#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 8:10 GMT TreeBASE (cc) 1994-2008 Study reference: Burlakoti R.R., Neate S.M., Adhikari T., Gyawali S., Salas B., Steffenson B.J., & Schwarz P.B. 2011. Trichothecene Profiling and Population Genetic Analysis of Gibberella zeae from Barley in North Dakota and Minnesota. Phytopathology, 101(6): 687-695. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10830] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=62; TAXLABELS 'Fusarium acaciae-mearnsii NRRL26752' 'Fusarium acaciae-mearnsii NRRL26754' Fusarium_asiaticum_NRRL13818 Fusarium_asiaticum_NRRL26156 Fusarium_asiaticum_NRRL6101 Fusarium_austroamericanum_NRRL28718 Fusarium_austroamericanum_NRRL2903 Fusarium_boothii_NRRL26916 Fusarium_boothii_NRRL29011 Fusarium_boothii_NRRL29105 Fusarium_brasilicum_NRRL31238 Fusarium_brasilicum_NRRL31281 Fusarium_cerealis_NRRL13721 Fusarium_cerealis_NRRL25491 Fusarium_cortaderiae_NRRL31185 Fusarium_cortaderiae_NRRL31205 Fusarium_culmorum_NRRL25475 Fusarium_culmorum_NRRL3288 Fusarium_graminearum_08Gz134 Fusarium_graminearum_08Gz145 Fusarium_graminearum_08Gz167 Fusarium_graminearum_08Gz178 Fusarium_graminearum_08Gz190 Fusarium_graminearum_08Gz195 Fusarium_graminearum_08Gz227 Fusarium_graminearum_08Gz231 Fusarium_graminearum_08Gz235 Fusarium_graminearum_08Gz252 Fusarium_graminearum_08Gz266 Fusarium_graminearum_08Gz29 Fusarium_graminearum_08Gz50 Fusarium_graminearum_08Gz6 Fusarium_graminearum_08Gz64 Fusarium_graminearum_08Gz70 Fusarium_graminearum_08Gz71 Fusarium_graminearum_08Gz76 Fusarium_graminearum_08Gz84 Fusarium_graminearum_KB1018 Fusarium_graminearum_KB1110 Fusarium_graminearum_KB1120 Fusarium_graminearum_KB1129 Fusarium_graminearum_KB1141 Fusarium_graminearum_KB1164 Fusarium_graminearum_KB1171 Fusarium_graminearum_KB1228 Fusarium_graminearum_KB1320 Fusarium_graminearum_KB809 Fusarium_graminearum_KB902 Fusarium_graminearum_KB906 Fusarium_graminearum_KB917 Fusarium_graminearum_NRRL13383 Fusarium_graminearum_NRRL28063 Fusarium_graminearum_NRRL28336 Fusarium_graminearum_NRRL31084 Fusarium_graminearum_NRRL5883 Fusarium_graminearum_NRRL6394 Fusarium_meridionale_NRRL28436 Fusarium_meridionale_NRRL29010 Fusarium_mesoamericanum_NRRL25797 Fusarium_mesoamericanum_NRRL29148 Fusarium_pseudograminearum_NRRL28334 Fusarium_pseudograminearum_NRRL28338 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=62; TAXLABELS 'Fusarium acaciae-mearnsii NRRL26752' 'Fusarium acaciae-mearnsii NRRL26754' Fusarium_asiaticum_NRRL13818 Fusarium_asiaticum_NRRL26156 Fusarium_asiaticum_NRRL6101 Fusarium_austroamericanum_NRRL28718 Fusarium_austroamericanum_NRRL2903 Fusarium_boothii_NRRL26916 Fusarium_boothii_NRRL29011 Fusarium_boothii_NRRL29105 Fusarium_brasilicum_NRRL31238b Fusarium_brasilicum_NRRL31281b Fusarium_cerealis_NRRL13721 Fusarium_cerealis_NRRL25491 Fusarium_cortaderiae_NRRL31185 Fusarium_cortaderiae_NRRL31205 Fusarium_culmorum_NRRL25475 Fusarium_culmorum_NRRL3288 Fusarium_graminearum_08Gz134 Fusarium_graminearum_08Gz145 Fusarium_graminearum_08Gz167 Fusarium_graminearum_08Gz178 Fusarium_graminearum_08Gz190 Fusarium_graminearum_08Gz195 Fusarium_graminearum_08Gz227 Fusarium_graminearum_08Gz231 Fusarium_graminearum_08Gz235 Fusarium_graminearum_08Gz252 Fusarium_graminearum_08Gz266 Fusarium_graminearum_08Gz29 Fusarium_graminearum_08Gz50 Fusarium_graminearum_08Gz6 Fusarium_graminearum_08Gz64 Fusarium_graminearum_08Gz70 Fusarium_graminearum_08Gz71 Fusarium_graminearum_08Gz76 Fusarium_graminearum_08Gz84 Fusarium_graminearum_KB1018 Fusarium_graminearum_KB1110 Fusarium_graminearum_KB1120 Fusarium_graminearum_KB1129 Fusarium_graminearum_KB1141 Fusarium_graminearum_KB1164 Fusarium_graminearum_KB1171 Fusarium_graminearum_KB1228 Fusarium_graminearum_KB1320 Fusarium_graminearum_KB809 Fusarium_graminearum_KB902 Fusarium_graminearum_KB906 Fusarium_graminearum_KB917 Fusarium_graminearum_NRRL13383 Fusarium_graminearum_NRRL28063 Fusarium_graminearum_NRRL28336 Fusarium_graminearum_NRRL31084 Fusarium_graminearum_NRRL5883 Fusarium_graminearum_NRRL6394 Fusarium_meridionale_NRRL28436 Fusarium_meridionale_NRRL29010 Fusarium_mesoamericanum_NRRL25797 Fusarium_mesoamericanum_NRRL29148 Fusarium_pseudograminearum_NRRL28334 Fusarium_pseudograminearum_NRRL28338 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7088] TITLE Gibberella_zeae_for_Fig_1a; LINK TAXA = Taxa1; DIMENSIONS NCHAR=849; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Fusarium acaciae-mearnsii NRRL26752' GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCACAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTACGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACAGTTTCAGGTCATGGG 'Fusarium acaciae-mearnsii NRRL26754' GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCACAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTATACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTACGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGAGATAAACTCAAGCTAACAGTTTCAGGTCATGGG Fusarium_asiaticum_NRRL13818 GTGGGTATCGGTGGCGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCTAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_asiaticum_NRRL26156 GTGGGTATCGGTGGCGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCTAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_asiaticum_NRRL6101 GTGGGTATCGGTGGCGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTGACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCTAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_austroamericanum_NRRL28718 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATTTCACGCTTCTATTTCAAGTCGGTCGCTCATCTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_austroamericanum_NRRL2903 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATTTCACGCTTCTATTTCAAGTCGGTCGCTCATCTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_boothii_NRRL26916 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACACTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_boothii_NRRL29011 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACACTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGCCATGGG Fusarium_boothii_NRRL29105 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACACTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_brasilicum_NRRL31238 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATTTTACGCTTCTATTTCAAGTCGGTCGCTCATCTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCA---GGACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACCATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGGGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_brasilicum_NRRL31281 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATTTTACGCTTCTATTTCAAGTCGGTCGCTCATCTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAGCACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGGACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACCATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGGGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_cerealis_NRRL13721 GTGGGCATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATTACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGTTTCGGAGCTGTCCCCGCTTGCATTGCACTCTACTGTAAGTCATCATATTCTTGGCATGTGAATCTATCTAACTAACTTTACTAGACCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGATGTCGCCCGTGACGTCGAGCAGGCTGATGAGGATGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCTCCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTTGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACTATCCAGCTTGGTGGTTTTATCATCCTGACTATTCTTTTCATTGTAAGTTGGATGCGTTGGATAAATGAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_cerealis_NRRL25491 GTGGGCATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTCGGCTTCAAGCCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGTTTCGGAGCTGTCCCCGCTTGCATTGCACTCTACTGTAAGTCATCATATTCTTGGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGATGTCGCCCGTGACGTCGAGCAGGCTGATGAGGATGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCTCCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTTGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACTATCCAGCTTGGTGGTTTTATCATCCTGACTATTCTTTTCATTGTAAGTTGGATGCGTTGGATAGATGAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_cortaderiae_NRRL31185 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATTTCACGCTTCTATTTCAAGTCGGTCGCTCATCTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGGACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_cortaderiae_NRRL31205 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATTTCACGCTTCTATTTCAAGTCGGTCGCTCATCTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGGACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_culmorum_NRRL25475 GTGGGAATCGGTGGTGACTACCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATTGAGCTCTTATTCCAATTCAGTCGCTTATTCTTCATCAGATTCGCTACTACTAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGCATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGATTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGCATCCATCTAACTCACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGATGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCTCCCGTGCCCAAAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTTGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACTATCCAGCTTGGTGGTTTTATCATCCTGACTATTCTTTTCATTGTAAGTTGGATGCGTTGGATAGATGAACTCAAGCTAACATTTGCAGGTCATGGG Fusarium_culmorum_NRRL3288 GTGGGAATCGGTGGTGACTACCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATTGAGCTCTTATTCCAATTCAGTCGCTTATTCTTCATCAGATTCGCTACTACTAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGCATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGATTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGCATCCATCTAACTCACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGATGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCTCCCGTGCCCAAAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTTGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACTATCCAGCTTGGTGGTTTTATCATCCTGACTATTCTTTTCATTGTAAGTTGGATGCGTTGGATAAATGAACTCAAGCTAACATTTGCAGGTCATGGG Fusarium_graminearum_08Gz134 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz145 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz167 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz178 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz190 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz195 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz227 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz231 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz235 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTA----TATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz252 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz266 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz29 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz50 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz6 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz64 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz70 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTTGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz71 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz76 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_08Gz84 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_KB1018 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_KB1110 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_KB1120 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_KB1129 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_KB1141 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_KB1164 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_KB1171 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_KB1228 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_KB1320 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_KB809 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_KB902 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_KB906 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_KB917 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_NRRL13383 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_NRRL28063 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_NRRL28336 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_NRRL31084 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_NRRL5883 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_graminearum_NRRL6394 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_meridionale_NRRL28436 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATTTCACGCTTCTATTTCAAGTCGGTCGCTCATCTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATTTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACCATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGGGTTGGAGATATAAATTCAAGCTAACATTTTCAGGTCATGGG Fusarium_meridionale_NRRL29010 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATTTCACGCTTCTATTTCAAGTCGGTCGCTCATCTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATTTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACCATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGGGTTGGAGATATAAATTCAAGCTAACATTTTCAGGTCATGGG Fusarium_mesoamericanum_NRRL25797 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTAACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCATTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_mesoamericanum_NRRL29148 GTGGGTATCGGTGGTGACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTAACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCATTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGAGATATAAACTCAAGCTAACATTTTCAGGTCATGGG Fusarium_pseudograminearum_NRRL28334 GTAGGCATCGGTGGTGATTATCCATTGTCTTCCATCATCACTTCAGAGTAAGTACGTCAAGCTCCTATTTCAAGTCAGTCGCTGATCTTTCATCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTTGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCCGTTGACAAGATGTGGCGAACACTCGTCGGCTTTGGAGCTGTCCCTGCTTGCATTGCCCTCTACTGTAAGTCATCATATTCTTGGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGTAAAAGCGAAGGCAACACCGACGAAGTCTCCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTGGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCAACCAAGGATGCCACCAATGTCTACGAGTTCCTCCACAACACAGCTGTTGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACTATCCAGCTTGGTGGTTTTATCATACTGACTATTCTTTTCATTGTAAGTTATATGTGTTGATGATATAAACCCAAGCTAACATTCTCAGGTCATGGG Fusarium_pseudograminearum_NRRL28338 GTAGGCATCGGTGGTGATTATCCATTGTCTTCCATCATCACTTCAGAGTAAGTACGTCAAGCTCCTATTTCAAGTCAGTCGCTGATCTTTCATCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTTGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCCGTTGACAAGATGTGGCGAACACTCGTCGGCTTTGGAGCTGTCCCTGCTTGCATTGCCCTCTACTGTAAGTCATCATATTCTTGGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGTAAAAGCGAAGGCAACACCGACGAAGTCTCCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTGGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCAACCAAGGATGCCACCAATGTCTACGAGTTCCTCCACAACACAGCTGTTGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACTATCCAGCTTGGTGGTTTTATCATACTGACTATTCTTTTCATTGTAAGTTATATGTGTTGATGATATAAACCCAAGCTAACATTCTCAGGTCATGGG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7089] TITLE Gibberella_zeae_for_Fig._1b; LINK TAXA = Taxa2; DIMENSIONS NCHAR=625; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Fusarium acaciae-mearnsii NRRL26752' TCTGGCAAGTCGACCACTGTGAGTACCACCGTATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-TCCTTTCGAAATATCATTCGAATCGCACTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG 'Fusarium acaciae-mearnsii NRRL26754' TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-TCCTTTCGAAATATCATTCGAATCGCACTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_asiaticum_NRRL13818 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCATGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_asiaticum_NRRL26156 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-TCCTTTCGAAATATCATTCGAATCGCACTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_asiaticum_NRRL6101 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCATGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACCCATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGTCTATCAGACGCTCCCGGTCACCGTG Fusarium_austroamericanum_NRRL28718 TCTGGCAAGTCGACCACTGTGAGTACCACCACATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATTGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAAATTTTTTT--CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACTACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGACTATCAGACGCTCCCGGTCACCGTG Fusarium_austroamericanum_NRRL2903 TCTGGCAAGTCGACCACTGTGAGTACCACCACATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATTGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAAATTTTTTT--CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACCCATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACTACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGACTATCAGACGCTCCCGGTCACCGTG Fusarium_boothii_NRRL26916 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGGGTAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA---TTTTTTTCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTCTCAGACGCTCCCGGTCACCGTG Fusarium_boothii_NRRL29011 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA---TTTTTTTCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTCTCAGACGCTCCCGGTCACCGTG Fusarium_boothii_NRRL29105 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGGGTAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA---TTTTTTTCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTCTCAGACGCTCCCGGTCACCGTG Fusarium_brasilicum_NRRL31238b TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAAATTTTTTT--CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGTTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATGCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_brasilicum_NRRL31281b TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAAATTTTTTT--CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGTTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATGCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_cerealis_NRRL13721 TCTGGCAAGTCGACCACTGTGAGTACCACTGCATCCCAACCCCGCCGATATTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTT-GATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAACATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-----TTTTTCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGCTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCGCACCATCACGTGTCAATCAGTTACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACTACTGCTGTCATGACCTTCTCATACTAACACGACTATCAGACGCTCCCGGTCACCGTG Fusarium_cerealis_NRRL25491 TCTGGCAAGTCGACCACTGTGAGTACCACTGCATCCCAACCCCGCCGATATTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTT-GATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAACATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-----TTTTTCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGCTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCGCACCATCACGTGTCAATCAGTTACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACTACTGCTGTCATGACCTTCTCATACTAACACGACTATCAGACGCTCCCGGTCACCGTG Fusarium_cortaderiae_NRRL31185 TCTGGCAAGTCGACCACTGTGAGTACCACCACATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTTAAATATCCAATGTGCTGACATACTTTAATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCA--CGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAAATTTTTTTTTCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGTTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_cortaderiae_NRRL31205 TCTGGCAAGTCGACCACTGTGAGTACCACCACATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTTAAATATCCAATGTGCTGACATACTTTAATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCA--CGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAAATTTTTTTTTCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGTTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_culmorum_NRRL25475 TCTGGCAAGTCGACCACTGTGAGTACCACTGCATCCCAACCCCGCCGATACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAACATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-----TTTTTCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGCTTGCCCTCTTCCCACAAACC-ATTCCCTAGGCGCGCACCATCACGTGTCAATCAGTTACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACTACTGCTGTCATCACATTCTCATACTAACACGACTATCAGACGCTCCCGGTCACCGTG Fusarium_culmorum_NRRL3288 TCTGGCAAGTCGACCACTGTGAGTACCACTGCATCCCAACCCCGCCGATACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAACATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-----TTTTTCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGCTTGCCCTCTTCCCACAAACC-ATTCCCTAGGCGCGCACCATCACGTGTCAATCAGTTACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACTACTGCTGTCATCACATTCTCATACTAACACGACTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz134 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz145 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTCCCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz167 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAATTTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz178 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTCCCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz190 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGCCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCACTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz195 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz227 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz231 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA--TTTTTTTCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz235 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTCCCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz252 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz266 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTCCCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz29 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz50 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz6 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz64 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAATTTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz70 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz71 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz76 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAATTTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_08Gz84 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTTGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_KB1018 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_KB1110 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA--TTTTTTTCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_KB1120 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTCCCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_KB1129 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_KB1141 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTCCCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_KB1164 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTCCCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_KB1171 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTTCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_KB1228 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAATTTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_KB1320 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_KB809 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_KB902 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_KB906 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTCCCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_KB917 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTTCCC-GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_NRRL13383 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA--TTTTTTTCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_NRRL28063 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA--TTTTTTTCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_NRRL28336 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA--TTTTTTTCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_NRRL31084 TCTGGCAAGTCGACCACTGTGAGTACCACTGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATCCTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCCCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCACTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA---TTTTTTTCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACTAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_NRRL5883 TCTGGCAAGTCGACCACTGTGAGTACCACTGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATCCTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCCCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCACTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA---TTTTTTTCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACTAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_NRRL6394 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA--TTTTTTTCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_meridionale_NRRL28436 TCTGGCAAGTCGACCACTGTGAGTACCACCACATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAACGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCTTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAAATTTTTTT--CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_meridionale_NRRL29010 TCTGGCAAGTCGACCACTGTGAGTACCACCACATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAACGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCTTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAAATTTTTTT--CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_mesoamericanum_NRRL25797 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTTCCCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_mesoamericanum_NRRL29148 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAA-TTTTTT-CCCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_pseudograminearum_NRRL28334 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCTACACTTGGCGGGG-TAGTTTCACATTTCCGATGTGCTGACATGCTTTAATAGACCGGTCACTTGATCTACCAGTGCGGTGGCATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCCCATTTTCCTCGATCGCGCGCCCTTATCCCCTTCGAAACATCATTCGAATCGCTC------GACGACTCGACACGCGCCTGTTACCCCGCTCGAGGACAAAATTTTTACGGCTTTGTCGTAA--TTTTTTTTCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGCTTGCCCTCCTCCCACAAATC-ATTCCCTGGGCG--CATCATCACGTGTCAATCAGTCACTAACAACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACTATTGTCCTCATCACATTCTCATACTAACATGTCTACCAGACGCTCCCGGTCACCGTG Fusarium_pseudograminearum_NRRL28338 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCTACACTTGGCGGGG-TAGTTTCACATTTCCGATGTGCTGACATGCTTTAATAGACCGGTCACTTGATCTACCAGTGCGGTGGCATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCCCATTTTCCTCGATCGCGCGCCCTTATCCCCTTCGAAACATCATTCGAATCGCTC------GACGACTCGACACGCGCCTGTTACCCCGCTCGAGGACAAAATTTTTACGGCTTTGTCGTAA--TTTTTTTTCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGCTTGCCCTCCTCCCACAAATC-ATTCCCTGGGCG--CATCAT---GTGTCAATCAGTCACTAACAACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACTATTGTCCTCATCACATTCTCATACTAACATGTCTACCAGACGCTCCCGGTCACCGTG ; END; BEGIN TREES; TITLE Fig._1a_TB; LINK TAXA = Taxa1; TRANSLATE 1 Fusarium_meridionale_NRRL28436, 2 Fusarium_meridionale_NRRL29010, 3 Fusarium_brasilicum_NRRL31281, 4 Fusarium_brasilicum_NRRL31238, 5 Fusarium_cortaderiae_NRRL31205, 6 Fusarium_cortaderiae_NRRL31185, 7 Fusarium_austroamericanum_NRRL28718, 8 Fusarium_austroamericanum_NRRL2903, 9 Fusarium_mesoamericanum_NRRL25797, 10 Fusarium_mesoamericanum_NRRL29148, 11 Fusarium_boothii_NRRL29105, 12 Fusarium_boothii_NRRL29011, 13 Fusarium_boothii_NRRL26916, 14 'Fusarium acaciae-mearnsii NRRL26754', 15 'Fusarium acaciae-mearnsii NRRL26752', 16 Fusarium_asiaticum_NRRL13818, 17 Fusarium_asiaticum_NRRL6101, 18 Fusarium_asiaticum_NRRL26156, 19 Fusarium_graminearum_08Gz6, 20 Fusarium_graminearum_08Gz235, 21 Fusarium_graminearum_08Gz64, 22 Fusarium_graminearum_08Gz190, 23 Fusarium_graminearum_KB809, 24 Fusarium_graminearum_KB906, 25 Fusarium_graminearum_KB1141, 26 Fusarium_graminearum_KB1110, 27 Fusarium_graminearum_08Gz134, 28 Fusarium_graminearum_08Gz167, 29 Fusarium_graminearum_08Gz76, 30 Fusarium_graminearum_08Gz195, 31 Fusarium_graminearum_KB1320, 32 Fusarium_graminearum_NRRL28336, 33 Fusarium_graminearum_08Gz70, 34 Fusarium_graminearum_NRRL13383, 35 Fusarium_graminearum_NRRL28063, 36 Fusarium_graminearum_NRRL5883, 37 Fusarium_graminearum_08Gz71, 38 Fusarium_graminearum_08Gz84, 39 Fusarium_graminearum_08Gz50, 40 Fusarium_graminearum_08Gz145, 41 Fusarium_graminearum_08Gz29, 42 Fusarium_graminearum_08Gz227, 43 Fusarium_graminearum_08Gz252, 44 Fusarium_graminearum_KB902, 45 Fusarium_graminearum_KB1129, 46 Fusarium_graminearum_KB1228, 47 Fusarium_graminearum_NRRL6394, 48 Fusarium_graminearum_08Gz178, 49 Fusarium_graminearum_08Gz231, 50 Fusarium_graminearum_NRRL31084, 51 Fusarium_graminearum_KB1171, 52 Fusarium_graminearum_KB1164, 53 Fusarium_graminearum_KB1120, 54 Fusarium_graminearum_KB1018, 55 Fusarium_graminearum_KB917, 56 Fusarium_graminearum_08Gz266, 57 Fusarium_pseudograminearum_NRRL28334, 58 Fusarium_pseudograminearum_NRRL28338, 59 Fusarium_cerealis_NRRL13721, 60 Fusarium_cerealis_NRRL25491, 61 Fusarium_culmorum_NRRL25475, 62 Fusarium_culmorum_NRRL3288; TREE Fig._1a = [&R] ((1:0.0,2:0.0):0.001272,((3:0.001251,4:0.0):0.002511,(5:0.001251,6:0.001251,7:0.0,8:0.0,((9:0.0,10:0.0):0.002547,((11:0.0,12:0.001248,13:0.001249):0.001965,(((57:0.0,58:0.0):0.065252,(59:0.002596,60:0.003777):0.006325,(61:0.001247,62:0.0):0.049601):0.022052,((14:0.002517,15:0.0):0.005149,(16:0.0,17:0.001244,18:0.001244):0.003699,(19:0.001242,20:0.001244,21:0.001242,22:0.001242,23:0.001242,24:0.001242,25:0.001242,26:0.001242,34:0.001242,35:0.001242,36:0.002497,37:0.001241,38:0.001241,39:0.001241,40:0.001241,41:0.001241,42:0.001241,43:0.001241,44:0.001241,45:0.001241,46:0.001241,47:0.002494,48:0.0,49:0.0,50:0.0,51:0.0,52:0.0,53:0.0,54:0.0,55:0.0,56:0.0,(27:0.0,28:0.0,29:0.0,30:0.0,31:0.0,32:0.0,33:0.001244):0.002498):0.0026):0.013309):0.01232):0.003147):0.00257):0.002567):0.001272) END; BEGIN TREES; TITLE Fig._1b_TB; LINK TAXA = Taxa2; TRANSLATE 1 Fusarium_culmorum_NRRL25475, 2 Fusarium_culmorum_NRRL3288, 3 Fusarium_cerealis_NRRL13721, 4 Fusarium_cerealis_NRRL25491, 5 Fusarium_graminearum_NRRL5883, 6 Fusarium_graminearum_NRRL31084, 7 Fusarium_graminearum_NRRL28336, 8 Fusarium_graminearum_NRRL28063, 9 Fusarium_graminearum_NRRL13383, 10 Fusarium_graminearum_NRRL6394, 11 Fusarium_graminearum_08Gz231, 12 Fusarium_graminearum_KB1110, 13 Fusarium_graminearum_KB1171, 14 Fusarium_graminearum_KB1018, 15 Fusarium_graminearum_KB902, 16 Fusarium_graminearum_08Gz134, 17 Fusarium_graminearum_KB917, 18 Fusarium_graminearum_08Gz195, 19 Fusarium_graminearum_08Gz70, 20 Fusarium_graminearum_KB1320, 21 Fusarium_graminearum_08Gz84, 22 Fusarium_graminearum_08Gz76, 23 Fusarium_graminearum_08Gz64, 24 Fusarium_graminearum_KB1228, 25 Fusarium_graminearum_08Gz167, 26 Fusarium_graminearum_08Gz71, 27 Fusarium_graminearum_08Gz252, 28 Fusarium_graminearum_KB1129, 29 Fusarium_graminearum_08Gz227, 30 Fusarium_graminearum_08Gz29, 31 Fusarium_graminearum_08Gz50, 32 Fusarium_graminearum_KB809, 33 Fusarium_graminearum_08Gz6, 34 Fusarium_graminearum_08Gz190, 35 Fusarium_graminearum_08Gz235, 36 Fusarium_graminearum_KB906, 37 Fusarium_graminearum_KB1120, 38 Fusarium_graminearum_KB1141, 39 Fusarium_graminearum_08Gz178, 40 Fusarium_graminearum_08Gz145, 41 Fusarium_graminearum_08Gz266, 42 Fusarium_graminearum_KB1164, 43 Fusarium_mesoamericanum_NRRL25797, 44 Fusarium_mesoamericanum_NRRL29148, 45 'Fusarium acaciae-mearnsii NRRL26754', 46 'Fusarium acaciae-mearnsii NRRL26752', 47 Fusarium_asiaticum_NRRL26156, 48 Fusarium_asiaticum_NRRL6101, 49 Fusarium_asiaticum_NRRL13818, 50 Fusarium_boothii_NRRL29105, 51 Fusarium_boothii_NRRL26916, 52 Fusarium_boothii_NRRL29011, 53 Fusarium_brasilicum_NRRL31281b, 54 Fusarium_brasilicum_NRRL31238b, 55 Fusarium_meridionale_NRRL28436, 56 Fusarium_meridionale_NRRL29010, 57 Fusarium_austroamericanum_NRRL2903, 58 Fusarium_austroamericanum_NRRL28718, 59 Fusarium_cortaderiae_NRRL31205, 60 Fusarium_cortaderiae_NRRL31185, 61 Fusarium_pseudograminearum_NRRL28334, 62 Fusarium_pseudograminearum_NRRL28338; TREE Fig._1b = [&R] ((61:0.0,62:0.0):0.1584665,((1:0.0,2:0.0,(3:0.0,4:0.0):0.013545):0.046172,(5:0.035483,6:0.035483,7:0.003223,8:0.003223,9:0.003223,10:0.003223,11:0.003223,12:0.003223,13:0.003222,14:0.0,15:0.0,16:0.0,17:0.0,18:0.0,19:0.0,20:0.0,21:0.003441,22:0.007332,23:0.007332,24:0.007332,25:0.007332,26:0.003448,27:0.003448,28:0.003448,29:0.003448,30:0.003448,31:0.003448,32:0.003448,33:0.003448,34:0.007066,35:0.003251,36:0.003251,37:0.003251,38:0.003251,39:0.003251,40:0.003251,41:0.003251,42:0.003251,(43:0.0,44:0.0):0.003251,(45:0.0,46:0.003168):0.014155,(53:0.0,54:0.0):0.015559,(55:0.0,56:0.0):0.019844,(57:0.0,58:0.0):0.024282,(59:0.0,60:0.0):0.03415,(47:0.010435,48:0.003237,49:0.0):0.01013,(50:0.0,51:0.0,52:0.0):0.017288):0.037465):0.1584665); END;