGGAGGAAGAACACGTTCTTTCTTTAATTTTTCCAAGGGCTTCGTCTACTTCGCGTAGGTTCTATTTATATAGAGGACGGATTTGGTATTTGGATATTTTTTCTATCAACGATCTGGTTAATTATGACTGAGTCGGTACGAGACCACGGACCCGGAATTTAGAACTCAGTTCTAAATAATTAATCGCTAATTAAAAAA-TTCCTTCATTTCTATTAAATGTTCATACAATAAGAATAATAAAAT-------------AAAGGGTTGATCGACTGAGTATTCAACTTTTTTAATGCCTTCATTAGGGATTTGGTTTCAAAGGGAGTTTTCGGTGTTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCATGCACGGCTTGGGGAGGGATTTTTTTTTGTTTTTCGAACTTGATGGTATCAAAAAAAA----TCTTCAATAGCACGCGGATCGGTTAATTCAATAAGAAATGGGAGTTCGCGCTCGATTTCGTTGGGACCGTCCAACCGAATGCAATTCAATTGTTTCCTGATGCTTAGGCATTTCTGCAATTTCAATGAGGGAATTTTCAAGTTCAACCAACCGCCTTTCAATGGATGAATAAAAATCTTGAGAAAGCTGTTCCTTTATCTATCATTATAGACAATACCCGTCCTATTATCTATCGAGTTTGAACCTGAACTCTCTGTTTCGATTCATTATTTCGAGCTCATTGGACCTTATTTCTTATTTTAGCATATCGATTTAGGTCTAGTCTATTCTTTTTATATATATTGATCCTGCCTTTCTTTCCTCGACGAATTATGCCTATTTTCTTTGCACATCTAGGATTTACGTATACAACATATATTACTGTCAAGAGTCAATTTAGTAGTATTTAGATATTTCGATTGAAAAAAAAAAAAAAAAA------------------------GTAAAGGATTAGAAACTTGAAAGGCGCTGATCGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGTAAATCAAATACCGTGGTCTAAAAAAACAAAAACAAGGAATCGTTCTGAGTAGTTGATAATATTAATTGAAAATCTTGTGAAAGATTCCTGTGAAGGGGTTTCATTAACTCCTGATTTATGTCGAGTAGACCTTGTTCTTGCGAGACTTCTTAATTCATGAGTTGTAGGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAAT?????????????????TCGAAACCTGCCTAGCAGAACGACCCGCGAACGAGTGAAATCACCGGCGC--GGGGGGGGCCTCGTCTCCTCCCCGCCACCGTCGCAGGGAG-CGCGGGACTCGTCCCGCATCCCCCGCGGCGCCATAACGAACCCCCGGCGCGGAATGCGCCAAGGAAACTTAACGAGAGAGCGAGCCCCGCGGGTTCGCCCGCCGGCGGCGCCGCCTTCTTTCACATATCCA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Thamnosma_montana_9022 GACTAAGGCGCGGTTTTGTAATCCATTAGGGCATCCCATCAGTAAGCCGGCCTGGGCCGATTTCTCTGATTCTCATCTTATCGACCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATCATAGCGGATCCTCAAAAAAAAA-GGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTGTTAAAAGTTTGGTTCGTAAACATAAAAGTACTGTACGCGCTTTTTTAAAAAGAGGGGGTTCGGGATTTTTGGAAGAATTCCTTATGGAGGAAGAACACGTTCTTTCTTTAATTTTTCCAAGGGCTTCGTCTACTTCGCGTAGGTTCTATTTATATAGAGGACGGATTTGGTATTTGGATATTTTTTGTATCAACGATCTGGTTAATTATGACTGAGTCGGTACGAGACCACGGACCCGGAATTTAGAACTCAGTTCTAAATAATTAATCGCTAATTAAAAAA-TTCCTTCATTTCTATTAAATGTTCATACAATAAGAATAATAAAAT-------------AAAGGGTTGATCGACTGAGTATTCAACTTTTTTAATGCCTTCATTAGGGATTTGGTTTCAAAGGGAGTTTTCGGTGTTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCATGCACGGCTTGGGGAGGGATTTTTTTTTGTTTTTCGAACTTGATGGTATCAAAAAAAA----TCTTCAATAGCACGCGGATCGGTTAATTCAATAAGAAATGGGAGTTCGCGCTCGATTTCGTTGGGACCGTCCAACCGAATGCAATTCAATTGTTTCCTGATGCTTAGGCATTTCTGCAATTTCAATGAGGGAATTTTCAAGTTCAACCAACCGCC-------GGATGAATAAAAATCTTGAGAAAGCTGTTCCTTTATCTATCATTATAGACAATACCCGTCCTATTATCTATCGAGTTTGAACCTGAACTCTCTGTTTCGATTCATTATTTCGAGCTCATTGGACCTTATTTCTTATTTTAGCATATCGATTTAGGTCTAGTCTATTCTTTTTATATATATTGATCCTGCCTTTCTTTCCTCGACGAATTTTGCCTATTTTCTTTGCACATCTAGGATTTACGTATACAACATATATTACTGTCAAGAGTCAATTTAGTAGTATTTAGATATTTCGATTGAAAAAAAAAAA------------------------------GTAAAGGATTAGAAACTTGAAAGGCGCTGATCGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGTAAATCAAATACCGTGGTCTAAAAAAACAAAAACAAGGAATCGTTCTGAGTAGTTGATAATATTAATTGAAAATCTTGTGAAAGATTCCTGTGAAGGGGTTTCATTAACTCCTGATTTATGTCGAGTAGACCTTGTTCTTGCGAGACTTCTTAATTCATGAGTTGTAGGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGTCGAAACCTGCCTAGCAGAACGACCCGCGAACGAGTGAAATCACCGGCTC--GGGGGGGGCCTCGTCTCCTCCCCGCCACCGTCGCAGGGAG-CGCGGGACTCGTCCCGCATCCCCCTCGGCGCCCTAACGAACCCCCGGCGCGGAATGCGCCAAGGAAACTTAACGAGAGAGCGAGCCCCGCGGGTTCGCCCGCCGGCGGCGCCGCCTTCTTTCACATATCCAATCGTCGCCCCCACCCCCCTCCCCCCTCGCGGGTGCTGCGGGACGT-GGGGGCGGATATTGGCCTCCCGTGCGCTTCCCGCTCGCGGCTGGCCCAAATTCGAGTCCCCGTCAATGCTGGCCGCGACGATCGGTGGTGAAAGCTAA-----TCGAG---CTC--CCGTC-----GCGCGCCTGCGGAAGGGCTCAAGGACCCCCCGCGCC-CGTACAAGGCGCTCGCATTGC Thamnosma_pailensis_369 GACTAAGGCGCGGTTTTGTAATCCATTAGGGCATCCCATCAGTAAGCCGGCCTGGGCCGATTTCTCTGATTCTCATCTTATCGACCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATCATAGCGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGTCTTTCTTGTGTTAAAAGTTTGGTTCGTAAACATAAAAGTACTGTACGCGCTTTTTTAAAAAGATGGGGTTCGGGATTTTTGGAAGAATTCCTTATGGAGGAAGAACACGTTCTTTCTTTAATTTTTCCAAGGGCTTCGTCTACTTCGCGTAGGTTCTATTTATATAGAGGACGGATTTGGTATTTGGATATTTTTTGTATCAACGATCTGGTTAATTATGACTGAGTGGGTACGAGACCACGGACCCGGAATTTAGAACTCAGTTCTAAATAATTAATCGCTAATTAAAAAAATTCCTTCATTTCTATTAAATGTTCATACAATAATAA-AATAAAATTAAAATTTAAAATAAAGGGTTGATCGACTGAGTATTCAACTTTTTTAATGCCTTCATTAGGGATTTGGTTTCAAAGGGAGTTTTCGGTGTTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCATGCACGGCTTGGGGAGGGATTTTTTTTTTTTTTTCGAACTTGATGGTATCAAAAAAAA----TCTTCAATAGCACGCGGATCGGTTAATTCAATAAGAAATGCAAGTTCGCGCTCGATTTCGTTGGGACCGTCCAACCGAATGCAATTCAATTGTTTCCTGATGCTTAGGCATTTCTGCAATTTCAATGCGGGAATTTTCAAGTTCAACCAACCGCCTTTCAATGGATGAATAAAAATCTTGAGAAAGCTGTTCCTTTATCTATCATTATAGACAATACCCGTCCTATTATCTATCGAGTTTGAACCTGAACTCTCTGTTTCGATTCATTATTTCGAGCTCATTGGACCTTATTTCTTATTTTAGCATATCGATTTAGGCCTAGTCTATTCTTTTTATATATATTGATCCTGCCTTTCTTTCCTCGACAAATTATGCCTATTTTCTTTGCACATCTAGGATTTACGTATACAACATATATTACTGTCAAGAGTCAATTTAGTAGTATTTAGCTATTTCGATTGAAAAAAAAAAAAAAAAA------------------------GTAAAGGATTAGAAACTTGAAAGGCGCTGATCGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGTAAATCAAATACCGTGGTCTAAAAAAACAAAAACAAGGAATCGTTCTGAGTAGTTGATAATATTAATTGAAAATCTTGTGAAAGATTCCTGTGAAGGGGTTTCATTAACTCCTGATTTATGTCGAGTAGACCTTGTTCTTGCGAGACTTCTTAATTCATGAGTTGTAGGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGTCGAAACCTGCCTAGCAGAACGACCCGCGAACGAGTGAAATCACCGGCGC--GGGGGGGGCCTCGTCTCCTCCCCGCCGCCGTCGCGGGGGGGCGCGGGACTTGTCCCGCATTCCCCGCGGCGCCCTAACGAACCCCCGGCGCGGAACGCGCCAAGGAAACCTAACGAGAGAGCGAGCCCCGCGGGTTCGCCCGCCGGCGGCGCCGCCTTCTTTCACATATCCAATCGTCGCCCCCACCCCC-TCCCCCCTCGCGGG-GCTGCGGGACGTTGGGGGCGGATATTGGCCTCCCGTGCGCTTCCCGCTCGCGGTTGGCCCAAATTCGAGTCCCCGGCAATGCTGGCCGCGACGATCGGTGGTGAAAGCTAA-----TCGAG---CTC--CCGTC-----GCGCGCCCGCGCAAGGGCTCCAGGACCCCC-GCGCC-CGCACAAGGCGCTCGCATTGC Thamnosma_rhodesica_104 GACTAAGGCGCGGTTTTGTAATCCATTAGGGCATCCCATCAGTAAGCCGGCCTGGGCCGATTTCTCAGATTCTCATCTTATCGACCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATCATAGCGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTGTTAAAAGTTTGGTTCGTAAACATAAAAGTACTGTACGCGCTTTTTTAAAAAGATGGGGTTCGGGATTTTTGGAAGAATTCCTTATGGAGGAAGAACACGTTCTTTCTTTCATTTTTCCAAGGGCTTCGTCTACTTCGCGTAGGTTCTATTTATATAGAGGACGAATTTGGTATTTGGATATTTTTTGTATCAACGATCTGGTTAATTATGACTGAGTGGGTACGAGACCACGGACCCGGAATTTAGAACTCAGTTCTAAATAATTAATCGCTAATTAAAAAAATTCCTTCATTTCTATTAAATGTTCATACAATAAGAATAATAAAAT-------------AAAGGGTTGATCGGCTGAGTATTCAACTTTTTTAATGCCTTCATTAGGGATTTGGTTTCAAAGGGAGTTTTCGGTGTTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCATGCACGGCTTGGGGAGGGATTTTTTTTTTTTTTTCGAACTTGATGGTATCAAAAAAAA----TCTTCAATAGCACGCGGATCGGTTAATTCAATAAGAAATGGGAGTTCGCGCTCGATTTCGTTGGGACCGTCCAATCGAATGCAATTCAATTGTTTCCTGATGCTTAGGCATTTCTGCAATTTCAATGAGGGAATTTTCAAGTTCAACCAACCGCCTTTCAATGGATGAATAAAAATCTTGAGAAAGCTGTTCCTTTATCTATCATTATAGACAATACCCGTCCTATTATCTATCGAGTTTGAACCTGAACTCTCTGTTTCGATTCATTATTTCGAGCTCATTGGACCTTATTTCTTATTTTAGTATATCGATTTAGGCCTAGTCTATTCTTTTTATATATATTGATCCTGCCTTTCTTTCCTCGACGAATTATGCCTATTTTCTTTGCACATCTAGGATTTACGTATACAACATATATTACTGTCAAGAGTCAATTTAGTAGTATTTAGATATTTCGATTGAAAACAAAAAAAAAAA-------------------------GTAAAGGATTAGAAACTTGAAAGGCGCTGATCGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGTAAATCAAATACCGTGGTCTAAAAAAACAAAAACAAGGAATCGTTCTGAGTAGTTGATAATATTAATTGAAAATCTTGTGAAAGATTCCTGTGAAGGGGTTTCATTAACTCCTGATTTATGTCGAGTAGACCTTGTTCTTGCGAGACTTCTTAATTCATGAGTTGTAGGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGTCGAAACCTGCCTAGCAGAATGACCCGCGAACGAGTGAAATCACCGTTGC--GGGGGGAGCCTCGTCTCCTCCCCGCCACCGTCGCATGGAG-TGCAGGACTCGTCCTGCATTCCCCGCGGCGCCCTAACGAACCCCCGGCGCGGAACGCGCCAAGGAAACTTAACGAGAGAGCGAGCCCCGCGGGTTCGCCCGTCGGTGGCGCCGCCTTCTTTCACATATCCAATCGTCGCCCCCACCCCC-TCCCCCTTCGCGGG-GCTGCGGGATGT-GGGGGCGGATATTGGCCTCCCGTGCGCTTCCCGCTCGCGGTTGGCTCAAATTCGAGTCCCCGGCAATGCTGGCCGCGACGATCGGTGGTGAAAGCTAT-----TCGAG---CTG--CCGTC-----GCGCGCCTGCAGAAGGGCTCAAGGACCCCC-GCGCC-AGAACAAGGCGCTCGCATTGC Thamnosma_socotrana_3176 GACTAAGGCGCGGTTTTGTAATCCATTAGGGCATCCCATCAGTAAGCCGGCCTGGGCCGATTTCTCAGATTCTCATCTTATCGACCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATCATAGCGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAACTATATACTTCGGCTTTCTTGTGTTAAAAGTTTGGTTCGTAAACATAAAAGTACTGTACGCGCTTTTTTAAAAAGATGGGGTTCGGGATTTTTGGAAGAATTCCTTATGGAGGAAGAACACGTTCTTTCTTTCATTTTTCCAAGGGCTTCGTCTACTTCGCGTAGGTTCTATTTATATAGAGGACGGATTTGGTATTTGGATATTTTTTGTATCAACGATCTGGTTAATTATGACTGAGTGGGTACGAGACCACGGACCCGGAATTTAGAACTCAGTTCTAAATAATTAATCCCTAATTAAAAAAATTCCTTCATTTCTATTAAATGTTCATACAATAAGAATAATAAAAT-------------AAAGGGTTGATCGACTGAGTATTCAACTTTTTTAATGCCTTCATTAGGGATTTGGTTTCAAAGGGAGTTTTCGGTGTTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCATGCACGGCTTGGGGAGGGATTTTTTTTTTTTTTTCGAACTTGATGGTATCAAAAAAAA----TCTTCAATAGCACGCGGATCGGTTAATTCAATAAGAAATGGGAGTTCGCGCTCGATTTCGTTGGGACCGTCCAACCGAATGCAATTCAATTGTTTCCTGATGCTTAGGCATTTCTGCAATTTCAATGAGGGAATTTTCAAGTTCAACCAACCGCCTTTCAATGGATGAATAAAAATCTTGAGAAAGCTGTTCCTTTATCTATCATTATAGACAATACCCGTCCTATTATCTATCGAGTTTGAACCTGAACTCTCTGTTTCGATTCATTATTTCGAGCTCATTGGACCTTATTTCTTATTTTAGTATATCGATTTAGGCCTAGTCTATTCTTTTTATATATATTGATCCTGCCTTTCTTTCCTCGACGAATTATGCCTATTTTCTTTGCACATCTAGGATTTACGTATACAACATATATTACTGTCAAGAGTCAATTTAGTAGTATTTAGATATTTCGATTGAAAAAAAAAAAAAAAAAA-----------------------GTAAAGGATTAGAAACTTGAAAGGCGCTGATCGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGTAAATCAAATACCGTGGTCTAAAAAAACAAAAACAAGGAATCGTTCTGAGTAGTTGATAATATTAATTGAAAATCTTGTGAAAGATTCCTGTGAAGGGGTTTCATTAACTCCTGATTTATGTCGAGTAGACCTTGTTCTTGCGAGACTTCTTAATTCATGAGTTGTAGGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGTCGAAACCTGCCTAGCAGAACGACCCGCGAACGAGTGAAATCACCGGCGC---GGGGGAGCCTCGTCTCCTCCCCGCCACCGCCGCAGGGAG-CGCGGGACTCGTCCCGCGTCCCCCGCGGCGTCCTAACGAACCCCCGGCGCGGAACTCGCCAAGGAAACTTAACGAGAGAGCGAGCCCCGCGGGTTCGCCCC-CGGCGGCGCCGTCTTCTTTCACATATCCAATCGTCGCCCCCACACCC-TCCCCC-TCGCGGG-GCTGGGGGACGT-GGGGGCGGATATTGGCCTCCCGTGCGCTTCCCCCTCGCGGTTGGCCCAAATTCGAGTCCCCGGCAATGCCGGCCGCGACGATCGGTGGTGAAAGCTAA-----TCGAG---CTC--CCGTC-----GCGCGCCTGCAGAAGGGCTCAAAGACCCCC-GCGCC-CGCACAAGGCGCTCGCATTGC Thamnosma_somalensis_9489 GACTAAGGCGCGGTTTTGTAATCCATTAGGGCATCCCATCAGTAAGCCGGCCTGGGCCGATTTCTCAGATTCTCATCTTATCGACCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATCATAGCGGATCCTCAAAAAAAAAA-GTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTGTTAAAAGTTTGGTTCGTAAACATAAAAGTACTGTACGCGCTTTTTTAAAAAGATGGGGTTCGGGATTTTTGGAAGAATTCCTTATGGAGGAAGAACACGTTCTTTCTTTCACTTTTCCAAGGGCTTCGTCTACTTCGCGTAGGTTCTATTTATATAGAGGACGGATTTGGTATTTGGATATTTTTTGTATCAACGATCTGGTTAATTATGACTGAGTGGGTACGAGACCACGGACCCGGAATTTAGAACTCAGTTCTAAATAATTAATCCCTAATTAAAAAAATTCCTTCATTTCTATTAAATGTTCATACAATAAGAATAATAAAAT---AAT--AAAATAAAGGGTTGATCGACTGAGTATTCAACTTTTTTAATGCCTTCATTAGGGATTTGGTTTCAAAGGGAGTTTTCGGTGTTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCATGCACGGCTTGGGGAGGAATTTTTTTTTTTTTTTCGAACTTGATGGTATCAAAAAAAA----TCTTCAATAGCACGCGGATCGGTTAATTCAATAAGAAATGGGAGTTCGCGCTCGATTTCGTTGGGACCGTCCAACCGAATGCAATTCAATTGTTTCCTGATGCTTAGGCATTTCTGCAATTTCAATGAGGGAATTTTCAAGTTCAACCAACCGCCTTTCAATGGATGAATAAAAATCTTGAGAAAGCTGTTCCTTTATCTATCATTATAGACAATACCCGTCCTATTATCTATCGAGTTTGAACCTGAACTCTCTGTTTCGATTCATTATTTCGAGCTCATTGGACCTTATTTCTTATTTTAGTATATCGATTTAGGCCTAGTCTATTCTTTTTATATATATTGATCCTGCCTTTCTTTCCTCGACGAATTATGCCTACTTTCTTTGCACATCTAGGATTTACGTATACAACATATATTACTGTCAAGAGTCAATTTAGTAGTATTTAGATATTTCGATTGAAAAAAAAAAAAAAAAAAAA---------------------GTAA{AG}GGATTAGAAACTTGAAAGGCGCTGATCGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGTAAATCAAATACCGTGGTCTAAAAAAACAAAAACAAGGAATCGTTCTGAGTAGTTGATAATATTAATTGAAAATCTTGTGAAAGATTCCTGTGAAGGGGTTTCATTAACTCCTGATTTATGTCGAGTAGACCTTGTTCTTGCGAGACTTCTTAATTCATGAGTTGTAGGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGTCGAAACCTGCCTAGCAGAACGACCCGCGAACGAGTGAAATCACCGGCGC--GGGGGGAGCCTCGTCTCCTTCCCGCCACCGTCGCAGGGAG-CGCGGGACTCTTCCTGCGACCCCCGCGGCGCCCTAACGAACCCCCGGCGCGGAACGCGCCAAGGAAACTTAACGAGGGAGCGAGCCCCGCGGGTTCGCCCG-CGGCGGCGCCGCCTTCTTTCACATATCCAATCGTCGCCCCCACCCCC-TCCCCCCTCG{AT}GGG-GCTGCG{GT}GACGT-GGGGGCGGATATTGGCCTCCCGTGCGCTTCCGGCTCGCGGTTGGCCC{AG}AATTCGAGTCCCCGGCAATGCTGGCCGCGACGATCGGTGGTGAAAGCTAA-----TCGAG---CTC--CCGTC-----GCGCGCCTGCAGAAGGGCTCAAGGACCCCC-GCGCC-GGCACAAGGCGCTCGCATTGC Thamnosma_stanfordii_9545 GACTAAGGCGCGGTTTTGTAATCCATTAGGGCATCCCATCAGTAAGCCGGCCTGGGCCGATTTCTCTGATTCTCATCTTATCGACCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATCATAGCGGATCCTCAAAAAAAAAA-GTTTGTATCGAATAAAATATATACTTCGTCTTTCTTGTGTTAAAAGTTTGGTTCGTAAACATAAAAGTACTGTACGCGCTTTTTTAAAAAGATGGGGTTCGGGATTTTTGGAAGAATTCCTTATGGAGGAAGAACACGTTCTTTCTTTAATTTTTCCAAGGGCTTCGTCTACTTCGCGTAGGTTCTATTTATATAGAGGACGGATTTGGTATTTGGATATTTTTTGTATCAACGATCTGGTTAATTATGACTGAGTGGGTACGAGACCACGGACCCGGAATTTAGAACTGAGTTCTAAATAATTAATCGCTAATTAAAAAAATTCCTTCATTTCTATTAAATGTTCATACAATAAGAATAATAAAAT--------AAAATAAAGGGTTGATCGACTGAGTATTCAACTTTTTTAATGCCTTCATTAGGGATTTGGTTTCAAAGGGAGTTTTCGGTGTTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCATGCACGGCTTGGGGAGGGATTTTTTTTTTTTTTTCGAACTTGATGGTATCAAAAAAAA----TCTTCAATAGCACGCGGATCGGTTAATTCAATAAGAAATGGGAGTTCGCGCTCGATTTCGTTGGGACCGTCCAACCGAATGCAATTCAATTGTTTCCTGATGCTTAGGCATTTCTGCAATTTCAATGAGGGAATTTTCAAGTTCAACCAACCGCCTTTCAATGGATGAATAAAAATCTTGAGAAAGCTGTTCCTTTATCTATCATTATAGA{CT}AATACCCGTCCTATTATCTATCGAGTTTGAACCTGAACTCTCTGTTTCGATTCATTATTTCGAGCTCATTGGACCTTATTTCTTATTTTAGCATATCGATTTAGGCCTAGTCTATTCTTTTTATATATATTGATCCTGCCTTTCTTTCCTCGACGAATTATGCCTATTTTCTTTGCACATCTAGGATTTACGTATACAACATATATTACTGTCAAGAGTCGATTTAGTAGTATTTAGCTATTTCGATTGAAAAAAAAAAAAAAAAAAAAA--------------------GTAAAGGATTAGAAACTTGAAAGGCGCTGATCGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGTAAATCAAATACCGTGGTCTAAAAAAACAAAAACAAGGAATCGTTCTGAGTAGTTGATAATATTAATTGAAAATCTTGTGAAAGATTCCTGTGAAGGGGTTTCATTAACTCCTGATTTATGTCGAGTAGACCTTGTTCTTGCGAGACTTCTTAATTCATGAGTTGTAGGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGTCGAAACCTGCCTAGCAGAACGACCCGCGAACGAGTGAAATCACCGGCGC---GGGGGGGCCTCGCGTCCTCCCCGCCACCGTCGCAGGGAG-CGCGGGACTCGTCCCGCCTTCCCCGCGGCGCCCTAACGAACCCCCGGCGCGGAACGCGCCAAGGAAACTTAACGAGAGAGCGAGCCCCGCGGGTTCGCCCGCCGGCGGCGCCGCCTTCTTTCACATATCCAATCGTCGCCCCCACCCCC-TCCCCCCTCGCGGG-GCTGCGGGACGT-GGGGGCGGACATTGGCCTCCCGTGCGCTTCCCGCTCGCGGTTGGCCCAAATTCGAGTCCCCGGCAATCCTGGCCGCGACGATCGGTGGTGAAAGCTAA-----TCGAG---CTC--CCGTC-----GCGCGCCTGCGTAAGGGCTCAAGGACCCCC-GCGCC-CGCACAGGGCGCTCGCATTGC Thamnosma_texana_Sn GACTAAGGCGCGGTTTTGTAATCCATTAGGGCATCCCATCAGTAAGCCGGCCTGGGCCGATTTCTCTGATTCTCATCTTATCGACCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATCATAGCGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGTCTTTCTTGTGTTAAAAGTTTGGTTCGTAAACATAAAAGTACTGTACGCGCTTTTTTAAAAAGATGGGGTTCGGGATTTTTGGAAGAATTCCTTATGGAGGAAGAACACGTTCTTTCTTTAATTTTTCCAAGGGCTTCGTCTACTTCGCGTAGGTTCTATTTATATAGAGGACGGATTTGGTATTTGGATATTTTTTGTATCAACGATCTGGTTAATTATGACTGAGTGGGTACGAGACCACGGACCCGGAATTTAGAACTGAGTTCTAAATAATTAATCGCTAATTAAAAAAATTCCTTCATTTCTATTAAATGTTCAT{AC}CAATAATAA-AATAAAATTAAAATTTAAAATAAAGGGTTGATCGACTGAGTATTCAACTTTTTTAATGCCTTCATTAGGGATTTGGTTTCAAAGGGAGTTTTCGGTGTTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCATGCCCGGCTTGGGGAGGGATTTTTTTTTTTTTTTCGAACTTGATGGTATCAAAAAAAA----TCTTCAATAGCACGCGGATCGGTTAATTCAATAAGAAATGCAAGTTCGCGCTCGATTTCGTTGGGACCGTCCAACCGAATGCAATTCAATTGTTTCCTGATGCTTAGGCATTTCTGCAATTTCAATGCGGGAATTTTCAAGTTCAACCAACCGCCTTTCAATGGATGAATAAAAATCTTGAGAAAGCTGTTCCTTTATCTATCATTATAGACAATACCCGTCCTATTATCTATCGAGTTTGAACCTGAACTCTCTGTTTCGATTCATTATTTCGAGCTCATTGGACCTTATTTCTTATTTTAGCATATCGATTTAGGCCTAGTCTATTCTTTTTATATATATTGATCCTGCCTTTCTTTCCTCGACAAATTATGCCTATTTTCTTTGCACATCTAGGATTTACGTATACAACATATATTACTGTCAAGAGTCAATTTAGTAGTATTTAGCTATTTCGATTGAAAAAAAAAAAAAAAAAAAAA--------------------GTAAAGGATTAGAAACTTGAAAGGCGCTGATCGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGTAAATCAAATACCGTGGTCTAAAAAAACAAAAACAAGGAATCGTTCTGAGTAGTTGATAATATTAATTGAAAATCTTGTGAAAGATTCCTGTGAAGGGGTTTCATTAACTCCTGATTTATGTCGAGTAGACCTTGTTCTTGCGAGACTTCTTAATTCATGAGTTGTAGGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGTCGAAACCTGCCTAGCAGAACGACCCGCGAACGAGTGAAATCACCGGCGCTGGGGGGGGGCCTCGTCTCCTCCCCGCCACCGTCGCAGGGAG-CGCGGGACTCGTCCCGCATTCCCCGCGGCGCCCTAACGAACCCCCGGCGCGGAATGCGCCAAGGAAACTCAACGAGAGAGCGAGCCCCGCGGGTTCGCCCGACGGCGGCGCCGCCTTCTTTCACATATCCAATCGTCGCCCCCACCCCC-TCCCCCCTCGCGGG-GCTGCGGGACGT-GGGGGCGGATATTGGCCTCCCGTGCGCTTCCCGCTCGCGGTTGGCCCAAATTCGAGTCCCCGGCAATGCTGGCCGCGACGATCGGTGGTGAAAGCTAA-----TCGAG---CTC--CCGTC-----GCGTGCCTGCGGAAGGGCTCAAGGACCCCC-GCGCC-CGCACAGGGCGCTCGCACTGC Thamnosma_trifoliata_7577 ???????GCGCGGTTTTGTAATCCATTAGGGCATCCCATCAGTAAGCCGGCCTGGGCCGATTTCTCTGATTCTCATCTTATCGACCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATCATAGCGGATCCTCAAAAAAAAAA-GTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTGTTAAAAGTTTGGTTCGTAAACATAAAAGTACTGTACGCGCTTTTTTAAAAAGAAGGGGTTCGGGATTTTTGGAAGAATTCCTTATGGAGGAAGAACACGTTCTTTCTTTAATTTTTCCAAGGGCTTCGTCTACTTCGCGTAGGTTCTATTTATATAGAGGACGGATTTGGTATTTGGATATTTTTTGTATCAACGATCTGGTTAATTATGACTGAGTGGGTACGAGACCACGGACCCGGCATTTAGAACTCAGTTCTAAATAATTAATCGCTAATTAAAAAAATTCCTTCATTTCTATTAAATGTTCATACAATAAGAATAATAAAAT-------------AAAGGGTTGATCGAATGAGTATTCAACTTTTTTAATGCCTTCATTAGGGATTTGGTTTCAAAGGGAGTTTTCGGTGTTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCATGCACGGCTTGGGGAGGGATTTTTTTTTTTTTTTCGAACTTGATGGTATCAAAAAAAA----TCTTCAATAGCACGCGGATCGGTTAATTCAATAAGAAATGGGAGTTCGCGCTCGATTTCGTTGGGACCGTCCAACCGAATGCAATTCAATTGTTTCCTGATGCTTAGGCATTTCTGCAATTTCAATGAGGGAATTTTCAAGTTCAACCAACCGCCTTTCAATGGATGAATAAAAATCTCGAGAAAGCTGTTCCTTTATCTATCATTATAGACAATACCCGTCCTATTATCTATCGAGTTTGAACCTGAACTCTCTGTTTCGATTCATTATTTCGAGCTCATTGGACCTTATTTCTTATTTTAGCATATCGATTTAGGCCTAGTCTATTCTTTTTATATATATTGATCCTGCCTTTCTTTCCTCGACGAATT-TGCCTATTTTCTTTGCACATCTAGGATTTACGTATACAACATATATTACTGTCAAGAGTCAATTTAGTAGTATTTAGATATTTCGATTGAAAAAAAAAAAAAAA--------------------------GTAAAGGATTAGAAACTTGAAAGGCGCTGATCGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGTAAATCAAATACCGTGGTCTAAAAAAACAAAAACAAGGAATCGTTCTGAGTAGTTGATAATATTAATTGAAA-TCTTGTGAAAGATTCCTGTGAAGGGGTTTCAGTAACTCCTGATTTATGTCGAGTAGACCTTGTTCTTGCGAGACTTCTTAATTCATGAGTTGTAGGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGTCGAAACCTGCCTAGCAGAACGACCCGCGAACGAGTCAAATCACCGGCGA--GGGGGGGGCCTCGTCTCCTCCCCGCCACCGTCGCAGGGAG-CGCGGGACTCGTCCCGCATTCCCCGCTGCGCCCTAACGAACCCCCGGCGCGGAACGCGCCAAGGAAACTTAACGAGAGAGCGAGCCCCGCGGGTTCGCCCGCCGGCGGCGCCGCCTTCTTTCACATATCCAATCGTCGCCCCCATCCCC-TCCCCC-TCGCGGG-GCTGCGGTAGGT-GGGGGCGGATATTGGCCTCCCGTGAGCTTCCCGCTCGCGGTTGGCCCAAATTCGAGTCCCCGGCAATGCTAGCCGCGACGATCGGTGGTGAAAGCTAA-----TCGAG---ATC--CCGTC-----GCGTGCCTGCGGAAGGGCTCAAGGACCCC--GCGCC-CGCACAAGGCGCTCGCATTGC ; END; BEGIN SETS; CHARSET pl (CHARACTERS = 'Thamnosma ITS, matK, rbcL-atpB sp.') = 1-1658; CHARSET ITS (CHARACTERS = 'Thamnosma ITS, matK, rbcL-atpB sp.') = 1659-2113; END; BEGIN TREES; TITLE rbcL_2BL_ML; LINK TAXA = Taxa2; TRANSLATE 1 Schinus_molle_U39270, 2 Acronychia_acidula_U38862, 3 Adenandra_uniflora_AF066803, 4 Chorilaena_quercifolia_AF066810, 5 Citrus_x_paradisi_AJ238407, 6 Neochamaelea_pulverulenta_AF206752, 7 Cneoridium_dumosum, 8 Coleonema_pulchellum_L12567, 9 Correa_pulchella_AF066816, 10 'Dictamnus sp. M.W.Chase-1820K AF066801', 11 Dictyoloma_vandellianum_AF066823, 12 Diplolaena_dampieri_AF066807, 13 Eremocitrus_glauca_AF066819, 14 Eriostemon_brevifolius_AF156883, 15 Euodia_hupehensis, 16 Flindersia_australis_U38861, 17 Citrus_japonica_AF066799, 18 Glycosmis_pentaphylla_AF066820, 19 Harrisonia_perforata_U38863, 20 Lunasia_amara_AF066814, 21 Melicope_ternata_AF116271, 22 Phellodendron_amurense_AF066804, 23 Citrus_trifoliata_AJ235806, 24 Ruta_graveolens_U39281, 25 Sarcomelicope_simplicifolia_AF066817, 26 Severinia_buxifolia_AF066806, 27 Simarouba_glauca_U38927, 28 Spathelia_excelsa_AF066798, 29 Swietenia_macrophylla_U39080, 30 Thamnosma_hirschii_3187b, 31 Thamnosma_montana_4351, 32 Thamnosma_montana_9022b, 33 Thamnosma_pailensis_369b, 34 Thamnosma_socotrana_2495, 35 Thamnosma_texana_S.N., 36 Thamnosma_trifoliata_7577b, 37 Zanthoxylum_sp._Chase_1348, 38 Zanthoxylum_monophyllum_U39282; TREE PAUP_1 = [&R] (1:0.0,(((((((((2:0.005946,25:0.001967):0.002669,21:0.005573):0.009693,(((4:0.007454,12:0.012837):0.002698,9:0.008294):0.001464,14:0.008529):0.002849):0.001377,(16:0.009123,20:0.007091):0.001295):0.001399,((3:0.00277,8:0.005703):0.002794,(10:0.0101,22:0.005649):0.002812,15:0.004292):0.001385,(37:0.001352,38:0.009994):0.001405):0.002662,((((((5:0.0,23:0.0):0.006382,17:0.004875):0.001737,13:0.004529):0.003569,26:0.007424):0.007874,18:0.012199):0.002777,(7:0.006186,(24:0.005428,(((30:0.002825,34:0.0):0.00141,(33:0.0,35:0.0):0.002786):0.002109,(31:0.0,32:0.0,36:0.0):7.51E-4):0.014901):0.008926):0.004512):0.00183):0.010018,((6:0.026811,19:0.015491):0.001488,(11:0.022149,28:0.00623):0.010098):0.00348):0.005848,27:0.04161):0.002829,29:0.013364):0.040173); END; BEGIN TREES; TITLE Combined_Thamn_5c2_consensus; LINK TAXA = Taxa1; TRANSLATE 1 Ruta_macrophylla_Sn, 2 Thamnosma_africana_21900, 3 Thamnosma_africana_8927, 4 Thamnosma_crenata_224, 5 Thamnosma_hirschii_10000, 6 Thamnosma_hirschii_3187, 7 Thamnosma_hirschii_6164, 8 Thamnosma_montana_9022, 9 Thamnosma_pailensis_369, 10 Thamnosma_rhodesica_104, 11 Thamnosma_socotrana_3176, 12 Thamnosma_somalensis_9489, 13 Thamnosma_stanfordii_9545, 14 Thamnosma_texana_Sn, 15 Thamnosma_trifoliata_7577, 16 Thamnosma_montana_4252; TREE TREE1 = [&R] (1:30.956252508750325,(((((2:5.067246591203899,(3:1.7899774342719672,((4:0.014833417819104798,5:0.014833417819104798):0.2225865408512795,6:0.2374199586703843):1.552557475601583):3.277269156931932):1.9926321937711338,((7:2.3931901482908335,8:2.3931901482908335):4.214894714108379,(9:2.866992497535347,10:2.866992497535347):3.7410923648638654):0.4517939225758205):5.225162283393497,(11:2.378676884620133,12:2.378676884620133):9.906364183748398):0.9025578853303102,((13:5.388851042103025,14:5.388851042103025):4.239726301458842,15:9.628577343561867):3.5590216101369734):1.2312422658819262,16:14.418841219580766):16.537411289169558); END;