#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 13:58 GMT TreeBASE (cc) 1994-2008 Study reference: Sotome K., Hattori T., & Ota Y. 2011. Taxonomic study on a threatened polypore Polyporus pseudobetulinus and a morphologically similar species, P. subvarius. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10847] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=26; TAXLABELS Datronia_mollis Ganoderma_lucidum Ganoderma_tsunodae Lentinus_tigrinus Perenniporia_tephroporus Polyporus_alveolaris Polyporus_arcularius Polyporus_badius Polyporus_brumalis Polyporus_grammocephalus_WD2343 Polyporus_grammocephalus_WD2351 Polyporus_grammocephalus_WD2379 Polyporus_pseudobetulinus_22626 Polyporus_pseudobetulinus_27567 Polyporus_pseudobetulinus_TRTC51022 Polyporus_squamosus_MUCL30721 Polyporus_squamosus_WD2380 Polyporus_subvarius_IFP_Yu2 Polyporus_subvarius_WD1872 Polyporus_subvarius_WD2349 Polyporus_subvarius_WD2368 Polyporus_tenuiculus Polyporus_tubaeformis Polyporus_varius_WD2384 Polyporus_varius_WD691 Pseudofavolus_cucullatus ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M6563] TITLE '5.8S-ITS2-LSU'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1479; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Datronia_mollis ACTGAG-TCTT-GAAATGGGGTTGTAGCTGGCCTTA---------AAGGCA-TGTGCTCGCCCTGTTCAAATCCA---CTCTACACCTGTGCACTTACTGTGGGCTTTGGTTA--GAAAGCCA-----------------GGTTTATAACC---------------------------------------------TGA-------------C----------------------------------CTTT--------G-----A--GCCGGGCTCATGTTTACTTTACAA--ACAACT----TAGTATC-AGAATGTGTATTGCAATTT-AATGCAT-TTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCATGAAATTCTCAACCTACAAAG-C-T-TTGT-G--------TTTTGTTAGGCTTGGA?-TTGGAGGC-TT-G---------CTG---GCTC-------------TTGTCAGCTTCTCTTAAATTCATTAGCTTGATTCC-TTGTGGAT-CGGC-C-TCGGTGTGATAA-TTGTCTACGCTGTGACCGT-GAAACATA-------T-----GGTGAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGTTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTTGTTTGGAACTCAGCCTTGC-TTTTGCTTGGTGCACTTTCTGAATGACGGGCCAGCATCAATTTCAGCCGTTGGAAAAAGGCTGGGGGAATGTGGCACCTTC--GGGTGT--GTTATAGCCTCTGG---TCACATACAACGGTTGGGATTGAGGACCGCAGCGCGCCGTAAGGCAGGGGG---T-TTCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCATGGAGGGCATCGACGCCCGGACTTGAAGTTTTCTGATGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Ganoderma_lucidum ATCGAG-TTTT--GA-CCGGGTTGTAGCTGGCCTTC--C------GAGGCA-TGTGCACGCCCTGCTC--ATCCA---CTCTACACCTGTGCACTTACTGTGGGCTTCAGATT--GCGAGGCA-----------------CGCTCTTTACC------------------------------------------------GG---------G---CTTGCGGA------------------------------------G---CAT--ATCTGTGCCTGCGTTT--ATCACAA--ACTCTAT-AA-AGTAAC-AGAATGTGTATTGCGATGT-AACACATCTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGC-T--TTTGT-G--------GTTTG-TAGGCTTGGAC-TTGGAGGC-TT-G---------TCG---GCCGT--------TA-TCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCC-TTGCGGAT-CGGCTC-TCGGTGTGATAA-T-GTCTACGCCGCGACCGT-GAAGCGTTT------------GGCGAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCGGAACTCAGCCTTGC-TTTTGCTTGGTGCACTTTCCGGATGACGGGTCAGCATCGATTTTGACCGTCGGAAAAGGGCTGGAGTAATGTGGCACCTCC--GGGTGT--GTTATAGACTCTGG---TCGCATACGACGGTTGGGATCGAGGAACGCAGCGCGCCGCAAGGCAGGGGT---T-CGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGTGGGGAGCACCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Ganoderma_tsunodae ATCGAG-TTTT--GA-CTGGGTTGTAGCTGGCCTTC--C------GAGGCA-TGTGCACGCCCTGCTC--ATCCA---CTCTACACCTGTGCACTTACTGTGGGTTTCGGATC--ATGGAGCG-----------------------------------------------------------------GG-TCCTTTACGG---------G---CT-------TGT---------------------------------GAA-GT--GGCTGTGCCTGCGTTT--ATTACAA--ACTCTAT-AA-AGTAAC-AGAATGTGTATCACGATGT-AACGCATCTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAG--C-TT-TGC-G--------GTTTG-TCGGCTTGGAT-TTGGAGGC-TT-G---------TCG---GCCT---------AA--CGGTCGGCTCCTCTTAAATGCATTAGCTTGATTCC-TTGCGGAT-CGGCTC-TCGGTGTGATAA-TTGTCTACGCCGCGACCGT-GAAGCGTTT------------GGCGAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGC-TTTCGCTTGGTGCACTTTCCGGTTGACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGGGTAATGTGGCACCTCC--GGGTGT--GTTATAGACTCTAG---TCGCATACGGCGGTCGGGATCGAGGAACGCAGCGCGCCGTAAGGCAGGGGT---T-CGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGTAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Lentinus_tigrinus -----------------------GTAGCTGGCCTTC--C------GAGGCA-TGTGCACGCCCTGCTC--ATCCA---CTCTACACCTGTGCACTTACTGTGGGTTTCAGGAGC----------------------------------------------TTC---------------------AAGGG-CGTTTCTTACG---------C-CG------------------------------------------GAG-TT-GT--GACTGGGCCTACGTTT--ACTACAA--ACTCTTA-CA-AGTATC-AGAATGTGTATTGCGATGT-AACGCATCTCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTAACGGG-T-TCTTA-----ACGGGACTTGCTTAGGCTTGGAC-TTGGAGGC-T--------CTTGTCG---GCTT-GCTTTCG---TCAAGTCGGCTCCTCTCAAATGCATTAGCTTGGTTCT-TTGCGGATCCGGCTC-ACGGTGTGATAA-TTGTCTACGCCGCGACCGTTGAAGCGTTTT-A--ATGG---GACTAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCCGGAACTCAGCCTTCC-TTTTGGTTGGTGCACTTTCCGGTAGACGGGCCAGCATCGATTTCGACCGTCGGATAAGGGCTGGGGAAATGTGGCACCTTC--GGGTGT--GTTATAGTCCTCAG---TCGCATACGGCGGTTGGGATCGAGGAACGCAGCGCGCCGCAAGGCAGGGGT---T-CGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Perenniporia_tephroporus ATCGAG-TTTT--GA-CTGGGTTGTAGCTGGCCTTC--C------GAGGCA-TGTGCACGCCCTGCTC--ATCCA---CTCTACACCTGTGCACTTACTGTGGGTTTCAGATG--GCGTAGTG-----------------------------------------A------------------------G--CCTTTACGG---------G---CT-------TGT---------------------------------GAAAGC--ATCTGTGCCTGCGTTT--ATTATAA--ACTCTTA-T-AAGTAAC-AGAATGTGTATTGCGATGT-AACGCATCTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCATCAACCTATAAAC-C--TTTGT-G-------GGTTTG-TAGGCTTGGAT-TTGGAGGC-TT-G---------TCG---GCCT-AA----------CAGTCGGCTCCTCTTAAATGCATTAGCTTGATTCC-TTGCGGAT-CGGCTC-TCGGTGTGATAA-TTGTCTACGCCGCGACCGT-GAAGCGTTT------------GGCGAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGC-TTTTGCTTGGTGCACTTTCCGGATGACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGGGTAATGTGGCACCTTC--GGGTGT--GTTATAGACCTTAG---TCGCATACGGCGGTTGGGATCGAGGAACGCAGCGCGCCGCAAGGCAGGGGT---T-CGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_alveolaris ATCGAG-TTTT-GAATCGGGGTTGTAGCTGGCCTTT--C------GGGGCA-TGTGCACGCCCTGCTC-AATCCA---CTCTACACCTGTGCACTTATTGTGGGTTTCGG--------------G----------------------------------------GGGCT--------------------------------TTT-TGCC---------------------------------------------------------ACTCGTACCTATGTTTA-TTTACAA--ACGCTT----CAGTAAA-AGAATGTGTATTGCGA--T-AACGCATCTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCATGAAATCATCAACTTATAAGC-C-TTTCAT-G-------GGTCTA-TAAGCTTGGAC-TTGGAGGC-CT-G---------TCGGCGGTC-------------AACGTCGGCTCCTCTCAAATGTATTAGCTTGGTTCC-TTGCGGAT-CGGCTC-CCGGTGTGATAA-T-GTCTACGCTGTGACCGT-GAAGCGTTT------------GGCGAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTATGGAACTCAGCCTCGC-TCTTGCGTGGTGCATTTTCCT-ACGACGGGCCAGCATCGATTTTGACCGTCGGATAAGGGTTGAAGGAATGTGGCACCTTC--GGGTGT--GTTATAGCCTTCAG---TCGCATACGGCGGTTGGGATCGAGGAACGCAGCGCGCCGCAAGGCAGGGGT---T-CGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGAGCAGACGTTCTCTGACGCATCCGCGGTTGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_arcularius -----------------------GTAGCTGGCCTTC--C------GAGGCA-TGTGCACGCCCTGCTC--ATCCA---CTCTACACCTGTGCACTTACTGTGGGTTTCAGGAGCTTCGAAGCG-----------------------------------------AGGGTTT-------------------------------AATC-GCT----CTCGCCGA------------------------------------G-TT-GT--TACTGGGCCTACGTTT--ATCACAA--ACTCTTA-AA-AGTATC-AGAATGTAAA-CGCG-TCT-AACGCATCTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTAACAAG-T-TCTTA-----ACGGGGCTTGCTTAGGCTTGGAC-TTGGAGGC-TT-G---------TCG---GCTCT--------TA-GCAGTCGGCTCCTCTCAAATGCATTAGCTTGGTTCC-TTGCGGAT-CGGCTC-ACGGTGTGATAA-TTATCTGCGCCGCGACCGTTGAAGCGTTTA----AT-----GGCCAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTTCCGGAACTCAGCCTTCC-TTTTGGTTGGTGCACTTTCCGGTAGACGGGCCAGCATCGATTTCGACCGTCGGAAAAGGGCTGGGGAAATGTGGCACCTTTCGGGGTGT--GTTATAGTCCTCAG---TCGCATACGTCGGTTGGGATCGAGGATCGCAGCGCGCCGCAAGGCAGGGGT---T-CGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTG-TTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_badius AACGAG-TTCT--GAAAGGGGTTGTAGCTGGCTTTT--C------C-AGCA-TGTGCTCGCCCTGTTC-AATCCA---CTCTACACCTGTGCACCAACTGTAGGCTTTTGG--------------TGGGCTTGCTTTCCTTGTCCTTTACCGGGCG---------------------------------------TTGAGG---------G-CT---------TGT---------------------------------T-----A-ACCTTGGCTTGCGTTTT-CATACAA--ACCCTGTAAAAAGTAAAAAGAATGTGTATTGCGATAT-AACGCATTTATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAATTCTCAACCTACAAGG-C-TTTTGT-----------TTTG-TAGGCTTGGAC-TTGGAGGCGTT-G---------CCG---ATGT-TT--TT-ATT-TACGTTGGCTCCTCTCAAATGCATTAGCTAGCGTCCTTTGCGGAT-CAGCTTTTCGGTGTGATAA-TTGTCTACGCCGTAGTTGT-GAAGCGTTTT-----T-----GACCAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTTTGGAACTCAGCCTTGCTTTTTGCTTGGTGCACTTTCTGAACGACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGATTGGAGGAATGTGGCACCTTC--GGGTGT--GTTATAGCCTTCAG---TCACATACGGCGGTTGGGATCGAGGAACGCAGCGCGCCGTAAGGCAGGGGT---T-CGCCCACTTTCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAGGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_brumalis ATCGAG-TTCT--GAAACGGGTTGTAGCTGGCCTTC--C------GAGGCA-TGTGCACGCCCTGCTC--ATCCA---CTCTACACCTGTGCACTTACTGTGGGTTTCAGGAGCTTCGAAGCG-----------------------------------------GGGGCTT-------------------------------AATC-GCC----TTCGCCGA------------------------------------G-TT-GT--TACTGGGCCTACGTTT--ACCACAA--ACACTTT-AA-AGTAAC-AGAATGTA-ATCGCG-TCT-AACGCATCTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTAACAAG-T-TCTTA-----ACCGGACTTGCTTAGGCTTGGAC-TTGGAGGC-TT-G---------TCG---GCTCT--------TA-GCAGTCGGCTCCTCTCAAATGCATTAGCTTGGTTCC-TTGCGGAT-CGGCTC-ACGGTGTGATAA-TTGTCTACGCCGCGACCGTTGAAGCGTTTT-A--AT-----GGCCAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCCGGAACTCAGCCTTCC-TTTTGGTTGGTGCACTTTCCGGTAGACGGGCCAGCATCGATTTCGACCGTCGGATAAGGGCTGGGGAAATGTGGCACCTTTCGGGGTGT--GTTATAGTCCTCAG---TCGCATACGTCGGTTGGGATCGAGGATCGCAGCGCGCCGCAAGGCAGGGGT---T-CGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGAAGTTCTCTGACGGTTCCGCGGTAGAGCATGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_grammocephalus_WD2343 ATCGAG-TTTT--GAAAGGGGTTGTAGCTGGCCTTA--C------GAGGCATTGTGCACACCCTGCTC-AATCCA---CTCTACACCTGTGAACTAACTGTGGGTCTTT--------------TGG---------------------------------------GGGTTTGCA-TCT--------------------------------GT----T-G------TAAGCCTT-----TG------G------------------------GGGCTCATGTTTACTTTACAA--ACACTCATAA-AGTAAT-GGAATGTGTATTGCGATGT-AATGCATCTTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACACCTGTTTGAGTGTCGTGTAATTCTCAACCTACAAGG-T-CTTTGT-G-----G-GCCTTGTTAGGCTTGGATATTGGAGGA------TATAATTGTCG---GCAT-------------GAGTCGGCTCCTCTTAAATGCATTAGCTTGGTCCT-TTGTGGAT-CGGCTC-TCGGTGTGATAAGTTGTTTATGCCGTGACCGT-GAAGCATTTTCT--ATG-GGA-AGGAGCTTATAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGTGCCGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCGGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTGCAGAACTCAACCTAGC-TTTTGCTTGGTGCACTTTCTGTATGACGGGCCAGCATCGATTTTGACTGTCGGAAAAGGGTTGAAGGAATGTGGCACCTCC--GGGTGT--GTTATAGCCTTTGG---TCGCATACGGCAGTTGGGATCGAGGAACGCAGCGTGCCGCAAGGTGGGGCT---TCGGCCTACATTCACGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGAAGTTTTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_grammocephalus_WD2351 ATCGAG-TTTT-TGAAAGGGGTTGTAGCTGGCCTTC--C------GAGGCA-TGTGCACGCCCTGCTC-ATTCCA---CTCTACACCTGTGCACTTACTGTGGGTCTCT--------------TG----------------------------------------GGGTTAGCA-TTC--------------------------------GT---TT-G------CGAACCTT-----TC-------------------G-----------GGGCCTACGTTTA-TTCACAA--ACACTTATA--AGTAAC-GGAATGTGTATTGCGATGT-AACGCATCCATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGTAATTCTCAACCTATCAGC-C--TTTGC-G-----G-GCTTGGTTAGGCTTGGATATTGGAGGA-CT-------ATCGTCG---GCTT-GT--TT-CAA-CGAGTCGGCCCCTCTCAAATGCATTAGCTTAGTCCC-TTGCGGAT-CGGCTC-CCAGTGTGATAGTTTATCTACGCTGCGACCGT-GAAGCGTCCT----AT-----GGCGAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGCGCCGGACCGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCGGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTGCAGAACTCAACCTTGC-TTTCGCTTGGTGCACTTTCTGTACGACGGGCCAGCATCAATTTTGACCGTCGGATAAAGGCCGAAGGAATGTGGCACCCGTTTGGGTGT--GTTATAGCCTTCGG---TCGCATACGGCGGTTGGGATTGAGGAACGCAGCGCGCCGCAAGGTGGGGCT---TCGGCCTACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCAGACGTTTACTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_grammocephalus_WD2379 ATCGAG-TTTT--GAAAGGGGTTGTAGCTGGCCTTA--C------GAGGCATTGTGCACACCCTGCTC-AATCCA---CTCTACACCTGTGAACTAACTGTGGGTCTTT--------------TGG---------------------------------------GGGTTTGCA-TCT---------------------------------T---TT-G------TAAGCCTT-----TG------G------------------------GGGCTCATGTTTACTTTACAA--ACACTCATAA-AGTAAT-GGAATGTGTATTGCGATGT-AATGCATCTTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACACCTGTTTGAGTGTCGTGTAATTCTCAACCTACAAGG-T-CTTTGT-G-----G-GCCTTGTTAGGCTTGGATATTGGAGGA------TATAATTGTCG---GCAT-------------GAGTCGGCTCCTCTTAAATGCATTAGCTTGGTCCT-TTGTGGAT-CGGCTC-TCGGTGTGATAAGTTGTTTATGCCGTGACCGT-GAAGCATTTTCT--ATG-GGA-AGGAGCTTATAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGTGCCGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCGGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGG{GT}GGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTGCAGAACTCAACCTAGC-TTTTGCTTGGTGCACTTTCTGTATGACGGGCCAGCATCGATTTTGACTGTCGGAAAAGGGTTGAAGGAATGTGGCACCTCC--GGGTGT--GTTATAGCCTTTGG---TCGCATACGGCAGTTGGGATCGAGGAACGCAGCGTGCCGCAAGGTGGGGCT---TCGGCCTACATTCACGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGAAGTTTTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_pseudobetulinus_22626 --CGAG-TTTT--GAAAGGAGTTGTAGCTGTCCTCA--T------GGGGCA-TGTGCACGCTCTGCTTCAATCCA-CTCTCTACACCTGTGCACTTACTGTGGGCTTTC--------------CG---------------------------------GAGGGGAGGGTTTGCAATCC--------------------------------GT---TT-G------TAAATCTT-----TT-------------------G-----GG---AGGGCCTGCGTTTA-TTCACAA--ACACTTATAACAGTAAT-GGAATGTATACTATGATGT-AACACATCTATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCATGTAATTCTCAACCTTTACAGGT-CCTTGT-G-------GCTTTGTTAGGCTTGGATATTGGAGGG-----ATTCTATTGCCG---GCTT-GA-----GTA-CAAGTTGGCTCCTCTTAAATGCATTAGCTTAGTCCC-TAGTGGAT-CAGCTC-TCAGTGTGATAAGTTCTTTACGCTGTGACCGT-GAAGCATCTT----AT-----GGCAAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAATAGAGCATCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACACTTGAAGTCAGTCGCGTTATGCAGAACTCAACCTTGCTTTTTGCTTGGTGCATTTTCTGTATGACGGGCCAGCATCGATTTTGACCGTCGGATAAGGAATGTATGAATGTGGCACCTCTCCGGGTGCGGGTTATAGCCTACAACCATCGCATACGTCGGTTGGGATCGAGGAACGCAGCGCGCCGCAAGGTGGGGCC-TTT-TGGTCACATTCGCGCTTAGGATGCTGGCGTAATGGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGAAGTTTTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_pseudobetulinus_27567 ATCGAG-TTTT-TGAAAGGAGTTGTAGCTGGCCTCA--T------GGGGCA-TGTGCACGCTCTGCTTCAATCCA-CTCTCTACACCTGTGCACTTACTGTGGGCTTTC--------------CG---------------------------------GA-GGGAGGGTTTGCAATCC--------------------------------GT---TT-G------TAAATCTT-----TT-------------------G-----GG---AGGGCCTGCGTTTA-TTCACAA--ACACTTATAACAGTAAT-GGAATGTATACTATGATGT-AACACATCTATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCATGTAATTCTCAACCTTTACAGGT-CCTTGT-G-------ACTTTGTTAGGCTTGGATATTGGAGGG-----ATTCTATTGCCG---GCTT-GA-----GTA-CAAGTTGGCTCCTCTTAAATGCATTAGCTTAGTCCC-TAGTGGAT-CAGCTC-TCAGTGTGATAAGTTCTTTACGCTGTGACTGT-GAAGCATCTT----AT-----GGCAAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAATAGAGCATCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACACTTGAAGTCAGTCGCGTTATGCAGAACTCAACCTTGCTTTTTGCTTGGTGCATTTTCTGTATGACGGGCCAGCATCGATTTTGACCGTCGGATAAGGAATGTATGAATGTGGCACCTCTCCGGGTGCGGGTTATAGCCTACAACCATCGCATACGTCGGTTGGGATCGAGGAACGCAGCGCGCCGCAAGGTGGGGCC-TTT-TGGTCACATTCGCGCTTAGGATGCTGGCGTAATGGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGAAGTTTTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_pseudobetulinus_TRTC51022 ATCGAGTTTTT--GAAAGGAGTTGTAGCTGGCCTCA--T------GGGGCA-TGTGCACGCTCTGCTTCAATCCA-CTCTCTACACCTGTGCACTTACTGTGGGCTTTC--------------CG---------------------------------GAGGGGAGGGTTTGCAATCC--------------------------------GT---TT-G------TAAATCTT-----TT-------------------G-----GG---AGGGCCTGCGTTTA-TTCACAA--ACACTTATAACAGTAAT-GGAATGTATACTATGATGT-AACACATCTATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCATGTAATTCTCAACCTTTACAG-GTCCTTGT-G-------GCTTTGTTAGGCTTGGATATTGGAGGG-----ATTCTATTGCCG---GCTT-GA-----GTA-CAAGTTGGCTCCTCTTAAATGCATTAGCTTAGTCCC-TAGTGGAT-CAGCTC-TCAGTGTGATAAGTTCTTTACGCTGTGACCGT-GAAGCATCTT----AT-----GGCAAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGTCTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAATAGAGCATCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACACTTGAAGTCAGTCGCGTTATGCAGAACTCAACCTTGCTTTTTGCTTGGTGCATTTTCTGTATGACGGGCCAGCATCGATTTTGACCGTCGGATAAGGACTGTATGAATGTGGCACCTCTCCGGGTGCGGGTTATAGCCTACGGCCATCGCATACGTCGGTTGGGATCGAGGAACGCAGCGCGCCGCAAGGTGGGGCC-TTT-TGGTCACATTCGCGCTTAGGATGCTGGCGTAATGGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGAAGTTTTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_squamosus_MUCL30721 ACTGAG-TCTT--GA-AGAGGTTGCAGCTGGTCTTT--T------CAGGCA-AGTGCTCGCCTCGTTCAAATCCA---CTCTACACCTGTGCACTTACTGTGGACTTTGGTATT--CTT-----------------------------------------------------------------GGAGGGT-CCTTTGG---------CCCT---TT-A------TAA---------------------------------------ATCCGGGTTCATGTTTT-ATTATATATACGCTT----CAGTATTGAGAATGTGTATTGTGATGT-AACACATCGTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACACCTGTTTGAGTGTCATGAAATTCTCAACCTTACAAA-C-TTTTGT-G--------TTTGATTTGGCTTGGAG-TTGGAGGC-TT-G---------CTA---ATGG-GA-----AAT-TCCTTTGGCTCCTCTCAAATGCATTAGCTTGGTTCC-TTGCGGAT-TGGCTC-CTGGTGTGATAA-ATGTTTACGCCGCAGCTGTTGAAGC?TTTT----G------GGCAAGCTCCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGCGTTGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAACCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACACTTGAAGTCAGTCGTGTTGTTTGGAACTCAGCCTTGC-TTTTGCTTGGTGCACTTTCTGAATGACAGGCCAGCATCAATTTTGACCGTTGGAAAAAGGCAGGGGGAATGTGGCACCTTC--GGGTGT--GTTATAGCCTCTTG---TCACATACAACGGTTGGGATTGAGGACCGCAGCACGCCGCAAGGCAGGGGG---T-TTCCCACTTTCGTGCTTAGGATGCTGGCATAATGGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_squamosus_WD2380 ACTGAG-TCTT--GA-AGAGGTTGCAGCTGGTCTTA--T------CAGGCA-AGTGCTCGCCTCGTTCAAATCCA---CTCTACACCTGTGCACTTACTGTGGACTTTGGTATT--TTT-----------------------------------------------------------------GGAGGGT-CCTTTGG---------CCCT---TT-A------TGA---------------------------------------ATCCGGGTTCATGTTTT-ATTATATATACGCTT----CAGTATTGAGAATGTGTATTGTGATGT-AACGCATCGTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACACCTGTTTGAGTGTCATGAAATTCTCAACCTTACAAA-C-TTTTGT-G--------TTTGATTTGGCTTGGAG-TTGGAGGC-TT-G---------CTG---ACGG-GA-----AAT-TCCTTTGGCTCCTCTCAAATGCATTAGCTTGGTTCC-TTGCGGAT-TGGCTC-CTGGTGTGATAA-ATGTTTACGCCGCAGCTGTTGAAGCGATTT----G------GGCAAGCTCCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGCGTTGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACACTTGAAGTCAGTCGTGTTGTTTGGAACTCAGCCTTGC-TTTTGCTTGGTGCACTTTCTGAATGACAGGCCAGCATCAATTTTGACCGTTGGAAAAAGGTAGGGGGAATGTGGCACCTTC--GGGTGT--GTTATAGCCTCTTG---TCACATACAACGGTTGGGATTGAGGACCGCAGCACGCCGCAAGGCAGGGGG---T-TTCCCACTTTCGTGCTTAGGATGCTGGCATAATGGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_subvarius_IFP_Yu2 ACCGAG-TTCTTGTAATGGGGTTGTAGCTGGCCTT-------------GCA-TGTGCTCGCCCTGTTCAAATCCA---CTCTACACCTGTGCACTTACTGTGGGTTCCGGT-------------------------------------------------TAG---------------------AAGGG-TTTCTTTGAGG---------C-CT---------TTC---------------------------------G-----A-GCCAGGGCTCACGTTTT-ATTATAA--ACGCTT----CAGTATC-AGAATGTTTATTGCGATAT-AACGCATCTTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAATTCTCAAACTGCAAAG-C-TT-TTTT-TAAAAG-GGTTTGTTATGTTTGGAG-TTGGAGGC-TT-G---------CCG---GCTT-TG-----TAA-CAAGTCGGCTCCTCTCAAATGCATTAGCTCGGATTC-TTGCGGAT-CGGCTC-TCAGTGTGATAA-TTGTTTACGCTGTGACCGTTGAAGTGTTT------T-----GGCCAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGTGCTGGACCGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCATTTGGAACTCAGCCTTGC-TTTTGCTTGGTGCACTTTCTGAATGACGGGCCAGCATCAATTTCAACCGTTGGAAAAAGGTTGGGGGAATGTGGCACCTTC--GGGTGT--GTTATAGCCTCTGG---TCACATACGACGGTTGGGATTGAGGACCGCAGCACGCCGCAAGGCAGGGGA---TATACCCACTTTCGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTTGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_subvarius_WD1872 ACCGAG-TTCTTGTAAGGGGGTTGTAGCTGGCCTT-------------GCA-TGTGCTCGCCCTGTTCAAATCCA---CTCTACACCTGTGCACTTACTGTGGGTTCCGGT-------------------------------------------------TAG---------------------AAGGG-TTTCTTTGAGG---------C-CT---------TTC---------------------------------G-----A-GCCAGGGCTCACGTTTT-ATTATAA--ACGCTT----CAGTATC-AGAATGTTTATTGCGATAT-AACGCATCTTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAATTCTCAAACTGCAAAG-C-TT-TTTT-TAAAAG-GGTTTGTTATGTTTGGAG-TTGGAGGC-TT-G---------CCG---GCTT-TG-----TAA-CAAGTCGGCTCCTCTCAAATGCATTAGCTCGGATTC-TTGCGGAT-CGGCTC-TCAGTGTGATAA-TTGTTTACGCTGTGACCGTTGAAGTGTTT------T-----GGCCAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGTGCTGGACCGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTTTGGAACTCAGCCTTGC-TTTTGCTTGGTGCACTTTCTGAATGACGGGCCAGCATCAATTTCGACCGTTGGAAAAAGGTTGGGGGAATGTGGCACCTTC--GGGTGT--GTTATAGCCTCTGG---TCACATACGACGGTTGGGATTGAGGACCGCAGCACGCCGCAAGGCAGGGGA---TATACCCACTTTCGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTTGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_subvarius_WD2349 T----------------GGGGTTGTAGCTGGCCTT-------------GCA-TGTGCTCGCCCTGTTCAAATCCA---CTCTACACCTGTGCACTTACTGTGGGTTCCGGT-------------------------------------------------TAG---------------------AAGGG-TTTCTTTGAGG---------C-CT---------TT--------------C-------------------G-----A-GCCAGGGCTCACGTTTT-ATTATAA--ACGCTT----CAGTATC-AGAATGTTTATTGCGATAT-AACGCATCTTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAATTCTCAAACTGCAAAG-C-TT-TTTT-TAAAAG-GGTTTGTTATGTTTGGAG-TTGGAGGC-TT-G---------CCG---GCTT-TG-----TAA-CAAGTCGGCTCCTCTCAAATGCATTAGCTCGGATTC-TTGCGGAT-CGGCTC-TCAGTGTGATAA-TTGTTTACGCTGTGACCGTTGAAGTGTTT------T-----GGCCAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGTGCTGGACCGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTTTGGAACTCAGCCTTGC-TTTTGCTTGGTGCACTTTCTGAATGACGGGCCAGCATCAATTTCGACCGTTGGAAAAAGGTTGGGGGAATGTGGCACCTTC--GGGTGT--GTTATAGCCTCTGG---TCACATACGACGGTTGGGATTGAGGACCGCAGCACGCCGCAAGGCAGGGGA---TATACCCACTTTCGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTTGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAAAGGAAACTCTGGTG Polyporus_subvarius_WD2368 ACCGAG-TTCTTGTAATGGGGTTGTAGCTGGCCTT-------------GCA-TGTGCTCGCCCTGTTCAAATCCA---CTCTACACCTGTGCACTTACTGTGGGTTCCGGT-------------------------------------------------TAG---------------------AAGGG-TTTCTTTGAGG---------C-CT---------TTC---------------------------------G-----A-GCCAGGGCTCACGTTTT-ATTATAA--ACGCTT----CAGTATC-AGAATGTTTATTGCGATAT-AACGCATCTTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAATTCTCAAACTGCAAAG-C-TT-TTTT-TAAAAG-GGTTTGTTATGTTTGGAG-TTGGAGGC-TT-G---------CCG---GCTT-TG-----TAA-CAAGTCGGCTCCTCTCAAATGCATTAGCTCGGATTC-TTGCGGAT-CGGCTC-TCAGTGTGATAA-TTGTTTACGCTGTGACCGTTGAAGTGTTT------T-----GGCCAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGTGCTGGACCGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTTTGGAACTCAGCCTTGC-TTTTGCTTGGTGCACTTTCTGAATGACGGGCCAGCATCAATTTCGACCGTTGGAAAAAGGTTGGGGGAATGTGGCACCTTC--GGGTGT--GTTATAGCCTCTGG---TCACATACGACGGTTGGGATTGAGGACCGCAGCACGCCGCAAGGCAGGGGA---TATACCCACTTTCGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTTGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_tenuiculus G-------------------------GCTGGCCCTT--CCG----AAGGCA-TGTGCACGCCCTGCTC-AATCCA---CTCTACACCTGTGCACTTACTGTGGGTCTTCGA-----------------------------------------------GCAATGGGGGTTTATA---------------------------------ATTTC---TT-A------TAAGCCTT-----CGT------------------------TT---GAAGCCCACGTTTA-CACACAA--ACACTTATAA-AGTAAA-AGAACGTGTATTGCGATGT-AACGCATCCATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGTAATTCTCAAACTTACCCG-T-CTTTGC-G-----G-ATGGTGTAAGGCTTGGATGTTGGAGGT-CT-------ATTGTCG---GTTT-GT------AA-CGAACCGGCTCCTCTTAAATGCATTAGCTCAGTCCT-TTGTGGAT-CGGCTC-CCAGTGTGATAA-TTATCTGCGCTGCGACCGT-GAAGCGTTTT-ATT--AT---GGCGAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTGTGGGACTCAGCCTTGC-TTTTGCTTGGTGCACTTCCTGCATGACGGGCCAGCATCAATTTCGACCGTTGGATAAGGGCCGAAGGAATGTGGCACCTCC--GGGTGT--GTTATAGCCTTCGG---TCGCATACAACGATTGGGATTGAGGAACGCAGCGTGCCGCAAGGTAACGTT---TG-----------------AGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCAGACGTTTTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_tubaeformis AACGAG-TTCT--GAAAGGGGTTGCAGCTGGCTTTCAT-TTTTTGGAAGCA-TGTGCTCGCCCTGCTC-AATCCA---CTCTACACCTGTGCACTAACTGTGGGTCTTGTGTG------------TGGGCCT-------TCGTCCTTCGCGGGGCGTC----------------------------------------------------------------G-----------------------GCTTT--------------A-ACCCTGGCCTACGTTTT-CTTACAA--ACACTTTAAA-AGTATCGAGAATGTGTATTGCGACAT-AACGCATTTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAATTCTCAACCTACAAAA-C-TTTT-TG---------------TAGGCTTGGAC-TTGGAGGTATT-G---------CCG---ACGT-TT-----TCATAATGCCGGCTCCTCTCAAATGCATTAGCTCGCGTCC-TTGCGGAT-CGGCTCTTCGGTGTGATAA-TTGTCTACGCCGTGGTCGT-GAAGCGTTTT-----T-----GACCGGCTTCTAA?????GTTGTAGTCTGGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTCTGACACGGACTGCCAGTGCTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTTTGGAACTCAGCCTTGCTTTTTGCATGGTGCACTTTCTGAACGACGGGCCAGCATCGATTTCGACCGTCGGAAAAGGGTTGGGGGAATGTGGCACCTTA--GGGTGT--GTTATAGCCTCCAG---TCACATACGACGGTTGGGATCGAGGAACGCAGCGCGCCGCAAGGCAGGGGT---T-CGCCCACTTTCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_varius_WD2384 -CCGAG-TATT--GAAACGGGTTGCAGCTGGCCTTT--TAC----CGGGCA-AGTGCTCGCCCTTTCG-AATTCAC-TCTCTACACCTGTGCACTTATTGTGGGTCTTGGT--------------TTTGTTCACTCTCCT------------------------------------------------------------------------------G---T---GTGATCT-----TAGTTGAT-CTTACGGGGGAG-GGGGG--AACTGGGCTCACATTTT-ATCACAA--ACCCCTT---CAGTATC-AGAATGTTTATTGCGATAT-AACGCATTTAT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAATTCTCAACCTACAAAC-A--CTTGT-GT----G-TTTTTGCTAGGCTTGGAC-TTGGAGGTGTT-G---------CGG---GCTT-GA------TT-AGAGTCGGCTCCTCTTAAATGCATTAGCTTGATTCCTTTGTGGAT-CGGCTC-CCGGTGTGATAA-TTGTCTACTCCGTGACCGT-GAAGCGCTT------------GGCAAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTTTGGAACTCAGCCTTGC-TTTTGCTTGGTGCACTTTCTGAATGACGGGCCAGCATCAATTTTGACTGTTGGAGAAGGGTTGGGGGAATGTGGCACTCTTCGGGGTGT--GTTATAGCCCGTTA---CCGCATGCAACGGTTGGGATTGAGGACCGCAGCGCGCCGCAAGGCAGGGGCATAT-CGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTGGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Polyporus_varius_WD691 ACTGAG-TCTT-GAAATGGGGTTGTAGCTGGCCTTA--T------CAGACA-TGTGCTCACCCTGTTCAAATCCA---CTCTACACCTGTGCACTTACTGTGGGCTTCGGT-------------------------------------------------TTT---------------------GGGGGGT-CTT----------------------------------GTATTTTAA--CTTGAC-CTTTT-------------A--GCTGGGCTCATGTTTTTGTTATAA--ACGCTTT---CAGTATC-AGAATGTGTATCGCGATGT-AACGCATCTTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAATTCTCAACCTTACAAA-C-CTTTGT--T----G-TGTTTGTCAGGTTTGGAC-TTGGAGGC-TT-T------TTGCTG---GCCT-------------TGGTCAGCTCCTCTCAAATTCATTAGCTTGGTTCC-TTGCGGAT-CGGCTC-TCGGTGTGATAAATTGTCTACGCTGTGGCCGT-GAAACGTTT------------GGCAAGCTTCTAA?????GTTGTAGTCTGGAGAAGTGTTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTCTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTTTGGAACTCAGCCTTGC-TTTCGCTTGGTGCACTTTCTGAACGACGGGCCAGCATCAATTTTGACCGTTGGAAAAGGGCCAGAGGAATGTGGCACTTTC--GGGTGC--GTTATAGCCTTTGG---TCGCATGCAACGGTTGGGATTGAGGACCGCAGCGCGCCGCAAGGCAGGGGT---T-TACCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTTGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG Pseudofavolus_cucullatus ACTGAG-TCTT--GAAAAGGGTTGCAGCTGGCCTTCAC-CC----AAGGCA-TGTGCTCACCCTGTTCAAATCCA---CTCTACACCTGTGCACTTACTGTGGGCTTTGGA---------------------------------------------------------TCTGTTTTTCGGTTCTGAGGGGT----------CA-------------------------AACCTTTGGA--AGCGCA-ATTCG-------------C--TCCAGGCTCACGTTTTTACTACAA--ACACTTTT---GGTATT-AGAATGTGTATTGCGATGTTAATGCATCTTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAATTCTCAACCTACAAAG-T-TGTTGT-----TGCAACTTTGTTTGGCTTGGAT-CTGGAGGC-TTTG---------CTG---GCTT-GC-----TCT-GAGTTCAGCTCCTCTTAAATGCATTAGCTTGGTTCC-TTGTGGAT-CAGCTC-TCGGTGTGATAAATTGTCTATGCCGTGACTGT-GAAGCGTTT------------GGCGAGCTTATAA?????GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACACTTGAAGTCAGTCGCGTCGCTTGGAACTCATCCTGGC-T-TTGCCTGGTGCACTTTCTGAGTGACGGGCCAGCATCAATTTTGACCGTTGGAAAAAGGCTGGGGGAATGTGGCACCTTC--GGGTGT--GTTATAGACTCTGG---TCACATACAACGGTTGGGATTGAGGACCGCAGCGCGCCGCAAGGCAGGGGT---T-CGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTG ; END; BEGIN SETS; CHARSET ITS1 (CHARACTERS = '5.8S-ITS2-LSU') = 1-348; CHARSET ITS2 (CHARACTERS = '5.8S-ITS2-LSU') = 512-724; CHARSET 28S (CHARACTERS = '5.8S-ITS2-LSU') = 730; CHARSET 5.8S (CHARACTERS = '5.8S-ITS2-LSU') = 349-511; END; BEGIN TREES; TITLE '5.8S-ITS2-LSU'; LINK TAXA = Taxa1; TRANSLATE 1 Ganoderma_lucidum, 2 Perenniporia_tephroporus, 3 Polyporus_alveolaris, 4 Datronia_mollis, 5 Polyporus_tenuiculus, 6 Polyporus_grammocephalus_WD2351, 7 Polyporus_varius_WD691, 8 Polyporus_varius_WD2384, 9 Ganoderma_tsunodae, 10 Pseudofavolus_cucullatus, 11 Polyporus_squamosus_MUCL30721, 12 Polyporus_squamosus_WD2380, 13 Polyporus_grammocephalus_WD2343, 14 Polyporus_grammocephalus_WD2379, 15 Polyporus_badius, 16 Polyporus_tubaeformis, 17 Polyporus_subvarius_IFP_Yu2, 18 Polyporus_subvarius_WD1872, 19 Polyporus_subvarius_WD2349, 20 Polyporus_subvarius_WD2368, 21 Polyporus_pseudobetulinus_27567, 22 Polyporus_pseudobetulinus_22626, 23 Polyporus_pseudobetulinus_TRTC51022, 24 Lentinus_tigrinus, 25 Polyporus_brumalis, 26 Polyporus_arcularius; TREE MP1 = [&R] (1,9,(2,(((3,(((5,6),(23,(21,22))),(13,14))),(((8,((4,7),(10,(11,12)))),(17,18,19,20)),(15,16))),(24,(25,26))))); TREE ML = [&R] ((2,((3,((((8,((10,(12,11)),(7,4))),(17,(20,(19,18)))),(16,15)),((14,13),((6,5),(23,(22,21)))))),(24,(26,25)))),(9,1)); TREE MP4 = [&R] (1,(2,9),((3,((((8,((4,7),(10,(11,12)))),(17,18,19,20)),(15,16)),(((5,6),(23,(21,22))),(13,14)))),(24,(25,26)))); TREE MP3 = [&R] (1,(2,9),(((3,(((5,6),(23,(21,22))),(13,14))),(((8,((4,7),(10,(11,12)))),(17,18,19,20)),(15,16))),(24,(25,26)))); TREE Fig._1 = [&R] (1,9,(2,((3,((((8,((4,7),(10,(11,12)))),(17,18,19,20)),(15,16)),(((5,6),(23,(21,22))),(13,14)))),(24,(25,26))))); END;