#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 20:01 GMT TreeBASE (cc) 1994-2008 Study reference: Gottlieb A., Giberti G., & Poggio L. 2003. Molecular analyses of the genus Ilex (Aquifoliaceae) in southern South America, evidence from AFLP and ITS sequence data. American Journal of Botany, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1091] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=48; TAXLABELS Helwingia_chinensis Helwingia_japonica Ilex_amelanchier Ilex_anomala Ilex_argentina Ilex_argentina_Gbk Ilex_beecheyi Ilex_brasiliensis Ilex_brevicuspis Ilex_buergeri Ilex_canariensis Ilex_cassine Ilex_collina Ilex_cornuta Ilex_crenata Ilex_decidua Ilex_dimorphophylla Ilex_dumosa_dumosa Ilex_dumosa_guaranina Ilex_glabra Ilex_integerrima Ilex_integra Ilex_kiusiana Ilex_latifolia Ilex_liukiuensis Ilex_macropoda Ilex_maximowicziana Ilex_mertensii Ilex_micrococca Ilex_microdonta Ilex_microdonta_Gbk Ilex_mitis Ilex_mucronata Ilex_mutchagara Ilex_opaca Ilex_paraguariensis Ilex_pedunculosa Ilex_percoriacea Ilex_pseudobuxus Ilex_rotunda Ilex_rugosa Ilex_serrata Ilex_taubertiana Ilex_theezans Ilex_theezans_Gbk Ilex_vomitoria Ilex_warburgii Ilex_yunnanensis ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=48; TAXLABELS Helwingia_chinensis Helwingia_japonica Ilex_amelanchier Ilex_anomala Ilex_argentina Ilex_argentina_Gbk Ilex_beecheyi Ilex_brasiliensis Ilex_brevicuspis Ilex_buergeri Ilex_canariensis Ilex_cassine Ilex_collina Ilex_cornuta Ilex_crenata Ilex_decidua Ilex_dimorphophylla Ilex_dumosa_dumosa Ilex_dumosa_guaranina Ilex_glabra Ilex_integerrima Ilex_integra Ilex_kiusiana Ilex_latifolia Ilex_liukiuensis Ilex_macropoda Ilex_maximowicziana Ilex_mertensii Ilex_micrococca Ilex_microdonta Ilex_microdonta_Gbk Ilex_mitis Ilex_mucronata Ilex_mutchagara Ilex_opaca Ilex_paraguariensis Ilex_pedunculosa Ilex_percoriacea Ilex_pseudobuxus Ilex_rotunda Ilex_rugosa Ilex_serrata Ilex_taubertiana Ilex_theezans Ilex_theezans_Gbk Ilex_vomitoria Ilex_warburgii Ilex_yunnanensis ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=48; TAXLABELS Helwingia_chinensis Helwingia_japonica Ilex_amelanchier Ilex_anomala Ilex_argentina Ilex_argentina_Gbk Ilex_beecheyi Ilex_brasiliensis Ilex_brevicuspis Ilex_buergeri Ilex_canariensis Ilex_cassine Ilex_collina Ilex_cornuta Ilex_crenata Ilex_decidua Ilex_dimorphophylla Ilex_dumosa_dumosa Ilex_dumosa_guaranina Ilex_glabra Ilex_integerrima Ilex_integra Ilex_kiusiana Ilex_latifolia Ilex_liukiuensis Ilex_macropoda Ilex_maximowicziana Ilex_mertensii Ilex_micrococca Ilex_microdonta Ilex_microdonta_Gbk Ilex_mitis Ilex_mucronata Ilex_mutchagara Ilex_opaca Ilex_paraguariensis Ilex_pedunculosa Ilex_percoriacea Ilex_pseudobuxus Ilex_rotunda Ilex_rugosa Ilex_serrata Ilex_taubertiana Ilex_theezans Ilex_theezans_Gbk Ilex_vomitoria Ilex_warburgii Ilex_yunnanensis ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2482] TITLE ITS_411; LINK TAXA = Taxa1; DIMENSIONS NCHAR=749; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Helwingia_chinensis C--AAAATAGA--CCCGCGAACA-TGTT----CAT-CCAT---C------GGGGG-T-TGGCGA--GGGGTGCGCGAG-C--CCCCAA--TCCACCCCCTC---TC-CGG--C------GA-TGCTGC-TTTGAA-TTGT-CGCCAA-TGCG-GTGGCATCCATTGTTG-TG-TCGACTGAA-C--AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG--AGCCAG-TCTTCGA-AAGC-CCCGTACGCGGTGCGC-TT--G-GGAGG{CT}GT-TGGCGTCTTTAAAAT--CATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG------CC-CCC-A---ACC--C--ACTCCACAC--AC-G--AATTG-CGGTGTTGCT---TTG----GGGG-CGGAGATTGGCCTCCCATA--CA--AA-A---T---AAGCTTGCGTGGTTG-GCC-----------TAAAA-GCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTT--AA-A--T--ATGCCTCTTG-CGTATTATC-GCGAGAC--AACCCAT--CT--CC---G-GCGTGTG-C-TC----T----TT-GA-GA-C-C-C-C---A--ATG-ACGATGCTT-CGATT Helwingia_japonica C--AAAATAGA--CCCGCGAACA-TGTT----CAT-CCAT---C-------GGGG-T-TGGCGA--GGGGTGCGCGAG-C--CCCCAA--TCCACCCCCTC---TC-CGG--C------GA-TGCTGC-TTTGAA-TTGT-CGCCAA-TGCG-GTGGCATCCATTGTTG-TG-TCGACTGAA-C--AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG--AGCCAG-TCTTCGA-AAGC-CCCGTACGCGGTGCGC-TT--G-GGAGGCGT-TGGCGTCTTTAAAAT--CATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG------CC-CCC-A---ACC--C--ACTCCACAC--AC-G--GATTG-CGGTGTTGCT---TTG----GGGG-CGGAGATTGGCCTCCCATA--CA--AA-A---T---AAGCTTGCGTGGTTG-GCC-----------TAAAA-GCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTT--AA-A--T--ATGCCTCTTG-CGTATTATC-GCGAGAC--AACCCAT--CT--CC---G-GCGTGTG-C-TC----T----TT-GA-GA-C-C-C-C---A--ATG-ACGATGCTT-CGATT Ilex_amelanchier C--AAAGTAGAC-CCGGTGAACT-TGTT----AAA-ACATG--C--C-C-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C--CCCC-C--CGA-CACACT----CC-CCC--A------CC-TCGGGA-TTTGGC-TTG--TGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCAAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTTG------CC-CCA-A-C-CCC--CAATTCCTATAT--A--G--TTGGA-TATTGTGTAA---GTT----GGGGCCGGAAATTGGCCTCCCGT---C---CA-C---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGGGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAG--CT---C---TAACC-GTG-ACCC--TATA-TGCG-CC-TT-C-T-T-C---A--GTG-ATGGTGCTT-CGACC Ilex_anomala C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG--C--A-T--GGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-C--CAA-CACACT----CC-CCC--A------CC-TCGGGA-TTTGGC-TTG--TGT-TC-ACCT-AGTGGAG-ACTCGGTCAAA-GGTCCCGAC----AACGAA----CCCCGGCGCTATA-TGTGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC-TATAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAA----T---------G--CTGGA-TATTACGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT---A---CA-C---G---GCTGTGCGCGGTTGG-CCC-----------AAAAA-TTGAGCTCTGGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCAAGTTGTGAGGCA-CCAAGTCTGTAGCGAG--CT---C---TGACT-GTG-ACCC----TG-TGCA-CC-TT-C-T-T-T---A--GGGAATGGTGCTT-CGACT Ilex_argentina C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAATATTTG--G--G-C-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-C--CGA-CACACT-C--TC-CCA--C------CC-ACGGGA-TTTGGC-TTG--CGT-TC-CCCT-AGTGGGG-ACCCGGTC-GA-CCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTAG-CCCCCTG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCGTC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCA------CC-CCA-A---CCC--CAATGCCTGGCTACC-AG--CTGGA-CGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT--CC--ACA-C---G---ACCGTGTGCGGTTGG-CCC-------A---AAAAA-ATGAGCTCTTGACGATGGACGTCACCACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTATAGCGAG--CT---C---TGATC-GTG-ACCC----TG-TGCA-CC-TT-CTTATTA---G--GGG-ATGGTGCTT-TGACC Ilex_argentina_Gbk C--AAAGTAGA--CCGGCGAACT-TGTT----AAA-ACATG--C--T-G-GGGGGTT-TGAGAA--GGGGTGCGTGAG-C--CCCC-C--CAA-CACACT---CCC-CCC--A------CC-TCGGGATTTCGGC-TTG--CGT-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGACAA--AACGAA-C--CCCCGGCGCTATC-TGCGCCAAGGAACCACAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-CC---CC-CCCTC-CACCC--CAATGCCCACCT--A--G--CTGGA-TATTGTGGGAGTCGTC----GGCG-CGGAAATTGGTCTCCCGTC--CG--CA-C---G---ATCGGGAGCGGTTGG-CCC----------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAG--CT---C---TAACC-GTG-ACCC----TG-CGCA-CC-TT-C-T-T-C---A--GCG-ATGGTGCTT-CGACC Ilex_beecheyi C--AAAGTAGAC-CCGGCGAACT-CGTT----AAA-ATATATGG--C-T-GGGGGTC-TGGGAA--GGGGTGCGCGAG----CCCC-C--CAA-CACACT----CC-CCC--AGCCC--GC-TCGGGA-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACTTGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCACAAC-TGAA---GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCAAC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----------C------CCC--CAA--CCC------------C---A--ATTGCGGGA---GTCG---GGGG-CGGAAATTGGCCTCCCGT---C---CA-C---G---AACGTGCACGGTTGGCCC-A----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT---C---TGACC-GTG-ACCC----TG-TGCA-CC--TCC-T-T-C---G--CGG-ATGGTGCTC-CGACC Ilex_brasiliensis C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAATATTTG--G--C-CGGGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-C--CGA-CACACT-C--CC-CCG--C------CC-CCGGGA-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACCCGGCC-TA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAGA-AGCTAG-CCCCCCC-GTGT-CCCGTTCGCGGCGTGC-AC--G-GGAGGCAT-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCTGGCTACC-AG--CCGGA-CGTTGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT--CC--ACA-C---G---ACCGTGTGCGGTTGG-CCC------AA---AAAAA-ATGAGCTCTCACCGATGGGCGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTACAGCGAG--CT---C---TGATC-GTG-ACCC----TG-CGCA-CC-TT-CTTATTA--GG--GGG-ATGGTGCTT-TGACC Ilex_brevicuspis C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAATATTTG--G--C-C-GGGGGTT-TGAGAA-GGGGGTGCGCGAG---CCCCC-C--CGA-CACACT-C--CC-CCG-CC------CC-TCGGGA-TTTGGC-TTA--CGT-TC-CCCT-ACTGGGG-ACCCGGTC-GA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCTGGCTACT-AG--CTGGA-CGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT--CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC-----AAA---AAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGGCCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT---C---TGATC-GTG-ACCC----TG-TGCA-CC-TC-CTTATTA---G--GGT-ATGGTGCTT-CGACC Ilex_buergeri CA-AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG--C--C-T-GGGGGTT-TGAAAA--GGGGTGCGCGAG----CCCC-C--CAA-CACACT----CC-CCC--AGCCC--CC-TCGGGA-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACCA-A---CCC--CAATGCCCA--------G--CTGGA-TATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT---C---CA-T---G---AACGCGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT---C---TGACC-GCG-ACCC----TG-TGCACCC-TTCC-T-T-C---A--CGG-ATGGTGCTC-CGACC Ilex_canariensis C--AAAGTAGAC-CCGGCGAACC-CGTT----AAA-ACATG--C--C-T-GGGGGTT-TGAGAA--GGGGCGCGCAAG---CCCCC-C-GACG-CACTCC-C--CC-ACC--C------CC-CGGGGG-TTTGGC-TTG--GGT-TC-CCCT-AGCGGGG-ACCCGGTC-AG-GCTCCCGGC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-AGAAG--AGCTGG-CCCCCCG-GTGTCCCCGTTCGCGGTGTGC-AC-TG-GGAGGCAT-TTGCGTC-TTTCG----AATC---TGAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGCTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCAAGGGCACGTCTGCCTGGGCGTCACCCATCACGTCG---C--CC-CCA-A---CCC--CAATGCCTGGCT--A--G--CCGGG-TATCGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT---C---CA-C-AGG---ACCGTGCGCGGTTGG-CCC-AA---AA---AACAA-ATGAGTTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGGGGCA-CCGAGTCTATGGCGAG--CT---C---CGACC-GGG-ACCC----TG-CGCA-CA-CT-C-CTCCG---G--GGG-ATGGTGCTC-CGACC Ilex_cassine C--AAAGTAGA--CCGGCGAACT-TGTT----AAA-ACATG--C--T-G-GGGGGTT-TGAGAA--GGGGTGCGTGAG-C--CCCC-C--CAA-CACACT---CCC-CCC--A------CC-TCGGGATTTCGGC-TTG--CGT-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGACAA--AACGAA-C--CCCCGGCGCTATC-TGCGCCAAGGAACCACAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-CC---CC-CCCTC-CACCC--CAATGCCCACCT--A--G--CTGGA-TATTGTGGGAGTCGTC----GGGG-CGGAAATTGGCCTCCCGTC--CG--CA-C---G---ATCGTGAGCGGTTGG-CCC----------AAAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAG--CT---C---TAACC-GTG-ACCC----TG-CGCA-CC-CT-C-T-T-C---A--GCG-ATGGTGCTT-CGACC Ilex_collina C--AAAGTAGA--CCCGCGAACT-TGTT----AAA-ATATG--C--T-G-GGGGTTTGAGGTTAG-GGGGTGCGCGAG-C--CCCC-C--CAA-CACACT----CC-CCC--A------CC-TCGGGA-TTTGGCTTTG--TGT-TC-CCCT-AGTGGGG-ACTCGGTC-AG-GCTCCCGAC--A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAATCATAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC-AC--G-GGGGGCAT-TTGCATC-TTTTG----AATC---TAAAA{CT}GACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCTA--------G--TTGGA-TATTGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT---C---CA-T---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAG--CT---C---TAATC-GTG-ACCC----TG-{CT}GCA-CC-TT-C-T-T-C---A--ACG-ACGGTGCTT-CGACC Ilex_cornuta C--AAAGTAGAC-CCGGCGAACT-TGTT--A-AAA-ATATG--C--C-T-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-C--CAA-CACACT----CC-CCC--AGCCC--CC-TCGGGA-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACGCGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-GTGT-CCCGTTCGCGGCGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG------CCACCA-A---CCC--CAATGCCCA--------G--CCGGA-TATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCC?GT---T---?A-C---G---AACGTGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT---C---TGACC-GCG-ACCC----TG-TGCACCC-TT-C-T-T-C---A--CGG-ATGGTGCTC-CGACC Ilex_crenata C--AAAGTA{AC}A--CCGGCGAACT-TGTT----AAA-ACATG--C--C-G-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C--CCCC-C--CAATAAGGTT----CC-CCC--A------CC-TCCGGA-TTTGGC-TTGT-TTT-CC-CCCT-GGCGGGGAACTCGGCC-CA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCATAAC-CGAAG--AGCTGG-TCTCCCG-GTGC-CCCGTCCGCGGTGTGC-AC--G-GGAGGCGT-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A-C-CCC--C--CAACGGCCT--A--G--CCGGA-TATTGCGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGTC--CG--CG-C---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TCGCATCACGTCGTGGGGCG-CCTAGTCTGTAGCGAG--CT--CC---GACCCTGTG-CACC----TG--ATT-CG-CT-C-T-A-G---G--GCG-A-GGTGCTT-CGACC Ilex_decidua C--AAAGTAGA--CCGGCGAACT-TGTT----AAA-ATATG--C--T-G-GGGGTTTGAGAAAAG-GGGGTGCGCGAG-C--CCCC-C--CAA-CACACT----CC-CCC--A------CC-TCGGGA-TTTGGCTTTG--TGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC--A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC-AC--G-GGGGGTAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCTA--------G--CTGGA-TATCGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT---T---CG-C---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAG--CT---C---TAACC-GTG-ACCC----TG-TGCA-CC-TT-C-T-T-C---A--GAG-ACGGTGCTT-CGACC Ilex_dimorphophylla C--AAAGTAGAC-CCGGCGAACT-TGTT--A-AAA-ATATG--C--C-T-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-C--CAA-CGCACT----CC-CCC--AGCCC--CC-TCGGGG-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACGCGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-GTGT-CCCGTTCGCGGCGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG------CCACCA-A---CCC--CAATGCCCA--------G--CCGGA-TATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT---T---CA-C---G---AACGTGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT---C---TGACC-GCG-ACCC----TG-TGCACCC-TT-C-T-T-G---A--CGG-ATGGTGCTC-CGACC Ilex_dumosa_dumosa C--AAAGTAGA--CCGGCGAACTCTGTT----AAA-ACATG--C--TGG-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C--CCCC-C--CAATCACGCT--C-CC-CCC--A------CC-TCGGGA-TCTGG{CT}-TTGT-TTT-CC-CCCT-GGCGGGGAACTCGGCG-GA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTGTA-TGCGCCAAGGACCCATAAC-CGAA{AG}--AGCTGG-TCTCCCG-TTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-CTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A-C-CCC--AAAAAACGTCCT--A--G--GTGGA-CATTGTGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGTC--CA--CA-C---GT--CCCGTGAGCGGTTGG-CCC----------AAAAAA-ACGAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTTGCATCATGTCGTGAGGCG-CCTAGT?TGCAACGA?--CT--CC---GACCCTGTGCACCT----AGTTGTC-CG-CT-G-T-A-G---G--GCG-ACGGTGCTT-CGACC Ilex_dumosa_guaranina C--AAAGTAGA--CCGGCGAACTCTGTT----AAA-ACATG--C--TGG-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C--CCCC-C--CAATCACGCT--C-CC-CCC--A------CC-TCGGGA-TCTGGC-TGGT-TTT-CC-CCCT-GGCGGGGAACTCGGCC-GA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTGTA-TGCGCCAAGGACCCATAAC-CGAAG--AGCTGG-TCTCCCG-TTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-CTGCGTC-TTTTG----AATC---CAAAAC{CG}ACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTT?AACGCAAGTTGCGCCCAAAGCCAT?AGGCCAAGGGCACGTCT?CCTGGGCGTCACGCATCACGTCG------CC-CCA-A-C-CCC--AAAAAACGTCCT--A--G--GTGGA-CATTGTGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGTC--CA--CA-C---GT--CCCGTGAGCGGTTGG-CCC----------AAAAAA-A?GAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTCGCATCATGTCGTGAGGCG-CCTAGTCTGCAACGAT--CT--CC---GACCCTGTGCACCT----AGTTGTC-CG-CT-G-T-A-G---G--GCG-ACGGTGCTT-CGACC Ilex_glabra C-AAAAGTAGAC-CCGGCGAACC-TGTT---AAAA-ATATG--C--A-T-GGGGGTC-TGAGAA--AGGGTGCGCGAG----CCCC-C--CGA-CACATT----CC-CCC--A------CC-CCGGGA-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC---AAACGAA---CCCCCGGCGCTATC-TGCGCCAAGGAACCTTAAC-{CT}GAAG--AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG--A-AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGC-----CC-CCA-A-C-CCC--CAATGCCTGGCT--A--G--CTGGG-TATTGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT---C---CA-C---G---ACCGTGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT---C---AGACC-GGG-ACCCTG--TG-TGCA-CA-TT-C-T-T-T---AG-GGG-ATGGTGCTT-CGACC Ilex_integerrima C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAATATTTG--G--C-C-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-C--CGA-CACACT-C--CC-CCG--C------CC-CCGGGA-TTCGGC-TTG--CGT-TA-CCCT-A{AG}CGGGG-ACCCGGTC-GA-GCTCCCGTC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AAGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC-ACGGG-GGAGGCAT-TTGCGTC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGT??????????GTC{CG}-----CCC-CC{AGT}-A---CCC--CAAAGCCCGGTTACC-AG--CTGGA-CCTTGCGGGA---?CT----GGGG-CGGAAATTGGCCTCCCGT--CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC-----?AA---AAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGAAGACCTC-TTGCAT?TAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT---C---TGATC-GCG-ACCC----TG-TGCA-CCTTC-TTTATTA---G--GGG-ACGGTGCTT-TGACC Ilex_integra C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATATGC--C-T-GGGGGTT-TGAGAA--GGGGTGTGCGAG----CCCC-C--CAA-CAAAAT----TC-CCC--AGCCC--CCTTGGGGA-TTTGGC-TTG--CGT-TC-CCCT-AGGGGGG-ATTGGGCC-AA-GTTCCGGAA----AACGAA----CCCGGGCGCTTTT-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATTT-CCCGTCCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----------C------CCC--CAA--CCC------------C---A--ATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT---C---CA-C---G---AACGTGCGCGGTTGGCCCAA----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT---C---TGACC-GCG-ACCC----TG-TGCA-CC--TTC-T-T-C---A--CGG-ATGGTGCTT-CGACC Ilex_kiusiana C--AAAGTAGAC-CC{CT}GCGAACT-{CT}GTT----TAA-ATATGT-C--C-T-GGGGGTC-AGACAA--GGGGTGCGCGAG--C-CCCC-C--CAA-CACACT----CC-CCC--AGGCC--CC-TCGGGA-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----------C------CCC--CAA--CCC------------C---A--ATTGCGGGA---TT{CG}A---GGGG-CGGAAATTGGCCTCCCGT---A---CATCT--G---AACGTGCGCGGTTGGCCCCG----------AAAAA-ATG{AG}GTTCTTGAATAAGGACGTCACGACAAGTGTTGGTTGAAATACGCC-TTGAGTCATGTCTTGAGGCA-CCTAGTCTGTAACGAG--CT---C---TGACC-GCA-ACTC----TG-TGCAGCC-ATCC-T-T-C---A--TGG-ATCGTGCTT-CAACC Ilex_latifolia C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG--C--C-T-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-C--CAA-CACACT----CC-CCC--AGCCC--CC-TCGGGA-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACCA-A---CCC--CAATGCCCA--------G--CTGGA-TATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT---C---CA-T---G---AACGCGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGC{AG}TCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT---C---TGAC{CT}-GCG-ACCC----TG-TGCACCC-TTCC-T-T-C---A--CGG-ATGGTGCTT-CGACC Ilex_liukiuensis C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG--C--C-T-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-C--CAA-CACACT----CC-CCC--AGCGC--CC-TCGGGT-TTTGGC-TTG--CGT-TC-CCCT-AGTGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATC-TGCG----GGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATGT-CCGGTTCGCGGTGTGC-AG--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTTAATTGCAGAATCCCGTGAACCATCGAGTTTTTGATCGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACCA-A---CCC--CAATGCGCG--------G--CTGGA-TATTACGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT-------TA-T---G---AACGCGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGCCTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT---C---TGACT-GCG-ACCC----TG-TGCAACC-TTCC-T-T-C---A--CGT-ATGGTGCTC-CGACC Ilex_macropoda C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG--T--T-T-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C--CCCC-C--CGA-CACACT----CC-CCC--A------CC-TCGGGG-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACTCGGTC-AG-GCTCCCGAC----AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-ATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCTACCT--G--G--CTGGA-TATTGCAGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT---C---CA-C---G---ACTGTGTGTGGTTGG-CCC------AA---AAAAA-AAGAATTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-TCGAGTCTTTGGCGAG--CT---C---TGACC-GTG-ACCC----TG-TGCA--C-TT-C-T-T-T---C--GGG-ATGGTGCTT-CGACC Ilex_maximowicziana C--AAAGTAGAC-CCGGCGAACT-CGTT----AAA-ATATG--C--C-T-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-C--CAA-CACACT----CC-CCC--AGCCC--CC-TCGGGA-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCGG-GTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG------CCACCA-A---CCC--CGATGCCCA--------T--CTGGA-TATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT---T---CA-C---G---AACGTGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTACCGAG--CT---C---TGGCC-GCG-ACCC----TG-CGCACCC-TT-C-T-T-C---A--CGG-ATGGTGCTC-CGACC Ilex_mertensii C--AAAGTAGAC-CCGGCGAACT-CGTT----AAA-ATATATGG--C-T-GGGGGTC-TGGGAA--GGGGTGCGCGAG----CCCC-C--CAA-CACACT----CC-CCC--AGCCC--GC-TCGGGA-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACTCGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCACAAC-TGAAG--GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCAAC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACAATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----------C------CCC--CAA--CCC------------C---A--ATTGCGGGA---GTCG---GGGG-CGGAAATTGGCCTCCCGT---C---CA-C---G---AACGTGCACGGTTGGCCC-A----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT---C---TGACC-GTG-ACCC----TG-TGCA-CC--TCC-T-T-C---G--CGG-ATGGTGCTC-CGACC Ilex_micrococca C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG--CT-T-T-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-C--CGA-CACACT-C--CC-CCC--A------CC-TCGGGA-TTTGGC-TTG--{CT}GT-TC-CCCT-AGCGGGG-ACTCGGTC-AG-GCTCCCGAC----AACGAAC---CCCCGGCGCTATT-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-ACGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCC-A---CCC--CAATGCCTAGCT--G--G--CTGGA-TATTGCGGGA---GTT--GGGGGG-CGGAAATTGGCCTCCCGT---C---CA-C---G---ACCGTGCGCGGTTGG-CCC------AA---AAAAATAAGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCGAGTCTCTAGCGAG--CT---C---TGATC-GTG-ACCC----TG-CGCG-CC-TC-C-T-T-C---C--GGG-ATGGCGCTT-TGACC Ilex_microdonta C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAATATTTG--G--C-C-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-C--CGA-CACACT-C--CC-CCGC-C------CC-TCGGGA-TTTGGC-TTG--CGT-TC-CCCT-ACCGGGG-ACCCGGTC-GA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTCAAC-TGAAG--AGCTGGCCCCCCCG-ATGC-CCCGTTCGCGGTGTGC-ACGGGAGGAGGCAT-TTGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCATGTCG----C-CC-CCA-A---CCC--CAACGCCTGGCTACT-AG--CCGGA-CGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT--CC--ACA-C---G-ACACCGTGCGCGGTTGG-CCC------AA---AAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT---C---TGATC-GTG-ACCC----TG-TGCA-CC-TC-CTTATTA---G--GGG-ATGGTGCTT-CGACC Ilex_microdonta_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTTAA--AAATATTTG--G--C-C-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-C--CGA-CACACT-C--CC-CCG--C------CC-TCGGGA-TTTGGC-TTG--CGT-TC-CCCT-ACCGGGG-ACCCGGTC-GA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC-ACGGGAGGAGGCAT-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG----C-CC-CCA-A---CCC--CAACGCCCGGCTACT-GG--CTGGA-CGTTGCGGGG---GCT----GGGG-CGGAAATTGGCCTCCCGT--CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC------AA---AAAAA-ATGAGCTCCTGACGATGGACGTCGCGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT---C---TGATC-GTG-ACCC----TG-TGCA-CC-TC-CTTATTA---G--GGG-ATGGGGCTT-CGACC Ilex_mitis C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG--C--C-T-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-C--CGA-CACACT-C--CC-CCA--C------CT-CGGGAT-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACTCGGCC-AG-GCTCCCGAA----AACGAA--C-CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGG-CCCCCCG-ACGT-CCCGTTCGCGGTGTGC-AC-GG-GGAGGCAT-GTGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCTAGCT--A--G--CTGGA-TATTGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT---C---CA-C---G---ACCGTGCGCGGTTGG-CCC-AA---AA---AAAAA-AGGAGTTCTTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTA-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT---C---TGACC-GTG-ACCC----TG-CGCA-CC-TT-C-TTTAA---C--GGA-ATGGTGCTC-CGACC Ilex_mucronata C--AAAGTAGAC-CCAGCGAACT-TGTT----AAA-ACATG--C--T-T-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-C--CGA-CACACT----CC-CCC--A------CC-TCGGGA-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-ACC-CCC--CAATTCCTATGT--A--C--CTGGA-TATTGTGGGA---GAT----GGGG-CGGAAATTGGCCTCCCGT---A---CA-C---G---ACCGTGAGCGGTTGG-CCC-----------AAATA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAG--CT---C---TAACC-GTG-ACCC--TATA-TGCA-CC-TT-C-T-T-C---A--GCG-ATGGTGCTT-CGACC Ilex_mutchagara C--AAAGTAGA--CCGGCGAACT-TGTT----TAA-ACATG--C--G-G-GGGGG{GT}T-TGAAAA--AGGGTTCGCGAA-C--CCCC-C--CAATCACGCTC---CC-CCC--A------CC-TCGGGA-TCTGGC-TCGT-TTTCCC-CCCT-GGCGGGGAACTCGGCC-AA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACAATAAC-CGAAG--AGCTGG-TCTCCCG-GTGC-CCCGTCCGCGGCGTGC-AC--G-GGAGGCGC-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--C--CACCGGCCC--A--G--CCGGA-TACTGCGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGTC--CG--CG-C---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TCGCATCATGTCGTGGGGCG-CCTAGTCCGCAGCGAG--CT--CC---GACCCTGTG-CACC----TG--ATT-CG-CT-C-T-C-G---G--GCG-ACGGTGCTT-CGACC Ilex_opaca C--AAAGTAGA--CCGGCGAACT-TGTT----AAA-ACATG--C--T-G-GGGGGTT-TGAGAA--GGGGTGCGTGAG-C--CCCC-C--{GT}AA-CACACT----CC-CCC--A------CC-TCGGGATTTTGGC-TTG--CGT-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCG-TTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCGTCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCC-C-CACCC--CAATGCCCACCT--A--G--CTGGA-TATTGCGGGA---GTC----GGGG-CGGAAATTGGCCTCCCGTC--CG--CA-C---G---ATCGTGAGCGGTTGG-CCC----------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTGGCGAG--CT---C---TAACC-GTG-ACCC----TG-CGCA-CC-CT-C-T-T-C---A--GCG-ATGGTGCTT-CGACC Ilex_paraguariensis C--AACGTAGA-CCCGGCGAACT-TGTT----AAA-ATACG--C-TG-G-GGGGGTT-TGGGAA--GGGGTGCGCGAG-C--CCCC-C--CGAACACACTC---CC-CCG--C------CC-TCGGGA-CTGGGC-TTGTGTTCCCCTCCCTAGGGGGGGGACTCGGTC-GA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTGTC-TGTGCCAAGGAACCATAAC-CGAAG--AGCTGG-TCTCCCG-ATGT-CCCGTTCGCGGTGCGC-AC--G-GGAGGCAT-TTGCATCTTTTTGA---AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCC-A---ACC--C--CAA-TGCCC-----G--GATGT-TGCGGGGGAG---TTG----GGGG-CGGAAATTGGCCTCCCGTC--CA--CA-{CT}---G---ATCGTGAGCGGTTGG-CCC-----------AAAAA-GTGAGTTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCG-CCTAGTCTGTAGCGAGCTCTAACCGTGGACCCTGCG-CACC----TA--ATT-CG-TT-C-G-A-GAA-G-AGCG-ACGGTGCTT-CGACC Ilex_pedunculosa C--AAAGTAGAC-CCGGCGAACT-CGTT-A--AAATATATG--G--C-T-GGGGGTC-TGGGAA--GGGGTGCGCGAG---CCCCC-CA-ACA-CACTCC-C--CCAGCC--C------GC-TCGGGA-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACTCGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCACAAC-TGAAG--GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGC-AA-CG-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCAAGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCAAGCT--T--G--CTGGG-TATTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---C---CA-C---G---ACCGTGCGCGGTTGG-CCC-------A---TAAAA-ATGAGTTCCTGACGATTGACGTCACGACAAGTGGTGGTTGAAAGACCTC-A{CT}GCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT---C---TGATC-GTG-ACCC----TT-CGCA-CC-TT-C-TCTAA---T--GGG-ATGGTGCTTCCGACC Ilex_percoriacea C--AAAGTAGAC-CCGGCGAACT-CGTT----AAA-ATATATGG--C-T-GGGGGTC-TGGGAA--GGGGTGCGCGAG----CCCC-C--CAA-CACACT----CC-CCC--AGCCC--GC-TCGGGA-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACTCGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCACAAC-TGAAG--GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCAAC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----------C------CCC--CAA--CCC------------C---A--ATTGCGGGA---GTCG---GGGG-CGGAAATTGGCCTCCCGT---C---CA-C---G---AACGTGCACGGTTGGCCC-A----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT---C---TGACC-GTG-ACCC----TG-TGCA-CC--TCC-T-T-C---G--CGG-ATGGTGCTC-CGACC Ilex_pseudobuxus C--AAAGTAGAC-CCGGCGAACC-TGTT-A--AAATATTTG--G--C-C-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-C--CGA-CACACT-C--CC-CCGC-C------CC-TCGGGA-TTCGGC-TTG--CGT-TC-CCCT-GCCGGGG-ACCCGGTC-GA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCCG-ATGC-CCCGTTCGCGGTGTGC-ACGGGAGGAGGCAT-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGTTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG----C-CC-CCA-A---CCC--CAACGCCCGGCTA{CT}T-GG--CTGGA-CGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT--CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC------AA---AAAAA-ACGAGCTCCTGACGATGGACGTCCCGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTGGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT---C---TGATC-GTG-ACCC----TG-TGCA-CC-TC-CTTATTA---G--GGG-ACGGTGCTT-CGACC Ilex_rotunda C--AAAGTAGAC-CCGGCGAACT-CGTT----AAA-ATATG--C--G-T-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C--CCCC-C--CGA-CACATT----CC-CCC--A----CCCC-CCGGGA-CTTGGC-CCG--GGT-TC-CCCT-TGCGGGG-ACTCGGCC-AAGGCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-CGAAG--AGCTGG-CCCCCCG-{AG}TGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCGT-ACGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGC-----CC-CCA-A-C-CCCGACAATGCCCGGCT--G--GCAGCCGGATATTGCGGGA---GTT-G--CGGG-CGGAGATTGGCCTCCCGT---C---CA-C---G---ACCGTGCACGGTTGG-CCC-----------AAAAA-GCGAGTTCTTGACGACGGACGTCACGACGAGTGGTGGTTGGAAGACCTC-TTGCGTCGAGTCGTGAGGCACCCGAGTCTGTAACGAG--CT---C---TGACC-GCG-ACCC----TG-TGCG-CC-TT-C-C-T-T---AG-GGG-GCGGCGCTC-CGACC Ilex_rugosa C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG--C--C-T-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-C--CAA-CACACT----CC-CCC--A------CC-TCGGGA-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACTTGGTC-AA-GCTACCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCTG-TTGT-CCCGTCTGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACCA-A---CCC--CAATGCCTA--------G--CTGGA-TATTG{AC}GGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT---C---CA-C---G---AACGTGCGCGGTTGG-CCC--------AA-AAAAA-ATGAGTTCTTGACGATGGACGTCACGATAAGTGGTGGTTGAAAGACCTA-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT---C---TGACC-GTG-ACCC----TG-TGCA-CC-TT-C-T-T-C---A--TGG-ATGGTGCTT-CGACC Ilex_serrata C--AAAATAGAC-C{CT}GGCGAACT-TGTT----AAA-ATATG--C--T-T-GGGGGTT-TGAGAA--GGGGTGCGCGAG-T--CCCC-C--CGA-CACACT----CC-CCC--A-----CCC-CCGGGA-TTTGGC-TTG--CGT-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCTTAAC-CGAAG--AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCGT-ATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACACATCACGTCG------CC-CCA-A---CCC--CAATGCCTAGTT--G--G--TTAGG-CATTGTTGGA---GTT-G--GGGG-CGGAAATTGGCCTCCCGT---C---CA-C---G---ATTGTGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAACGAG--CT---C---TAACC-GTG-ACCC----TG-TGCA-CC-TT-C-T-T-T---AG-GGG-ATGGTGCTC-CGACC Ilex_taubertiana C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAATATTTG--G--C-C-GGGGGTT-TGAGAA-GGGGGTGCGCGAG---CCCCC-C--C{AG}A-CACA{CT}T-C--CC-CCG--C------CC-TGGGAT-TTGGGT-TTG--CGT-TC-CCCT-ACCGGGG-ACCCGGT{CG}-GA-GCTCCCG{AC}C----ACCAA{AC}----CCCCGGCGCTGTT-TGCGCCAAGGAACCTTAAC-TGAA?--A?CTGGCCCCCCCG-ATGT-CCCGTTC?CGGTGTGC-AC-GG-GGAGGCAT-TTGCGTC-TTTTG----AATT---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGT{CT}TGCCTGGGCGTCACGCATCACGT{CT}G------CC-CCA-A---CCC--CAATGCCCGGCTACT-A{AG}--CTGGA-CGTT{CT}CGGGA---{AG}CT----GGGG-CGGAAATTGGCCTCCCGT--CC--ACA-C---G---ACCGTGGGCGGTTGG-CCC---AAAAA---AAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGGCCTC-TTGCGTCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT---T---TGATC-GTG-ACCC----TG-TGCG-CC-TC-CTTATTA---G--GGG-ACGGTGCTT-CGACC Ilex_theezans C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAATATTTG--G--C-CGGGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-C--CGA-CACA{CT}T-C--CC-CCG--C------CC-CCGGGA-TTTGG{CGT}-TTG--{CG}GT-TC-CCCT-AGCGGGG-ACCCGGCC-GA-GCTCCCGAC----AACGAA----CCCCGG{CG}G{CG}TGTC-TGCGCCAAGGAACCTTAAC-TGAA{AG}A-AGCT{AG}G-CCCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCTGGCTACC-AG--C{CT}GGA-CGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT--CC--ACA-C---G---{AG}CCGTG{CGT}GCGGTTGG-CCC------AA---AAAAA-ATGAGCTCTCACCGATGGG{CG}GTCACG{AG}CAAGTGGTGGTTGAAAGGCCTC-TAGCATCTAGTCGTGAGGC{AT}-CCGAGTTTACAGCGAG--CT---C---TGATC-GTG-ACCC----TG-TGCA-CC-TT-CTTATTA--GG--GGG-A{CT}GGTGCTT-TGACC Ilex_theezans_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAATATTTG--G--C-C-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-C--CGA-CACACT-C--CC-CCG--C------CC-CCGGGA-TTCGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACCCGGTC-GA-GCTCCCGTC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAA?-TGAAG-AAGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGGGTGC-ACGGG-GGAGGCAT-TTGCGTC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCCGGCTACC-AG--CTGGA-CGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT--CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC-----AAA---AAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAATCTGTAGCGAG--CT---C---TGATC-GTG-ACCC----TG-TGCA-CCTTC-TTTATTA---G--GGG-ACGGTGCTT-TGACC Ilex_vomitoria C--AAAGTAGA--CCGGCGAACT-TGTT----AAA-ATATG--C--T-G-GGGGTTTGAGAAAAG-GGGGTGCGCGAGCC--CCCC-C--CAA-CACACT----CC-CCC--A------CC-TCGGGA-TTTGGC-TTG--TGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC--A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC-AC--G-GGGGGTAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCTA--------G--CTGGA-TATCGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT---T---CG-C---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAG--CT---C---TAACC-GTG-ACCC----TG-TGCA-CC-TT-C-T-T-C---A--GAG-ACGGTGCTT-CGACC Ilex_warburgii C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG--C--C-T-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-C--CAA-CACACT----CC-CCC--AGCGC--CC-TCGGGA-TTTGGC-TTG--CGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACCA-A---CCC--CAATGCCCG--------G--CTGGA-TATTACGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT-C-C-A-TA-T---G---AACGCGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT---C---TGACT-GCG-ACCC----TG-TGCACCC-TTCC-T-T-C---A--CGG-ATGGTGCTC-CGACC Ilex_yunnanensis C--AAAGTAGAC-CCAGCGAACT-TGTT----AAA-ATATG--C--C-C-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-C--CGA-CACAAT-C--CC-CCA--C------CC-CCGGGA-TCTGGC-TTG--CGT-TC-CCAT-AGCGGGG-ACTGGGTC-AG-GCTCCCGGC----AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAATCTTAAC-TGAAG--AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-ATGCATC-TTTTG---AAATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCTAGCT--A--G--CTGGA-TATTGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT---C---CA-C---G---ACCGTGCGCGGTTGG-CCC------AA---AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT---C---TGACC-GTG-ACCC----TG-CGCA-CC-TT-C-TCT-A---T--GGG-ATGGTGCTT-CGACC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_411) = N: 1-749; CODONPOSSET CodonPositions (CHARACTERS = ITS_411) = N: 1-749; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2483] TITLE ITS_241; LINK TAXA = Taxa1; DIMENSIONS NCHAR=822; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Helwingia_chinensis C--AAAATAGAC-CC-GCGAACA-TGTT-----------CA--T-C---CA-TC---GGGGG-TTG-GC-G--A--GGGGTGCGCGAG----CCCCC-AAT-C-CAC---CCCC-T---------CT-C--C--GGCGA-TGCT---GC-TT-TGAA---T-TGT--CGCCA-ATGC-GGTGGCATCCATTGTT-GT-G-TCGACTGAAC---AACGAA---CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG-AGCCAG-TCT-TCGAAAGC-CCCGTACGCGGTGCGC--TT----G-GGAGG{CT}GTT-GGCGTC-TTTAA---AATCATCATAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCGC--------CC-C-CAA------CC--C-----AC------TCC------------A--CACACGA-ATTGC--GGTGTTGCTTTG---G---GG-G-CGGAGATTGGCCTCCCAT--A--CAAAA-TA---A---GCT-TGCGTGGTTGG-CCT-----------A-AA-A-G-CGAGTGCTCGG-G--GATGGGTC-TCACGATAAGTGGTGGTTAAATATG-C-CTC-TTGCGT-AT-TATCGCGA-G-A--CAA--CC-CA-T---CTCCGGCGTGT-G-CTC--TTT-GAGA--C-C-----------C-------C--A------AT--G-ACGATGCTT-CGATT Helwingia_japonica C--AAAATAGAC-CC-GCGAACA-TGTT-----------CA--T-C---CA-TC----GGGG-TTG-GC-G--A--GGGGTGCGCGAG----CCCCC-AAT-C-CAC---CCCC-T---------CT-C--C--GGCGA-TGCT---GC-TT-TGAA---T-TGT--CGCCA-ATGC-GGTGGCATCCATTGTT-GT-G-TCGACTGAAC---AACGAA---CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG-AGCCAG-TCT-TCGAAAGC-CCCGTACGCGGTGCGC--TT----G-GGAGGCGTT-GGCGTC-TTTAA---AATCATCATAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCGC--------CC-C-CAA------CC--C-----AC------TCC------------A--CACACGG-ATTGC--GGTGTTGCTTTG---G---GG-G-CGGAGATTGGCCTCCCAT--A--CAAAA-TA---A---GCT-TGCGTGGTTGG-CCT-----------A-AA-A-G-CGAGTGCTCGG-G--GATGGGTC-TCACGATAAGTGGTGGTTAAATATG-C-CTC-TTGCGT-AT-TATCGCGA-G-A--CAA--CC-CA-T---CTCCGGCGTGT-G-CTC--TTT-GAGA--C-C-----------C-------C--A------AT--G-ACGATGCTT-CGATT Ilex_amelanchier C--AAAGTAGAC-CCGGTGAACT-TGTT-----AAA--ACA--T-G---C--C--C-GGGGGTTTGAG--A--A--GGGGTGCGCGAG--CCCCCCC-GA--CACACT--CCCC-CA--------CC-T--C--GG-GA-T-TT--GGC-TTGTG-----T-T-C-CC-CT--A-GC-GG-GG-ACTCG--GTC-AA-GCTC--CCA-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTTG---------CC-C-CAA----CCCC--C----AATT-----CCTATA-T-------A-GT-TG-GATATTGT--GT-A-AG--TT----G---GG-GCCGGAAATTGGCCTCCCGT--C--C---A-C----G---ACCGTGAGCGGTTGG-CCC-----------A-AA-A-AATGAGT-TCTTG-A-CGATGGA-CGTCACGACAAGGGGTGGTTGAA-A-GAC-CTC-TTGCATCA--TGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAAC-CGT-GACCCTATAT-G-CG--C-C--------TT-C---T-T-C--A------GT--G-ATGGTGCTT-CGACC Ilex_anomala C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATA--T-G---CA-T-----GGGGTTTGAG--A--A--GGGGTGCGCGAG---CCCCCC-AA--CACACT--CCCC-CA--------CC-T--C--GG-GA-T-TT--GGC-TTGTG-----T-T-C-AC-CT--A-GT-GG-AG-ACTCG--GTCAAA-GGTC--CCG-AC---AACGAA---CCCCGGCGC-TATATGTGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC-T-ATAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CCC--C----AA---------T------------G--C-TG-GATATTAC--GG-G-AG--TTG---G---GG-G-CGGAAATTGGCCTCCCGT--A--C---A-C----G---GCTGTGCGCGGTTGG-CCC-----------A-AA-A-ATTGAGC-TCTGG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATCA--AGTTGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-TGT-GACCC--TGT-G-CA--C-C--------TT-C---T-T-T--A------G--GGAATGGTGCTT-CGACT Ilex_argentina C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATTTGG---G--C----GGGGGTTTGAG--A--A--GGGGTGCGCGAG--CCCCCCC-GA--CACACT--CTCC-CA--------CC-C-AC--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GT-GG-GG-ACCCG--GTC-GA-CCTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTAG-CCCCCTG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCGTC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCA---------CC-C-CAA-----CCC--C----AATG-----CCTG-GCT-ACCA--G--C-TG-GACGTTGC--GG-G-AG--CT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C--ACG---ACCGTGTGCGGTTGG-CCC-----------AAAA-A-AATGAGC-TCTTG-A-CGATGGA-CGTCACCACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC--TAGTCGTGAGGCA-CCGAGTCTATAGCGAGCTCTGAT-CGT-GACCC--TGT-G-CA--C-C--------TT-C--TTAT-T--A------G-GGG-ATGGTGCTT-TGACC Ilex_argentina_Gbk C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ACA--T-G---C--T--G-GGGGGTTTGAG--A--A--GGGGTGCGTGAG--CCCCCCC-AA--CACACT-CCCCC-CA--------CC-T--C--GG-GA-T-TTC-GGC-TTGCG-----T-C-C-CC-CT--A-GC-GG-GG-ACTCG--GTC-AA-GCTC--CCG-ACAA-AACGAA-C-CCCCGGCGC-TATCTGCGCCAAGGAACCACAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATCATGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--CCCC---CC-CTCCA-----CCC--C----AATG-CCCACCTA-G------------C-TG-GATATTGT--GG-G-AG--TC----G-TCGGCG-CGGAAATTGGTCTCCCGT-CC-GC---A-C----G---ATCGGGAGCGGTTGG-CCC----------AA-AA-A-AATGAGC-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATCA--CGTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAAC-CGT-GACCC--TGC-G-CA--C-C--------TT-C---T-T-C--A------GC--G-ATGGTGCTT-CGACC Ilex_beecheyi C--AAAGTAGAC-CCGGCGAACT-CGTTA----AAAT-ATA--T-GG--C--T----GGGGGTCTGGG--A--A--GGGGTGCGCGAG---CCCCCC-AA--CACACT--CCCC-CA-GCC---CGC-T--C--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACTTG--GCC-AA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCACAAC-TGAA--GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCA-AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C-------CCC--C----AA-------CCC---------------C-----A-ATTGC--GG-G-AG--TCG---G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C----G---AACGTGCACGGTTGG-CCC--A--------A-AA-A-AATGAGT-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTCA--TGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-CGT-GACCC--TGT-G-CA--C-C--------TC-C---T-T-C--G-------C-GG-ATGGTGCTC-CGACC Ilex_brasiliensis C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATTTGG---C--C---GGGGGGTTTGAG--A--A--GGGGTGCGCGAG--CCCCCCC-GA--CACACT--CCCC-CG-------CCC-C--C--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACCCG--GCC-TA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAGAAGCTAGCCCCCCC--GTGT-CCCGTTCGCGGCGTGC--AC----G-GGAGGCATT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CCC--C----AATG-----CCTG-GCT-ACCA--G--C-CG-GACGTTGC--GG-G-AG--TT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C--ACG---ACCGTGTGCGGTTGG-CCC--------A--AAAA-A-AATGAGC-TCTC--ACCGATGGG-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC--TAGTCGTGAGGCA-CCGAGTCTACAGCGAGCTCTGAT-CGT-GACCC--TGC-G-CA--C-C--------TT-C--TTAT-T--A-----GG-GGG-ATGGTGCTT-TGACC Ilex_brevicuspis C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATTTGG---C--C----GGGGGTTTGAG--A--A-GGGGGTGCGCGAG--CCCCCCC-GA--CACACT--CCCC-CG-------CCC-C-TC--GG-GA-T-TT--GGC-TTACG-----T-T-C-CC-CT--A-CT-GG-GG-ACCCG--GTC-GA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCGTC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CCC--C----AATG-----CCTG-GCT-ACTA--G--C-TG-GACGTTGC--GG-G-AG--CT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C--ACG---ACCGTGCGCGGTTGG-CCC-------AA--AAAA-A-AATGAGC-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GGC-CTC-TTGCATC--TAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGAT-CGT-GACCC--TGT-G-CA--C-C--------TC-C--TTAT-T--A------G-GGT-ATGGTGCTT-CGACC Ilex_buergeri CA-AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATA--T-GC--C--T----GGGGGTTTGAA--A--A--GGGGTGCGCGAG---CCCCCC-AA--CACACT--CCCC-CA-GCC---CCC-T--C--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACTCG--GTC-AA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TATTTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA-----CCC--C----AATG-----CCCA-----------G--C-TG-GATATTGC--GG-G-AG--TTG---G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-T----G---AACGCGCGCGGTTGG-CCC-----------A-AA-A-AATGAGT-TCTTG-A-CGATGGA-CGTCACGGCAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTCA--TGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-CGC-GACCC--TGT-G-CA-CC-C--------TTCC---T-T-C--A-------C-GG-ATGGTGCTC-CGACC Ilex_canariensis C--AAAGTAGAC-CCGGCGAACC-CGTT-----AAA--ACA--T-G---C-CT----GGGGGTTTGAG--A--A--GGGGCGCGCAAG---CCCCCC-GA--CGCACT--CCCC-CA------CCCC-C--C-GGG-GG-T-TT--GGC-TTGGG-----T-T-C-CC-CT--A-GC-GG-GG-ACCCG--GTC-AG-GCTC--CCG-GC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-AGAAG-AGCTGG-CCCCCCG-GTGTCCCCGTTCGCGGTGTGC--AC-T--G-GGAGGCATT-TGCGTC-TTTCG---AATC----TGAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGCTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCAAGGGCACGTCTGCCTGGGCGTCACCCATCACGTCG------C--CC-C-CAA-----CCC--C----AATG-----CCTG-GCT----A--G--C-CG-GGTATCGC--GG-G-AG--TT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C--AGG---ACCGTGCGCGGTTGG-CCC----A---A--AAAACA-AATGAGT-TCCTG-A-CGATGGG-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTCA-T-GTCGTGGGGCA-CCGAGTCTATGGCGAGCTCCGAC-CGG-GACCC--TGC-G-CA--CAC--------TC-C---T-C-C--G------G-GGG-ATGGTGCTC-CGACC Ilex_cassine C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ACA--T-G---C--T--G-GGGGGTTTGAG--A--A--GGGGTGCGTGAG--CCCCCCC-AA--CACACT-CCCCC-CA--------CC-T--C--GG-GA-T-TTC-GGC-TTGCG-----T-C-C-CC-CT--A-GC-GG-GG-ACTCG--GTC-AA-GCTC--CCG-ACAA-AACGAA-C-CCCCGGCGC-TATCTGCGCCAAGGAACCACAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATCATGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--CCCC---CC-CTCCA-----CCC--C----AATG-CCCACCTA-G------------C-TG-GATATTGT--GG-G-AG--TC----G-TCGGGG-CGGAAATTGGCCTCCCGT-CC-GC---A-C----G---ATCGTGAGCGGTTGG-CCC----------AA-AA-A-AATGAGC-TCCTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATCA--CGTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAAC-CGT-GACCC--TGC-G-CA--C-C--------CT-C---T-T-C--A------GC--G-ATGGTGCTT-CGACC Ilex_collina C--AAAGTAGA--CCCGCGAACT-TGTT-----AAA--ATA--T-G---C--T----GGGGGTTTGAG--GTTAG-GGGGTGCGCGAG--CCCCCCC-AA--CACACT--CCCC-CA--------CC-T--C--GG-GA-T-TT--GGCTTTGTG-----T-T-C-CC-CT--A-GT-GG-GG-ACTCG--GTC-AG-GCTC--CCG-AC-A-AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAATCATAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC--AC----G-GGGGGCATT-TGCATC-TTTTG---AATC----TAAAA{CT}GACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CCC--C----AATG-----CCTA-G------------T-TG-GATATTGT--GG-G-AG--TT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-T----G---ACCGTGAGCGGTTGG-CCC-----------A-AA-A-AATGAGT-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATCA--TGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAAT-CGT-GACCC--TG{CT}-G-CA--C-C--------TT-C---T-T-C--A------AC--G-ACGGTGCTT-CGACC Ilex_cornuta C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA--ATA--T-GC--C--T----GGGGGTTTGAG--A--A--GGGGTGCGCGAG---CCCCCC-AA--CACACT--CCCC-CA-GCC---CCC-T--C--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACGCG--GCC-AA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-GTGT-CCCGTTCGCGGCGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG---------CCAC-CAA-----CCC--C----AATG-----CCCA-----------G--C-CG-GATATTGC--GG-G-AG--TTG---G---GG-G-CGGAAATTGGCCTCC?GT--T--?---A-C----G---AACGTGCGCGGTTGG-CCC-----------A-AA-A-AATGAGT-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTCA--TGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-CGC-GACCC--TGT-G-CA-CC-C--------TT-C---T-T-C--A-------C-GG-ATGGTGCTC-CGACC Ilex_crenata C--AAAGTA{AC}A--CCGGCGAACT-TGTT-----AAA--ACA--T-G---C----CG-GGGGGTTTGAG--A--A--GGGGTGCGCGAG--CCCCCCC-AA-T-AAGGT-TCCCC-CA--------CC-T--C--CG-GA-T-TT--GGC-TTGT---TT-T-C-C-CC-CT--G-GCGGG-GA-ACTCG--GCC-CA-GCTC--CCG-AC-A-AACGAA---CCCCGGCGC-TGTTTGCGCCAAGGAACCATAAC-CGAAG-AGCTGG-TCTCCCG-GTGC-CCCGTCCGCGGTGTGC--AC----G-GGAGGCGTT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-C---CCC--C---CAACGG----CCTA-G----------C-C--G-GATATTGC--GG-G-AG--TT----G---GG-G-CGGAGATTGGCCTCCCGT-CC-GC---G-C----G---ACCGTGAGCGGTTGG-CCC-----------A-AA-A-AACGAGT-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TCGCATCA--CGTCGTGGGGCG-CCTAGTCTGTAGCGA--GCT--C-C---GACCC--TGT-G-CA--C-C-T-G--A-TT-CG--C-TCT--AG--G--GC--G-A-GGTGCTT-CGACC Ilex_decidua C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ATA--T-G---C--T----GGGGGTTTGAG--AAAAG-GGGGTGCGCGAG--CCCCCCC-AA--CACACT--CCCC-CA--------CC-T--C--GG-GA-T-TT--GGCTTTGTG-----T-T-C-CC-CT--A-GC-GG-GG-ACTCG--GTC-AA-GCTC--CCG-AC-A-AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC--AC----G-GGGGGTATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CCC--C----AATG-----CCTA-G------------C-TG-GATATCGT--GG-G-AG--TT----G---GG-G-CGGAAATTGGCCTCCCGT--T--C---G-C----G---ACCGTGAGCGGTTGG-CCC-----------A-AA-A-AATGAGT-TCCTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATCA--TGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAAC-CGT-GACCC--TGT-G-CA--C-C--------TT-C---T-T-C--A---G--A---G-ACGGTGCTT-CGACC Ilex_dimorphophylla C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA--ATA--T-GC--C--T----GGGGGTTTGAG--A--A--GGGGTGCGCGAG---CCCCCC-AA--CGCACT--CCCC-CA-GCC---CCC-T--C--GG-GG-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACGCG--GCC-AA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-GTGT-CCCGTTCGCGGCGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG---------CCAC-CAA-----CCC--C----AATG-----CCCA-----------G--C-CG-GATATTGC--GG-G-AG--TTG---G---GG-G-CGGAAATTGGCCTCCCGT--T--C---A-C----G---AACGTGCGCGGTTGG-CCC-----------A-AA-A-AATGAGT-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTCA--TGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-CGC-GACCC--TGT-G-CA-CC-C--------TT-C---T-T-G--A-------C-GG-ATGGTGCTC-CGACC Ilex_dumosa_dumosa C--AAAGTAGA--CCGGCGAACTCTGTT-----AAA--ACA--T-G---C--T-GG-GGGGGTTTGAG--A--A--GGGGTGCGCGAG--CCCCCCC-AA-TCACGCT-CCCCC-CA--------CC-T--C--GG-GA-T-CT--GG{CT}-TTGT---TT-T-C-C-CC-CT--G-GCGGG-GA-ACTCG--GCG-GA-GCTC--CCG-AC-A-AACGAA---CCCCGGCGC-TGTATGCGCCAAGGACCCATAAC-CGAA{AG}-AGCTGG-TCTCCCG-TTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATC-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CCC--CAAAAAACGT----CCTA-G----------G-T--G-GACATTGT--GG-G-AG--TT----G---GG-G-CGGAGATTGGCCTCCCGT-CC-AC---A-C----GT--CCCGTGAGCGGTTGG-CCC---------A-A-AA-A-AACGAGT-TCTTG-A-CGACGGA-CGTCACGGCAAGTGGTGGTTGAA-A-GAC-CTCTTTGCATCA--TGTCGTGAGGCG-CCTAGT?TGCAACGA--?CT--C-C---GACCC--TGT-G-CA--C-C-TAGTTG-TC-CG--C-TGT--AG--G--GC--G-ACGGTGCTT-CGACC Ilex_dumosa_guaranina C--AAAGTAGA--CCGGCGAACTCTGTT-----AAA--ACA--T-G---C--T-GG-GGGGGTTTGAG--A--A--GGGGTGCGCGAG--CCCCCCC-AA-TCACGCT-CCCCC-CA--------CC-T--C--GG-GA-T-CT--GGC-TGGT---TT-T-C-C-CC-CT--G-GCGGG-GA-ACTCG--GCC-GA-GCTC--CCG-AC-A-AACGAA---CCCCGGCGC-TGTATGCGCCAAGGACCCATAAC-CGAAG-AGCTGG-TCTCCCG-TTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATC-TGCGTC-TTTTG---AATC----CAAAAC{CG}ACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTT?AACGCAAGTTGCGCCCAAAGCCAT?AGGCCAAGGGCACGTCT?CCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CCC--CAAAAAACGT----CCTA-G----------G-T--G-GACATTGT--GG-G-AG--TT----G---GG-G-CGGAGATTGGCCTCCCGT-CC-AC---A-C----GT--CCCGTGAGCGGTTGG-CCC---------A-A-AA-A-AA?GAGT-TCTTG-A-CGACGGA-CGTCACGGCAAGTGGTGGTTGAA-A-GAC-CTCTTCGCATCA--TGTCGTGAGGCG-CCTAGTCTGCAACGA--TCT--C-C---GACCC--TGT-G-CA--C-C-TAGTTG-TC-CG--C-TGT--AG--G--GC--G-ACGGTGCTT-CGACC Ilex_glabra C-AAAAGTAGAC-CCGGCGAACC-TGTT---A-AAA--ATA--T-G---C-AT----GGGGGTCTGAG--A--A--AGGGTGCGCGAG---CCCCCC-GA--CACATT--CCCC-CA--------CC-C--C--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACTCG--GTC-AA-GCTC--CCG-AC--AAACGAA--CCCCCGGCGC-TATCTGCGCCAAGGAACCTTAAC-{CT}GAAG-AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG-A-AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------C--CC-C-CAA--C--CCC--C----AATG-----CCTG-GCT----A--G--C-TG-GGTATTGC--GG-G-AG--TT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C----G---ACCGTGCGCGGTTGG-CCC------------AAA-A-AATGAGT-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATCA-T-GTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCAGAC-CGG-GACCC--TGT-G-TG--CAC-------ATT-C---T-T-T--A------G-GGG-ATGGTGCTT-CGACC Ilex_integerrima C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATTTGG---C--C----GGGGGTTTGAG--A--A--GGGGTGCGCGAG--CCCCCCC-GA--CACACT--CCCC-CG-------CCC-C--C--GG-GA-T-TC--GGC-TTGCG-----T-T-A-CC-CT--A-{AG}C-GG-GG-ACCCG--GTC-GA-GCTC--CCG-TC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAGAAGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC--GGG-GGAGGCATT-TGCGTC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGT??????????GTC{CG}--------CCC-C-C{AGT}A-----CCC--C----AAAG-----CCCG-GTT-ACCA--G--C-TG-GACCTTGC--GG-G-A?--CT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C--ACG---ACCGTGCGCGGTTGG-CCC-------?A--AAAA-A-AATGAGC-TCCTG-A-CGATGGG-CGTCACGACAAGTGGTGGTTGGA-A-GAC-CTC-TTGCAT?--TAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGAT-CGC-GACCC--TGT-G-CA--C-C--------TT-C-TTTAT-T--A------G-GGG-ACGGTGCTT-TGACC Ilex_integra C--AAAGTAGAC-CCGGCGAACT-TGTTA----AAAT-ATA--T-GC--C--T----GGGGGTTTGAG--A--A--GGGGTGTGCGAG---CCCCCC-AA--CAAAAT--TCCC-CA-GCC---CCC-T--TG-GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GG-GG-GG-ATTGG--GCC-AA-GTTC--CGG-AA---AACGAA---CCCGGGCGC-TTTTTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATTT-CCCGTCCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C-------CCC--C----AA-------CCC---------------C-----A-ATTGC--GG-G-AG--TTG---G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C----G---AACGTGCGCGGTTGG-CCCA-A--------A-AA-A-AATGAGT-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTCA--TGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-CGC-GACCC--TGT-G-CA--C-C--------TT-C---T-T-C--A-------C-GG-ATGGTGCTT-CGACC Ilex_kiusiana C--AAAGTAGAC-CC{CT}GCGAACT-{CT}GTTT----AAAT-ATG--T--C--C--T----GGGGGTC-AGA-CA--A--GGGGTGCGCGAGC--CCCCCC-AA--CACACT--CCCC-CAGGCC---C-C-T--C--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACTCG--GTC-AA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TATTTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGCA-G-----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C-------CCC--C----AA-------CCC---------------C-----A-ATTGC--GG-G-AT--T{CG}A---G---GG-G-CGGAAATTGGCCTCCCGT--A--C---ATC-T--G---AACGTGCGCGGTTGGCCCC--G--------A-AA-A-AATG{AG}GT-TCTTGAA-TAA-GGA-CGTCACGACAAGTGTTGGTTGAA-A-TACGC-C-TTGAGTCA--TGTCTTGAGGCA-CCTAGTCTGTAACGAGCTCTGAC-CGC-AACTC--TGT-G-CAG-C-CA-------TC-C---T-T-C--A-------T-GG-ATCGTGCTT-CAACC Ilex_latifolia C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATA--T-GC--C--T----GGGGGTTTGAG--A--A--GGGGTGCGCGAG---CCCCCC-AA--CACACT--CCCC-CA-GCC---CCC-T--C--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACTCG--GTC-AA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA-----CCC--C----AATG-----CCCA-----------G--C-TG-GATATTGC--GG-G-AG--TTG---G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-T----G---AACGCGCGCGGTTGG-CCC-----------A-AA-A-AATGAGT-TCTTG-A-CGATGGA-CGTCACGGCAAGTGGTGGTTGAA-A-GAC-CTC-TTGC{AG}TCA--TGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-{CT}GC-GACCC--TGT-G-CA-CC-C--------TTCC---T-T-C--A-------C-GG-ATGGTGCTT-CGACC Ilex_liukiuensis C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATA--T-GC--C--T----GGGGGTTTGAG--A--A--GGGGTGCGCGAG---CCCCCC-AA--CACACT--CCCC-CA-GCG---CCC-T--C--GG-GT-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GT-GG-GG-ACTCG--GTC-AA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TATCTGCG----GGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATGT-CCGGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTTAATTGCAGAATCCCGTGAACCATCGAGTTTTTGATCGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA-----CCC--C----AATG-----CGCG-----------G--C-TG-GATATTAC--GG-G-AG--TTG---G---GG-G-CGGAAATTGGCCTCCCGT-----T---A-T----G---AACGCGCGCGGTTGG-CCC-----------A-AA-A-AATGAGT-TCTTG-A-CGATGGA-CGTCACGGCAAGTGGTGGTTGAA-A-GAC-CTC-TTGCCTCA--TGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-TGC-GACCC--TGT-G-CA-AC-C--------TTCC---T-T-C--A-------C-GT-ATGGTGCTC-CGACC Ilex_macropoda C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATA--T-G--TT--T----GGGGGTTTGAG--A--A--GGGGTGCGCGAG--CCCCCCC-GA--CACACT--CCCC-CA--------CC-T--C--GG-GG-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACTCG--GTC-AG-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TATTTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATA-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CCC--C----AATG-----CCTA-CCT----G--G--C-TG-GATATTGC--AG-G-AG--TT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C----G---ACTGTGTGTGGTTGG-CCC---A----A--AAAA-A-AA-GAAT-TCCTG-A-CGACGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATCA--TGTCGTGAGGCA-TCGAGTCTTTGGCGAGCTCTGAC-CGT-GACCC--TGT-G-CA----C--------TT-C---T-T-T---------C-GGG-ATGGTGCTT-CGACC Ilex_maximowicziana C--AAAGTAGAC-CCGGCGAACT-CGTT-----AAA--ATA--T-GC--C--T----GGGGGTTTGAG--A--A--GGGGTGCGCGAG---CCCCCC-AA--CACACT--CCCC-CA-GCC---CCC-T--C--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACTCG--GTC-AA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCGG-GTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG---------CCAC-CAA-----CCC--C----GATG-----CCCA-----------T--C-TG-GATATTGC--GG-G-AG--TTG---G---GG-G-CGGAAATTGGCCTCCCGT--T--C---A-C----G---AACGTGCGCGGTTGG-CCC-----------A-AA-A-AATGAGT-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTCA--TGTCGTGAGGCA-CCAAGTCTGTACCGAGCTCTGGC-CGC-GACCC--TGC-G-CA-CC-C--------TT-C---T-T-C--A-------C-GG-ATGGTGCTC-CGACC Ilex_mertensii C--AAAGTAGAC-CCGGCGAACT-CGTTA----AAAT-ATA--T-GG--C--T----GGGGGTCTGGG--A--A--GGGGTGCGCGAG---CCCCCC-AA--CACACT--CCCC-CA-GCC---CGC-T--C--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACTCG--GCC-AA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TGTTTGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCA-AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACAATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C-------CCC--C----AA-------CCC---------------C-----A-ATTGC--GG-G-AG--TCG---G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C----G---AACGTGCACGGTTGG-CCC--A--------A-AA-A-AATGAGT-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTCA--TGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-CGT-GACCC--TGT-G-CA--C-C--------TC-C---T-T-C--G-------C-GG-ATGGTGCTC-CGACC Ilex_micrococca C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATA--T-G-CTT--T----GGGGGTTTGAG--A--A--GGGGTGCGCGAG---CCCCCC-GA--CACACTC-CCCC-CA--------CC-T--C--GG-GA-T-TT--GGC-TTG{CT}G-----T-T-C-CC-CT--A-GC-GG-GG-ACTCG--GTC-AG-GCTC--CCG-AC---AACGAAC--CCCCGGCGC-TATTTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATA-CGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CCA-----CCC--C----AATG-----CCTA-GCT----G--G--C-TG-GATATTGC--GG-G-AG--TT-GG-G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C----G---ACCGTGCGCGGTTGG-CCC---A----A--AAAA-ATAA-GAGT-TCCTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATCA--TGTCGTGAGGCA-CCGAGTCTCTAGCGAGCTCTGAT-CGT-GACCC--TGC-G-CG--C-C--------TC-C---T-T-C---------C-GGG-ATGGCGCTT-TGACC Ilex_microdonta C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATTTGG---C--C----GGGGGTTTGAG--A--A--GGGGTGCGCGAG--CCCCCCC-GA--CACACT--CCCC-CG-------CCC-C-TC--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-CC-GG-GG-ACCCG--GTC-GA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTCAAC-TGAAG-AGCTGGCCCCCCCG-ATGC-CCCGTTCGCGGTGTGC--AC--GGGAGGAGGCATT-TGCGTC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCATGTCG-------C-CC-C-CAA-----CCC--C----AACG-----CCTG-GCT-ACTA--G--C-CG-GACGTTGC--GG-G-AG--CT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C--ACG-ACACCGTGCGCGGTTGG-CCC--------A--AAAA-A-AATGAGC-TCCTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC--TAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGAT-CGT-GACCC--TGT-G-CA--C-C--------TC-C--TTAT-T--A------G-GGG-ATGGTGCTT-CGACC Ilex_microdonta_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT----AAAA--ATATTTGG---C--C----GGGGGTTTGAG--A--A--GGGGTGCGCGAG--CCCCCCC-GA--CACACT--CCCC-CG--------CC-C-TC--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-CC-GG-GG-ACCCG--GTC-GA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC--GGGAGGAGGCATT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-------C-CC-C-CAA-----CCC--C----AACG-----CCCG-GCT-ACTG--G--C-TG-GACGTTGC--GG-G-GG--CT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C--ACG---ACCGTGCGCGGTTGG-CCC--------A--AAAA-A-AATGAGC-TCCTG-A-CGATGGA-CGTCGCGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC--TAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGAT-CGT-GACCC--TGT-G-CA--C-C--------TC-C--TTAT-T--A------G-GGG-ATGGGGCTT-CGACC Ilex_mitis C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATA--T-G--CC--T----GGGGGTTTGAG--A--A--GGGGTGCGCGAG--CCCCCCC-GA--CACACT--CCCC-CA--------CC-T--C--GG-GATT-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACTCG--GCC-AG-GCTC--CCG-AA---AACGAAC--CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCG-ACGT-CCCGTTCGCGGTGTGC--ACG---G-GGAGGCATG-TGCGTC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CCC--C----AATG-----CCTA-GCT----A--G--C-TG-GATATTGT--GG-G-AG--TT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C----G---ACCGTGCGCGGTTGG-CCC---A----A--AAAA-AAAAGGAGT-TCTTG-A-CGACGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTA-TTGCATCA--AGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGAC-CGT-GACCC--TGC-G-CA--C-C--------TT-C---T-T-T-AA------C-GGA-ATGGTGCTC-CGACC Ilex_mucronata C--AAAGTAGAC-CCAGCGAACT-TGTT-----AAA--ACA--T-G---C--T--T-GGGGGTTTGAG--A--A--GGGGTGCGCGAG---CCCCCC-GA--CACACT--CCCC-CA--------CC-T--C--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACTCG--GTC-AA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA---CCCCC--C----AATT-----CCTATG-T-------A-CC-TG-GATATTGT--GG-G-AG--AT----G---GG-G-CGGAAATTGGCCTCCCGT--A--C---A-C----G---ACCGTGAGCGGTTGG-CCC-----------A-AA-T-AATGAGT-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATCA--TGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAAC-CGT-GACCCTATAT-G-CA--C-C--------TT-C---T-T-C--A------GC--G-ATGGTGCTT-CGACC Ilex_mutchagara C--AAAGTAGA--CCGGCGAACT-TGTT-----TAA--ACA--T-G---C----GG-GGGGG{GT}TTGAA--A--A--AGGGTTCGCGAA--CCCCCCC-AA-TCACGCT-CCCCC-CA--------CC-T--C--GG-GA-T-CT--GGC-TCGT---TT-TCC-C-CC-CT--G-GCGGG-GA-ACTCG--GCC-AA-GCTC--CCG-AC-A-AACGAA---CCCCGGCGC-TGTTTGCGCCAAGGAACAATAAC-CGAAG-AGCTGG-TCTCCCG-GTGC-CCCGTCCGCGGCGTGC--AC----G-GGAGGCGCT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CCC--C---CACCGG----CCCA-G----------C-C--G-GATACTGC--GG-G-AG--TT----G---GG-G-CGGAGATTGGCCTCCCGT-CC-GC---G-C----G---ACCGTGAGCGGTTGG-CCC-----------A-AA-A-AACGAGT-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TCGCATCA--TGTCGTGGGGCG-CCTAGTCCGCAGCGA--GCT--C-C---GACCC--TGT-G-CA--C-C-T-G--A-TT-CG--C-TCT--CG--G--GC--G-ACGGTGCTT-CGACC Ilex_opaca C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ACA--T-G---C--T--G-GGGGGTTTGAG--A--A--GGGGTGCGTGAG--CCCCCC{GT}-AA--CACACT--CCCC-CA--------CC-T--C--GG-GA-T-TTT-GGC-TTGCG-----T-C-C-CC-CT--A-GC-GG-GG-ACTCG--GTC-AA-GCTC--CCG-AC-A-AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCG-TTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCGTCATGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----CC---CC-C-CCA-----CCC--C----AATG-CCCACCTA-G------------C-TG-GATATTGC--GG-G-AG--TC----G---GG-G-CGGAAATTGGCCTCCCGT-CC-GC---A-C----G---ATCGTGAGCGGTTGG-CCC----------AA-AA-A-AATGAGC-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATCA--TGTCGTGAGGCA-CCAAGTCTGTGGCGAGCTCTAAC-CGT-GACCC--TGC-G-CA--C-C--------CT-C---T-T-C--A------GC--G-ATGGTGCTT-CGACC Ilex_paraguariensis C--AACGTAGA-CCCGGCGAACT-TGTT-----AAA--ATA--C-G---C--T-GG-GGGGGTTTGGG--A--A--GGGGTGCGCGAG--CCCCCCCGAA--CACACT-CCCCCGC---------CC-T--C--GG-GA---CTG-GGC-TTGTG--TTCC-C-CTCC-CT-AG-GGGGG-GG-ACTCG--GTC-GA-GCTC--CCG-AC-A-AACGAA---CCCCGGCGC-TGTCTGTGCCAAGGAACCATAAC-CGAAG-AGCTGG-TCTCCCG-ATGT-CCCGTTCGCGGTGCGC--AC----G-GGAGGCATT-TGCATCTTTTTGA--AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----C---CC-C-CAA-----CCC--C----AATG-----CC----------------C--G-GATGTTGCGGGG-G-AG--TT---GG---GG-G-CGGAAATTGGCCTCCCGT-CC-AC---A-{CT}----G---ATCGTGAGCGGTTGG-CCC-----------A-AA-A-AGTGAGT-TCCTG-A-CGACGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATCA--TGTCGTGAGGCG-CCTAGTCTGTAGCGAGCTCTAAC-CGTGGACCC--TGC-G-CA--C-C-T-A--A-TT-CG--T-T-CG-AGAAGA-GC--G-ACGGTGCTT-CGACC Ilex_pedunculosa C--AAAGTAGAC-CCGGCGAACT-CGTT-A---AAA-TATA--T-G--GC--T----GGGGGTCTGGG--A--A--GGGGTGCGCGAG---CCCCCC-AA--CACACT--CCCC-CA----G--CCCGCT-C--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACTCG--GCC-AA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGC-AAC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCAAGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CCC--C----AATG-----CCAA-GCT----T--G--C-TG-GGTATTGC--GG-G-AG--CT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C----G---ACCGTGCGCGGTTGG-CCC-----------ATAA-A-AATGAGT-TCCTG-A-CGATTGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-A{CT}GCATCA--AGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGAT-CGT-GACCC--T-TCG-CA--C-C--------TT-C---T-C-T--A------ATGGG-ATGGTGCTTCCGACC Ilex_percoriacea C--AAAGTAGAC-CCGGCGAACT-CGTTA----AAAT-ATA--T-GG--C--T----GGGGGTCTGGG--A--A--GGGGTGCGCGAG---CCCCCC-AA--CACACT--CCCC-CA-GCC---CGC-T--C--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACTCG--GCC-AA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TGTTTGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCA-AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C-------CCC--C----AA-------CCC---------------C-----A-ATTGC--GG-G-AG--TCG---G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C----G---AACGTGCACGGTTGG-CCC--A--------A-AA-A-AATGAGT-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTCA--TGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-CGT-GACCC--TGT-G-CA--C-C--------TC-C---T-T-C--G-------C-GG-ATGGTGCTC-CGACC Ilex_pseudobuxus C--AAAGTAGAC-CCGGCGAACC-TGTT-----AAA--ATATTTGG---C--C----GGGGGTTTGAG--A--A--GGGGTGCGCGAG--CCCCCCC-GA--CACACT--CCCC-CG-------CCC-C-TC--GG-GA-T-TC--GGC-TTGCG-----T-T-C-CC-CT--G-CC-GG-GG-ACCCG--GTC-GA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCG-ATGC-CCCGTTCGCGGTGTGC--AC--GGGAGGAGGCATT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGTTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-------C-CC-C-CAA-----CCC--C----AACG-----CCCG-GCT-A{CT}TG--G--C-TG-GACGTTGC--GG-G-AG--CT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C--ACG---ACCGTGCGCGGTTGG-CCC--------A--AAAA-A-AACGAGC-TCCTG-A-CGATGGA-CGTCCCGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC--TGGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGAT-CGT-GACCC--TGT-G-CA--C-C--------TC-C--TTAT-T--A------G-GGG-ACGGTGCTT-CGACC Ilex_rotunda C--AAAGTAGAC-CCGGCGAACT-CGTT-----AAA--ATA--T-G--CG--T----GGGGGTTTGAG--A--A--GGGGTGCGCGAG--CCCCCCC-GA--CACATT--CCCC-CA-----C-CCC-C--C--GG-GA-C-TT--GGC-CCGGG-----T-T-C-CC-CT--T-GC-GG-GG-ACTCG--GCC-AAGGCTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-CGAAG-AGCTGG-CCCCCCG-{AG}TGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCGTA-CGCATC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-C-------CC-C-CAAC----CCCGAC----AATG-----CCCG-GCTG---GCAG--C-CG-GATATTGC--GG-G-AG--TT----GC--GG-G-CGGAGATTGGCCTCCCGT--C--C---A-C----G---ACCGTGCACGGTTGG-CCC------------AAA-A-AGCGAGT-TCTTG-A-CGACGGA-CGTCACGACGAGTGGTGGTTGGA-A-GAC-CTC-TTGCGTCG--AGTCGTGAGGCACCCGAGTCTGTAACGAGCTCTGAC-CGC-GACCC--TGT-G-CG--C-C--------TT-C---C-T-T--A------G-GGG-GCGGCGCTC-CGACC Ilex_rugosa C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATA--T-GC--C--T----GGGGGTTTGAG--A--A--GGGGTGCGCGAG---CCCCCC-AA--CACACT--CCCC-CA--------CC-T--C--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACTTG--GTC-AA-GCTA--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCTG-TTGT-CCCGTCTGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA-----CCC--C----AATG-----CCTA-----------G--C-TG-GATATTG{AC}--GG-G-AG--TTG---G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C----G---AACGTGCGCGGTTGG-CCC-AA--------A-AA-A-AATGAGT-TCTTG-A-CGATGGA-CGTCACGATAAGTGGTGGTTGAA-A-GAC-CTA-TTGCGTCA--TGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-CGT-GACCC--TGT-G-CA--C-C--------TT-C---T-T-C--A-------T-GG-ATGGTGCTT-CGACC Ilex_serrata C--AAAATAGAC-C{CT}GGCGAACT-TGTT-----AAA--ATA--T-G--CT--T----GGGGGTTTGAG--A--A--GGGGTGCGCGAG--TCCCCCC-GA--CACACT--CCCC-CA-------CCC-C--C--GG-GA-T-TT--GGC-TTGCG-----T-C-C-CC-CT--A-GC-GG-GG-ACTCG--GTC-AA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCTTAAC-CGAAG-AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCGTA-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACACATCACGTCG---------CC-C-CAA-----CCC--C----AATG-----CCTA-GTT----G--G--T-TA-GGCATTGT--TG-G-AG--TT----GG--GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C----G---ATTGTGCGCGGTTGG-CCC------------AAA-A-AATGAGT-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATCA--AGTCGTGAGGCA-CCGAGTCTGTAACGAGCTCTAAC-CGT-GACCC--TGT-G-CA--C-C--------TT-C---T-T-T--A------G-GGG-ATGGTGCTC-CGACC Ilex_taubertiana C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATTTGG---C--C----GGGGGTTTGAG--A--A-GGGGGTGCGCGAG--CCCCCCC-{AG}A--CACA{CT}T--CCCC-CG--------CC-C-T---GG-GA-T-TT-GGGT-TTGCG-----T-T-C-CC-CT--A-CC-GG-GG-ACCCG--GT{CG}-GA-GCTC--CCG-{AC}C---ACCAA{AC}---CCCCGGCGC-TGTTTGCGCCAAGGAACCTTAAC-TGAA?-A?CTGGCCCCCCCG-ATGT-CCCGTTC?CGGTGTGC--AC---GG-GGAGGCATT-TGCGTC-TTTTG---AATT----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGT{CT}TGCCTGGGCGTCACGCATCACGT{CT}G---------CC-C-CAA-----CCC--C----AATG-----CCCG-GCT-ACTA--{AG}--C-TG-GACGTT{CT}C--GG-G-A{AG}--CT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C--ACG---ACCGTGGGCGGTTGG-CCC-----AAAA--AAAA-A-AATGAGC-TCTTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GGC-CTC-TTGCGTC--TAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTTTGAT-CGT-GACCC--TGT-G-CG--C-C--------TC-C--TTAT-T--A------G-GGG-ACGGTGCTT-CGACC Ilex_theezans C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATTTGG---C--C---GGGGGGTTTGAG--A--A--GGGGTGCGCGAG--CCCCCCC-GA--CACA{CT}T--CCCC-CG-------CCC-C--C--GG-GA-T-TT--GG{CGT}-TTG{CG}G-----T-T-C-CC-CT--A-GC-GG-GG-ACCCG--GCC-GA-GCTC--CCG-AC---AACGAA---CCCCGG{CG}G{CG}-TGTCTGCGCCAAGGAACCTTAAC-TGAA{AG}AAGCT{AG}GCCCCCCCG-{AG}TGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CCC--C----AATG-----CCTG-GCT-ACCA--G--C-{CT}G-GACGTTGC--GG-G-AG--CT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C--ACG---{AG}CCGTG{CGT}GCGGTTGG-CCC--------A--AAAA-A-AATGAGC-TCTC--ACCGATGGG-{CG}GTCACG{AG}CAAGTGGTGGTTGAA-A-GGC-CTC-TAGCATC--TAGTCGTGAGGC{AT}-CCGAGTTTACAGCGAGCTCTGAT-CGT-GACCC--TGT-G-CA--C-C--------TT-C--TTAT-T--A-----GG-GGG-A{CT}GGTGCTT-TGACC Ilex_theezans_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATTTGG---C--C----GGGGGTTTGAG--A--A--GGGGTGCGCGAG--CCCCCCC-GA--CACACT--CCCC-CG-------CCC-C--C--GG-GA-T-TC--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACCCG--GTC-GA-GCTC--CCG-TC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAA?-TGAAGAAGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGGGTGC--AC--GGG-GGAGGCATT-TGCGTC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CCC--C----AATG-----CCCG-GCT-ACCA--G--C-TG-GACGTTGC--GG-G-AG--CT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C--ACG---ACCGTGCGCGGTTGG-CCC-------AA--AAAA-A-AATGAGC-TCCTG-A-CGATGGG-CGTCACGACAAGTGGTGGTTGGA-A-GAC-CTC-TTGCATC--TAGTCGTGAGGCA-CCGAATCTGTAGCGAGCTCTGAT-CGT-GACCC--TGT-G-CA--C-C--------TT-C-TTTAT-T--A------G-GGG-ACGGTGCTT-TGACC Ilex_vomitoria C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ATA--T-G---C--T----GGGGGTTTGAG--AAAAG-GGGGTGCGCGAG-CCCCCCCC-AA--CACACT--CCCC-CA--------CC-T--C--GG-GA-T-TT--GGC-TTGTG-----T-T-C-CC-CT--A-GC-GG-GG-ACTCG--GTC-AA-GCTC--CCG-AC-A-AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC--AC----G-GGGGGTATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CCC--C----AATG-----CCTA-G------------C-TG-GATATCGT--GG-G-AG--TT----G---GG-G-CGGAAATTGGCCTCCCGT--T--C---G-C----G---ACCGTGAGCGGTTGG-CCC-----------A-AA-A-AATGAGT-TCCTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATCA--TGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAAC-CGT-GACCC--TGT-G-CA--C-C--------TT-C---T-T-C--A---G--A---G-ACGGTGCTT-CGACC Ilex_warburgii C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATA--T-GC--C--T----GGGGGTTTGAG--A--A--GGGGTGCGCGAG---CCCCCC-AA--CACACT--CCCC-CA-GCG---CCC-T--C--GG-GA-T-TT--GGC-TTGCG-----T-T-C-CC-CT--A-GC-GG-GG-ACTCG--GTC-AA-GCTC--CCG-AC---AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA-----CCC--C----AATG-----CCCG-----------G--C-TG-GATATTAC--GG-G-AG--TTG---G---GG-G-CGGAAATTGGCCTCCCGTC-CA-T---A-T----G---AACGCGCGCGGTTGG-CCC-----------A-AA-A-AATGAGT-TCTTG-A-CGATGGA-CGTCACGGCAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTCA--TGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-TGC-GACCC--TGT-G-CA-CC-C--------TTCC---T-T-C--A-------C-GG-ATGGTGCTC-CGACC Ilex_yunnanensis C--AAAGTAGAC-CCAGCGAACT-TGTT-----AAA--ATA--T-G--CC--C----GGGGGTTTGAG--A--A--GGGGTGCGCGAG---CCCCCC-GA--CACAAT--CCCC-CA-------CCC-C--C--GG-GA-T-CT--GGC-TTGCG-----T-T-C-CC-AT--A-GC-GG-GG-ACTGG--GTC-AG-GCTC--CCG-GC---AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAATCTTAAC-TGAAG-AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATA-TGCATC-TTTTG--AAATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CCC--C----AATG-----CCTA-GCT----A--G--C-TG-GATATTGC--GG-G-AG--TT----G---GG-G-CGGAAATTGGCCTCCCGT--C--C---A-C----G---ACCGTGCGCGGTTGG-CCC--------A--AAAA-A-AATGAGT-TCCTG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATCA--AGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGAC-CGT-GACCC--TGC-G-CA--C-C--------TT-C---T-C-T--A------T-GGG-ATGGTGCTT-CGACC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_241) = N: 1-822; CODONPOSSET CodonPositions (CHARACTERS = ITS_241) = N: 1-822; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2481] TITLE ITS_421; LINK TAXA = Taxa1; DIMENSIONS NCHAR=758; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Helwingia_chinensis C--AAAATAGA--CCCGCGAACA-TGTT-----CAT--CCAT--C-----GGGGG-T-TGGCGA--GGGGTGCGCGAG-C-----CCCCAATCCACCCCCTC-TCCGG-C---------G-ATG-CTGC-TTTGAA-TTGT-CG-C-CA-ATGC-GGTGGCATCCATTGTT-GT-GTCGACTGAA-C-AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG--AGCCAG-TCTTCGA-AAGC-CCCGTACGCGGTGCGC-TT--G-GGAGG{CT}GTT-GGCGTCTTTAAAAT--CATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG---------CC-C-CCA----ACC--C--ACTCCACACAC---G---AAT-TGCGGTGTTGCT---TTG----GGGG-CGGAGATTGGCCTCCCATAC--AA--AA-T---A---AGCTTGCGTGGTTGG-CCT-----------AAAA-GCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTTAAATATGCCTC-TTGCGTATTATCGCGA-G-A--C-AA-C--C--C-ATCTCCGG-CGTGTGC-TC----T-T-TG-A--GA-----CC-C--C-----A---A---TG-ACGATGCTT-CGATT Helwingia_japonica C--AAAATAGA--CCCGCGAACA-TGTT-----CAT--CCAT--C------GGGG-T-TGGCGA--GGGGTGCGCGAG-C-----CCCCAATCCACCCCCTC-TCCGG-C---------G-ATG-CTGC-TTTGAA-TTGT-CG-C-CA-ATGC-GGTGGCATCCATTGTT-GT-GTCGACTGAA-C-AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG--AGCCAG-TCTTCGA-AAGC-CCCGTACGCGGTGCGC-TT--G-GGAGGCGTT-GGCGTCTTTAAAAT--CATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG---------CC-C-CCA----ACC--C--ACTCCACACAC---G---GAT-TGCGGTGTTGCT---TTG----GGGG-CGGAGATTGGCCTCCCATAC--AA--AA-T---A---AGCTTGCGTGGTTGG-CCT-----------AAAA-GCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTTAAATATGCCTC-TTGCGTATTATCGCGA-G-A--C-AA-C--C--C-ATCTCCGG-CGTGTGC-TC----T-T-TG-A--GA-----CC-C--C-----A---A---TG-ACGATGCTT-CGATT Ilex_amelanchier C--AAAGTAGAC-CCGGTGAACT-TGTT-----AAA--ACATG-C--CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG------CCCCC-CCGA-CACACT--CCCCC-A---------C-CTC-GGGA-TTTGGC-TTG--TG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCAAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATT-TGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTTG---------CC-C-CAA---CCCC--C-AATTCC-TATAT---A---GTTGGATATTGTGTAA---GTT----GGGGCCGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGAGCGGTTGG-CCC----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGGGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTG-AC-CC--TAT-A-TGCG--CC-----TT-C--T-----T-C-A--GTG-ATGGTGCTT-CGACC Ilex_anomala C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATG-C--AT--GGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCC-CCAA-CACACT--CCCCC-A---------C-CTC-GGGA-TTTGGC-TTG--TG-T-TC-ACCT-AGTGGAG-ACTCGGTCAAA-G-GTCCCGAC---AACGAA----CCCCGGCGCTATA-TGTGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATT-TGCATC-TTTTG----AATC-TATAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AA---------T-------GCTGGATATTACGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----A---CA-C---G---GCTGTGCGCGGTTGG-CCC----------AAAAA-TTGAGCTCTGGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTTGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGTG-AC-CC----T-G-TGCA--CC-----TT-C--T-----T-T-A--GGGAATGGTGCTT-CGACT Ilex_argentina C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTG-G--GC-GGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCC-CCGA-CACACT--CTCCC-A--------CC-CAC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-AGTGGGG-ACCCGGTC-GA-C-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTAG-CCCCCTG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATT-TGCGTC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCA---------CC-C-CAA----CCC--C-AATGCC-TGGCT-ACC--AGCTGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGTGCGGTTGG-CCC--------A-AAAAA-ATGAGCTCTTGACGATGGACGTCACCACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTATAGCGAGCTCTGATCGTG-AC-CC----T-G-TGCA--CC-----TT-C--T-----TATTA-GGGG-ATGGTGCTT-TGACC Ilex_argentina_Gbk C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ACATG-C--TG-GGGGGTT-TGAGAA--GGGGTGCGTGAG-C-----CCCC-CCAA-CACACT-CCCCCC-A---------C-CTC-GGGATTTCGGC-TTG--CG-T-CC-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGACAA-AACGAA-C--CCCCGGCGCTATC-TGCGCCAAGGAACCACAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-CCCC----CC-CTCCA----CCC--C-AATGCC-CACCT---A---GCTGGATATTGTGGGAGTCGTC----GGCG-CGGAAATTGGTCTCCCGT-C--CG--CA-C---G---ATCGGGAGCGGTTGG-CCC---------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAACCGTG-AC-CC----T-G-CGCA--CC-----TT-C--T-----T-C-A--GCG-ATGGTGCTT-CGACC Ilex_beecheyi C--AAAGTAGAC-CCGGCGAACT-CGTTA----AAAT-ATATG-G--CT-GGGGGTC-TGGGAA--GGGGTGCGCGAG-------CCCC-CCAA-CACACT--CCCCC-AGCC-----CG-CTC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTTGGCC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCACAAC-TGAA---GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCAAC--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C------CCC--C-AA---------C--------CC-CA-ATTGCGGGA---GTCG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGG-CCC-A--------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTG-AC-CC----T-G-TGCA--CC-----TC-C--T-----T-C-G--CGG-ATGGTGCTC-CGACC Ilex_brasiliensis C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTG-G--CCGGGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCC-CCGA-CACACT--CCCCC-G--------CC-CCC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACCCGGCC-TA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAGA-AGCTAG-CCCCCCC-GTGT-CCCGTTCGCGGCGTGC-AC--G-GGAGGCATT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATGCC-TGGCT-ACC--AGCCGGACGTTGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGTGCGGTTGG-CCC-------AA-AAAAA-ATGAGCTCTCACCGATGGGCGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTACAGCGAGCTCTGATCGTG-AC-CC----T-G-CGCA--CC-----TT-C--T-----TATTAGGGGG-ATGGTGCTT-TGACC Ilex_brevicuspis C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTG-G--CC-GGGGGTT-TGAGAA-GGGGGTGCGCGAG-----C-CCCC-CCGA-CACACT--CCCCC-G-------CCC-CTC-GGGA-TTTGGC-TTA--CG-T-TC-CCCT-ACTGGGG-ACCCGGTC-GA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATT-TGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATGCC-TGGCT-ACT--AGCTGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC------AAA-AAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGGCCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-AC-CC----T-G-TGCA--CC-----TC-C--T-----TATTA-GGGT-ATGGTGCTT-CGACC Ilex_buergeri CA-AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATG-C--CT-GGGGGTT-TGAAAA--GGGGTGCGCGAG-------CCCC-CCAA-CACACT--CCCCC-AGCC-----CC-CTC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA----CCC--C-AATG-C----CC---A---GCTGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-T---G---AACGCGCGCGGTTGG-CCC----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCG-AC-CC----T-G-TGCA-CCC-----TTCC--T-----T-C-A--CGG-ATGGTGCTC-CGACC Ilex_canariensis C--AAAGTAGAC-CCGGCGAACC-CGTT-----AAA--ACATG-C--CT-GGGGGTT-TGAGAA--GGGGCGCGCAAG-------CCCC-CCGA-CGCACT--CCCCC-A---CC---CC-CCG-GGGG-TTTGGC-TTG--GG-T-TC-CCCT-AGCGGGG-ACCCGGTC-AG-G-CTCCCGGC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-AGAAG--AGCTGG-CCCCCCG-GTGTCCCCGTTCGCGGTGTGC-AC-TG-GGAGGCATT-TGCGTC-TTTCG----AATC---TGAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGCTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCAAGGGCACGTCTGCCTGGGCGTCACCCATCACGTCG------C--CC-C-CAA----CCC--C-AATGCC-TGGCT---A---GCCGGGTATCGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C-AGG---ACCGTGCGCGGTTGG-CCC--AA---AA-AACAA-ATGAGTTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGGGGCA-CCGAGTCTATGGCGAGCTCCGACCGGG-AC-CC----T-G-CGCA--CA-----CT-C--C-----T-CCG-GGGG-ATGGTGCTC-CGACC Ilex_cassine C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ACATG-C--TG-GGGGGTT-TGAGAA--GGGGTGCGTGAG-C-----CCCC-CCAA-CACACT-CCCCCC-A---------C-CTC-GGGATTTCGGC-TTG--CG-T-CC-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGACAA-AACGAA-C--CCCCGGCGCTATC-TGCGCCAAGGAACCACAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-CCCC----CC-CTCCA----CCC--C-AATGCC-CACCT---A---GCTGGATATTGTGGGAGTCGTC----GGGG-CGGAAATTGGCCTCCCGT-C--CG--CA-C---G---ATCGTGAGCGGTTGG-CCC---------AAAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAACCGTG-AC-CC----T-G-CGCA--CC-----CT-C--T-----T-C-A--GCG-ATGGTGCTT-CGACC Ilex_collina C--AAAGTAGA--CCCGCGAACT-TGTT-----AAA--ATATG-C--TG-GGGGTTTGAGGTTAG-GGGGTGCGCGAG-C-----CCCC-CCAA-CACACT--CCCCC-A---------C-CTC-GGGA-TTTGGCTTTG--TG-T-TC-CCCT-AGTGGGG-ACTCGGTC-AG-G-CTCCCGAC-A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAATCATAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC-AC--G-GGGGGCATT-TGCATC-TTTTG----AATC---TAAAA{CT}GACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATG-C----CT---A---GTTGGATATTGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-T---G---ACCGTGAGCGGTTGG-CCC----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAATCGTG-AC-CC----T-G-{CT}GCA--CC-----TT-C--T-----T-C-A--ACG-ACGGTGCTT-CGACC Ilex_cornuta C--AAAGTAGAC-CCGGCGAACT-TGTT---A-AAA--ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCC-CCAA-CACACT--CCCCC-AGCC-----CC-CTC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACGCGGCC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-GTGT-CCCGTTCGCGGCGTGC-AC--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG---------CCAC-CAA----CCC--C-AATG-C----CC---A---GCCGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCC?GT----T---?A-C---G---AACGTGCGCGGTTGG-CCC----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCG-AC-CC----T-G-TGCA-CCC-----TT-C--T-----T-C-A--CGG-ATGGTGCTC-CGACC Ilex_crenata C--AAAGTA{AC}A--CCGGCGAACT-TGTT-----AAA--ACATG-C--CG-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C-----CCCC-CCAAT-AAGGTT-CCCCC-A---------C-CTC-CGGA-TTTGGC-TTGT-TT-T-CC-CCCT-GGCGGGGAACTCGGCC-CA-G-CTCCCGAC-A-AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCATAAC-CGAAG--AGCTGG-TCTCCCG-GTGC-CCCGTCCGCGGTGTGC-AC--G-GGAGGCGTT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C--CCAAC-GGCCT---A---GCCGGATATTGCGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGT-C--CG--CG-C---G---ACCGTGAGCGGTTGG-CCC----------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TCGCATCACGTCGTGGGGCG-CCTAGTCTGTAGCGAGCTCCGACCCTGTGCACC----T-G--ATT--CG-----CT-C--T-----A-G-G--GCG-A-GGTGCTT-CGACC Ilex_decidua C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ATATG-C--TG-GGGGTTTGAGAAAAG-GGGGTGCGCGAG-C-----CCCC-CCAA-CACACT--CCCCC-A---------C-CTC-GGGA-TTTGGCTTTG--TG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC-A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC-AC--G-GGGGGTATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATG-C----CT---A---GCTGGATATCGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----T---CG-C---G---ACCGTGAGCGGTTGG-CCC----------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTG-AC-CC----T-G-TGCA--CC-----TT-C--T-----T-C-A--GAG-ACGGTGCTT-CGACC Ilex_dimorphophylla C--AAAGTAGAC-CCGGCGAACT-TGTT---A-AAA--ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCC-CCAA-CGCACT--CCCCC-AGCC-----CC-CTC-GGGG-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACGCGGCC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-GTGT-CCCGTTCGCGGCGTGC-AC--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG---------CCAC-CAA----CCC--C-AATG-C----CC---A---GCCGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----T---CA-C---G---AACGTGCGCGGTTGG-CCC----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCG-AC-CC----T-G-TGCA-CCC-----TT-C--T-----T-G-A--CGG-ATGGTGCTC-CGACC Ilex_dumosa_dumosa C--AAAGTAGA--CCGGCGAACTCTGTT-----AAA--ACATG-C-TGG-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C-----CCCC-CCAATCACGCTC-CCCCC-A---------C-CTC-GGGA-TCTGG{CT}-TTGT-TT-T-CC-CCCT-GGCGGGGAACTCGGCG-GA-G-CTCCCGAC-A-AACGAA----CCCCGGCGCTGTA-TGCGCCAAGGACCCATAAC-CGAA{AG}--AGCTGG-TCTCCCG-TTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATC-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--CAAAAAAC-GTCCT---A---GGTGGACATTGTGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGT-C--CA--CA-C---GT--CCCGTGAGCGGTTGG-CCC---------AAAAAA-ACGAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTCTTTGCATCATGTCGTGAGGCG-CCTAGT?TGCAACGA?CTCCGACCCTGTGCACC----TAGTTGTC--CG-----CT-G--T-----A-G-G--GCG-ACGGTGCTT-CGACC Ilex_dumosa_guaranina C--AAAGTAGA--CCGGCGAACTCTGTT-----AAA--ACATG-C-TGG-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C-----CCCC-CCAATCACGCTC-CCCCC-A---------C-CTC-GGGA-TCTGGC-TGGT-TT-T-CC-CCCT-GGCGGGGAACTCGGCC-GA-G-CTCCCGAC-A-AACGAA----CCCCGGCGCTGTA-TGCGCCAAGGACCCATAAC-CGAAG--AGCTGG-TCTCCCG-TTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATC-TGCGTC-TTTTG----AATC---CAAAAC{CG}ACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTT?AACGCAAGTTGCGCCCAAAGCCAT?AGGCCAAGGGCACGTCT?CCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--CAAAAAAC-GTCCT---A---GGTGGACATTGTGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGT-C--CA--CA-C---GT--CCCGTGAGCGGTTGG-CCC---------AAAAAA-A?GAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTCTTCGCATCATGTCGTGAGGCG-CCTAGTCTGCAACGATCTCCGACCCTGTGCACC----TAGTTGTC--CG-----CT-G--T-----A-G-G--GCG-ACGGTGCTT-CGACC Ilex_glabra C-AAAAGTAGAC-CCGGCGAACC-TGTT----AAAA--ATATG-C--AT-GGGGGTC-TGAGAA--AGGGTGCGCGAG-------CCCC-CCGA-CACATT--CCCCC-A---------C-CCC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC--AAACGAA---CCCCCGGCGCTATC-TGCGCCAAGGAACCTTAAC-{CT}GAAG--AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATT-TGCATC-TTTTG--A-AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----C---CC-C-CAA-C--CCC--C-AATGCC-TGGCT---A---GCTGGGTATTGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCAGACCGGG-AC-CCTG--T-G-TGCA--CA-----TT-C--T-----T-T-A-GGGG-ATGGTGCTT-CGACC Ilex_integerrima C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTG-G--CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCC-CCGA-CACACT--CCCCC-G--------CC-CCC-GGGA-TTCGGC-TTG--CG-T-TA-CCCT-A{AG}CGGGG-ACCCGGTC-GA-G-CTCCCGTC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AAGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC-ACGGG-GGAGGCATT-TGCGTC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGT??????????GTC{CG}--------CCC-C-C{AGT}A----CCC--C-AAAGCC-CGGTT-ACC--AGCTGGACCTTGCGGGA---?CT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC------?AA-AAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGA-AGACCTC-TTGCAT?TAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGCG-AC-CC----T-G-TGCA--CC----TTC-T--T-----TATTA-GGGG-ACGGTGCTT-TGACC Ilex_integra C--AAAGTAGAC-CCGGCGAACT-TGTTA----AAAT-ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGTGCGAG-------CCCC-CCAA-CAAAAT--TCCCC-AGCC-----CC-CTTGGGGA-TTTGGC-TTG--CG-T-TC-CCCT-AGGGGGG-ATTGGGCC-AA-G-TTCCGGAA---AACGAA----CCCGGGCGCTTTT-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATTT-CCCGTCCGCGGTGTGC-AC--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C------CCC--C-AA---------C--------CC-CA-ATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCGCGGTTGGCCCA-A--------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCG-AC-CC----T-G-TGCA--CC-----TT-C--T-----T-C-A--CGG-ATGGTGCTT-CGACC Ilex_kiusiana C--AAAGTAGAC-CC{CT}GCGAACT-{CT}GTTT----AAAT-ATGT--C--CT-GGGGGTC-AGACAA--GGGGTGCGCGAG--C----CCCC-CCAA-CACACT--CCCCC-AGGC-----CC-CTC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C------CCC--C-AA---------C--------CC-CA-ATTGCGGGA---TT{CG}A---GGGG-CGGAAATTGGCCTCCCGT----A---CATCT--G---AACGTGCGCGGTTGGCCCC-G--------AAAAA-ATG{AG}GTTCTTGAATAAGGACGTCACGACAAGTGTTGGTTGAA-ATACGCC-TTGAGTCATGTCTTGAGGCA-CCTAGTCTGTAACGAGCTCTGACCGCA-AC-TC----T-G-TGCAG-CCA----TC-C--T-----T-C-A--TGG-ATCGTGCTT-CAACC Ilex_latifolia C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCC-CCAA-CACACT--CCCCC-AGCC-----CC-CTC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA----CCC--C-AATG-C----CC---A---GCTGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-T---G---AACGCGCGCGGTTGG-CCC----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGC{AG}TCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC{CT}GCG-AC-CC----T-G-TGCA-CCC-----TTCC--T-----T-C-A--CGG-ATGGTGCTT-CGACC Ilex_liukiuensis C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCC-CCAA-CACACT--CCCCC-AGCG-----CC-CTC-GGGT-TTTGGC-TTG--CG-T-TC-CCCT-AGTGGGG-ACTCGGTC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTATC-TGCG----GGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATGT-CCGGTTCGCGGTGTGC-AG--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTTAATTGCAGAATCCCGTGAACCATCGAGTTTTTGATCGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA----CCC--C-AATG-C----GC---G---GCTGGATATTACGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT--------TA-T---G---AACGCGCGCGGTTGG-CCC----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCCTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGCG-AC-CC----T-G-TGCA-ACC-----TTCC--T-----T-C-A--CGT-ATGGTGCTC-CGACC Ilex_macropoda C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATG-T--TT-GGGGGTT-TGAGAA--GGGGTGCGCGAG----C--CCCC-CCGA-CACACT---CCCC-C--------AC-CTC-GGGG-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AG-G-CTCCCGAC---AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATA-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATGCC-TACCT---G---GCTGGATATTGCAGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACTGTGTGTGGTTGG-CCC-------AA-AAAAA-AAGAATTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-TCGAGTCTTTGGCGAGCTCTGACCGTG-AC-CC----T-G-TGCA---C-----TT-C--T-----T-T---CGGG-ATGGTGCTT-CGACC Ilex_maximowicziana C--AAAGTAGAC-CCGGCGAACT-CGTT-----AAA--ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCC-CCAA-CACACT--CCCCC-AGCC-----CC-CTC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCGG-GTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG---------CCAC-CAA----CCC--C-GATG-C----CC---A---TCTGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----T---CA-C---G---AACGTGCGCGGTTGG-CCC----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTACCGAGCTCTGGCCGCG-AC-CC----T-G-CGCA-CCC-----TT-C--T-----T-C-A--CGG-ATGGTGCTC-CGACC Ilex_mertensii C--AAAGTAGAC-CCGGCGAACT-CGTTA----AAAT-ATATG-G--CT-GGGGGTC-TGGGAA--GGGGTGCGCGAG-------CCCC-CCAA-CACACT--CCCCC-AGCC-----CG-CTC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGCC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCACAAC-TGAAG--GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCAAC--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACAATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C------CCC--C-AA---------C--------CC-CA-ATTGCGGGA---GTCG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGG-CCC-A--------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTG-AC-CC----T-G-TGCA--CC-----TC-C--T-----T-C-G--CGG-ATGGTGCTC-CGACC Ilex_micrococca C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATGCT--TT-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCC-CCGA-CACACT--CCCCC-C--------AC-CTC-GGGA-TTTGGC-TTG--{CT}G-T-TC-CCCT-AGCGGGG-ACTCGGTC-AG-G-CTCCCGAC---AACGAAC---CCCCGGCGCTATT-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATA-CGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CCA----CCC--C-AATGCC-TAGCT---G---GCTGGATATTGCGGGA---GTT--GGGGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC-------AA-AAAAATAAGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCGAGTCTCTAGCGAGCTCTGATCGTG-AC-CC----T-G-CGCG--CC-----TC-C--T-----T-C---CGGG-ATGGCGCTT-TGACC Ilex_microdonta C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTG-G--CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCC-CCGA-CACACT--CCCCC-G------C-CC-CTC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-ACCGGGG-ACCCGGTC-GA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTCAAC-TGAAG--AGCTGGCCCCCCCG-ATGC-CCCGTTCGCGGTGTGC-ACGGGAGGAGGCATT-TGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCATGTCG-------C-CC-C-CAA----CCC--C-AACGCC-TGGCT-ACT--AGCCGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G-ACACCGTGCGCGGTTGG-CCC-------AA-AAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-AC-CC----T-G-TGCA--CC-----TC-C--T-----TATTA-GGGG-ATGGTGCTT-CGACC Ilex_microdonta_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT-AA--AAA-TATTTG-G--CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCC-CCGA-CACACT--CCCCC-G--------CC-CTC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-ACCGGGG-ACCCGGTC-GA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC-ACGGGAGGAGGCATT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-------C-CC-C-CAA----CCC--C-AACGCC-CGGCT-ACT--GGCTGGACGTTGCGGGG---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC-------AA-AAAAA-ATGAGCTCCTGACGATGGACGTCGCGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-AC-CC----T-G-TGCA--CC-----TC-C--T-----TATTA-GGGG-ATGGGGCTT-CGACC Ilex_mitis C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCC-CCGA-CACACT--CCCCC-A--------CC-TCG-GGAT-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGCC-AG-G-CTCCCGAA---AACGAA--C-CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGG-CCCCCCG-ACGT-CCCGTTCGCGGTGTGC-AC-GG-GGAGGCATG-TGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATGCC-TAGCT---A---GCTGGATATTGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC--AA---AA-AAAAA-AGGAGTTCTTGACGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTA-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGACCGTG-AC-CC----T-G-CGCA--CC-----TT-C--T-----T-TAA-CGGA-ATGGTGCTC-CGACC Ilex_mucronata C--AAAGTAGAC-CCAGCGAACT-TGTT-----AAA--ACATG-C--TT-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCC-CCGA-CACACT--CCCCC-A---------C-CTC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATT-TGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCCCC--C-AATTCC-TATGT---A---CCTGGATATTGTGGGA---GAT----GGGG-CGGAAATTGGCCTCCCGT----A---CA-C---G---ACCGTGAGCGGTTGG-CCC----------AAATA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTG-AC-CC--TAT-A-TGCA--CC-----TT-C--T-----T-C-A--GCG-ATGGTGCTT-CGACC Ilex_mutchagara C--AAAGTAGA--CCGGCGAACT-TGTT-----TAA--ACATG-C--GG-GGGGG{GT}T-TGAAAA--AGGGTTCGCGAA-C-----CCCC-CCAATCACGCTC-CCCCC-A---------C-CTC-GGGA-TCTGGC-TCGT-TT-TCCC-CCCT-GGCGGGGAACTCGGCC-AA-G-CTCCCGAC-A-AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACAATAAC-CGAAG--AGCTGG-TCTCCCG-GTGC-CCCGTCCGCGGCGTGC-AC--G-GGAGGCGCT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CC--C--CCACC-GGCCC---A---GCCGGATACTGCGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGT-C--CG--CG-C---G---ACCGTGAGCGGTTGG-CCC----------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TCGCATCATGTCGTGGGGCG-CCTAGTCCGCAGCGAGCTCCGACCCTGTGCACC----T-G--ATT--CG-----CT-C--T-----C-G-G--GCG-ACGGTGCTT-CGACC Ilex_opaca C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ACATG-C--TG-GGGGGTT-TGAGAA--GGGGTGCGTGAG-C-----CCCC-C{GT}AA-CACACT--CCCCC-A---------C-CTC-GGGATTTTGGC-TTG--CG-T-CC-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC-A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCG-TTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCGTCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---CC----CC-C-CCA----CCC--C-AATGCC-CACCT---A---GCTGGATATTGCGGGA---GTC----GGGG-CGGAAATTGGCCTCCCGT-C--CG--CA-C---G---ATCGTGAGCGGTTGG-CCC---------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTGGCGAGCTCTAACCGTG-AC-CC----T-G-CGCA--CC-----CT-C--T-----T-C-A--GCG-ATGGTGCTT-CGACC Ilex_paraguariensis C--AACGTAGA-CCCGGCGAACT-TGTT-----AAA--ATACG-CT-GG-GGGGGTT-TGGGAA--GGGGTGCGCGAG-C-----CCCC-CCGAACACACTC-CCCCG-C---------C-CTC-GGGA-CTGGGC-TTGTGTTCC-CCTCCCTAGGGGGGGGACTCGGTC-GA-G-CTCCCGAC-A-AACGAA----CCCCGGCGCTGTC-TGTGCCAAGGAACCATAAC-CGAAG--AGCTGG-TCTCCCG-ATGT-CCCGTTCGCGGTGCGC-AC--G-GGAGGCATT-TGCATCTTTTTGA---AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CCA----ACC--C---CAA--TGCCC---G---GAT-GTTGCGGGGGAG---TTG----GGGG-CGGAAATTGGCCTCCCGT-C--CA--CA-{CT}---G---ATCGTGAGCGGTTGG-CCC----------AAAAA-GTGAGTTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCG-CCTAGTCTGTAGCGAGCTCTAACCGTGGAC-CC----T-G-CGCA--CC-TAA-TT-CGTTCGAGAA-G-A--GCG-ACGGTGCTT-CGACC Ilex_pedunculosa C--AAAGTAGAC-CCGGCGAACT-CGTT--A--AAA-TATATG-G--CT-GGGGGTC-TGGGAA--GGGGTGCGCGAG-------CCCC-CCAA-CACACT--CCCCCAG----C---CCGCTC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGCC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCACAAC-TGAAG--GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGC-AA-CG-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCAAGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATGCC-AAGCT---T---GCTGGGTATTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC--------A-TAAAA-ATGAGTTCCTGACGATTGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-A{CT}GCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-AC-CC----T-T-CGCA--CC-----TT-C--T-----C-TAA-TGGG-ATGGTGCTTCCGACC Ilex_percoriacea C--AAAGTAGAC-CCGGCGAACT-CGTTA----AAAT-ATATG-G--CT-GGGGGTC-TGGGAA--GGGGTGCGCGAG-------CCCC-CCAA-CACACT--CCCCC-AGCC-----CG-CTC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGCC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCACAAC-TGAAG--GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCAAC--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C------CCC--C-AA---------C--------CC-CA-ATTGCGGGA---GTCG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGG-CCC-A--------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTG-AC-CC----T-G-TGCA--CC-----TC-C--T-----T-C-G--CGG-ATGGTGCTC-CGACC Ilex_pseudobuxus C--AAAGTAGAC-CCGGCGAACC-TGTT--A--AAA-TATTTG-G--CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCC-CCGA-CACACT--CCCCC-G------C-CC-CTC-GGGA-TTCGGC-TTG--CG-T-TC-CCCT-GCCGGGG-ACCCGGTC-GA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCCG-ATGC-CCCGTTCGCGGTGTGC-ACGGGAGGAGGCATT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGTTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-------C-CC-C-CAA----CCC--C-AACGCC-CGGCT-A{CT}T--GGCTGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC-------AA-AAAAA-ACGAGCTCCTGACGATGGACGTCCCGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTGGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-AC-CC----T-G-TGCA--CC-----TC-C--T-----TATTA-GGGG-ACGGTGCTT-CGACC Ilex_rotunda C--AAAGTAGAC-CCGGCGAACT-CGTT-----AAA--ATATG-C--GT-GGGGGTT-TGAGAA--GGGGTGCGCGAG---C---CCCC-CCGA-CACATT--CCCCC-A-----C--CC-CCC-GGGA-CTTGGC-CCG--GG-T-TC-CCCT-TGCGGGG-ACTCGGCC-AAGG-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-CGAAG--AGCTGG-CCCCCCG-{AG}TGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCGTA-CGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGC--------CC-C-CAAC---CCCGAC-AATGCC-CGGCTG--GCA-GCCGGATATTGCGGGA---GTT-G--CGGG-CGGAGATTGGCCTCCCGT----C---CA-C---G---ACCGTGCACGGTTGG-CCC----------AAAAA-GCGAGTTCTTGACGACGGACGTCACGACGAGTGGTGGTTGGA-AGACCTC-TTGCGTCGAGTCGTGAGGCACCCGAGTCTGTAACGAGCTCTGACCGCG-AC-CC----T-G-TGCG--CC-----TT-C--C-----T-T-A-GGGG-GCGGCGCTC-CGACC Ilex_rugosa C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCC-CCAA-CACACT--CCCCC-A---------C-CTC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTTGGTC-AA-G-CTACCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCTG-TTGT-CCCGTCTGCGGTGTGC-AC--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA----CCC--C-AATG-C----CT---A---GCTGGATATTG{AC}GGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCGCGGTTGG-CCCAA--------AAAAA-ATGAGTTCTTGACGATGGACGTCACGATAAGTGGTGGTTGAA-AGACCTA-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTG-AC-CC----T-G-TGCA--CC-----TT-C--T-----T-C-A--TGG-ATGGTGCTT-CGACC Ilex_serrata C--AAAATAGAC-C{CT}GGCGAACT-TGTT-----AAA--ATATG-C--TT-GGGGGTT-TGAGAA--GGGGTGCGCGAG---T---CCCC-CCGA-CACACT--CCCCC-A--------CC-CCC-GGGA-TTTGGC-TTG--CG-T-CC-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCTTAAC-CGAAG--AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCGTA-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACACATCACGTCG---------CC-C-CAA----CCC--C-AATGCC-TAGTT---G---GTTAGGCATTGTTGGA---GTT-G--GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ATTGTGCGCGGTTGG-CCC----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAACGAGCTCTAACCGTG-AC-CC----T-G-TGCA--CC-----TT-C--T-----T-T-A-GGGG-ATGGTGCTC-CGACC Ilex_taubertiana C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTG-G--CC-GGGGGTT-TGAGAA-GGGGGTGCGCGAG-----C-CCCC-CC{AG}A-CACA{CT}T--CCCCC-G--------CC-CTG-GGAT-TTGGGT-TTG--CG-T-TC-CCCT-ACCGGGG-ACCCGGT{CG}-GA-G-CTCCCG{AC}C---ACCAA{AC}----CCCCGGCGCTGTT-TGCGCCAAGGAACCTTAAC-TGAA?--A?CTGGCCCCCCCG-ATGT-CCCGTTC?CGGTGTGC-AC-GG-GGAGGCATT-TGCGTC-TTTTG----AATT---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGT{CT}TGCCTGGGCGTCACGCATCACGT{CT}G---------CC-C-CAA----CCC--C-AATGCC-CGGCT-ACT--A{AG}CTGGACGTT{CT}CGGGA---{AG}CT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGGGCGGTTGG-CCC----AAAAA-AAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGGCCTC-TTGCGTCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTTTGATCGTG-AC-CC----T-G-TGCG--CC-----TC-C--T-----TATTA-GGGG-ACGGTGCTT-CGACC Ilex_theezans C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTG-G--CCGGGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCC-CCGA-CACA{CT}T--CCCCC-G--------CC-CCC-GGGA-TTTGG{CGT}-TTG--{CG}G-T-TC-CCCT-AGCGGGG-ACCCGGCC-GA-G-CTCCCGAC---AACGAA----CCCCGG{CG}G{CG}TGTC-TGCGCCAAGGAACCTTAAC-TGAA{AG}A-AGCT{AG}G-CCCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATGCC-TGGCT-ACC--AGC{CT}GGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---{AG}CCGTG{CGT}GCGGTTGG-CCC-------AA-AAAAA-ATGAGCTCTCACCGATGGG{CG}GTCACG{AG}CAAGTGGTGGTTGAA-AGGCCTC-TAGCATCTAGTCGTGAGGC{AT}-CCGAGTTTACAGCGAGCTCTGATCGTG-AC-CC----T-G-TGCA--CC-----TT-C--T-----TATTAGGGGG-A{CT}GGTGCTT-TGACC Ilex_theezans_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTG-G--CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCC-CCGA-CACACT--CCCCC-G--------CC-CCC-GGGA-TTCGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACCCGGTC-GA-G-CTCCCGTC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAA?-TGAAG-AAGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGGGTGC-ACGGG-GGAGGCATT-TGCGTC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATGCC-CGGCT-ACC--AGCTGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC------AAA-AAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAATCTGTAGCGAGCTCTGATCGTG-AC-CC----T-G-TGCA--CC----TTC-T--T-----TATTA-GGGG-ACGGTGCTT-TGACC Ilex_vomitoria C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ATATG-C--TG-GGGGTTTGAGAAAAG-GGGGTGCGCGAGCC-----CCCC-CCAA-CACACT--CCCCC-A---------C-CTC-GGGA-TTTGGC-TTG--TG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC-A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC-AC--G-GGGGGTATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATG-C----CT---A---GCTGGATATCGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----T---CG-C---G---ACCGTGAGCGGTTGG-CCC----------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTG-AC-CC----T-G-TGCA--CC-----TT-C--T-----T-C-A--GAG-ACGGTGCTT-CGACC Ilex_warburgii C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCC-CCAA-CACACT--CCCCC-AGCG-----CC-CTC-GGGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA----CCC--C-AATG-C----CC---G---GCTGGATATTACGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT--C-C-A-TA-T---G---AACGCGCGCGGTTGG-CCC----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGCG-AC-CC----T-G-TGCA-CCC-----TTCC--T-----T-C-A--CGG-ATGGTGCTC-CGACC Ilex_yunnanensis C--AAAGTAGAC-CCAGCGAACT-TGTT-----AAA--ATATG-C--CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCC-CCGA-CACAAT--CCCCC-A--------CC-CCC-GGGA-TCTGGC-TTG--CG-T-TC-CCAT-AGCGGGG-ACTGGGTC-AG-G-CTCCCGGC---AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAATCTTAAC-TGAAG--AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATA-TGCATC-TTTTG---AAATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATGCC-TAGCT---A---GCTGGATATTGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC-------AA-AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGACCGTG-AC-CC----T-G-CGCA--CC-----TT-C--T-----C-T-A-TGGG-ATGGTGCTT-CGACC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_421) = N: 1-758; CODONPOSSET CodonPositions (CHARACTERS = ITS_421) = N: 1-758; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2487] TITLE ITS_121; LINK TAXA = Taxa1; DIMENSIONS NCHAR=833; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Helwingia_chinensis C--AAAATAGAC-CC-GCGAACA-TGTT-------C--ATCCA--T-----C------GGGGG-TTG-GC-G--A--GGGGTGCGCGAG------CCCCC-AAT-C-CAC---CCCC-T--------C-TC-C--GGCGA-TGCT---GCT-TTGAATTG-----TC-GCCAAT--GC-GGTGGCATCCATT-GTT----GTGTCGACTGAAC---AACGAA---CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG-AGCCAG-TCT-TCGAAAGC-CCCGTACGCGGTGCGC--TT----G-GGAGG{CT}GTT-GGCGTC-TTTAA---AATCATCATAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCGC-------CC-C-CAA-----CC--C-----A------------CTC------C-A----CACACGA-ATTGC--GGTGTTGCTTTG-----G---GG-G-CGGAGATTGGCCTCCCAT---A---CAAAA-TA---A---GCT-TGCGTGGTTGG-CCT---------A-AAAG------CGAGTGCTCGG-G--GATGGGTC-TCACGATAAGTGGTGGTTAAATATG-C-CTC-TTGCGT---ATTATCGCGAGACAA-CCCA-TCT-C--CG-G--C-G--TGT-G-CTC--TTT-GAGA--C-C-----------C-------C----A-------ATG-ACGATGCTT-CGATT Helwingia_japonica C--AAAATAGAC-CC-GCGAACA-TGTT-------C--ATCCA--T-----C-------GGGG-TTG-GC-G--A--GGGGTGCGCGAG------CCCCC-AAT-C-CAC---CCCC-T--------C-TC-C--GGCGA-TGCT---GCT-TTGAATTG-----TC-GCCAAT--GC-GGTGGCATCCATT-GTT----GTGTCGACTGAAC---AACGAA---CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG-AGCCAG-TCT-TCGAAAGC-CCCGTACGCGGTGCGC--TT----G-GGAGGCGTT-GGCGTC-TTTAA---AATCATCATAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCGC-------CC-C-CAA-----CC--C-----A------------CTC------C-A----CACACGG-ATTGC--GGTGTTGCTTTG-----G---GG-G-CGGAGATTGGCCTCCCAT---A---CAAAA-TA---A---GCT-TGCGTGGTTGG-CCT---------A-AAAG------CGAGTGCTCGG-G--GATGGGTC-TCACGATAAGTGGTGGTTAAATATG-C-CTC-TTGCGT---ATTATCGCGAGACAA-CCCA-TCT-C--CG-G--C-G--TGT-G-CTC--TTT-GAGA--C-C-----------C-------C----A-------ATG-ACGATGCTT-CGATT Ilex_amelanchier C--AAAGTAGAC-CCGGTGAACT-TGTT-----AAA--AC--A--T--G--C--C-C-GGGGGTTTGAG--A--A--GGGGTGCGCGAG----CCCCCCC-GA--CACACT--CCCC-CA-------C-CT-C--GG-GA-T-TT--GGC--TTG---TG---T-TC-CCC--T-AGC-GG-GG-A--C-TCGGTC--AAG-CTC--CCA-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTTG--------CC-C-CAA---CCCC--C----AATT------C---CT-------ATA-TAGT-TG-GATATTGT--GT-A-AG--TT------G---GG-GCCGGAAATTGGCCTCCCGT---C---C---A-C----G---ACCGTGAGCGGTTGG-CCC---------A-AAAA-A----TGAGTTCT-TG-A-CGATGGA-CGTCACGACAAGGGGTGGTTGAA-A-GAC-CTC-TTGCATC--A-TGTCGTGAGGC-A-CCTAGTCTGTAGCGAGCTCTAACCGT-GACCCTATAT-G-CG--C-C--------TT-C---T-T-C----A-------GTG-ATGGTGCTT-CGACC Ilex_anomala C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--A--T--G--C-AT----GGGGTTTGAG--A--A--GGGGTGCGCGAG-----CCCCCC-AA--CACACT--CCCC-CA-------C-CT-C--GG-GA-T-TT--GGC--TTG---TG---T-TC-ACC--T-AGT-GG-AG-A--C-TCGGTC-AAAG-GTC--CCG-AC---AACGAA---CCCCGGCGC-TATATGTGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC-T-ATAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC--C----AA-------------T---------G----C-TG-GATATTAC--GG-G-AG--TTG-----G---GG-G-CGGAAATTGGCCTCCCGT---A---C---A-C----G---GCTGTGCGCGGTTGG-CCC---------A-AAAA-T----TGAGCTCT-GG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC--A-AGTTGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACTGT-GACCC--TGT-G-CA--C-C--------TT-C---T-T-T----A-------GGGAATGGTGCTT-CGACT Ilex_argentina C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--ATTT-GG--GC-----GGGGGTTTGAG--A--A--GGGGTGCGCGAG--C--CCCCCC-GA--CACACT--CTCC-CA------CC-C-AC--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGT-GG-GG-A--C-CCGGTC--GAC-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTAG-CCCCCTG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCGTC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCA--------CC-C-CAA----CCC--C----AATGC-----CTGGCT----ACCA-G----C-TG-GACGTTGC--GG-G-AG--CT------G---GG-G-CGGAAATTGGCCTCCCGT--CC--AC---A-C----G---ACCGTGTGCGGTTGG-CCC---------A-AAAA-AA---TGAGCTCT-TG-A-CGATGGA-CGTCACCACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC-TA--GTCGTGAGGC-A-CCGAGTCTATAGCGAGCTCTGATCGT-GACCC--TGT-G-CA--C-C--------TT-C--TTAT-T-A--G-G-----G-G-ATGGTGCTT-TGACC Ilex_argentina_Gbk C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--AC--A--T--G--C--T-G-GGGGGTTTGAG--A--A--GGGGTGCGTGAG----CCCCCCC-AA--CACACT-CCCCC-CA-------C-CT-C--GG-GA-T-TTC-GGC--TTG---CG---T-CC-CCC--T-AGC-GG-GG-A--C-TCGGTC--AAG-CTC--CCG-ACAA-AACGAA-C-CCCCGGCGC-TATCTGCGCCAAGGAACCACAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATCATGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--CCCC--CC-CTCCA----CCC--C----AATG--CCCAC---CT-------A-G----C-TG-GATATTGT--GG-G-AG--TC------G-TCGGCG-CGGAAATTGGTCTCCCGT-C-C-G-C---A-C----G---ATCGGGAGCGGTTGG-CCC--------AA-AAAA-A----TGAGCTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC--A-CGTCGTGAGGC-A-CCGAGTCTGTGGCGAGCTCTAACCGT-GACCC--TGC-G-CA--C-C--------TT-C---T-T-C----A-------GCG-ATGGTGCTT-CGACC Ilex_beecheyi C--AAAGTAGAC-CCGGCGAACT-CGTTA----AAAT-AT--A--T--GG-C--T---GGGGGTCTGGG--A--A--GGGGTGCGCGAG-----CCCCCC-AA--CACACT--CCCC-CA-GC--CCG-CT-C--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-TTGGCC--AAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCACAAC-TGAA--GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCA-AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------------C------CCC--C----AA--------C---CC--------------C-----A-ATTGC--GG-G-AG--TC-G----G---GG-G-CGGAAATTGGCCTCCCGT---C---C---A-C----G---AACGTGCACGGTTGG-CCC---------AAAAAA-A----TGAGTTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTC--A-TGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACCGT-GACCC--TGT-G-CA--C-C--------TC-C---T-T-C----GC------G-G-ATGGTGCTC-CGACC Ilex_brasiliensis C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--ATTT-GG--CC----GGGGGGTTTGAG--A--A--GGGGTGCGCGAG--C--CCCCCC-GA--CACACT--CCCC-CG-----CCC-C--C--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-CCGGCC--TAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAGAAGCTAGCCCCCCC--GTGT-CCCGTTCGCGGCGTGC--AC----G-GGAGGCATT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC--C----AATGC-----CTGGCT----ACCA-G----C-CG-GACGTTGC--GG-G-AG--TT------G---GG-G-CGGAAATTGGCCTCCCGT--CC--AC---A-C----G---ACCGTGTGCGGTTGG-CCC------A--A-AAAA-AA---TGAGCT-C-TC-ACCGATGGG-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC-TA--GTCGTGAGGC-A-CCGAGTCTACAGCGAGCTCTGATCGT-GACCC--TGC-G-CA--C-C--------TT-C--TTAT-T-A-GG-G-----G-G-ATGGTGCTT-TGACC Ilex_brevicuspis C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--ATTT-GG--CC-----GGGGGTTTGAG--A--A-GGGGGTGCGCGAG--C--CCCCCC-GA--CACACT--CCCC-CG-----CCC-C-TC--GG-GA-T-TT--GGC--TTA---CG---T-TC-CCC--T-ACT-GG-GG-A--C-CCGGTC--GAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCGTC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC--C----AATGC-----CTGGCT----ACTA-G----C-TG-GACGTTGC--GG-G-AG--CT------G---GG-G-CGGAAATTGGCCTCCCGT--CC--AC---A-C----G---ACCGTGCGCGGTTGG-CCC-----AA--A-AAAA-AA---TGAGCTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GGC-CTC-TTGCATC-TA--GTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTCTGATCGT-GACCC--TGT-G-CA--C-C--------TC-C--TTAT-T-A--G-G-----G-T-ATGGTGCTT-CGACC Ilex_buergeri CA-AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--A--T--GC-C--T---GGGGGTTTGAA--A--A--GGGGTGCGCGAG-----CCCCCC-AA--CACACT--CCCC-CA-GC--CCC-CT-C--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-TCGGTC--AAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TATTTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CCAC-CAA----CCC--C----AATG------C---CC-------A-G----C-TG-GATATTGC--GG-G-AG--TT-G----G---GG-G-CGGAAATTGGCCTCCCGT---C---C---A-T----G---AACGCGCGCGGTTGG-CCC----------AAAAA-A----TGAGTTCT-TG-A-CGATGGA-CGTCACGGCAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTC--A-TGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACCGC-GACCC--TGT-G-CA-CC-C--------TTCC---T-T-C----AC------G-G-ATGGTGCTC-CGACC Ilex_canariensis C--AAAGTAGAC-CCGGCGAACC-CGTT-----AAA--AC--A--T--G--CC-T---GGGGGTTTGAG--A--A--GGGGCGCGCAAG-----CCCCCC-GA--CGCACT--CCCC-CA----CCCC-C--C-GGG-GG-T-TT--GGC--TTG---GG---T-TC-CCC--T-AGC-GG-GG-A--C-CCGGTC--AGG-CTC--CCG-GC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-AGAAG-AGCTGG-CCCCCCG-GTGTCCCCGTTCGCGGTGTGC--AC-T--G-GGAGGCATT-TGCGTC-TTTCG---AATC----TGAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGCTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCAAGGGCACGTCTGCCTGGGCGTCACCCATCACGTCG-C------CC-C-CAA----CCC--C----AATGC-----CTGGCT-------A-G----C-CG-GGTATCGC--GG-G-AG--TT------G---GG-G-CGGAAATTGGCCTCCCGT---C---C---A-C--AGG---ACCGTGCGCGGTTGG-CCC---------A-AAAA-ACAAATGAGTTCC-TG-A-CGATGGG-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTC--A-TGTCGTGGGGC-A-CCGAGTCTATGGCGAGCTCCGACCGG-GACCC--TGC-G-CA--CAC---------T-C---C-TCC-G--G-G-----G-G-ATGGTGCTC-CGACC Ilex_cassine C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--AC--A--T--G--C--T-G-GGGGGTTTGAG--A--A--GGGGTGCGTGAG----CCCCCCC-AA--CACACT-CCCCC-CA-------C-CT-C--GG-GA-T-TTC-GGC--TTG---CG---T-CC-CCC--T-AGC-GG-GG-A--C-TCGGTC--AAG-CTC--CCG-ACAA-AACGAA-C-CCCCGGCGC-TATCTGCGCCAAGGAACCACAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATCATGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--CCCC--CC-CTCCA----CCC--C----AATG--CCCAC---CT-------A-G----C-TG-GATATTGT--GG-G-AG--TC------G-TCGGGG-CGGAAATTGGCCTCCCGT-C-C-G-C---A-C----G---ATCGTGAGCGGTTGG-CCC--------AA-AAAA-A----TGAGCTCC-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC--A-CGTCGTGAGGC-A-CCGAGTCTGTGGCGAGCTCTAACCGT-GACCC--TGC-G-CA--C-C--------CT-C---T-T-C----A-------GCG-ATGGTGCTT-CGACC Ilex_collina C--AAAGTAGA--CCCGCGAACT-TGTT-----AAA--AT--A--T--G--C--T---GGGGGTTTGAG--GTTAG-GGGGTGCGCGAG----CCCCCCC-AA--CACACT--CCCC-CA-------C-CT-C--GG-GA-T-TT--GGC-TTTG---TG---T-TC-CCC--T-AGT-GG-GG-A--C-TCGGTC--AGG-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAATCATAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC--AC----G-GGGGGCATT-TGCATC-TTTTG---AATC----TAAAA{CT}GACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC--C----AATG------C---CT-------A-G----T-TG-GATATTGT--GG-G-AG--TT------G---GG-G-CGGAAATTGGCCTCCCGT---C---C---A-T----G---ACCGTGAGCGGTTGG-CCC---------A-AAAA-A----TGAGTTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC--A-TGTCGTGAGGC-A-CCTAGTCTGTAGCGAGCTCTAATCGT-GACCC--TG{CT}-G-CA--C-C--------TT-C---T-T-C----A-------ACG-ACGGTGCTT-CGACC Ilex_cornuta C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA--AT--A--T--GC-C--T---GGGGGTTTGAG--A--A--GGGGTGCGCGAG-----CCCCCC-AA--CACACT--CCCC-CA-GC--CCC-CT-C--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-GCGGCC--AAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-GTGT-CCCGTTCGCGGCGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG--------CCAC-CAA----CCC--C----AATG------C---CC-------A-G----C-CG-GATATTGC--GG-G-AG--TT-G----G---GG-G-CGGAAATTGGCCTCC?GT---T---?---A-C----G---AACGTGCGCGGTTGG-CCC----------AAAAA-A----TGAGTTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTC--A-TGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACCGC-GACCC--TGT-G-CA-CC-C--------TT-C---T-T-C----AC------G-G-ATGGTGCTC-CGACC Ilex_crenata C--AAAGTA{AC}A--CCGGCGAACT-TGTT-----AAA--AC--A--T--G--C---CG-GGGGGTTTGAG--A--A--GGGGTGCGCGAG----CCCCCCC-AA-T-AAGGT-TCCCC-CA-------C-CT-C--CG-GA-T-TT--GGC--TTG---T-TT-T-CC-CCC--T-GGCGGG-GA-A--C-TCGGCC--CAG-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TGTTTGCGCCAAGGAACCATAAC-CGAAG-AGCTGG-TCTCCCG-GTGC-CCCGTCCGCGGTGTGC--AC----G-GGAGGCGTT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA-C--CCC--C---CAACG-G----C---CT-------A-GC---C--G-GATATTGC--GG-G-AG--TT------G---GG-G-CGGAGATTGGCCTCCCGT-C-C-G-C---G-C----G---ACCGTGAGCGGTTGG-CCC---------A-AAAA-A----CGAGTTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TCGCATC--A-CGTCGTGGGGC-G-CCTAGTCTGTAGCGA--GCT--CC---GACCC--TGT-G-CA--C-C-T-G--A-TT-CG--C-T-C--T-A--G--G-GCG-A-GGTGCTT-CGACC Ilex_decidua C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--AT--A--T--G--C--T---GGGGGTTTGAG--AAAAG-GGGGTGCGCGAG----CCCCCCC-AA--CACACT--CCCC-CA-------C-CT-C--GG-GA-T-TT--GGC-TTTG---TG---T-TC-CCC--T-AGC-GG-GG-A--C-TCGGTC--AAG-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC--AC----G-GGGGGTATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC--C----AATG------C---CT-------A-G----C-TG-GATATCGT--GG-G-AG--TT------G---GG-G-CGGAAATTGGCCTCCCGT---T---C---G-C----G---ACCGTGAGCGGTTGG-CCC---------A-AAAA-A----TGAGTTCC-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC--A-TGTCGTGAGGC-A-CCTAGTCTGTAGCGAGCTCTAACCGT-GACCC--TGT-G-CA--C-C--------TT-C---T-T-C----A-----G-A-G-ACGGTGCTT-CGACC Ilex_dimorphophylla C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA--AT--A--T--GC-C--T---GGGGGTTTGAG--A--A--GGGGTGCGCGAG-----CCCCCC-AA--CGCACT--CCCC-CA-GC--CCC-CT-C--GG-GG-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-GCGGCC--AAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-GTGT-CCCGTTCGCGGCGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG--------CCAC-CAA----CCC--C----AATG------C---CC-------A-G----C-CG-GATATTGC--GG-G-AG--TT-G----G---GG-G-CGGAAATTGGCCTCCCGT---T---C---A-C----G---AACGTGCGCGGTTGG-CCC----------AAAAA-A----TGAGTTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTC--A-TGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACCGC-GACCC--TGT-G-CA-CC-C--------TT-C---T-T-G----AC------G-G-ATGGTGCTC-CGACC Ilex_dumosa_dumosa C--AAAGTAGA--CCGGCGAACTCTGTT-----AAA--AC--A--T--G--C--TGG-GGGGGTTTGAG--A--A--GGGGTGCGCGAG----CCCCCCC-AA-TCACGCT-CCCCC-CA-------C-CT-C--GG-GA-T-CT--GG{CT}--TTG---T-TT-T-CC-CCC--T-GGCGGG-GA-A--C-TCGGCG--GAG-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TGTATGCGCCAAGGACCCATAAC-CGAA{AG}-AGCTGG-TCTCCCG-TTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATC-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC--CAAAAAACG-T----C---CT-------A-GG---T--G-GACATTGT--GG-G-AG--TT------G---GG-G-CGGAGATTGGCCTCCCGT-C-C-A-C---A-C----GT--CCCGTGAGCGGTTGG-CCC-------A-A-AAAA-A----CGAGTTCT-TG-A-CGACGGA-CGTCACGGCAAGTGGTGGTTGAA-A-GAC-CTCTTTGCATC--A-TGTCGTGAGGC-G-CCTAGT?TGCAACGA--?CT--CC---GACCC--TGT-G-CA--C-C-TAGTTG-TC-CG--C-T-G--T-A--G--G-GCG-ACGGTGCTT-CGACC Ilex_dumosa_guaranina C--AAAGTAGA--CCGGCGAACTCTGTT-----AAA--AC--A--T--G--C--TGG-GGGGGTTTGAG--A--A--GGGGTGCGCGAG----CCCCCCC-AA-TCACGCT-CCCCC-CA-------C-CT-C--GG-GA-T-CT--GGC--TGG---T-TT-T-CC-CCC--T-GGCGGG-GA-A--C-TCGGCC--GAG-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TGTATGCGCCAAGGACCCATAAC-CGAAG-AGCTGG-TCTCCCG-TTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATC-TGCGTC-TTTTG---AATC----CAAAAC{CG}ACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTT?AACGCAAGTTGCGCCCAAAGCCAT?AGGCCAAGGGCACGTCT?CCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC--CAAAAAACG-T----C---CT-------A-GG---T--G-GACATTGT--GG-G-AG--TT------G---GG-G-CGGAGATTGGCCTCCCGT-C-C-A-C---A-C----GT--CCCGTGAGCGGTTGG-CCC-------A-A-AAAA-A----?GAGTTCT-TG-A-CGACGGA-CGTCACGGCAAGTGGTGGTTGAA-A-GAC-CTCTTCGCATC--A-TGTCGTGAGGC-G-CCTAGTCTGCAACGA--TCT--CC---GACCC--TGT-G-CA--C-C-TAGTTG-TC-CG--C-T-G--T-A--G--G-GCG-ACGGTGCTT-CGACC Ilex_glabra C-AAAAGTAGAC-CCGGCGAACC-TGTT---A-AAA--AT--A--T--G--CA-T---GGGGGTCTGAG--A--A--AGGGTGCGCGAG-----CCCCCC-GA--CACATT--CCCC-CA------CC-C--C--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-TCGGTC--AAG-CTC--CCG-AC--AAACGAA--CCCCCGGCGC-TATCTGCGCCAAGGAACCTTAAC-{CT}GAAG-AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG-A-AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-C------CC-C-CAAC---CCC--C----AATGC-----CTGGCT-------A-G----C-TG-GGTATTGC--GG-G-AG--TT------G---GG-G-CGGAAATTGGCCTCCCGT---C---C---A-C----G---ACCGTGCGCGGTTGG-CCC---------A-AAAA-A----TGAGTTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC--A-TGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCAGACCGG-GACCC--TGT-G-TG--CAC-------ATT-C---T-T-T-A--G-G-----G-G-ATGGTGCTT-CGACC Ilex_integerrima C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--ATTT-GG--CC-----GGGGGTTTGAG--A--A--GGGGTGCGCGAG--C--CCCCCC-GA--CACACT--CCCC-CG-----CCC-C--C--GG-GA-T-TC--GGC--TTG---CG---T-TA-CCC--T-A{AG}C-GG-GG-A--C-CCGGTC--GAG-CTC--CCG-TC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAGAAGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC--GGG-GGAGGCATT-TGCGTC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGT??????????GTC{CG}-------CCC-C-C{AGT}A----CCC--C----AAAGC-----CCGGTT----ACCA-G----C-TG-GACCTTGC--GG-G-A?--CT------G---GG-G-CGGAAATTGGCCTCCCGT--CC--AC---A-C----G---ACCGTGCGCGGTTGG-CCC-----?A--A-AAAA-AA---TGAGCTCC-TG-A-CGATGGG-CGTCACGACAAGTGGTGGTTGGA-A-GAC-CTC-TTGCAT?-TA--GTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTCTGATCGC-GACCC--TGT-G-CA--C-C--------TT-C-TTTAT-T-A--G-G-----G-G-ACGGTGCTT-TGACC Ilex_integra C--AAAGTAGAC-CCGGCGAACT-TGTTA----AAAT-AT--A--T--GC-C--T---GGGGGTTTGAG--A--A--GGGGTGTGCGAG-----CCCCCC-AA--CAAAAT--TCCC-CA-GC--CCC-CT-TG-GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGG-GG-GG-A--T-TGGGCC--AAG-TTC--CGG-AA---AACGAA---CCCGGGCGC-TTTTTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATTT-CCCGTCCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------------C------CCC--C----AA--------C---CC--------------C-----A-ATTGC--GG-G-AG--TT-G----G---GG-G-CGGAAATTGGCCTCCCGT---C---C---A-C----G---AACGTGCGCGGTTGG-CCCA--------AAAAAA-A----TGAGTTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTC--A-TGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACCGC-GACCC--TGT-G-CA--C-C--------TT-C---T-T-C----AC------G-G-ATGGTGCTT-CGACC Ilex_kiusiana C--AAAGTAGAC-CC{CT}GCGAACT-{CT}GTTT----AAAT-AT--G--T---C-C--T---GGGGGTC-AGA-CA--A--GGGGTGCGCGAGC----CCCCCC-AA--CACACT--CCCC-CAGGC--CC--CT-C--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-TCGGTC--AAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TATTTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGCA-G-----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------------C------CCC--C----AA--------C---CC--------------C-----A-ATTGC--GG-G-AT--T{CG}-A----G---GG-G-CGGAAATTGGCCTCCCGT---A---C---ATC-T--G---AACGTGCGCGGTTGGCCCC---------GAAAAA-A----TG{AG}GTTCT-TGAA-TAA-GGA-CGTCACGACAAGTGTTGGTTGAA-A-TACGC-C-TTGAGTC--A-TGTCTTGAGGC-A-CCTAGTCTGTAACGAGCTCTGACCGC-AACTC--TGT-G-CAG-C-CA-------TC-C---T-T-C----AT------G-G-ATCGTGCTT-CAACC Ilex_latifolia C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--A--T--GC-C--T---GGGGGTTTGAG--A--A--GGGGTGCGCGAG-----CCCCCC-AA--CACACT--CCCC-CA-GC--CCC-CT-C--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-TCGGTC--AAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CCAC-CAA----CCC--C----AATG------C---CC-------A-G----C-TG-GATATTGC--GG-G-AG--TT-G----G---GG-G-CGGAAATTGGCCTCCCGT---C---C---A-T----G---AACGCGCGCGGTTGG-CCC----------AAAAA-A----TGAGTTCT-TG-A-CGATGGA-CGTCACGGCAAGTGGTGGTTGAA-A-GAC-CTC-TTGC{AG}TC--A-TGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGAC{CT}GC-GACCC--TGT-G-CA-CC-C--------TTCC---T-T-C----AC------G-G-ATGGTGCTT-CGACC Ilex_liukiuensis C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--A--T--GC-C--T---GGGGGTTTGAG--A--A--GGGGTGCGCGAG-----CCCCCC-AA--CACACT--CCCC-CA-GC--GCC-CT-C--GG-GT-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGT-GG-GG-A--C-TCGGTC--AAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TATCTGCG----GGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATGT-CCGGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTTAATTGCAGAATCCCGTGAACCATCGAGTTTTTGATCGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CCAC-CAA----CCC--C----AATG------C---GC-------G-G----C-TG-GATATTAC--GG-G-AG--TT-G----G---GG-G-CGGAAATTGGCCTCCCGT-------T---A-T----G---AACGCGCGCGGTTGG-CCC----------AAAAA-A----TGAGTTCT-TG-A-CGATGGA-CGTCACGGCAAGTGGTGGTTGAA-A-GAC-CTC-TTGCCTC--A-TGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACTGC-GACCC--TGT-G-CA-AC-C--------TTCC---T-T-C----AC------G-T-ATGGTGCTC-CGACC Ilex_macropoda C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--A--T--G--TT-T---GGGGGTTTGAG--A--A--GGGGTGCGCGAG--C--CCCCCC-GA--CACACT--CCCC-CA------CC-T--C--GG-GG-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-TCGGTC--AGG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TATTTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATA-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC--C----AATGC-----CTACCT-------G-G----C-TG-GATATTGC--AG-G-AG--TT------G---GG-G-CGGAAATTGGCCTCCCGT---C---C---A-C----G---ACTGTGTGTGGTTGG-CCC--A---A--A-AAAA-AA----GAATTCC-TG-A-CGACGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC-AT--GTCGTGAGGC-A-TCGAGTCTTTGGCGAGCTCTGACCGT-GACCC--TGT-G-CA----C--------TT-C---T-T-T----C-G-----G-G-ATGGTGCTT-CGACC Ilex_maximowicziana C--AAAGTAGAC-CCGGCGAACT-CGTT-----AAA--AT--A--T--GC-C--T---GGGGGTTTGAG--A--A--GGGGTGCGCGAG-----CCCCCC-AA--CACACT--CCCC-CA-GC--CCC-CT-C--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-TCGGTC--AAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCGG-GTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG--------CCAC-CAA----CCC--C----GATG------C---CC-------A-T----C-TG-GATATTGC--GG-G-AG--TT-G----G---GG-G-CGGAAATTGGCCTCCCGT---T---C---A-C----G---AACGTGCGCGGTTGG-CCC----------AAAAA-A----TGAGTTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTC--A-TGTCGTGAGGC-A-CCAAGTCTGTACCGAGCTCTGGCCGC-GACCC--TGC-G-CA-CC-C--------TT-C---T-T-C----AC------G-G-ATGGTGCTC-CGACC Ilex_mertensii C--AAAGTAGAC-CCGGCGAACT-CGTTA----AAAT-AT--A--T--GG-C--T---GGGGGTCTGGG--A--A--GGGGTGCGCGAG-----CCCCCC-AA--CACACT--CCCC-CA-GC--CCG-CT-C--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-TCGGCC--AAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTTTGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCA-AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACAATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------------C------CCC--C----AA--------C---CC--------------C-----A-ATTGC--GG-G-AG--TC-G----G---GG-G-CGGAAATTGGCCTCCCGT---C---C---A-C----G---AACGTGCACGGTTGG-CCC---------AAAAAA-A----TGAGTTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTC--A-TGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACCGT-GACCC--TGT-G-CA--C-C--------TC-C---T-T-C----GC------G-G-ATGGTGCTC-CGACC Ilex_micrococca C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--A--T--G-CTT-T---GGGGGTTTGAG--A--A--GGGGTGCGCGAG-----CCCCCC-GA--CACACTC-CCCC-CA------CC-T--C--GG-GA-T-TT--GGC--TTG---{CT}G---T-TC-CCC--T-AGC-GG-GG-A--C-TCGGTC--AGG-CTC--CCG-AC---AACGAAC--CCCCGGCGC-TATTTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATA-CGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CCA----CCC--C----AATGC-----CTAGCT-------G-G----C-TG-GATATTGC--GG-G-AG--TT--GG--G---GG-G-CGGAAATTGGCCTCCCGT---C---C---A-C----G---ACCGTGCGCGGTTGG-CCC--A---A--A-AAAATAA----GAGTTCC-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC-AT--GTCGTGAGGC-A-CCGAGTCTCTAGCGAGCTCTGATCGT-GACCC--TGC-G-CG--C-C--------TC-C---T-T-C----C-G-----G-G-ATGGCGCTT-TGACC Ilex_microdonta C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--ATTT-GG--CC-----GGGGGTTTGAG--A--A--GGGGTGCGCGAG--C--CCCCCC-GA--CACACT--CCCC-CG-----CCC-C-TC--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-ACC-GG-GG-A--C-CCGGTC--GAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTCAAC-TGAAG-AGCTGGCCCCCCCG-ATGC-CCCGTTCGCGGTGTGC--AC--GGGAGGAGGCATT-TGCGTC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCATGTCG------C-CC-C-CAA----CCC--C----AACGC-----CTGGCT----ACTA-G----C-CG-GACGTTGC--GG-G-AG--CT------G---GG-G-CGGAAATTGGCCTCCCGT--CC--AC---A-C----G-ACACCGTGCGCGGTTGG-CCC------A--A-AAAA-AA---TGAGCTCC-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC-TA--GTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTCTGATCGT-GACCC--TGT-G-CA--C-C--------TC-C--TTAT-T-A--G-G-----G-G-ATGGTGCTT-CGACC Ilex_microdonta_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT----AAAA--AT--ATTT-GG--CC-----GGGGGTTTGAG--A--A--GGGGTGCGCGAG--C--CCCCCC-GA--CACACT--CCCC-CG------CC-C-TC--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-ACC-GG-GG-A--C-CCGGTC--GAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC--GGGAGGAGGCATT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG------C-CC-C-CAA----CCC--C----AACGC-----CCGGCT----ACTG-G----C-TG-GACGTTGC--GG-G-GG--CT------G---GG-G-CGGAAATTGGCCTCCCGT--CC--AC---A-C----G---ACCGTGCGCGGTTGG-CCC------A--A-AAAA-AA---TGAGCTCC-TG-A-CGATGGA-CGTCGCGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC-TA--GTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTCTGATCGT-GACCC--TGT-G-CA--C-C--------TC-C--TTAT-T-A--G-G-----G-G-ATGGGGCTT-CGACC Ilex_mitis C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--A--T--G--CC-T---GGGGGTTTGAG--A--A--GGGGTGCGCGAG--C--CCCCCC-GA--CACACT--CCCC-CA------CC-T--C--GG-GATT-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-TCGGCC--AGG-CTC--CCG-AA---AACGAAC--CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCG-ACGT-CCCGTTCGCGGTGTGC--ACG---G-GGAGGCATG-TGCGTC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC--C----AATGC-----CTAGCT-------A-G----C-TG-GATATTGT--GG-G-AG--TT------G---GG-G-CGGAAATTGGCCTCCCGT---C---C---A-C----G---ACCGTGCGCGGTTGG-CCC--A---A--A-AAAAAAA---GGAGTTCT-TG-A-CGACGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTA-TTGCATC-AA--GTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTCTGACCGT-GACCC--TGC-G-CA--C-C--------TT-C---T-T-TAA--C-G-----G-A-ATGGTGCTC-CGACC Ilex_mucronata C--AAAGTAGAC-CCAGCGAACT-TGTT-----AAA--AC--A--T--G--C--T-T-GGGGGTTTGAG--A--A--GGGGTGCGCGAG-----CCCCCC-GA--CACACT--CCCC-CA-------C-CT-C--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-TCGGTC--AAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA--CCCCC--C----AATT------C---CT-------ATG-TACC-TG-GATATTGT--GG-G-AG--AT------G---GG-G-CGGAAATTGGCCTCCCGT---A---C---A-C----G---ACCGTGAGCGGTTGG-CCC---------A-AATA-A----TGAGTTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC--A-TGTCGTGAGGC-A-CCTAGTCTGTAGCGAGCTCTAACCGT-GACCCTATAT-G-CA--C-C--------TT-C---T-T-C----A-------GCG-ATGGTGCTT-CGACC Ilex_mutchagara C--AAAGTAGA--CCGGCGAACT-TGTT-----TAA--AC--A--T--G--C---GG-GGGGG{GT}TTGAA--A--A--AGGGTTCGCGAA----CCCCCCC-AA-TCACGCT-CCCCC-CA-------C-CT-C--GG-GA-T-CT--GGC--TCG---T-TT-TCCC-CCC--T-GGCGGG-GA-A--C-TCGGCC--AAG-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TGTTTGCGCCAAGGAACAATAAC-CGAAG-AGCTGG-TCTCCCG-GTGC-CCCGTCCGCGGCGTGC--AC----G-GGAGGCGCT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC--C---CACCG-G----C---CC-------A-GC---C--G-GATACTGC--GG-G-AG--TT------G---GG-G-CGGAGATTGGCCTCCCGT-C-C-G-C---G-C----G---ACCGTGAGCGGTTGG-CCC---------A-AAAA-A----CGAGTTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TCGCATC--A-TGTCGTGGGGC-G-CCTAGTCCGCAGCGA--GCT--CC---GACCC--TGT-G-CA--C-C-T-G--A-TT-CG--C-T-C--T-C--G--G-GCG-ACGGTGCTT-CGACC Ilex_opaca C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--AC--A--T--G--C--T-G-GGGGGTTTGAG--A--A--GGGGTGCGTGAG----CCCCCC{GT}-AA--CACACT--CCCC-CA-------C-CT-C--GG-GA-T-TTT-GGC--TTG---CG---T-CC-CCC--T-AGC-GG-GG-A--C-TCGGTC--AAG-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCG-TTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCGTCATGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----CC--CC-C-CCA----CCC--C----AATG--CCCAC---CT-------A-G----C-TG-GATATTGC--GG-G-AG--TC------G---GG-G-CGGAAATTGGCCTCCCGT-C-C-G-C---A-C----G---ATCGTGAGCGGTTGG-CCC--------AA-AAAA-A----TGAGCTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC--A-TGTCGTGAGGC-A-CCAAGTCTGTGGCGAGCTCTAACCGT-GACCC--TGC-G-CA--C-C--------CT-C---T-T-C----A-------GCG-ATGGTGCTT-CGACC Ilex_paraguariensis C--AACGTAGA-CCCGGCGAACT-TGTT-----AAA--AT--A--C--G--C--TGG-GGGGGTTTGGG--A--A--GGGGTGCGCGAG----CCCCCCCGAA--CACACT-CCCCCGC--------C-CT-C--GG-GA---CTG-GGC--TTG---TGTTCC-CCTCCC--TAGGGGGG-GG-A--C-TCGGTC--GAG-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TGTCTGTGCCAAGGAACCATAAC-CGAAG-AGCTGG-TCTCCCG-ATGT-CCCGTTCGCGGTGCGC--AC----G-GGAGGCATT-TGCATCTTTTTGA--AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----C--CC-C-CAA----CCC--C----AATG------C---C---------------C--G-GATGTTGCGGGG-G-AG--TT-----GG---GG-G-CGGAAATTGGCCTCCCGT-C-C-A-C---A-{CT}----G---ATCGTGAGCGGTTGG-CCC---------A-AAAA-G----TGAGTTCC-TG-A-CGACGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC--A-TGTCGTGAGGC-G-CCTAGTCTGTAGCGAGCTCTAACCGTGGACCC--TGC-G-CA--C-C-T-A--A-TT-CG--T-T-C--G-A--GAAGAGCG-ACGGTGCTT-CGACC Ilex_pedunculosa C--AAAGTAGAC-CCGGCGAACT-CGTT-A---AAA-TAT--A--TG-G--C--T---GGGGGTCTGGG--A--A--GGGGTGCGCGAG-----CCCCCC-AA--CACACT--CCCC-CA---G-CCCGCT-C--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-TCGGCC--AAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGC-AAC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCAAGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC--C----AATGC-----CAAGCT-------T-G----C-TG-GGTATTGC--GG-G-AG--CT------G---GG-G-CGGAAATTGGCCTCCCGT---C---C---A-C----G---ACCGTGCGCGGTTGG-CCC---------ATAAAA-A----TGAGTTCC-TG-A-CGATTGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-A{CT}GCATC--A-AGTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTCTGATCGT-GACCC--T-TCG-CA--C-C--------TT-C---T-C-T-A--ATG-----G-G-ATGGTGCTTCCGACC Ilex_percoriacea C--AAAGTAGAC-CCGGCGAACT-CGTTA----AAAT-AT--A--T--GG-C--T---GGGGGTCTGGG--A--A--GGGGTGCGCGAG-----CCCCCC-AA--CACACT--CCCC-CA-GC--CCG-CT-C--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-TCGGCC--AAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTTTGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCA-AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------------C------CCC--C----AA--------C---CC--------------C-----A-ATTGC--GG-G-AG--TC-G----G---GG-G-CGGAAATTGGCCTCCCGT---C---C---A-C----G---AACGTGCACGGTTGG-CCC---------AAAAAA-A----TGAGTTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTC--A-TGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACCGT-GACCC--TGT-G-CA--C-C--------TC-C---T-T-C----GC------G-G-ATGGTGCTC-CGACC Ilex_pseudobuxus C--AAAGTAGAC-CCGGCGAACC-TGTT-----AAA--AT--ATTT-GG--CC-----GGGGGTTTGAG--A--A--GGGGTGCGCGAG--C--CCCCCC-GA--CACACT--CCCC-CG-----CCC-C-TC--GG-GA-T-TC--GGC--TTG---CG---T-TC-CCC--T-GCC-GG-GG-A--C-CCGGTC--GAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCG-ATGC-CCCGTTCGCGGTGTGC--AC--GGGAGGAGGCATT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGTTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG------C-CC-C-CAA----CCC--C----AACGC-----CCGGCT----A{CT}TG-G----C-TG-GACGTTGC--GG-G-AG--CT------G---GG-G-CGGAAATTGGCCTCCCGT--CC--AC---A-C----G---ACCGTGCGCGGTTGG-CCC------A--A-AAAA-AA---CGAGCTCC-TG-A-CGATGGA-CGTCCCGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC-TG--GTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTCTGATCGT-GACCC--TGT-G-CA--C-C--------TC-C--TTAT-T-A--G-G-----G-G-ACGGTGCTT-CGACC Ilex_rotunda C--AAAGTAGAC-CCGGCGAACT-CGTT-----AAA--AT--A--T--G--CG-T---GGGGGTTTGAG--A--A--GGGGTGCGCGAG-C---CCCCCC-GA--CACATT--CCCC-CA----CCCC-C--C--GG-GA-C-TT--GGC--CCG---GG---T-TC-CCC--T-TGC-GG-GG-A--C-TCGGCCA-AGG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-CGAAG-AGCTGG-CCCCCCG-{AG}TGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCGTA-CGCATC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-C------CC-C-CAAC---CCCGAC----AATGC-----CCGGCT-GGC---A-G----C-CG-GATATTGC--GG-G-AG--TT------GC--GG-G-CGGAGATTGGCCTCCCGT---C---C---A-C----G---ACCGTGCACGGTTGG-CCC---------A-AAAA-GC----GAGTTCT-TG-A-CGACGGA-CGTCACGACGAGTGGTGGTTGGA-A-GAC-CTC-TTGCGTCG-A--GTCGTGAGGC-ACCCGAGTCTGTAACGAGCTCTGACCGC-GACCC--TGT-G-CG--C-C--------TT-C---C-T-T-A--G-G-----G-G-GCGGCGCTC-CGACC Ilex_rugosa C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--A--T--GC-C--T---GGGGGTTTGAG--A--A--GGGGTGCGCGAG-----CCCCCC-AA--CACACT--CCCC-CA-------C-CT-C--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-TTGGTC--AAG-CTA--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCTG-TTGT-CCCGTCTGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CCAC-CAA----CCC--C----AATG------C---CT-------A-G----C-TG-GATATTG{AC}--GG-G-AG--TT-G----G---GG-G-CGGAAATTGGCCTCCCGT---C---C---A-C----G---AACGTGCGCGGTTGG-CCC-A-------AAAAAA-A----TGAGTTCT-TG-A-CGATGGA-CGTCACGATAAGTGGTGGTTGAA-A-GAC-CTA-TTGCGTC--A-TGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACCGT-GACCC--TGT-G-CA--C-C--------TT-C---T-T-C----AT------G-G-ATGGTGCTT-CGACC Ilex_serrata C--AAAATAGAC-C{CT}GGCGAACT-TGTT-----AAA--AT--A--T--G--CT-T---GGGGGTTTGAG--A--A--GGGGTGCGCGAG--T--CCCCCC-GA--CACACT--CCCC-CA-----CCC-C--C--GG-GA-T-TT--GGC--TTG---CG---T-CC-CCC--T-AGC-GG-GG-A--C-TCGGTC--AAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCTTAAC-CGAAG-AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCGTA-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACACATCACGTCG--------CC-C-CAA----CCC--C----AATGC-----CTAGTT-------G-G----T-TA-GGCATTGT--TG-G-AG--TT----G-G---GG-G-CGGAAATTGGCCTCCCGT---C---C---A-C----G---ATTGTGCGCGGTTGG-CCC-----------AAAA-AA---TGAGTTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC-AA--GTCGTGAGGC-A-CCGAGTCTGTAACGAGCTCTAACCGT-GACCC--TGT-G-CA--C-C--------TT-C---T-T-T-A--G-G-----G-G-ATGGTGCTC-CGACC Ilex_taubertiana C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--ATTT-GG--CC-----GGGGGTTTGAG--A--A-GGGGGTGCGCGAG--C--CCCCCC-{AG}A--CACA{CT}T--CCCC-CG------CC-C-T---GG-GA-T-TT-GGGT--TTG---CG---T-TC-CCC--T-ACC-GG-GG-A--C-CCGGT{CG}--GAG-CTC--CCG-{AC}C---ACCAA{AC}---CCCCGGCGC-TGTTTGCGCCAAGGAACCTTAAC-TGAA?-A?CTGGCCCCCCCG-ATGT-CCCGTTC?CGGTGTGC--AC---GG-GGAGGCATT-TGCGTC-TTTTG---AATT----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGT{CT}TGCCTGGGCGTCACGCATCACGT{CT}G--------CC-C-CAA----CCC--C----AATGC-----CCGGCT----ACTA-{AG}----C-TG-GACGTT{CT}C--GG-G-A{AG}--CT------G---GG-G-CGGAAATTGGCCTCCCGT--CC--AC---A-C----G---ACCGTGGGCGGTTGG-CCC---AAAA--A-AAAA-AA---TGAGCTCT-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GGC-CTC-TTGCGTC-TA--GTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTTTGATCGT-GACCC--TGT-G-CG--C-C--------TC-C--TTAT-T-A--G-G-----G-G-ACGGTGCTT-CGACC Ilex_theezans C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--ATTT-GG--CC----GGGGGGTTTGAG--A--A--GGGGTGCGCGAG--C--CCCCCC-GA--CACA{CT}T--CCCC-CG-----CCC-C--C--GG-GA-T-TT--GG{CGT}--TTG---{CG}G---T-TC-CCC--T-AGC-GG-GG-A--C-CCGGCC--GAG-CTC--CCG-AC---AACGAA---CCCCGG{CG}G{CG}-TGTCTGCGCCAAGGAACCTTAAC-TGAA{AG}AAGCT{AG}GCCCCCCCG-{AG}TGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC--C----AATGC-----CTGGCT----ACCA-G----C-{CT}G-GACGTTGC--GG-G-AG--CT------G---GG-G-CGGAAATTGGCCTCCCGT--CC--AC---A-C----G---{AG}CCGTG{CGT}GCGGTTGG-CCC------A--A-AAAA-AA---TGAGCT-C-TC-ACCGATGGG-{CG}GTCACG{AG}CAAGTGGTGGTTGAA-A-GGC-CTC-TAGCATC-TA--GTCGTGAGGC-{AT}-CCGAGTTTACAGCGAGCTCTGATCGT-GACCC--TGT-G-CA--C-C--------TT-C--TTAT-T-A-GG-G-----G-G-A{CT}GGTGCTT-TGACC Ilex_theezans_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--ATTT-GG--CC-----GGGGGTTTGAG--A--A--GGGGTGCGCGAG--C--CCCCCC-GA--CACACT--CCCC-CG-----CCC-C--C--GG-GA-T-TC--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-CCGGTC--GAG-CTC--CCG-TC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAA?-TGAAGAAGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGGGTGC--AC--GGG-GGAGGCATT-TGCGTC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC--C----AATGC-----CCGGCT----ACCA-G----C-TG-GACGTTGC--GG-G-AG--CT------G---GG-G-CGGAAATTGGCCTCCCGT--CC--AC---A-C----G---ACCGTGCGCGGTTGG-CCC-----AA--A-AAAA-AA---TGAGCTCC-TG-A-CGATGGG-CGTCACGACAAGTGGTGGTTGGA-A-GAC-CTC-TTGCATC-TA--GTCGTGAGGC-A-CCGAATCTGTAGCGAGCTCTGATCGT-GACCC--TGT-G-CA--C-C--------TT-C-TTTAT-T-A--G-G-----G-G-ACGGTGCTT-TGACC Ilex_vomitoria C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--AT--A--T--G--C--T---GGGGGTTTGAG--AAAAG-GGGGTGCGCGAG---CCCCCCCC-AA--CACACT--CCCC-CA-------C-CT-C--GG-GA-T-TT--GGC--TTG---TG---T-TC-CCC--T-AGC-GG-GG-A--C-TCGGTC--AAG-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC--AC----G-GGGGGTATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC--C----AATG------C---CT-------A-G----C-TG-GATATCGT--GG-G-AG--TT------G---GG-G-CGGAAATTGGCCTCCCGT---T---C---G-C----G---ACCGTGAGCGGTTGG-CCC---------A-AAAA-A----TGAGTTCC-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC--A-TGTCGTGAGGC-A-CCTAGTCTGTAGCGAGCTCTAACCGT-GACCC--TGT-G-CA--C-C--------TT-C---T-T-C----A-----G-A-G-ACGGTGCTT-CGACC Ilex_warburgii C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--AT--A--T--GC-C--T---GGGGGTTTGAG--A--A--GGGGTGCGCGAG-----CCCCCC-AA--CACACT--CCCC-CA-GC--GCC-CT-C--GG-GA-T-TT--GGC--TTG---CG---T-TC-CCC--T-AGC-GG-GG-A--C-TCGGTC--AAG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CCAC-CAA----CCC--C----AATG------C---CC-------G-G----C-TG-GATATTAC--GG-G-AG--TT-G----G---GG-G-CGGAAATTGGCCTCCCGTC--CA--T---A-T----G---AACGCGCGCGGTTGG-CCC----------AAAAA-A----TGAGTTCT-TG-A-CGATGGA-CGTCACGGCAAGTGGTGGTTGAA-A-GAC-CTC-TTGCGTC--A-TGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACTGC-GACCC--TGT-G-CA-CC-C--------TTCC---T-T-C----AC------G-G-ATGGTGCTC-CGACC Ilex_yunnanensis C--AAAGTAGAC-CCAGCGAACT-TGTT-----AAA--AT--A--T--G--CC-C---GGGGGTTTGAG--A--A--GGGGTGCGCGAG-----CCCCCC-GA--CACAAT--CCCC-CA-----CCC-C--C--GG-GA-T-CT--GGC--TTG---CG---T-TC-CCA--T-AGC-GG-GG-A--C-TGGGTC--AGG-CTC--CCG-GC---AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAATCTTAAC-TGAAG-AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATA-TGCATC-TTTTG--AAATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC--C----AATGC-----CTAGCT-------A-G----C-TG-GATATTGC--GG-G-AG--TT------G---GG-G-CGGAAATTGGCCTCCCGT---C---C---A-C----G---ACCGTGCGCGGTTGG-CCC------A--A-AAAA-AA---TGAGTTCC-TG-A-CGATGGA-CGTCACGACAAGTGGTGGTTGAA-A-GAC-CTC-TTGCATC-AA--GTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTCTGACCGT-GACCC--TGC-G-CA--C-C--------TT-C---T-C-T-A--T-G-----G-G-ATGGTGCTT-CGACC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_121) = N: 1-833; CODONPOSSET CodonPositions (CHARACTERS = ITS_121) = N: 1-833; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2488] TITLE ITS_111; LINK TAXA = Taxa2; DIMENSIONS NCHAR=787; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Helwingia_chinensis C--AAAATAGA--CCCGCGAACA-TGTT---CAT-CCAT-----C----GGGGGTTGGC-G--A--GGGGTGCGCGAG--------CCCCC-AATC-CAC---CCCCTC-T-----CC-----G-GCGA--TGCT-GCT-TTGAATTG---TC-GCCAA-TGCGGTGGCATCCATTGTT--GTGTCGACTGAA-C-AACGAA---CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG-AGCCAG-TCTTCGAAAGC-CCCGTACGCGGTGCGC--TT----G-GGAGG{CT}GT-TGGCGTC-TTTAAA---ATCATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG---C---CC-C-CA-A----C--C--C-ACT-----CC----ACACA------CG--A---ATT--GCGGTGTT---GCTTTG-G--G-GG-CGGAGATTGGCCTCCCATAC--AA--AA-T---A---AGCTTGCGTGGTTGG-CC----------TAAAAG-----C-GAGTGCTCGG-GGATGGGTCTCACGATAAGTGGTGGTTAAATATGCCTC-TTGCGT-A--T--T-A-TCG--CGAGAC--AACCCA--TCT--CC---G-GCG----TGTGCT-CTTT-GA-G-A-C---C-CC----A--A----TGACGATGCTT-CGATT Helwingia_japonica C--AAAATAGA--CCCGCGAACA-TGTT---CAT-CCAT-----C-----GGGGTTGGC-G--A--GGGGTGCGCGAG--------CCCCC-AATC-CAC---CCCCTC-T-----CC-----G-GCGA--TGCT-GCT-TTGAATTG---TC-GCCAA-TGCGGTGGCATCCATTGTT--GTGTCGACTGAA-C-AACGAA---CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG-AGCCAG-TCTTCGAAAGC-CCCGTACGCGGTGCGC--TT----G-GGAGGCGT-TGGCGTC-TTTAAA---ATCATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG---C---CC-C-CA-A----C--C--C-ACT-----CC----ACACA------CG--G---ATT--GCGGTGTT---GCTTTG-G--G-GG-CGGAGATTGGCCTCCCATAC--AA--AA-T---A---AGCTTGCGTGGTTGG-CC----------TAAAAG-----C-GAGTGCTCGG-GGATGGGTCTCACGATAAGTGGTGGTTAAATATGCCTC-TTGCGT-A--T--T-A-TCG--CGAGAC--AACCCA--TCT--CC---G-GCG----TGTGCT-CTTT-GA-G-A-C---C-CC----A--A----TGACGATGCTT-CGATT Ilex_amelanchier C--AAAGTAGAC-CCGGTGAACT-TGTT---AAA-ACATG---CCC---GGGGGTTTGA-G-AA--GGGGTGCGCGAG------CCCCCCC-GA-CACACT--CCCCC--A-----CC--T--C-GGGA--T-TT-GGC-TTG-TG-T---TC-CCCTA--GCGG-GG---ACTCGGTC--AAG-CTCCCAAC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCAT-TTGCATC-TTT-CG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTTG-------CC-C-CA-A--CCC--C--CAA-TT----CCTATATAGTT------GG--A--TATT--GTGT-A-A---G--TT--G--G-GGCCGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGAGCGGTTGGCCC----------AAAAAA-----T-GAGTTCTTGA-CGATGGACGTCACGACAAGGGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGT-GACCC--TATATGCG-C-C-----T-T-C---T-TC-------A---GTGATGGTGCTT-CGACC Ilex_anomala C--AAAGTAGAC-CCGGCGAACT-TGTT---AAA-ATATG---CAT----GGGGTTTGA-G-AA--GGGGTGCGCGAG-------CCCCCC-AA-CACACT--CCCCC--A-----CC--T--C-GGGA--T-TT-GGC-TTG-TG-T---TC-ACCTA--GTGG-AG---ACTCGGTC-AAAG-GTCCCGAC---AACGAA---CCCCGGCGC-TATATGTGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC-TATAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CC-C-CA-A---CC--C--CAA-------------T-GCT------GG--A--TATT--ACGG-G-A---G--TT--G--G-GGGCGGAAATTGGCCTCCCGT----A---CA-C---G---GCTGTGCGCGGTTGGCCC----------AAAAAT-----T-GAGCTCTGGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTTGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGT-GACCC----TGTGCA-C-C-----T-T-C---T-TT-------A--GGGAATGGTGCTT-CGACT Ilex_argentina C--AAAGTAGAC-CCGGCGAACT-TGTT-A-AAATATTTG---GGC---GGGGGTTTGA-G-AA--GGGGTGCGCGAG--C----CCCCCC-GA-CACACT--CTCCC--A----CCC--A--C-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--GTGG-GG---ACCCGGTC--GAC-CTCCCGAC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTAG-CCCCCTGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCAT-TTGCGTC-TTT-TG---A--ATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCA-------CC-C-CA-A---CC--C--CAA-TG----CC----TGGCT---ACCAGCTGGACGTT--GCGG-G-A---G--CT-----G-GGGCGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGTGCGGTTGGCCC----------AAAAAA-A---T-GAGCTCTTGA-CGATGGACGTCACCACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTATAGCGAGCTCTGATCGT-GACCC----TGTGCA-C-C-----T-T-C--TTATT-------A--GGGGATGGTGCTT-TGACC Ilex_argentina_Gbk C--AAAGTAGA--CCGGCGAACT-TGTT---AAA-ACATG----CT-G-GGGGGTTTGA-G-AA--GGGGTGCGTGAG-----C-CCCCCC-AA-CACACT-CCCCCC--A-----CC--T--C-GGGAT-T-TC-GGC-TTG-CG-T---CC-CCCTA--GCGG-GG---ACTCGGTC--AAG-CTCCCGACAA-AACGAA-C-CCCCGGCGC-TATCTGCGCCAAGGAACCACAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATCATGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCC---CC-CTCC-A---CC--C--CAA-TGCCCACC----TAGCT------GG--A--TATT--GTGG-G-AGTCG--TC--G--G-CG-CGGAAATTGGTCTCCCGT-C--CG--CA-C---G---ATCGGGAGCGGTTGGCCC-----A----AAAAAA-----T-GAGCTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAACCGT-GACCC----TGCGCA-C-C-----T-T-C---T-TC-------A---GCGATGGTGCTT-CGACC Ilex_beecheyi C--AAAGTAGAC-CCGGCGAACT-CGTT---AAA-ATATATG-GCT---GGGGGTCTGG-G-AA--GGGGTGCGCGAG-------CCCCCC-AA-CACACT--CCCCC--AGCC-CGC--T--C-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACTTGGCC--AAG-CTCCCGAC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCACAAC-TGAA--GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCA-AC----G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------------C------CC--C--CAA-------CC----C--C-----------A---ATT--GCGG-G-A---G--TC--G--G-GGGCGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGGCCC--A-------AAAAAA-----T-GAGTTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGT-GACCC----TGTGCA-C-C-----T-C-C---T-TC-------G---CGGATGGTGCTC-CGACC Ilex_brasiliensis C--AAAGTAGAC-CCGGCGAACT-TGTT-A-AAATATTTG---GCC--GGGGGGTTTGA-G-AA--GGGGTGCGCGAG--C----CCCCCC-GA-CACACT--CCCCC--G----CCC--C--C-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACCCGGCC--TAG-CTCCCGAC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAGAAGCTAGCCCCCCC-GTGT-CCCGTTCGCGGCGTGC--AC----G-GGAGGCAT-TTGCGTC-TTT-TG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CC-C-CA-A---CC--C--CAA-TG----CC----TGGCT---ACCAGCCGGACGTT--GCGG-G-A---G--TT-----G-GGGCGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGTGCGGTTGGCCC---------AAAAAAA-A---T-GAGCT-CTCACCGATGGGCGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTACAGCGAGCTCTGATCGT-GACCC----TGCGCA-C-C-----T-T-C--TTATT-------A-GGGGGATGGTGCTT-TGACC Ilex_brevicuspis C--AAAGTAGAC-CCGGCGAACT-TGTT-A-AAATATTTG---GCC---GGGGGTTTGA-G-AA-GGGGGTGCGCGAG--C----CCCCCC-GA-CACACT--CCCCC--G----CCC--C-TC-GGGA--T-TT-GGC-TTA-CG-T---TC-CCCTA--CTGG-GG---ACCCGGTC--GAG-CTCCCGAC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCAT-TTGCGTC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CC-C-CA-A---CC--C--CAA-TG----CC----TGGCT---ACTAGCTGGACGTT--GCGG-G-A---G--CT-----G-GGGCGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGGCCC--------AAAAAAAA-A---T-GAGCTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGGCCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGT-GACCC----TGTGCA-C-C-----T-C-C--TTATT-------A--GGGTATGGTGCTT-CGACC Ilex_buergeri CA-AAAGTAGAC-CCGGCGAACT-TGTT---AAA-ATATG---CCT---GGGGGTTTGA-A-AA--GGGGTGCGCGAG-------CCCCCC-AA-CACACT--CCCCC--AGCC-CCC--T--C-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACTCGGTC--AAG-CTCCCGAC---AACGAA---CCCCGGCGC-TATTTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CCAC-CA-A---CC--C--CAA-TG----CC----CAGCT------GG--A--TATT--GCGG-G-A---G--TT--G--G-GGGCGGAAATTGGCCTCCCGT----C---CA-T---G---AACGCGCGCGGTTGGCCC----------AAAAAA-----T-GAGTTCTTGA-CGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGC-GACCC----TGTGCACC-C----TT-C-C---T-TC-------A---CGGATGGTGCTC-CGACC Ilex_canariensis C--AAAGTAGAC-CCGGCGAACC-CGTT---AAA-ACATG---CCT---GGGGGTTTGA-G-AA--GGGGCGCGCAAG-------CCCCCC-GA-CGCACT--CCCCC--A---CCCC--C--CGGGGG--T-TT-GGC-TTG-GG-T---TC-CCCTA--GCGG-GG---ACCCGGTC--AGG-CTCCCGGC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-AGAAG-AGCTGG-CCCCCCGGTGTCCCCGTTCGCGGTGTGC--AC-T--G-GGAGGCAT-TTGCGTC-TTT-CG---A--ATC---TGAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGCTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCAAGGGCACGTCTGCCTGGGCGTCACCCATCACGTCG----C--CC-C-CA-A---CC--C--CAA-TG----CC----TGGCT------AGCCGGGTATC--GCGG-G-A---G--TT-----G-GGGCGGAAATTGGCCTCCCGT----C---CA-C-AGG---ACCGTGCGCGGTTGGCCC----------AAAAAA-CAAAT-GAGTTCCTGA-CGATGGGCGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGGGGCA-CCGAGTCTATGGCGAGCTCCGACCGG-GACCC----TGCGCA-C-A-----C-T-C---C-TC-------CG-GGGGATGGTGCTC-CGACC Ilex_cassine C--AAAGTAGA--CCGGCGAACT-TGTT---AAA-ACATG----CT-G-GGGGGTTTGA-G-AA--GGGGTGCGTGAG-----C-CCCCCC-AA-CACACT-CCCCCC--A-----CC--T--C-GGGAT-T-TC-GGC-TTG-CG-T---CC-CCCTA--GCGG-GG---ACTCGGTC--AAG-CTCCCGACAA-AACGAA-C-CCCCGGCGC-TATCTGCGCCAAGGAACCACAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATCATGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCC---CC-CTCC-A---CC--C--CAA-TGCCCACC----TAGCT------GG--A--TATT--GTGG-G-AGTCG--TC--G--G-GG-CGGAAATTGGCCTCCCGT-C--CG--CA-C---G---ATCGTGAGCGGTTGGCCC-----A----AAAAAA-----T-GAGCTCCTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAACCGT-GACCC----TGCGCA-C-C-----C-T-C---T-TC-------A---GCGATGGTGCTT-CGACC Ilex_collina C--AAAGTAGA--CCCGCGAACT-TGTT---AAA-ATATG----CT---GGGGGTTTGAGGTTAG-GGGGTGCGCGAG-----C-CCCCCC-AA-CACACT--CCCCC--A-----CC--T--C-GGGA--T-TT-GGCTTTG-TG-T---TC-CCCTA--GTGG-GG---ACTCGGTC--AGG-CTCCCGAC-A-AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAATCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC--AC----G-GGGGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAA{CT}GACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CC-C-CA-A---CC--C--CAA-TG----CC----TAGTT------GG--A--TATT--GTGG-G-A---G--TT--G--G-GG-CGGAAATTGGCCTCCCGT----C---CA-T---G---ACCGTGAGCGGTTGGCCC----------AAAAAA-----T-GAGTTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAATCGT-GACCC----TG{CT}GCA-C-C-----T-T-C---T-TC-------A---ACGACGGTGCTT-CGACC Ilex_cornuta C--AAAGTAGAC-CCGGCGAACT-TGTT--AAAA-ATATG---CCT---GGGGGTTTGA-G-AA--GGGGTGCGCGAG-------CCCCCC-AA-CACACT--CCCCC--AGCC-CCC--T--C-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACGCGGCC--AAG-CTCCCGAC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGGTGT-CCCGTTCGCGGCGTGC--AC----G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG-------CCAC-CA-A---CC--C--CAA-TG----CC----CAGCC------GG--A--TATT--GCGG-G-A---G--TT--G--G-GGGCGGAAATTGGCCTCC?GT----T---?A-C---G---AACGTGCGCGGTTGGCCC----------AAAAAA-----T-GAGTTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGC-GACCC----TGTGCACC-C----TT---C---T-TC-------A---CGGATGGTGCTC-CGACC Ilex_crenata C--AAAGTA{AC}A--CCGGCGAACT-TGTT---AAA-ACATG----C-CG-GGGGGTTTGA-G-AA--GGGGTGCGCGAG-----C-CCCCCC-AAT-AAGGT--TCCCCC-A-----CC--T--C-CGGA--T-TT-GGC-TTG-TTTT---CC-CCCT--GGCGG-GG-A-ACTCGGCC--CAG-CTCCCGAC-A-AACGAA---CCCCGGCGC-TGTTTGCGCCAAGGAACCATAAC-CGAAG-AGCTGG-TCTCCCGGTGC-CCCGTCCGCGGTGTGC--AC----G-GGAGGCGT-TTGCGTC-TTT-TG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C---CC-C-AACC---CC--C--CAACGG----CC----TAGCC------GG--A--TATT--GCGG-G-A---G--TT--G--G-GG-CGGAGATTGGCCTCCCGT-C--CG--CG-C---G---ACCGTGAGCGGTTGGCCC----------AAAAAA-----C-GAGTTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TCGCATCACGTCGTGGGGCG-CCTAGTCTGTAGCGA--GCT--CC---GACCC----TGTGCA-C-CT-GA-T-T-CG--C-TC---TAG-G---GCGA-GGTGCTT-CGACC Ilex_decidua C--AAAGTAGA--CCGGCGAACT-TGTT---AAA-ATATG----CT---GGGGGTTTGAGAAAAG-GGGGTGCGCGAG-----C-CCCCCC-AA-CACACT--CCCCC--A-----CC--T--C-GGGA--T-TT-GGCTTTG-TG-T---TC-CCCTA--GCGG-GG---ACTCGGTC--AAG-CTCCCGAC-A-AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC--AC----G-GGGGGTAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CC-C-CA-A---CC--C--CAA-TG----CC----TAGCT------GG--A--TATC--GTGG-G-A---G--TT--G--G-GG-CGGAAATTGGCCTCCCGT----T---CG-C---G---ACCGTGAGCGGTTGGCCC----------AAAAAA-----T-GAGTTCCTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGT-GACCC----TGTGCA-C-C-----T-T-C---T-TC-------A---GAGACGGTGCTT-CGACC Ilex_dimorphophylla C--AAAGTAGAC-CCGGCGAACT-TGTT--AAAA-ATATG---CCT---GGGGGTTTGA-G-AA--GGGGTGCGCGAG-------CCCCCC-AA-CGCACT--CCCCC--AGCC-CCC--T--C-GGGG--T-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACGCGGCC--AAG-CTCCCGAC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGGTGT-CCCGTTCGCGGCGTGC--AC----G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG-------CCAC-CA-A---CC--C--CAA-TG----CC----CAGCC------GG--A--TATT--GCGG-G-A---G--TT--G--G-GGGCGGAAATTGGCCTCCCGT----T---CA-C---G---AACGTGCGCGGTTGGCCC----------AAAAAA-----T-GAGTTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGC-GACCC----TGTGCACC-C----TT---C---T-TG-------A---CGGATGGTGCTC-CGACC Ilex_dumosa_dumosa C--AAAGTAGA--CCGGCGAACTCTGTT---AAA-ACATG----CTGG-GGGGGTTTGA-G-AA--GGGGTGCGCGAG-----C-CCCCCC-AATCACGCT--CCCCCC-A-----CC--T--C-GGGA--T-CT-GG{CT}-TTG-TTTT---CC-CCCT--GGCGG-GG-A-ACTCGGCG--GAG-CTCCCGAC-A-AACGAA---CCCCGGCGC-TGTATGCGCCAAGGACCCATAAC-CGAA{AG}-AGCTGG-TCTCCCGTTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCAT-CTGCGTC-TTT-TG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C---CC-C-AACC---CCAAA--AAACGT----CC----TAGGT------GG--A--CATT--GTGG-G-A---G--TT--G--G-GG-CGGAGATTGGCCTCCCGT-C--CA--CA-C---GT--CCCGTGAGCGGTTGGCCC----A-----AAAAAA-----C-GAGTTCTTGA-CGACGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTCTTTGCATCATGTCGTGAGGCG-CCTAGT?TGCAACGA--?CT--CC---GACCC----TGTGCA-C-CTAGT-TGTCCG--C-TG---TAG-G---GCGACGGTGCTT-CGACC Ilex_dumosa_guaranina C--AAAGTAGA--CCGGCGAACTCTGTT---AAA-ACATG----CTGG-GGGGGTTTGA-G-AA--GGGGTGCGCGAG-----C-CCCCCC-AATCACGCT--CCCCCC-A-----CC--T--C-GGGA--T-CT-GGC-TGG-TTTT---CC-CCCT--GGCGG-GG-A-ACTCGGCC--GAG-CTCCCGAC-A-AACGAA---CCCCGGCGC-TGTATGCGCCAAGGACCCATAAC-CGAAG-AGCTGG-TCTCCCGTTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCAT-CTGCGTC-TTT-TG---A--ATC---CAAAAC{CG}ACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTT?AACGCAAGTTGCGCCCAAAGCCAT?AGGCCAAGGGCACGTCT?CCTGGGCGTCACGCATCACGTCG---C---CC-C-AACC---CCAAA--AAACGT----CC----TAGGT------GG--A--CATT--GTGG-G-A---G--TT--G--G-GG-CGGAGATTGGCCTCCCGT-C--CA--CA-C---GT--CCCGTGAGCGGTTGGCCC----A-----AAAAAA-----?-GAGTTCTTGA-CGACGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTCTTCGCATCATGTCGTGAGGCG-CCTAGTCTGCAACGA--TCT--CC---GACCC----TGTGCA-C-CTAGT-TGTCCG--C-TG---TAG-G---GCGACGGTGCTT-CGACC Ilex_glabra C-AAAAGTAGAC-CCGGCGAACC-TGTT-A-AAA-ATATG---CAT---GGGGGTCTGA-G-AA--AGGGTGCGCGAG-------CCCCCC-GA-CACATT--CCCCC--A-----CC--C--C-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACTCGGTC--AAG-CTCCCGAC--AAACGAA--CCCCCGGCGC-TATCTGCGCCAAGGAACCTTAAC-{CT}GAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCAT-TTGCATC-TTT-TG-A-A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----C--CC-C-CA-AC--CC--C--CAA-TG----CC----TGGCT------AGCTGGGTATT--GCGG-G-A---G--TT-----G-GGGCGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGGCCC----------AAAAAA-----T-GAGTTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCAGACCGG-GACCCTG--TGTGCA-C-A-----T-T-C---T-TT-------A--GGGGATGGTGCTT-CGACC Ilex_integerrima C--AAAGTAGAC-CCGGCGAACT-TGTT-A-AAATATTTG---GCC---GGGGGTTTGA-G-AA--GGGGTGCGCGAG--C----CCCCCC-GA-CACACT--CCCCC--G----CCC--C--C-GGGA--T-TC-GGC-TTG-CG-T---TA-CCCTA--{AG}CGG-GG---ACCCGGTC--GAG-CTCCCGTC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAGAAGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC--AC--GGG-GGAGGCAT-TTGCGTC-TTT-CG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGT??????????GTC{CG}------CCC-C-C{AGT}-A---CC--C--CAA-AG----CC----CGGTT---ACCAGCTGGACCTT--GCGG-G-A---?--CT-----G-GGGCGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGGCCC--------?AAAAAAA-A---T-GAGCTCCTGA-CGATGGGCGTCACGACAAGTGGTGGTTGGA-AGACCTC-TTGCAT?TAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGC-GACCC----TGTGCA-C-C-----T-T-C-TTTATT-------A--GGGGACGGTGCTT-TGACC Ilex_integra C--AAAGTAGAC-CCGGCGAACT-TGTT---AAA-ATATATG-CCT---GGGGGTTTGA-G-AA--GGGGTGTGCGAG-------CCCCCC-AA-CAAAAT--TCCCC--AGCC-CCCT-T--G-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--GGGG-GG---ATTGGGCC--AAG-TTCCGGAA---AACGAA---CCCGGGCGC-TTTTTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATTT-CCCGTCCGCGGTGTGC--AC----G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------------C------CC--C--CAA-------CC----C--C-----------A---ATT--GCGG-G-A---G--TT--G--G-GGGCGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCGCGGTTGGCCCA-A-------AAAAAA-----T-GAGTTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGC-GACCC----TGTGCA-C-C-----T-T-C---T-TC-------A---CGGATGGTGCTT-CGACC Ilex_kiusiana C--AAAGTAGAC-CC{CT}GCGAACT-{CT}GTT---TAA-ATATGT--CCT---GGGGGTCAGA-C-AA--GGGGTGCGCGAGC------CCCCCC-AA-CACACT--CCCCC--AGGC-CCC--T--C-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACTCGGTC--AAG-CTCCCGAC---AACGAA---CCCCGGCGC-TATTTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------------C------CC--C--CAA-------CC----C--C-----------A---ATT--GCGG-G-A---T--T{CG}--A--G-GGGCGGAAATTGGCCTCCCGT----A---CATCT--G---AACGTGCGCGGTTGGCCCC-G-------AAAAAA-----T-G{AG}GTTCTTGA-ATAAGGACGTCACGACAAGTGTTGGTTGAA-ATACGCC-TTGAGTCATGTCTTGAGGCA-CCTAGTCTGTAACGAGCTCTGACCGC-AACTC----TGTGCAGC-C----AT-C-C---T-TC-------A---TGGATCGTGCTT-CAACC Ilex_latifolia C--AAAGTAGAC-CCGGCGAACT-TGTT---AAA-ATATG---CCT---GGGGGTTTGA-G-AA--GGGGTGCGCGAG-------CCCCCC-AA-CACACT--CCCCC--AGCC-CCC--T--C-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACTCGGTC--AAG-CTCCCGAC---AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CCAC-CA-A---CC--C--CAA-TG----CC----CAGCT------GG--A--TATT--GCGG-G-A---G--TT--G--G-GGGCGGAAATTGGCCTCCCGT----C---CA-T---G---AACGCGCGCGGTTGGCCC----------AAAAAA-----T-GAGTTCTTGA-CGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGC{AG}TCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC{CT}GC-GACCC----TGTGCACC-C----TT-C-C---T-TC-------A---CGGATGGTGCTT-CGACC Ilex_liukiuensis C--AAAGTAGAC-CCGGCGAACT-TGTT---AAA-ATATG---CCT---GGGGGTTTGA-G-AA--GGGGTGCGCGAG-------CCCCCC-AA-CACACT--CCCCC--AGCG-CCC--T--C-GGGT--T-TT-GGC-TTG-CG-T---TC-CCCTA--GTGG-GG---ACTCGGTC--AAG-CTCCCGAC---AACGAA---CCCCGGCGC-TATCTGCG----GGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCGGTTCGCGGTGTGC--AG----G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTTAATTGCAGAATCCCGTGAACCATCGAGTTTTTGATCGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CCAC-CA-A---CC--C--CAA-TG----CG----CGGCT------GG--A--TATT--ACGG-G-A---G--TT--G--G-GGGCGGAAATTGGCCTCCCGT--------TA-T---G---AACGCGCGCGGTTGGCCC----------AAAAAA-----T-GAGTTCTTGA-CGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCCTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGC-GACCC----TGTGCAAC-C----TT-C-C---T-TC-------A---CGTATGGTGCTC-CGACC Ilex_macropoda C--AAAGTAGAC-CCGGCGAACT-TGTT---AAA-ATATG---TTT---GGGGGTTTGA-G-AA--GGGGTGCGCGAG--C----CCCCCC-GA-CACACT--CCCCC--A-----CC--T--C-GGGG--T-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACTCGGTC--AGG-CTCCCGAC---AACGAA---CCCCGGCGC-TATTTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCAT-ATGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CC-C-CA-A---CC--C--CAA-TG----CC----TACCT------GGCTGGATATT--GCAG-G-A---G--TT-----G-GGGCGGAAATTGGCCTCCCGT----C---CA-C---G---ACTGTGTGTGGTTGGCCC---A------AAAAAA-A---A-GAATTCCTGA-CGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-TCGAGTCTTTGGCGAGCTCTGACCGT-GACCC----TGTGC--A-C-----T-T-C---T-TT----------CGGGATGGTGCTT-CGACC Ilex_maximowicziana C--AAAGTAGAC-CCGGCGAACT-CGTT---AAA-ATATG---CCT---GGGGGTTTGA-G-AA--GGGGTGCGCGAG-------CCCCCC-AA-CACACT--CCCCC--AGCC-CCC--T--C-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACTCGGTC--AAG-CTCCCGAC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCGGGTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG-------CCAC-CA-A---CC--C--CGA-TG----CC----CATCT------GG--A--TATT--GCGG-G-A---G--TT--G--G-GGGCGGAAATTGGCCTCCCGT----T---CA-C---G---AACGTGCGCGGTTGGCCC----------AAAAAA-----T-GAGTTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTACCGAGCTCTGGCCGC-GACCC----TGCGCACC-C----TT---C---T-TC-------A---CGGATGGTGCTC-CGACC Ilex_mertensii C--AAAGTAGAC-CCGGCGAACT-CGTT---AAA-ATATATG-GCT---GGGGGTCTGG-G-AA--GGGGTGCGCGAG-------CCCCCC-AA-CACACT--CCCCC--AGCC-CGC--T--C-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACTCGGCC--AAG-CTCCCGAC---AACGAA---CCCCGGCGC-TGTTTGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCA-AC----G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACAATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------------C------CC--C--CAA-------CC----C--C-----------A---ATT--GCGG-G-A---G--TC--G--G-GGGCGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGGCCC--A-------AAAAAA-----T-GAGTTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGT-GACCC----TGTGCA-C-C-----T-C-C---T-TC-------G---CGGATGGTGCTC-CGACC Ilex_micrococca C--AAAGTAGAC-CCGGCGAACT-TGTT---AAA-ATATG--CTTT---GGGGGTTTGA-G-AA--GGGGTGCGCGAG-------CCCCCC-GA-CACACTC-CCCCC--A-----CC--T--C-GGGA--T-TT-GGC-TTG-{CT}G-T---TC-CCCTA--GCGG-GG---ACTCGGTC--AGG-CTCCCGAC---AACGAAC--CCCCGGCGC-TATTTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCAT-ACGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CC-C-CC-A---CC--C--CAA-TG----CC----TAGCT------GGCTGGATATT--GCGG-G-A---G--TT---GGG-GGGCGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGGCCC---A------AAAAAATA---A-GAGTTCCTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCGAGTCTCTAGCGAGCTCTGATCGT-GACCC----TGCGCG-C-C-----T-C-C---T-TC----------CGGGATGGCGCTT-TGACC Ilex_microdonta C--AAAGTAGAC-CCGGCGAACT-TGTT-A-AAATATTTG---GCC---GGGGGTTTGA-G-AA--GGGGTGCGCGAG--C----CCCCCC-GA-CACACT--CCCCC--G----CCC--C-TC-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--CCGG-GG---ACCCGGTC--GAG-CTCCCGAC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTCAAC-TGAAG-AGCTGGCCCCCCCGATGC-CCCGTTCGCGGTGTGC--AC--GGGAGGAGGCAT-TTGCGTC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCATGTCG-----C-CC-C-CA-A---CC--C--CAA-CG----CC----TGGCT---ACTAGCCGGACGTT--GCGG-G-A---G--CT-----G-GGGCGGAAATTGGCCTCCCGT---CC--ACA-C---G-ACACCGTGCGCGGTTGGCCC---------AAAAAAA-A---T-GAGCTCCTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGT-GACCC----TGTGCA-C-C-----T-C-C--TTATT-------A--GGGGATGGTGCTT-CGACC Ilex_microdonta_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTTAA-AAATATTTG---GCC---GGGGGTTTGA-G-AA--GGGGTGCGCGAG--C----CCCCCC-GA-CACACT--CCCCC--G-----CC--C-TC-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--CCGG-GG---ACCCGGTC--GAG-CTCCCGAC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC--AC--GGGAGGAGGCAT-TTGCGTC-TTT-TG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-----C-CC-C-CA-A---CC--C--CAA-CG----CC----CGGCT---ACTGGCTGGACGTT--GCGG-G-G---G--CT-----G-GGGCGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGGCCC---------AAAAAAA-A---T-GAGCTCCTGA-CGATGGACGTCGCGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGT-GACCC----TGTGCA-C-C-----T-C-C--TTATT-------A--GGGGATGGGGCTT-CGACC Ilex_mitis C--AAAGTAGAC-CCGGCGAACT-TGTT---AAA-ATATG---CCT---GGGGGTTTGA-G-AA--GGGGTGCGCGAG--C----CCCCCC-GA-CACACT--CCCCC--A-----CC--T--C-GGGA-TT-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACTCGGCC--AGG-CTCCCGAA---AACGAAC--CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCGACGT-CCCGTTCGCGGTGTGC--ACG---G-GGAGGCAT-GTGCGTC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CC-C-CA-A---CC--C--CAA-TG----CC----TAGCT------AGCTGGATATT--GTGG-G-A---G--TT-----G-GGGCGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGGCCC---A------AAAAAAAA---AGGAGTTCTTGA-CGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTA-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGACCGT-GACCC----TGCGCA-C-C-----T-T-C---T-TT------AA--CGGAATGGTGCTC-CGACC Ilex_mucronata C--AAAGTAGAC-CCAGCGAACT-TGTT---AAA-ACATG---CTT---GGGGGTTTGA-G-AA--GGGGTGCGCGAG-------CCCCCC-GA-CACACT--CCCCC--A-----CC--T--C-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACTCGGTC--AAG-CTCCCGAC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCAT-TTGCATC-TTT-CG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CC-C-CA-A-CCCC--C--CAA-TT----CCTATGTACCT------GG--A--TATT--GTGG-G-A---G--AT--G--G-GG-CGGAAATTGGCCTCCCGT----A---CA-C---G---ACCGTGAGCGGTTGGCCC----------AAATAA-----T-GAGTTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGT-GACCC--TATATGCA-C-C-----T-T-C---T-TC-------A---GCGATGGTGCTT-CGACC Ilex_mutchagara C--AAAGTAGA--CCGGCGAACT-TGTT---TAA-ACATG----C-GG-GGGGG{GT}TTGA-A-AA--AGGGTTCGCGAA-----C-CCCCCC-AATCACGCT--CCCCCC-A-----CC--T--C-GGGA--T-CT-GGC-TCG-TTTT--CCC-CCCT--GGCGG-GG-A-ACTCGGCC--AAG-CTCCCGAC-A-AACGAA---CCCCGGCGC-TGTTTGCGCCAAGGAACAATAAC-CGAAG-AGCTGG-TCTCCCGGTGC-CCCGTCCGCGGCGTGC--AC----G-GGAGGCGC-TTGCGTC-TTT-TG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C---CC-C-AA-C---CC--C--CACCGG----CC----CAGCC------GG--A--TACT--GCGG-G-A---G--TT--G--G-GG-CGGAGATTGGCCTCCCGT-C--CG--CG-C---G---ACCGTGAGCGGTTGGCCC----------AAAAAA-----C-GAGTTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TCGCATCATGTCGTGGGGCG-CCTAGTCCGCAGCGA--GCT--CC---GACCC----TGTGCA-C-CT-GA-T-T-CG--C-TC---TCG-G---GCGACGGTGCTT-CGACC Ilex_opaca C--AAAGTAGA--CCGGCGAACT-TGTT---AAA-ACATG----CT-G-GGGGGTTTGA-G-AA--GGGGTGCGTGAG-----C-CCCCC{GT}-AA-CACACT--CCCCC--A-----CC--T--C-GGGAT-T-TT-GGC-TTG-CG-T---CC-CCCTA--GCGG-GG---ACTCGGTC--AAG-CTCCCGAC-A-AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGTTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCGTCATGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--CC---CC-C-CC-A---CC--C--CAA-TGCCCACC----TAGCT------GG--A--TATT--GCGG-G-A---G--TC--G--G-GG-CGGAAATTGGCCTCCCGT-C--CG--CA-C---G---ATCGTGAGCGGTTGGCCC-----A----AAAAAA-----T-GAGCTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTGGCGAGCTCTAACCGT-GACCC----TGCGCA-C-C-----C-T-C---T-TC-------A---GCGATGGTGCTT-CGACC Ilex_paraguariensis C--AACGTAGA-CCCGGCGAACT-TGTT---AAA-ATACG----CTGG-GGGGGTTTGG-G-AA--GGGGTGCGCGAG-----C-CCCCCCGAA-CACACT--CCCCCG-C-----CC--T--C-GGGA--C-TG-GGC-TTG-TGTTCC-CCTCCCTAGGGGGG-GG---ACTCGGTC--GAG-CTCCCGAC-A-AACGAA---CCCCGGCGC-TGTCTGTGCCAAGGAACCATAAC-CGAAG-AGCTGG-TCTCCCGATGT-CCCGTTCGCGGTGCGC--AC----G-GGAGGCAT-TTGCATCTTTT-TGA--A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C---CC-C-CA-A---CC--C--CAA-TG----CC-------C-------GG--A--TGTTGCGGGG-G-A---G--TT-GG--G-GG-CGGAAATTGGCCTCCCGT-C--CA--CA-{CT}---G---ATCGTGAGCGGTTGGCCC----------AAAAAG-----T-GAGTTCCTGA-CGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCG-CCTAGTCTGTAGCGAGCTCTAACCGTGGACCC----TGCGCA-C-CT-AA-T-T-CG--T-TCGAGAAG-A---GCGACGGTGCTT-CGACC Ilex_pedunculosa C--AAAGTAGAC-CCGGCGAACT-CGTT-A-AAATATATG---GCT---GGGGGTCTGG-G-AA--GGGGTGCGCGAG-------CCCCCC-AA-CACACT--CCCCC-AG----CCC-GCT-C-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACTCGGCC--AAG-CTCCCGAC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGC-AAC----G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCAAGTCTGCCTGGGCGTCACGCATCACGTCG-------CC-C-CA-A---CC--C--CAA-TG----CC----AAGCT------TGCTGGGTATT--GCGG-G-A---G--CT-----G-GGGCGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGGCCC----------ATAAAA-A---T-GAGTTCCTGA-CGATTGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-A{CT}GCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGT-GACCC----TTCGCA-C-C-----T-T-C---TCTA-------A--TGGGATGGTGCTTCCGACC Ilex_percoriacea C--AAAGTAGAC-CCGGCGAACT-CGTT---AAA-ATATATG-GCT---GGGGGTCTGG-G-AA--GGGGTGCGCGAG-------CCCCCC-AA-CACACT--CCCCC--AGCC-CGC--T--C-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACTCGGCC--AAG-CTCCCGAC---AACGAA---CCCCGGCGC-TGTTTGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCA-AC----G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------------C------CC--C--CAA-------CC----C--C-----------A---ATT--GCGG-G-A---G--TC--G--G-GGGCGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGGCCC--A-------AAAAAA-----T-GAGTTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGT-GACCC----TGTGCA-C-C-----T-C-C---T-TC-------G---CGGATGGTGCTC-CGACC Ilex_pseudobuxus C--AAAGTAGAC-CCGGCGAACC-TGTT-A-AAATATTTG---GCC---GGGGGTTTGA-G-AA--GGGGTGCGCGAG--C----CCCCCC-GA-CACACT--CCCCC--G----CCC--C-TC-GGGA--T-TC-GGC-TTG-CG-T---TC-CCCTG--CCGG-GG---ACCCGGTC--GAG-CTCCCGAC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCGATGC-CCCGTTCGCGGTGTGC--AC--GGGAGGAGGCAT-TTGCGTC-TTT-TG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGTTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-----C-CC-C-CA-A---CC--C--CAA-CG----CC----CGGCT---A{CT}TGGCTGGACGTT--GCGG-G-A---G--CT-----G-GGGCGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGGCCC---------AAAAAAA-A---C-GAGCTCCTGA-CGATGGACGTCCCGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTGGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGT-GACCC----TGTGCA-C-C-----T-C-C--TTATT-------A--GGGGACGGTGCTT-CGACC Ilex_rotunda C--AAAGTAGAC-CCGGCGAACT-CGTT---AAA-ATATG---CGT---GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C-----CCCCCC-GA-CACATT--CCCCC--A---CCCC--C--C-GGGA--C-TT-GGC-CCG-GG-T---TC-CCCTT--GCGG-GG---ACTCGGCCA-AGG-CTCCCGAC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-CGAAG-AGCTGG-CCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCGT-ACGCATC-TTT-CG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----C--CC-C-CA-AC--CC--CGACAA-TG----CC----CGGCTGGC---AGCCGGATATT--GCGG-G-A---G--TT-----GCGGGCGGAGATTGGCCTCCCGT----C---CA-C---G---ACCGTGCACGGTTGGCCC----------AAAAAG-C-----GAGTTCTTGA-CGACGGACGTCACGACGAGTGGTGGTTGGA-AGACCTC-TTGCGTCGAGTCGTGAGGCACCCGAGTCTGTAACGAGCTCTGACCGC-GACCC----TGTGCG-C-C-----T-T-C---C-TT-------AG-GGGG-CGGCGCTC-CGACC Ilex_rugosa C--AAAGTAGAC-CCGGCGAACT-TGTT---AAA-ATATG---CCT---GGGGGTTTGA-G-AA--GGGGTGCGCGAG-------CCCCCC-AA-CACACT--CCCCC--A-----CC--T--C-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACTTGGTC--AAG-CTACCGAC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCTGTTGT-CCCGTCTGCGGTGTGC--AC----G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CCAC-CA-A---CC--C--CAA-TG----CC----TAGCT------GG--A--TATT--G{AC}GG-G-A---G--TT--G--G-GGGCGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCGCGGTTGGCCC-AA-------AAAAAA-----T-GAGTTCTTGA-CGATGGACGTCACGATAAGTGGTGGTTGAA-AGACCTA-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGT-GACCC----TGTGCA-C-C-----T-T-C---T-TC-------A---TGGATGGTGCTT-CGACC Ilex_serrata C--AAAATAGAC-C{CT}GGCGAACT-TGTT---AAA-ATATG---CTT---GGGGGTTTGA-G-AA--GGGGTGCGCGAG---T---CCCCCC-GA-CACACT--CCCCC--A----CCC--C--C-GGGA--T-TT-GGC-TTG-CG-T---CC-CCCTA--GCGG-GG---ACTCGGTC--AAG-CTCCCGAC---AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCTTAAC-CGAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCGT-ATGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACACATCACGTCG-------CC-C-CA-A---CC--C--CAA-TG----CC----TAGTT------GGTTAGGCATT--GTTG-G-A---G--TT--G--G-GGGCGGAAATTGGCCTCCCGT----C---CA-C---G---ATTGTGCGCGGTTGGCCC----------AAAAAA-----T-GAGTTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAACGAGCTCTAACCGT-GACCC----TGTGCA-C-C-----T-T-C---T-TT-------A--GGGGATGGTGCTC-CGACC Ilex_taubertiana C--AAAGTAGAC-CCGGCGAACT-TGTT-A-AAATATTTG---GCC---GGGGGTTTGA-G-AA-GGGGGTGCGCGAG--C----CCCCCC-{AG}A-CACA{CT}T--CCCCC--G-----CC--C-T--GGGA--T-TTGGGT-TTG-CG-T---TC-CCCTA--CCGG-GG---ACCCGGT{CG}--GAG-CTCCCG{AC}C---ACCAA{AC}---CCCCGGCGC-TGTTTGCGCCAAGGAACCTTAAC-TGAA?-A?CTGGCCCCCCCGATGT-CCCGTTC?CGGTGTGC--AC---GG-GGAGGCAT-TTGCGTC-TTT-TG---A--ATT---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGT{CT}TGCCTGGGCGTCACGCATCACGT{CT}G-------CC-C-CA-A---CC--C--CAA-TG----CC----CGGCT---ACTA{AG}CTGGACGTT--{CT}CGG-G-A---{AG}--CT-----G-GGGCGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGGGCGGTTGGCCC------AAAAAAAAAA-A---T-GAGCTCTTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGGCCTC-TTGCGTCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTTTGATCGT-GACCC----TGTGCG-C-C-----T-C-C--TTATT-------A--GGGGACGGTGCTT-CGACC Ilex_theezans C--AAAGTAGAC-CCGGCGAACT-TGTT-A-AAATATTTG---GCC--GGGGGGTTTGA-G-AA--GGGGTGCGCGAG--C----CCCCCC-GA-CACA{CT}T--CCCCC--G----CCC--C--C-GGGA--T-TT-GG{CGT}-TTG-{CG}G-T---TC-CCCTA--GCGG-GG---ACCCGGCC--GAG-CTCCCGAC---AACGAA---CCCCGG{CG}G{CG}-TGTCTGCGCCAAGGAACCTTAAC-TGAA{AG}AAGCT{AG}GCCCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCAT-TTGCGTC-TTT-TG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CC-C-CA-A---CC--C--CAA-TG----CC----TGGCT---ACCAGC{CT}GGACGTT--GCGG-G-A---G--CT-----G-GGGCGGAAATTGGCCTCCCGT---CC--ACA-C---G---{AG}CCGTG{CGT}GCGGTTGGCCC---------AAAAAAA-A---T-GAGCT-CTCACCGATGGG{CG}GTCACG{AG}CAAGTGGTGGTTGAA-AGGCCTC-TAGCATCTAGTCGTGAGGC{AT}-CCGAGTTTACAGCGAGCTCTGATCGT-GACCC----TGTGCA-C-C-----T-T-C--TTATT-------A-GGGGGA{CT}GGTGCTT-TGACC Ilex_theezans_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT-A-AAATATTTG---GCC---GGGGGTTTGA-G-AA--GGGGTGCGCGAG--C----CCCCCC-GA-CACACT--CCCCC--G----CCC--C--C-GGGA--T-TC-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACCCGGTC--GAG-CTCCCGTC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAA?-TGAAGAAGCTGGCCCCCCCGATGT-CCCGTTCGCGGGGTGC--AC--GGG-GGAGGCAT-TTGCGTC-TTT-CG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CC-C-CA-A---CC--C--CAA-TG----CC----CGGCT---ACCAGCTGGACGTT--GCGG-G-A---G--CT-----G-GGGCGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGGCCC--------AAAAAAAA-A---T-GAGCTCCTGA-CGATGGGCGTCACGACAAGTGGTGGTTGGA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAATCTGTAGCGAGCTCTGATCGT-GACCC----TGTGCA-C-C-----T-T-C-TTTATT-------A--GGGGACGGTGCTT-TGACC Ilex_vomitoria C--AAAGTAGA--CCGGCGAACT-TGTT---AAA-ATATG----CT---GGGGGTTTGAGAAAAG-GGGGTGCGCGAG----CC-CCCCCC-AA-CACACT--CCCCC--A-----CC--T--C-GGGA--T-TT-GGC-TTG-TG-T---TC-CCCTA--GCGG-GG---ACTCGGTC--AAG-CTCCCGAC-A-AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC--AC----G-GGGGGTAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CC-C-CA-A---CC--C--CAA-TG----CC----TAGCT------GG--A--TATC--GTGG-G-A---G--TT--G--G-GG-CGGAAATTGGCCTCCCGT----T---CG-C---G---ACCGTGAGCGGTTGGCCC----------AAAAAA-----T-GAGTTCCTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGT-GACCC----TGTGCA-C-C-----T-T-C---T-TC-------A---GAGACGGTGCTT-CGACC Ilex_warburgii C--AAAGTAGAC-CCGGCGAACT-TGTT---AAA-ATATG---CCT---GGGGGTTTGA-G-AA--GGGGTGCGCGAG-------CCCCCC-AA-CACACT--CCCCC--AGCG-CCC--T--C-GGGA--T-TT-GGC-TTG-CG-T---TC-CCCTA--GCGG-GG---ACTCGGTC--AAG-CTCCCGAC---AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CCAC-CA-A---CC--C--CAA-TG----CC----CGGCT------GG--A--TATT--ACGG-G-A---G--TT--G--G-GGGCGGAAATTGGCCTCCCGT--C-C-A-TA-T---G---AACGCGCGCGGTTGGCCC----------AAAAAA-----T-GAGTTCTTGA-CGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGC-GACCC----TGTGCACC-C----TT-C-C---T-TC-------A---CGGATGGTGCTC-CGACC Ilex_yunnanensis C--AAAGTAGAC-CCAGCGAACT-TGTT---AAA-ATATG---CCC---GGGGGTTTGA-G-AA--GGGGTGCGCGAG-------CCCCCC-GA-CACAAT--CCCCC--A----CCC--C--C-GGGA--T-CT-GGC-TTG-CG-T---TC-CCATA--GCGG-GG---ACTGGGTC--AGG-CTCCCGGC---AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAATCTTAAC-TGAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCAT-ATGCATC-TTT-TG--AA--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------CC-C-CA-A---CC--C--CAA-TG----CC----TAGCT------AGCTGGATATT--GCGG-G-A---G--TT-----G-GGGCGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGGCCC---A------AAAAAA-A---T-GAGTTCCTGA-CGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGACCGT-GACCC----TGCGCA-C-C-----T-T-C---T-CT-------A--TGGGATGGTGCTT-CGACC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_111) = N: 1-787; CODONPOSSET CodonPositions (CHARACTERS = ITS_111) = N: 1-787; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2478] TITLE ITS_821; LINK TAXA = Taxa1; DIMENSIONS NCHAR=741; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Helwingia_chinensis C--AAAATAGA--CCCGCGAACA-TGTT-----CAT--CCAT--C--GG-GGGTTGG-CGAG-G--GGTGCGCGAGCC-C-CCAATCC-ACC-CCCT-CTC-CGG--C----GATGCTGCTTTGAA-TTGT-CG-C-CA-ATGCGGTGGCATCCATTGTTG-TG-TCGACTGAA-C--AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG-AGCCAG-TCTTCGAAAGC-CCCGTACGCGGTGCGC-TT--G-GGAGG{CT}GT-TGGCGTCTTTAAAAT--CATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG---------CC-C-CCA--ACC--C-ACTCCACACAC---G---AAT-TGCGGTGTTGCT---TTG----GGGG-CGGAGATTGGCCTCCCATAC--AA--AA-T---A---AGCTTGCGTGGTTGG-CCT------------AAAA-GCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTT-AAATA-TGC-CT-C-TTGCGT-ATTA-TCG--CGAGAC-A-ACCCATCTCCGG-CGTGTGCTC--TT-T--G-A--GA-----CC-C--C-----A---A---TG-ACGATGCTT-CGATT Helwingia_japonica C--AAAATAGA--CCCGCGAACA-TGTT-----CAT--CCAT--C---G-GGGTTGG-CGAG-G--GGTGCGCGAGCC-C-CCAATCC-ACC-CCCT-CTC-CGG--C----GATGCTGCTTTGAA-TTGT-CG-C-CA-ATGCGGTGGCATCCATTGTTG-TG-TCGACTGAA-C--AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG-AGCCAG-TCTTCGAAAGC-CCCGTACGCGGTGCGC-TT--G-GGAGGCGT-TGGCGTCTTTAAAAT--CATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG---------CC-C-CCA--ACC--C-ACTCCACACAC---G---GAT-TGCGGTGTTGCT---TTG----GGGG-CGGAGATTGGCCTCCCATAC--AA--AA-T---A---AGCTTGCGTGGTTGG-CCT------------AAAA-GCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTT-AAATA-TGC-CT-C-TTGCGT-ATTA-TCG--CGAGAC-A-ACCCATCTCCGG-CGTGTGCTC--TT-T--G-A--GA-----CC-C--C-----A---A---TG-ACGATGCTT-CGATT Ilex_amelanchier C--AAAGTAGAC-CCGGTGAACT-TGTT-----AAA--ACATG-C--CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C-CCCCCCG-A-CACACT-CCC-CCA-------CCTCGGGATTTGGC-TTG--TG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCAAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTTG---------CC-C-CAA-CCCC--C-AATTCCTATAT---A---GTTGGATATTGTGTAA---GTT----GGGGCCGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGGGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTG-ACCCTATA-T--GCG--CC-----TT-C--T-----T-C-A--GTG-ATGGTGCTT-CGACC Ilex_anomala C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATG-C--AT--GGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCCCA-A-CACACT-CCC-CCA-------CCTCGGGATTTGGC-TTG--TG-T-TC-ACCT-AGTGGAG-ACTCGGTCAAA-GGTCCCGAC----AACGAA----CCCCGGCGCTATA-TGTGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC-TATAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCC--C-AA--------T-------GCTGGATATTACGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----A---CA-C---G---GCTGTGCGCGGTTGG-CCC-----------AAAAA-TTGAGCTCTGGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCAAGTTGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGTG-ACCC--TG-T--GCA--CC-----TT-C--T-----T-T-A--GGGAATGGTGCTT-CGACT Ilex_argentina C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTG-G--GC-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C-CCCCCCG-A-CACACT-CTC-CCA--C----CCACGGGATTTGGC-TTG--CG-T-TC-CCCT-AGTGGGG-ACCCGGTC-GA-CCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTAG-CCCCCTGATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCGTC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCA---------CC-C-CAA--CCC--C-AATGCCTGGCT-ACC--AGCTGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGTGCGGTTGG-CCC---------A-AAAAA-ATGAGCTCTTGACGATGGACGTCACCACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTATAGCGAGCTCTGATCGTG-ACCC--TG-T--GCA--CC-----TT-C--T-----TATTAG-GGG-ATGGTGCTT-TGACC Ilex_argentina_Gbk C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ACATG-C--TG-GGGGGTT-TGAGAA--GGGGTGCGTGAG-C-CCCCCCA-A-CACACTCCCC-CCA--C----CTCGGGATTTCGGC-TTG--CG-T-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGACAA--AACGAA-C--CCCCGGCGCTATC-TGCGCCAAGGAACCACAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-CCCC----CC-CTCCA--CCC--C-AATGCCCACCT---A---GCTGGATATTGTGGGAGTCGTC----GGCG-CGGAAATTGGTCTCCCGT-C--CG--CA-C---G---ATCGGGAGCGGTTGG-CCC----------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAACCGTG-ACCC--TG-C--GCA--CC-----TT-C--T-----T-C-A--GCG-ATGGTGCTT-CGACC Ilex_beecheyi C--AAAGTAGAC-CCGGCGAACT-CGTTA----AAAT-ATATG-G--CT-GGGGGTC-TGGGAA--GGGGTGCGCGAG---CCCCCCA-A-CACACT-CCC-CCA---GCCCGCTCGGGATTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTTGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCACAAC-TGAA--GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCAAC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C----CCC--C-AA--------C--------CC-CA-ATTGCGGGA---GTCG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGG-CCC-A---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTG-ACCC--TG-T--GCA--CC-----TC-C--T-----T-C-G--CGG-ATGGTGCTC-CGACC Ilex_brasiliensis C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTG-G--CCGGGGGGTT-TGAGAA--GGGGTGCGCGAG-C-CCCCCCG-A-CACACT-CCC-CCG--C----CCCCGGGATTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACCCGGCC-TA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAGAAGCTAGCCCCCCC-GTGT-CCCGTTCGCGGCGTGC-AC--G-GGAGGCAT-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCC--C-AATGCCTGGCT-ACC--AGCCGGACGTTGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGTGCGGTTGG-CCC--------AA-AAAAA-ATGAGCTCTCACCGATGGGCGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTACAGCGAGCTCTGATCGTG-ACCC--TG-C--GCA--CC----TTC-T--T-----ATTAGG-GGG-ATGGTGCTT-TGACC Ilex_brevicuspis C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTG-G--CC-GGGGGTT-TGAGAA-GGGGGTGCGCGAG-C-CCCCCCG-A-CACACT-CCC-CCG-CC----CCTCGGGATTTGGC-TTA--CG-T-TC-CCCT-ACTGGGG-ACCCGGTC-GA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCC--C-AATGCCTGGCT-ACT--AGCTGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC-------AAA-AAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGGCCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-ACCC--TG-T--GCA--CC-----TC-C--T-----TATTAG-GGT-ATGGTGCTT-CGACC Ilex_buergeri CA-AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATG-C--CT-GGGGGTT-TGAAAA--GGGGTGCGCGAG---CCCCCCA-A-CACACT-CCC-CCA---GCCCCCTCGGGATTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA--CCC--C-AATGCC----C---A---GCTGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-T---G---AACGCGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCG-ACCC--TG-T--GCA-CCC-----TTCC--T-----T-C-A--CGG-ATGGTGCTC-CGACC Ilex_canariensis C--AAAGTAGAC-CCGGCGAACC-CGTT-----AAA--ACATG-C--CT-GGGGGTT-TGAGAA--GGGGCGCGCAAG-C-CCCCCGACG-CACTCC-CCC-ACC--C----CCCGGGGGTTTGGC-TTG--GG-T-TC-CCCT-AGCGGGG-ACCCGGTC-AG-GCTCCCGGC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-AGAAG-AGCTGG-CCCCCCGGTGTCCCCGTTCGCGGTGTGC-AC-TG-GGAGGCAT-TTGCGTC-TTTCG----AATC---TGAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGCTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCAAGGGCACGTCTGCCTGGGCGTCACCCATCACGTCG------C--CC-C-CAA--CCC--C-AATGCCTGGCT---A---GCCGGGTATCGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C-AGG---ACCGTGCGCGGTTGG-CCC--AAA----A-AACAA-ATGAGTTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGGGGCA-CCGAGTCTATGGCGAGCTCCGACCGGG-ACCC--TG-C--GCA--CA-----CT-C--C-----T-CCGG-GGG-ATGGTGCTC-CGACC Ilex_cassine C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ACATG-C--TG-GGGGGTT-TGAGAA--GGGGTGCGTGAG-C-CCCCCCA-A-CACACTCCCC-CCA--C----CTCGGGATTTCGGC-TTG--CG-T-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGACAA--AACGAA-C--CCCCGGCGCTATC-TGCGCCAAGGAACCACAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-CCCC----CC-CTCCA--CCC--C-AATGCCCACCT---A---GCTGGATATTGTGGGAGTCGTC----GGGG-CGGAAATTGGCCTCCCGT-C--CG--CA-C---G---ATCGTGAGCGGTTGG-CCC----------AAAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAACCGTG-ACCC--TG-C--GCA--CC-----CT-C--T-----T-C-A--GCG-ATGGTGCTT-CGACC Ilex_collina C--AAAGTAGA--CCCGCGAACT-TGTT-----AAA--ATATG-C--TG-GGGGTTTGAGGTTAG-GGGGTGCGCGAG-C-CCCCCCA-A-CACACT-CCC-CCA-------CCTCGGGATTTGGCTTTG--TG-T-TC-CCCT-AGTGGGG-ACTCGGTC-AG-GCTCCCGAC--A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAATCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC-AC--G-GGGGGCAT-TTGCATC-TTTTG----AATC---TAAAA{CT}GACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCC--C-AATGCC----T---A---GTTGGATATTGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-T---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAATCGTG-ACCC--TG-{CT}--GCA--CC-----TT-C--T-----T-C-A--ACG-ACGGTGCTT-CGACC Ilex_cornuta C--AAAGTAGAC-CCGGCGAACT-TGTT---A-AAA--ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCCCA-A-CACACT-CCC-CCA---GCCCCCTCGGGATTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACGCGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGGTGT-CCCGTTCGCGGCGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG---------CCAC-CAA--CCC--C-AATGCC----C---A---GCCGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCC?GT----T---?A-C---G---AACGTGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCG-ACCC--TG-T--GCA-CCC-----TT-C--T-----T-C-A--CGG-ATGGTGCTC-CGACC Ilex_crenata C--AAAGTA{AC}A--CCGGCGAACT-TGTT-----AAA--ACATG-C--CG-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C-CCCCCCA-AT-AAGGT-TCC-CCC--A----CCTCCGGATTTGGC-TTGT-TT-T-CC-CCCT-GGCGGGGAACTCGGCC-CA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCATAAC-CGAAG-AGCTGG-TCTCCCGGTGC-CCCGTCCGCGGTGTGC-AC--G-GGAGGCGT-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCC--C--CCAACGGCCT---A---GCCGGATATTGCGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGT-C--CG--CG-C---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TCGCATCACGTCGTGGGGCG-CCTAGTCTGTAGCGAGCTCCGACCCTGTGCAC--CT-G--ATT--CG-----CT-C--T-----A-G-G--GCG-A-GGTGCTT-CGACC Ilex_decidua C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ATATG-C--TG-GGGGTTTGAGAAAAG-GGGGTGCGCGAG-C-CCCCCCA-A-CACACT-CCC-CCA-------CCTCGGGATTTGGCTTTG--TG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC--A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC-AC--G-GGGGGTAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCC--C-AATGCC----T---A---GCTGGATATCGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----T---CG-C---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTG-ACCC--TG-T--GCA--CC-----TT-C--T-----T-C-A--GAG-ACGGTGCTT-CGACC Ilex_dimorphophylla C--AAAGTAGAC-CCGGCGAACT-TGTT---A-AAA--ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCCCA-A-CGCACT-CCC-CCA---GCCCCCTCGGGGTTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACGCGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGGTGT-CCCGTTCGCGGCGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG---------CCAC-CAA--CCC--C-AATGCC----C---A---GCCGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----T---CA-C---G---AACGTGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCG-ACCC--TG-T--GCA-CCC-----TT-C--T-----T-G-A--CGG-ATGGTGCTC-CGACC Ilex_dumosa_dumosa C--AAAGTAGA--CCGGCGAACTCTGTT-----AAA--ACATG-C-TGG-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C-CCCCCCA-ATCACGCT-CCC-CCC--A----CCTCGGGATCTGG{CT}-TTGT-TT-T-CC-CCCT-GGCGGGGAACTCGGCG-GA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTGTA-TGCGCCAAGGACCCATAAC-CGAA{AG}-AGCTGG-TCTCCCGTTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-CTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCC--CAAAAAACGTCCT---A---GGTGGACATTGTGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGT-C--CA--CA-C---GT--CCCGTGAGCGGTTGG-CCC----------AAAAAA-ACGAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTTGCATCATGTCGTGAGGCG-CCTAGT?TGCAACGA?CTCCGACCCTGTGCAC--CTAGTTGTC--CG-----CT-G--T-----A-G-G--GCG-ACGGTGCTT-CGACC Ilex_dumosa_guaranina C--AAAGTAGA--CCGGCGAACTCTGTT-----AAA--ACATG-C-TGG-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C-CCCCCCA-ATCACGCT-CCC-CCC--A----CCTCGGGATCTGGC-TGGT-TT-T-CC-CCCT-GGCGGGGAACTCGGCC-GA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTGTA-TGCGCCAAGGACCCATAAC-CGAAG-AGCTGG-TCTCCCGTTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-CTGCGTC-TTTTG----AATC---CAAAAC{CG}ACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTT?AACGCAAGTTGCGCCCAAAGCCAT?AGGCCAAGGGCACGTCT?CCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCC--CAAAAAACGTCCT---A---GGTGGACATTGTGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGT-C--CA--CA-C---GT--CCCGTGAGCGGTTGG-CCC----------AAAAAA-A?GAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTCGCATCATGTCGTGAGGCG-CCTAGTCTGCAACGATCTCCGACCCTGTGCAC--CTAGTTGTC--CG-----CT-G--T-----A-G-G--GCG-ACGGTGCTT-CGACC Ilex_glabra C-AAAAGTAGAC-CCGGCGAACC-TGTT----AAAA--ATATG-C--AT-GGGGGTC-TGAGAA--AGGGTGCGCGAG---CCCCCCG-A-CACATT-CCC-CCA-------CCCCGGGATTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC---AAACGAA---CCCCCGGCGCTATC-TGCGCCAAGGAACCTTAAC-{CT}GAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG--A-AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----C---CC-C-CAA-CCCC--C-AATGCCTGGCT---A---GCTGGGTATTGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCAGACCGGG-ACCCTGTG-T--GCA--CA-----TT-C--T-----T-T-A-GGGG-ATGGTGCTT-CGACC Ilex_integerrima C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTG-G--CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C-CCCCCCG-A-CACACT-CCC-CCG--C----CCCCGGGATTCGGC-TTG--CG-T-TA-CCCT-A{AG}CGGGG-ACCCGGTC-GA-GCTCCCGTC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAGAAGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC-ACGGG-GGAGGCAT-TTGCGTC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGT??????????GTC{CG}--------CCC-C-C{AGT}A--CCC--C-AAAGCCCGGTT-ACC--AGCTGGACCTTGCGGGA---?CT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC-------?AA-AAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGAAGACCTC-TTGCAT?TAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGCG-ACCC--TG-T--GCA--CC----TTC-T--T-----TATTAG-GGG-ACGGTGCTT-TGACC Ilex_integra C--AAAGTAGAC-CCGGCGAACT-TGTTA----AAAT-ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGTGCGAG--CCCCCCAA-C-AAAATT-CCC-CAG---CCCCCTTGGGGATTTGGC-TTG--CG-T-TC-CCCT-AGGGGGG-ATTGGGCC-AA-GTTCCGGAA----AACGAA----CCCGGGCGCTTTT-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATTT-CCCGTCCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C----CCC--C-AA--------C--------CC-CA-ATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCGCGGTTGGCCCA-A---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCG-ACCC--TG-T--GCA--CC-----TT-C--T-----T-C-A--CGG-ATGGTGCTT-CGACC Ilex_kiusiana C--AAAGTAGAC-CC{CT}GCGAACT-{CT}GTTT----AAAT-ATGT--C--CT-GGGGGTC-AGACAA--GGGGTGCGCGAG--CCCCCCCA-A-CACACT-CCC-CCA---GGCCCCTCGGGATTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C----CCC--C-AA--------C--------CC-CA-ATTGCGGGA---TT{CG}A---GGGG-CGGAAATTGGCCTCCCGT----A---CATCT--G---AACGTGCGCGGTTGGCCCC-G---------AAAAA-ATG{AG}GTTCTTGAATAAGGACGTCACGACAAGTGTTGGTTGAAATACGCC-TTGAGTCATGTCTTGAGGCA-CCTAGTCTGTAACGAGCTCTGACCGCA-ACTC--TG-T--GCAG-CCA----TC-C--T-----T-C-A--TGG-ATCGTGCTT-CAACC Ilex_latifolia C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCCCA-A-CACACT-CCC-CCA---GCCCCCTCGGGATTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA--CCC--C-AATGCC----C---A---GCTGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-T---G---AACGCGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGC{AG}TCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC{CT}GCG-ACCC--TG-T--GCA-CCC-----TTCC--T-----T-C-A--CGG-ATGGTGCTT-CGACC Ilex_liukiuensis C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCCCA-A-CACACT-CCC-CCA---GCGCCCTCGGGTTTTGGC-TTG--CG-T-TC-CCCT-AGTGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATC-TGCG----GGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCGGTTCGCGGTGTGC-AG--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTTAATTGCAGAATCCCGTGAACCATCGAGTTTTTGATCGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA--CCC--C-AATGCG----C---G---GCTGGATATTACGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT--------TA-T---G---AACGCGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGCCTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGCG-ACCC--TG-T--GCA-ACC-----TTCC--T-----T-C-A--CGT-ATGGTGCTC-CGACC Ilex_macropoda C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATG-T--TT-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCCCC-G-ACACAC-TCC-CCC--A----CCTCGGGGTTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AG-GCTCCCGAC----AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-ATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCC--C-AATGCCTACCT---G---GCTGGATATTGCAGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACTGTGTGTGGTTGG-CCC----A----A-AAAAA-AAGAATTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-TCGAGTCTTTGGCGAGCTCTGACCGTG-ACCC--TG-T--GCA---C-----TT-C--T-----T-T--C-GGG-ATGGTGCTT-CGACC Ilex_maximowicziana C--AAAGTAGAC-CCGGCGAACT-CGTT-----AAA--ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCCCA-A-CACACT-CCC-CCA---GCCCCCTCGGGATTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCGGGTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG---------CCAC-CAA--CCC--C-GATGCC----C---A---TCTGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----T---CA-C---G---AACGTGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTACCGAGCTCTGGCCGCG-ACCC--TG-C--GCA-CCC-----TT-C--T-----T-C-A--CGG-ATGGTGCTC-CGACC Ilex_mertensii C--AAAGTAGAC-CCGGCGAACT-CGTTA----AAAT-ATATG-G--CT-GGGGGTC-TGGGAA--GGGGTGCGCGAG---CCCCCCA-A-CACACT-CCC-CCA---GCCCGCTCGGGATTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCAAC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACAATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C----CCC--C-AA--------C--------CC-CA-ATTGCGGGA---GTCG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGG-CCC-A---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTG-ACCC--TG-T--GCA--CC-----TC-C--T-----T-C-G--CGG-ATGGTGCTC-CGACC Ilex_micrococca C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATGCT--TT-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCCCG-A-CACACT-CCC-CCC--A----CCTCGGGATTTGGC-TTG--{CT}G-T-TC-CCCT-AGCGGGG-ACTCGGTC-AG-GCTCCCGAC----AACGAAC---CCCCGGCGCTATT-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-ACGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CCA--CCC--C-AATGCCTAGCT---G---GCTGGATATTGCGGGA---GTT--GGGGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC----A----A-AAAAATAAGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCGAGTCTCTAGCGAGCTCTGATCGTG-ACCC--TG-C--GCG--CC-----TC-C--T-----T-C--C-GGG-ATGGCGCTT-TGACC Ilex_microdonta C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTG-G--CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C-CCCCCCG-A-CACACT-CCC-CCG-CC----CCTCGGGATTTGGC-TTG--CG-T-TC-CCCT-ACCGGGG-ACCCGGTC-GA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTCAAC-TGAAG-AGCTGGCCCCCCCGATGC-CCCGTTCGCGGTGTGC-ACGGGAGGAGGCAT-TTGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCATGTCG-------C-CC-C-CAA--CCC--C-AACGCCTGGCT-ACT--AGCCGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G-ACACCGTGCGCGGTTGG-CCC--------AA-AAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-ACCC--TG-T--GCA--CC-----TC-C--T-----TATTAG-GGG-ATGGTGCTT-CGACC Ilex_microdonta_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT-AA--AAA-TATTTG-G--CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C-CCCCCCG-A-CACACT-CCC-CCG--C----CCTCGGGATTTGGC-TTG--CG-T-TC-CCCT-ACCGGGG-ACCCGGTC-GA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC-ACGGGAGGAGGCAT-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-------C-CC-C-CAA--CCC--C-AACGCCCGGCT-ACT--GGCTGGACGTTGCGGGG---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC--------AA-AAAAA-ATGAGCTCCTGACGATGGACGTCGCGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-ACCC--TG-T--GCA--CC-----TC-C--T-----TATTAG-GGG-ATGGGGCTT-CGACC Ilex_mitis C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C-CCCCCCG-A-CACACT-CCC-CCA--C----CTCGGGATTTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGCC-AG-GCTCCCGAA----AACGAA--C-CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCGACGT-CCCGTTCGCGGTGTGC-AC-GG-GGAGGCAT-GTGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCC--C-AATGCCTAGCT---A---GCTGGATATTGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC--AAA----A-AAAAA-AGGAGTTCTTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTA-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGACCGTG-ACCC--TG-C--GCA--CC-----TT-C--T-----T-TAAC-GGA-ATGGTGCTC-CGACC Ilex_mucronata C--AAAGTAGAC-CCAGCGAACT-TGTT-----AAA--ACATG-C--TT-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCCCG-A-CACACT-CCC-CCA-------CCTCGGGATTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----C---CC-C-AAC-CCCC--C-AATTCCTATGT---A---CCTGGATATTGTGGGA---GAT----GGGG-CGGAAATTGGCCTCCCGT----A---CA-C---G---ACCGTGAGCGGTTGG-CCC-----------AAATA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTG-ACCCTATA-T--GCA--CC-----TT-C--T-----T-C-A--GCG-ATGGTGCTT-CGACC Ilex_mutchagara C--AAAGTAGA--CCGGCGAACT-TGTT-----TAA--ACATG-C--GG-GGGGG{GT}T-TGAAAA--AGGGTTCGCGAA-C-CCCCCCA-ATCACGCT-CCC-CCC--A----CCTCGGGATCTGGC-TCGT-TT-TCCC-CCCT-GGCGGGGAACTCGGCC-AA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACAATAAC-CGAAG-AGCTGG-TCTCCCGGTGC-CCCGTCCGCGGCGTGC-AC--G-GGAGGCGC-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA---CC--C--CCACCGGCCC---A---GCCGGATACTGCGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGT-C--CG--CG-C---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TCGCATCATGTCGTGGGGCG-CCTAGTCCGCAGCGAGCTCCGACCCTGTGCAC--CT-G--ATT--CG-----CT-C--T-----C-G-G--GCG-ACGGTGCTT-CGACC Ilex_opaca C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ACATG-C--TG-GGGGGTT-TGAGAA--GGGGTGCGTGAG-C-CCCCC{GT}A-A-CACACT-CCC-CCA--C----CTCGGGATTTTGGC-TTG--CG-T-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGTTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCGTCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---CC----CC-C-CCA--CCC--C-AATGCCCACCT---A---GCTGGATATTGCGGGA---GTC----GGGG-CGGAAATTGGCCTCCCGT-C--CG--CA-C---G---ATCGTGAGCGGTTGG-CCC----------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTGGCGAGCTCTAACCGTG-ACCC--TG-C--GCA--CC-----CT-C--T-----T-C-A--GCG-ATGGTGCTT-CGACC Ilex_paraguariensis C--AACGTAGA-CCCGGCGAACT-TGTT-----AAA--ATACG-CT-GG-GGGGGTT-TGGGAA--GGGGTGCGCGAG-C-CCCCCCG-AACACACT-CCC-CCG--C----CCTCGGGACTGGGC-TTGTGTTCC-CCTCCCTAGGGGGGGGACTCGGTC-GA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTGTC-TGTGCCAAGGAACCATAAC-CGAAG-AGCTGG-TCTCCCGATGT-CCCGTTCGCGGTGCGC-AC--G-GGAGGCAT-TTGCATCTTTTTGA---AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CCA--ACC--C---CAA-TGCCC---G---GAT-GTTGCGGGGGAG---TTG----GGGG-CGGAAATTGGCCTCCCGT-C--CA--CA-{CT}---G---ATCGTGAGCGGTTGG-CCC-----------AAAAA-GTGAGTTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCG-CCTAGTCTGTAGCGAGCTCTAACCGTGGACCC--TG-C--GCA--CC-TAA-TT-CGTTCGAGAA-G-A--GCG-ACGGTGCTT-CGACC Ilex_pedunculosa C--AAAGTAGAC-CCGGCGAACT-CGTT--A--AAA-TATATG-G--CT-GGGGGTC-TGGGAA--GGGGTGCGCGAG-C-CCCCCAACA-CACTCC-CCCAGCC--C----GCTCGGGATTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGC-AA-CG-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCAAGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCC--C-AATGCCAAGCT---T---GCTGGGTATTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC---------A-TAAAA-ATGAGTTCCTGACGATTGACGTCACGACAAGTGGTGGTTGAAAGACCTC-A{CT}GCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-ACCC--TT-C--GCA--CC-----TT-C--T-----C-TAAT-GGG-ATGGTGCTTCCGACC Ilex_percoriacea C--AAAGTAGAC-CCGGCGAACT-CGTTA----AAAT-ATATG-G--CT-GGGGGTC-TGGGAA--GGGGTGCGCGAG---CCCCCCA-A-CACACT-CCC-CCA---GCCCGCTCGGGATTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCAAC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C----CCC--C-AA--------C--------CC-CA-ATTGCGGGA---GTCG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGG-CCC-A---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTG-ACCC--TG-T--GCA--CC-----TC-C--T-----T-C-G--CGG-ATGGTGCTC-CGACC Ilex_pseudobuxus C--AAAGTAGAC-CCGGCGAACC-TGTT--A--AAA-TATTTG-G--CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C-CCCCCCG-A-CACACT-CCC-CCG-CC----CCTCGGGATTCGGC-TTG--CG-T-TC-CCCT-GCCGGGG-ACCCGGTC-GA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCGATGC-CCCGTTCGCGGTGTGC-ACGGGAGGAGGCAT-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGTTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-------C-CC-C-CAA--CCC--C-AACGCCCGGCT-A{CT}T--GGCTGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC--------AA-AAAAA-ACGAGCTCCTGACGATGGACGTCCCGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTGGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-ACCC--TG-T--GCA--CC-----TC-C--T-----TATTAG-GGG-ACGGTGCTT-CGACC Ilex_rotunda C--AAAGTAGAC-CCGGCGAACT-CGTT-----AAA--ATATG-C--GT-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C-CCCCCCG-A-CACATT-CCC-CCAC-C----CCCCGGGACTTGGC-CCG--GG-T-TC-CCCT-TGCGGGG-ACTCGGCC-AAGGCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-CGAAG-AGCTGG-CCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCGT-ACGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGC--------CC-C-CAAC-CCCGAC-AATGCCCGGCTG--GCA-GCCGGATATTGCGGGA---GTT-G--CGGG-CGGAGATTGGCCTCCCGT----C---CA-C---G---ACCGTGCACGGTTGG-CCC-----------AAAAA-GCGAGTTCTTGACGACGGACGTCACGACGAGTGGTGGTTGGAAGACCTC-TTGCGTCGAGTCGTGAGGCACCCGAGTCTGTAACGAGCTCTGACCGCG-ACCC--TG-T--GCG--CC-----TT-C--C-----T-T-AG-GGG-GCGGCGCTC-CGACC Ilex_rugosa C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCCCA-A-CACACT-CCC-CCA-------CCTCGGGATTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTTGGTC-AA-GCTACCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCTGTTGT-CCCGTCTGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA--CCC--C-AATGCC----T---A---GCTGGATATTG{AC}GGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCGCGGTTGG-CCCAA---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGATAAGTGGTGGTTGAAAGACCTA-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTG-ACCC--TG-T--GCA--CC-----TT-C--T-----T-C-A--TGG-ATGGTGCTT-CGACC Ilex_serrata C--AAAATAGAC-C{CT}GGCGAACT-TGTT-----AAA--ATATG-C--TT-GGGGGTT-TGAGAA--GGGGTGCGCGAG-T-CCCCCCG-A-CACACT-CCC-CCA--C----CCCCGGGATTTGGC-TTG--CG-T-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCTTAAC-CGAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCGT-ATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACACATCACGTCG---------CC-C-CAA--CCC--C-AATGCCTAGTT---G---GTTAGGCATTGTTGGA---GTT-G--GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ATTGTGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAACGAGCTCTAACCGTG-ACCC--TG-T--GCA--CC-----TT-C--T-----T-T-AG-GGG-ATGGTGCTC-CGACC Ilex_taubertiana C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTG-G--CC-GGGGGTT-TGAGAA-GGGGGTGCGCGAG-C-CCCCCC{AG}-A-CACA{CT}T-CCC-CCG--C----CCTGGGATTTGGGT-TTG--CG-T-TC-CCCT-ACCGGGG-ACCCGGT{CG}-GA-GCTCCCG{AC}C----ACCAA{AC}----CCCCGGCGCTGTT-TGCGCCAAGGAACCTTAAC-TGAA?-A?CTGGCCCCCCCGATGT-CCCGTTC?CGGTGTGC-AC-GG-GGAGGCAT-TTGCGTC-TTTTG----AATT---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGT{CT}TGCCTGGGCGTCACGCATCACGT{CT}G---------CC-C-CAA--CCC--C-AATGCCCGGCT-ACT--A{AG}CTGGACGTT{CT}CGGGA---{AG}CT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGGGCGGTTGG-CCC-----AAAAA-AAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGGCCTC-TTGCGTCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTTTGATCGTG-ACCC--TG-T--GCG--CC-----TC-C--T-----TATTAG-GGG-ACGGTGCTT-CGACC Ilex_theezans C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTG-G--CCGGGGGGTT-TGAGAA--GGGGTGCGCGAG-C-CCCCCCG-A-CACA{CT}T-CCC-CCG--C----CCCCGGGATTTGG{CGT}-TTG--{CG}G-T-TC-CCCT-AGCGGGG-ACCCGGCC-GA-GCTCCCGAC----AACGAA----CCCCGG{CG}G{CG}TGTC-TGCGCCAAGGAACCTTAAC-TGAA{AG}AAGCT{AG}GCCCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCC--C-AATGCCTGGCT-ACC--AGC{CT}GGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---{AG}CCGTG{CGT}GCGGTTGG-CCC--------AA-AAAAA-ATGAGCTCTCACCGATGGG{CG}GTCACG{AG}CAAGTGGTGGTTGAAAGGCCTC-TAGCATCTAGTCGTGAGGC{AT}-CCGAGTTTACAGCGAGCTCTGATCGTG-ACCC--TG-T--GCA--CC----TTC-T--T-----ATTAGG-GGG-A{CT}GGTGCTT-TGACC Ilex_theezans_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTG-G--CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C-CCCCCCG-A-CACACT-CCC-CCG--C----CCCCGGGATTCGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACCCGGTC-GA-GCTCCCGTC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAA?-TGAAGAAGCTGGCCCCCCCGATGT-CCCGTTCGCGGGGTGC-ACGGG-GGAGGCAT-TTGCGTC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCC--C-AATGCCCGGCT-ACC--AGCTGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC-------AAA-AAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAATCTGTAGCGAGCTCTGATCGTG-ACCC--TG-T--GCA--CC----TTC-T--T-----TATTAG-GGG-ACGGTGCTT-TGACC Ilex_vomitoria C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ATATG-C--TG-GGGGTTTGAGAAAAG-GGGGTGCGCGAGCC-CCCCCCA-A-CACACT-CCC-CCA-------CCTCGGGATTTGGC-TTG--TG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC--A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC-AC--G-GGGGGTAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCC--C-AATGCC----T---A---GCTGGATATCGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----T---CG-C---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTG-ACCC--TG-T--GCA--CC-----TT-C--T-----T-C-A--GAG-ACGGTGCTT-CGACC Ilex_warburgii C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATG-C--CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCCCA-A-CACACT-CCC-CCA---GCGCCCTCGGGATTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA--CCC--C-AATGCC----C---G---GCTGGATATTACGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT--C-C-A-TA-T---G---AACGCGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGCG-ACCC--TG-T--GCA-CCC-----TTCC--T-----T-C-A--CGG-ATGGTGCTC-CGACC Ilex_yunnanensis C--AAAGTAGAC-CCAGCGAACT-TGTT-----AAA--ATATG-C--CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCCCG-A-CACAAT-CCC-CCA--C----CCCCGGGATCTGGC-TTG--CG-T-TC-CCAT-AGCGGGG-ACTGGGTC-AG-GCTCCCGGC----AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAATCTTAAC-TGAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-ATGCATC-TTTTG---AAATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCC--C-AATGCCTAGCT---A---GCTGGATATTGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC----A----A-AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGACCGTG-ACCC--TG-C--GCA--CC-----TT-C--T-----C-T-AT-GGG-ATGGTGCTT-CGACC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_821) = N: 1-741; CODONPOSSET CodonPositions (CHARACTERS = ITS_821) = N: 1-741; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M160] TITLE ITS_441; LINK TAXA = Taxa1; DIMENSIONS NCHAR=786; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Helwingia_chinensis C--AAAATAGAC-CC-GCGAACA-TGTT---CATCCA--T----C----G---GGGG-TTGG-C-GA--GGGGTGCGCGAG-----CCCCC-AATCCAC---CCCCT--------CT-C--C--GGCGA--TGCT-GCT-TTG--AA-T-TGT-CGCC-AAT-GCGGTGGCATCCATTGTT-GTGTCGACTGAAC---AACGAA---CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG-AGCCAG-TCTTCGAAAGC-CCCGTACGCGGTGCGC--TT----G-GGAGG{CT}GTT-GGCGTC-TTTAA---AATCATCATAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG--------CC-C-CCA----ACC-----CACT------C-----C-------ACACACGA-ATTGCGGTGTT---GCTTTG----GGGG-CGGAGATTGGCCTCCCAT---A---CAAAA-T---A---AGCTTGCGTGGTTGGCCT-----------AA-AA-GC-GAGTGCTCG-GGGATGGGTCTCACGATAAGTGGTGGTTAAATATGCCTC-TTGCGTATTATCGCGA-G-A--CAA--CC-CA-T---CTCCGGCGTGT-G-CTC--TTTG-A------------GA-C---C-CC----A------ATG-ACGATGCTT-CGATT Helwingia_japonica C--AAAATAGAC-CC-GCGAACA-TGTT---CATCCA--T----C--------GGGG-TTGG-C-GA--GGGGTGCGCGAG-----CCCCC-AATCCAC---CCCCT--------CT-C--C--GGCGA--TGCT-GCT-TTG--AA-T-TGT-CGCC-AAT-GCGGTGGCATCCATTGTT-GTGTCGACTGAAC---AACGAA---CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG-AGCCAG-TCTTCGAAAGC-CCCGTACGCGGTGCGC--TT----G-GGAGGCGTT-GGCGTC-TTTAA---AATCATCATAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG--------CC-C-CCA----ACC-----CACT------C-----C-------ACACACGG-ATTGCGGTGTT---GCTTTG----GGGG-CGGAGATTGGCCTCCCAT---A---CAAAA-T---A---AGCTTGCGTGGTTGGCCT-----------AA-AA-GC-GAGTGCTCG-GGGATGGGTCTCACGATAAGTGGTGGTTAAATATGCCTC-TTGCGTATTATCGCGA-G-A--CAA--CC-CA-T---CTCCGGCGTGT-G-CTC--TTTG-A------------GA-C---C-CC----A------ATG-ACGATGCTT-CGATT Ilex_amelanchier C--AAAGTAGAC-CCGGTGAACT-TGTT---AAAACA--TG---C----CC-GGGGGTTTGA-G-AA--GGGGTGCGCGAG---CCCCCCC-GACACACT--CCCCCA-------CC-T--C--GG-GA--T-TT-GGC-TTG--TG-T-T-C-CCCT-AGC-G-GG-GAC-TCGGTC-AA-G-CTC--CCA-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTTG--------CC-C-CAA---CCCC-----CAAT----TCCTATA-T----A--GT-TG-GATATTGTGT-A-A---G--TT-----GGGGCCGGAAATTGGCCTCCCGT---C---C---A-C---G---ACCGTGAGCGGTTGGCCC----------AAA-AA-AT-GAGTTCTTG-ACGATGGACGTCACGACAAGGGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAAC-CGT-GACCCTATATGCG-C-C--------TT-C---T-TC----A------GTG-ATGGTGCTT-CGACC Ilex_anomala C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATA--TG---C----AT--GGGGTTTGA-G-AA--GGGGTGCGCGAG----CCCCCC-AACACACT--CCCCCA-------CC-T--C--GG-GA--T-TT-GGC-TTG--TG-T-T-C-ACCT-AGT-G-GA-GAC-TCGGTCAAA-G-GTC--CCG-AC---AACGAA---CCCCGGCGC-TATATGTGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC-T-ATAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC-----CAA-------------T-------GC-TG-GATATTACGG-G-A---G--TTG----GGGG-CGGAAATTGGCCTCCCGT---A---C---A-C---G---GCTGTGCGCGGTTGGCCC----------AAA-AA-TT-GAGCTCTGG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTTGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-TGT-GACCC--TGTGCA-C-C--------TT-C---T-TT----A------GGGAATGGTGCTT-CGACT Ilex_argentina C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATTTG---G----GC-GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C--CCCCCC-GACACACT--CTCCCA------CCC-A--C--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGT-G-GG-GAC-CCGGTC-GA-C-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTAG-CCCCCTGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCGTC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCA--------CC-C-CAA----CCC-----CAAT----GCCTG-GCT-ACCA--GC-TG-GACGTTGCGG-G-A---G--CT-----GGGG-CGGAAATTGGCCTCCCGT--CC--AC---A-C---G---ACCGTGTGCGGTTGGCCC-------A--AAA-AA-AT-GAGCTCTTG-ACGATGGACGTCACCACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTATAGCGAGCTCTGAT-CGT-GACCC--TGTGCA-C-C--------TT-C--TTATT-A--G------GGG-ATGGTGCTT-TGACC Ilex_argentina_Gbk C--AAAGTAGA--CCGGCGAACT-TGTT---AAAACA--TG---C----TG-GGGGGTTTGA-G-AA--GGGGTGCGTGAG---CCCCCCC-AACACACT-CCCCCCA-------CC-T--C--GG-GAT-T-TC-GGC-TTG--CG-T-C-C-CCCT-AGC-G-GG-GAC-TCGGTC-AA-G-CTC--CCG-ACAA-AACGAA-C-CCCCGGCGC-TATCTGCGCCAAGGAACCACAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATCATGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-CCCC---CC-CTCCA----CCC-----CAATGCCCACC-----T----A--GC-TG-GATATTGTGG-G-AGTCG--TC-----GGCG-CGGAAATTGGTCTCCCGT-C-C-G-C---A-C---G---ATCGGGAGCGGTTGGCCC---------AAAA-AA-AT-GAGCTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAAC-CGT-GACCC--TGCGCA-C-C--------TT-C---T-TC----A------GCG-ATGGTGCTT-CGACC Ilex_beecheyi C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATA--TATG-G----CT-GGGGGTCTGG-G-AA--GGGGTGCGCGAG----CCCCCC-AACACACT--CCCCCAGCC---CGC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-TTGGCC-AA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCACAAC-TGAA--GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCA-AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------------C------CCC-----CAA------CC-----C--------C-----A-ATTGCGG-G-A---G--TCG----GGGG-CGGAAATTGGCCTCCCGT---C---C---A-C---G---AACGTGCACGGTTGGCCC-------A--AAA-AA-AT-GAGTTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-CGT-GACCC--TGTGCA-C-C--------TC-C---T-TC----G------CGG-ATGGTGCTC-CGACC Ilex_brasiliensis C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATTTG---G----CCGGGGGGTTTGA-G-AA--GGGGTGCGCGAG-C--CCCCCC-GACACACT--CCCCCG------CCC-C--C--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-CCGGCC-TA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAGAAGCTAGCCCCCCC-GTGT-CCCGTTCGCGGCGTGC--AC----G-GGAGGCATT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC-----CAAT----GCCTG-GCT-ACCA--GC-CG-GACGTTGCGG-G-A---G--TT-----GGGG-CGGAAATTGGCCTCCCGT--CC--AC---A-C---G---ACCGTGTGCGGTTGGCCC------AA--AAA-AA-AT-GAGCTCTCA-CCGATGGGCGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTACAGCGAGCTCTGAT-CGT-GACCC--TGCGCA-C-C--------TT-C--TTATT-A-GG------GGG-ATGGTGCTT-TGACC Ilex_brevicuspis C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATTTG---G----CC-GGGGGTTTGA-G-AA-GGGGGTGCGCGAG-C--CCCCCC-GACACACT--CCCCCG------CCC-C-TC--GG-GA--T-TT-GGC-TTA--CG-T-T-C-CCCT-ACT-G-GG-GAC-CCGGTC-GA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCGTC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC-----CAAT----GCCTG-GCT-ACTA--GC-TG-GACGTTGCGG-G-A---G--CT-----GGGG-CGGAAATTGGCCTCCCGT--CC--AC---A-C---G---ACCGTGCGCGGTTGGCCC-----AAA--AAA-AA-AT-GAGCTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGGCCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGAT-CGT-GACCC--TGTGCA-C-C--------TC-C--TTATT-A--G------GGT-ATGGTGCTT-CGACC Ilex_buergeri CA-AAAGTAGAC-CCGGCGAACT-TGTT---AAAATA--TG---C----CT-GGGGGTTTGA-A-AA--GGGGTGCGCGAG----CCCCCC-AACACACT--CCCCCAGCC---CCC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-TCGGTC-AA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TATTTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CCAC-CAA----CCC-----CAAT----GCC-----C----A--GC-TG-GATATTGCGG-G-A---G--TTG----GGGG-CGGAAATTGGCCTCCCGT---C---C---A-T---G---AACGCGCGCGGTTGGCCC----------AAA-AA-AT-GAGTTCTTG-ACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-CGC-GACCC--TGTGCA-C-CC-------TTCC---T-TC----A------CGG-ATGGTGCTC-CGACC Ilex_canariensis C--AAAGTAGAC-CCGGCGAACC-CGTT---AAAACA--TG---C----CT-GGGGGTTTGA-G-AA--GGGGCGCGCAAG----CCCCCC-GACGCACT--CCCCCA-----CCCC-C--C-GGG-GG--T-TT-GGC-TTG--GG-T-T-C-CCCT-AGC-G-GG-GAC-CCGGTC-AG-G-CTC--CCG-GC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-AGAAG-AGCTGG-CCCCCCGGTGTCCCCGTTCGCGGTGTGC--AC-T--G-GGAGGCATT-TGCGTC-TTTCG---AATC----TGAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGCTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCAAGGGCACGTCTGCCTGGGCGTCACCCATCACGTCG-----C--CC-C-CAA----CCC-----CAAT----GCCTG-GCT----A--GC-CG-GGTATCGCGG-G-A---G--TT-----GGGG-CGGAAATTGGCCTCCCGT---C---C---A-C-AGG---ACCGTGCGCGGTTGGCCC--A---AA--AAACAA-AT-GAGTTCCTG-ACGATGGGCGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGGGGCA-CCGAGTCTATGGCGAGCTCCGAC-CGG-GACCC--TGCGCA-CAC--------TC-C---T-CC-G--G------GGG-ATGGTGCTC-CGACC Ilex_cassine C--AAAGTAGA--CCGGCGAACT-TGTT---AAAACA--TG---C----TG-GGGGGTTTGA-G-AA--GGGGTGCGTGAG---CCCCCCC-AACACACT-CCCCCCA-------CC-T--C--GG-GAT-T-TC-GGC-TTG--CG-T-C-C-CCCT-AGC-G-GG-GAC-TCGGTC-AA-G-CTC--CCG-ACAA-AACGAA-C-CCCCGGCGC-TATCTGCGCCAAGGAACCACAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATCATGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-CCCC---CC-CTCCA----CCC-----CAATGCCCACC-----T----A--GC-TG-GATATTGTGG-G-AGTCG--TC-----GGGG-CGGAAATTGGCCTCCCGT-C-C-G-C---A-C---G---ATCGTGAGCGGTTGGCCC---------AAAA-AA-AT-GAGCTCCTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAAC-CGT-GACCC--TGCGCA-C-C--------CT-C---T-TC----A------GCG-ATGGTGCTT-CGACC Ilex_collina C--AAAGTAGA--CCCGCGAACT-TGTT---AAAATA--TG---C----T--GGGGGTTTGAGGTTAG-GGGGTGCGCGAG---CCCCCCC-AACACACT--CCCCCA-------CC-T--C--GG-GA--T-TT-GGCTTTG--TG-T-T-C-CCCT-AGT-G-GG-GAC-TCGGTC-AG-G-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAATCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC--AC----G-GGGGGCATT-TGCATC-TTTTG---AATC----TAAAA{CT}GACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC-----CAAT----GCC-----T----A--GT-TG-GATATTGTGG-G-A---G--TT-----GGGG-CGGAAATTGGCCTCCCGT---C---C---A-T---G---ACCGTGAGCGGTTGGCCC----------AAA-AA-AT-GAGTTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAAT-CGT-GACCC--TG{CT}GCA-C-C--------TT-C---T-TC----A------ACG-ACGGTGCTT-CGACC Ilex_cornuta C--AAAGTAGAC-CCGGCGAACT-TGTTA--AAAATA--TG---C----CT-GGGGGTTTGA-G-AA--GGGGTGCGCGAG----CCCCCC-AACACACT--CCCCCAGCC---CCC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-GCGGCC-AA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGGTGT-CCCGTTCGCGGCGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG--------CCAC-CAA----CCC-----CAAT----GCC-----C----A--GC-CG-GATATTGCGG-G-A---G--TTG----GGGG-CGGAAATTGGCCTCC?GT---T---?---A-C---G---AACGTGCGCGGTTGGCCC----------AAA-AA-AT-GAGTTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-CGC-GACCC--TGTGCA-C-CC-------TT-C---T-TC----A------CGG-ATGGTGCTC-CGACC Ilex_crenata C--AAAGTA{AC}A--CCGGCGAACT-TGTT---AAAACA--TG---C----CG-GGGGGTTTGA-G-AA--GGGGTGCGCGAG---CCCCCCCAAT-AAGGT-TCCCCCA-------CC-T--C--CG-GA--T-TT-GGC-TTGT-TT-T-C-C-CCCT-GGCGG-GG-AAC-TCGGCC-CA-G-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TGTTTGCGCCAAGGAACCATAAC-CGAAG-AGCTGG-TCTCCCGGTGC-CCCGTCCGCGGTGTGC--AC----G-GGAGGCGTT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----C---CC-C-AAC----CCC----CCAACG---GCC-----T----A--GC-CG-GATATTGCGG-G-A---G--TT-----GGGG-CGGAGATTGGCCTCCCGT-C-C-G-C---G-C---G---ACCGTGAGCGGTTGGCCC----------AAA-AA-AC-GAGTTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TCGCATCACGTCGTGGGGCG-CCTAGTCTGTAGCGAG--CT--C-C---GACCC--TGTGCA-C-C-T-G--A-TT-CG--C-TC--T-A-G--G-GCG-A-GGTGCTT-CGACC Ilex_decidua C--AAAGTAGA--CCGGCGAACT-TGTT---AAAATA--TG---C----T--GGGGGTTTGAGAAAAG-GGGGTGCGCGAG---CCCCCCC-AACACACT--CCCCCA-------CC-T--C--GG-GA--T-TT-GGCTTTG--TG-T-T-C-CCCT-AGC-G-GG-GAC-TCGGTC-AA-G-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC--AC----G-GGGGGTATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC-----CAAT----GCC-----T----A--GC-TG-GATATCGTGG-G-A---G--TT-----GGGG-CGGAAATTGGCCTCCCGT---T---C---G-C---G---ACCGTGAGCGGTTGGCCC----------AAA-AA-AT-GAGTTCCTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAAC-CGT-GACCC--TGTGCA-C-C--------TT-C---T-TC----A------GAG-ACGGTGCTT-CGACC Ilex_dimorphophylla C--AAAGTAGAC-CCGGCGAACT-TGTTA--AAAATA--TG---C----CT-GGGGGTTTGA-G-AA--GGGGTGCGCGAG----CCCCCC-AACGCACT--CCCCCAGCC---CCC-T--C--GG-GG--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-GCGGCC-AA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGGTGT-CCCGTTCGCGGCGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG--------CCAC-CAA----CCC-----CAAT----GCC-----C----A--GC-CG-GATATTGCGG-G-A---G--TTG----GGGG-CGGAAATTGGCCTCCCGT---T---C---A-C---G---AACGTGCGCGGTTGGCCC----------AAA-AA-AT-GAGTTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-CGC-GACCC--TGTGCA-C-CC-------TT-C---T-TG----A------CGG-ATGGTGCTC-CGACC Ilex_dumosa_dumosa C--AAAGTAGA--CCGGCGAACTCTGTT---AAAACA--TG---C---TGG-GGGGGTTTGA-G-AA--GGGGTGCGCGAG---CCCCCCCAATCACGCT-CCCCCCA-------CC-T--C--GG-GA--T-CT-GG{CT}-TTGT-TT-T-C-C-CCCT-GGCGG-GG-AAC-TCGGCG-GA-G-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TGTATGCGCCAAGGACCCATAAC-CGAA{AG}-AGCTGG-TCTCCCGTTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATC-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----C---CC-C-AAC----CCC--AAAAAACG---TCC-----T----A--GG-TG-GACATTGTGG-G-A---G--TT-----GGGG-CGGAGATTGGCCTCCCGT-C-C-A-C---A-C---GT--CCCGTGAGCGGTTGGCCC--------A-AAA-AA-AC-GAGTTCTTG-ACGACGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTCTTTGCATCATGTCGTGAGGCG-CCTAGT?TGCAACGA?--CT--C-C---GACCC--TGTGCA-C-C-TAGTTG-TC-CG--C-TG--T-A-G--G-GCG-ACGGTGCTT-CGACC Ilex_dumosa_guaranina C--AAAGTAGA--CCGGCGAACTCTGTT---AAAACA--TG---C---TGG-GGGGGTTTGA-G-AA--GGGGTGCGCGAG---CCCCCCCAATCACGCT-CCCCCCA-------CC-T--C--GG-GA--T-CT-GGC-TGGT-TT-T-C-C-CCCT-GGCGG-GG-AAC-TCGGCC-GA-G-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TGTATGCGCCAAGGACCCATAAC-CGAAG-AGCTGG-TCTCCCGTTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATC-TGCGTC-TTTTG---AATC----CAAAAC{CG}ACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTT?AACGCAAGTTGCGCCCAAAGCCAT?AGGCCAAGGGCACGTCT?CCTGGGCGTCACGCATCACGTCG----C---CC-C-AAC----CCC--AAAAAACG---TCC-----T----A--GG-TG-GACATTGTGG-G-A---G--TT-----GGGG-CGGAGATTGGCCTCCCGT-C-C-A-C---A-C---GT--CCCGTGAGCGGTTGGCCC--------A-AAA-AA-A?-GAGTTCTTG-ACGACGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTCTTCGCATCATGTCGTGAGGCG-CCTAGTCTGCAACGAT--CT--C-C---GACCC--TGTGCA-C-C-TAGTTG-TC-CG--C-TG--T-A-G--G-GCG-ACGGTGCTT-CGACC Ilex_glabra C-AAAAGTAGAC-CCGGCGAACC-TGTT-A-AAAATA--TG---C----AT-GGGGGTCTGA-G-AA--AGGGTGCGCGAG----CCCCCC-GACACATT--CCCCCA-------CC-C--C--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-TCGGTC-AA-G-CTC--CCG-AC--AAACGAA--CCCCCGGCGC-TATCTGCGCCAAGGAACCTTAAC-{CT}GAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG-A-AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----C--CC-C-CAA-C--CCC-----CAAT----GCCTG-GCT----A--GC-TG-GGTATTGCGG-G-A---G--TT-----GGGG-CGGAAATTGGCCTCCCGT---C---C---A-C---G---ACCGTGCGCGGTTGGCCC----------AAA-AA-AT-GAGTTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCAGAC-CGG-GACCC--TGTGTG-CAC-------ATT-C---T-TT-A--G------GGG-ATGGTGCTT-CGACC Ilex_integerrima C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATTTG---G----CC-GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C--CCCCCC-GACACACT--CCCCCG------CCC-C--C--GG-GA--T-TC-GGC-TTG--CG-T-T-A-CCCT-A{AG}C-G-GG-GAC-CCGGTC-GA-G-CTC--CCG-TC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAGAAGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC--AC--GGG-GGAGGCATT-TGCGTC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGT??????????GTC{CG}-------CCC-C-C{AGT}A----CCC-----CAAA----GCCCG-GTT-ACCA--GC-TG-GACCTTGCGG-G-A---?--CT-----GGGG-CGGAAATTGGCCTCCCGT--CC--AC---A-C---G---ACCGTGCGCGGTTGGCCC-----?AA--AAA-AA-AT-GAGCTCCTG-ACGATGGGCGTCACGACAAGTGGTGGTTGGA-AGACCTC-TTGCAT?TAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGAT-CGC-GACCC--TGTGCA-C-C--------TT-C-TTTATT-A--G------GGG-ACGGTGCTT-TGACC Ilex_integra C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATA--TATG-C----CT-GGGGGTTTGA-G-AA--GGGGTGTGCGAG----CCCCCC-AACAAAAT--TCCCCAGCC---CCC-T--TG-GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGG-G-GG-GAT-TGGGCC-AA-G-TTC--CGG-AA---AACGAA---CCCGGGCGC-TTTTTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATTT-CCCGTCCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------------C------CCC-----CAA------CC-----C--------C-----A-ATTGCGG-G-A---G--TTG----GGGG-CGGAAATTGGCCTCCCGT---C---C---A-C---G---AACGTGCGCGGTTGGCCCA------A--AAA-AA-AT-GAGTTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-CGC-GACCC--TGTGCA-C-C--------TT-C---T-TC----A------CGG-ATGGTGCTT-CGACC Ilex_kiusiana C--AAAGTAGAC-CC{CT}GCGAACT-{CT}GTT---TAAATA--TGT--C----CT-GGGGGTCAGA-C-AA--GGGGTGCGCGAGC---CCCCCC-AACACACT--CCCCCAGGC---CCC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-TCGGTC-AA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TATTTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------------C------CCC-----CAA------CC-----C--------C-----A-ATTGCGG-G-A---T--T{CG}A----GGGG-CGGAAATTGGCCTCCCGT---A---C---ATCT--G---AACGTGCGCGGTTGGCCCC------G--AAA-AA-AT-G{AG}GTTCTTGAATAA-GGACGTCACGACAAGTGTTGGTTGAA-ATACGCC-TTGAGTCATGTCTTGAGGCA-CCTAGTCTGTAACGAGCTCTGAC-CGC-AACTC--TGTGCAGC-CA-------TC-C---T-TC----A------TGG-ATCGTGCTT-CAACC Ilex_latifolia C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATA--TG---C----CT-GGGGGTTTGA-G-AA--GGGGTGCGCGAG----CCCCCC-AACACACT--CCCCCAGCC---CCC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-TCGGTC-AA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CCAC-CAA----CCC-----CAAT----GCC-----C----A--GC-TG-GATATTGCGG-G-A---G--TTG----GGGG-CGGAAATTGGCCTCCCGT---C---C---A-T---G---AACGCGCGCGGTTGGCCC----------AAA-AA-AT-GAGTTCTTG-ACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGC{AG}TCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-{CT}GC-GACCC--TGTGCA-C-CC-------TTCC---T-TC----A------CGG-ATGGTGCTT-CGACC Ilex_liukiuensis C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATA--TG---C----CT-GGGGGTTTGA-G-AA--GGGGTGCGCGAG----CCCCCC-AACACACT--CCCCCAGCG---CCC-T--C--GG-GT--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGT-G-GG-GAC-TCGGTC-AA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TATCTGCG----GGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCGGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTTAATTGCAGAATCCCGTGAACCATCGAGTTTTTGATCGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CCAC-CAA----CCC-----CAAT----GCG-----C----G--GC-TG-GATATTACGG-G-A---G--TTG----GGGG-CGGAAATTGGCCTCCCGT-------T---A-T---G---AACGCGCGCGGTTGGCCC----------AAA-AA-AT-GAGTTCTTG-ACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCCTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-TGC-GACCC--TGTGCA-A-CC-------TTCC---T-TC----A------CGT-ATGGTGCTC-CGACC Ilex_macropoda C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATA--TG---T----TT-GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C--CCCCCC-GACACACT--CCCCCA-------CC-T--C--GG-GG--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-TCGGTC-AG-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TATTTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATA-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC-----CAAT----GCCTA-CCT----G--GC-TG-GATATTGCAG-G-A---G--TT-----GGGG-CGGAAATTGGCCTCCCGT---C---C---A-C---G---ACTGTGTGTGGTTGGCCC------AA--AAA-AA-AA-GAATTCCTG-ACGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-TCGAGTCTTTGGCGAGCTCTGAC-CGT-GACCC--TGTGCA---C--------TT-C---T-TT----C------GGG-ATGGTGCTT-CGACC Ilex_maximowicziana C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATA--TG---C----CT-GGGGGTTTGA-G-AA--GGGGTGCGCGAG----CCCCCC-AACACACT--CCCCCAGCC---CCC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-TCGGTC-AA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCGGGTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG--------CCAC-CAA----CCC-----CGAT----GCC-----C----A--TC-TG-GATATTGCGG-G-A---G--TTG----GGGG-CGGAAATTGGCCTCCCGT---T---C---A-C---G---AACGTGCGCGGTTGGCCC----------AAA-AA-AT-GAGTTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTACCGAGCTCTGGC-CGC-GACCC--TGCGCA-C-CC-------TT-C---T-TC----A------CGG-ATGGTGCTC-CGACC Ilex_mertensii C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATA--TATG-G----CT-GGGGGTCTGG-G-AA--GGGGTGCGCGAG----CCCCCC-AACACACT--CCCCCAGCC---CGC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-TCGGCC-AA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTTTGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCA-AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACAATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------------C------CCC-----CAA------CC-----C--------C-----A-ATTGCGG-G-A---G--TCG----GGGG-CGGAAATTGGCCTCCCGT---C---C---A-C---G---AACGTGCACGGTTGGCCC-------A--AAA-AA-AT-GAGTTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-CGT-GACCC--TGTGCA-C-C--------TC-C---T-TC----G------CGG-ATGGTGCTC-CGACC Ilex_micrococca C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATA--TG--CT----TT-GGGGGTTTGA-G-AA--GGGGTGCGCGAG----CCCCCC-GACACACTC-CCCCCA-------CC-T--C--GG-GA--T-TT-GGC-TTG--{CT}G-T-T-C-CCCT-AGC-G-GG-GAC-TCGGTC-AG-G-CTC--CCG-AC---AACGAAC--CCCCGGCGC-TATTTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATA-CGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CCA----CCC-----CAAT----GCCTA-GCT----G--GC-TG-GATATTGCGG-G-A---G--TT--GG-GGGG-CGGAAATTGGCCTCCCGT---C---C---A-C---G---ACCGTGCGCGGTTGGCCC------AA--AAA-AATAA-GAGTTCCTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCGAGTCTCTAGCGAGCTCTGAT-CGT-GACCC--TGCGCG-C-C--------TC-C---T-TC----C------GGG-ATGGCGCTT-TGACC Ilex_microdonta C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATTTG---G----CC-GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C--CCCCCC-GACACACT--CCCCCG------CCC-C-TC--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-ACC-G-GG-GAC-CCGGTC-GA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTCAAC-TGAAG-AGCTGGCCCCCCCGATGC-CCCGTTCGCGGTGTGC--AC--GGGAGGAGGCATT-TGCGTC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCATGTCG------C-CC-C-CAA----CCC-----CAAC----GCCTG-GCT-ACTA--GC-CG-GACGTTGCGG-G-A---G--CT-----GGGG-CGGAAATTGGCCTCCCGT--CC--AC---A-C---G-ACACCGTGCGCGGTTGGCCC------AA--AAA-AA-AT-GAGCTCCTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGAT-CGT-GACCC--TGTGCA-C-C--------TC-C--TTATT-A--G------GGG-ATGGTGCTT-CGACC Ilex_microdonta_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT--AAAAATATTTG---G----CC-GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C--CCCCCC-GACACACT--CCCCCG-------CC-C-TC--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-ACC-G-GG-GAC-CCGGTC-GA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC--AC--GGGAGGAGGCATT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG------C-CC-C-CAA----CCC-----CAAC----GCCCG-GCT-ACTG--GC-TG-GACGTTGCGG-G-G---G--CT-----GGGG-CGGAAATTGGCCTCCCGT--CC--AC---A-C---G---ACCGTGCGCGGTTGGCCC------AA--AAA-AA-AT-GAGCTCCTG-ACGATGGACGTCGCGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGAT-CGT-GACCC--TGTGCA-C-C--------TC-C--TTATT-A--G------GGG-ATGGGGCTT-CGACC Ilex_mitis C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATA--TG---C----CT-GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C--CCCCCC-GACACACT--CCCCCA-------CC-T--C--GG-GA-TT-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-TCGGCC-AG-G-CTC--CCG-AA---AACGAAC--CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCGACGT-CCCGTTCGCGGTGTGC--ACG---G-GGAGGCATG-TGCGTC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC-----CAAT----GCCTA-GCT----A--GC-TG-GATATTGTGG-G-A---G--TT-----GGGG-CGGAAATTGGCCTCCCGT---C---C---A-C---G---ACCGTGCGCGGTTGGCCC------AA--AAA-AAAAAGGAGTTCTTG-ACGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTA-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGAC-CGT-GACCC--TGCGCA-C-C--------TT-C---T-TTAA--C------GGA-ATGGTGCTC-CGACC Ilex_mucronata C--AAAGTAGAC-CCAGCGAACT-TGTT---AAAACA--TG---C----TT-GGGGGTTTGA-G-AA--GGGGTGCGCGAG----CCCCCC-GACACACT--CCCCCA-------CC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-TCGGTC-AA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA--CCCCC-----CAAT----TCCTATG-T----A--CC-TG-GATATTGTGG-G-A---G--AT-----GGGG-CGGAAATTGGCCTCCCGT---A---C---A-C---G---ACCGTGAGCGGTTGGCCC----------AAA-TA-AT-GAGTTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAAC-CGT-GACCCTATATGCA-C-C--------TT-C---T-TC----A------GCG-ATGGTGCTT-CGACC Ilex_mutchagara C--AAAGTAGA--CCGGCGAACT-TGTT---TAAACA--TG---C----GG-GGGGG{GT}TTGA-A-AA--AGGGTTCGCGAA---CCCCCCCAATCACGCT-CCCCCCA-------CC-T--C--GG-GA--T-CT-GGC-TCGT-TT-TCC-C-CCCT-GGCGG-GG-AAC-TCGGCC-AA-G-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TGTTTGCGCCAAGGAACAATAAC-CGAAG-AGCTGG-TCTCCCGGTGC-CCCGTCCGCGGCGTGC--AC----G-GGAGGCGCT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----C---CC-C-AAC----CCC-----CACCG---GCC-----C----A--GC-CG-GATACTGCGG-G-A---G--TT-----GGGG-CGGAGATTGGCCTCCCGT-C-C-G-C---G-C---G---ACCGTGAGCGGTTGGCCC----------AAA-AA-AC-GAGTTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TCGCATCATGTCGTGGGGCG-CCTAGTCCGCAGCGAG--CT--C-C---GACCC--TGTGCA-C-C-T-G--A-TT-CG--C-TC--T-C-G--G-GCG-ACGGTGCTT-CGACC Ilex_opaca C--AAAGTAGA--CCGGCGAACT-TGTT---AAAACA--TG---C----TG-GGGGGTTTGA-G-AA--GGGGTGCGTGAG---CCCCCC{GT}-AACACACT--CCCCCA-------CC-T--C--GG-GAT-T-TT-GGC-TTG--CG-T-C-C-CCCT-AGC-G-GG-GAC-TCGGTC-AA-G-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGTTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCGTCATGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---CC---CC-C-CCA----CCC-----CAATGCCCACC-----T----A--GC-TG-GATATTGCGG-G-A---G--TC-----GGGG-CGGAAATTGGCCTCCCGT-C-C-G-C---A-C---G---ATCGTGAGCGGTTGGCCC---------AAAA-AA-AT-GAGCTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTGGCGAGCTCTAAC-CGT-GACCC--TGCGCA-C-C--------CT-C---T-TC----A------GCG-ATGGTGCTT-CGACC Ilex_paraguariensis C--AACGTAGA-CCCGGCGAACT-TGTT---AAAATA--CG---C--T-GG-GGGGGTTTGG-G-AA--GGGGTGCGCGAG---CCCCCCCGAACACACT-CCCCCGC-------CC-T--C--GG-GA--C-TG-GGC-TTGTGTTCC-C-CTCCCTAGGGGG-GG-GAC-TCGGTC-GA-G-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TGTCTGTGCCAAGGAACCATAAC-CGAAG-AGCTGG-TCTCCCGATGT-CCCGTTCGCGGTGCGC--AC----G-GGAGGCATT-TGCATCTTTTTGA--AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----C---CC-C-CAA----CCC-----CAAT----GCC-----C----G--GA-T--GTTG-CGGGG-G-A---G--TT----GGGGG-CGGAAATTGGCCTCCCGT-C-C-A-C---A-{CT}---G---ATCGTGAGCGGTTGGCCC----------AAA-AA-GT-GAGTTCCTG-ACGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCG-CCTAGTCTGTAGCGAGCTCTAAC-CGTGGACCC--TGCGCA-C-C-T-A--A-TT-CG--T-TC--G-A-GAAGAGCG-ACGGTGCTT-CGACC Ilex_pedunculosa C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATA--TA---TGG--CT-GGGGGTCTGG-G-AA--GGGGTGCGCGAG----CCCCCC-AACACACT--CCCCCA---G--CCCGCT-C--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-TCGGCC-AA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGC-AAC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCAAGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC-----CAAT----GCCAA-GCT----T--GC-TG-GGTATTGCGG-G-A---G--CT-----GGGG-CGGAAATTGGCCTCCCGT---C---C---A-C---G---ACCGTGCGCGGTTGGCCC-------A--TAA-AA-AT-GAGTTCCTG-ACGATTGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-A{CT}GCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGAT-CGT-GACCC--TTCGCA-C-C--------TT-C---T-CT-A--AT-----GGG-ATGGTGCTTCCGACC Ilex_percoriacea C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATA--TATG-G----CT-GGGGGTCTGG-G-AA--GGGGTGCGCGAG----CCCCCC-AACACACT--CCCCCAGCC---CGC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-TCGGCC-AA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTTTGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCA-AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------------C------CCC-----CAA------CC-----C--------C-----A-ATTGCGG-G-A---G--TCG----GGGG-CGGAAATTGGCCTCCCGT---C---C---A-C---G---AACGTGCACGGTTGGCCC-------A--AAA-AA-AT-GAGTTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-CGT-GACCC--TGTGCA-C-C--------TC-C---T-TC----G------CGG-ATGGTGCTC-CGACC Ilex_pseudobuxus C--AAAGTAGAC-CCGGCGAACC-TGTT---AAAATATTTG---G----CC-GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C--CCCCCC-GACACACT--CCCCCG------CCC-C-TC--GG-GA--T-TC-GGC-TTG--CG-T-T-C-CCCT-GCC-G-GG-GAC-CCGGTC-GA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCGATGC-CCCGTTCGCGGTGTGC--AC--GGGAGGAGGCATT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGTTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG------C-CC-C-CAA----CCC-----CAAC----GCCCG-GCT-A{CT}TG--GC-TG-GACGTTGCGG-G-A---G--CT-----GGGG-CGGAAATTGGCCTCCCGT--CC--AC---A-C---G---ACCGTGCGCGGTTGGCCC------AA--AAA-AA-AC-GAGCTCCTG-ACGATGGACGTCCCGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTGGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGAT-CGT-GACCC--TGTGCA-C-C--------TC-C--TTATT-A--G------GGG-ACGGTGCTT-CGACC Ilex_rotunda C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATA--TG---C----GT-GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C--CCCCCC-GACACATT--CCCCCA----C-CCC-C--C--GG-GA--C-TT-GGC-CCG--GG-T-T-C-CCCT-TGC-G-GG-GAC-TCGGCC-AAGG-CTC--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-CGAAG-AGCTGG-CCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCGTA-CGCATC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGC-------CC-C-CAAC---CCCGA---CAAT----GCCCG-GCTG---GCAGC-CG-GATATTGCGG-G-A---G--TT-G---CGGG-CGGAGATTGGCCTCCCGT---C---C---A-C---G---ACCGTGCACGGTTGGCCC----------AAA-AA-GC-GAGTTCTTG-ACGACGGACGTCACGACGAGTGGTGGTTGGA-AGACCTC-TTGCGTCGAGTCGTGAGGCACCCGAGTCTGTAACGAGCTCTGAC-CGC-GACCC--TGTGCG-C-C--------TT-C---C-TT-A--G------GGG-GCGGCGCTC-CGACC Ilex_rugosa C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATA--TG---C----CT-GGGGGTTTGA-G-AA--GGGGTGCGCGAG----CCCCCC-AACACACT--CCCCCA-------CC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-TTGGTC-AA-G-CTA--CCG-AC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCTGTTGT-CCCGTCTGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CCAC-CAA----CCC-----CAAT----GCC-----T----A--GC-TG-GATATTG{AC}GG-G-A---G--TTG----GGGG-CGGAAATTGGCCTCCCGT---C---C---A-C---G---AACGTGCGCGGTTGGCCC-A-----A--AAA-AA-AT-GAGTTCTTG-ACGATGGACGTCACGATAAGTGGTGGTTGAA-AGACCTA-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-CGT-GACCC--TGTGCA-C-C--------TT-C---T-TC----A------TGG-ATGGTGCTT-CGACC Ilex_serrata C--AAAATAGAC-C{CT}GGCGAACT-TGTT---AAAATA--TG---C----TT-GGGGGTTTGA-G-AA--GGGGTGCGCGAG-T--CCCCCC-GACACACT--CCCCCA------CCC-C--C--GG-GA--T-TT-GGC-TTG--CG-T-C-C-CCCT-AGC-G-GG-GAC-TCGGTC-AA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCTTAAC-CGAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCGTA-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACACATCACGTCG--------CC-C-CAA----CCC-----CAAT----GCCTA-GTT----G--GT-TA-GGCATTGTTG-G-A---G--TT-G---GGGG-CGGAAATTGGCCTCCCGT---C---C---A-C---G---ATTGTGCGCGGTTGGCCC----------AAA-AA-AT-GAGTTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAACGAGCTCTAAC-CGT-GACCC--TGTGCA-C-C--------TT-C---T-TT-A--G------GGG-ATGGTGCTC-CGACC Ilex_taubertiana C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATTTG---G----CC-GGGGGTTTGA-G-AA-GGGGGTGCGCGAG-C--CCCCCC-{AG}ACACA{CT}T--CCCCCG-------CC-C-T---GG-GA--T-TTGGGT-TTG--CG-T-T-C-CCCT-ACC-G-GG-GAC-CCGGT{CG}-GA-G-CTC--CCG-{AC}C---ACCAA{AC}---CCCCGGCGC-TGTTTGCGCCAAGGAACCTTAAC-TGAA?-A?CTGGCCCCCCCGATGT-CCCGTTC?CGGTGTGC--AC---GG-GGAGGCATT-TGCGTC-TTTTG---AATT----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGT{CT}TGCCTGGGCGTCACGCATCACGT{CT}G--------CC-C-CAA----CCC-----CAAT----GCCCG-GCT-ACTA--{AG}C-TG-GACGTT{CT}CGG-G-A---{AG}--CT-----GGGG-CGGAAATTGGCCTCCCGT--CC--AC---A-C---G---ACCGTGGGCGGTTGGCCC---AAAAA--AAA-AA-AT-GAGCTCTTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGGCCTC-TTGCGTCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTTTGAT-CGT-GACCC--TGTGCG-C-C--------TC-C--TTATT-A--G------GGG-ACGGTGCTT-CGACC Ilex_theezans C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATTTG---G----CCGGGGGGTTTGA-G-AA--GGGGTGCGCGAG-C--CCCCCC-GACACA{CT}T--CCCCCG------CCC-C--C--GG-GA--T-TT-GG{CGT}-TTG--{CG}G-T-T-C-CCCT-AGC-G-GG-GAC-CCGGCC-GA-G-CTC--CCG-AC---AACGAA---CCCCGG{CG}G{CG}-TGTCTGCGCCAAGGAACCTTAAC-TGAA{AG}AAGCT{AG}GCCCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC-----CAAT----GCCTG-GCT-ACCA--GC-{CT}G-GACGTTGCGG-G-A---G--CT-----GGGG-CGGAAATTGGCCTCCCGT--CC--AC---A-C---G---{AG}CCGTG{CGT}GCGGTTGGCCC------AA--AAA-AA-AT-GAGCTCTCA-CCGATGGG{CG}GTCACG{AG}CAAGTGGTGGTTGAA-AGGCCTC-TAGCATCTAGTCGTGAGGC{AT}-CCGAGTTTACAGCGAGCTCTGAT-CGT-GACCC--TGTGCA-C-C--------TT-C--TTATT-A-GG------GGG-A{CT}GGTGCTT-TGACC Ilex_theezans_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATTTG---G----CC-GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C--CCCCCC-GACACACT--CCCCCG------CCC-C--C--GG-GA--T-TC-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-CCGGTC-GA-G-CTC--CCG-TC---AACGAA---CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAA?-TGAAGAAGCTGGCCCCCCCGATGT-CCCGTTCGCGGGGTGC--AC--GGG-GGAGGCATT-TGCGTC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC-----CAAT----GCCCG-GCT-ACCA--GC-TG-GACGTTGCGG-G-A---G--CT-----GGGG-CGGAAATTGGCCTCCCGT--CC--AC---A-C---G---ACCGTGCGCGGTTGGCCC-----AAA--AAA-AA-AT-GAGCTCCTG-ACGATGGGCGTCACGACAAGTGGTGGTTGGA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAATCTGTAGCGAGCTCTGAT-CGT-GACCC--TGTGCA-C-C--------TT-C-TTTATT-A--G------GGG-ACGGTGCTT-TGACC Ilex_vomitoria C--AAAGTAGA--CCGGCGAACT-TGTT---AAAATA--TG---C----T--GGGGGTTTGAGAAAAG-GGGGTGCGCGAG--CCCCCCCC-AACACACT--CCCCCA-------CC-T--C--GG-GA--T-TT-GGC-TTG--TG-T-T-C-CCCT-AGC-G-GG-GAC-TCGGTC-AA-G-CTC--CCG-AC-A-AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC--AC----G-GGGGGTATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC-----CAAT----GCC-----T----A--GC-TG-GATATCGTGG-G-A---G--TT-----GGGG-CGGAAATTGGCCTCCCGT---T---C---G-C---G---ACCGTGAGCGGTTGGCCC----------AAA-AA-AT-GAGTTCCTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAAC-CGT-GACCC--TGTGCA-C-C--------TT-C---T-TC----A------GAG-ACGGTGCTT-CGACC Ilex_warburgii C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATA--TG---C----CT-GGGGGTTTGA-G-AA--GGGGTGCGCGAG----CCCCCC-AACACACT--CCCCCAGCG---CCC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-T-C-CCCT-AGC-G-GG-GAC-TCGGTC-AA-G-CTC--CCG-AC---AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CCAC-CAA----CCC-----CAAT----GCC-----C----G--GC-TG-GATATTACGG-G-A---G--TTG----GGGG-CGGAAATTGGCCTCCCGTC--CA--T---A-T---G---AACGCGCGCGGTTGGCCC----------AAA-AA-AT-GAGTTCTTG-ACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC-TGC-GACCC--TGTGCA-C-CC-------TTCC---T-TC----A------CGG-ATGGTGCTC-CGACC Ilex_yunnanensis C--AAAGTAGAC-CCAGCGAACT-TGTT---AAAATA--TG---C----CC-GGGGGTTTGA-G-AA--GGGGTGCGCGAG----CCCCCC-GACACAAT--CCCCCA------CCC-C--C--GG-GA--T-CT-GGC-TTG--CG-T-T-C-CCAT-AGC-G-GG-GAC-TGGGTC-AG-G-CTC--CCG-GC---AACGAA---CCCCGGCGC-TATCTGCGCCAAGGAATCTTAAC-TGAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATA-TGCATC-TTTTG--AAATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CAA----CCC-----CAAT----GCCTA-GCT----A--GC-TG-GATATTGCGG-G-A---G--TT-----GGGG-CGGAAATTGGCCTCCCGT---C---C---A-C---G---ACCGTGCGCGGTTGGCCC------AA--AAA-AA-AT-GAGTTCCTG-ACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGAC-CGT-GACCC--TGCGCA-C-C--------TT-C---T-CT-A--T------GGG-ATGGTGCTT-CGACC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_441) = N: 1-786; CODONPOSSET CodonPositions (CHARACTERS = ITS_441) = N: 1-786; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2486] TITLE ITS_141; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1116; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Helwingia_chinensis C--A-AA-ATAGA-C--CC---GCGAAC-A--TG--TT--------C-ATCCA---T---------C--------GGGGG-TTG-GC---G--A--GGGG-TG-CGCGAG--------CCCCC-AAT-C---C----AC------CCCC-T-----------C-TC--C--G-GCGA---TGCT---GCT-T-T--GAATT-G-----T-----CG-CCAA--T-------G--C--GGTGGCATCCAT---T-----GT---T--------G-T-G---TCGA-CT-GA--A--C-----A-A-CGAA---C-CCC-GGCGCAAA-CA------AGCGCCAAGGAA-C-C-A--TAACA-C-AAAG-AGCCAG-TCT--TC--G-AAA--------G-C-C-CC-G-T-ACGC-GGT-GCGC-T---T------G-GGAGG{CT}G----T---T-GGCGTC--TTT-AA---AATCATCATAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCCGAGGGC-AC-GTCTGCCTGGGCGTCA-CA-TGT-C-A-C-GTCGC---------CC--CCA---A-----CC--C-------A---------------------C----TC---C--A--------CACACGA--A--TTG--C--G--GT-G-TTGCT--T--TG-----G----GG-G-CGGAGATTGGCCTCCCAT---A-------CAAAA-TA---A---G-C-T--T--GC---GTGGTTGG-CCT--------------AAA--AG-----CGAG-T-GC-TC-G-G-G--GA-TG-GGTC-T-CA--CG-ATAA-GT-G-G-TGGTTAAATATG---C-CTC-----T---T-G-CGT--A-TT-------A----TCG--CGAGACAA-CCC----A-TC-T--C----CG-G-----C--G--T--GT--G-CTC-T--T-T-GA-G-A---C-C-----------C----------C----A----------------AT--G---AC-G--AT-GCTT-CGATT Helwingia_japonica C--A-AA-ATAGA-C--CC---GCGAACA---TG--TT--------C-ATCCA---T---------C---------GGGG-TTG-GC---G--A--GGGG-TG-CGCGAG--------CCCCC-AAT-C---C----AC------CCCC-T-----------C-TC--C--G-GCGA---TGCT---GCT-T-T--GAATT-G-----T-----CG-CCAA--T-------G--C--GGTGGCATCCAT---T-----GT---T--------GT--G---TCGA-CT-GA--A--C-----A-A-CGAA---C-CCC-GGCGCAAA-CA------AGCGCCAAGGAA-C-C-A--TAACA-C-AAAG-AGCCAG-TCT--TC--GA-AA--------G-C-C-CC-G-TA-CGC-GGT-GCGCT----T------G-GGAGGCG----T---TG-GCGTC--TTTA-A---AATCATCATAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCCGAGGGC-AC-GTCTGCCTGGGCGTCA-CA-TGT-C-A-C-GTCGC---------CC--CCA---A-----CC--C-------A---------------------C----TC---C--A--------CACACGG--A--TTG--C--G--GT-GT-TGCT--T--TG-----G----GG-G-CGGAGATTGGCCTCCCAT---A-------CAAAA-TA---A---G-C-T--T--GC---GTGGTTGG-CCT--------------AAA--AG-----CGAG-TG-C-TCG--G-G--GA-TG-GGTC-T-CA--CG-ATAA-GT-G-G-TGGTTAAATATG---C-CTC-----T---T-G-CGT--A-TT-------A----TCG--CGAGACAA-CCC----A-TC-T--C----CG-G-----C--G--T--GT--G-CTCT---T-T-GAG--A---C-C-----------C----------C----A----------------AT--G---AC-G--AT-GCTT-CGATT Ilex_amelanchier C--A-AA-GTAGA-C--CC-G-GTGAAC--T-TG--TT-----A-AA-AC--A---T--G-----CC----C---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG-----C-CCCCCC-GA--C--AC----AC---T--CCCC-C-A---------C-CT--C--G-G-GA---T-TT--GGC--T-T--G---T-G---T-TC----C--CC----T---A---G--C--GG-GG-A--C-T---C----GGT---C--A-----A---G--CTC---CC-A---A--C-----A-A-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C-A--TAAC--T-GAAG-AGCTGG-CCTC-CC--G---A-------TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCAT---T---T--GCATC-TTTC--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTTG----------CC--CCA---A---CCCC--C-----A-A-TT----------C-------C----T----A-TA----TA-GT-TG-GA-TA--TTG--T-----G-TA--AG------TT------G----GG-GCCGGAAATTGGCCTCCCGT----------CC---A-C----G---A-C-C-GT--GA---GCGGTTGG-CCC-------------AAAA--AA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ACAAGG--G-G-TGGTTGAA-A-G--AC-CTC-----T---T-G-C----A-TC-------AT--GTCG--TGAGGC-A-CCT----AGTC-TG-TAG--CGAGCT---CT-AACC--GT--GACCC--TATAT-GC---G---C-C--------TT-C--T-T-----C----A----------------G--TG---AT-G--GT-GCTT-CGACC Ilex_anomala C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--A---T--G------C---AT----GGGGTTTGAG----A--A--GGGG-TG-CGCGAG-------CCCCCC-AA--C--AC----AC---T--CCCC-C-A---------C-CT--C--G-G-GA---T-TT--GGC--T-T--G---T-G---T-T-----C-ACC----T---A---G--T--GG-AG-A--C-T---C----GGT---C-AA-----A--GG---TC---CC-G---A--C-----A-A-CGAA---C-CCC-GGCGC----TA--T--ATGTGCCAAGGAA-C-C-A--TAAC--T-GAAG-AGCTGG-CCTC-TC--G---A-------TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCAT---T---T--GCATC-TTTT--G---AATC-T-ATAAAATGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CCA---A----CCC--C-----A-A--------------------------T-------G--------C-TG-GA-TA--TTA--C--G--G--G--AG----T--TG-----G----GG-G-CGGAAATTGGCCTCCCGT---A-------C---A-C----G---G-C-T-GT--GC---GCGGTTGG-CCC--------------AAA--AA----TTGAGCT--C-T---GG-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC-----T---T-G-C----A-TC------AA---GTTG--TGAGGC-A-CCA----AGTC-TG-TAG--CGAGCT---CT-GACT--GT--GACCC----TGT-GC---A---C-C--------TT-C--T-T-----T----A---------------GG---G--AAT-G--GT-GCTT-CGACT Ilex_argentina C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--ATT-T-GG---------G-C---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG------CCCCCCC-GA--C--AC----AC---T--CTCC-C-A--------CC-C--AC--G-G-GA---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A----G-T--GG-GG-A--C-C---C----GGT---C--G-----A-----CCTC---CC-G----A-C-----A-A-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C---TTAAC--T-GAAG-AGCTAG-CCCC-CT--G---A-------TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCA-T--T---T--GCGTC-TTTT--G---AATC----TAAAATGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-A-CGTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCA----------CC--CCA---A----CCC--C-----A-A--T--GCC-----T--GG---CT-ACC----A--G--------C-TG-GA-CG--TTG--C--G--G--G--AG----C--T------G----GG-G-CGGAAATTGGCCTCCCGT--CC----A--C---A-C----G---A--CC-GT--G-T--GCGGTTGG-CCC--------A--A--AAA--AA-----TGAGCT--CTT----G-A-CGA-T-GGA-CGT-CAC-C--ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC--------TT-G-C----A-TC----T--A---GTCG--TGAGGC-A-CCG----AGTC-TA-TAG--CGAGCT---CT-GATC--GT--GACCC----TGT-GC---A---C-C--------TT-C--T-T---ATT----A-----G-G--------G---G---AT-G--GT-GCTT-TGACC Ilex_argentina_Gbk C--A-AA-GTAGA----CC-G-GCGAAC--T-TG--TT-----A-AA-AC--A---T--G------C----T--GGGGGGTTTGAG----A--A--GGGG-TG-CGTGAG-----C-CCCCCC-AA--C--AC----AC---T-CCCCC-C-A---------C-CT--C--G-G-GA---T-TTC-GGC--T-T--G---C-G---T-CC----C--CC----T---A---G----CGG-GG-A--C-T---C----GGT---C--A-----A---G--CTC---CC-G---A--C--AA-A-A-CGAA-C-C-CCC-GGCGC----TA--TC--TGCGCCAAGGAA-C-C-A--CAAC--T-GAAG-AGCTGG-CCTC-CC--G---------A-TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCAT---C--AT--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG---CCCCC--CC-TCC----A----CCC--C-----A-A--T--G---CCCAC-------C----T----A--G--------C-TG-GA-TA--TTG--T--G--G--G--AG----T--C------G-TC-GGCG-CGGAAATTGGTCTCCCGT-C-C---G---C---A-C----G---A-T-CGG---G--A-GCGGTTGG-CCC----------AA--AAA--AA-----TGAGCT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC-----T---T-G-C----A-TC-------AC--GTCG--TGAGGC-A-CC----GAGTC-TG-TGG--CGAGCT---CT-AACC--GT--GACCC----TGC-GC---A---C-C--------TT-C--T-T-----C----A----------------G--CG---AT-G--GT-GCTT-CGACC Ilex_beecheyi C--A-AA-GTAGA-C--CCG--GCGAAC--T-CG--TTA----A-AATAT--A---TG-G------C----T---GGGGGTCTGGG----A--A--GGGG-TG-CGCGAG-------CCCCCC-AA--C--A-C---A-C--T--CCCC-C-A-GC--C--CG-CT--C--G-G-GA---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A---G---C-GG-GG-A--C-----TT---GGC---C--A-----A---G--CT---CCC-G---A---C----A-A-CGAA----CCCC-GGCGC----T-G-TC--TGCGCCAAGGAA-C-C-A--CAAC--T-GAA--GGCTGG-CCTC-TC--G----A------T-GT-C-CC-GTT--CGC-GGT-GTGC--A-AC------G-GGAGGCAT---T---T--GCATC-TTTT--G---AATC----TAAAATGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAA-C-CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG---------------C---------CCC--C-----A-A-------------C-------C----C----------------C-----A--A--TTG--C--G--G--G--A---G-T--C-G----G----GG-G-CGGAAATTGGCCTCCCGT----C------C---A-C----GA--A---C-GT--G-C--ACGGTTGG-CCC--------A--A--AAA--AA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT--GG-TGGTTGAA-A--G-AC-CT-C----T---T-G----C-G-TC-------AT--GTC-G-TGAGGC-A-CC-A---AGTC-TG-TAG--CGAGCT---CT-GACC--GT--GACCC----TGT-GC---A---C-C--------TC-C--T-T-----C----GC---------------G---G---AT--G-GT-GCTC-CGACC Ilex_brasiliensis C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--ATT-T-GG----C-C--G-----GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG------CCCCCCC-GA--C--AC----AC---T--CCCC-C-G-------CCC-C---C--G-G-GA---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A----G-C--GG-GG-A--C-C---C----GGC---C-------TA----G-CTC---CC-G----A-C-----A-A-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C---TTAAC--T-GAAGAAGCTAGCCCCC-CC------G-------TG-T-C-CC-GTT--CGC-GGC-GTGC----AC------G-GGAGGCA-T--T---T--GCGTC-TTTT--G---AATC----CAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-A-CGTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CCA---A----CCC--C-----A-A--T--GCC-----T--GG---CT-ACC----A--G--------C-CG-GA-CG--TTG--C--G--G--G--AG----T--T------G----GG-G-CGGAAATTGGCCTCCCGT--CC----A--C---A-C----G---A--CC-GT--G-T--GCGGTTGG-CCC-------AA--A--AAA--AA-----TGAGCT--CTC------ACCGA-T-GGG-CGT-CA--C-GACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC-------T-T-G-C----A-TC----T--A---GTCG--TGAGGC-A-CCG----AGTC-TA-CAG--CGAGCT---CT-GATC--GT--GACCC----TGC-GC---A---C-C--------TT-C--T-T---ATT----A----GG-G--------G---G---AT-G--GT-GCTT-TGACC Ilex_brevicuspis C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--ATT-T-GG------C----C---GGGGGTTTGAG----A--A-GGGGG-TG-CGCGAG------CCCCCCC-GA--C--AC----AC---T--CCCC-C-G-----C--CC-CT--C--G-G-GA---T-TT--GGC--T-T--A---C-G---T-TC----C--CC----T---A-----CT--GG-GG-A--C-C---C----GGT---C--G-----A---G--CTC---CC-G---A--C------AA-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C---TTAAC--T-GAAG-AGCTGGCCCCC-CC--G---A-------TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCA-T--T---T--GCGTC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-A-CGTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CCA---A----CCC--C-----A-A--T--GCC-----T--GG---CT-ACT----A--G--------C-TG-GA-CG--TT--GC--G--G--G--AG----C--T------G----GG-G-CGGAAATTGGCCTCCCGT--CC----A--C---A-C----G---A--CC-GT--G---CGCGGTTGG-CCC------AAA--A--AAA--AA-----TGAGCT--CTT----G-A-CGA-T-GGA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--GC-CTC--------TT-G-C----A-TC----T--A---GTCG--TGAGGC-A-CCG----AGTC-TG-TAG--CGAGCT---CT-GATC--GT--GACCC----TGT-GC---A---C-C--------TC-C--T-T---ATT----A-------G--------G---G-T-AT-G--GT-GCTT-CGACC Ilex_buergeri CA-A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--A---T--GC-----C----T---GGGGGTTTGAA----A--A--GGGG-TG-CGCGAG-------CCCCCC-AA--C--AC----AC---T--CCCC-C-A-G-C-C--CC-CT--C--G-G-GA---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A---G--C--GG-GG-A--C--T--C----GGT---C--A-----A---G--CTC---CC-G---A--C-----A-A-CGAA---C-CCC-GGCGC----TA--TT--TGCGCCAAGGAA-C-C-A--TAAC--T-GAAG-GGCTGG-CCTC-CC--G----A------TG-T-C-CC-GTT--CGC-GGT-GTGC----A-G-----G-GGAGGCAT---T---T--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C--AC-GTCG----------CCA-CCA---A----CCC--C-----A-A--T--G-------C-------C----C----A---G-------C-TG-GA-TA--TTG--C--G--G--G--AG----T--T-G----G----GG-G-CGGAAATTGGCCTCCCGT---C-------C---A-T----GA--A---C-GC--G-C--GCGGTTGG-CCC-----------A--AAA--AA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-GCAA-GT-G-G-TGGTTGAA-A-G--AC-CT-C----T---T-G-C----G-TC-------AT--GTCG--TGAGGC-A-CCA----AGTC-TG-TAG--CGAGCT---CT-GACC--GC--GACCC----TGT-GC---A-C-C-C--------TTCC--T-T-----C----AC---------------G---G---AT-G--GT-GCTC-CGACC Ilex_canariensis C--A-AA-GTAGA-C--CC-G-GCGAAC--C-CG--TT-----A-AA-AC--A---T--G---C--C----T---GGGGGTTTGAG----A--A--GGGG-CG-CGCAAG-------CCCCCC-GA--C--GC----AC---T--CCCC-C-A----CC--CC-C---C-GG-G-GG---T-TT--GGC--T-TG-G-----G---T-TC----C--CC----T------AG--C--GG-GG-A--C-C---C----GGT---C--A-----G---G--CTC---CC-G---G--C-----A-A-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C-T--TAA---CAGAAG-AGCTGG-CCCC-CC--G---G-------TG-TCC-CC-GTT--CGC-GGT-GTGC----AC---T--G-GGAGGCA---TT---T--GCGTC-TTTC--G---AATC----TGAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGCGAAC-C-ATCGAGCTTTTGA-A-CGCAAGTTGCGCCCGAAG--CCGTTAGGCCAAGGGC-AC-GTCTGCCTGGGCGTCACC--CAT-C-A-C-GTCG-C--------CC--CCA---A----CCC--C-----A-A--T--G-C-----C-TGG---C----T----A--G--------C-CG-GG-TA--TCG--C---G-G--G--AG----T--T------G----GG-G-CGGAAATTGGCCTCCCGT---C-------C---A-C--AGG---A--CC-GT--G-C--GCGGTTGG-CCC-----------A--AAA--AACAAA-TGAGTT--CCT----G-A-CGA-TG-GG-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC-----T---T-G-C----G-TC-------A--TGTCG--TGGGGC-A-CCG----AGTC-TA-TGG--CGAGCTC--C--GACC-GG---GACCC----TGC-GC---A---CAC---------T-C--C-T--C--C----G--G----G--------G---G---AT-G--GT-GCTC-CGACC Ilex_cassine C--A-AA-GTAGA----CC-G-GCGAAC--T-TG--TT-----A-AA-AC--A---T--G------C----T--GGGGGGTTTGAG----A--A--GGGG-TG-CGTGAG-----C-CCCCCC-AA--C--AC----AC---T-CCCCC-C-A---------C-CT--C--G-G-GA---T-TTC-GGC--T-T--G---C-G---T-CC----C--CC----T---A---G----CGG-GG-A--C-T---C----GGT---C--A-----A---G--CTC---CC-G---A--C--AA-A-A-CGAA-C-C-CCC-GGCGC----TA--TC--TGCGCCAAGGAA-C-C-A--CAAC--T-GAAG-AGCTGG-CCTC-CC--G---------A-TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCAT---C--AT--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG---CCCCC--CC-TCC----A----CCC--C-----A-A--T--G---CCCAC-------C----T----A--G--------C-TG-GA-TA--TTG--T--G--G--G--AG----T--C------G-TCGGG-G-CGGAAATTGGCCTCCCGT-C-C---G---C---A-C----G---A-T-C-G-T-G--A-GCGGTTGG-CCC----------AA--AAA--AA-----TGAGCT--CCT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC-----T---T-G-C----A-TC-------AC--GTCG--TGAGGC-A-CC----GAGTC-TG-TGG--CGAGCT---CT-AACC--GT--GACCC----TGC-GC---A---C-C--------CT-C--T-T-----C----A----------------G--CG---AT-G--GT-GCTT-CGACC Ilex_collina C--A-AA-GTAGA---CCC---GCGAAC--T-TG--TT-----A-AA-AT--A---T--G------C----T---GGGGGTTTGAG----GTTAG-GGGG-TG-CGCGAG-----C-CCCCCC-AA--C--AC----AC---T--CCCC-C-A---------C-CT--C--G-G-GA---T-TT--GGC-TT-T--G---T-G---T-TC----C--CC----T---A---G--T--GG-GG-A--C-T---C----GGT---C--A-----G---G--CTC---CC-G---A--C---A-A-A-CGAA---C-CCC-GGCGC----TA--TC--TGCGCCAAGGAA-T-C-A--TAAC--T-GAAG-AGCTGG-CCTC-CC--G---A-------TG-T-C-CC-GTT--CGC-GGC-GCGC----AC------G-GGGGGCAT---T---T--GCATC-TTTT--G---AATC----TAAAA{CT}GACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CC---AA----CCC--C-----A-A--T--G-------C-------C----T----A--G--------T-TG-GA-TA--TTG--T--G--G--G--AG----T--T------G----GG-G-CGGAAATTGGCCTCCCGT---C-------C---A-T----G---A-C-C-GT--G--A-GCGGTTGG-CCC-----------A--AAA--AA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC-----T---T-G-C----A-TC-------AT--GTCG--TGAGGC-A-CCT----AGTC-TG-TAG--CGAGCT---CT-AATC--GT--GACCC----TG{CT}-GC---A---C-C--------TT-C--T-T-----C----A----------------A--CG---AC-G--GT-GCTT-CGACC Ilex_cornuta C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT--A--A-AA-AT--A---T--GC-----C----T---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG-------CCCCCC-AA--C--AC----AC---T--CCCC-C-A-GC--C--CC-CT--C--G-G-GA---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A---G--C--GG-GG-A--C----GC----GGC---C--A-----A---G--CTC---CC-G---A--C-----A-A-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C-A--TAAC--T-GAAG-GGCTGG-CCT-CCC--G----G------TG-T-C-CC-GTT--CGC-GGC-GTGC----A--C----G-GGAGGCAT---T---T--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CATCC---C-GTCG----------CCA-CCA---A----CCC--C-----A-A--T--G-------C-------C----C----A-----G-----C-CG-GA-TA--TTG--C--G--G--G--AG----T--T-G----G----GG-G-CGGAAATTGGCCTCC?GT---T-------?---A-C----GA--A---C-GT--G-C--GCGGTTGG-CCC-----------A--AAA--AA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CT-C----T---T-G-C----G-TC-------AT--GTCG--TGAGGC-A-CCA----AGTC-TG-TA--GCGAGCT---CT-GACC--GC--GACCC----TGT-GC---A-C-C-C--------TT-C--T-T-------C--AC---------------G---G---AT-G--GT-GCTC-CGACC Ilex_crenata C---AAA-GTA{AC}A----CC-G-GCGAAC--T-TG--TT------AAA-AC--A---T--G--C---C-------GGGGGGTTTGAG----A--A--GGGG-T-GCGCGAG-----C-CCCCCC-AA-TA--A--G--G----T-TCCCC-C-A---------C-CTC-C----G-GA---T-TT--GGC--T-T--G---T--TT-T-CC----C--CC----T--GG-C-G-----GG-GA-A--C-T---C----GG--CCC--------A---G--CTC---CC-G---A--C---A-A-A-CGAA---C-CCC-GGCGC----TG-TT---TGCGCCAAGG-A-ACC-A--TAAC--C-GAAG-AGCTGG-TCTC-CC-GG-----------TG-C-C-CC-GTC--CGC-GGT-GTGC----AC------G-GGAGGCGT---T---T--GCGTC-TTTT--G---AATC----CAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCCAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CC--A-A-C--CCC--C-----CAA--CG-G-------C-------C----T----A--G---C----C--G-GA-TA--TTG--C--G--G--G--AG----T--T------G----GG-G-CGGAGATTGGCCTCCCGT-C-C---G---C---G-C----G---A-C-C-GT--G--A-GCGGTTGG-CCC-----------A--AAA--AA-----CGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC-----T---C-G-C----A-TC-------AC--GTCG--TGGGGC-G-CC---T-AGTC-TG-TAG--CGA-----GCT---CC------GACCC----TGT-GC---A---C-C-T-G--A-TT-CG-C-T-C---T-------------A-G--G--G--CG---A--G--GT-GCTT-CGACC Ilex_decidua C--A-AA-GTAGA----CC--GGCGAAC--T-TG--TT-----A-AA-AT--A---T--G------C----T---GGGGGTTTGAG--AAA--AG-GGGG-TG-CGCGAG-----C-CCCCCC-AA--C--AC----AC---T--CCCC-C-A---------C-CT--C--G-G-GA---T-TT--GGC-TT-T--G---T-G---T-TC----C--CC----T---A---G--C--GG-GG-A--C-T---C----GGT---C--A-----A---G--CTC---CC-G---A--C---A-A-A-CGAA---C-CCC-GGCGC----TA--TC--TGCGCCAAGGAA-C-C-A--TAAC--T-GAAG-AGCTGG-CCTC-CC--G---A-------TG-T-C-CC-GTT--CGC-GGC-GCGC----AC------G-GGGGGTAT---T---T--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CC---AA----CCC--C-----A-A--T--G-------C-------C----T----A--G--------C-TG-GA-TA--TCG--T--G--G--G--AG----T--T------G----GG-G-CGGAAATTGGCCTCCCGT---T-------C---G-C----G---A-C-C-GT--G--A-GCGGTTGG-CCC-----------A--AAA--AA-----TGAGTT--CCT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC-----T---T-G-C----A-TC-------AT--GTCG--TGAGGC-A-CCT----AGTC-TG-TAG--CGAGCT---CT-AACC--GT--GACCC----TGT-GC---A---C-C--------TT-C--T-T-----C----A-------------G--A---G---AC-G--GT-GCTT-CGACC Ilex_dimorphophylla C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT--A--A-AA-AT--A---T--GC-----C----T---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG-------CCCCCC-AA--C--GC----AC---T--CCCC-C-A-GC--C--CC-CT--C--G-G-GG---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A---G--C--GG-GG-A--C----GC----GGC---C--A-----A---G--CTC---CC-G---A--C-----A-A-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C-A--TAAC--T-GAAG-GGCTGG-CCT-CCC--G----G------TG-T-C-CC-GTT--CGC-GGC-GTGC----A--C----G-GGAGGCAT---T---T--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CATCC---C-GTCG----------CCA-CCA---A----CCC--C-----A-A--T--G-------C-------C----C----A-----G-----C-CG-GA-TA--TTG--C--G--G--G--AG----T--T-G----G----GG-G-CGGAAATTGGCCTCCCGT---T-------C---A-C----GA--A---C-GT--G-C--GCGGTTGG-CCC-----------A--AAA--AA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CT-C----T---T-G-C----G-TC-------AT--GTCG--TGAGGC-A-CCA----AGTC-TG-TA--GCGAGCT---CT-GACC--GC--GACCC----TGT-GC---A-C-C-C--------TT-C--T-T------G---AC---------------G---G---AT-G--GT-GCTC-CGACC Ilex_dumosa_dumosa C---AAA-GTAGA----CC-G-GCGAAC--TCTG--TT-----A-AA-AC--A---T--G------C----TG-GGGGGGTTTGAG----A--A--GGGG-TG-CGCGAG-----C-CCCCCC-AA-TC--AC----GC---T-CCCCC-C-A---------C-CT--C--G-G-GA---T-CT--GG{CT}---TT--G---T--TT-T-CC----C--CC----T--GG-C-G-----GG-GA-A--C-T---C----GG----C---GG---A---G--CTC---CC-G---A--C---A-A-A-CGAA---C-CCC-GGCGC----TG--T-A-TGCGCCAAGG-ACC-C-A--TAAC--C-GAA{AG}-AGCTGG-TCTC-CC--G-------T---TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCAT---C---T--GCGTC-TTTT--G---AATC----CAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCCAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CC--A-A----CCC--CAAAA-A-A--C--G--T----C-------C----T----AG-G--------T--G-GA-CA--TTG--T--G--G--G--AG----T--T------G----GG-G-CGGAGATTGGCCTCCCGT-C-C---A---C---A-C----G---TCC-C-GT--G--A-GCGGTTGG-CCC---------A-A--AAA--AA-----CGAGTT--CTT----G-A-CGA-CG-GA-CGT-CA--CG-GCAA-GT-G-G-TGGTTGAA-A-G--AC-CTC---T-T---T-G-C----A-TC-------AT--GTCG--TGAGGC-G-CC---T-AGT?-TG-CAA--CGA----?-CT---CC------GACCC----TGT-GC---A---C-C-TAGTTG-TC-CG-C-TG----T----A----------G--G--G--CG---AC-G--GT-GCTT-CGACC Ilex_dumosa_guaranina C---AAA-GTAGA----CC-G-GCGAAC--TCTG--TT-----A-AA-AC--A---T--G------C----TG-GGGGGGTTTGAG----A--A--GGGG-TG-CGCGAG-----C-CCCCCC-AA-TC--AC----GC---T-CCCCC-C-A---------C-CT--C--G-G-GA---T-CT--GGC----T-GG---T--TT-T-CC----C--CC----T--GG-C-G-----GG-GA-A--C-T---C----GG-C--C----G---A---G--CTC---CC-G---A--C---A-A-A-CGAA---C-CCC-GGCGC----TG--T-A-TGCGCCAAGG-ACC-C-A--TAAC--C-GAAG-AGCTGG-TCTC-CC--G-------T---TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCAT---C---T--GCGTC-TTTT--G---AATC----CAAAAC{CG}ACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTT?A-A-CGCAAGTTGCGCCCAAAG--CCAT?AGGCCAAGGGC-AC-GTCT?CCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CC--A-A----CCC--CAAAA-A-A--C--G--T----C-------C----T----AG-G--------T--G-GA-CA--TTG--T--G--G--G--AG----T--T------G----GG-G-CGGAGATTGGCCTCCCGT-C-C---A---C---A-C----G---TCC-C-GT--G--A-GCGGTTGG-CCC---------A-A--AAA--AA-----?GAGTT--CTT----G-A-CGA-CG-GA-CGT-CA--CG-GCAA-GT-G-G-TGGTTGAA-A-G--AC-CTC---T-T---C-G-C----A-TC-------AT--GTCG--TGAGGC-G-CC---T-AGTC-TG-CAA--CGA----T-CT---CC------GACCC----TGT-GC---A---C-C-TAGTTG-TC-CG-C-TG----T----A----------G--G--G--CG---AC-G--GT-GCTT-CGACC Ilex_glabra C-AA-AA-GTAGA-C--CC-G-GCGAAC--C-TG--TT---A-A-AA-AT--A---T--G------C-A--T---GGGGGTCTGAG----A--A--AGGG-TG-CGCGAG-------CCCCCC-GA--C--AC----AT---T--CCCC-C-A--------CC-C---C--G-G-GA---T-TT--GGC--T-T--G----CG---T-TC----C--CC----T---A---G--C--GG-GG-A--C-T---C----GGT---C--A-----A---G--CTC---CC-G---A--C----AA-A-CGAA--CC-CCC-GGCGC----TA--TC--TGCGCCAAGGAA-C-C-T--TAAC--{CT}-GAAG-AGCTGG-CCCC-CC--G---A-------TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCA--T-T---T--GCATC-TTTT--G-A-AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG-C--------CC--CCA---AC---CCC--C-----A-A--T--G-C-----C-TGG---C----T----A--G--------C-TG-GG-TA--TTG--C---G-G--G--AG----T--T------G----GG-G-CGGAAATTGGCCTCCCGT---C-------C---A-C----G---A--CC-GT--G-C--GCGGTTGG-CCC-----------A--AAA--AA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC-----T---T-G-C----A-TC-------A--TGTCG--TGAGGC-A-CCA----AGTC-TG-TAG--CGAGCT---C-AGACCG-G---GACCC----TGT-GT---G---CAC-------ATT-C--T-T-----T----A--G----G--------G---G---AT-G--GT-GCTT-CGACC Ilex_integerrima C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--ATT-T-GG------C----C---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG------CCCCCCC-GA--C--AC----AC---T--CCCC-C-G-----C--CC-C---C--G-G-GA---T-TC--GGC--T-T--G---C-G---T-T---A-C--CC----T---A----{AG}-C--GG-GG-A--C-C---C----GGT---C--G-----A---G--CTC---CC-G-----TC-----A-A-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C---TTAAC--T-GAAGAAGCTGGCCCCC-CC--G---A-------TG-T-C-CC-GTT--CGC-GG-TGTGC----AC----GGG-GGAGGCA-T--T---T--GCGTC-TTTC--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-A-CGTCTGCCTGGGCGT??-??-???-?-?-?-GTC{CG}---------CCC--CC{AGT}---A----CCC--C----AA-A-----GCC-----C--GG---TT-ACC----A--G--------C-TG-GACC---TTG--C--G--G--G--A?----C--T------G----GG-G-CGGAAATTGGCCTCCCGT--CC----A--C---A-C----G---A--CC-GT--G-C--GCGGTTGG-CCC------?AA--A--AAA--AA-----TGAGCT--CCT----G-A-CGA-T-GGG-CGT-CA--CG-ACAA-GT-G-G-TGGTTGGA-A-G--AC-CTC--------TT-G-C----A-T?----T--A---GTCG--TGAGGC-A-CCG----AGTC-TG-TAG--CGAGCT---CT-GATC--GC--GACCC----TGT-GC---A---C-C--------TT-C-TT-T---ATT----A-----G-G--------G---G---AC-G--GT-GCTT-TGACC Ilex_integra C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-A---A-AATAT--A---T--GC-----C----T---GGGGGTTTGAG----A--A--GGGG-TG-TGCGAG-------CCCCCC-AA--CAAA-----A----T--TCCC-C-A-GC--C--CC-CT--TG-G-G-GA---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---AG--G-----GG-GG-A--T-----T-G--GGC---C--A-----A---G--TT----CCGG-A-A--------A-A-CGAA-----CCCGGGCGC---TT---TT--TGCGCCAAGGAA-C-C-A--TAAC--T-GAAG-GGCTGG-CCTC-CC--G----A-----TT--T-C-CC-GTC--CGC-GGT-GTGC----AC------G-GGAGGCAT---T---T--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCCAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG---------------C---------CCC--C-----A-A-------------C-------C----C----------------C-----A--A--TTG--C--G--G--G--AG----T--T-G----G----GG-G-CGGAAATTGGCCTCCCGT---C-------C---A-C----GA--A---C-GT--G-C--GCGGTTGG-CCCA-------A--A--AAA--AA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CT-C----T---T-G-C----G-TC-------AT--GTCG--TGAGGC-A-CCA----AGTC-TG-TAG--CGAGCT---CT-GACC--GC--GACCC----TGT-GC---A---C-C--------TT-C--T-T-----C----AC---------------G---G---AT-G--GT-GCTT-CGACC Ilex_kiusiana C--A-AA-GTAGACC--C{CT}---GCGAAC--T-{CT}GT-TT-----A-AATAT--G---T--C------C----T---GGGGGTC-AGA-C--A--A--GGGG-TG-CGCGAGC------CCCCCC-AA--C--A-C---A-C--T--CCCC-C-AGGC--C--C--CT--C--G-G-GA---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A---G---C-GG-GG-A--C-----TC---GGT---C--A-----A---G--CT---CCC-G---A---C----A-A-CGAA----CCCC-GGCGC----T-A-TT--TGCGCCAAGGAA-C-C-A--TAAC--T-GAAG-GGCTGG-CCTC-CC--G----A------T-GT-C-CC-GTT--CGC-GGT-GTGC--A-G-------G-GGAGGCAT---T---T--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAA--GCCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG---------------C---------CCC--C-----A-A-------------C-------C----C----------------C-----A--A--TTG--C--G--G--G--A----TT--{CG}-A----G----GG-G-CGGAAATTGGCCTCCCGT-----A-----C---ATC-T--GA--A---C-GT--G-C--GCGGTTGGCCCC--------G--A--AAA--AA-----TG{AG}GTT--CTT----GAA-TAA--G-GA-CGT-CA--CG-ACAA-GT---GTTGGTTGAA-A---TACGC--C----T---T-G-----AG-TC-------AT--GTC--TTGAGGC-A-CC--T--AGTC-TG-TAA--CGAGCT---CT-GACC--GC--AACTC----TGT-GC---AG--C-CA-------TC-C--T-T-----C----AT---------------G---G---AT---CGT-GCTT-CAACC Ilex_latifolia C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--A---T--GC-----C----T---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG-------CCCCCC-AA--C--AC----AC---T--CCCC-C-A-GC--C--CC-CT--C--G-G-GA---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A---G--C--GG-GG-A--C--T--C----GGT---C--A-----A---G--CTC---CC-G---A--C-----A-A-CGAA---C-CCC-GGCGC----TA--TC--TGCGCCAAGGAA-C-C-A--TAAC--T-GAAG-GGCTGG-CCTC-CC--G----A------TG-T-C-CC-GTT--CGC-GGT-GTGC----A-G-----G-GGAGGCAT---T---T--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C--AC-GTCG----------CCA-CCA---A----CCC--C-----A-A--T--G-------C-------C----C----A---G-------C-TG-GA-TA--TTG--C--G--G--G--AG----T--T-G----G----GG-G-CGGAAATTGGCCTCCCGT---C-------C---A-T----GA--A---C-GC--G-C--GCGGTTGG-CCC-----------A--AAA--AA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-GCAA-GT-G-G-TGGTTGAA-A-G--AC-CT-C----T---T-G-C----{AG}-TC-------AT--GTCG--TGAGGC-A-CCA----AGTC-TG-TAG--CGAGCT---CT-GAC{CT}--GC--GACCC----TGT-GC---A-C-C-C--------TTCC--T-T-----C----AC---------------G---G---AT-G--GT-GCTT-CGACC Ilex_liukiuensis C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--A---T--GC-----C----T---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG-------CCCCCC-AA--C--AC----AC---T--CCCC-C-A-G---CG-CC-CT--C--G-G-G-T--T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A---G--T--GG-GG-A--C--T--C----GGT---C--A-----A---G--CTC---CC-G---A--C-----A-A-CGAA---C-CCC-GGCGC----TA--TC--TGCG----GGAA-C-C-A--TAAC--T-GAAG-GGCTGG-CCTC-CC--G----A------TG-T---CCGGTT--CGC-GGT-GTGC----A-G-----G-GGAGGCAT---T---T--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTT--AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTG--ATCGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C--AC-GTCG----------CCA-CCA---A----CCC--C-----A-A--T--G---------------C-G--C----G---G-------C-TG-GA-TA--TTA--C--G--G--G--AG----T--T-G----G----GG-G-CGGAAATTGGCCTCCCGT-----------T---A-T----GA--A---C-GC--G-C--GCGGTTGG-CCC-----------A--AAA--AA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-GCAA-GT-G-G-TGGTTGAA-A-G--AC-CT-C----T---T-GCC------TC-------AT--GTCG--TGAGGC-A-CCA----AGTC-TG-TAG--CGAGCT---CT-GACT--GC--GACCC----TGT-GC--AA---C-C--------TTCC--T-T-----C----AC-------------------GT--AT-G--GT-GCTC-CGACC Ilex_macropoda C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--A---T--G------T-T--T---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG--C----CCCCCC-GA--C--AC----A--C-T--CCCC-C-A--------CC-T---C--G-G-GG---T-TT--GGC--T-T--G---C-G---T-T-C---C--CC----T---A---G--C--GG-GG-A--C-T------C-GGT---C--A-----G---G--CTC---CC-G---A----C---A-A-CGAA---C-CCC-GGCGC----TA--TT--TGCGCCAAGGAA-C-C-T--TAAC--T-GAAG-AGCTGG-CCCC-CC--G---A-------TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCA----T-A-T--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGG?TTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CC-A--A----CCC--C-----A-A--T--G-C-----C-TA--C-C----T----G--G--------C-TG-GA-TA--TTG--C--A--G--G--AG----T--T------G----GG-G-CGGAAATTGGCCTCCCGT---C-------C---A-C----G---A--CT-GT--G-T--GTGGTTGG-CCC--AA----A--A--AAA--AA------GAATT--CCT----G-A-CGA-CG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CT---C--T---T-G-C----A-TC-------A-T-GTCG--TGAGGC-A-TCG----AGTCTT--TGG--CGAGCT---CT-GACC--GT--GACCC----TGT-GC---A-----C--------TT-C--T-T-----T--------C---G--------G---G---AT-G--GT-GCTT-CGACC Ilex_maximowicziana C--A-AA-GTAGA-C--CC-G-GCGAAC--T-CG--TT-----A-AA-AT--A---T--GC-----C----T---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG-------CCCCCC-AA--C--AC----AC---T--CCCC-C-A-GC--C--CC-CT--C--G-G-GA---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A---G--C--GG-GG-A--C---T-C----GGT---C--A-----A---G--CTC---CC-G---A--C-----A-A-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C-A--TAAC--T-GAAG-GGCTGG-CCT--CCG-G----G------TG-T-C-CC-GTT--CGC-GGT-GTGC----A--C----G-GGAGGCAT---T---T--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CATCC---C-GTCG----------CCA-CCA---A----CCC--C-----G-A--T--G-------C-------C----C----A----T------C-TG-GA-TA--TTG--C--G--G--G--AG----T--T-G----G----GG-G-CGGAAATTGGCCTCCCGT---T-------C---A-C----GA--A---C-GT--G-C--GCGGTTGG-CCC-----------A--AAA--AA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CT-C----T---T-G-C----G-TC-------AT--GTCG--TGAGGC-A-CCA----AGTC-TG-TA-C-CGAGCT---CT-GGCC--GC--GACCC----TGC-GC---A-C-C-C--------TT-C--T-T-----C----AC---------------G---G---AT-G--GT-GCTC-CGACC Ilex_mertensii C--A-AA-GTAGA-C--CCG--GCGAAC--T-CG--TTA----A-AATAT--A---TG-G------C----T---GGGGGTCTGGG----A--A--GGGG-TG-CGCGAG-------CCCCCC-AA--C--A-C---A-C--T--CCCC-C-A-GC--C--CG-CT--C--G-G-GA---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A---G---C-GG-GG-A--C-----TC---GGC---C--A-----A---G--CT---CCC-G---A---C----A-A-CGAA----CCCC-GGCGC----T-G-TT--TGCGCCAAGGAA-C-C-A--CAAC--T-GAAG-GGCTGG-CCTC-TC--G----A------T-GT-C-CC-GTT--CGC-GGT-GTGC--A-AC------G-GGAGGCAT---T---T--GCATC-TTTT--G---AATC----TAAAATGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAA--CAATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAA-C-CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG---------------C---------CCC--C-----A-A-------------C-------C----C----------------C-----A--A--TTG--C--G--G--G--A---G-T--C-G----G----GG-G-CGGAAATTGGCCTCCCGT----C------C---A-C----GA--A---C-GT--G-C--ACGGTTGG-CCC--------A--A--AAA--AA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT--GG-TGGTTGAA-A--G-AC-CT-C----T---T-G----C-G-TC-------AT--GTC-G-TGAGGC-A-CC-A---AGTC-TG-TAG--CGAGCT---CT-GACC--GT--GACCC----TGT-GC---A---C-C--------TC-C--T-T-----C----GC---------------G---G---AT--G-GT-GCTC-CGACC Ilex_micrococca C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--A---T--G-C----T-T--T---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG-------CCCCCC-GA--C--AC----A--C-TC-CCCC-C-A--------CC-T---C--G-G-GA---T-TT--GGC--T-T--G---{CT}-G---T-T-C---C--CC----T---A---G--C--GG-GG-A--C-T------C-GGT---C--A-----G---G--CTC---CC-G---A----C---A-A-CGAAC--C-CCC-GGCGC----TA--TT--TGCGCCAAGGAA-C-C-T--TAAC--T-GAAG-AGCTGG-CCCC-CC--G---A-------TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCA----T-A-C--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG--C-------CC--CC----A----CCC--C-----A-A--T--G-C-----C-TA---GC----T----G--G--------C-TG-GA-TA--TTG--C--G--G--G--AG----T--T--GG--G----GG-G-CGGAAATTGGCCTCCCGT---C-------C---A-C----G---A--CC-GT--G-C--GCGGTTGG-CCC--AA----A--A--AAAT-AA------GAGTT--CCT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CT---C--T---T-G-C----A-TC-------A-T-GTCG--TGAGGC-A-CCG----AGTCTC--TAG--CGAGCT---CT-GATC--GT--GACCC----TGC-GC---G---C-C--------TC-C--T-T-----C--------C---G--------G---G---AT-G--GC-GCTT-TGACC Ilex_microdonta C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--ATT-T-GG------C----C---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG------CCCCCCC-GA--C--AC----AC---T--CCCC-C-G-----C--CC-CT--C--G-G-GA---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A-----CC--GG-GG-A--C-C---C----GGT---C--G-----A---G--CTC---CC-G---A--C-----A-A-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C---TCAAC--T-GAAG-AGCTGGCCCCC-CC--G---A-------TG-C-C-CC-GTT--CGC-GGT-GTGC----AC----GGGAGGAGGCA-T--T---T--GCGTC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-A-CGTCTGCCTGGGCGTCA-CG-CAT-C-A--TGTCG--------C-CC--CCA---A----CCC--C-----A-A--C--GCC-----T--GG---CT-ACT----A--G--------C-CG-GA-CG--TTG--C--G--G--G--AG----C--T------G----GG-G-CGGAAATTGGCCTCCCGT--CC----A--C---A-C----G-ACA--CC-GT--G-C--GCGGTTGG-CCC-------AA--A--AAA--AA-----TGAGCT--CCT----G-A-CGA-T-GGA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC--------TT-G-C----A-TC----T--A---GTCG--TGAGGC-A-CCG----AGTC-TG-TAG--CGAGCT---CT-GATC--GT--GACCC----TGT-GC---A---C-C--------TC-C--T-T---ATT----A-----G-G--------G---G---AT-G--GT-GCTT-CGACC Ilex_microdonta_Gbk C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT----AA-AA-AT--ATT-T-GG------C----C---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG------CCCCCCC-GA--C--AC----AC---T--CCCC-C-G--------CC-CT--C--G-G-GA---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A-----CC--GG-GG-A--C-C---C----GGT---C--G-----A---G--CTC---CC-G---A--C-----A-A-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C---TTAAC--T-GAAG-AGCTGGCCCCC-CC--G---A-------TG-T-C-CC-GTT--CGC-GGT-GTGC----AC----GGGAGGAGGCA-T--T---T--GCGTC-TTTT--G---AATC----CAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-A-CGTCTGCCTGGGCGTCA-CG-CAT-CAA---GTCG--------C-CC--CCA---A----CCC--C-----A-A--C--GCC-----C--GG---CT-ACT----G--G--------C-TG-GA-CG--TTG--C--G--G--G--GG----C--T------G----GG-G-CGGAAATTGGCCTCCCGT--CC----A--C---A-C----G---A--CC-GT--G-C--GCGGTTGG-CCC-------AA--A--AAA--AA-----TGAGCT--CCT----G-A-CGA-T-GGA-CGT-C--GCG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC--------TT-G-C----A-TC----T--A---GTCG--TGAGGC-A-CCG----AGTC-TG-TAG--CGAGCT---CT-GATC--GT--GACCC----TGT-GC---A---C-C--------TC-C--T-T---ATT----A-----G-G--------G---G---ATGG--G--GCTT-CGACC Ilex_mitis C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--A---T--G------C-C--T---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG--C----CCCCCC-GA--C--AC----A--C-T--CCCC-C-A--------CC-T---C--G-G-GA--TT-TT--GGC--T-T--G---C-G---T-T-C---C--CC----T---A---G--C--GG-GG-A--C-T------C-GGC---C--A-----G---G--CTC---CC-G--AA--------A-A-CGAAC--C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C-T--TAAC--T-GAAG-AGCTGG-CCCC-CC--G---A-------CG-T-C-CC-GTT--CGC-GGT-GTGC----AC--G---G-GGAGGCA----T-G-T--GCGTC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CCA---A----CCC--C-----A-A--T--G-C-----C-TAG---C----T----A--G--------C-TG-GA-TA--TTG--T--G--G--G--AG----T--T------G----GG-G-CGGAAATTGGCCTCCCGT---C-------C---A-C----G---A--CC-GT--G-C--GCGGTTGG-CCC--AA----A--A--AAAA-AA-----GGAGTT--CTT----G-A-CGA-CG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CT-----AT---T-G-C----A-TC---A---A---GTCG--TGAGGC-A-CCG----AGTC-T-GTAG--CGAGCT---CT-GACC--GT--GACCC----TGC-GC---A---C-C--------TT-C--T-T-----T---AA---C---G--------G---A---AT-G--GT-GCTC-CGACC Ilex_mucronata C--A-AA-GTAGA-C--CC-A-GCGAAC--T-TG--TT-----A-AA-AC--A---T--G-----CT----T---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG-------CCCCCC-GA--C--AC----AC---T--CCCC-C-A---------C-CT--C--G-G-GA---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A---G--C--GG-GG-A--C-T---C----GGT---C--A-----A---G--CTC---CC-G---A--C-----A-A-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C-A--TAAC--T-GAAG-AGCTGG-CCTC-CC--G---A-------TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCAT---T---T--GCATC-TTTC--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CCA---A--CCCCC--C-----A-A-TT----------C-------C----T----A-TG----TAC-C-TG-GA-TA--TTG--T----GG--G--AG-----A-T------G----GG-G-CGGAAATTGGCCTCCCGT---------A-C---A-C----G---A-C-C-GT--GA---GCGGTTGG-CCC--------------AAA-TAA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-G-TG-G-TGGTTGAA-A-G--AC-CTC-----T---T-G-C----A-TC-------AT--GTCG--TGAGGC-A-CCT----AGTC-TG-TAG--CGAGCT---CT-AACC--GT--GACCC--TATAT-GC---A---C-C--------TT-C--T-T-----C----A----------------G--CG---AT-G--GT-GCTT-CGACC Ilex_mutchagara C---AAA-GTAGA----CC-G-GCGAAC--T-TG-TTT-------AA-AC--A---T--G------C------GGGGGGG{GT}TTGAA----A--A--AGGGTT--CGCGAA-----C-CCCCCC-AA-TC--A---C-G---CT-CCCCC-C-A---------C-CT--C---GG-GA---T-CT--GGC--T-C--G---T--TT-TCCC----C--CC----T--GG-C-G-----GG-GA-A--C-T---C----GG---CC-----A--A---G--CTC---CC-G---A--C---A-A-A-CGAA---C-CCC-GGCGC----TG-TT---TGCGCCAAGG-A-A-CAA--TAAC--C-GAAG-AGCTGG-TCTC-CC-GG-----------TG-C-C-CC-GTC--CGC-GGC-GTGC----AC------G-GGAGGCGC---T---T--GCGTC-TTTT--G---AATC----CAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCCAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CC--A-A----CCC--C-----C-AC-CG-G-------C-------C----C----A--G---C----C--G-GA-TA--CTG--C--G--G--G--AG----T--T------G----GG-G-CGGAGATTGGCCTCCCGT-C-C---G---C---G-C----G---A-C-C-GT--G--A-GCGGTTGG-CCC-----------A--AAA--AA-----CGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC-----T---C-G-C----A-TC-------AT--GTCG--TGGGGC-G-CC---T-AGTC-CG-CAG--CGA-----GCT---CC------GACCC----TGT-GC---A---C-C-T-G--A-TT-CG-C-T-C---T--------------CG--G--G--CG---AC-G--GT-GCTT-CGACC Ilex_opaca C--A-AA-GTAGA----CC-G-GCGAAC--T-TG--TT-----A-AA-AC--A---T--G------C----T--GGGGGGTTTGAG----A--A--GGGG-TG-CGTGAG-----C-CCCCC{GT}-AA--C--AC----AC---T--CCCC-C-A---------C-CT--C--G-G-GA---T-TTT-GGC--T-T--G---C-G---T-CC----C--CC----T---A---G----CGG-GG-A--C-T---C----GGT---C--A-----A---G--CTC---CC-G---A--C---A-A-A-CGAA---C-CCC-GGCGC----TA--TC--TGCGCCAAGGAA-C-C-A--TAAC--T-GAAG-AGCTGG-CCTC-CC--G--------T--TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCGT---C--AT--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG-----CCC--CC--CC----A----CCC--C-----A-A--T--G---CCCAC-------C----T----A--G--------C-TG-GA-TA--TTG--C--G--G--G--AG----T--C------G----GG-G-CGGAAATTGGCCTCCCGT-C-C---G---C---A-C----G---A-T-C-GT--G--A-GCGGTTGG-CCC----------AA--AAA--AA-----TGAGCT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC-----T---T-G-C----A-TC-------AT--GTCG--TGAGGC-A-CC----AAGTC-TG-TGG--CGAGCT---CT-AACC--GT--GACCC----TGC-GC---A---C-C--------CT-C--T-T-----C----A----------------G--CG---AT-G--GT-GCTT-CGACC Ilex_paraguariensis C----AACGTAGA--C-CC-G-GCGAAC--T-TG--TT-----A-AA-AT--A---C--G------C----TG-GGGGGGTTTGGG----A--A--GGGG-TG-CGCGAG-----C-CCCCCCGAA--C--AC----AC---T-CCCCCGC-----------C-CT--C--G-G-GA-----CTG-GGC--T-T--G---T-GTTCC-CC-T--C--CC----TAGGG---G-----GG-GG-A--C-T---C----GGT---C--G-----A---G--CTC---CC-G---A--C---A-A-A-CGAA---C-CCC-GGCGC----TG--TC--TGTGCCAAGGAA-C-C-A--TAAC--C-GAAG-AGCTGG-TCTC-CC--G------A----TG-T-C-CC-GTT--CGC-GGT-GCGC----AC------G-GGAGGCAT---T---T--GCATCTTTTT--GA--AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG-------C--CC--CC--A-A----CCC--C-----A-A--T--G-------C-------C---------------------C--G-GA-TG--TTG--CGGG--G--G--AG----T--T-----GG----GG-G-CGGAAATTGGCCTCCCGT-C-C---A---C---A-{CT}----G---A-T-C-GT--G--A-GCGGTTGG-CCC-----------A--AAA--AG-----TGAGTT--CCT----G-A-CGA-CG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC-----T---T-G-C----A-TC-------AT--GTCG--TGAGGC-G-CC---T-AGTC-TG-TAG--CGAGCT---CT-AACC--GT-GGACCC----TGC-GC---A---C-C-T-A--A-TT-CG-T-T-----C--G-A----------GAAGA-G--CG---AC-G--GT-GCTT-CGACC Ilex_pedunculosa C--A-AA-GTAGA-C--CC-G-GCGAAC--T-CG--TT-----A-AA-AT--A-TAT-GG------C----T---GGGGGTCTGGG----A--A--GGGG-TG-CGCGAG-------CCCCCC-AA--C--AC----AC---T--CCCC-CAG-----C--CCGCT--C--G-G-GA---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A---G--C--GG-GG-A--C-T---C----GGC---C--A-----A---G--CTC---CC-G---A--C-----A-A-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C--A-CAAC--T-GAAG-GGCTGG-CCTC-TC--G---A-------TG-T-C-CC-GTT--CGC-GGT-GTGC---AAC------G-GGAGGCA-T--T---T--GCATC-TTTT--G---AATC----TAAAATGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGCAA--GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CCA---A----CCC--C-----A-A--T--G-C-----CA-AG---CT---T-------G--------C-TG-GG-TA--TTG--C--G--G--G--AG----C--T------G----GG-G-CGGAAATTGGCCTCCCGT---C-------C---A-C----G---A--CC-GT--G-C--GCGGTTGG-CCC-----------AT-AAA--AA-----TGAGTT--CCT----G-A-CGATT--GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC------A--{CT}-G-C----A-TCA------A---GTCG--TGAGGC-A-CCG----AGTC-TG-TAG--CGAGCT---CT-GATC--GT--GACCC----T-TCGC---A---C-C--------TT-C--TCT---A------A-T-----G--------G---G---AT-G--GT-GCTTCCGACC Ilex_percoriacea C--A-AA-GTAGA-C--CCG--GCGAAC--T-CG--TTA----A-AATAT--A---TG-G------C----T---GGGGGTCTGGG----A--A--GGGG-TG-CGCGAG-------CCCCCC-AA--C--A-C---A-C--T--CCCC-C-A-GC--C--CG-CT--C--G-G-GA---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A---G---C-GG-GG-A--C-----TC---GGC---C--A-----A---G--CT---CCC-G---A---C----A-A-CGAA----CCCC-GGCGC----T-G-TT--TGCGCCAAGGAA-C-C-A--CAAC--T-GAAG-GGCTGG-CCTC-TC--G----A------T-GT-C-CC-GTT--CGC-GGT-GTGC--A-AC------G-GGAGGCAT---T---T--GCATC-TTTT--G---AATC----TAAAATGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAA-CC-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAA-C-CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG---------------C---------CCC--C-----A-A-------------C-------C----C----------------C-----A--A--TTG--C--G--G--G--A---G-T--C-G----G----GG-G-CGGAAATTGGCCTCCCGT----C------C---A-C----GA--A---C-GT--G-C--ACGGTTGG-CCC--------A--A--AAA--AA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT--GG-TGGTTGAA-A--G-AC-CT-C----T---T-G----C-G-TC-------AT--GTC-G-TGAGGC-A-CC-A---AGTC-TG-TAG--CGAGCT---CT-GACC--GT--GACCC----TGT-GC---A---C-C--------TC-C--T-T-----C----GC---------------G---G---AT--G-GT-GCTC-CGACC Ilex_pseudobuxus C--A-AA-GTAGA-C--CC-G-GCGAAC--C-TG--TT-----A-AA-AT--ATT-T-GG------C----C---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG------CCCCCCC-GA--C--AC----AC---T--CCCC-C-G-----C--CC-CT--C--G-G-GA---T-TC--GGC--T-T--G---C-G---T-TC----C--CC----T---G-----CC--GG-GG-A--C-C---C----GGT---C--G-----A---G--CTC---CC-G---A--C-----A-A-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C---TTAAC--T-GAAG-AGCTGGCCCCC-CC--G---A-------TG-C-C-CC-GTT--CGC-GGT-GTGC----AC----GGGAGGAGGCA-T--T---T--GCGTC-TTTT--G---AATC----CAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGTTAAGGGC-A-CGTCTGCCTGGGCGTCA-CG-CAT-CAA---GTCG--------C-CC--CCA---A----CCC--C-----A-A--C--GCC-----C--GG---CT-A{CT}T----G--G--------C-TG-GA-CG--TTG--C--G--G--G--AG----C--T------G----GG-G-CGGAAATTGGCCTCCCGT--CC----A--C---A-C----G---A--CC-GT--G-C--GCGGTTGG-CCC-------AA--A--AAA--AA-----CGAGCT--CCT----G-A-CGA-T-GGA-CGTCC---CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC--------TT-G-C----A-TC----T--G---GTCG--TGAGGC-A-CCG----AGTC-TG-TAG--CGAGCT---CT-GATC--GT--GACCC----TGT-GC---A---C-C--------TC-C--T-T---ATT----A-----G-G--------G---G---AC-G--G-TGCTT-CGACC Ilex_rotunda C--A-AA-GTAGA-C--CC-G-GCGAAC--T-CG--TT-----A-AA-AT--A---T--G------CG---T---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG-C-----CCCCCC-GA--C--AC----AT---T--CCCC-C-A----CC--CC-C---C--G-G-GA---C-TT--GGC--C-CG-G-----G---T-TC----C--CC--T-T-------G--C--GG-GG-A--C-T---C----GGC---CA-A-----G---G--CTC---CC-G---A--C-----A-A-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C-T--TAA--CC-GAAG-AGCTGG-CCCC-CC--G---{AG}-------TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCG----TA--C--GCATC-TTTC--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-C-GCAT-C-A-C-GTCG-C--------CC--CCA---AC---CCCGAC-----A-A--T--G-C-----C-CGG---C----T-GGCA--G--------C-CG-GA-TA--TTG--C---G-G--G--AG----T--T------GC---GG-G-CGGAGATTGGCCTCCCGT---C-------C---A-C----G---A--CC-GT--G-C--ACGGTTGG-CCC-----------A--AAA--AGC-----GAGTT--CTT----G-A-CGA-CG-GA-CGT-CA--CG-ACGA-GT-G-G-TGGTTGGA-A-G--AC-CTC-----T---T-G-C----G-TC-G-----A---GTCG--TGAGGC-ACCCG----AGTC-TG-TAA--CGAGCTC--T--GACC--G-C-GACCC----TGT-GC---G---C-C--------TT-C--C-T-----T----A--G----G--------G---G---GC-G--GC-GCTC-CGACC Ilex_rugosa C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--A---T--GC-----C----T---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG-------CCCCCC-AA--C--AC----AC---T--CCCC-C-A---------C-CT--C--G-G-GA---T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A---G--C--GG-GG-A--C-T---T----GGT---C--A-----A---G--CTA---CC-G---A--C-----A-A-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C-A--TAAC--T-GAAG-AGCTGG-CCTC-CT--G-----T-----TG-T-C-CC-GTC--TGC-GGT-GTGC----AC------G-GGAGGCAT---T---T--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGG?TTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CCA-CCA---A----CCC--C-----A-A--T--G-------C-------C----T----A--G--------C-TG-GA-TA--TTG--{AC}--G--G--G--AG----T--T-G----G----GG-G-CGGAAATTGGCCTCCCGT---C-------C---A-C----GA--A---C-GT--G-C--GCGGTTGG-CCC-A------A--A--AAA--AA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ATAA-GT-G-G-TGGTTGAA-A-G--AC-CT--A---T---T-G-C----G-TC-------AT--GTCG--TGAGGC-A-CCA----AGTC-TG-TAG--CGAGCT---CT-GACC--GT--GACCC----TGT-GC---A---C-C--------TT-C--T-T-----C----AT---------------G---G---AT-G--GT-GCTT-CGACC Ilex_serrata C--A-AA-ATAGA-C--C{CT}-G-GCGAAC--T-TG--TT-----A-AA-AT--A---T--G------C-T--T---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG---T---CCCCCC-GA--C--AC----AC---T--CCCC-C-A-----C--CC-C---C--G-G-GA---T-TT--GGC--T-T--G---C-G---T-CC----C--CC----T---A---G--C--GG-GG-A--C-T---C----GGT---C--A-----A---G--CTC---CC-G---A--C-----A-A-CGAA---C-CCC-GGCGC----TA--TC--TGCGCCAAGGAA-C-C-T--TAAC--C-GAAG-AGCTGG-CCCC-CC--G---A-------TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCG----T-A-T--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CA-CAT-C-A-C-GTCG----------CC--CCA---A----CCC--C-----A-A--T--G-C-----C-TAG---T----T----G--G--------T-TA-GG-CA--TTGT-T-----G--G--AG----T--T----G-G----GG-G-CGGAAATTGGCCTCCCGT---C-------C---A-C----G---A--TT-GT--G-C--GCGGTTGG-CCC-----------A--AAA--AA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC-----T---T-G-C----A-TC--A----A---GTCG--TGAGGC-A-CCG----AGTC-TG-TAA--CGAGCT---CT-AACC--GT--GACCC----TGT-GC---A---C-C--------TT-C--T-T-----T----A--G----G--------G---G---AT-G--GT-GCTC-CGACC Ilex_taubertiana C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--ATT-T-GG------C----C---GGGGGTTTGAG----A--A-GGGGG-TG-CGCGAG------CCCCCCC-{AG}A--C--AC----A{CT}---T--CCCC-C-G--------CC-CT-----G-G-GA---T-TT-GGGT--T-T--G---C-G---T-TC----C--CC----T---A-----CC--GG-GG-A--C-C---C----GGT---{CG}--G-----A---G--CTC---CC-G---{AC}--C-------ACCAA{AC}---C-CCC-GGCGC----TG--TT--TGCGCCAAGGAA-C-C---TTAAC--T-GAA?-A?CTGGCCCCC-CC--G---A-------TG-T-C-CC-GTT--C?C-GGT-GTGC----AC-----GG-GGAGGCA-T--T---T--GCGTC-TTTT--G---AATT----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-A-CGT{CT}TGCCTGGGCGTCA-CG-CAT-C-A-C-GT{CT}G----------CC--CCA---A----CCC--C-----A-A--T--GCC-----C--GG---CT-ACT----A--{AG}--------C-TG-GA-CGT-T{CT}---C--G--G--G--A{AG}----C--T------G----GG-G-CGGAAATTGGCCTCCCGT--CC----A--C---A-C----G---A--CC-GT-GG----GCGGTTGG-CCC----AAAAA--A--AAA--AA-----TGAGCT--CTT----G-A-CGA-T-GGA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--GC-CTC--------TT-G-C----G-TC----T--A---GTCG--TGAGGC-A-CCG----AGTC-TG-TAG--CGAGCT---TT-GATC--GT--GACCC----TGT-GC---G---C-C--------TC-C--T-T---ATT----A------GG--------G---G---AC-G--GT-GCTT-CGACC Ilex_theezans C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--ATT-T-GG----C-C--G-----GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG------CCCCCCC-GA--C--AC----A{CT}---T--CCCC-C-G-------CCC-C---C--G-G-GA---T-TT--GG{CGT}--T-T--G---{CG}-G---T-TC----C--CC----T---A----G-C--GG-GG-A--C-C---C----GGC---C------G-A----G-CTC---CC-G----A-C-----A-A-CGAA---C-CCC-GG{CG}G{CG}----TG--TC--TGCGCCAAGGAA-C-C---TTAAC--T-GAA{AG}AAGCT{AG}GCCCCC-CC--G---{AG}-------TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCA-T--T---T--GCGTC-TTTT--G---AATC----CAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-A-CGTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CCA---A----CCC--C-----A-A--T--GCC-----T--GG---CT-ACC----A--G--------C-{CT}G-GA-CG--TTG--C--G--G--G--AG----C--T------G----GG-G-CGGAAATTGGCCTCCCGT--CC----A--C---A-C----G---{AG}--CC-GT--G-{CGT}--GCGGTTGG-CCC-------AA--A--AAA--AA-----TGAGCT--CTC------ACCGA-T-GGG-{CG}GT-CA--C-G{AG}CAA-GT-G-G-TGGTTGAA-A-G--GC-CTC---------TAG-C----A-TC----T--A---GTCG--TGAGGC-{AT}-CCG----AGTT-TA-CAG--CGAGCT---CT-GATC--GT--GACCC----TGT-GC---A---C-C--------TT-C--T-T---ATT----A----GG-G--------G---G---A{CT}-G--GT-GCTT-TGACC Ilex_theezans_Gbk C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--ATT-T-GG------C----C---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG------CCCCCCC-GA--C--AC----AC---T--CCCC-C-G-----C--CC-C---C--G-G-GA---T-TC--GGC--T-T--G---C-G---T-T----CC--CC----T---A----G-C--GG-GG-A--C-C---C----GGT---C--G-----A---G--CTC---CC-G-----TC-----A-A-CGAA---C-CCC-GGCGC----TG--TC--TGCGCCAAGGAA-C-C---TTAA?--T-GAAGAAGCTGGCCCCC-CC--G---A-------TG-T-C-CC-GTT--CGCGGG--GTGC----AC----GGG-GGAGGCA-T--T---T--GCGTC-TTTC--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-A-CGTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CCA---A----CCC--C-----A-A----TGCC-----C--GG---CT-ACC----A--G--------C-TG-GA-C--GTTG--C--G--G--G--AG----C--T------G----GG-G-CGGAAATTGGCCTCCCGT--CC----A--C---A-C----G---A--CC-GT--G-C--GCGGTTGG-CCC------AAA--A--AAA--AA-----TGAGCT--CCT----G-A-CGA-T-GGG-CGT-CA--CG-ACAA-GT-G-G-TGGTTGGA-A-G--AC-CTC--------TT-G-C----A-TC----T--A---GTCG--TGAGGC-A-CCG----AATC-TG-TAG--CGAGCT---CT-GATC--GT--GACCC----TGT-GC---A---C-C--------TT-C-TT-T---ATT----A-----G-G--------G---G---AC-G--GT-GCTT-TGACC Ilex_vomitoria C--A-AA-GTAGA----CC--GGCGAAC--T-TG--TT-----A-AA-AT--A---T--G------C----T---GGGGGTTTGAG--AAA--AG-GGGG-TG-CGCGAG----CC-CCCCCC-AA--C--AC----AC---T--CCCC-C-A---------C-CT--C--G-G-GA---T-TT--GGC--T-T--G---T-G---T-TC----C--CC----T---A---G--C--GG-GG-A--C-T---C----GGT---C--A-----A---G--CTC---CC-G---A--C---A-A-A-CGAA---C-CCC-GGCGC----TA--TC--TGCGCCAAGGAA-C-C-A--TAAC--T-GAAG-AGCTGG-CCTC-CC--G---A-------TG-T-C-CC-GTT--CGC-GGC-GCGC----AC------G-GGGGGTAT---T---T--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CC---AA----CCC--C-----A-A--T--G-------C-------C----T----A--G--------C-TG-GA-TA--TCG--T--G--G--G--AG----T--T------G----GG-G-CGGAAATTGGCCTCCCGT---T-------C---G-C----G---A-C-C-GT--G--A-GCGGTTGG-CCC-----------A--AAA--AA-----TGAGTT--CCT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC-----T---T-G-C----A-TC-------AT--GTCG--TGAGGC-A-CCT----AGTC-TG-TAG--CGAGCT---CT-AACC--GT--GACCC----TGT-GC---A---C-C--------TT-C--T-T-----C----A-------------G--A---G---AC-G--GT-GCTT-CGACC Ilex_warburgii C--A-AA-GTAGA-C--CC-G-GCGAAC--T-TG--TT-----A-AA-AT--A---T--GC-----C----T---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG-------CCCCCC-AA--C--AC----AC---T--CCCC-C-A-G---CG-CC-CT--C--G-G-G--A-T-TT--GGC--T-T--G---C-G---T-TC----C--CC----T---A---G--C--GG-GG-A--C--T--C----GGT---C--A-----A---G--CTC---CC-G---A--C-----A-A-CGAA---C-CCC-GGCGC----TA--TC--TGCGCCAAGGAA-C-C-A--TAAC--T-GAAG-GGCTGG-CCTC-CC--G----A------TG-T--CCC-GTT--CGC-GGT-GTGC----A-G-----G-GGAGGCAT---T---T--GCATC-TTTT--G---AATC----TAAAACGACTCTCGGCAACGGCTTGGTG-T-GAATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTG-AA-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C--AC-GTCG----------CCA-CCA---A----CCC--C-----A-A--T--G------------C--C----C----G---G-------C-TG-GA-TA--TTA--C--G--G--G--AG----T--T-G----G----GG-G-CGGAAATTGGCCTCCCGTC--C--A----T---A-T----GA--A---C-GC--G-C--GCGGTTGG-CCC-----------A--AAA--AA-----TGAGTT--CTT----G-A-CGA-TG-GA-CGT-CA--CG-GCAA-GT-G-G-TGGTTGAA-A-G--AC-CT-C----T---T-G-C-----GTC-------AT--GTCG--TGAGGC-A-CCA----AGTC-TG-TAG--CGAGCT---CT-GACT--GC--GACCC----TGT-GC---A--CC-C--------TTCC--T-T-----C----AC-----------------G-G---AT-G--GT-GCTC-CGACC Ilex_yunnanensis C--A-AA-GTAGA-C--CC-A-GCGAAC--T-TG--TT-----A-AA-AT--A---T--G------C-C--C---GGGGGTTTGAG----A--A--GGGG-TG-CGCGAG-------CCCCCC-GA--C--AC---AA----T--CCCC-C-A-----C--CC-C---C--G-G-GA---T-CT--GGC--T-T--G---C-G---T-T-----C--CC---AT---A---G--C--GG-GG-A--C-T-------GGGT---C--A-----G---G--CTC---CC-G---G--C-----A-A-CGAA---C-CCC-GGCGC----TA--TC--TGCGCCAAGGAA-T-C-T--TAAC--T-GAAG-AGCTGG-CCCC-CC--G---A-------TG-T-C-CC-GTT--CGC-GGT-GTGC----AC------G-GGAGGCA----T-A-T--GCATC-TTTT--G--AAATC----TAAAACGACTCTCGGCAACGGCTTGGTG-TG-AATTGCAGAATCCCGTGAAC-C-ATCGAGTTTTTGA-A-CGCAAGTTGCGCCCAAAG--CCATTAGGCTAAGGGC-AC-GTCTGCCTGGGCGTCA-CG-CAT-C-A-C-GTCG----------CC--CCA---A----CCC--C-----A-A--T--G-C-----C-TAG---C----T----A--G--------C-TG-GA-TA--TTG--C--G--G--G--AG----T--T------G----GG-G-CGGAAATTGGCCTCCCGT---C-------C---A-C----G---A--CC-GT--G-C--GCGGTTGG-CCC---A----A--A--AAA--AA-----TGAGTT--CCT----G-A-CGA-TG-GA-CGT-CA--CG-ACAA-GT-G-G-TGGTTGAA-A-G--AC-CTC-----T---T-G-C----A-TC-----A-A---GTCG--TGAGGC-A-CCG----AGTC-TG-TAG--CGAGCT---CT-GACC--GT--GACCC----TGC-GC---A---C-C--------TT-C--T-C-----T----A---T---G--------G---G---AT-G--GT-GCTT-CGACC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_141) = N: 1-1116; CODONPOSSET CodonPositions (CHARACTERS = ITS_141) = N: 1-1116; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2476] TITLE ITS_1011; LINK TAXA = Taxa1; DIMENSIONS NCHAR=715; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Helwingia_chinensis C--AAAATAGAC-CC-GCGAACATGTT----CAT-CCATC--G-GG-GGTTGGCGAGGGG-TGCGCGAGCCCCCAATCC---ACC-CCCTCTCCGG--C-GAT---GCT-GCTTTG-AATTGTCGC-CA-A-TG-CGGT-GGCATCC-ATTGTTGTGT-CG-ACTGAAC---AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG--AGCCAGTCTTCGA-AAGC-CCCGTACGCGGTGCGC--TT---G-GGAGG{CT}GT-TGGCGTC-TTTAAA---ATCATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG------CC-CC-CA-ACC--CACT-----CC-------ACAC--ACGAAT-TGCG---GTG---TTGCTTT-GGGGGCGGAGATTG--G----CCT--C--C-CATACAAAATAAGCTT-----------GCGTG-GTTGGCCTAAAAGCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTTAAATATG-CCTCTTGCGTA-TTATCGCGAGACAACCCATCTCCGGCGTGTGCTCT-TT--G-A-G--A--C--CCC-A-ATG-ACGATGCTTCGATT Helwingia_japonica C--AAAATAGAC-CC-GCGAACATGTT----CAT-CCAT---C-GG-GGTTGGCGAGGGG-TGCGCGAGCCCCCAATCC---ACC-CCCTCTCCGG--C-GAT---GCT-GCTTTG-AATTGTCGC-CA-A-TG-CGGT-GGCATCC-ATTGTTGTGT-CG-ACTGAAC---AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG--AGCCAGTCTTCGA-AAGC-CCCGTACGCGGTGCGC--TT---G-GGAGGCGT-TGGCGTC-TTTAAA---ATCATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG------CC-CC-CA-ACC--CACT-----CC-------ACAC--ACGGAT-TGCG---GTG---TTGCTTT-GGGGGCGGAGATTG--G----CCT--C--C-CATACAAAATAAGCTT-----------GCGTG-GTTGGCCTAAAAGCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTTAAATATG-CCTCTTGCGTA-TTATCGCGAGACAACCCATCTCCGGCGTGTGCTCT-TT--G-A-G--A--C--CCC-A-ATG-ACGATGCTTCGATT Ilex_amelanchier C--AAAGTAGAC-CCGGTGAACTTGTT----AAA-ACATG--C-CC-GGGGGTTTGAGAA-GGGGTGCGCGAGCCCCCC---CGA-CACACT--CC--C--CC---ACC-TCGGGA-TTTGGCTTG-TG-T-TC-CCCT-AGCGGGG-ACTCGGTCAA-GCTCCCAAC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG--AGCTGGCCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCAT-TTGCATC-TTT-CG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTTG------CCCCA-AC-CCC--CAATTCCTATAT------AGTTGGATATTGTGTAA---GTTG--GGGCCGGAAATTGGCCTCCCGT--C----CAC--G--ACCGTGAGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGGGGTGGTTGAAAGACCTCTTGCATCAT-GTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTGACCCTATATGC-GC-C-T--T--C--TTC-A-GTG-ATGGTGCTTCGACC Ilex_anomala C--AAAGTAGAC-CCGGCGAACTTGTT----AAA-ATATG--C-AT--GGGGTTTGAGAA-GGGGTGCGCGAGCCCCCC---A-A-CACACT--CC--C--CC---ACC-TCGGGA-TTTGGCTTG-TG-T-TC-ACCT-AGTGGAG-ACTCGGTCAA-AGGTCCCGAC---AACGAA----CCCCGGCGC-TATATGTGCCAAGGAACCATAAC-TGAAG--AGCTGGCCTCTCG-ATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC-TATAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA-CCC--CAATG----CT-------GGAT--ATTACG-GGAG---TTG---GGGGCGGAAATTGGCCTCCCGT--A----CAC--G--GCTGTGCGCGGTTGGCCC-----------AAAAA-TTGAGCTCTGGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCATCAA-GTTGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGTGACCCTGTG-CA--C-C-T--T--C--TTT-A-GGGAATGGTGCTTCGACT Ilex_argentina C--AAAGTAGAC-CCGGCGAACTTGTT-A--AAATATTTG--G-GC-GGGGGTTTGAGAA-GGGGTGCGCGAGCCCCCC---CGA-CACACT-CTC--C--CA---CCC-ACGGGA-TTTGGCTTG-CG-T-TC-CCCT-AGTGGGG-ACCCGGTCGA-CCTCCCGAC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG--AGCTAGCCCCCTG-ATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCAT-TTGCGTC-TTT-TG---A--ATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCA------CCCCA-A--CCC--CAATGCCTGGCT---ACCAGCTGGACGTTGCGGGA---GCT---GGGGCGGAAATTGGCCTCCCGT-CC---ACAC--G--ACCGTGTGCGGTTGGCCC-------A---AAAAA-ATGAGCTCTTGACGATGGACGTCACCACAAGTGGTGGTTGAAAGACCTCTTGCATCTA-GTCGTGAGGCA-CCGAGTCTATAGCGAGCTCTGATCGTGACCCTGTG-CA-CC-T-TCTT--A--TTA-G-GGG-ATGGTGCTTTGACC Ilex_argentina_Gbk C--AAAGTAGA--CCGGCGAACTTGTT----AAA-ACATG--C-TG-GGGGGTTTGAGAA-GGGGTGCGTGAGCCCCCC---CAA-CACACT-CCC--C--CC---ACC-TCGGGATTTCGGCTTG-CG-T-CC-CCCT-AGCGGGG-ACTCGGTCAA-GCTCCCGAC-AA-AACGAA-C--CCCCGGCGC-TATCTGCGCCAAGGAACCACAAC-TGAAG--AGCTGGCCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATCATGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-CC---CCCCCTCCACCC--CAATGCCCACCT------AGCTGGATATTGTGGGAGTCGTCG--GCGCGGAAATTGGTCTCCCGTC--C--G-CAC--G--ATCGGGAGCGGTTGGCCC----------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCATCAC-GTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAACCGTG-ACCCTGC-GC-AC-C-T--T--C--TTC-A-GCG-ATGGTGCTTCGACC Ilex_beecheyi C--AAAGTAGAC-CCGGCGAACTCGTT----AAA-ATATAT-G-GC-TGGGGGTCTGGGA-AGGGGTGCGCGAGCCCCC---CAA-CACACTCCCC--CAGCC---CGC-TCGGGA-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACTTGGCCAA-GC-TCCCGAC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCACAAC-TGAA---GGCTGGCCTCTCG-ATGT-CCCGTTCGCGGTGTGCA-AC---G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-CA-ACC--CCA------AT-------TGCG--GGAGTC-GGGG---GCG---GAAATTG-GCCTCCCGTCCA-C-------GAA--C--G-TGCACGGTTGGCCC-A-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCGTCAT-GTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTGACCCTGTG-CA--C-C-T--C--C--TTC-G-CGG-ATGGTGCTCCGACC Ilex_brasiliensis C--AAAGTAGAC-CCGGCGAACTTGTT-A--AAATATTTG--G-CCGGGGGGTTTGAGAA-GGGGTGCGCGAGCCCCCC---CGA-CACACT-CCC--C--CG---CCC-CCGGGA-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACCCGGCCTA-GCTCCCGAC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AAGCTAGCCCCCCC-GTGT-CCCGTTCGCGGCGTGC--AC---G-GGAGGCAT-TTGCGTC-TTT-TG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCA-A--CCC--CAATGCCTGGCT---ACCAGCCGGACGTTGCGGGA---GTT---GGGGCGGAAATTGGCCTCCCGT-CC---ACAC--G--ACCGTGTGCGGTTGGCCC------AA---AAAAA-ATGAGCTCTCACCGATGGGCGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCATCTA-GTCGTGAGGCA-CCGAGTCTACAGCGAGCTCTGATCGTGACCCTGCG-CA-CC-T-TCTT--A--TTAGG-GGG-ATGGTGCTTTGACC Ilex_brevicuspis C--AAAGTAGAC-CCGGCGAACTTGTT-A--AAATATTTG--G-CCGGGGGTTTGAGAAG-GGGGTGCGCGAGCCCCCC---CGA-CACACT-CCC--C--CG--CCCC-TCGGGA-TTTGGCTTA-CG-T-TC-CCCT-ACTGGGG-ACCCGGTCGA-GCTCCCGAC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCAT-TTGCGTC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCA-A--CCC--CAATGCCTGGCT---ACTAGCTGGACGTTGCGGGA---GCT---GGGGCGGAAATTGGCCTCCCGT-CC---ACAC--G--ACCGTGCGCGGTTGGCCC-----AAA---AAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGGCCTCTTGCATCTA-GTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTGACCCTGTG-CA-CC-T-CCTT--A--TTA-G-GGT-ATGGTGCTTCGACC Ilex_buergeri CA-AAAGTAGAC-CCGGCGAACTTGTT----AAA-ATATG--C-CT-GGGGGTTTGAAAA-GGGGTGCGCGAGCCCCCCA--ACA-CACTCC-CCCA-G--CC---CCC-TCGGGA-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACTCGGTCAA-GCTCCCGAC----AACGAA----CCCCGGCGC-TATTTGCGCCAAGGAACCATAAC-TGAAG--GGCTGGCCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AG---G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACC-AA-CCC--CAATG--C-CC-------AGCTGGATATTGCGGGA---GTTG--GGGGCGGAAATTGGCCTCCCGT--C----CAT--G--AACGCGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTGCGTCAT-GTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCGACCCTGTG-CA-CC-C-T--TC-C--TTC-A-CGG-ATGGTGCTCCGACC Ilex_canariensis C--AAAGTAGAC-CCGGCGAACCCGTT----AAA-ACATG--C-CT-GGGGGTTTGAGAA-GGGGCGCGCAAGCCCCCC--GACG-CACTCC-CCC--A--CC---CCC-CGGGGG-TTTGGCTTG-GG-T-TC-CCCT-AGCGGGG-ACCCGGTCAG-GCTCCCGGC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-AGAAG--AGCTGGCCCCCCG-GTGTCCCCGTTCGCGGTGTGC--ACT--G-GGAGGCAT-TTGCGTC-TTT-CG---A--ATC---TGAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGCTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCAAGGGCACGTCTGCCTGGGCGTCACCCATCACGTCG----C-CCCCA-A--CCC--CAATGCCTGGCT------AGCCGGGTATCGCGGGA---GTT---GGGGCGGAAATTGGCCTCCCGT--C----CACAGG--ACCGTGCGCGGTTGGCCCAAA----A---AACAA-ATGAGTTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCGTCAT-GTCGTGGGGCA-CCGAGTCTATGGCGAGCTCCGACCGGGACCCTGCG-CA-CA-C-TC-C--T--CCG-G-GGG-ATGGTGCTCCGACC Ilex_cassine C--AAAGTAGA--CCGGCGAACTTGTT----AAA-ACATG--C-TG-GGGGGTTTGAGAA-GGGGTGCGTGAGCCCCCC---CAA-CACACT-CCC--C--CC---ACC-TCGGGATTTCGGCTTG-CG-T-CC-CCCT-AGCGGGG-ACTCGGTCAA-GCTCCCGAC-AA-AACGAA-C--CCCCGGCGC-TATCTGCGCCAAGGAACCACAAC-TGAAG--AGCTGGCCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATCATGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-CC---CCCCCTCCACCC--CAATGCCCACCT------AGCTGGATATTGTGGGAGTCGTCG--GGGCGGAAATTGGCCTCCCGTC--C--G-CAC--G--ATCGTGAGCGGTTGGCCC----------AAAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCATCAC-GTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAACCGTG-ACCCTGC-GC-AC-C-C--T--C--TTC-A-GCG-ATGGTGCTTCGACC Ilex_collina C--AAAGTAGAC-CCGCGAACTTGTTA----AAA-TATGC--T-GG-GGGTTTGAGGTTAGGGGGTGCGCGAGCCCCCC---CAA-CACACT-CCC--C--CA---CCT-CGGGAT-TTGGCTTTG-TG-T-TC-CCCT-AGTGGGG-ACTCGGTCAG-GCTCCCGACA---AACGAA----CCCCGGCGC-TATCTGCGCCAAGGAATCATAAC-TGAAG--AGCTGGCCTCCCG-ATGT-CCCGTTCGCGGCGCGC--AC---G-GGGGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAA{CT}GACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA-CCC--CAATG--C-CT-------AGTTGGATATTGTGGGA---GTT---GGGGCGGAAATTGGCCTCCCGT--C----CAT--G--ACCGTGAGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCATCAT-GTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAATCGTGACCCTG{CT}G-CA--C-C-T--T--C--TTC-A-ACG-ACGGTGCTTCGACC Ilex_cornuta C--AAAGTAGAC-CCGGCGAACTTGTT--A-AAA-ATATG--C-CT-GGGGGTTTGAGAA-GGGGTGCGCGAGCCCCCCA--ACA-CACTCC-CCCA-G--CC---CCC-TCGGGA-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACGCGGCCAA-GCTCCCGAC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG--GGCTGGCCTCCCG-GTGT-CCCGTTCGCGGCGTGC--AC---G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG------CCACC-AA-CCC--CAATG--C-CC-------AGCCGGATATTGCGGGA---GTTG--GGGGCGGAAATTGGCCTCC?GT--T----?AC--G--AACGTGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCGTCAT-GTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCGACCCTGTG-CA-CC-C-T--T--C--TTC-A-CGG-ATGGTGCTCCGACC Ilex_crenata C--AAAGTA{AC}A--CCGGCGAACTTGTT----AAA-ACATG--C-CG-GGGGGTTTGAGAA-GGGGTGCGCGAGCCCCCC---CAAT-AAGGT-TCC--C--CC---ACC-TCCGGATTTGGCTTGT-TT-T-CC-CCCT-GGCGGGGAACTCGGCCCA-GCTCCCGAC--A-AACGAA----CCCCGGCGC-TGTTTGCGCCAAGGAACCATAAC-CGAAG--AGCTGGTCTCCCG-GTGC-CCCGTCCGCGGTGTGC--AC---G-GGAGGCGT-TTGCGTC-TTT-TG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCA-AC-CCC--C--CAACGGCCT------AGCCGGATATTGCGGGA---GTTG--GGGCGGAGATTGGCCTCCCGTC--C--G-CGC--G--ACCGTGAGCGGTTGGCCC-----------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTCGCATCAC-GTCGTGGGGCG-CCTAGTCTGTAGCGAGCTCCGACCCTGTGCACCTG-AT-TC-G-C--T--C--TAG-G-GCG-A-GGTGCTTCGACC Ilex_decidua C--AAAGTAGAC-CGGCGAACTTGTTA----AAA-TATGC--T-GG-GGGTTTGAGAAAAGGGGGTGCGCGAGCCCCCC---CAA-CACACT-CCC--C--CA---CCT-CGGGAT-TTGGCTTTG-TG-T-TC-CCCT-AGCGGGG-ACTCGGTCAA-GCTCCCGACA---AACGAA----CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG--AGCTGGCCTCCCG-ATGT-CCCGTTCGCGGCGCGC--AC---G-GGGGGTAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA-CCC--CAATG--C-CT-------AGCTGGATATCGTGGGA---GTT---GGGGCGGAAATTGGCCTCCCGT--T----CGC--G--ACCGTGAGCGGTTGGCCC-----------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCATCAT-GTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTGACCCTGTG-CA--C-C-T--T--C--TTC-A-GAG-ACGGTGCTTCGACC Ilex_dimorphophylla C--AAAGTAGAC-CCGGCGAACTTGTT--A-AAA-ATATG--C-CT-GGGGGTTTGAGAA-GGGGTGCGCGAGCCCCCCA--ACG-CACTCC-CCCA-G--CC---CCC-TCGGGG-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACGCGGCCAA-GCTCCCGAC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG--GGCTGGCCTCCCG-GTGT-CCCGTTCGCGGCGTGC--AC---G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG------CCACC-AA-CCC--CAATG--C-CC-------AGCCGGATATTGCGGGA---GTTG--GGGGCGGAAATTGGCCTCCCGT--T----CAC--G--AACGTGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCGTCAT-GTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCGACCCTGTG-CA-CC-C-T--T--C--TTG-A-CGG-ATGGTGCTCCGACC Ilex_dumosa_dumosa C--AAAGTAGA-CCGGCGAACTCTGTT----AAA-ACATG--CTGG-GGGGGTTTGAGAA-GGGGTGCGCGAGCCCCCC---CAATCACGCT-CCC--C--CC---ACC-TCGGGATCTGG{CT}TTGT-TT-T-CC-CCCT-GGCGGGGAACTCGGCGGA-GCTCCCGAC--A-AACGAA----CCCCGGCGC-TGTATGCGCCAAGGACCCATAAC-CGAA{AG}--AGCTGGTCTCCCG-TTGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCAT-CTGCGTC-TTT-TG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCA-AC-CCC--AAAAAACGTCCT------AGGTGGACATTGTGGGA---GTTG--GGGCGGAGATTGGCCTCCCGTC--C-AC-ACG--T--CCCGTGAGCGGTTGGCCC----------AAAAAA-ACGAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTTGCATCATGTCGTGAGGCG-CCTAGT?TGCAACGA?CTCCGACCCTGTGCACCTA-GT-TG-T-C--C-GCTGTAG-G-GCG-ACGGTGCTTCGACC Ilex_dumosa_guaranina C--AAAGTAGA-CCGGCGAACTCTGTT----AAA-ACATG--CTGG-GGGGGTTTGAGAA-GGGGTGCGCGAGCCCCCC---CAATCACGCT-CCC--C--CC---ACC-TCGGGATCTGGCTGGT-TT-T-CC-CCCT-GGCGGGGAACTCGGCCGA-GCTCCCGAC--A-AACGAA----CCCCGGCGC-TGTATGCGCCAAGGACCCATAAC-CGAAG--AGCTGGTCTCCCG-TTGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCAT-CTGCGTC-TTT-TG---A--ATC---CAAAAC{CG}ACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTT?AACGCAAGTTGCGCCCAAAGCCAT?AGGCCAAGGGCACGTCT?CCTGGGCGTCACGCATCACGTCG------CCCCA-AC-CCC--AAAAAACGTCCT------AGGTGGACATTGTGGGA---GTTG--GGGCGGAGATTGGCCTCCCGTC--C-AC-ACG--T--CCCGTGAGCGGTTGGCCC----------AAAAAA-A?GAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTCGCATCATGTCGTGAGGCG-CCTAGTCTGCAACGATCTCCGACCCTGTGCACCTA-GT-TG-T-C--C-GCTGTAG-G-GCG-ACGGTGCTTCGACC Ilex_glabra C-AAAAGTAGAC-CCGGCGAACCTGTT---AAAA-ATATG--C-AT-GGGGGTCTGAGAA-AGGGTGCGCGAG-CCCCC---CGA-CACATT--CC--C--CC---ACC-CCGGGA-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACTCGGTCAA-GCTCCCGAC---AAACGAA---CCCCCGGCGC-TATCTGCGCCAAGGAACCTTAAC-{CT}GAAG--AGCTGGCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCAT-TTGCATC-TTT-TG-A-A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C--CCCCA-AC-CCC--CAATGCCTGGCT------AGCTGGGTATTGCGGGA---GTTG--GGG-CGGAAATTGGCCTCCCGT--C----CAC--G--ACCGTGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCATCAT-GTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCAGACCGGGACCCTGTGTGC-AC-A-T--T--C--TTT-AGGGG-ATGGTGCTTCGACC Ilex_integerrima C--AAAGTAGAC-CCGGCGAACTTGTT-A--AAATATTTG--G-CCGGGGGTTTGAGAA--GGGGTGCGCGAGCCCCCC---CGA-CACACT-CCC--C--CG---CCC-CCGGGA-TTCGGCTTG-CG-T-TA-CCCT-A{AG}CGGGG-ACCCGGTCGA-GCTCCCGTC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAGAAGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC-GGG-GGAGGCAT-TTGCGTC-TTT-CG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGT??????????GTC{CG}-----CCCCC{AGT}-A--CCC--CAAAGCCCGGTT---ACCAGCTGGACCTTGCGGGA---?CT---GGGGCGGAAATTGGCCTCCCGT-CC---ACAC--G--ACCGTGCGCGGTTGGCCC-----?AA---AAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGAAGACCTCTTGCAT?TA-GTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGCGACCCTGTG-CA-CCTT-CTTT--A--TTA-G-GGG-ACGGTGCTTTGACC Ilex_integra C--AAAGTAGAC-CCGGCGAACTTGTT----AAA-ATATAT-G-CC-TGGGGGTTTGAGA-AGGGGTGTGCGAGCCCCC---CAA-CAAAATTCCC--CAGCC---CCCTTGGGGA-TTTGGCTTG-CG-T-TC-CCCT-AGGGGGG-ATTGGGCCAA-GT-TCCGGAA---AACGAA----CCCGGGCGC-TTTTTGCGCCAAGGAACCATAAC-TGAAG--GGCTGGCCTCCCG-ATTT-CCCGTCCGCGGTGTGC--AC---G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-CA-ACC--CCA------AT-------TGCG--GGAGTT-GGGG---GCG---GAAATTG-GCCTCCCGTCCA-C-------GAA--C--G-TGCGCGGTTGGCCCAA-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCGTCAT-GTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCGACCCTGTG-CA--C-C-T--T--C--TTC-A-CGG-ATGGTGCTTCGACC Ilex_kiusiana C--AAAGTAGAC-CC{CT}GCGAACT{CT}GTT----TAA-ATATGT-C-CT-GGGGGTCAGACAA-GGGGTGCGCGAGCCCCCC---CAA-CACACTCCCC--CAGGC---CCC-TCGGGA-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACTCGGTCAA-GC-TCCCGAC---AACGAA----CCCCGGCGC-TATTTGCGCCAAGGAACCATAAC-TGAAG--GGCTGGCCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AG---G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-CA-ACC--CCA------AT-------TGCG--GGATT{CG}-AGGG---GCG---GAAATTG-GCCTCCCGTACATC--T----GAA--C--G-TGCGCGGTTGGCCCCG-----------AAAAA-ATG{AG}GTTCTTGAATAAGGACGTCACGACAAGTGTTGGTTGAAATACGCCTTGAGTCAT-GTCTTGAGGCA-CCTAGTCTGTAACGAGCTCTGACCGCAACTCTGTG-CAG-C-CAT--C--C--TTC-A-TGG-ATCGTGCTTCAACC Ilex_latifolia C--AAAGTAGAC-CCGGCGAACTTGTT----AAA-ATATG--C-CT-GGGGGTTTGAGAA-GGGGTGCGCGAGCCCCCCA--ACA-CACTCC-CCCA-G--CC---CCC-TCGGGA-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACTCGGTCAA-GCTCCCGAC----AACGAA----CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG--GGCTGGCCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AG---G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACC-AA-CCC--CAATG--C-CC-------AGCTGGATATTGCGGGA---GTTG--GGGGCGGAAATTGGCCTCCCGT--C----CAT--G--AACGCGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTGC{AG}TCAT-GTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC{CT}GCGACCCTGTG-CA-CC-C-T--TC-C--TTC-A-CGG-ATGGTGCTTCGACC Ilex_liukiuensis C--AAAGTAGAC-CCGGCGAACTTGTT----AAA-ATATG--C-CT-GGGGGTTTGAGAA-GGGGTGCGCGAGCCCCCCA--ACA-CACTCC-CCCA-G--CG---CCC-TCGGGT-TTTGGCTTG-CG-T-TC-CCCT-AGTGGGG-ACTCGGTCAA-GCTCCCGAC----AACGAA----CCCCGGCGC-TATCTGCG----GGAACCATAAC-TGAAG--GGCTGGCCTCCCG-ATGT-CCGGTTCGCGGTGTGC--AG---G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTTAATTGCAGAATCCCGTGAACCATCGAGTTTTTGATCGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACC-AA-CCC--CAATG--C-GC-------GGCTGGATATTACGGGA---GTTG--GGGGCGGAAATTGGCCTCCCGT-------TAT--G--AACGCGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTGCCTCAT-GTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGCGACCCTGTG-CA-AC-C-T--TC-C--TTC-A-CGT-ATGGTGCTCCGACC Ilex_macropoda C--AAAGTAGAC-CCGGCGAACTTGTT----AAA-ATATG--T-TT-GGGGGTTTGAGAA-GGGGTGCGCGAG-CCCCC---CCG-ACACAC-TCC--C--CC---ACC-TCGGGG-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACTCGGTCAG-GCTCCCGAC----AACGAA----CCCCGGCGC-TATTTGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCAT-ATGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCA-A--CCC--CAATGCCTACCT------GGCTGGATATTGCAGGA---GTT---GGGGCGGAAATTGGCCTCCCGT--C----CAC--G--ACTGTGTGTGGTTGGCCC--A----A---AAAAA-AAGAATTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCATCAT-GTCGTGAGGCA-TCGAGTCTTTGGCGAGCTCTGACCGTGACCCTGTG-C--AC-T-T--C--T---TT-C-GGG-ATGGTGCTTCGACC Ilex_maximowicziana C--AAAGTAGAC-CCGGCGAACTCGTT----AAA-ATATG--C-CT-GGGGGTTTGAGAA-GGGGTGCGCGAGCCCCCCA--ACA-CACTCC-CCCA-G--CC---CCC-TCGGGA-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACTCGGTCAA-GCTCCCGAC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG--GGCTGGCCTCCGG-GTGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG------CCACC-AA-CCC--CGATG--C-CC-------ATCTGGATATTGCGGGA---GTTG--GGGGCGGAAATTGGCCTCCCGT--T----CAC--G--AACGTGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCGTCAT-GTCGTGAGGCA-CCAAGTCTGTACCGAGCTCTGGCCGCGACCCTGCG-CA-CC-C-T--T--C--TTC-A-CGG-ATGGTGCTCCGACC Ilex_mertensii C--AAAGTAGAC-CCGGCGAACTCGTT----AAA-ATATAT-G-GC-TGGGGGTCTGGGA-AGGGGTGCGCGAGCCCCC---CAA-CACACTCCCC--CAGCC---CGC-TCGGGA-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACTCGGCCAA-GC-TCCCGAC---AACGAA----CCCCGGCGC-TGTTTGCGCCAAGGAACCACAAC-TGAAG--GGCTGGCCTCTCG-ATGT-CCCGTTCGCGGTGTGCA-AC---G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACAATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-CA-ACC--CCA------AT-------TGCG--GGAGTC-GGGG---GCG---GAAATTG-GCCTCCCGTCCA-C-------GAA--C--G-TGCACGGTTGGCCC-A-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCGTCAT-GTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTGACCCTGTG-CA--C-C-T--C--C--TTC-G-CGG-ATGGTGCTCCGACC Ilex_micrococca C--AAAGTAGAC-CCGGCGAACTTGTT----AAA-ATATG-CT-TT-GGGGGTTTGAGAA-GGGGTGCGCGAG-CCCCC---CGA-CACACT-CCC--C--CC---ACC-TCGGGA-TTTGGCTTG-{CT}G-T-TC-CCCT-AGCGGGG-ACTCGGTCAG-GCTCCCGAC----AACGAAC---CCCCGGCGC-TATTTGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCAT-ACGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCC-A--CCC--CAATGCCTAGCT------GGCTGGATATTGCGGGA---GTT-GGGGGGCGGAAATTGGCCTCCCGT--C----CAC--G--ACCGTGCGCGGTTGGCCC--A----A---AAAAATAAGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCATCAT-GTCGTGAGGCA-CCGAGTCTCTAGCGAGCTCTGATCGTGACCCTGCG-CG-CC-T-C--C--T---TC-C-GGG-ATGGCGCTTTGACC Ilex_microdonta C--AAAGTAGAC-CCGGCGAACTTGTT-A--AAATATTTG--G-CCGGGGGTTTGAGAA--GGGGTGCGCGAGCCCCCC---CGA-CACACT-CCC--C--CG-C-CCC-TCGGGA-TTTGGCTTG-CG-T-TC-CCCT-ACCGGGG-ACCCGGTCGA-GCTCCCGAC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTCAAC-TGAAG-AGCTGGCCCCCCCG-ATGC-CCCGTTCGCGGTGTGC--AC-GGGAGGAGGCAT-TTGCGTC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCATGTCG-----CCCCCA-A--CCC--CAACGCCTGGCT---ACTAGCCGGACGTTGCGGGA---GCT---GGGGCGGAAATTGGCCTCCCGT-CC---ACAC--GACACCGTGCGCGGTTGGCCC------AA---AAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCATCTA-GTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTGACCCTGTG-CA-CC-T-CCTT--A--TTA-G-GGG-ATGGTGCTTCGACC Ilex_microdonta_Gbk C--AAAGTAGAC-CCGGCGAACTTGTTAA--AAATATTTG--G-CCGGGGGTTTGAGAA--GGGGTGCGCGAGCCCCCC---CGA-CACACT-CCC--C--CG---CCC-TCGGGA-TTTGGCTTG-CG-T-TC-CCCT-ACCGGGG-ACCCGGTCGA-GCTCCCGAC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC-GGGAGGAGGCAT-TTGCGTC-TTT-TG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-----CCCCCA-A--CCC--CAACGCCCGGCT---ACTGGCTGGACGTTGCGGGG---GCT---GGGGCGGAAATTGGCCTCCCGT-CC---ACAC--G--ACCGTGCGCGGTTGGCCC------AA---AAAAA-ATGAGCTCCTGACGATGGACGTCGCGACAAGTGGTGGTTGAAAGACCTCTTGCATCTA-GTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTGACCCTGTG-CA-CC-T-CCTT--A--TTA-G-GGG-ATGGGGCTTCGACC Ilex_mitis C--AAAGTAGAC-CCGGCGAACTTGTT----AAA-ATATG--C-CT-GGGGGTTTGAGAA-GGGGTGCGCGAGCCCCCC---CGA-CACACT-CCC--C--CA---CCT-CGGGAT-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACTCGGCCAG-GCTCCCGAA----AACGAA--C-CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCG-ACGT-CCCGTTCGCGGTGTGC--ACG--G-GGAGGCAT-GTGCGTC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCA-A--CCC--CAATGCCTAGCT------AGCTGGATATTGTGGGA---GTT---GGGGCGGAAATTGGCCTCCCGT--C----CAC--G--ACCGTGCGCGGTTGGCCCAAA----A---AAAAA-AGGAGTTCTTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTATTGCATCAA-GTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGACCGTGACCCTGCG-CA-CC-T-TC-T--T--TAA-C-GGA-ATGGTGCTCCGACC Ilex_mucronata C--AAAGTAGAC-CCAGCGAACTTGTT----AAA-ACATG--C-TT-GGGGGTTTGAGAA-GGGGTGCGCGAG-CCCCC---CGA-CACACT--CC--C--CC---ACC-TCGGGA-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACTCGGTCAA-GCTCCCGAC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG--AGCTGGCCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCAT-TTGCATC-TTT-CG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C--CCCAA-CC-CCC--CAATTCCTATGT------ACCTGGATATTGTGGGA---GATG--GGG-CGGAAATTGGCCTCCCGT--A----CAC--G--ACCGTGAGCGGTTGGCCC-----------AAATA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCATCAT-GTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTGACCCTATATGC-AC-C-T--T--C--TTC-A-GCG-ATGGTGCTTCGACC Ilex_mutchagara C--AAAGTAGA--CCGGCGAACTTGTT----TAA-ACATG--C-GG-GGGGG{GT}TTGAAAA-AGGGTTCGCGAACCCCCC---CAATCACGCT-CCC--C--CC---ACC-TCGGGATCTGGCTCGT-TT-TCCC-CCCT-GGCGGGGAACTCGGCCAA-GCTCCCGAC--A-AACGAA----CCCCGGCGC-TGTTTGCGCCAAGGAACAATAAC-CGAAG--AGCTGGTCTCCCG-GTGC-CCCGTCCGCGGCGTGC--AC---G-GGAGGCGC-TTGCGTC-TTT-TG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCA-A--CCC--C--CACCGGCCC------AGCCGGATACTGCGGGA---GTTG--GGGCGGAGATTGGCCTCCCGTC--C--G-CGC--G--ACCGTGAGCGGTTGGCCC-----------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTCGCATCAT-GTCGTGGGGCG-CCTAGTCCGCAGCGAGCTCCGACCCTGTGCACCTG-AT-TC-G-C--T--C--TCG-G-GCG-ACGGTGCTTCGACC Ilex_opaca C--AAAGTAGA--CCGGCGAACTTGTT----AAA-ACATG--C-TG-GGGGGTTTGAGAA-GGGGTGCGTGAGCCCCCC---{GT}AA-CACACT--CC--C--CC---ACC-TCGGGATTTTGGCTTG-CG-T-CC-CCCT-AGCGGGG-ACTCGGTCAA-GCTCCCGAC--A-AACGAA----CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG--AGCTGGCCTCCCG-TTGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCGTCATGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCC-CCACCC--CAATGCCCACCT------AGCTGGATATTGCGGGA---GTCG--GGGCGGAAATTGGCCTCCCGTC--C--G-CAC--G--ATCGTGAGCGGTTGGCCC----------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCATCAT-GTCGTGAGGCA-CCAAGTCTGTGGCGAGCTCTAACCGTG-ACCCTGC-GC-AC-C-C--T--C--TTC-A-GCG-ATGGTGCTTCGACC Ilex_paraguariensis C--AACGTAGA-CCCGGCGAACTTGTT----AAA-ATACG--CTGG-GGGGGTTTGGGAA-GGGGTGCGCGAGCCCCCC---CGAACACACT-CCC--C--CG---CCC-TCGGGACTGGGCTTGTGTTCC-CCTCCCTAGGGGGGGGACTCGGTCGA-GCTCCCGAC--A-AACGAA----CCCCGGCGC-TGTCTGTGCCAAGGAACCATAAC-CGAAG--AGCTGGTCTCCCG-ATGT-CCCGTTCGCGGTGCGC--AC---G-GGAGGCAT-TTGCATCTTTT-TGA--A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCC-AA-CCC--CAATGCCCGGAT------GTTGCGGGGGAGTTGGG---GGCG--GAAATTGGCCTCCCGTCCACA{CT}--G-AT-CGT--G--AGCGGTTGGCCCAAAAAG----------TGAGTT-CCTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCATCATGTCGTGA-GGCGCCTAGTC-TGTAGCGAGCTCTAACCGTGGACCCTGCGCACCTA-AT-TC-G-T--T-CGAGAAG-A-GCG-ACGGTGCTTCGACC Ilex_pedunculosa C--AAAGTAGAC-CCGGCGAACTCGTT-A--AAATATATG--G-CT-GGGGGTCTGGGAA-GGGGTGCGCGAGCCCCCC-A-ACA-CACTCC-CCC-AG--CC---CGC-TCGGGA-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACTCGGCCAA-GCTCCCGAC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCACAAC-TGAAG--GGCTGGCCTCTCG-ATGT-CCCGTTCGCGGTGTGC-AAC---G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCAAGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCA-A--CCC--CAATGCCAAGCT------TGCTGGGTATTGCGGGA---GCT---GGGGCGGAAATTGGCCTCCCGT--C----CAC--G--ACCGTGCGCGGTTGGCCC-------A---TAAAA-ATGAGTTCCTGACGATTGACGTCACGACAAGTGGTGGTTGAAAGACCTCA{CT}GCATCAA-GTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTGACCCTTCG-CA-CC-T-TCTC--T--AAT-G-GGA-TGGTGCTTCCGACC Ilex_percoriacea C--AAAGTAGAC-CCGGCGAACTCGTT----AAA-ATATAT-G-GC-TGGGGGTCTGGGA-AGGGGTGCGCGAGCCCCC---CAA-CACACTCCCC--CAGCC---CGC-TCGGGA-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACTCGGCCAA-GC-TCCCGAC---AACGAA----CCCCGGCGC-TGTTTGCGCCAAGGAACCACAAC-TGAAG--GGCTGGCCTCTCG-ATGT-CCCGTTCGCGGTGTGCA-AC---G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-CA-ACC--CCA------AT-------TGCG--GGAGTC-GGGG---GCG---GAAATTG-GCCTCCCGTCCA-C-------GAA--C--G-TGCACGGTTGGCCC-A-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCGTCAT-GTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTGACCCTGTG-CA--C-C-T--C--C--TTC-G-CGG-ATGGTGCTCCGACC Ilex_pseudobuxus C--AAAGTAGAC-CCGGCGAACCTGTT-A--AAATATTTG--G-CCGGGGGTTTGAGAA--GGGGTGCGCGAGCCCCCC---CGA-CACACT-CCC--C--CG-C-CCC-TCGGGA-TTCGGCTTG-CG-T-TC-CCCT-GCCGGGG-ACCCGGTCGA-GCTCCCGAC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCG-ATGC-CCCGTTCGCGGTGTGC--AC-GGGAGGAGGCAT-TTGCGTC-TTT-TG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGTTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-----CCCCCA-A--CCC--CAACGCCCGGCT---A{CT}TGGCTGGACGTTGCGGGA---GCT---GGGGCGGAAATTGGCCTCCCGT-CC---ACAC--G--ACCGTGCGCGGTTGGCCC------AA---AAAAA-ACGAGCTCCTGACGATGGACGTCCCGACAAGTGGTGGTTGAAAGACCTCTTGCATCTG-GTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTGACCCTGTG-CA-CC-T-CCTT--A--TTA-G-GGG-ACGGTGCTTCGACC Ilex_rotunda C--AAAGTAGAC-CCGGCGAACTCGTT----AAA-ATATG--C-GT-GGGGGTTTGAGAA-GGGGTGCGCGAGCCCCCC---CGA-CACATT-CCC--C--CAC--CCC-CCGGGA-CTTGGCCCG-GG-T-TC-CCCT-TGCGGGG-ACTCGGCCAAGGCTCCCGAC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-CGAAG--AGCTGGCCCCCCG-{AG}TGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCGT-ACGCATC-TTT-CG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGC-----CCCCA-AC-CCCGACAATGCCCGGCTGGC---AGCCGGATATTGCGGGA---GTTG--CGGGCGGAGATTGGCCTCCCGT--C----CAC--G--ACCGTGCACGGTTGGCCC-----------AAAAA-GCGAGTTCTTGACGACGGACGTCACGACGAGTGGTGGTTGGAAGACCTCTTGCGTCGA-GTCGTGAGGCACCCGAGTCTGTAACGAGCTCTGACCGCGACCCTGTG-CG-CC-T-T--C--C--TTA-G-GGG-GCGGCGCTCCGACC Ilex_rugosa C--AAAGTAGAC-CCGGCGAACTTGTT----AAA-ATATG--C-CT-GGGGGTTTGAGAA-GGGGTGCGCGAGCCCCCC---A-A-CACACT--CC--C--CC---ACC-TCGGGA-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACTTGGTCAA-GCTACCGAC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG--AGCTGGCCTCCTG-TTGT-CCCGTCTGCGGTGTGC--AC---G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACC-AA-CCC--CAATG--C-CT-------AGCTGGATATTG{AC}GGGA---GTTG--GGGGCGGAAATTGGCCTCCCGT--C----CAC--G--AACGTGCGCGGTTGGCCC--------AA-AAAAA-ATGAGTTCTTGACGATGGACGTCACGATAAGTGGTGGTTGAAAGACCTATTGCGTCAT-GTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTGACCCTGTG-CA--C-C-T--T--C--TTC-A-TGG-ATGGTGCTTCGACC Ilex_serrata C--AAAATAGAC-C{CT}GGCGAACTTGTT----AAA-ATATG--C-TT-GGGGGTTTGAGAA-GGGGTGCGCGAGTCCCCC---CGA-CACACT-CCC--C--CA---CCC-CCGGGA-TTTGGCTTG-CG-T-CC-CCCT-AGCGGGG-ACTCGGTCAA-GCTCCCGAC----AACGAA----CCCCGGCGC-TATCTGCGCCAAGGAACCTTAAC-CGAAG--AGCTGGCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCGT-ATGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACACATCACGTCG------CCCCA-A--CCC--CAATGCCTAGTT------GGTTAGGCATTGTTGGA---GTTG--GGGGCGGAAATTGGCCTCCCGT--C----CAC--G--ATTGTGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCATCAA-GTCGTGAGGCA-CCGAGTCTGTAACGAGCTCTAACCGTGACCCTGTG-CA-CC-T-T--C--T--TTA-G-GGG-ATGGTGCTCCGACC Ilex_taubertiana C--AAAGTAGAC-CCGGCGAACTTGTT-A--AAATATTTG--G-CCGGGGGTTTGAGAAG-GGGGTGCGCGAGCCCCCC---C{AG}A-CACA{CT}T-CCC--C--CG---CCC-TGGGAT-TTGGGTTTG-CG-T-TC-CCCT-ACCGGGG-ACCCGGT{CG}GA-GCTCCCG{AC}C----ACCAA{AC}----CCCCGGCGC-TGTTTGCGCCAAGGAACCTTAAC-TGAA?-A?CTGGCCCCCCCG-ATGT-CCCGTTC?CGGTGTGC--AC--GG-GGAGGCAT-TTGCGTC-TTT-TG---A--ATT---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGT{CT}TGCCTGGGCGTCACGCATCACGT{CT}G------CCCCA-A--CCC--CAATGCCCGGCT---ACTA{AG}CTGGACGTT{CT}CGGGA---{AG}CT---GGGGCGGAAATTGGCCTCCCGT-CC---ACAC--G--ACCGTGGGCGGTTGGCCC---AAAAA---AAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGGCCTCTTGCGTCTA-GTCGTGAGGCA-CCGAGTCTGTAGCGAGCTTTGATCGTGACCCTGTG-CG-CC-T-CCTT--A--TTA-G-GGG-ACGGTGCTTCGACC Ilex_theezans C--AAAGTAGAC-CCGGCGAACTTGTT-A--AAATATTTG--G-CCGGGGGGTTTGAGAA-GGGGTGCGCGAGCCCCCC---CGA-CACA{CT}T-CCC--C--CG---CCC-CCGGGA-TTTGG{CGT}TTG-{CG}G-T-TC-CCCT-AGCGGGG-ACCCGGCCGA-GCTCCCGAC----AACGAA----CCCCGG{CG}G{CG}-TGTCTGCGCCAAGGAACCTTAAC-TGAA{AG}-AAGCT{AG}GCCCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCAT-TTGCGTC-TTT-TG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCA-A--CCC--CAATGCCTGGCT---ACCAGC{CT}GGACGTTGCGGGA---GCT---GGGGCGGAAATTGGCCTCCCGT-CC---ACAC--G--{AG}CCGTG{CGT}GCGGTTGGCCC------AA---AAAAA-ATGAGCTCTCACCGATGGG{CG}GTCACG{AG}CAAGTGGTGGTTGAAAGGCCTCTAGCATCTA-GTCGTGAGGC{AT}-CCGAGTTTACAGCGAGCTCTGATCGTGACCCTGTG-CA-CC-T-TCTT--A--TTAGG-GGG-A{CT}GGTGCTTTGACC Ilex_theezans_Gbk C--AAAGTAGAC-CCGGCGAACTTGTT-A--AAATATTTG--G-CCGGGGGTTTGAGAA--GGGGTGCGCGAGCCCCCC---CGA-CACACT-CCC--C--CG---CCC-CCGGGA-TTCGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACCCGGTCGA-GCTCCCGTC----AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAA?-TGAAGAAGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGGGTGC--AC-GGG-GGAGGCAT-TTGCGTC-TTT-CG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCA-A--CCC--CAATGCCCGGCT---ACCAGCTGGACGTTGCGGGA---GCT---GGGGCGGAAATTGGCCTCCCGT-CC---ACAC--G--ACCGTGCGCGGTTGGCCC-----AAA---AAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGAAGACCTCTTGCATCTA-GTCGTGAGGCA-CCGAATCTGTAGCGAGCTCTGATCGTGACCCTGTG-CA-CCTT-CTTT--A--TTA-G-GGG-ACGGTGCTTTGACC Ilex_vomitoria C--AAAGTAGAC-CGGCGAACTTGTTA----AAA-TATGC--T-GG-GGGTTTGAGAAAAGGGGGTGCGCGAGCCCCCC---CCA-ACACAC-TCC--C--CC---ACC-TCGGGA-TTTGGCTTG-TG-T-TC-CCCT-AGCGGGG-ACTCGGTCAA-GCTCCCGACA---AACGAA----CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG--AGCTGGCCTCCCG-ATGT-CCCGTTCGCGGCGCGC--AC---G-GGGGGTAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA-CCC--CAATG--C-CT-------AGCTGGATATCGTGGGA---GTT---GGGGCGGAAATTGGCCTCCCGT--T----CGC--G--ACCGTGAGCGGTTGGCCC-----------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCATCAT-GTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTGACCCTGTG-CA--C-C-T--T--C--TTC-A-GAG-ACGGTGCTTCGACC Ilex_warburgii C--AAAGTAGAC-CCGGCGAACTTGTT----AAA-ATATG--C-CT-GGGGGTTTGAGAA-GGGGTGCGCGAGCCCCCCA--ACA-CACTCC-CCCA-G--CG---CCC-TCGGGA-TTTGGCTTG-CG-T-TC-CCCT-AGCGGGG-ACTCGGTCAA-GCTCCCGAC----AACGAA----CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG--GGCTGGCCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AG---G-GGAGGCAT-TTGCATC-TTT-TG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACC-AA-CCC--CAATG--C-CC-------GGCTGGATATTACGGGA---GTTG--GGGGCGGAAATTGGCCTCCCGTC-CA---TAT--G--AACGCGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTGCGTCAT-GTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGCGACCCTGTG-CA-CC-C-T--TC-C--TTC-A-CGG-ATGGTGCTCCGACC Ilex_yunnanensis C--AAAGTAGAC-CCAGCGAACTTGTT----AAA-ATATG--C-CC-GGGGGTTTGAGAA-GGGGTGCGCGAG-CCCCC---CGA-CACAAT-CCC--C--CA---CCC-CCGGGA-TCTGGCTTG-CG-T-TC-CCAT-AGCGGGG-ACTGGGTCAG-GCTCCCGGC----AACGAA----CCCCGGCGC-TATCTGCGCCAAGGAATCTTAAC-TGAAG--AGCTGGCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCAT-ATGCATC-TTT-TG--AA--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCA-A--CCC--CAATGCCTAGCT------AGCTGGATATTGCGGGA---GTT---GGGGCGGAAATTGGCCTCCCGT--C----CAC--G--ACCGTGCGCGGTTGGCCC--A----A---AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTCTTGCATCAA-GTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGACCGTGACCCTGCG-CA-CC-T-T--C--T--CTA-T-GGG-ATGGTGCTTCGACC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_1011) = N: 1-715; CODONPOSSET CodonPositions (CHARACTERS = ITS_1011) = N: 1-715; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2477] TITLE ITS_841; LINK TAXA = Taxa1; DIMENSIONS NCHAR=765; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Helwingia_chinensis C--AAAATAGA--CCCGCGAACA-TGTT-----CATCCA---T--C----GGGGG-T-TGGCGA--GGGGTGCGCGAG-------CCCCCAATCCACCCCCT-CTCCG-G----------C-GAT-GCTGC-TTTGAA-TTGT-CG-C-CA-ATGC-GGTGGCATCCATTGTT-GT-GTCGACTGAA-C-AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG--AGCCAG-TCTTCGA-AAGC-CCCGTACGCGGTGCGC-TT--G-GGAGG{CT}GTT-GGCGTCTTTAAAAT--CATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG---C-----CC-C-CA-A---CC--CA--CTCCAC---A-C---AC---G---AAT-TGCGGTGTTGCT---TTG----GGGG-CGGAGATTGGCCTCCCATAC--AA--AA-T---A---AGCTTGCGTGGTTGG-CCT------------AAAA-GCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTTAAATATGCCTC-TTGCGTATTATCGCGA-G-A--C-AA-CC-CA-T---CTCCGG-CGTGTGCTC--TT-T--G-A--G--A----C--C--C-C--------AATG-ACGATGCTT-CGATT Helwingia_japonica C--AAAATAGA--CCCGCGAACA-TGTT-----CATCCA---T--C-----GGGG-T-TGGCGA--GGGGTGCGCGAG-------CCCCCAATCCACCCCCT-CTCCG-G----------C-GAT-GCTGC-TTTGAA-TTGT-CG-C-CA-ATGC-GGTGGCATCCATTGTT-GT-GTCGACTGAA-C-AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG--AGCCAG-TCTTCGA-AAGC-CCCGTACGCGGTGCGC-TT--G-GGAGGCGTT-GGCGTCTTTAAAAT--CATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG---C-----CC-C-CA-A---CC--CA--CTCCAC---A-C---AC---G---GAT-TGCGGTGTTGCT---TTG----GGGG-CGGAGATTGGCCTCCCATAC--AA--AA-T---A---AGCTTGCGTGGTTGG-CCT------------AAAA-GCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTTAAATATGCCTC-TTGCGTATTATCGCGA-G-A--C-AA-CC-CA-T---CTCCGG-CGTGTGCTC--TT-T--G-A--G--A----C--C--C-C--------AATG-ACGATGCTT-CGATT Ilex_amelanchier C--AAAGTAGAC-CCGGTGAACT-TGTT---AAAACATG---C--C--C-GGGGGTT-TGAGAA--GGGGTGCGCGAG------CCCCCCCGA-CACACT---CCCCC-A----------C-CTC-G-GGA-TTTGGC-TTG--TG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCAAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATT-TGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTTG---------CC-C-CA-A--CCC--C---CAATT-----CCTATAT---A---GTTGGATATTGTGTAA---GTT----GGGGCCGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGGGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTG-ACCCTATA-T--GCG--C--C----TT-C--T-T------C-AGTG-ATGGTGCTT-CGACC Ilex_anomala C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG---C--A--T--GGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCCCCAA-CACACT---CCCCC-A----------C-CTC-G-GGA-TTTGGC-TTG--TG-T-TC-ACCT-AGTGGAG-ACTCGGTCAAA-GGT-CCCGAC---AACGAA----CCCCGGCGCTATA-TGTGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATT-TGCATC-TTTTG----AATC-TATAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CA-A---CC--C---CAA-------------T-------GCTGGATATTACGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----A---CA-C---G---GCTGTGCGCGGTTGG-CCC-----------AAAAA-TTGAGCTCTGGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTTGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGTG-ACCC--TG-T--GCA--C--C----TT-C--T-T------T-AGGGAATGGTGCTT-CGACT Ilex_argentina C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATT---TGGG--C-GGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCCCCGA-CACACT---CTCCC-A---------CC-CAC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-AGTGGGG-ACCCGGTC-GA-CCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTAG-CCCCCTG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATT-TGCGTC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCA---------CC-C-CA-A---CC--C---CAATG-----CCTGGCT-ACC--AGCTGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGTGCGGTTGG-CCC--------A--AAAAA-ATGAGCTCTTGACGATGGACGTCACCACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTATAGCGAGCTCTGATCGTG-ACCCTGTG-C--AC---C--T----TC-T--TATT-----A-GGGG-ATGGTGCTT-TGACC Ilex_argentina_Gbk C--AAAGTAGA--CCGGCGAACT-TGTT---AAAACATG---C--T--G-GGGGGTT-TGAGAA--GGGGTGCGTGAG----C--CCCCCCAA-CACACT--CCCCCC-A----------C-CTC-G-GGATTTCGGC-TTG--CG-T-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGACAA-AACGAA-C--CCCCGGCGCTATC-TGCGCCAAGGAACCACAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCC-----CC-CTCC-A---CC--C---CAATG-CCCA-C---CT---A---GCTGGATATTGTGGGAGTCGTC----GGCG-CGGAAATTGGTCTCCCGT-C--CG--CA-C---G---ATCGGGAGCGGTTGG-CCC----------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAACCGTG-ACCC--TG-C--GCA--C--C----TT-C--T-T------C-AGCG-ATGGTGCTT-CGACC Ilex_beecheyi C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATATATG-G--C--T-GGGGGTC-TGGGAA--GGGGTGCGCGAG-------CCCCCCAA-CACACT---CCCCC-AGCCC------G-CTC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTTGGCC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCACAAC-TGAA---GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCAAC--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C------CC--C---CAA-------------C--------CC-CA-ATTGCGGGA---GTCG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGGCCC--A---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTG-ACCC--TG-T--GCA--C--C----TC-C--T-T------C-GCGG-ATGGTGCTC-CGACC Ilex_brasiliensis C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATT---TGGC--CGGGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCCCCGA-CACACT---CCCCC-G---------CC-CCC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACCCGGCC-TA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAGA-AGCTAG-CCCCCCC-GTGT-CCCGTTCGCGGCGTGC-AC--G-GGAGGCATT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CA-A---CC--C---CAATG-----CCTGGCT-ACC--AGCCGGACGTTGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGTGCGGTTGG-CCC-------AA--AAAAA-ATGAGCTCTCACCGATGGGCGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTACAGCGAGCTCTGATCGTG-ACCCTGCG-C--AC---C--T----TC-T--TATT-----AGGGGG-ATGGTGCTT-TGACC Ilex_brevicuspis C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATT---TGGC--C-GGGGGTT-TGAGAA-GGGGGTGCGCGAG-----C-CCCCCCGA-CACACT---CCCCC-G--------CCC-CTC-G-GGA-TTTGGC-TTA--CG-T-TC-CCCT-ACTGGGG-ACCCGGTC-GA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATT-TGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CA-A---CC--C---CAATG-----CCTGGCT-ACT--AGCTGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC------AAA--AAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGGCCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-ACCCTGTG-C--AC---C--T----CC-T--TATT-----A-GGGT-ATGGTGCTT-CGACC Ilex_buergeri CA-AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG---C--C--T-GGGGGTT-TGAAAA--GGGGTGCGCGAG-------CCCCCCAA-CACACT---CCCCC-AGCCC------C-CTC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CA-A---CC--C---CAATG------C---CC---A---GCTGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-T---G---AACGCGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCG-ACCC--TG-T--GCA-CC--C----TTCC--T-T------C-ACGG-ATGGTGCTC-CGACC Ilex_canariensis C--AAAGTAGAC-CCGGCGAACC-CGTT---AAAACATG---C--C--T-GGGGGTT-TGAGAA--GGGGCGCGCAAG-------CCCCCCGA-CGCACT---CCCCC-A----CC---CC-CCG-G-GGG-TTTGGC-TTG--GG-T-TC-CCCT-AGCGGGG-ACCCGGTC-AG-GCT-CCCGGC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-AGAAG--AGCTGG-CCCCCCG-GTGTCCCCGTTCGCGGTGTGC-AC-TG-GGAGGCATT-TGCGTC-TTTCG----AATC---TGAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGCTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCAAGGGCACGTCTGCCTGGGCGTCACCCATCACGTCG------C--CC-C-CA-A---CC--C---CAATG-----CCTGGCT---A---GCCGGGTATCGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C-AGG---ACCGTGCGCGGTTGG-CCC--AA---AA--AACAA-ATGAGTTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGGGGCA-CCGAGTCTATGGCGAGCTCCGACCGGG-ACCCTGCG-C--AC---A--C----TC-C--T-CC-----G-GGGG-ATGGTGCTC-CGACC Ilex_cassine C--AAAGTAGA--CCGGCGAACT-TGTT---AAAACATG---C--T--G-GGGGGTT-TGAGAA--GGGGTGCGTGAG----C--CCCCCCAA-CACACT--CCCCCC-A----------C-CTC-G-GGATTTCGGC-TTG--CG-T-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGACAA-AACGAA-C--CCCCGGCGCTATC-TGCGCCAAGGAACCACAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCC-----CC-CTCC-A---CC--C---CAATG-CCCA-C---CT---A---GCTGGATATTGTGGGAGTCGTC----GGGG-CGGAAATTGGCCTCCCGT-C--CG--CA-C---G---ATCGTGAGCGGTTGG-CCC----------AAAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAACCGTG-ACCC--TG-C--GCA--C--C----CT-C--T-T------C-AGCG-ATGGTGCTT-CGACC Ilex_collina C--AAAGTAGA--CCCGCGAACT-TGTT---AAAATATG---C--T--G-GGGGTTTGAGGTTAG-GGGGTGCGCGAG----C--CCCCCCAA-CACACT---CCCCC-A----------C-CTC-G-GGA-TTTGGCTTTG--TG-T-TC-CCCT-AGTGGGG-ACTCGGTC-AG-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAATCATAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC-AC--G-GGGGGCATT-TGCATC-TTTTG----AATC---TAAAA{CT}GACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CA-A---CC--C---CAATG------C---CT---A---GTTGGATATTGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-T---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAATCGTG-ACCC--TG-{CT}--GCA--C--C----TT-C--T-T------C-AACG-ACGGTGCTT-CGACC Ilex_cornuta C--AAAGTAGAC-CCGGCGAACT-TGTTA--AAAATATG---C--C--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCCCCAA-CACACT---CCCCC-AGCCC------C-CTC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACGCGGCC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-GTGT-CCCGTTCGCGGCGTGC-AC--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG---------CCAC-CA-A---CC--C---CAATG------C---CC---A---GCCGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCC?GT----T---?A-C---G---AACGTGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCG-ACCC--TG-T--GCA-CC--C----TT-C--T-T------C-ACGG-ATGGTGCTC-CGACC Ilex_crenata C--AAAGTA{AC}A--CCGGCGAACT-TGTT---AAAACATG---C--C--G-GGGGGTT-TGAGAA--GGGGTGCGCGAG----C--CCCCCCAAT-AAGGTT--CCCCC-A----------C-CTC-C-GGA-TTTGGC-TTGT-TT-T-CC-CCCT-GGCGGGGAACTCGGCC-CA-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCATAAC-CGAAG--AGCTGG-TCTCCCG-GTGC-CCCGTCCGCGGTGTGC-AC--G-GGAGGCGTT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C-----CC-C-AACC---CC--C---CAACG----G-C---CT---A---GCCGGATATTGCGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGT-C--CG--CG-C---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TCGCATCACGTCGTGGGGCG-CCTAGTCTGTAGCGAGCTCCGACCCTGTGCAC--CT-G--ATT--C--G----CT-C--T-A------G-GGCG-A-GGTGCTT-CGACC Ilex_decidua C--AAAGTAGA--CCGGCGAACT-TGTT---AAAATATG---C--T--G-GGGGTTTGAGAAAAG-GGGGTGCGCGAG----C--CCCCCCAA-CACACT---CCCCC-A----------C-CTC-G-GGA-TTTGGCTTTG--TG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC-AC--G-GGGGGTATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CA-A---CC--C---CAATG------C---CT---A---GCTGGATATCGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----T---CG-C---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTG-ACCC--TG-T--GCA--C--C----TT-C--T-T------C-AGAG-ACGGTGCTT-CGACC Ilex_dimorphophylla C--AAAGTAGAC-CCGGCGAACT-TGTTA--AAAATATG---C--C--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCCCCAA-CGCACT---CCCCC-AGCCC------C-CTC-G-GGG-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACGCGGCC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-GTGT-CCCGTTCGCGGCGTGC-AC--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG---------CCAC-CA-A---CC--C---CAATG------C---CC---A---GCCGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----T---CA-C---G---AACGTGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCG-ACCC--TG-T--GCA-CC--C----TT-C--T-T------G-ACGG-ATGGTGCTC-CGACC Ilex_dumosa_dumosa C--AAAGTAGA--CCGGCGAACTCTGTT---AAAACATG---C--T-GG-GGGGGTT-TGAGAA--GGGGTGCGCGAG----C--CCCCCCAATCACGCTC--CCCCC-A----------C-CTC-G-GGA-TCTGG{CT}-TTGT-TT-T-CC-CCCT-GGCGGGGAACTCGGCG-GA-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTGTA-TGCGCCAAGGACCCATAAC-CGAA{AG}--AGCTGG-TCTCCCG-TTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATC-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C-----CC-C-AACC---CCAAA---AAACG----T-C---CT---A---GGTGGACATTGTGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGT-C--CA--CA-C---GT--CCCGTGAGCGGTTGG-CCC---------A-AAAAA-ACGAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTCTTTGCATCATGTCGTGAGGCG-CCTAGT?TGCAACGA?CTCCGACCCTGTGCAC--CTAGTTGTC--C--G----CT-G--T-A------G-GGCG-ACGGTGCTT-CGACC Ilex_dumosa_guaranina C--AAAGTAGA--CCGGCGAACTCTGTT---AAAACATG---C--T-GG-GGGGGTT-TGAGAA--GGGGTGCGCGAG----C--CCCCCCAATCACGCTC--CCCCC-A----------C-CTC-G-GGA-TCTGGC-TGGT-TT-T-CC-CCCT-GGCGGGGAACTCGGCC-GA-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTGTA-TGCGCCAAGGACCCATAAC-CGAAG--AGCTGG-TCTCCCG-TTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATC-TGCGTC-TTTTG----AATC---CAAAAC{CG}ACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTT?AACGCAAGTTGCGCCCAAAGCCAT?AGGCCAAGGGCACGTCT?CCTGGGCGTCACGCATCACGTCG---C-----CC-C-AACC---CCAAA---AAACG----T-C---CT---A---GGTGGACATTGTGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGT-C--CA--CA-C---GT--CCCGTGAGCGGTTGG-CCC---------A-AAAAA-A?GAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTCTTCGCATCATGTCGTGAGGCG-CCTAGTCTGCAACGATCTCCGACCCTGTGCAC--CTAGTTGTC--C--G----CT-G--T-A------G-GGCG-ACGGTGCTT-CGACC Ilex_glabra C-AAAAGTAGAC-CCGGCGAACC-TGTT-A-AAAATATG---C--A--T-GGGGGTC-TGAGAA--AGGGTGCGCGAG-------CCCCCCGA-CACATT---CCCCC-A----------C-CCC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC--AAACGAA---CCCCCGGCGCTATC-TGCGCCAAGGAACCTTAAC-{CT}GAAG--AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATT-TGCATC-TTTTG--A-AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----C---CC-C-CA-A--CCC--C---CAATG-----CCTGGCT---A---GCTGGGTATTGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCAGACCGGG-ACCCTGTG-T--GCA--CA-T----TC-T--T-T------A-GGGG-ATGGTGCTT-CGACC Ilex_integerrima C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATT---TGGC--C-GGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCCCCGA-CACACT---CCCCC-G---------CC-CCC-G-GGA-TTCGGC-TTG--CG-T-TA-CCCT-A{AG}CGGGG-ACCCGGTC-GA-GCT-CCCGTC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AAGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC-ACGGG-GGAGGCATT-TGCGTC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGT??????????GTC{CG}--------CCC-C-C{AGT}-A---CC--C---CAAAG-----CCCGGTT-ACC--AGCTGGACCTTGCGGGA---?CT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC------?AA--AAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGA-AGACCTC-TTGCAT?TAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGCG-ACCCTGTG-C--AC---C-TT----CT-T--TATT-----A-GGGG-ACGGTGCTT-TGACC Ilex_integra C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATATG-C--C--T-GGGGGTT-TGAGAA--GGGGTGTGCGAG-------CCCCCCAA-CAAAAT---TCCCC-AGCCC------C-CTTGG-GGA-TTTGGC-TTG--CG-T-TC-CCCT-AGGGGGG-ATTGGGCC-AA-GTT-CCGGAA---AACGAA----CCCGGGCGCTTTT-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATTT-CCCGTCCGCGGTGTGC-AC--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C------CC--C---CAA-------------C--------CC-CA-ATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCGCGGTTGGCCCA-A---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCG-ACCC--TG-T--GCA--C--C----TT-C--T-T------C-ACGG-ATGGTGCTT-CGACC Ilex_kiusiana C--AAAGTAGAC-CC{CT}GCGAACT-{CT}GTT---TAAATATGT--C--C--T-GGGGGTC-AGACAA--GGGGTGCGCGAGC------CCCCCCAA-CACACT---CCCCC-AGGCC------C-CTC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C------CC--C---CAA-------------C--------CC-CA-ATTGCGGGA---TT{CG}A---GGGG-CGGAAATTGGCCTCCCGT----A---CATCT--G---AACGTGCGCGGTTGGCCCC-G---------AAAAA-ATG{AG}GTTCTTGAATAAGGACGTCACGACAAGTGTTGGTTGAA-ATACGCC-TTGAGTCATGTCTTGAGGCA-CCTAGTCTGTAACGAGCTCTGACCGCA-ACTC--TG-T--GCAG-C--CA---TC-C--T-T------C-ATGG-ATCGTGCTT-CAACC Ilex_latifolia C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG---C--C--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCCCCAA-CACACT---CCCCC-AGCCC------C-CTC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CA-A---CC--C---CAATG------C---CC---A---GCTGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-T---G---AACGCGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGC{AG}TCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC{CT}GCG-ACCC--TG-T--GCA-CC--C----TTCC--T-T------C-ACGG-ATGGTGCTT-CGACC Ilex_liukiuensis C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG---C--C--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCCCCAA-CACACT---CCCCC-AGCGC------C-CTC-G-GGT-TTTGGC-TTG--CG-T-TC-CCCT-AGTGGGG-ACTCGGTC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTATC-TGCG----GGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATGT-CCGGTTCGCGGTGTGC-AG--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTTAATTGCAGAATCCCGTGAACCATCGAGTTTTTGATCGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CA-A---CC--C---CAATG------C---GC---G---GCTGGATATTACGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT--------TA-T---G---AACGCGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCCTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGCG-ACCC--TG-T--GCA-AC--C----TTCC--T-T------C-ACGT-ATGGTGCTC-CGACC Ilex_macropoda C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG---T--T--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG--C----CCCCCCGA-CACACT----CCCC-C---------AC-CTC-G-GGG-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AG-GCT-CCCGAC---AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATA-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CA-A---CC--C---CAATG-----CCTACCT---G---GCTGGATATTGCAGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACTGTGTGTGGTTGG-CCC-------AA--AAAAA-AAGAATTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-TCGAGTCTTTGGCGAGCTCTGACCGTG-ACCCTGTG-C--A----C--T----TC-T--T-T--------CGGG-ATGGTGCTT-CGACC Ilex_maximowicziana C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATATG---C--C--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCCCCAA-CACACT---CCCCC-AGCCC------C-CTC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCGG-GTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG---------CCAC-CA-A---CC--C---CGATG------C---CC---A---TCTGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----T---CA-C---G---AACGTGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTACCGAGCTCTGGCCGCG-ACCC--TG-C--GCA-CC--C----TT-C--T-T------C-ACGG-ATGGTGCTC-CGACC Ilex_mertensii C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATATATG-G--C--T-GGGGGTC-TGGGAA--GGGGTGCGCGAG-------CCCCCCAA-CACACT---CCCCC-AGCCC------G-CTC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGCC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCACAAC-TGAAG--GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCAAC--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACAATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C------CC--C---CAA-------------C--------CC-CA-ATTGCGGGA---GTCG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGGCCC--A---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTG-ACCC--TG-T--GCA--C--C----TC-C--T-T------C-GCGG-ATGGTGCTC-CGACC Ilex_micrococca C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG--CT--T--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCCCCGA-CACACT---CCCCC-C---------AC-CTC-G-GGA-TTTGGC-TTG--{CT}G-T-TC-CCCT-AGCGGGG-ACTCGGTC-AG-GCT-CCCGAC---AACGAAC---CCCCGGCGCTATT-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATA-CGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CC-A---CC--C---CAATG-----CCTAGCT---G---GCTGGATATTGCGGGA---GTT--GGGGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC-------AA--AAAAATAAGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCGAGTCTCTAGCGAGCTCTGATCGTG-ACCCTGCG-C--GC---C--T----CC-T--T-C--------CGGG-ATGGCGCTT-TGACC Ilex_microdonta C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATT---TGGC--C-GGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCCCCGA-CACACT---CCCCC-G-------C-CC-CTC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-ACCGGGG-ACCCGGTC-GA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTCAAC-TGAAG--AGCTGGCCCCCCCG-ATGC-CCCGTTCGCGGTGTGC-ACGGGAGGAGGCATT-TGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCATGTCG-------C-CC-C-CA-A---CC--C---CAACG-----CCTGGCT-ACT--AGCCGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G-ACACCGTGCGCGGTTGG-CCC-------AA--AAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-ACCCTGTG-C--AC---C--T----CC-T--TATT-----A-GGGG-ATGGTGCTT-CGACC Ilex_microdonta_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT--AAAAATATT---TGGC--C-GGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCCCCGA-CACACT---CCCCC-G---------CC-CTC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-ACCGGGG-ACCCGGTC-GA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC-ACGGGAGGAGGCATT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-------C-CC-C-CA-A---CC--C---CAACG-----CCCGGCT-ACT--GGCTGGACGTTGCGGGG---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC-------AA--AAAAA-ATGAGCTCCTGACGATGGACGTCGCGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-ACCCTGTG-C--AC---C--T----CC-T--TATT-----A-GGGG-ATGGGGCTT-CGACC Ilex_mitis C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG---C--C--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCCCCGA-CACACT---CCCCC-A---------CC-TCG-G-GAT-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGCC-AG-GCT-CCCGAA---AACGAA--C-CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGG-CCCCCCG-ACGT-CCCGTTCGCGGTGTGC-AC-GG-GGAGGCATG-TGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CA-A---CC--C---CAATG-----CCTAGCT---A---GCTGGATATTGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC--AA---AA--AAAAA-AGGAGTTCTTGACGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTA-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGACCGTG-ACCCTGCG-C--AC---C--T----TC-T--T-TA-----A-CGGA-ATGGTGCTC-CGACC Ilex_mucronata C--AAAGTAGAC-CCAGCGAACT-TGTT---AAAACATG---C--T--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCCCCGA-CACACT---CCCCC-A----------C-CTC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATT-TGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CA-A-CCCC--C---CAATT-----CCTATGT---A---CCTGGATATTGTGGGA---GAT----GGGG-CGGAAATTGGCCTCCCGT----A---CA-C---G---ACCGTGAGCGGTTGG-CCC-----------AAATA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTG-ACCCTATA-T--GCA--C--C----TT-C--T-T------C-AGCG-ATGGTGCTT-CGACC Ilex_mutchagara C--AAAGTAGA--CCGGCGAACT-TGTT---TAAACATG---C--G--G-GGGGG{GT}T-TGAAAA--AGGGTTCGCGAA----C--CCCCCCAATCACGCTC--CCCCC-A----------C-CTC-G-GGA-TCTGGC-TCGT-TT-TCCC-CCCT-GGCGGGGAACTCGGCC-AA-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACAATAAC-CGAAG--AGCTGG-TCTCCCG-GTGC-CCCGTCCGCGGCGTGC-AC--G-GGAGGCGCT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C-----CC-C-AA-C---CC--C---CACCG----G-C---CC---A---GCCGGATACTGCGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGT-C--CG--CG-C---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TCGCATCATGTCGTGGGGCG-CCTAGTCCGCAGCGAGCTCCGACCCTGTGCAC--CT-G--ATT--C--G----CT-C--T-C------G-GGCG-ACGGTGCTT-CGACC Ilex_opaca C--AAAGTAGA--CCGGCGAACT-TGTT---AAAACATG---C--T--G-GGGGGTT-TGAGAA--GGGGTGCGTGAG----C--CCCCC{GT}AA-CACACT---CCCCC-A----------C-CTC-G-GGATTTTGGC-TTG--CG-T-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCG-TTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCGTCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--CC-----CC-C-CC-A---CC--C---CAATG-CCCA-C---CT---A---GCTGGATATTGCGGGA---GTC----GGGG-CGGAAATTGGCCTCCCGT-C--CG--CA-C---G---ATCGTGAGCGGTTGG-CCC----------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTGGCGAGCTCTAACCGTG-ACCC--TG-C--GCA--C--C----CT-C--T-T------C-AGCG-ATGGTGCTT-CGACC Ilex_paraguariensis C--AACGTAGA-CCCGGCGAACT-TGTT---AAAATACG---C--TG-G-GGGGGTT-TGGGAA--GGGGTGCGCGAG----C--CCCCCCGAACACACTC--CCCCG-C----------C-CTC-G-GGA-CTGGGC-TTGTGTTCC-CCTCCCTAGGGGGGGGACTCGGTC-GA-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTGTC-TGTGCCAAGGAACCATAAC-CGAAG--AGCTGG-TCTCCCG-ATGT-CCCGTTCGCGGTGCGC-AC--G-GGAGGCATT-TGCATCTTTTTGA---AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C-----CC-C-CA-A---CC--C---CAAT-----G-C---CC---G---GAT-GTTGCGGGGGAG---TTG----GGGG-CGGAAATTGGCCTCCCGT-C--CA--CA-{CT}---G---ATCGTGAGCGGTTGG-CCC-----------AAAAA-GTGAGTTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCG-CCTAGTCTGTAGCGAGCTCTAACCGTGGACCC--TG-C--GCA--C--C-TAATT-CGTT-C-GAGAAG-AGCG-ACGGTGCTT-CGACC Ilex_pedunculosa C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATATA---TGGC--T-GGGGGTC-TGGGAA--GGGGTGCGCGAG-------CCCCCCAA-CACACT---CCCCCAG-----C---CCGCTC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGCC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCACAAC-TGAAG--GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGC-AA-CG-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCAAGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CA-A---CC--C---CAATG-----CCAAGCT---T---GCTGGGTATTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC--------A--TAAAA-ATGAGTTCCTGACGATTGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-A{CT}GCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-ACCCTTCG-C--AC---C--T----TC-T--C-TA-----A-TGGG-ATGGTGCTTCCGACC Ilex_percoriacea C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATATATG-G--C--T-GGGGGTC-TGGGAA--GGGGTGCGCGAG-------CCCCCCAA-CACACT---CCCCC-AGCCC------G-CTC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGCC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCACAAC-TGAAG--GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCAAC--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C------CC--C---CAA-------------C--------CC-CA-ATTGCGGGA---GTCG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGGCCC--A---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTG-ACCC--TG-T--GCA--C--C----TC-C--T-T------C-GCGG-ATGGTGCTC-CGACC Ilex_pseudobuxus C--AAAGTAGAC-CCGGCGAACC-TGTT---AAAATATT---TGGC--C-GGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCCCCGA-CACACT---CCCCC-G-------C-CC-CTC-G-GGA-TTCGGC-TTG--CG-T-TC-CCCT-GCCGGGG-ACCCGGTC-GA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCCG-ATGC-CCCGTTCGCGGTGTGC-ACGGGAGGAGGCATT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGTTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-------C-CC-C-CA-A---CC--C---CAACG-----CCCGGCT-A{CT}T--GGCTGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC-------AA--AAAAA-ACGAGCTCCTGACGATGGACGTCCCGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTGGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-ACCCTGTG-C--AC---C--T----CC-T--TATT-----A-GGGG-ACGGTGCTT-CGACC Ilex_rotunda C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATATG---C--G--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C-----CCCCCCGA-CACATT---CCCCC-A------C--CC-CCC-G-GGA-CTTGGC-CCG--GG-T-TC-CCCT-TGCGGGG-ACTCGGCC-AAGGCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-CGAAG--AGCTGG-CCCCCCG-{AG}TGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCGTA-CGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----C----CC-C-CA-AC--CC--C-GACAATG-----CCCGGCTG--GCA-GCCGGATATTGCGGGA---GTT-G--CGGG-CGGAGATTGGCCTCCCGT----C---CA-C---G---ACCGTGCACGGTTGG-CCC-----------AAAAA-GCGAGTTCTTGACGACGGACGTCACGACGAGTGGTGGTTGGA-AGACCTC-TTGCGTCGAGTCGTGAGGCACCCGAGTCTGTAACGAGCTCTGACCGCG-ACCCTGTG-C--GC---C--T----TC-C--T-T------A-GGGG-GCGGCGCTC-CGACC Ilex_rugosa C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG---C--C--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCCCCAA-CACACT---CCCCC-A----------C-CTC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTTGGTC-AA-GCT-ACCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCTG-TTGT-CCCGTCTGCGGTGTGC-AC--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CA-A---CC--C---CAATG------C---CT---A---GCTGGATATTG{AC}GGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCGCGGTTGG-CCCAA---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGATAAGTGGTGGTTGAA-AGACCTA-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTG-ACCC--TG-T--GCA--C--C----TT-C--T-T------C-ATGG-ATGGTGCTT-CGACC Ilex_serrata C--AAAATAGAC-C{CT}GGCGAACT-TGTT---AAAATATG---C--T--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG-T-----CCCCCCGA-CACACT---CCCCC-A---------CC-CCC-G-GGA-TTTGGC-TTG--CG-T-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCTTAAC-CGAAG--AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCGTA-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACACATCACGTCG---------CC-C-CA-A---CC--C---CAATG-----CCTAGTT---G---GTTAGGCATTGTTGGA---GTT-G--GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ATTGTGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAACGAGCTCTAACCGTG-ACCCTGTG-C--AC---C--T----TC-T--T-T------A-GGGG-ATGGTGCTC-CGACC Ilex_taubertiana C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATT---TGGC--C-GGGGGTT-TGAGAA-GGGGGTGCGCGAG-----C-CCCCCC{AG}A-CACA{CT}T---CCCCC-G---------CC-CTG-G-GAT-TTGGGT-TTG--CG-T-TC-CCCT-ACCGGGG-ACCCGGT{CG}-GA-GCT-CCCG{AC}C---ACCAA{AC}----CCCCGGCGCTGTT-TGCGCCAAGGAACCTTAAC-TGAA?--A?CTGGCCCCCCCG-ATGT-CCCGTTC?CGGTGTGC-AC-GG-GGAGGCATT-TGCGTC-TTTTG----AATT---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGT{CT}TGCCTGGGCGTCACGCATCACGT{CT}G---------CC-C-CA-A---CC--C---CAATG-----CCCGGCT-ACT--A{AG}CTGGACGTT{CT}CGGGA---{AG}CT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGGGCGGTTGG-CCC----AAAAA--AAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGGCCTC-TTGCGTCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTTTGATCGTG-ACCCTGTG-C--GC---C--T----CC-T--TATT-----A-GGGG-ACGGTGCTT-CGACC Ilex_theezans C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATT---TGGC--CGGGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCCCCGA-CACA{CT}T---CCCCC-G---------CC-CCC-G-GGA-TTTGG{CGT}-TTG--{CG}G-T-TC-CCCT-AGCGGGG-ACCCGGCC-GA-GCT-CCCGAC---AACGAA----CCCCGG{CG}G{CG}TGTC-TGCGCCAAGGAACCTTAAC-TGAA{AG}A-AGCT{AG}G-CCCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CA-A---CC--C---CAATG-----CCTGGCT-ACC--AGC{CT}GGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---{AG}CCGTG{CGT}GCGGTTGG-CCC-------AA--AAAAA-ATGAGCTCTCACCGATGGG{CG}GTCACG{AG}CAAGTGGTGGTTGAA-AGGCCTC-TAGCATCTAGTCGTGAGGC{AT}-CCGAGTTTACAGCGAGCTCTGATCGTG-ACCCTGTG-C--AC---C--T----TC-T--TATT-----AGGGGG-A{CT}GGTGCTT-TGACC Ilex_theezans_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATT---TGGC--C-GGGGGTT-TGAGAA--GGGGTGCGCGAG-----C-CCCCCCGA-CACACT---CCCCC-G---------CC-CCC-G-GGA-TTCGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACCCGGTC-GA-GCT-CCCGTC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAA?-TGAAG-AAGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGGGTGC-ACGGG-GGAGGCATT-TGCGTC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CA-A---CC--C---CAATG-----CCCGGCT-ACC--AGCTGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC------AAA--AAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAATCTGTAGCGAGCTCTGATCGTG-ACCCTGTG-C--AC---C-TT----CT-T--TATT-----A-GGGG-ACGGTGCTT-TGACC Ilex_vomitoria C--AAAGTAGA--CCGGCGAACT-TGTT---AAAATATG---C--T--G-GGGGTTTGAGAAAAG-GGGGTGCGCGAG---CC--CCCCCCAA-CACACT---CCCCC-A----------C-CTC-G-GGA-TTTGGC-TTG--TG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC-AC--G-GGGGGTATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CA-A---CC--C---CAATG------C---CT---A---GCTGGATATCGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----T---CG-C---G---ACCGTGAGCGGTTGG-CCC-----------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTG-ACCC--TG-T--GCA--C--C----TT-C--T-T------C-AGAG-ACGGTGCTT-CGACC Ilex_warburgii C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG---C--C--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCCCCAA-CACACT---CCCCC-AGCGC------C-CTC-G-GGA-TTTGGC-TTG--CG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CA-A---CC--C---CAATG------C---CC---G---GCTGGATATTACGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT--C-C-A-TA-T---G---AACGCGCGCGGTTGG-CCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGCG-ACCC--TG-T--GCA-CC--C----TTCC--T-T------C-ACGG-ATGGTGCTC-CGACC Ilex_yunnanensis C--AAAGTAGAC-CCAGCGAACT-TGTT---AAAATATG---C--C--C-GGGGGTT-TGAGAA--GGGGTGCGCGAG-------CCCCCCGA-CACAAT---CCCCC-A---------CC-CCC-G-GGA-TCTGGC-TTG--CG-T-TC-CCAT-AGCGGGG-ACTGGGTC-AG-GCT-CCCGGC---AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAATCTTAAC-TGAAG--AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATA-TGCATC-TTTTG---AAATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CA-A---CC--C---CAATG-----CCTAGCT---A---GCTGGATATTGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC-------AA--AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGACCGTG-ACCCTGCG-C--AC---C--T----TC-T--C-T------A-TGGG-ATGGTGCTT-CGACC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_841) = N: 1-765; CODONPOSSET CodonPositions (CHARACTERS = ITS_841) = N: 1-765; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2484] TITLE ITS_221; LINK TAXA = Taxa1; DIMENSIONS NCHAR=776; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Helwingia_chinensis C--AAAATAGA--CCCGCGAACA-TGTT----CAT-CCA--T-----C-----GGGGG-TTGG-C-GA--GGGGTGCGCGAG------CCCCC-AA-TCCAC----CCCCT----------CT-C--C--GGCGA--TGCT-GCT-TTGAATT-G-TC-GCCAATGCGGTGGCATCCATTGTT-GT-GTCGACTGAA-C-AACGAA---CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG-AGCCAG-TCTTCGAAAGC-CCCGTACGCGGTGCGC--TT----G-GGAGG{CT}GTT-GGCGTC-TTTAAA--ATCATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCGC--------CC-C-CAA-----CC--C-ACTCCACAC-A-CG----A--ATT-G-CG--GTGTTGC---TTTG----GGGG-CGGAGATTGGCCTCCCATAC--AA--AA-T---A---AGCTTGCGTGGTTGGCCT----------AA-AA-GC-GAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTTAAATATGCCTC-TTGCGTATTATCGCGAGACAA-CCCA-TCTCCGGC--G-TGT-G-C-T---C-TT--T-G-AG-A-C-C-----C--C-----------A--A----TGACGATGCTT-CGATT Helwingia_japonica C--AAAATAGA--CCCGCGAACA-TGTT----CAT-CCA--T-----C------GGGG-TTGG-C-GA--GGGGTGCGCGAG------CCCCC-AA-TCCAC----CCCCT----------CT-C--C--GGCGA--TGCT-GCT-TTGAATT-G-TC-GCCAATGCGGTGGCATCCATTGTT-GT-GTCGACTGAA-C-AACGAA---CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG-AGCCAG-TCTTCGAAAGC-CCCGTACGCGGTGCGC--TT----G-GGAGGCGTT-GGCGTC-TTTAAA--ATCATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCGC--------CC-C-CAA-----CC--C-ACTCCACAC-A-CG----G--ATT-G-CG--GTGTTGC---TTTG----GGGG-CGGAGATTGGCCTCCCATAC--AA--AA-T---A---AGCTTGCGTGGTTGGCCT----------AA-AA-GC-GAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTTAAATATGCCTC-TTGCGTATTATCGCGAGACAA-CCCA-TCTCCGGC--G-TGT-G-C-T---C-TT--T-G-AG-A-C-C-----C--C-----------A--A----TGACGATGCTT-CGATT Ilex_amelanchier C--AAAGTAGAC-CCGGTGAACT-TGTT----AAA-ACA--TG---CC--C--GGGGGTTTGA-G-AA--GGGGTGCGCGAG----CCCCCCC-GA-CACACT---CCCCCA---------CC-T--C--GG-GA--T-TT-GGC-TTG--TG-T-TC-CCCT-AGCGG-GG-ACTCG--GTC-AA-G-CTCCCAAC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTCG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTTG---------CC-C-CAA---CCCC--C-AATTCCTA--TAT-----A--GTTGGATATTGTG-TAA---GTT-----GGGGCCGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGAGCGGTTGGCCC---------AAA-AA-AT-GAGTTCTTGACGATGGACGTCACGACAAGGGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGC-A-CCTAGTCTGTAGCGAGCTCTAACCGTG-AC-CCTAT-A-TGCG-C-C-----TT-C----T------TC-A---GTGATGGTGCTT-CGACC Ilex_anomala C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATA--TG---CA--T---GGGGTTTGA-G-AA--GGGGTGCGCGAG-----CCCCCC-AA-CACACT---CCCCCA---------CC-T--C--GG-GA--T-TT-GGC-TTG--TG-T-TC-ACCT-AGTGG-AG-ACTCG--GTCAAA-G-GTCCCGAC---AACGAA---CCCCGGCGCTATA-TGTGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---A--ATC-TATAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AA----------T--------GCTGGATATTACG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT----A---CA-C---G---GCTGTGCGCGGTTGGCCC---------AAA-AA-TT-GAGCTCTGGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTTGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACTGTG-AC-CC--T-G-TGCA-C-C-----TT-C----T------TT-A-G-GGAATGGTGCTT-CGACT Ilex_argentina C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATTTG---GG--C--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C---CCCCCC-GA-CACACT---CTCCCA-------C-CC-A--C--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-AGTGG-GG-ACCCG--GTC-GA-C-CTCCCGAC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTAG-CCCCCTGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCGTC-TTTTG---A--ATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCA---------CC-C-CAA----CCC--C-AATGCCTG-GC-T--ACCA--GCTGGACGTTGCG-GGA---GCT-----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGTGCGGTTGGCCC-------A-AAA-AA-AT-GAGCTCTTGACGATGGACGTCACCACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGC-A-CCGAGTCTATAGCGAGCTCTGATCGTG-AC-CC--T-G-TGCA-C-C-----TT-C---TT-----ATT-A-G-GGGATGGTGCTT-TGACC Ilex_argentina_Gbk C--AAAGTAGA--CCGGCGAACT-TGTT----AAA-ACA--TG----C--TG-GGGGGTTTGA-G-AA--GGGGTGCGTGAG---C-CCCCCC-AA-CACACT--CCCCCCA---------CC-T--C--GG-GAT-T-TC-GGC-TTG--CG-T-CC-CCCT-AGCGG-GG-ACTCG--GTC-AA-G-CTCCCGACAA-AACGAA-C-CCCCGGCGCTATC-TGCGCCAAGGAACCACAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATCATGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--CCCC---CC-CTCCA----CCC--C-AATGCCCAC-C-T-----A--GCTGGATATTGTG-GGAGTCGTC-----GGCG-CGGAAATTGGTCTCCCGT-C--CG--CA-C---G---ATCGGGAGCGGTTGGCCC--------AAAA-AA-AT-GAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCACGTCGTGAGGC-A-CCGAGTCTGTGGCGAGCTCTAACCGTG-AC-CC--T-G-CGCA-C-C-----TT-C----T------TC-A---GCGATGGTGCTT-CGACC Ilex_beecheyi C--AAAGTAGAC-CCGGCGAACT-CGTT----AAA-ATA--TATG-GC--T--GGGGGTCTGG-G-AA--GGGGTGCGCGAG-----CCCCCC-AA-CACACT---CCCCCAGCCC-----GC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACTTG--GCC-AA-G-CTCCCGAC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCACAAC-TGAA--GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCA-AC----G-GGAGGCATT-TGCATC-TTTTG---A--ATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C------CCC--C-AA---C----C-C---------C---A-ATTGCG-GGA---GTC-G---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGGCCC-------A-AAA-AA-AT-GAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACCGTG-AC-CC--T-G-TGCA-C-C-----TC-C----T------TC-G-C-GG-ATGGTGCTC-CGACC Ilex_brasiliensis C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATTTG---GC--C-GGGGGGTTTGA-G-AA--GGGGTGCGCGAG-C---CCCCCC-GA-CACACT---CCCCCG-------C-CC-C--C--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACCCG--GCC-TA-G-CTCCCGAC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAGAAGCTAGCCCCCCC-GTGT-CCCGTTCGCGGCGTGC--AC----G-GGAGGCATT-TGCGTC-TTTTG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATGCCTG-GC-T--ACCA--GCCGGACGTTGCG-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGTGCGGTTGGCCC------AA-AAA-AA-AT-GAGCTCTCACCGATGGGCGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGC-A-CCGAGTCTACAGCGAGCTCTGATCGTG-AC-CC--T-G-CGCA-C-C-----TT-C---TT-----ATT-AGG-GGGATGGTGCTT-TGACC Ilex_brevicuspis C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATTTG---GC--C--GGGGGTTTGA-G-AA-GGGGGTGCGCGAG-C---CCCCCC-GA-CACACT---CCCCCG-------C-CC-C-TC--GG-GA--T-TT-GGC-TTA--CG-T-TC-CCCT-ACTGG-GG-ACCCG--GTC-GA-G-CTCCCGAC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCGTC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATGCCTG-GC-T--ACTA--GCTGGACGTTGCG-GGA---GCT-----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGGCCC-----AAA-AAA-AA-AT-GAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGGCCTC-TTGCATCTAGTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTCTGATCGTG-AC-CC--T-G-TGCA-C-C-----TC-C---TT-----ATT-A-G-GGTATGGTGCTT-CGACC Ilex_buergeri CA-AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATA--TG---CC--T--GGGGGTTTGA-A-AA--GGGGTGCGCGAG-----CCCCCC-AA-CACACT---CCCCCAGCCC-----CC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACTCG--GTC-AA-G-CTCCCGAC---AACGAA---CCCCGGCGCTATT-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA----CCC--C-AATG-C----C-C-----A--GCTGGATATTGCG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT----C---CA-T---G---AACGCGCGCGGTTGGCCC---------AAA-AA-AT-GAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACCGCG-AC-CC--T-G-TGCA-C-CC----TTCC----T------TC-A-C-GG-ATGGTGCTC-CGACC Ilex_canariensis C--AAAGTAGAC-CCGGCGAACC-CGTT----AAA-ACA--TG---CC--T--GGGGGTTTGA-G-AA--GGGGCGCGCAAG-----CCCCCC-GA-CGCACT---CCCCCA------CC-CC-C--C-GGG-GG--T-TT-GGC-TTG--GG-T-TC-CCCT-AGCGG-GG-ACCCG--GTC-AG-G-CTCCCGGC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-AGAAG-AGCTGG-CCCCCCGGTGTCCCCGTTCGCGGTGTGC--AC-T--G-GGAGGCATT-TGCGTC-TTTCG---A--ATC---TGAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGCTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCAAGGGCACGTCTGCCTGGGCGTCACCCATCACGTCG------C--CC-C-CAA----CCC--C-AATGCCTG-GC-T-----A--GCCGGGTATCGCG-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C-AGG---ACCGTGCGCGGTTGGCCC--A---AA-AAACAA-AT-GAGTTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGGGGC-A-CCGAGTCTATGGCGAGCTCCGACCGGG-AC-CC--T-G-CGCA-CAC-----TC-C----T------CC-G-G-GGGATGGTGCTC-CGACC Ilex_cassine C--AAAGTAGA--CCGGCGAACT-TGTT----AAA-ACA--TG----C--TG-GGGGGTTTGA-G-AA--GGGGTGCGTGAG---C-CCCCCC-AA-CACACT--CCCCCCA---------CC-T--C--GG-GAT-T-TC-GGC-TTG--CG-T-CC-CCCT-AGCGG-GG-ACTCG--GTC-AA-G-CTCCCGACAA-AACGAA-C-CCCCGGCGCTATC-TGCGCCAAGGAACCACAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATCATGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--CCCC---CC-CTCCA----CCC--C-AATGCCCAC-C-T-----A--GCTGGATATTGTG-GGAGTCGTC-----GGGG-CGGAAATTGGCCTCCCGT-C--CG--CA-C---G---ATCGTGAGCGGTTGGCCC--------AAAA-AA-AT-GAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCACGTCGTGAGGC-A-CCGAGTCTGTGGCGAGCTCTAACCGTG-AC-CC--T-G-CGCA-C-C-----CT-C----T------TC-A---GCGATGGTGCTT-CGACC Ilex_collina C--AAAGTAGA--CCCGCGAACT-TGTT----AAA-ATA--TG----C--T--GGGGGTTTGAGGTTAG-GGGGTGCGCGAG---C-CCCCCC-AA-CACACT---CCCCCA---------CC-T--C--GG-GA--T-TT-GGCTTTG--TG-T-TC-CCCT-AGTGG-GG-ACTCG--GTC-AG-G-CTCCCGAC-A-AACGAA---CCCCGGCGCTATC-TGCGCCAAGGAATCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC--AC----G-GGGGGCATT-TGCATC-TTTTG---A--ATC---TAAAA{CT}GACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATG-C----C-T-----A--GTTGGATATTGTG-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT----C---CA-T---G---ACCGTGAGCGGTTGGCCC---------AAA-AA-AT-GAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGC-A-CCTAGTCTGTAGCGAGCTCTAATCGTG-AC-CC--T-G-{CT}GCA-C-C-----TT-C----T------TC-A---ACGACGGTGCTT-CGACC Ilex_cornuta C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAA-ATA--TG---CC--T--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-----CCCCCC-AA-CACACT---CCCCCAGCCC-----CC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACGCG--GCC-AA-G-CTCCCGAC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGGTGT-CCCGTTCGCGGCGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG---------CCAC-CAA----CCC--C-AATG-C----C-C-----A--GCCGGATATTGCG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCC?GT----T---?A-C---G---AACGTGCGCGGTTGGCCC---------AAA-AA-AT-GAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACCGCG-AC-CC--T-G-TGCA-C-CC----TT-C----T------TC-A-C-GG-ATGGTGCTC-CGACC Ilex_crenata C--AAAGTA{AC}A--CCGGCGAACT-TGTT----AAA-ACA--TG----C--CG-GGGGGTTTGA-G-AA--GGGGTGCGCGAG---C-CCCCCC-AAT-AAGGT-T-CCCCCA---------CC-T--C--CG-GA--T-TT-GGC-TTGT-TT-T-CC-CCCT-GGCGG-GGAACTCG--GCC-CA-G-CTCCCGAC-A-AACGAA---CCCCGGCGCTGTT-TGCGCCAAGGAACCATAAC-CGAAG-AGCTGG-TCTCCCGGTGC-CCCGTCCGCGGTGTGC--AC----G-GGAGGCGTT-TGCGTC-TTTTG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C--CCAACGGC-C-T-----A--GCCGGATATTGCG-GGA---GTT-----GGGG-CGGAGATTGGCCTCCCGT-C--CG--CG-C---G---ACCGTGAGCGGTTGGCCC---------AAA-AA-AC-GAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TCGCATCACGTCGTGGGGC-G-CCTAGTCTGTAGCGAGCTCCGACCCTGTGCACC--T-G--ATT-C-G-----CT-C----T------AG-G---GCGA-GGTGCTT-CGACC Ilex_decidua C--AAAGTAGA--CCGGCGAACT-TGTT----AAA-ATA--TG----C--T--GGGGGTTTGAGAAAAG-GGGGTGCGCGAG---C-CCCCCC-AA-CACACT---CCCCCA---------CC-T--C--GG-GA--T-TT-GGCTTTG--TG-T-TC-CCCT-AGCGG-GG-ACTCG--GTC-AA-G-CTCCCGAC-A-AACGAA---CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC--AC----G-GGGGGTATT-TGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATG-C----C-T-----A--GCTGGATATCGTG-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT----T---CG-C---G---ACCGTGAGCGGTTGGCCC---------AAA-AA-AT-GAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGC-A-CCTAGTCTGTAGCGAGCTCTAACCGTG-AC-CC--T-G-TGCA-C-C-----TT-C----T------TC-A---GAGACGGTGCTT-CGACC Ilex_dimorphophylla C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAA-ATA--TG---CC--T--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-----CCCCCC-AA-CGCACT---CCCCCAGCCC-----CC-T--C--GG-GG--T-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACGCG--GCC-AA-G-CTCCCGAC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGGTGT-CCCGTTCGCGGCGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG---------CCAC-CAA----CCC--C-AATG-C----C-C-----A--GCCGGATATTGCG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT----T---CA-C---G---AACGTGCGCGGTTGGCCC---------AAA-AA-AT-GAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACCGCG-AC-CC--T-G-TGCA-C-CC----TT-C----T------TG-A-C-GG-ATGGTGCTC-CGACC Ilex_dumosa_dumosa C--AAAGTAGA--CCGGCGAACTCTGTT----AAA-ACA--TG----C-TGG-GGGGGTTTGA-G-AA--GGGGTGCGCGAG---C-CCCCCC-AATCACGCT-C-CCCCCA---------CC-T--C--GG-GA--T-CT-GG{CT}-TTGT-TT-T-CC-CCCT-GGCGG-GGAACTCG--GCG-GA-G-CTCCCGAC-A-AACGAA---CCCCGGCGCTGTA-TGCGCCAAGGACCCATAAC-CGAA{AG}-AGCTGG-TCTCCCGTTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATC-TGCGTC-TTTTG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--CAAAAAACGTC-C-T-----A--GGTGGACATTGTG-GGA---GTT-----GGGG-CGGAGATTGGCCTCCCGT-C--CA--CA-C---GT--CCCGTGAGCGGTTGGCCC--------AAAA-AA-AC-GAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTCTTTGCATCATGTCGTGAGGC-G-CCTAGT?TGCAACGA?CTCCGACCCTGTGCACC--TAGTTGTC-C-G-----CT-G----T------AG-G---GCGACGGTGCTT-CGACC Ilex_dumosa_guaranina C--AAAGTAGA--CCGGCGAACTCTGTT----AAA-ACA--TG----C-TGG-GGGGGTTTGA-G-AA--GGGGTGCGCGAG---C-CCCCCC-AATCACGCT-C-CCCCCA---------CC-T--C--GG-GA--T-CT-GGC-TGGT-TT-T-CC-CCCT-GGCGG-GGAACTCG--GCC-GA-G-CTCCCGAC-A-AACGAA---CCCCGGCGCTGTA-TGCGCCAAGGACCCATAAC-CGAAG-AGCTGG-TCTCCCGTTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATC-TGCGTC-TTTTG---A--ATC---CAAAAC{CG}ACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTT?AACGCAAGTTGCGCCCAAAGCCAT?AGGCCAAGGGCACGTCT?CCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--CAAAAAACGTC-C-T-----A--GGTGGACATTGTG-GGA---GTT-----GGGG-CGGAGATTGGCCTCCCGT-C--CA--CA-C---GT--CCCGTGAGCGGTTGGCCC--------AAAA-AA-A?-GAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTCTTCGCATCATGTCGTGAGGC-G-CCTAGTCTGCAACGATCTCCGACCCTGTGCACC--TAGTTGTC-C-G-----CT-G----T------AG-G---GCGACGGTGCTT-CGACC Ilex_glabra C-AAAAGTAGAC-CCGGCGAACC-TGTT--A-AAA-ATA--TG---CA--T--GGGGGTCTGA-G-AA--AGGGTGCGCGAG-----CCCCCC-GA-CACATT---CCCCCA---------CC-C--C--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACTCG--GTC-AA-G-CTCCCGAC--AAACGAA--CCCCCGGCGCTATC-TGCGCCAAGGAACCTTAAC-{CT}GAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG-A-A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------C--CC-C-CAA-C--CCC--C-AATGCCTG-GC-T-----A--GCTGGGTATTGCG-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGGCCC---------AAA-AA-AT-GAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCAGACCGGG-AC-CC--T-G-TGTG-CAC----ATT-C----T------TT-A-G-GGGATGGTGCTT-CGACC Ilex_integerrima C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATTTG---GC--C--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C---CCCCCC-GA-CACACT---CCCCCG-------C-CC-C--C--GG-GA--T-TC-GGC-TTG--CG-T-TA-CCCT-A{AG}CGG-GG-ACCCG--GTC-GA-G-CTCCCGTC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAGAAGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC--AC--GGG-GGAGGCATT-TGCGTC-TTTCG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGT??????????GTC{CG}--------CCC-C-C{AGT}A----CCC--C-AAAGCCCG-GT-T--ACCA--GCTGGACCTTGCG-GGA---?CT-----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGGCCC-----?AA-AAA-AA-AT-GAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGA-AGACCTC-TTGCAT?TAGTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTCTGATCGCG-AC-CC--T-G-TGCA-C-C-----TT-C--TTT-----ATT-A-G-GGGACGGTGCTT-TGACC Ilex_integra C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATA--TATG-CC--T--GGGGGTTTGA-G-AA--GGGGTGTGCGAG-----CCCCCC-AA-CAAAAT---TCCCCAGCCC-----CC-T--TG-GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-AGGGG-GG-ATTGG--GCC-AA-G-TTCCGGAA---AACGAA---CCCGGGCGCTTTT-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATTT-CCCGTCCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C------CCC--C-AA---C----C-C---------C---A-ATTGCG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCGCGGTTGGCCCA------A-AAA-AA-AT-GAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACCGCG-AC-CC--T-G-TGCA-C-C-----TT-C----T------TC-A-C-GG-ATGGTGCTT-CGACC Ilex_kiusiana C--AAAGTAGAC-CC{CT}GCGAACT-{CT}GTT----TAA-ATA--TGT--CC--T--GGGGGTCAGA-C-AA--GGGGTGCGCGAGC----CCCCCC-AA-CACACT---CCCCCAGGCC-----CC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACTCG--GTC-AA-G-CTCCCGAC---AACGAA---CCCCGGCGCTATT-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C------CCC--C-AA---C----C-C---------C---A-ATTGCG-GGA---TT{CG}-A---GGGG-CGGAAATTGGCCTCCCGT----A---CATCT--G---AACGTGCGCGGTTGGCCCC------G-AAA-AA-AT-G{AG}GTTCTTGAATAAGGACGTCACGACAAGTGTTGGTTGAA-ATACGCC-TTGAGTCATGTCTTGAGGC-A-CCTAGTCTGTAACGAGCTCTGACCGCA-AC-TC--T-G-TGCAGC-CA----TC-C----T------TC-A-T-GG-ATCGTGCTT-CAACC Ilex_latifolia C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATA--TG---CC--T--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-----CCCCCC-AA-CACACT---CCCCCAGCCC-----CC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACTCG--GTC-AA-G-CTCCCGAC---AACGAA---CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA----CCC--C-AATG-C----C-C-----A--GCTGGATATTGCG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT----C---CA-T---G---AACGCGCGCGGTTGGCCC---------AAA-AA-AT-GAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGC{AG}TCATGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGAC{CT}GCG-AC-CC--T-G-TGCA-C-CC----TTCC----T------TC-A-C-GG-ATGGTGCTT-CGACC Ilex_liukiuensis C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATA--TG---CC--T--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-----CCCCCC-AA-CACACT---CCCCCAGCGC-----CC-T--C--GG-GT--T-TT-GGC-TTG--CG-T-TC-CCCT-AGTGG-GG-ACTCG--GTC-AA-G-CTCCCGAC---AACGAA---CCCCGGCGCTATC-TGCG----GGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCGGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTTAATTGCAGAATCCCGTGAACCATCGAGTTTTTGATCGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA----CCC--C-AATG-C----G-C-----G--GCTGGATATTACG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT--------TA-T---G---AACGCGCGCGGTTGGCCC---------AAA-AA-AT-GAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCCTCATGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACTGCG-AC-CC--T-G-TGCA-A-CC----TTCC----T------TC-A-C-GT-ATGGTGCTC-CGACC Ilex_macropoda C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATA--TG---TT--T--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C---CCCCCC-GA-CACACT---CCCCCA---------CC-T--C--GG-GG--T-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACTCG--GTC-AG-G-CTCCCGAC---AACGAA---CCCCGGCGCTATT-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATA-TGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATGCCTA-CC-T-----G--GCTGGATATTGCA-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACTGTGTGTGGTTGGCCC------AA-AAA-AA-AA-GAATTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGC-A-TCGAGTCTTTGGCGAGCTCTGACCGTG-AC-CC--T-G-TGCA---C-----TT-C----T------TT---C-GGGATGGTGCTT-CGACC Ilex_maximowicziana C--AAAGTAGAC-CCGGCGAACT-CGTT----AAA-ATA--TG---CC--T--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-----CCCCCC-AA-CACACT---CCCCCAGCCC-----CC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACTCG--GTC-AA-G-CTCCCGAC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCGGGTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG---------CCAC-CAA----CCC--C-GATG-C----C-C-----A--TCTGGATATTGCG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT----T---CA-C---G---AACGTGCGCGGTTGGCCC---------AAA-AA-AT-GAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGC-A-CCAAGTCTGTACCGAGCTCTGGCCGCG-AC-CC--T-G-CGCA-C-CC----TT-C----T------TC-A-C-GG-ATGGTGCTC-CGACC Ilex_mertensii C--AAAGTAGAC-CCGGCGAACT-CGTT----AAA-ATA--TATG-GC--T--GGGGGTCTGG-G-AA--GGGGTGCGCGAG-----CCCCCC-AA-CACACT---CCCCCAGCCC-----GC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACTCG--GCC-AA-G-CTCCCGAC---AACGAA---CCCCGGCGCTGTT-TGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCA-AC----G-GGAGGCATT-TGCATC-TTTTG---A--ATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACAATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C------CCC--C-AA---C----C-C---------C---A-ATTGCG-GGA---GTC-G---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGGCCC-------A-AAA-AA-AT-GAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACCGTG-AC-CC--T-G-TGCA-C-C-----TC-C----T------TC-G-C-GG-ATGGTGCTC-CGACC Ilex_micrococca C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATA--TG--CTT--T--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-----CCCCCC-GA-CACACTC--CCCCCA---------CC-T--C--GG-GA--T-TT-GGC-TTG--{CT}G-T-TC-CCCT-AGCGG-GG-ACTCG--GTC-AG-G-CTCCCGAC---AACGAAC--CCCCGGCGCTATT-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATA-CGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CCA----CCC--C-AATGCCTA-GC-T-----G--GCTGGATATTGCG-GGA---GTT---GGGGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGGCCC------AA-AAA-AATAA-GAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGC-A-CCGAGTCTCTAGCGAGCTCTGATCGTG-AC-CC--T-G-CGCG-C-C-----TC-C----T------TC---C-GGGATGGCGCTT-TGACC Ilex_microdonta C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATTTG---GC--C--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C---CCCCCC-GA-CACACT---CCCCCG-------C-CC-C-TC--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-ACCGG-GG-ACCCG--GTC-GA-G-CTCCCGAC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCTCAAC-TGAAG-AGCTGGCCCCCCCGATGC-CCCGTTCGCGGTGTGC--AC--GGGAGGAGGCATT-TGCGTC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCATGTCG-------C-CC-C-CAA----CCC--C-AACGCCTG-GC-T--ACTA--GCCGGACGTTGCG-GGA---GCT-----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G-ACACCGTGCGCGGTTGGCCC------AA-AAA-AA-AT-GAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTCTGATCGTG-AC-CC--T-G-TGCA-C-C-----TC-C---TT-----ATT-A-G-GGGATGGTGCTT-CGACC Ilex_microdonta_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAA-ATATTTG---GC--C--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C---CCCCCC-GA-CACACT---CCCCCG---------CC-C-TC--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-ACCGG-GG-ACCCG--GTC-GA-G-CTCCCGAC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC--AC--GGGAGGAGGCATT-TGCGTC-TTTTG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-------C-CC-C-CAA----CCC--C-AACGCCCG-GC-T--ACTG--GCTGGACGTTGCG-GGG---GCT-----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGGCCC------AA-AAA-AA-AT-GAGCTCCTGACGATGGACGTCGCGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTCTGATCGTG-AC-CC--T-G-TGCA-C-C-----TC-C---TT-----ATT-A-G-GGGATGGGGCTT-CGACC Ilex_mitis C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATA--TG---CC--T--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C---CCCCCC-GA-CACACT---CCCCCA---------CC-T--C--GG-GA-TT-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACTCG--GCC-AG-G-CTCCCGAA---AACGAAC--CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCGACGT-CCCGTTCGCGGTGTGC--ACG---G-GGAGGCATG-TGCGTC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATGCCTA-GC-T-----A--GCTGGATATTGTG-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGGCCC------AA-AAA-AAAAAGGAGTTCTTGACGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTA-TTGCATCAAGTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTCTGACCGTG-AC-CC--T-G-CGCA-C-C-----TT-C----T------TTAA-C-GGAATGGTGCTC-CGACC Ilex_mucronata C--AAAGTAGAC-CCAGCGAACT-TGTT----AAA-ACA--TG---CT--T--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-----CCCCCC-GA-CACACT---CCCCCA---------CC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACTCG--GTC-AA-G-CTCCCGAC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTCG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA--CCCCC--C-AATTCCTA--TGT-----A--CCTGGATATTGTG-GGA---GAT-----GGGG-CGGAAATTGGCCTCCCGT----A---CA-C---G---ACCGTGAGCGGTTGGCCC---------AAA-TA-AT-GAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGC-A-CCTAGTCTGTAGCGAGCTCTAACCGTG-AC-CCTAT-A-TGCA-C-C-----TT-C----T------TC-A---GCGATGGTGCTT-CGACC Ilex_mutchagara C--AAAGTAGA--CCGGCGAACT-TGTT----TAA-ACA--TG----C--GG-GGGGG{GT}TTGA-A-AA--AGGGTTCGCGAA---C-CCCCCC-AATCACGCT-C-CCCCCA---------CC-T--C--GG-GA--T-CT-GGC-TCGT-TT-TCCC-CCCT-GGCGG-GGAACTCG--GCC-AA-G-CTCCCGAC-A-AACGAA---CCCCGGCGCTGTT-TGCGCCAAGGAACAATAAC-CGAAG-AGCTGG-TCTCCCGGTGC-CCCGTCCGCGGCGTGC--AC----G-GGAGGCGCT-TGCGTC-TTTTG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA-----CC--C--CCACCGGC-C-C-----A--GCCGGATACTGCG-GGA---GTT-----GGGG-CGGAGATTGGCCTCCCGT-C--CG--CG-C---G---ACCGTGAGCGGTTGGCCC---------AAA-AA-AC-GAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TCGCATCATGTCGTGGGGC-G-CCTAGTCCGCAGCGAGCTCCGACCCTGTGCACC--T-G--ATT-C-G-----CT-C----T------CG-G---GCGACGGTGCTT-CGACC Ilex_opaca C--AAAGTAGA--CCGGCGAACT-TGTT----AAA-ACA--TG----C--TG-GGGGGTTTGA-G-AA--GGGGTGCGTGAG---C-CCCCC{GT}-AA-CACACT---CCCCCA---------CC-T--C--GG-GAT-T-TT-GGC-TTG--CG-T-CC-CCCT-AGCGG-GG-ACTCG--GTC-AA-G-CTCCCGAC-A-AACGAA---CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGTTGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCGTCATGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----CC---CC-C-CCA----CCC--C-AATGCCCAC-C-T-----A--GCTGGATATTGCG-GGA---GTC-----GGGG-CGGAAATTGGCCTCCCGT-C--CG--CA-C---G---ATCGTGAGCGGTTGGCCC--------AAAA-AA-AT-GAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGC-A-CCAAGTCTGTGGCGAGCTCTAACCGTG-AC-CC--T-G-CGCA-C-C-----CT-C----T------TC-A---GCGATGGTGCTT-CGACC Ilex_paraguariensis C--AACGTAGA-CCCGGCGAACT-TGTT----AAA-ATA--CG----CT-GG-GGGGGTTTGG-G-AA--GGGGTGCGCGAG---C-CCCCCCGAA-CACACT---CCCCCG--------CCC-T--C--GG-GA--C-TG-GGC-TTGTGTTCC-CCTCCCTAGGGGG-GGGACTCG--GTC-GA-G-CTCCCGAC-A-AACGAA---CCCCGGCGCTGTC-TGTGCCAAGGAACCATAAC-CGAAG-AGCTGG-TCTCCCGATGT-CCCGTTCGCGGTGCGC--AC----G-GGAGGCATT-TGCATCTTTTTGA--A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGC--------CC-C-CAA----CCC--C-AATGCCCGG-A-T--------GTT-G-CG--G-G-GGA---GTTG----GGGG-CGGAAATTGGCCTCCCGT-C--CA--CA-{CT}---G---ATCGTGAGCGGTTGGCCC---------AAA-AA-GT-GAGTTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGC-G-CCTAGTCTGTAGCGAGCTCTAACCGTGGAC-CC--T-G-CGCA-C-C-TAA-TT-CGT--TCGAGA-AG-A---GCGACGGTGCTT-CGACC Ilex_pedunculosa C--AAAGTAGAC-CCGGCGAACT-CGTTA---AAATATA--TG---GC--T--GGGGGTCTGG-G-AA--GGGGTGCGCGAG-----CCCCCC-AA-CACACT---CCCCCA----G--C-CCGCT-C--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACTCG--GCC-AA-G-CTCCCGAC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGC-AAC----G-GGAGGCATT-TGCATC-TTTTG---A--ATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCAAGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATGCCAA-GC-T-----T--GCTGGGTATTGCG-GGA---GCT-----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGGCCC-------A-TAA-AA-AT-GAGTTCCTGACGATTGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-A{CT}GCATCAAGTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTCTGATCGTG-AC-CC--T-T-CGCA-C-C-----TT-C----T------CT-A-ATGGGATGGTGCTTCCGACC Ilex_percoriacea C--AAAGTAGAC-CCGGCGAACT-CGTT----AAA-ATA--TATG-GC--T--GGGGGTCTGG-G-AA--GGGGTGCGCGAG-----CCCCCC-AA-CACACT---CCCCCAGCCC-----GC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACTCG--GCC-AA-G-CTCCCGAC---AACGAA---CCCCGGCGCTGTT-TGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCA-AC----G-GGAGGCATT-TGCATC-TTTTG---A--ATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------------C------CCC--C-AA---C----C-C---------C---A-ATTGCG-GGA---GTC-G---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGGCCC-------A-AAA-AA-AT-GAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACCGTG-AC-CC--T-G-TGCA-C-C-----TC-C----T------TC-G-C-GG-ATGGTGCTC-CGACC Ilex_pseudobuxus C--AAAGTAGAC-CCGGCGAACC-TGTT----AAA-ATATTTG---GC--C--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C---CCCCCC-GA-CACACT---CCCCCG-------C-CC-C-TC--GG-GA--T-TC-GGC-TTG--CG-T-TC-CCCT-GCCGG-GG-ACCCG--GTC-GA-G-CTCCCGAC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCGATGC-CCCGTTCGCGGTGTGC--AC--GGGAGGAGGCATT-TGCGTC-TTTTG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGTTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-------C-CC-C-CAA----CCC--C-AACGCCCG-GC-T--A{CT}TG--GCTGGACGTTGCG-GGA---GCT-----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGGCCC------AA-AAA-AA-AC-GAGCTCCTGACGATGGACGTCCCGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTGGTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTCTGATCGTG-AC-CC--T-G-TGCA-C-C-----TC-C---TT-----ATT-A-G-GGGACGGTGCTT-CGACC Ilex_rotunda C--AAAGTAGAC-CCGGCGAACT-CGTT----AAA-ATA--TG---CG--T--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C---CCCCCC-GA-CACATT---CCCCCA-----C-C-CC-C--C--GG-GA--C-TT-GGC-CCG--GG-T-TC-CCCT-TGCGG-GG-ACTCG--GCC-AAGG-CTCCCGAC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-CGAAG-AGCTGG-CCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCGTA-CGCATC-TTTCG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-C-------CC-C-CAAC---CCCGAC-AATGCCCG-GC-T-G---GCAGCCGGATATTGCG-GGA---GTT--G--CGGG-CGGAGATTGGCCTCCCGT----C---CA-C---G---ACCGTGCACGGTTGGCCC---------AAA-AA-GC-GAGTTCTTGACGACGGACGTCACGACGAGTGGTGGTTGGA-AGACCTC-TTGCGTCGAGTCGTGAGGC-ACCCGAGTCTGTAACGAGCTCTGACCGCG-AC-CC--T-G-TGCG-C-C-----TT-C----C------TT-A-G-GGGGCGGCGCTC-CGACC Ilex_rugosa C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATA--TG---CC--T--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-----CCCCCC-AA-CACACT---CCCCCA---------CC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACTTG--GTC-AA-G-CTACCGAC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCTGTTGT-CCCGTCTGCGGTGTGC--AC----G-GGAGGCATT-TGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA----CCC--C-AATG-C----C-T-----A--GCTGGATATTG{AC}G-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCGCGGTTGGCCC-A-----A-AAA-AA-AT-GAGTTCTTGACGATGGACGTCACGATAAGTGGTGGTTGAA-AGACCTA-TTGCGTCATGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACCGTG-AC-CC--T-G-TGCA-C-C-----TT-C----T------TC-A-T-GG-ATGGTGCTT-CGACC Ilex_serrata C--AAAATAGAC-C{CT}GGCGAACT-TGTT----AAA-ATA--TG---CT--T--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-T---CCCCCC-GA-CACACT---CCCCCA-------C-CC-C--C--GG-GA--T-TT-GGC-TTG--CG-T-CC-CCCT-AGCGG-GG-ACTCG--GTC-AA-G-CTCCCGAC---AACGAA---CCCCGGCGCTATC-TGCGCCAAGGAACCTTAAC-CGAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCGTA-TGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACACATCACGTCG---------CC-C-CAA----CCC--C-AATGCCTA-GT-T-----G--GTTAGGCATTGTT-GGA---GTT--G--GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ATTGTGCGCGGTTGGCCC---------AAA-AA-AT-GAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTCGTGAGGC-A-CCGAGTCTGTAACGAGCTCTAACCGTG-AC-CC--T-G-TGCA-C-C-----TT-C----T------TT-A-G-GGGATGGTGCTC-CGACC Ilex_taubertiana C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATTTG---GC--C--GGGGGTTTGA-G-AA-GGGGGTGCGCGAG-C---CCCCCC-{AG}A-CACA{CT}T---CCCCCG---------CC-C-T---GG-GA--T-TTGGGT-TTG--CG-T-TC-CCCT-ACCGG-GG-ACCCG--GT{CG}-GA-G-CTCCCG{AC}C---ACCAA{AC}---CCCCGGCGCTGTT-TGCGCCAAGGAACCTTAAC-TGAA?-A?CTGGCCCCCCCGATGT-CCCGTTC?CGGTGTGC--AC---GG-GGAGGCATT-TGCGTC-TTTTG---A--ATT---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGT{CT}TGCCTGGGCGTCACGCATCACGT{CT}G---------CC-C-CAA----CCC--C-AATGCCCG-GC-T--ACTA--{AG}CTGGACGTT{CT}CG-GGA---{AG}CT-----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGGGCGGTTGGCCC---AAAAA-AAA-AA-AT-GAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGGCCTC-TTGCGTCTAGTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTTTGATCGTG-AC-CC--T-G-TGCG-C-C-----TC-C---TT-----ATT-A-G-GGGACGGTGCTT-CGACC Ilex_theezans C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATTTG---GC--C-GGGGGGTTTGA-G-AA--GGGGTGCGCGAG-C---CCCCCC-GA-CACA{CT}T---CCCCCG-------C-CC-C--C--GG-GA--T-TT-GG{CGT}-TTG--{CG}G-T-TC-CCCT-AGCGG-GG-ACCCG--GCC-GA-G-CTCCCGAC---AACGAA---CCCCGG{CG}G{CG}TGTC-TGCGCCAAGGAACCTTAAC-TGAA{AG}AAGCT{AG}GCCCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATT-TGCGTC-TTTTG---A--ATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATGCCTG-GC-T--ACCA--GC{CT}GGACGTTGCG-GGA---GCT-----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---{AG}CCGTG{CGT}GCGGTTGGCCC------AA-AAA-AA-AT-GAGCTCTCACCGATGGG{CG}GTCACG{AG}CAAGTGGTGGTTGAA-AGGCCTC-TAGCATCTAGTCGTGAGGC-{AT}-CCGAGTTTACAGCGAGCTCTGATCGTG-AC-CC--T-G-TGCA-C-C-----TT-C---TT-----ATT-AGG-GGGA{CT}GGTGCTT-TGACC Ilex_theezans_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATTTG---GC--C--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-C---CCCCCC-GA-CACACT---CCCCCG-------C-CC-C--C--GG-GA--T-TC-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACCCG--GTC-GA-G-CTCCCGTC---AACGAA---CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAA?-TGAAGAAGCTGGCCCCCCCGATGT-CCCGTTCGCGGGGTGC--AC--GGG-GGAGGCATT-TGCGTC-TTTCG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATGCCCG-GC-T--ACCA--GCTGGACGTTGCG-GGA---GCT-----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGGCCC-----AAA-AAA-AA-AT-GAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGA-AGACCTC-TTGCATCTAGTCGTGAGGC-A-CCGAATCTGTAGCGAGCTCTGATCGTG-AC-CC--T-G-TGCA-C-C-----TT-C--TTT-----ATT-A-G-GGGACGGTGCTT-TGACC Ilex_vomitoria C--AAAGTAGA--CCGGCGAACT-TGTT----AAA-ATA--TG----C--T--GGGGGTTTGAGAAAAG-GGGGTGCGCGAG--CC-CCCCCC-AA-CACACT---CCCCCA---------CC-T--C--GG-GA--T-TT-GGC-TTG--TG-T-TC-CCCT-AGCGG-GG-ACTCG--GTC-AA-G-CTCCCGAC-A-AACGAA---CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC--AC----G-GGGGGTATT-TGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATG-C----C-T-----A--GCTGGATATCGTG-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT----T---CG-C---G---ACCGTGAGCGGTTGGCCC---------AAA-AA-AT-GAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGC-A-CCTAGTCTGTAGCGAGCTCTAACCGTG-AC-CC--T-G-TGCA-C-C-----TT-C----T------TC-A---GAGACGGTGCTT-CGACC Ilex_warburgii C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATA--TG---CC--T--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-----CCCCCC-AA-CACACT---CCCCCAGCGC-----CC-T--C--GG-GA--T-TT-GGC-TTG--CG-T-TC-CCCT-AGCGG-GG-ACTCG--GTC-AA-G-CTCCCGAC---AACGAA---CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG----G-GGAGGCATT-TGCATC-TTTTG---A--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CCAC-CAA----CCC--C-AATG-C----C-C-----G--GCTGGATATTACG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT--C-C-A-TA-T---G---AACGCGCGCGGTTGGCCC---------AAA-AA-AT-GAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGC-A-CCAAGTCTGTAGCGAGCTCTGACTGCG-AC-CC--T-G-TGCA-C-CC----TTCC----T------TC-A-C-GG-ATGGTGCTC-CGACC Ilex_yunnanensis C--AAAGTAGAC-CCAGCGAACT-TGTT----AAA-ATA--TG---CC--C--GGGGGTTTGA-G-AA--GGGGTGCGCGAG-----CCCCCC-GA-CACAAT---CCCCCA-------C-CC-C--C--GG-GA--T-CT-GGC-TTG--CG-T-TC-CCAT-AGCGG-GG-ACTGG--GTC-AG-G-CTCCCGGC---AACGAA---CCCCGGCGCTATC-TGCGCCAAGGAATCTTAAC-TGAAG-AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC----G-GGAGGCATA-TGCATC-TTTTG--AA--ATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---------CC-C-CAA----CCC--C-AATGCCTA-GC-T-----A--GCTGGATATTGCG-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGGCCC------AA-AAA-AA-AT-GAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTCGTGAGGC-A-CCGAGTCTGTAGCGAGCTCTGACCGTG-AC-CC--T-G-CGCA-C-C-----TT-C----T------CT-A-T-GGGATGGTGCTT-CGACC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_221) = N: 1-776; CODONPOSSET CodonPositions (CHARACTERS = ITS_221) = N: 1-776; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2485] TITLE ITS_211; LINK TAXA = Taxa1; DIMENSIONS NCHAR=756; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Helwingia_chinensis C--AAAATAGA--CCCGCGAACA-TGTT-----CAT--CCAT-C------GGGGG-T-TGGCGA--GGGGTGCGCGAG-C--CCCCAATCCACCCCCTC--TCCG--GC------G-A-TGCTGC--TTTGAA-TTGTCGC---CA-ATGC-GGTGGCATCCATTGTT-GT-GTCGACTGAAC--AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG-AGCCAG-TCTTCGA-AAGC-CCCGTACGCGGTGCGC-TT--G-GGAGG{CT}GT-TGGCGTCTTTAAAAT--CATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG------CC-CC-CA-A--C--C--CAC-TC----CAC--A-C--ACGAA-TTGCGGTGTTGC---TTTG----GGGG-CGGAGATTGGCCTCCCATAC---AA---AA-T---A---AGCTTGCGTGGTTGG--CC---------TAAAA-GCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTTAAATATGCCTC-TTGCGTATTATCGCGAGACA-ACCCATC--T-CCG-GC-GTGT-GC--T---CTT---T-GAG--A--CC-------C----C------A---A--TG-ACGATGCTT-CGATT Helwingia_japonica C--AAAATAGA--CCCGCGAACA-TGTT-----CAT--CCAT-C-------GGGG-T-TGGCGA--GGGGTGCGCGAG-C--CCCCAATCCACCCCCTC--TCCG--GC------G-A-TGCTGC--TTTGAA-TTGTCGC---CA-ATGC-GGTGGCATCCATTGTT-GT-GTCGACTGAAC--AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG-AGCCAG-TCTTCGA-AAGC-CCCGTACGCGGTGCGC-TT--G-GGAGGCGT-TGGCGTCTTTAAAAT--CATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG------CC-CC-CA-A--C--C--CAC-TC----CAC--A-C--ACGGA-TTGCGGTGTTGC---TTTG----GGGG-CGGAGATTGGCCTCCCATAC---AA---AA-T---A---AGCTTGCGTGGTTGG--CC---------TAAAA-GCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTTAAATATGCCTC-TTGCGTATTATCGCGAGACA-ACCCATC--T-CCG-GC-GTGT-GC--T---CTT---T-GAG--A--CC-------C----C------A---A--TG-ACGATGCTT-CGATT Ilex_amelanchier C--AAAGTAGAC-CCGGTGAACT-TGTT-----AAA--ACATGC---CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C--CCCC-CCGA-CACACT---CCCC--CA------C-C-TCGGGA--TTTGGC-TTGTGTT----C-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCAAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTTG--C---CC-CA-A---CCC--C--CAA-TTCCTATAT--A-G--TTGGA-TATT-GTG-TAA---GTT-----GGGGCCGGAAATTGGCCTCCCGT-----C----CA-C---G---ACCGTGAGCGGTTGG-CCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGGGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAA-CC-GT-GACCC-TAT-ATG-CG--CC----TT-C----T------T-C-A-GTG-ATGGTGCTT-CGACC Ilex_anomala C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATGC---AT--GGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-CCAA-CACACT---CCCC--CA------C-C-TCGGGA--TTTGGC-TTGTGTT----C-ACCT-AGTGGAG-ACTCGGTCAAA-G-GTCCCGAC---AACGAA----CCCCGGCGCTATA-TGTGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC-TATAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA---CC--C--CAA---------T----G--CTGGA-TATT-ACG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT-----A----CA-C---G---GCTGTGCGCGGTTGG-CCC---------AAAAA-TTGAGCTCTGGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTTGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGA-CT-GT-GACCC---T-GTG-CA--CC----TT-C----T------T-T-A-GGGAATGGTGCTT-CGACT Ilex_argentina C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTGG---GC-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-CCGA-CACACT-C-TCCC-ACC------C-A--CGGGA--TTTGGC-TTGCGTT----C-CCCT-AGTGGGG-ACCCGGTC-GA-C-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTAG-CCCCCTG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCGTC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCA------CC-CC-AA---CC--C--CAA-TGCCTGGCTACCAG--CTGGA-CGTT-GCG-GGA---GCT-----GGGG-CGGAAATTGGCCTCCCGT----CC---ACA-C---G---ACCGTGTGCGGTTGG-CCC------A--AAAAA-ATGAGCTCTTGACGATGGACGTCACCACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTATAGCGAGCTCTGA-TC-GT-GACCC---T-GTG-CA--CC----TT-C---TTA-----TTA-G-GGG-ATGGTGCTT-TGACC Ilex_argentina_Gbk C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ACATGC---TG-GGGGGTT-TGAGAA--GGGGTGCGTGAG-C--CCCC-CCAA-CACACT--CCCCC--CA------C-C-TCGGGAT-TTCGGC-TTGCGTC----C-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC-AAAACGAA-C--CCCCGGCGCTATC-TGCGCCAAGGAACCACAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCC---CC-CCTCC--ACC--C--CAA-TGCCCACCT--A-G--CTGGA-TATT-GTG-GGAGTCGTC-----GGCG-CGGAAATTGGTCTCCCGT---C-C--G-CA-C---G---ATCGGGAGCGGTTGG-CCC--------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAA-CC-GT-GACCC---T-GCG-CA--CC----TT-C----T------T-C-A-GCG-ATGGTGCTT-CGACC Ilex_beecheyi C--AAAGTAGAC-CCGGCGAACT-CGTTA----AAAT-ATATGG---CT-GGGGGTC-TGGGAA--GGGGTGCGCGAG----CCCC-CCAA-CACACT---CCCC--CAGCCC--G-C-TCGGGA--TTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACTTGGCC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCACAAC-TGAA--GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCAAC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----------C------CC--C--CAA-------CCC-------C---A--ATT-GCG-GGA---GTC-G---GGGG-CGGAAATTGGCCTCCCGT-----C----CA-C---G---AACGTGCACGGTTGG-CCC------A--AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGA-CC-GT-GACCC---T-GTG-CA--CC----TC-C----T------T-C-G-CGG-ATGGTGCTC-CGACC Ilex_brasiliensis C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTGG---CCGGGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-CCGA-CACACT-C-CCCC-GCC------C-C--CGGGA--TTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACCCGGCC-TA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAGAAGCTAG-CCCCCCC-GTGT-CCCGTTCGCGGCGTGC-AC--G-GGAGGCAT-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA---CC--C--CAA-TGCCTGGCTACCAG--CCGGA-CGTT-GCG-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT----CC---ACA-C---G---ACCGTGTGCGGTTGG-CCC-----AA--AAAAA-ATGAGCTCTCACCGATGGGCGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTACAGCGAGCTCTGA-TC-GT-GACCC---T-GCG-CA--CC----TT-C---TTA-----TTAGG-GGG-ATGGTGCTT-TGACC Ilex_brevicuspis C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTGG---CC-GGGGGTT-TGAGAA-GGGGGTGCGCGAG---CCCCC-CCGA-CACACT-C-CCCC-GCC------C-C-TCGGGA--TTTGGC-TTACGTT----C-CCCT-ACTGGGG-ACCCGGTC-GA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA---CC--C--CAA-TGCCTGGCTACTAG--CTGGA-CGTT-GCG-GGA---GCT-----GGGG-CGGAAATTGGCCTCCCGT----CC---ACA-C---G---ACCGTGCGCGGTTGG-CCC----AAA--AAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGGCCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGA-TC-GT-GACCC---T-GTG-CA--CC----TC-C---TTA-----TTA-G-GGT-ATGGTGCTT-CGACC Ilex_buergeri CA-AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATGC---CT-GGGGGTT-TGAAAA--GGGGTGCGCGAG----CCCC-CCAA-CACACT---CCCC--CAGCCC--C-C-TCGGGA--TTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACC-AA---CC--C--CAA-TG----CCC--A-G--CTGGA-TATT-GCG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT-----C----CA-T---G---AACGCGCGCGGTTGG-CCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGA-CC-GC-GACCC---T-GTG-CA-CCC----TTCC----T------T-C-A-CGG-ATGGTGCTC-CGACC Ilex_canariensis C--AAAGTAGAC-CCGGCGAACC-CGTT-----AAA--ACATGC---CT-GGGGGTT-TGAGAA--GGGGCGCGCAAG----CCCC-CCGA-CGCACT-C-CCCC-ACC------C-C-CCGGGG-GTTTGGC-TTGGGTT----C-CCCT-AGCGGGG-ACCCGGTC-AG-G-CTCCCGGC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-AGAAG-AGCTGG-CCCCCCG-GTGTCCCCGTTCGCGGTGTGC-AC-TG-GGAGGCAT-TTGCGTC-TTTCG----AATC---TGAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGCTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCAAGGGCACGTCTGCCTGGGCGTCACCCATCACGTCG---C--CC-CC-AA---CC--C--CAA-TGCCTGGCT--A-G--CCGGG-TATC-GCG-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT-----C----CA-C-AGG---ACCGTGCGCGGTTGG-CCCAA---AA--AACAA-ATGAGTTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGGGGCA-CCGAGTCTATGGCGAGCTCCGA-CC-GG-GACCC---T-GCG-CA--CA----CT-C----CT-----CCG-G-GGG-ATGGTGCTC-CGACC Ilex_cassine C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ACATGC---TG-GGGGGTT-TGAGAA--GGGGTGCGTGAG-C--CCCC-CCAA-CACACT--CCCCC--CA------C-C-TCGGGAT-TTCGGC-TTGCGTC----C-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC-AAAACGAA-C--CCCCGGCGCTATC-TGCGCCAAGGAACCACAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCATCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCC---CC-CCTCC--ACC--C--CAA-TGCCCACCT--A-G--CTGGA-TATT-GTG-GGAGTCGTC-----GGGG-CGGAAATTGGCCTCCCGT---C-C--G-CA-C---G---ATCGTGAGCGGTTGG-CCC--------AAAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAA-CC-GT-GACCC---T-GCG-CA--CC----CT-C----T------T-C-A-GCG-ATGGTGCTT-CGACC Ilex_collina C--AAAGTAGA--CCCGCGAACT-TGTT-----AAA--ATATGC---TG-GGGGTTTGAGGTTAG-GGGGTGCGCGAG-C--CCCC-CCAA-CACACT---CCCC--CA------C-C-TCGGGA--TTTGGCTTTGTGTT----C-CCCT-AGTGGGG-ACTCGGTC-AG-G-CTCCCGACA--AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAATCATAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC-AC--G-GGGGGCAT-TTGCATC-TTTTG----AATC---TAAAA{CT}GACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA---CC--C--CAA-TG----CCT--A-G--TTGGA-TATT-GTG-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT-----C----CA-T---G---ACCGTGAGCGGTTGG-CCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAA-TC-GT-GACCC---T-G{CT}G-CA--CC----TT-C----T------T-C-A-ACG-ACGGTGCTT-CGACC Ilex_cornuta C--AAAGTAGAC-CCGGCGAACT-TGTT---A-AAA--ATATGC---CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-CCAA-CACACT---CCCC--CAGCCC--C-C-TCGGGA--TTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACGCGGCC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-GTGT-CCCGTTCGCGGCGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG------CCACC-AA---CC--C--CAA-TG----CCC--A-G--CCGGA-TATT-GCG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCC?GT-----T----?A-C---G---AACGTGCGCGGTTGG-CCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGA-CC-GC-GACCC---T-GTG-CA-CCC----TT-C----T------T-C-A-CGG-ATGGTGCTC-CGACC Ilex_crenata C--AAAGTA{AC}A--CCGGCGAACT-TGTT-----AAA--ACATGC---CG-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C--CCCC-CCAAT-AAGGTT--CCCC--CA------C-C-TCCGGA--TTTGGC-TTGTTTT---CC-CCCT-GGCGGGGAACTCGGCC-CA-G-CTCCCGACA--AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCATAAC-CGAAG-AGCTGG-TCTCCCG-GTGC-CCCGTCCGCGGTGTGC-AC--G-GGAGGCGT-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AACC-CC--C--CAACGG----CCT--A-G--CCGGA-TATT-GCG-GGA---GTT-----GGGG-CGGAGATTGGCCTCCCGT-C---CG---CG-C---G---ACCGTGAGCGGTTGG-CCC---------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TCGCATCACGTCGTGGGGCG-CCTAGTCTGTAGCGAGCTCCGACCCTGT-GCACC---T-GAT-T---CG----CT-C----T------A-G-G-GCG-A-GGTGCTT-CGACC Ilex_decidua C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ATATGC---TG-GGGGTTTGAGAAAAG-GGGGTGCGCGAG-C--CCCC-CCAA-CACACT---CCCC--CA------C-C-TCGGGA--TTTGGCTTTGTGTT----C-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGACA--AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC-AC--G-GGGGGTAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA---CC--C--CAA-TG----CCT--A-G--CTGGA-TATC-GTG-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT-----T----CG-C---G---ACCGTGAGCGGTTGG-CCC---------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAA-CC-GT-GACCC---T-GTG-CA--CC----TT-C----T------T-C-A-GAG-ACGGTGCTT-CGACC Ilex_dimorphophylla C--AAAGTAGAC-CCGGCGAACT-TGTT---A-AAA--ATATGC---CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-CCAA-CGCACT---CCCC--CAGCCC--C-C-TCGGGG--TTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACGCGGCC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-GTGT-CCCGTTCGCGGCGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG------CCACC-AA---CC--C--CAA-TG----CCC--A-G--CCGGA-TATT-GCG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT-----T----CA-C---G---AACGTGCGCGGTTGG-CCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGA-CC-GC-GACCC---T-GTG-CA-CCC----TT-C----T------T-G-A-CGG-ATGGTGCTC-CGACC Ilex_dumosa_dumosa C--AAAGTAGA--CCGGCGAACTCTGTT-----AAA--ACATGC--TGG-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C--CCCC-CCAATCACGCTC--CCCC--CA------C-C-TCGGGA--TCTGG{CT}-TTGTTTT---CC-CCCT-GGCGGGGAACTCGGCG-GA-G-CTCCCGACA--AACGAA----CCCCGGCGCTGTA-TGCGCCAAGGACCCATAAC-CGAA{AG}-AGCTGG-TCTCCCG-TTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-CTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AACC-CCAAA--AAACGT----CCT--A-G--GTGGA-CATT-GTG-GGA---GTT-----GGGG-CGGAGATTGGCCTCCCGT-C---CA---CA-C---GT--CCCGTGAGCGGTTGG-CCC-------A-AAAAA-ACGAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTCTTTGCATCATGTCGTGAGGCG-CCTAGT?TGCAACGA?CTCCGACCCTGT-GCACC---TAGTTGTC--CG----CT-G----T------A-G-G-GCG-ACGGTGCTT-CGACC Ilex_dumosa_guaranina C--AAAGTAGA--CCGGCGAACTCTGTT-----AAA--ACATGC--TGG-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C--CCCC-CCAATCACGCTC--CCCC--CA------C-C-TCGGGA--TCTGGC-TGGTTTT---CC-CCCT-GGCGGGGAACTCGGCC-GA-G-CTCCCGACA--AACGAA----CCCCGGCGCTGTA-TGCGCCAAGGACCCATAAC-CGAAG-AGCTGG-TCTCCCG-TTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-CTGCGTC-TTTTG----AATC---CAAAAC{CG}ACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTT?AACGCAAGTTGCGCCCAAAGCCAT?AGGCCAAGGGCACGTCT?CCTGGGCGTCACGCATCACGTCG------CC-CC-AACC-CCAAA--AAACGT----CCT--A-G--GTGGA-CATT-GTG-GGA---GTT-----GGGG-CGGAGATTGGCCTCCCGT-C---CA---CA-C---GT--CCCGTGAGCGGTTGG-CCC-------A-AAAAA-A?GAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTCTTCGCATCATGTCGTGAGGCG-CCTAGTCTGCAACGATCTCCGACCCTGT-GCACC---TAGTTGTC--CG----CT-G----T------A-G-G-GCG-ACGGTGCTT-CGACC Ilex_glabra C-AAAAGTAGAC-CCGGCGAACC-TGTT----AAAA--ATATGC---AT-GGGGGTC-TGAGAA--AGGGTGCGCGAG----CCCC-CCGA-CACATT---CCCC--CA------C-C-CCGGGA--TTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC--AAACGAA---CCCCCGGCGCTATC-TGCGCCAAGGAACCTTAAC-{CT}GAAG-AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG--A-AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--C---CC-CC-AA--CCC--C--CAA-TGCCTGGCT--A-G--CTGGG-TATT-GCG-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT-----C----CA-C---G---ACCGTGCGCGGTTGG-CCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCAGA-CC-GG-GACCCT-GT-GTG-CA--CA----TT-C----T------T-T-AGGGG-ATGGTGCTT-CGACC Ilex_integerrima C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTGG---CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-CCGA-CACACT-C-CCCC-GCC------C-C--CGGGA--TTCGGC-TTGCGTT----A-CCCT-A{AG}CGGGG-ACCCGGTC-GA-G-CTCCCGTC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAGAAGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC-ACGGG-GGAGGCAT-TTGCGTC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGT??????????GTC{CG}-----CCC-CC-{AGT}A---CC--C--CAA-AGCCCGGTTACCAG--CTGGA-CCTT-GCG-GGA---?CT-----GGGG-CGGAAATTGGCCTCCCGT----CC---ACA-C---G---ACCGTGCGCGGTTGG-CCC----?AA--AAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGA-AGACCTC-TTGCAT?TAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGA-TC-GC-GACCC---T-GTG-CA--CC----TT-C--TTTA-----TTA-G-GGG-ACGGTGCTT-TGACC Ilex_integra C--AAAGTAGAC-CCGGCGAACT-TGTTA----AAAT-ATATGC---CT-GGGGGTT-TGAGAA--GGGGTGTGCGAG----CCCC-CCAA-CAAAAT---TCCC--CAGCCC--C-CTTGGGGA--TTTGGC-TTGCGTT----C-CCCT-AGGGGGG-ATTGGGCC-AA-G-TTCCGGAA---AACGAA----CCCGGGCGCTTTT-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATTT-CCCGTCCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----------C------CC--C--CAA-------CCC-------C---A--ATT-GCG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT-----C----CA-C---G---AACGTGCGCGGTTGGCCCA------A--AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGA-CC-GC-GACCC---T-GTG-CA--CC----TT-C----T------T-C-A-CGG-ATGGTGCTT-CGACC Ilex_kiusiana C--AAAGTAGAC-CC{CT}GCGAACT-{CT}GTTT----AAAT-ATGT-C---CT-GGGGGTC-AGACAA--GGGGTGCGCGAG--C-CCCC-CCAA-CACACT---CCCC--CAGGCC--C-C-TCGGGA--TTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----------C------CC--C--CAA-------CCC-------C---A--ATT-GCG-GGA---TT{CG}-A---GGGG-CGGAAATTGGCCTCCCGT-----A----CATCT--G---AACGTGCGCGGTTGGCCCC------G--AAAAA-ATG{AG}GTTCTTGAATAAGGACGTCACGACAAGTGTTGGTTGAA-ATACGCC-TTGAGTCATGTCTTGAGGCA-CCTAGTCTGTAACGAGCTCTGA-CC-GC-AACTC---T-GTG-CAG-CCA---TC-C----T------T-C-A-TGG-ATCGTGCTT-CAACC Ilex_latifolia C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATGC---CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-CCAA-CACACT---CCCC--CAGCCC--C-C-TCGGGA--TTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACC-AA---CC--C--CAA-TG----CCC--A-G--CTGGA-TATT-GCG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT-----C----CA-T---G---AACGCGCGCGGTTGG-CCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGC{AG}TCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGA-C{CT}-GC-GACCC---T-GTG-CA-CCC----TTCC----T------T-C-A-CGG-ATGGTGCTT-CGACC Ilex_liukiuensis C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATGC---CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-CCAA-CACACT---CCCC--CAGCGC--C-C-TCGGGT--TTTGGC-TTGCGTT----C-CCCT-AGTGGGG-ACTCGGTC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTATC-TGCG----GGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATGT-CCGGTTCGCGGTGTGC-AG--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTTAATTGCAGAATCCCGTGAACCATCGAGTTTTTGATCGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACC-AA---CC--C--CAA-TG----CGC--G-G--CTGGA-TATT-ACG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT----------TA-T---G---AACGCGCGCGGTTGG-CCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCCTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGA-CT-GC-GACCC---T-GTG-CA-ACC----TTCC----T------T-C-A-CGT-ATGGTGCTC-CGACC Ilex_macropoda C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATGT---TT-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C--CCCC-CCGA-CACACT---CCCC--CA------C-C-TCGGGG--TTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACTCGGTC-AG-G-CTCCCGAC---AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-ATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA---CC--C--CAA-TGCCTACCT--G-G--CTGGA-TATT-GCA-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT-----C----CA-C---G---ACTGTGTGTGGTTGG-CCC-----AA--AAAAA-AAGAATTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-TCGAGTCTTTGGCGAGCTCTGA-CC-GT-GACCC---T-GTG-CA---C----TT-C----T------T-T-C-GGG-ATGGTGCTT-CGACC Ilex_maximowicziana C--AAAGTAGAC-CCGGCGAACT-CGTT-----AAA--ATATGC---CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-CCAA-CACACT---CCCC--CAGCCC--C-C-TCGGGA--TTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCGG-GTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG------CCACC-AA---CC--C--CGA-TG----CCC--A-T--CTGGA-TATT-GCG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT-----T----CA-C---G---AACGTGCGCGGTTGG-CCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTACCGAGCTCTGG-CC-GC-GACCC---T-GCG-CA-CCC----TT-C----T------T-C-A-CGG-ATGGTGCTC-CGACC Ilex_mertensii C--AAAGTAGAC-CCGGCGAACT-CGTTA----AAAT-ATATGG---CT-GGGGGTC-TGGGAA--GGGGTGCGCGAG----CCCC-CCAA-CACACT---CCCC--CAGCCC--G-C-TCGGGA--TTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACTCGGCC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCAAC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACAATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----------C------CC--C--CAA-------CCC-------C---A--ATT-GCG-GGA---GTC-G---GGGG-CGGAAATTGGCCTCCCGT-----C----CA-C---G---AACGTGCACGGTTGG-CCC------A--AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGA-CC-GT-GACCC---T-GTG-CA--CC----TC-C----T------T-C-G-CGG-ATGGTGCTC-CGACC Ilex_micrococca C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATGCT--TT-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-CCGA-CACACT-C-CCCC--CA------C-C-TCGGGA--TTTGGC-TTG{CT}GTT----C-CCCT-AGCGGGG-ACTCGGTC-AG-G-CTCCCGAC---AACGAAC---CCCCGGCGCTATT-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-ACGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-CA---CC--C--CAA-TGCCTAGCT--G-G--CTGGA-TATT-GCG-GGA---GTT---GGGGGG-CGGAAATTGGCCTCCCGT-----C----CA-C---G---ACCGTGCGCGGTTGG-CCC-----AA--AAAAATAAGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCGAGTCTCTAGCGAGCTCTGA-TC-GT-GACCC---T-GCG-CG--CC----TC-C----T------T-C-C-GGG-ATGGCGCTT-TGACC Ilex_microdonta C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTGG---CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-CCGA-CACACT-C-CCCC-GCC------C-C-TCGGGA--TTTGGC-TTGCGTT----C-CCCT-ACCGGGG-ACCCGGTC-GA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTCAAC-TGAAG-AGCTGGCCCCCCCG-ATGC-CCCGTTCGCGGTGTGC-ACGGGAGGAGGCAT-TTGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCATGTCG----C-CC-CC-AA---CC--C--CAA-CGCCTGGCTACTAG--CCGGA-CGTT-GCG-GGA---GCT-----GGGG-CGGAAATTGGCCTCCCGT----CC---ACA-C---G-ACACCGTGCGCGGTTGG-CCC-----AA--AAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGA-TC-GT-GACCC---T-GTG-CA--CC----TC-C---TTA-----TTA-G-GGG-ATGGTGCTT-CGACC Ilex_microdonta_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT-AA--AAA-TATTTGG---CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-CCGA-CACACT-C-CCCC-G-C------C-C-TCGGGA--TTTGGC-TTGCGTT----C-CCCT-ACCGGGG-ACCCGGTC-GA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC-ACGGGAGGAGGCAT-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG----C-CC-CC-AA---CC--C--CAA-CGCCCGGCTACTGG--CTGGA-CGTT-GCG-GGG---GCT-----GGGG-CGGAAATTGGCCTCCCGT----CC---ACA-C---G---ACCGTGCGCGGTTGG-CCC-----AA--AAAAA-ATGAGCTCCTGACGATGGACGTCGCGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGA-TC-GT-GACCC---T-GTG-CA--CC----TC-C---TTA-----TTA-G-GGG-ATGGGGCTT-CGACC Ilex_mitis C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATGC---CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-CCGA-CACACT-C-CCCC-A--------C-C-TCGGGA-TTTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACTCGGCC-AG-G-CTCCCGAA---AACGAA--C-CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGG-CCCCCCG-ACGT-CCCGTTCGCGGTGTGC-AC-GG-GGAGGCAT-GTGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA---CC--C--CAA-TGCCTAGCT--A-G--CTGGA-TATT-GTG-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT-----C----CA-C---G---ACCGTGCGCGGTTGG-CCCAA---AA--AAAAA-AGGAGTTCTTGACGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTA-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGA-CC-GT-GACCC---T-GCG-CA--CC----TT-C----TT-----TAA-C-GGA-ATGGTGCTC-CGACC Ilex_mucronata C--AAAGTAGAC-CCAGCGAACT-TGTT-----AAA--ACATGC---TT-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-CCGA-CACACT---CCCC--CA------C-C-TCGGGA--TTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--C---CC-CA-AC--CCC--C--CAA-TTCCTATGT--A-C--CTGGA-TATT-GTG-GGA---GAT-----GGGG-CGGAAATTGGCCTCCCGT-----A----CA-C---G---ACCGTGAGCGGTTGG-CCC---------AAATA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAA-CC-GT-GACCC-TAT-ATG-CA--CC----TT-C----T------T-C-A-GCG-ATGGTGCTT-CGACC Ilex_mutchagara C--AAAGTAGA--CCGGCGAACT-TGTT-----TAA--ACATGC---GG-GGGGG{GT}T-TGAAAA--AGGGTTCGCGAA-C--CCCC-CCAATCACGCTC--CCCC--CA------C-C-TCGGGA--TCTGGC-TCGTTTT--CCC-CCCT-GGCGGGGAACTCGGCC-AA-G-CTCCCGACA--AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACAATAAC-CGAAG-AGCTGG-TCTCCCG-GTGC-CCCGTCCGCGGCGTGC-AC--G-GGAGGCGC-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA-C-CC--C--CACCGG----CCC--A-G--CCGGA-TACT-GCG-GGA---GTT-----GGGG-CGGAGATTGGCCTCCCGT-C---CG---CG-C---G---ACCGTGAGCGGTTGG-CCC---------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TCGCATCATGTCGTGGGGCG-CCTAGTCCGCAGCGAGCTCCGACCCTGT-GCACC---T-GAT-T---CG----CT-C----T------C-G-G-GCG-ACGGTGCTT-CGACC Ilex_opaca C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ACATGC---TG-GGGGGTT-TGAGAA--GGGGTGCGTGAG-C--CCCC-C{GT}AA-CACACT---CCCC--CA------C-C-TCGGGAT-TTTGGC-TTGCGTC----C-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC--AAACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCG-TTGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCGTCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--C---CC-CC-CC--ACC--C--CAA-TGCCCACCT--A-G--CTGGA-TATT-GCG-GGA---GTC-----GGGG-CGGAAATTGGCCTCCCGT---C-C--G-CA-C---G---ATCGTGAGCGGTTGG-CCC--------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTGGCGAGCTCTAA-CC-GT-GACCC---T-GCG-CA--CC----CT-C----T------T-C-A-GCG-ATGGTGCTT-CGACC Ilex_paraguariensis C--AACGTAGA-CCCGGCGAACT-TGTT-----AAA--ATACGC-T-GG-GGGGGTT-TGGGAA--GGGGTGCGCGAG-C--CCCC-CCGAACACACTC--CCCC--GC------C-C-TCGGGA--CTGGGC-TTGTGTTCC-CCTCCCTAGGGGGGGGACTCGGTC-GA-G-CTCCCGACA--AACGAA----CCCCGGCGCTGTC-TGTGCCAAGGAACCATAAC-CGAAG-AGCTGG-TCTCCCG-ATGT-CCCGTTCGCGGTGCGC-AC--G-GGAGGCAT-TTGCATCTTTTTGA---AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-CA-A-CC--C--CAA-TG----CCC--G-G--AT-G--TTGC-GGG-GGA---GTTG----GGGG-CGGAAATTGGCCTCCCGT-C---CA---CA-{CT}---G---ATCGTGAGCGGTTGG-CCC---------AAAAA-GTGAGTTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCG-CCTAGTCTGTAGCGAGCTCTAA-CC-GTGGACCC---T-GCG-CA--CC-TAATT-CGT--T-CGAGAA-G-A-GCG-ACGGTGCTT-CGACC Ilex_pedunculosa C--AAAGTAGAC-CCGGCGAACT-CGTT--A--AAA-TATATGG---CT-GGGGGTC-TGGGAA--GGGGTGCGCGAG----CCCC-CCAA-CACACT-C-CCCCAGCC------CGC-TCGGGA--TTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACTCGGCC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGC-AA-CG-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCAAGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA---CC--C--CAA-TGCCAAGCT--T-G--CTGGG-TATT-GCG-GGA---GCT-----GGGG-CGGAAATTGGCCTCCCGT-----C----CA-C---G---ACCGTGCGCGGTTGG-CCC------A--TAAAA-ATGAGTTCCTGACGATTGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-A{CT}GCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGA-TC-GT-GACCC---T-TCG-CA--CC----TT-C----TC-----TAA-T-GGG-ATGGTGCTTCCGACC Ilex_percoriacea C--AAAGTAGAC-CCGGCGAACT-CGTTA----AAAT-ATATGG---CT-GGGGGTC-TGGGAA--GGGGTGCGCGAG----CCCC-CCAA-CACACT---CCCC--CAGCCC--G-C-TCGGGA--TTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACTCGGCC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCACAAC-TGAAG-GGCTGG-CCTCTCG-ATGT-CCCGTTCGCGGTGTGCAAC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----------C------CC--C--CAA-------CCC-------C---A--ATT-GCG-GGA---GTC-G---GGGG-CGGAAATTGGCCTCCCGT-----C----CA-C---G---AACGTGCACGGTTGG-CCC------A--AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGA-CC-GT-GACCC---T-GTG-CA--CC----TC-C----T------T-C-G-CGG-ATGGTGCTC-CGACC Ilex_pseudobuxus C--AAAGTAGAC-CCGGCGAACC-TGTT--A--AAA-TATTTGG---CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-CCGA-CACACT-C-CCCC-GCC------C-C-TCGGGA--TTCGGC-TTGCGTT----C-CCCT-GCCGGGG-ACCCGGTC-GA-G-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCG-ATGC-CCCGTTCGCGGTGTGC-ACGGGAGGAGGCAT-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGTTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG----C-CC-CC-AA---CC--C--CAA-CGCCCGGCTA{CT}TGG--CTGGA-CGTT-GCG-GGA---GCT-----GGGG-CGGAAATTGGCCTCCCGT----CC---ACA-C---G---ACCGTGCGCGGTTGG-CCC-----AA--AAAAA-ACGAGCTCCTGACGATGGACGTCCCGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCTGGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGA-TC-GT-GACCC---T-GTG-CA--CC----TC-C---TTA-----TTA-G-GGG-ACGGTGCTT-CGACC Ilex_rotunda C--AAAGTAGAC-CCGGCGAACT-CGTT-----AAA--ATATGC---GT-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C--CCCC-CCGA-CACATT---CCCC--CA----CCC-C-CCGGGA--CTTGGC-CCGGGTT----C-CCCT-TGCGGGG-ACTCGGCC-AAGG-CTCCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-CGAAG-AGCTGG-CCCCCCG-{AG}TGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCGT-ACGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--C---CC-CC-AA--CCC--CGACAA-TGCCCGGCT--G-GCAGCCGGATATT-GCG-GGA---GTT--G--CGGG-CGGAGATTGGCCTCCCGT-----C----CA-C---G---ACCGTGCACGGTTGG-CCC---------AAAAA-GCGAGTTCTTGACGACGGACGTCACGACGAGTGGTGGTTGGA-AGACCTC-TTGCGTCGAGTCGTGAGGCACCCGAGTCTGTAACGAGCTCTGA-CC-GC-GACCC---T-GTG-CG--CC----TT-C----C------T-T-AGGGG-GCGGCGCTC-CGACC Ilex_rugosa C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATGC---CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-CCAA-CACACT---CCCC--CA------C-C-TCGGGA--TTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACTTGGTC-AA-G-CTACCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCTG-TTGT-CCCGTCTGCGGTGTGC-AC--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACC-AA---CC--C--CAA-TG----CCT--A-G--CTGGA-TATT-G{AC}G-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT-----C----CA-C---G---AACGTGCGCGGTTGGCCCA------A--AAAAA-ATGAGTTCTTGACGATGGACGTCACGATAAGTGGTGGTTGAA-AGACCTA-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGA-CC-GT-GACCC---T-GTG-CA--CC----TT-C----T------T-C-A-TGG-ATGGTGCTT-CGACC Ilex_serrata C--AAAATAGAC-C{CT}GGCGAACT-TGTT-----AAA--ATATGC---TT-GGGGGTT-TGAGAA--GGGGTGCGCGAG-T--CCCC-CCGA-CACACT---CCCC--CA-----CC-C-CCGGGA--TTTGGC-TTGCGTC----C-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCTTAAC-CGAAG-AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCGT-ATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACACATCACGTCG------CC-CC-AA---CC--C--CAA-TGCCTAGTT--G-G--TTAGG-CATT-GTT-GGA---GTT--G--GGGG-CGGAAATTGGCCTCCCGT-----C----CA-C---G---ATTGTGCGCGGTTGG-CCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAACGAGCTCTAA-CC-GT-GACCC---T-GTG-CA--CC----TT-C----T------T-T-AGGGG-ATGGTGCTC-CGACC Ilex_taubertiana C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTGG---CC-GGGGGTT-TGAGAA-GGGGGTGCGCGAG---CCCCC-CC{AG}A-CACA{CT}T-C-CCCC-G-C------C-C-TGGGAT--TTGGGT-TTGCGTT----C-CCCT-ACCGGGG-ACCCGGT{CG}-GA-G-CTCCCG{AC}C---ACCAA{AC}----CCCCGGCGCTGTT-TGCGCCAAGGAACCTTAAC-TGAA?-A?CTGGCCCCCCCG-ATGT-CCCGTTC?CGGTGTGC-AC-GG-GGAGGCAT-TTGCGTC-TTTTG----AATT---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGT{CT}TGCCTGGGCGTCACGCATCACGT{CT}G------CC-CC-AA---CC--C--CAA-TGCCCGGCTACTA{AG}--CTGGA-CGTT-{CT}CG-GGA---{AG}CT-----GGGG-CGGAAATTGGCCTCCCGT----CC---ACA-C---G---ACCGTGGGCGGTTGG-CCC--AAAAA--AAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGGCCTC-TTGCGTCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTTTGA-TC-GT-GACCC---T-GTG-CG--CC----TC-C---TTA-----TTA-G-GGG-ACGGTGCTT-CGACC Ilex_theezans C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTGG---CCGGGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-CCGA-CACA{CT}T-C-CCCC-GCC------C-C--CGGGA--TTTGG{CGT}-TTG{CG}GTT----C-CCCT-AGCGGGG-ACCCGGCC-GA-G-CTCCCGAC---AACGAA----CCCCGG{CG}G{CG}TGTC-TGCGCCAAGGAACCTTAAC-TGAA{AG}AAGCT{AG}G-CCCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-TTGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA---CC--C--CAA-TGCCTGGCTACCAG--C{CT}GGA-CGTT-GCG-GGA---GCT-----GGGG-CGGAAATTGGCCTCCCGT----CC---ACA-C---G---{AG}CCGTG{CGT}GCGGTTGG-CCC-----AA--AAAAA-ATGAGCTCTCACCGATGGG{CG}GTCACG{AG}CAAGTGGTGGTTGAA-AGGCCTC-TAGCATCTAGTCGTGAGGC{AT}-CCGAGTTTACAGCGAGCTCTGA-TC-GT-GACCC---T-GTG-CA--CC----TT-C---TTA-----TTAGG-GGG-A{CT}GGTGCTT-TGACC Ilex_theezans_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT--A--AAA-TATTTGG---CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG---CCCCC-CCGA-CACACT-C-CCCC-GCC------C-C--CGGGA--TTCGGC-TTGCGTT----C-CCCT-AGCGGGG-ACCCGGTC-GA-G-CTCCCGTC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAA?-TGAAGAAGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGGGTGC-ACGGG-GGAGGCAT-TTGCGTC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA---CC--C--CAA-TGCCCGGCTACCAG--CTGGA-CGTT-GCG-GGA---GCT-----GGGG-CGGAAATTGGCCTCCCGT----CC---ACA-C---G---ACCGTGCGCGGTTGG-CCC----AAA--AAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGA-AGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAATCTGTAGCGAGCTCTGA-TC-GT-GACCC---T-GTG-CA--CC----TT-C--TTTA-----TTA-G-GGG-ACGGTGCTT-TGACC Ilex_vomitoria C--AAAGTAGA--CCGGCGAACT-TGTT-----AAA--ATATGC---TG-GGGGTTTGAGAAAAG-GGGGTGCGCGAGCC--CCCC-CCAA-CACACT---CCCC--CA------C-C-TCGGGA--TTTGGC-TTGTGTT----C-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGACA--AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG-AGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGCGCGC-AC--G-GGGGGTAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA---CC--C--CAA-TG----CCT--A-G--CTGGA-TATC-GTG-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT-----T----CG-C---G---ACCGTGAGCGGTTGG-CCC---------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAA-CC-GT-GACCC---T-GTG-CA--CC----TT-C----T------T-C-A-GAG-ACGGTGCTT-CGACC Ilex_warburgii C--AAAGTAGAC-CCGGCGAACT-TGTT-----AAA--ATATGC---CT-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-CCAA-CACACT---CCCC--CAGCGC--C-C-TCGGGA--TTTGGC-TTGCGTT----C-CCCT-AGCGGGG-ACTCGGTC-AA-G-CTCCCGAC---AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG-GGCTGG-CCTCCCG-ATGT-CCCGTTCGCGGTGTGC-AG--G-GGAGGCAT-TTGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACC-AA---CC--C--CAA-TG----CCC--G-G--CTGGA-TATT-ACG-GGA---GTT-G---GGGG-CGGAAATTGGCCTCCCGT--C--C-A--TA-T---G---AACGCGCGCGGTTGG-CCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAA-AGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGA-CT-GC-GACCC---T-GTG-CA-CCC----TTCC----T------T-C-A-CGG-ATGGTGCTC-CGACC Ilex_yunnanensis C--AAAGTAGAC-CCAGCGAACT-TGTT-----AAA--ATATGC---CC-GGGGGTT-TGAGAA--GGGGTGCGCGAG----CCCC-CCGA-CACAAT-C-CCCC-ACC------C-C--CGGGA--TCTGGC-TTGCGTT----C-CCAT-AGCGGGG-ACTGGGTC-AG-G-CTCCCGGC---AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAATCTTAAC-TGAAG-AGCTGG-CCCCCCG-ATGT-CCCGTTCGCGGTGTGC-AC--G-GGAGGCAT-ATGCATC-TTTTG---AAATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CC-AA---CC--C--CAA-TGCCTAGCT--A-G--CTGGA-TATT-GCG-GGA---GTT-----GGGG-CGGAAATTGGCCTCCCGT-----C----CA-C---G---ACCGTGCGCGGTTGG-CCC-----AA--AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAA-AGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGA-CC-GT-GACCC---T-GCG-CA--CC----TT-C----TC-----T-A-T-GGG-ATGGTGCTT-CGACC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_211) = N: 1-756; CODONPOSSET CodonPositions (CHARACTERS = ITS_211) = N: 1-756; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2474] TITLE ITS_1041; LINK TAXA = Taxa3; DIMENSIONS NCHAR=755; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Helwingia_chinensis C--AAAATAGA--CCCGCGAACA-TGTT-----CATCCA---T--C----GGGGG-T-TGGCGA--GGGGTGCGCGAG-C----CCCCAAT-CCACCCCCT-CTCCG-G--------C-GAT-GCTGCTTTGAAT-TGTC-G-CCAATGC-GGTGGCATCCATTGTT-GT-GTCGACTGAA-C-AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG--AGCCAG-TCTTCGAAAGC-CCCGTACGCGGTGCGC--TT---G-GGAGG{CT}GTT-GGCGTCTTTAAAAT--CATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG---C----CC-C-CA-A--CC--CA--CTCCAC---A-C---AC---G---AAT-TGCGGTGTTGCT---TTG----GGGG-CGGAGATTGGCCTCCCATAC--AA--AA-T---A---AGCTTGCGTGGTTGG-CCT-------------AAAA-GCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTT-AAATATGCC-TCTTG-CGTATTAT----CG--CGAGAC-A-ACCCATCTCCGG-CGTGTGCTCTT-T--G-A---G-A---C--C--C-C------A---ATGACGATGCTT-CGATT Helwingia_japonica C--AAAATAGA--CCCGCGAACA-TGTT-----CATCCA---T--C-----GGGG-T-TGGCGA--GGGGTGCGCGAG-C----CCCCAAT-CCACCCCCT-CTCCG-G--------C-GAT-GCTGCTTTGAAT-TGTC-G-CCAATGC-GGTGGCATCCATTGTT-GT-GTCGACTGAA-C-AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG--AGCCAG-TCTTCGAAAGC-CCCGTACGCGGTGCGC--TT---G-GGAGGCGTT-GGCGTCTTTAAAAT--CATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG---C----CC-C-CA-A--CC--CA--CTCCAC---A-C---AC---G---GAT-TGCGGTGTTGCT---TTG----GGGG-CGGAGATTGGCCTCCCATAC--AA--AA-T---A---AGCTTGCGTGGTTGG-CCT-------------AAAA-GCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTT-AAATATGCC-TCTTG-CGTATTAT----CG--CGAGAC-A-ACCCATCTCCGG-CGTGTGCTCTT-T--G-A---G-A---C--C--C-C------A---ATGACGATGCTT-CGATT Ilex_amelanchier C--AAAGTAGAC-CCGGTGAACT-TGTT---AAAACATG---C--C--C-GGGGGTT-TGAGAA--GGGGTGCGCGAG-----CCCCCCCG-A-CACACT--CCCCC-A--------C-CTC-GGGATTTGGC-T-TGTG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCAAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATT-TGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTTG-----C--CC-C-AA---CCC--C---CAATT-----CCTATAT---A---GTTGGATATTGTGTAA---GTT----GGGGCCGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGAGCGGTTGG-CCC------------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGGGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTG-ACCCTA-T--ATG-CGC-C---TT-C--T-T-----CA---GTGATGGTGCTT-CGACC Ilex_anomala C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG---C--A--T--GGGGTT-TGAGAA--GGGGTGCGCGAG------CCCCCCA-A-CACACT--CCCCC-A--------C-CTC-GGGATTTGGC-T-TGTG-T-TC-ACCT-AGTGGAG-ACTCGGTCAAA-GGT-CCCGAC---AACGAA----CCCCGGCGCTATA-TGTGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATT-TGCATC-TTTTG----AATC-TATAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CA-A--CC--C---CAA-------------T-------GCTGGATATTACGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----A---CA-C---G---GCTGTGCGCGGTTGG-CCC------------AAAAA-TTGAGCTCTGGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCAAGTTGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGTG-ACCCTG-T--GCA-C-C-T---TC-T--T-T-----AG---GGAATGGTGCTT-CGACT Ilex_argentina C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATT---TGGG--C-GGGGGTT-TGAGAA--GGGGTGCGCGAG---C--CCCCCCG-A-CACACT--CTCCC-A-------CC-CAC-GGGATTTGGC-T-TGCG-T-TC-CCCT-AGTGGGG-ACCCGGTC-GA-CCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTAG-CCCCCTGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATT-TGCGTC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCA--------CC-C-CA-A--CC--C---CAATG-----CCTGGCT-ACC--AGCTGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGTGCGGTTGG-CCC---------A--AAAAA-ATGAGCTCTTGACGATGGACGTCACCACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTATAGCGAGCTCTGATCGTG-ACCCTG-T--GCA-C-C-T---TC-T--TAT-----TA-G-GGGATGGTGCTT-TGACC Ilex_argentina_Gbk C--AAAGTAGA--CCGGCGAACT-TGTT---AAAACATG---C--T--G-GGGGGTT-TGAGAA--GGGGTGCGTGAG-C----CCCCCCA-A-CACACT-CCCCCC-A--------C-CTC-GGGATTTCGGCT-TGCG-T-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGACAA-AACGAA-C--CCCCGGCGCTATC-TGCGCCAAGGAACCACAAC-TGAAG--AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCC----CC-CTCC-A--CC--C---CAATG-CCCA-C---CT---A---GCTGGATATTGTGGGAGTCGTC----GGCG-CGGAAATTGGTCTCCCGT-C--CG--CA-C---G---ATCGGGAGCGGTTGG-CCC-----------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAACCGTG-ACCCTG-C--GCA---C-C---TT-C--T-T-----CA---GCGATGGTGCTT-CGACC Ilex_beecheyi C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATATATG-G--C--T-GGGGGTC-TGGGAA--GGGGTGCGCGAG------CCCCCCA-A-CACACT--CCCCC-AGCC----CG-CTC-GGGATTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACTTGGCC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCACAAC-TGAA---GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCA-AC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------------C-----CC--C---CAA-------------C--------CC-CA-ATTGCGGGA---GTCG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGGCCC--A----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTG-ACCCTG-T--GCA-C-C-----TC-C--T-T-----CG---CGGATGGTGCTC-CGACC Ilex_brasiliensis C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATT---TGGC--CGGGGGGTT-TGAGAA--GGGGTGCGCGAG---C--CCCCCCG-A-CACACT--CCCCC-G-------CC-CCC-GGGATTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACCCGGCC-TA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAGA-AGCTAGCCCCCCC-GTGT-CCCGTTCGCGGCGTGC--AC---G-GGAGGCATT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CA-A--CC--C---CAATG-----CCTGGCT-ACC--AGCCGGACGTTGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGTGCGGTTGG-CCC--------AA--AAAAA-ATGAGCTCTCACCGATGGGCGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTACAGCGAGCTCTGATCGTG-ACCCTG-C--GCA-C-C-T---TC-T--TAT-----TAGG-GGGATGGTGCTT-TGACC Ilex_brevicuspis C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATT---TGGC--C-GGGGGTT-TGAGAA-GGGGGTGCGCGAG---C--CCCCCCG-A-CACACT--CCCCC-G------CCC-CTC-GGGATTTGGC-T-TACG-T-TC-CCCT-ACTGGGG-ACCCGGTC-GA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATT-TGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CA-A--CC--C---CAATG-----CCTGGCT-ACT--AGCTGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC-------AAA--AAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGGCCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-ACCCTG-T--GCA-C-C-T---CC-T--TAT-----TA-G-GGTATGGTGCTT-CGACC Ilex_buergeri CA-AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG---C--C--T-GGGGGTT-TGAAAA--GGGGTGCGCGAG------CCCCCCA-A-CACACT--CCCCC-AGCC----CC-CTC-GGGATTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CCAC-CA-A--CC--C---CAATG------C---CC---A---GCTGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-T---G---AACGCGCGCGGTTGG-CCC------------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCG-ACCCTG-T--GCA-C-C-C---TTCC--T-T-----CA---CGGATGGTGCTC-CGACC Ilex_canariensis C--AAAGTAGAC-CCGGCGAACC-CGTT---AAAACATG---C--C--T-GGGGGTT-TGAGAA--GGGGCGCGCAAG---C--CCCCCGACG-CACTCC--CCCAC-C-------CC-CCG-GGGGTTTGGC-T-TGGG-T-TC-CCCT-AGCGGGG-ACCCGGTC-AG-GCT-CCCGGC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-AGAAG--AGCTGG-CCCCCCGGTGTCCCCGTTCGCGGTGTGC--ACT--G-GGAGGCATT-TGCGTC-TTTCG----AATC---TGAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGCTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCAAGGGCACGTCTGCCTGGGCGTCACCCATCACGTCG------C-CC-C-CA-A--CC--C---CAATG-----CCTGGCT---A---GCCGGGTATCGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C-AGG---ACCGTGCGCGGTTGG-CCC--AAA----A--AACAA-ATGAGTTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGGGGCA-CCGAGTCTATGGCGAGCTCCGACCGGG-ACCCTG-C--GCA-C-A-C---TC-C--T-C-----CG-G-GGGATGGTGCTC-CGACC Ilex_cassine C--AAAGTAGA--CCGGCGAACT-TGTT---AAAACATG---C--T--G-GGGGGTT-TGAGAA--GGGGTGCGTGAG-C----CCCCCCA-A-CACACT-CCCCCC-A--------C-CTC-GGGATTTCGGCT-TGCG-T-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGACAA-AACGAA-C--CCCCGGCGCTATC-TGCGCCAAGGAACCACAAC-TGAAG--AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCC----CC-CTCC-A--CC--C---CAATG-CCCA-C---CT---A---GCTGGATATTGTGGGAGTCGTC----GGGG-CGGAAATTGGCCTCCCGT-C--CG--CA-C---G---ATCGTGAGCGGTTGG-CCC-----------AAAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAGCTCTAACCGTG-ACCCTG-C--GCA---C-C---CT-C--T-T-----CA---GCGATGGTGCTT-CGACC Ilex_collina C--AAAGTAGA--CCCGCGAACT-TGTT---AAAATATG---C--T--G-GGGGTTTGAGGTTAG-GGGGTGCGCGAG-C----CCCCCCA-A-CACACT--CCCCC-A--------C-CTC-GGGATTTGGCTT-TGTG-T-TC-CCCT-AGTGGGG-ACTCGGTC-AG-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAATCATAAC-TGAAG--AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC--AC---G-GGGGGCATT-TGCATC-TTTTG----AATC---TAAAA{CT}GACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CA-A--CC--C---CAATG------C---CT---A---GTTGGATATTGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-T---G---ACCGTGAGCGGTTGG-CCC------------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAATCGTG-ACCCTG-{CT}--GCA---C-C---TT-C--T-T-----CA---ACGACGGTGCTT-CGACC Ilex_cornuta C--AAAGTAGAC-CCGGCGAACT-TGTTA--AAAATATG---C--C--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG------CCCCCCA-A-CACACT--CCCCC-AGCC----CC-CTC-GGGATTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACGCGGCC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCGGTGT-CCCGTTCGCGGCGTGC--AC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG--------CCAC-CA-A--CC--C---CAATG------C---CC---A---GCCGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCC?GT----T---?A-C---G---AACGTGCGCGGTTGG-CCC------------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCG-ACCCTG-T--GCA-C-C-C---TT-C--T-T-----CA---CGGATGGTGCTC-CGACC Ilex_crenata C--AAAGTA{AC}A--CCGGCGAACT-TGTT---AAAACATG---C--C--G-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C----CCCCCCA-AT-AAGGTT-CCCCC-A--------C-CTC-CGGATTTGGCTT-GTTT-T-CC-CCCT-GGCGGGGAACTCGGCC-CA-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCATAAC-CGAAG--AGCTGG-TCTCCCGGTGC-CCCGTCCGCGGTGTGC--AC---G-GGAGGCGTT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C----CC-C-AACC--CC--C---CAACG----G-C---CT---A---GCCGGATATTGCGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGT-C--CG--CG-C---G---ACCGTGAGCGGTTGG-CCC------------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TCGCATCACGTCGTGGGGCG-CCTAGTCTGTAGCGAGCTCCGACCCTGTGCACCT-G--ATT---C-G---CT-C--T-A-----GG---GCGA-GGTGCTT-CGACC Ilex_decidua C--AAAGTAGA--CCGGCGAACT-TGTT---AAAATATG---C--T--G-GGGGTTTGAGAAAAG-GGGGTGCGCGAG-C----CCCCCCA-A-CACACT--CCCCC-A--------C-CTC-GGGATTTGGCTT-TGTG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC--AC---G-GGGGGTATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CA-A--CC--C---CAATG------C---CT---A---GCTGGATATCGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----T---CG-C---G---ACCGTGAGCGGTTGG-CCC------------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTG-ACCCTG-T--GCA---C-C---TT-C--T-T-----CA---GAGACGGTGCTT-CGACC Ilex_dimorphophylla C--AAAGTAGAC-CCGGCGAACT-TGTTA--AAAATATG---C--C--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG------CCCCCCA-A-CGCACT--CCCCC-AGCC----CC-CTC-GGGGTTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACGCGGCC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCGGTGT-CCCGTTCGCGGCGTGC--AC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG--------CCAC-CA-A--CC--C---CAATG------C---CC---A---GCCGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----T---CA-C---G---AACGTGCGCGGTTGG-CCC------------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCG-ACCCTG-T--GCA-C-C-C---TT-C--T-T-----GA---CGGATGGTGCTC-CGACC Ilex_dumosa_dumosa C--AAAGTAGA--CCGGCGAACTCTGTT---AAAACATG---C--T-GG-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C----CCCCCCA-ATCACGCTC-CCCCC-A--------C-CTC-GGGATCTGG{CT}TT-GTTT-T-CC-CCCT-GGCGGGGAACTCGGCG-GA-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTGTA-TGCGCCAAGGACCCATAAC-CGAA{AG}--AGCTGG-TCTCCCGTTGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATC-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C----CC-C-AACC--CCAAA---AAACG----T-C---CT---A---GGTGGACATTGTGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGT-C--CA--CA-C---GT--CCCGTGAGCGGTTGG-CCC----------A-AAAAA-ACGAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTTGCATCATGTCGTGAGGCG-CCTAGT?TGCAACGA?CTCCGACCCTGTGCACCTAGTTGTC---C-G---CT-G--T-A-----GG---GCGACGGTGCTT-CGACC Ilex_dumosa_guaranina C--AAAGTAGA--CCGGCGAACTCTGTT---AAAACATG---C--T-GG-GGGGGTT-TGAGAA--GGGGTGCGCGAG-C----CCCCCCA-ATCACGCTC-CCCCC-A--------C-CTC-GGGATCTGGCTG-GTTT-T-CC-CCCT-GGCGGGGAACTCGGCC-GA-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTGTA-TGCGCCAAGGACCCATAAC-CGAAG--AGCTGG-TCTCCCGTTGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATC-TGCGTC-TTTTG----AATC---CAAAAC{CG}ACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTT?AACGCAAGTTGCGCCCAAAGCCAT?AGGCCAAGGGCACGTCT?CCTGGGCGTCACGCATCACGTCG---C----CC-C-AACC--CCAAA---AAACG----T-C---CT---A---GGTGGACATTGTGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGT-C--CA--CA-C---GT--CCCGTGAGCGGTTGG-CCC----------A-AAAAA-A?GAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTCGCATCATGTCGTGAGGCG-CCTAGTCTGCAACGATCTCCGACCCTGTGCACCTAGTTGTC---C-G---CT-G--T-A-----GG---GCGACGGTGCTT-CGACC Ilex_glabra C-AAAAGTAGAC-CCGGCGAACC-TGTT-A-AAAATATG---C--A--T-GGGGGTC-TGAGAA--AGGGTGCGCGAG------CCCCCCG-A-CACATT--CCCCC-A--------C-CCC-GGGATTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC--AAACGAA---CCCCCGGCGCTATC-TGCGCCAAGGAACCTTAAC-{CT}GAAG--AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATT-TGCATC-TTTTG--A-AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----C--CC-C-CA-A-CCC--C---CAATG-----CCTGGCT---A---GCTGGGTATTGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC------------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCAGACCGGG-ACCCTG-T--GTG-CAC-A---TT-C--T-T-----TA--GGGGATGGTGCTT-CGACC Ilex_integerrima C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATT---TGGC--C-GGGGGTT-TGAGAA--GGGGTGCGCGAG---C--CCCCCCG-A-CACACT--CCCCC-G-------CC-CCC-GGGATTCGGC-T-TGCG-T-TA-CCCT-A{AG}CGGGG-ACCCGGTC-GA-GCT-CCCGTC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AAGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC--AC-GGG-GGAGGCATT-TGCGTC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGT??????????GTC{CG}-------CCC-C-C{AGT}-A--CC--C---CAAAG-----CCCGGTT-ACC--AGCTGGACCTTGCGGGA---?CT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC-------?AA--AAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGAAGACCTC-TTGCAT?TAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGCG-ACCCTG-T--GCA-C-CTT---CT-T--TAT-----TA-G-GGGACGGTGCTT-TGACC Ilex_integra C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATATG-C--C--T-GGGGGTT-TGAGAA--GGGGTGTGCGAG------CCCCCCA-A-CAAAAT--TCCCC-AGCC----CC-CTTGGGGATTTGGC-T-TGCG-T-TC-CCCT-AGGGGGG-ATTGGGCC-AA-GTT-CCGGAA---AACGAA----CCCGGGCGCTTTT-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCGATTT-CCCGTCCGCGGTGTGC--AC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------------C-----CC--C---CAA-------------C--------CC-CA-ATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCGCGGTTGGCCCA-A----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGCG-ACCCTG-T--GCA-C-C-----TT-C--T-T-----CA---CGGATGGTGCTT-CGACC Ilex_kiusiana C--AAAGTAGAC-CC{CT}GCGAACT-{CT}GTT---TAAATATGT--C--C--T-GGGGGTC-AGACAA--GGGGTGCGCGAG--C---CCCCCCA-A-CACACT--CCCCC-AGGC----CC-CTC-GGGATTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------------C-----CC--C---CAA-------------C--------CC-CA-ATTGCGGGA---TT{CG}A---GGGG-CGGAAATTGGCCTCCCGT----A---CATCT--G---AACGTGCGCGGTTGGCCCC-G----------AAAAA-ATG{AG}GTTCTTGAATAAGGACGTCACGACAAGTGTTGGTTGAAATACGCC-TTGAGTCATGTCTTGAGGCA-CCTAGTCTGTAACGAGCTCTGACCGCA-ACTCTG-T--GCAGC-C-A---TC-C--T-T-----CA---TGGATCGTGCTT-CAACC Ilex_latifolia C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG---C--C--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG------CCCCCCA-A-CACACT--CCCCC-AGCC----CC-CTC-GGGATTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CCAC-CA-A--CC--C---CAATG------C---CC---A---GCTGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-T---G---AACGCGCGCGGTTGG-CCC------------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGC{AG}TCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGAC{CT}GCG-ACCCTG-T--GCA-C-C-C---TTCC--T-T-----CA---CGGATGGTGCTT-CGACC Ilex_liukiuensis C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG---C--C--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG------CCCCCCA-A-CACACT--CCCCC-AGCG----CC-CTC-GGGTTTTGGC-T-TGCG-T-TC-CCCT-AGTGGGG-ACTCGGTC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTATC-TGCG----GGAACCATAAC-TGAAG--GGCTGG-CCTCCCGATGT-CCGGTTCGCGGTGTGC--AG---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTTAATTGCAGAATCCCGTGAACCATCGAGTTTTTGATCGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CCAC-CA-A--CC--C---CAATG------C---GC---G---GCTGGATATTACGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT--------TA-T---G---AACGCGCGCGGTTGG-CCC------------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGCCTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGCG-ACCCTG-T--GCA-A-C-C---TTCC--T-T-----CA---CGTATGGTGCTC-CGACC Ilex_macropoda C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG---T--T--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG----C-CCCCCCG-A-CACACT---CCCC-C-------AC-CTC-GGGGTTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AG-GCT-CCCGAC---AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATA-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CA-A--CC--C---CAATG-----CCTACCT---G---GCTGGATATTGCAGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACTGTGTGTGGTTGG-CCC----A----A--AAAAA-AAGAATTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-TCGAGTCTTTGGCGAGCTCTGACCGTG-ACCCTG-T--GCA---C-T---TC-T--T-T--------C-GGGATGGTGCTT-CGACC Ilex_maximowicziana C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATATG---C--C--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG------CCCCCCA-A-CACACT--CCCCC-AGCC----CC-CTC-GGGATTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCGGGTGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG--------CCAC-CA-A--CC--C---CGATG------C---CC---A---TCTGGATATTGCGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----T---CA-C---G---AACGTGCGCGGTTGG-CCC------------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTACCGAGCTCTGGCCGCG-ACCCTG-C--GCA-C-C-C---TT-C--T-T-----CA---CGGATGGTGCTC-CGACC Ilex_mertensii C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATATATG-G--C--T-GGGGGTC-TGGGAA--GGGGTGCGCGAG------CCCCCCA-A-CACACT--CCCCC-AGCC----CG-CTC-GGGATTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACTCGGCC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCACAAC-TGAAG--GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCA-AC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACAATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------------C-----CC--C---CAA-------------C--------CC-CA-ATTGCGGGA---GTCG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGGCCC--A----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTG-ACCCTG-T--GCA-C-C-----TC-C--T-T-----CG---CGGATGGTGCTC-CGACC Ilex_micrococca C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG--CT--T--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG------CCCCCCG-A-CACACT--CCCCC-C-------AC-CTC-GGGATTTGGC-T-TG{CT}G-T-TC-CCCT-AGCGGGG-ACTCGGTC-AG-GCT-CCCGAC---AACGAAC---CCCCGGCGCTATT-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATA-CGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CC-A--CC--C---CAATG-----CCTAGCT---G---GCTGGATATTGCGGGA---GTT--GGGGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC----A----A--AAAAATAAGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCGAGTCTCTAGCGAGCTCTGATCGTG-ACCCTG-C--GCG-C-C-T---CC-T--T-C--------C-GGGATGGCGCTT-TGACC Ilex_microdonta C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATT---TGGC--C-GGGGGTT-TGAGAA--GGGGTGCGCGAG---C--CCCCCCG-A-CACACT--CCCCC-G-----C-CC-CTC-GGGATTTGGC-T-TGCG-T-TC-CCCT-ACCGGGG-ACCCGGTC-GA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTCAAC-TGAAG--AGCTGGCCCCCCCGATGC-CCCGTTCGCGGTGTGC--AC-GGGAGGAGGCATT-TGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCATGTCG-------CCC-C-CA-A--CC--C---CAACG-----CCTGGCT-ACT--AGCCGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G-ACACCGTGCGCGGTTGG-CCC--------AA--AAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-ACCCTG-T--GCA-C-C-T---CC-T--TAT-----TA-G-GGGATGGTGCTT-CGACC Ilex_microdonta_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT--AAAAATATT---TGGC--C-GGGGGTT-TGAGAA--GGGGTGCGCGAG---C--CCCCCCG-A-CACACT--CCCCC-G-------CC-CTC-GGGATTTGGC-T-TGCG-T-TC-CCCT-ACCGGGG-ACCCGGTC-GA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC--AC-GGGAGGAGGCATT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-------CCC-C-CA-A--CC--C---CAACG-----CCCGGCT-ACT--GGCTGGACGTTGCGGGG---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC--------AA--AAAAA-ATGAGCTCCTGACGATGGACGTCGCGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-ACCCTG-T--GCA-C-C-T---CC-T--TAT-----TA-G-GGGATGGGGCTT-CGACC Ilex_mitis C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG---C--C--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG---C--CCCCCCG-A-CACACT--CCCCC-A-------CC-TCG-GGATTTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACTCGGCC-AG-GCT-CCCGAA---AACGAA--C-CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGG-CCCCCCGACGT-CCCGTTCGCGGTGTGC--ACG--G-GGAGGCATG-TGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CA-A--CC--C---CAATG-----CCTAGCT---A---GCTGGATATTGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC--AAA----A--AAAAA-AGGAGTTCTTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTA-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGACCGTG-ACCCTG-C--GCA-C-C-T---TC-T--T-T-----AA-C-GGAATGGTGCTC-CGACC Ilex_mucronata C--AAAGTAGAC-CCAGCGAACT-TGTT---AAAACATG---C--T--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG------CCCCCCG-A-CACACT--CCCCC-A--------C-CTC-GGGATTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATT-TGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----C--CC-C-AA-C-CCC--C---CAATT-----CCTATGT---A---CCTGGATATTGTGGGA---GAT----GGGG-CGGAAATTGGCCTCCCGT----A---CA-C---G---ACCGTGAGCGGTTGG-CCC------------AAATA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTG-ACCCTA-T--ATG-CAC-C---TT-C--T-T-----CA---GCGATGGTGCTT-CGACC Ilex_mutchagara C--AAAGTAGA--CCGGCGAACT-TGTT---TAAACATG---C--G--G-GGGGG{GT}T-TGAAAA--AGGGTTCGCGAA-C----CCCCCCA-ATCACGCTC-CCCCC-A--------C-CTC-GGGATCTGGCTC-GTTT-TCCC-CCCT-GGCGGGGAACTCGGCC-AA-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACAATAAC-CGAAG--AGCTGG-TCTCCCGGTGC-CCCGTCCGCGGCGTGC--AC---G-GGAGGCGCT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C----CC-C-AA-C--CC--C---CACCG----G-C---CC---A---GCCGGATACTGCGGGA---GTT----GGGG-CGGAGATTGGCCTCCCGT-C--CG--CG-C---G---ACCGTGAGCGGTTGG-CCC------------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TCGCATCATGTCGTGGGGCG-CCTAGTCCGCAGCGAGCTCCGACCCTGTGCACCT-G--ATT---C-G---CT-C--T-C-----GG---GCGACGGTGCTT-CGACC Ilex_opaca C--AAAGTAGA--CCGGCGAACT-TGTT---AAAACATG---C--T--G-GGGGGTT-TGAGAA--GGGGTGCGTGAG-C----CCCCC{GT}A-A-CACACT--CCCCC-A--------C-CTC-GGGATTTTGGCT-TGCG-T-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCGTTGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCGTCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--CC----CC-C-CC-A--CC--C---CAATG-CCCA-C---CT---A---GCTGGATATTGCGGGA---GTC----GGGG-CGGAAATTGGCCTCCCGT-C--CG--CA-C---G---ATCGTGAGCGGTTGG-CCC-----------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTGGCGAGCTCTAACCGTG-ACCCTG-C--GCA---C-C---CT-C--T-T-----CA---GCGATGGTGCTT-CGACC Ilex_paraguariensis C--AACGTAGA-CCCGGCGAACT-TGTT---AAAATACG---C--TG-G-GGGGGTT-TGGGAA--GGGGTGCGCGAG-C----CCCCCCG-AACACACTC-CCCCG-C--------C-CTC-GGGACTGGGCTTGTGTTCC-CCTCCCTAGGGGGGGGACTCGGTC-GA-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTGTC-TGTGCCAAGGAACCATAAC-CGAAG--AGCTGG-TCTCCCGATGT-CCCGTTCGCGGTGCGC--AC---G-GGAGGCATT-TGCATCTTTTTGA---AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C----CC-C-CA-A--CC--C---CAAT-----G-C---CC---G---GAT-GTTGCGGGGGAG---TTG----GGGG-CGGAAATTGGCCTCCCGT-C--CA--CA-{CT}---G---ATCGTGAGCGGTTGG-CCC------------AAAAA-GTGAGTTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCG-CCTAGTCTGTAGCGAGCTCTAACCGTGGACCCTG-C--GCA---C-CTAATT-CGTT-CGAGAAGA---GCGACGGTGCTT-CGACC Ilex_pedunculosa C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATATA---TGGC--T-GGGGGTC-TGGGAA--GGGGTGCGCGAG------CCCCCCA-A-CACACT--CCCCCAG---C---CCGCTC-GGGATTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACTCGGCC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCACAAC-TGAAG--GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGC-AAC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCAAGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CA-A--CC--C---CAATG-----CCAAGCT---T---GCTGGGTATTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC---------A--TAAAA-ATGAGTTCCTGACGATTGACGTCACGACAAGTGGTGGTTGAAAGACCTC-A{CT}GCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-ACCCTT-C--GCA-C-C-T---TC-T--C-T-----AA-T-GGGATGGTGCTTCCGACC Ilex_percoriacea C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATATATG-G--C--T-GGGGGTC-TGGGAA--GGGGTGCGCGAG------CCCCCCA-A-CACACT--CCCCC-AGCC----CG-CTC-GGGATTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACTCGGCC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCACAAC-TGAAG--GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCA-AC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-------------C-----CC--C---CAA-------------C--------CC-CA-ATTGCGGGA---GTCG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCACGGTTGGCCC--A----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTG-ACCCTG-T--GCA-C-C-----TC-C--T-T-----CG---CGGATGGTGCTC-CGACC Ilex_pseudobuxus C--AAAGTAGAC-CCGGCGAACC-TGTT---AAAATATT---TGGC--C-GGGGGTT-TGAGAA--GGGGTGCGCGAG---C--CCCCCCG-A-CACACT--CCCCC-G-----C-CC-CTC-GGGATTCGGC-T-TGCG-T-TC-CCCT-GCCGGGG-ACCCGGTC-GA-GCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCCGATGC-CCCGTTCGCGGTGTGC--AC-GGGAGGAGGCATT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGTTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-------CCC-C-CA-A--CC--C---CAACG-----CCCGGCT-A{CT}T--GGCTGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC--------AA--AAAAA-ACGAGCTCCTGACGATGGACGTCCCGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTGGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGATCGTG-ACCCTG-T--GCA-C-C-T---CC-T--TAT-----TA-G-GGGACGGTGCTT-CGACC Ilex_rotunda C--AAAGTAGAC-CCGGCGAACT-CGTT---AAAATATG---C--G--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG---C--CCCCCCG-A-CACATT--CCCCC-A----C--CC-CCC-GGGACTTGGC-C-CGGG-T-TC-CCCT-TGCGGGG-ACTCGGCC-AAGGCT-CCCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-CGAAG--AGCTGG-CCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCGTA-CGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG----C---CC-C-CA-AC-CC--C-GACAATG-----CCCGGCTG--GCA-GCCGGATATTGCGGGA---GTT-G--CGGG-CGGAGATTGGCCTCCCGT----C---CA-C---G---ACCGTGCACGGTTGG-CCC------------AAAAA-GCGAGTTCTTGACGACGGACGTCACGACGAGTGGTGGTTGGAAGACCTC-TTGCGTCGAGTCGTGAGGCACCCGAGTCTGTAACGAGCTCTGACCGCG-ACCCTG-T--GCG-C-C-T---TC-C--T-T-----AG---GGGGCGGCGCTC-CGACC Ilex_rugosa C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG---C--C--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG------CCCCCCA-A-CACACT--CCCCC-A--------C-CTC-GGGATTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACTTGGTC-AA-GCT-ACCGAC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCTGTTGT-CCCGTCTGCGGTGTGC--AC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CCAC-CA-A--CC--C---CAATG------C---CT---A---GCTGGATATTG{AC}GGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---AACGTGCGCGGTTGG-CCCAA----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGATAAGTGGTGGTTGAAAGACCTA-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACCGTG-ACCCTG-T--GCA---C-C---TT-C--T-T-----CA---TGGATGGTGCTT-CGACC Ilex_serrata C--AAAATAGAC-C{CT}GGCGAACT-TGTT---AAAATATG---C--T--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG---T--CCCCCCG-A-CACACT--CCCCC-A-------CC-CCC-GGGATTTGGC-T-TGCG-T-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCTTAAC-CGAAG--AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCGTA-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACACATCACGTCG--------CC-C-CA-A--CC--C---CAATG-----CCTAGTT---G---GTTAGGCATTGTTGGA---GTT-G--GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ATTGTGCGCGGTTGG-CCC------------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAACGAGCTCTAACCGTG-ACCCTG-T--GCA-C-C-T---TC-T--T-T-----AG---GGGATGGTGCTC-CGACC Ilex_taubertiana C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATT---TGGC--C-GGGGGTT-TGAGAA-GGGGGTGCGCGAG---C--CCCCCC{AG}-A-CACA{CT}T--CCCCC-G-------CC-CTG-GGATTTGGGT-T-TGCG-T-TC-CCCT-ACCGGGG-ACCCGGT{CG}-GA-GCT-CCCG{AC}C---ACCAA{AC}----CCCCGGCGCTGTT-TGCGCCAAGGAACCTTAAC-TGAA?--A?CTGGCCCCCCCGATGT-CCCGTTC?CGGTGTGC--AC--GG-GGAGGCATT-TGCGTC-TTTTG----AATT---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGT{CT}TGCCTGGGCGTCACGCATCACGT{CT}G--------CC-C-CA-A--CC--C---CAATG-----CCCGGCT-ACT--A{AG}CTGGACGTT{CT}CGGGA---{AG}CT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGGGCGGTTGG-CCC-----AAAAA--AAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGGCCTC-TTGCGTCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTTTGATCGTG-ACCCTG-T--GCG-C-C-T---CC-T--TAT-----TA-G-GGGACGGTGCTT-CGACC Ilex_theezans C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATT---TGGC--CGGGGGGTT-TGAGAA--GGGGTGCGCGAG---C--CCCCCCG-A-CACA{CT}T--CCCCC-G-------CC-CCC-GGGATTTGG{CGT}-T-TG{CG}G-T-TC-CCCT-AGCGGGG-ACCCGGCC-GA-GCT-CCCGAC---AACGAA----CCCCGG{CG}G{CG}TGTC-TGCGCCAAGGAACCTTAAC-TGAA{AG}A-AGCT{AG}GCCCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CA-A--CC--C---CAATG-----CCTGGCT-ACC--AGC{CT}GGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---{AG}CCGTG{CGT}GCGGTTGG-CCC--------AA--AAAAA-ATGAGCTCTCACCGATGGG{CG}GTCACG{AG}CAAGTGGTGGTTGAAAGGCCTC-TAGCATCTAGTCGTGAGGC{AT}-CCGAGTTTACAGCGAGCTCTGATCGTG-ACCCTG-T--GCA-C-C-T---TC-T--TAT-----TAGG-GGGA{CT}GGTGCTT-TGACC Ilex_theezans_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATT---TGGC--C-GGGGGTT-TGAGAA--GGGGTGCGCGAG---C--CCCCCCG-A-CACACT--CCCCC-G-------CC-CCC-GGGATTCGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACCCGGTC-GA-GCT-CCCGTC---AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAA?-TGAAG-AAGCTGGCCCCCCCGATGT-CCCGTTCGCGGGGTGC--AC-GGG-GGAGGCATT-TGCGTC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CA-A--CC--C---CAATG-----CCCGGCT-ACC--AGCTGGACGTTGCGGGA---GCT----GGGG-CGGAAATTGGCCTCCCGT---CC--ACA-C---G---ACCGTGCGCGGTTGG-CCC-------AAA--AAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAATCTGTAGCGAGCTCTGATCGTG-ACCCTG-T--GCA-C-CTT---CT-T--TAT-----TA-G-GGGACGGTGCTT-TGACC Ilex_vomitoria C--AAAGTAGA--CCGGCGAACT-TGTT---AAAATATG---C--T--G-GGGGTTTGAGAAAAG-GGGGTGCGCGAGCC----CCCCCCA-A-CACACT--CCCCC-A--------C-CTC-GGGATTTGGC-T-TGTG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC-A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC--AC---G-GGGGGTATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CA-A--CC--C---CAATG------C---CT---A---GCTGGATATCGTGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----T---CG-C---G---ACCGTGAGCGGTTGG-CCC------------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAGCTCTAACCGTG-ACCCTG-T--GCA---C-C---TT-C--T-T-----CA---GAGACGGTGCTT-CGACC Ilex_warburgii C--AAAGTAGAC-CCGGCGAACT-TGTT---AAAATATG---C--C--T-GGGGGTT-TGAGAA--GGGGTGCGCGAG------CCCCCCA-A-CACACT--CCCCC-AGCG----CC-CTC-GGGATTTGGC-T-TGCG-T-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCT-CCCGAC---AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CCAC-CA-A--CC--C---CAATG------C---CC---G---GCTGGATATTACGGGA---GTTG---GGGG-CGGAAATTGGCCTCCCGT--C-C-A-TA-T---G---AACGCGCGCGGTTGG-CCC------------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAGCTCTGACTGCG-ACCCTG-T--GCA-C-C-C---TTCC--T-T-----CA---CGGATGGTGCTC-CGACC Ilex_yunnanensis C--AAAGTAGAC-CCAGCGAACT-TGTT---AAAATATG---C--C--C-GGGGGTT-TGAGAA--GGGGTGCGCGAG------CCCCCCG-A-CACAAT--CCCCC-A-------CC-CCC-GGGATCTGGC-T-TGCG-T-TC-CCAT-AGCGGGG-ACTGGGTC-AG-GCT-CCCGGC---AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAATCTTAAC-TGAAG--AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATA-TGCATC-TTTTG---AAATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG--------CC-C-CA-A--CC--C---CAATG-----CCTAGCT---A---GCTGGATATTGCGGGA---GTT----GGGG-CGGAAATTGGCCTCCCGT----C---CA-C---G---ACCGTGCGCGGTTGG-CCC----A----A--AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAGCTCTGACCGTG-ACCCTG-C--GCA-C-C-T---TC-T--C-T------A-T-GGGATGGTGCTT-CGACC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_1041) = N: 1-755; CODONPOSSET CodonPositions (CHARACTERS = ITS_1041) = N: 1-755; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2475] TITLE ITS_1021; LINK TAXA = Taxa1; DIMENSIONS NCHAR=734; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Helwingia_chinensis C--AAAATAGA--CCCGCGAACA-TGTT----CAT-CCAT----C-G-G-GGGTTGG-CGAG-G-GGTGCGCGAGCC-C-CCAATCC--ACC-CCCTC--TCC-GGC--------GATG-CTGCTTTGAAT-TGT-CGCCAA-TGCG-GTGGCATCCATTGTTG-TG-TCGACTGAA-C--AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG--AGCCAG-TCTTCGAAAGC-CCCGTACGCGGTGCGC--TT---G-GGAGG{CT}GTT-GGCGTCTTTAAAAT--CATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG------CC-CCC-A---ACC--C--ACTCCACAC---AC---GAATTGCGGTGTTGCT---TTG---GGGG-CGGAGATTGGCCTCCCATA--CA--AAA--T---AAGCTTGCGTGGTTGGCC-----------TAAAA-GCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTT-AAATA-TGC-CT-C-TTGCGT-ATTA-TCG--CGAGAC-A-ACCCAT--CT--CC---GG--C-GTG-TGCTCTTTG-A-G-ACC-CCA---------ATGACGATGCTTCGATT Helwingia_japonica C--AAAATAGA--CCCGCGAACA-TGTT----CAT-CCAT----C---G-GGGTTGG-CGAG-G-GGTGCGCGAGCC-C-CCAATCC--ACC-CCCTC--TCC-GGC--------GATG-CTGCTTTGAAT-TGT-CGCCAA-TGCG-GTGGCATCCATTGTTG-TG-TCGACTGAA-C--AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG--AGCCAG-TCTTCGAAAGC-CCCGTACGCGGTGCGC--TT---G-GGAGGCGTT-GGCGTCTTTAAAAT--CATCA--TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG------CC-CCC-A---ACC--C--ACTCCACAC---AC---GGATTGCGGTGTTGCT---TTG---GGGG-CGGAGATTGGCCTCCCATA--CA--AAA--T---AAGCTTGCGTGGTTGGCC-----------TAAAA-GCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGGTT-AAATA-TGC-CT-C-TTGCGT-ATTA-TCG--CGAGAC-A-ACCCAT--CT--CC---GG--C-GTG-TGCTCTTTG-A-G-ACC-CCA---------ATGACGATGCTTCGATT Ilex_amelanchier C--AAAGTAGAC-CCGGTGAACT-TGTT----AAA-ACATG---C-C-C-GGGGGTT-TGAGAA-GGGGTGCGCGAG-C-CCCCCCG--A-CACACT---CCC-CCA--------CCTC-GGGA-TTTGGC-TTG-TGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCAAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATT-TGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTTG------CC-CCA-A-C-CCC--CAATTCCTATAT---A----GTTGGATATTGTGTAA---GTT---GGGGCCGGAAATTGGCCTCCCGT---C---CAC--G---ACCGTGAGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGGGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAG--CT--CT---AA-CC-GTG-ACCCTATATGCGC-CTT-CTTC--A-----GTGATGGTGCTTCGACC Ilex_anomala C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG---C-A-T--GGGGTT-TGAGAA-GGGGTGCGCGAG---CCCCCCA--A-CACACT---CCC-CCA--------CCTC-GGGA-TTTGGC-TTG-TGT-TC-ACCT-AGTGGAG-ACTCGGTCAAA-GGTCCCGAC----AACGAA----CCCCGGCGCTATA-TGTGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATT-TGCATC-TTTTG----AATC-TATAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAA--------T--------GCTGGATATTACGGGA---GTTG--GGGG-CGGAAATTGGCCTCCCGT---A---CAC--G---GCTGTGCGCGGTTGGCCC-----------AAAAA-TTGAGCTCTGGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCAAGTTGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GA-CT-GTG-ACCCTGTGCAC-C-TTC-TTTA--G-----GGAATGGTGCTTCGACT Ilex_argentina C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAATATTTG---G-G-C-GGGGGTT-TGAGAA-GGGGTGCGCGAG-C-CCCCCCG--A-CACACT---CTC-CCA-------CCCAC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-AGTGGGG-ACCCGGTC-GA-CCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTAG-CCCCCTGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATT-TGCGTC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCA------CC-CCA-A---CCC--CAATGCCTGGCT-ACC---AGCTGGACGTTGCGGGA---GCT---GGGG-CGGAAATTGGCCTCCCGT--CC--ACAC--G---ACCGTGTGCGGTTGGCCC-------A---AAAAA-ATGAGCTCTTGACGATGGACGTCACCACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTATAGCGAG--CT--CT---GA-TC-GTG-ACCCTGTGCAC-C-TTC-TTAT--TA-G--GGGATGGTGCTTTGACC Ilex_argentina_Gbk C--AAAGTAGA--CCGGCGAACT-TGTT----AAA-ACATG---C-T-G-GGGGGTT-TGAGAA-GGGGTGCGTGAG-C-CCCCCCA--A-CACACT--CCCC-CCA--------CCTC-GGGATTTCGGC-TTG-CGT-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGACAA--AACGAA-C--CCCCGGCGCTATC-TGCGCCAAGGAACCACAAC-TGAAG--AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-CC---CC-CCCTC-CACCC--CAATGCCCACCT---A----GCTGGATATTGTGGGAGTCGTC---GGCG-CGGAAATTGGTCTCCCGTC--CG--CAC--G---ATCGGGAGCGGTTGGCCC----------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAG--CT--CT---AA-CC-GTG-ACCCTGCGCAC-C-T-T-CTTC--A-----GCGATGGTGCTTCGACC Ilex_beecheyi C--AAAGTAGAC-CCGGCGAACT-CGTT----AAA-ATATATG-G-C-T-GGGGGTC-TGGGAA-GGGGTGCGCGAG---CCCCCCA--A-CACACT---CCC-CCAGCCC----GCTC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACTTGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCACAAC-TGAA---GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCA-AC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCCA-A---CCC--CAAT--T---GC--------G--GG--AGT-CGGGG---GCGG--AAAT-TGGCCTCCCGTCCA-C-G-------AAC--G---TGCACGGTTGGCC--C-A-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GA-CC-GTG-ACCCTGTGCA--C-C-TCCTTC--G-----CGGATGGTGCTCCGACC Ilex_brasiliensis C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAATATTTG---G-C-CGGGGGGTT-TGAGAA-GGGGTGCGCGAG-C-CCCCCCG--A-CACACT---CCC-CCG-------CCCCC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACCCGGCC-TA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAGA-AGCTAGCCCCCCC-GTGT-CCCGTTCGCGGCGTGC--AC---G-GGAGGCATT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCTGGCT-ACC---AGCCGGACGTTGCGGGA---GTT---GGGG-CGGAAATTGGCCTCCCGT--CC--ACAC--G---ACCGTGTGCGGTTGGCCC------AA---AAAAA-ATGAGCTCTCACCGATGGGCGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTACAGCGAG--CT--CT---GA-TC-GTG-ACCCTGCGCAC-C-TTC-TTAT--TAGG--GGGATGGTGCTTTGACC Ilex_brevicuspis C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAATATTTG---G-C-CGGGGGTTT-GAGAAG-GGGGTGCGCGAG-C-CCCCCCG--A-CACACT---CCC-CCG------CCCCTC-GGGA-TTTGGC-TTA-CGT-TC-CCCT-ACTGGGG-ACCCGGTC-GA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATT-TGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCTGGCT-ACT---AGCTGGACGTTGCGGGA---GCT---GGGG-CGGAAATTGGCCTCCCGT--CC--ACAC--G---ACCGTGCGCGGTTGGCCC-----AAA---AAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGGCCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--CT---GA-TC-GTG-ACCCTGTGCAC-C-TCC-TTAT--TA-G--GGTATGGTGCTTCGACC Ilex_buergeri CA-AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG---C-C-T-GGGGGTT-TGAAAA-GGGGTGCGCGAG---CCCCCCA--A-CACACT---CCC-CCAGCCC----CCTC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACCA-A---CCC--CAATG-C---CC---A----GCTGGATATTGCGGGA---GTTG--GGGG-CGGAAATTGGCCTCCCGT---C---CAT--G---AACGCGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GA-CC-GCG-ACCCTGTGCAC-C-CTTCCTTC--A-----CGGATGGTGCTCCGACC Ilex_canariensis C--AAAGTAGAC-CCGGCGAACC-CGTT----AAA-ACATG---C-C-T-GGGGGTT-TGAGAA-GGGGCGCGCAAG-C-CCCCCGA-CG-CACTCC---CCC-ACC-------CCCCG-GGGG-TTTGGC-TTG-GGT-TC-CCCT-AGCGGGG-ACCCGGTC-AG-GCTCCCGGC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-AGAAG--AGCTGG-CCCCCCGGTGTCCCCGTTCGCGGTGTGC--ACT--G-GGAGGCATT-TGCGTC-TTTCG----AATC---TGAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGCTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCAAGGGCACGTCTGCCTGGGCGTCACCCATCACGTCG----C-CC-CCA-A---CCC--CAATGCCTGGCT---A----GCCGGGTATCGCGGGA---GTT---GGGG-CGGAAATTGGCCTCCCGT---C---CACAGG---ACCGTGCGCGGTTGGCCCAAA----A---AACAA-ATGAGTTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGGGGCA-CCGAGTCTATGGCGAG--CT--CC---GA-CC-GGG-ACCCTGCGCAC-A-CTC-CTCC--GG----GGGATGGTGCTCCGACC Ilex_cassine C--AAAGTAGA--CCGGCGAACT-TGTT----AAA-ACATG---C-T-G-GGGGGTT-TGAGAA-GGGGTGCGTGAG-C-CCCCCCA--A-CACACT--CCCC-CCA--------CCTC-GGGATTTCGGC-TTG-CGT-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGACAA--AACGAA-C--CCCCGGCGCTATC-TGCGCCAAGGAACCACAAC-TGAAG--AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-CC---CC-CCCTC-CACCC--CAATGCCCACCT---A----GCTGGATATTGTGGGAGTCGTC---GGGG-CGGAAATTGGCCTCCCGTC--CG--CAC--G---ATCGTGAGCGGTTGGCCC----------AAAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAG--CT--CT---AA-CC-GTG-ACCCTGCGCAC-C-C-T-CTTC--A-----GCGATGGTGCTTCGACC Ilex_collina C--AAAGTAGA--CCCGCGAACT-TGTT----AAA-ATATG---C-T-G-GGGGTTTGAGGTTAGGGGGTGCGCGAG-C-CCCCCCA--A-CACACT---CCC-CCA--------CCTC-GGGA-TTTGGCTTTG-TGT-TC-CCCT-AGTGGGG-ACTCGGTC-AG-GCTCCCGAC--A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAATCATAAC-TGAAG--AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC--AC---G-GGGGGCATT-TGCATC-TTTTG----AATC---TAAAA{CT}GACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATG-C---CT---A----GTTGGATATTGTGGGA---GTT---GGGG-CGGAAATTGGCCTCCCGT---C---CAT--G---ACCGTGAGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAG--CT--CT---AA-TC-GTG-ACCCTG{CT}GCA--C-CTT-CTTC--A-----ACGACGGTGCTTCGACC Ilex_cornuta C--AAAGTAGAC-CCGGCGAACT-TGTT--A-AAA-ATATG---C-C-T-GGGGGTT-TGAGAA-GGGGTGCGCGAG---CCCCCCA--A-CACACT---CCC-CCAGCCC----CCTC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACGCGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCGGTGT-CCCGTTCGCGGCGTGC--AC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG------CCACCA-A---CCC--CAATG-C---CC---A----GCCGGATATTGCGGGA---GTTG--GGGG-CGGAAATTGGCCTCC?GT---T---?AC--G---AACGTGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GA-CC-GCG-ACCCTGTGCAC-C-CTT-CTTC--A-----CGGATGGTGCTCCGACC Ilex_crenata C--AAAGTA{AC}A--CCGGCGAACT-TGTT----AAA-ACATG---C-C-G-GGGGGTT-TGAGAA-GGGGTGCGCGAG-C-CCCCCCA--ATAAGGTT---CCC-CCA--------CCTC-CGGATTTGGCT-TGT-TTT-CC-CCCT-GGCGGGGAACTCGGCC-CA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCATAAC-CGAAG--AGCTGG-TCTCCCGGTGC-CCCGTCCGCGGTGTGC--AC---G-GGAGGCGTT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A-C-CCC--C--CAACGGCCT---A----GCCGGATATTGCGGGA---GTT---GGGG-CGGAGATTGGCCTCCCGTC--CG--CGC--G---ACCGTGAGCGGTTGGCCC-----------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TCGCATCACGTCGTGGGGCG-CCTAGTCTGTAGCGAG--CT--CC---GA-CC-CTG-TGCACCTGATT-C-GCT-CTAG--G-----GCGA-GGTGCTTCGACC Ilex_decidua C--AAAGTAGA--CCGGCGAACT-TGTT----AAA-ATATG---C-T-G-GGGGTTTGAGAAAAGGGGGTGCGCGAG-C-CCCCCCA--A-CACACT---CCC-CCA--------CCTC-GGGA-TTTGGCTTTG-TGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC--A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC--AC---G-GGGGGTATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATG-C---CT---A----GCTGGATATCGTGGGA---GTT---GGGG-CGGAAATTGGCCTCCCGT---T---CGC--G---ACCGTGAGCGGTTGGCCC-----------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAG--CT--CT---AA-CC-GTG-ACCCTGTGCA--C-CTT-CTTC--A-----GAGACGGTGCTTCGACC Ilex_dimorphophylla C--AAAGTAGAC-CCGGCGAACT-TGTT--A-AAA-ATATG---C-C-T-GGGGGTT-TGAGAA-GGGGTGCGCGAG---CCCCCCA--A-CGCACT---CCC-CCAGCCC----CCTC-GGGG-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACGCGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCGGTGT-CCCGTTCGCGGCGTGC--AC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG------CCACCA-A---CCC--CAATG-C---CC---A----GCCGGATATTGCGGGA---GTTG--GGGG-CGGAAATTGGCCTCCCGT---T---CAC--G---AACGTGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GA-CC-GCG-ACCCTGTGCAC-C-CTT-CTTG--A-----CGGATGGTGCTCCGACC Ilex_dumosa_dumosa C--AAAGTAGA--CCGGCGAACTCTGTT----AAA-ACATG---C-TGG-GGGGGTT-TGAGAA-GGGGTGCGCGAG-C-CCCCCCA--ATCACGCT-C-CCC-CCA--------CCTC-GGGATCTGG{CT}T-TGT-TTT-CC-CCCT-GGCGGGGAACTCGGCG-GA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTGTA-TGCGCCAAGGACCCATAAC-CGAA{AG}--AGCTGG-TCTCCCGTTGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATC-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A-C-CCC--AAAAAACGTCCT---A----GGTGGACATTGTGGGA---GTT---GGGG-CGGAGATTGGCCTCCCGTC--CA--CAC--GT--CCCGTGAGCGGTTGGCCC----------AAAAAA-ACGAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTTGCATCATGTCGTGAGGCG-CCTAGT?TGCAACGA?--CT--CC---GACCCTGTGCACCTAGTTGTC-C-GCT-GTAG--G-----GCGACGGTGCTTCGACC Ilex_dumosa_guaranina C--AAAGTAGA--CCGGCGAACTCTGTT----AAA-ACATG---C-TGG-GGGGGTT-TGAGAA-GGGGTGCGCGAG-C-CCCCCCA--ATCACGCT-C-CCC-CCA--------CCTC-GGGATCTGGCT-GGT-TTT-CC-CCCT-GGCGGGGAACTCGGCC-GA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTGTA-TGCGCCAAGGACCCATAAC-CGAAG--AGCTGG-TCTCCCGTTGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATC-TGCGTC-TTTTG----AATC---CAAAAC{CG}ACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTT?AACGCAAGTTGCGCCCAAAGCCAT?AGGCCAAGGGCACGTCT?CCTGGGCGTCACGCATCACGTCG------CC-CCA-A-C-CCC--AAAAAACGTCCT---A----GGTGGACATTGTGGGA---GTT---GGGG-CGGAGATTGGCCTCCCGTC--CA--CAC--GT--CCCGTGAGCGGTTGGCCC----------AAAAAA-A?GAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTCGCATCATGTCGTGAGGCG-CCTAGTCTGCAACGAT--CT--CC---GACCCTGTGCACCTAGTTGTC-C-GCT-GTAG--G-----GCGACGGTGCTTCGACC Ilex_glabra C-AAAAGTAGAC-CCGGCGAACC-TGTT---AAAA-ATATG---C-A-T-GGGGGTC-TGAGAA-AGGGTGCGCGAG---CCCCCCG--A-CACATT---CCC-CCA--------CCCC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC---AAACGAA---CCCCCGGCGCTATC-TGCGCCAAGGAACCTTAAC-{CT}GAAG--AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATT-TGCATC-TTTTG--A-AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C--CC-CCA-A-C-CCC--CAATGCCTGGCT---A----GCTGGGTATTGCGGGA---GTT---GGGG-CGGAAATTGGCCTCCCGT---C---CAC--G---ACCGTGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CA---GA-CC-GGG-ACCCTGTGTGCAC-ATT-CTTT--A----GGGGATGGTGCTTCGACC Ilex_integerrima C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAATATTTG---G-C-CGGGGGTTT-GAGAA--GGGGTGCGCGAG-C-CCCCCCG--A-CACACT---CCC-CCG-------CCCCC-GGGA-TTCGGC-TTG-CGT-TA-CCCT-A{AG}CGGGG-ACCCGGTC-GA-GCTCCCGTC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG-AAGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC--AC-GGG-GGAGGCATT-TGCGTC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGT??????????GTC{CG}-----CCC-CC{AGT}-A---CCC--CAAAGCCCGGTT-ACC---AGCTGGACCTTGCGGGA---?CT---GGGG-CGGAAATTGGCCTCCCGT--CC--ACAC--G---ACCGTGCGCGGTTGGCCC-----?AA---AAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGAAGACCTC-TTGCAT?TAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--CT---GA-TC-GCG-ACCCTGTGCAC-CTTCT-TTAT--TA-G--GGGACGGTGCTTTGACC Ilex_integra C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATATG-C-C-T-GGGGGTT-TGAGAA-GGGGTGTGCGAG---CCCCCCA--A-CAAAAT---TCC-CCAGCCC----CCTTGGGGA-TTTGGC-TTG-CGT-TC-CCCT-AGGGGGG-ATTGGGCC-AA-GTTCCGGAA----AACGAA----CCCGGGCGCTTTT-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCGATTT-CCCGTCCGCGGTGTGC--AC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCCA-A---CCC--CAAT--T---GC--------G--GG--AGT-TGGGG---GCGG--AAAT-TGGCCTCCCGTCCA-C-G-------AAC--G---TGCGCGGTTGGCC--CAA-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GA-CC-GCG-ACCCTGTGCA--C-C-TTCTTC--A-----CGGATGGTGCTTCGACC Ilex_kiusiana C--AAAGTAGAC-CC{CT}GCGAACT-{CT}GTT----TAA-ATATGT--C-C-T-GGGGGTC-AGACAA-GGGGTGCGCGAG--CCCCCCCA--A-CACACT---CCC-CCAGGCC----CCTC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCCA-A---CCC--CAAT--T---GC--------G--GG--ATT-{CG}AGGG---GCGG--AAAT-TGGCCTCCCGTACATCTG-------AAC--G---TGCGCGGTTGGCC--CCG-----------AAAAA-ATG{AG}GTTCTTGAATAAGGACGTCACGACAAGTGTTGGTTGAAATACGCC-TTGAGTCATGTCTTGAGGCA-CCTAGTCTGTAACGAG--CT--CT---GA-CC-GCA-ACTCTGTGCAG-C-CATCCTTC--A-----TGGATCGTGCTTCAACC Ilex_latifolia C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG---C-C-T-GGGGGTT-TGAGAA-GGGGTGCGCGAG---CCCCCCA--A-CACACT---CCC-CCAGCCC----CCTC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACCA-A---CCC--CAATG-C---CC---A----GCTGGATATTGCGGGA---GTTG--GGGG-CGGAAATTGGCCTCCCGT---C---CAT--G---AACGCGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGC{AG}TCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GA-C{CT}-GCG-ACCCTGTGCAC-C-CTTCCTTC--A-----CGGATGGTGCTTCGACC Ilex_liukiuensis C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG---C-C-T-GGGGGTT-TGAGAA-GGGGTGCGCGAG---CCCCCCA--A-CACACT---CCC-CCAGCGC----CCTC-GGGT-TTTGGC-TTG-CGT-TC-CCCT-AGTGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATC-TGCG----GGAACCATAAC-TGAAG--GGCTGG-CCTCCCGATGT-CCGGTTCGCGGTGTGC--AG---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTTAATTGCAGAATCCCGTGAACCATCGAGTTTTTGATCGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACCA-A---CCC--CAATG-C---GC---G----GCTGGATATTACGGGA---GTTG--GGGG-CGGAAATTGGCCTCCCGT-------TAT--G---AACGCGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGCCTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GA-CT-GCG-ACCCTGTGCAA-C-CTTCCTTC--A-----CGTATGGTGCTCCGACC Ilex_macropoda C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG---T-T-T-GGGGGTT-TGAGAA-GGGGTGCGCGAG---CCCCCCC--G-ACACAC---TCC-CCC-------ACCTC-GGGG-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACTCGGTC-AG-GCTCCCGAC----AACGAA----CCCCGGCGCTATT-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATA-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCTACCT---G----GCTGGATATTGCAGGA---GTT---GGGG-CGGAAATTGGCCTCCCGT---C---CAC--G---ACTGTGTGTGGTTGGCCC--A----A---AAAAA-AAGAATTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-TCGAGTCTTTGGCGAG--CT--CT---GA-CC-GTG-ACCCTGTGCA--C-TTC-TTT----C----GGGATGGTGCTTCGACC Ilex_maximowicziana C--AAAGTAGAC-CCGGCGAACT-CGTT----AAA-ATATG---C-C-T-GGGGGTT-TGAGAA-GGGGTGCGCGAG---CCCCCCA--A-CACACT---CCC-CCAGCCC----CCTC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCGGGTGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG------CCACCA-A---CCC--CGATG-C---CC---A----TCTGGATATTGCGGGA---GTTG--GGGG-CGGAAATTGGCCTCCCGT---T---CAC--G---AACGTGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTACCGAG--CT--CT---GG-CC-GCG-ACCCTGCGCAC-C-CTT-CTTC--A-----CGGATGGTGCTCCGACC Ilex_mertensii C--AAAGTAGAC-CCGGCGAACT-CGTT----AAA-ATATATG-G-C-T-GGGGGTC-TGGGAA-GGGGTGCGCGAG---CCCCCCA--A-CACACT---CCC-CCAGCCC----GCTC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACTCGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCACAAC-TGAAG--GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCA-AC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACAATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCCA-A---CCC--CAAT--T---GC--------G--GG--AGT-CGGGG---GCGG--AAAT-TGGCCTCCCGTCCA-C-G-------AAC--G---TGCACGGTTGGCC--C-A-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GA-CC-GTG-ACCCTGTGCA--C-C-TCCTTC--G-----CGGATGGTGCTCCGACC Ilex_micrococca C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG--CT-T-T-GGGGGTT-TGAGAA-GGGGTGCGCGAG---CCCCCCG--A-CACACT---CCC-CCC-------ACCTC-GGGA-TTTGGC-TTG-{CT}GT-TC-CCCT-AGCGGGG-ACTCGGTC-AG-GCTCCCGAC----AACGAAC---CCCCGGCGCTATT-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATA-CGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCC-A---CCC--CAATGCCTAGCT---G----GCTGGATATTGCGGGA---GTT-GGGGGG-CGGAAATTGGCCTCCCGT---C---CAC--G---ACCGTGCGCGGTTGGCCC--A----A---AAAAATAAGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCGAGTCTCTAGCGAG--CT--CT---GA-TC-GTG-ACCCTGCGCGC-C-TCC-TTC----C----GGGATGGCGCTTTGACC Ilex_microdonta C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAATATTTG---G-C-CGGGGGTTT-GAGAA--GGGGTGCGCGAG-C-CCCCCCG--A-CACACT---CCC-CCG-----C-CCCTC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-ACCGGGG-ACCCGGTC-GA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTCAAC-TGAAG--AGCTGGCCCCCCCGATGC-CCCGTTCGCGGTGTGC--AC-GGGAGGAGGCATT-TGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCATGTCG-----CCC-CCA-A---CCC--CAACGCCTGGCT-ACT---AGCCGGACGTTGCGGGA---GCT---GGGG-CGGAAATTGGCCTCCCGT--CC--ACAC--G-ACACCGTGCGCGGTTGGCCC------AA---AAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--CT---GA-TC-GTG-ACCCTGTGCAC-C-TCC-TTAT--TA-G--GGGATGGTGCTTCGACC Ilex_microdonta_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTTAA--AAATATTTG---G-C-CGGGGGTTT-GAGAA--GGGGTGCGCGAG-C-CCCCCCG--A-CACACT---CCC-CCG-------CCCTC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-ACCGGGG-ACCCGGTC-GA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCCGATGT-CCCGTTCGCGGTGTGC--AC-GGGAGGAGGCATT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-----CCC-CCA-A---CCC--CAACGCCCGGCT-ACT---GGCTGGACGTTGCGGGG---GCT---GGGG-CGGAAATTGGCCTCCCGT--CC--ACAC--G---ACCGTGCGCGGTTGGCCC------AA---AAAAA-ATGAGCTCCTGACGATGGACGTCGCGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--CT---GA-TC-GTG-ACCCTGTGCAC-C-TCC-TTAT--TA-G--GGGATGGGGCTTCGACC Ilex_mitis C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG---C-C-T-GGGGGTT-TGAGAA-GGGGTGCGCGAG-C-CCCCCCG--A-CACACT---CCC-CCA-------CCTCG-GGAT-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACTCGGCC-AG-GCTCCCGAA----AACGAA--C-CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGG-CCCCCCGACGT-CCCGTTCGCGGTGTGC--ACG--G-GGAGGCATG-TGCGTC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCTAGCT---A----GCTGGATATTGTGGGA---GTT---GGGG-CGGAAATTGGCCTCCCGT---C---CAC--G---ACCGTGCGCGGTTGGCCCAAA----A---AAAAA-AGGAGTTCTTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTA-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--CT---GA-CC-GTG-ACCCTGCGCAC-C-TTC-TTTA--AC----GGAATGGTGCTCCGACC Ilex_mucronata C--AAAGTAGAC-CCAGCGAACT-TGTT----AAA-ACATG---C-T-T-GGGGGTT-TGAGAA-GGGGTGCGCGAG---CCCCCCG--A-CACACT---CCC-CCA--------CCTC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATT-TGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C--CC-CAA-C-C-CCC--CAATTCCTATGT---A----CCTGGATATTGTGGGA---GAT---GGGG-CGGAAATTGGCCTCCCGT---A---CAC--G---ACCGTGAGCGGTTGGCCC-----------AAATA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAG--CT--CT---AA-CC-GTG-ACCCTATATGCAC-CTT-CTTC--A-----GCGATGGTGCTTCGACC Ilex_mutchagara C--AAAGTAGA--CCGGCGAACT-TGTT----TAA-ACATG---C-G-G-GGGGG{GT}T-TGAAAA-AGGGTTCGCGAA-C-CCCCCCA--ATCACGCTC--CCC-CCA--------CCTC-GGGATCTGGCT-CGT-TTTCCC-CCCT-GGCGGGGAACTCGGCC-AA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACAATAAC-CGAAG--AGCTGG-TCTCCCGGTGC-CCCGTCCGCGGCGTGC--AC---G-GGAGGCGCT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--C--CACCGGCCC---A----GCCGGATACTGCGGGA---GTT---GGGG-CGGAGATTGGCCTCCCGTC--CG--CGC--G---ACCGTGAGCGGTTGGCCC-----------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TCGCATCATGTCGTGGGGCG-CCTAGTCCGCAGCGAG--CT--CC---GA-CC-CTG-TGCACCTGATT-C-GCT-CTCG--G-----GCGACGGTGCTTCGACC Ilex_opaca C--AAAGTAGA--CCGGCGAACT-TGTT----AAA-ACATG---C-T-G-GGGGGTT-TGAGAA-GGGGTGCGTGAG-C-CCCCC{GT}A--A-CACACT---CCC-CCA--------CCTC-GGGATTTTGGC-TTG-CGT-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCGTTGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCGTCATGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCC-C-CACCC--CAATGCCCACCT---A----GCTGGATATTGCGGGA---GTC---GGGG-CGGAAATTGGCCTCCCGTC--CG--CAC--G---ATCGTGAGCGGTTGGCCC----------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTGGCGAG--CT--CT---AA-CC-GTG-ACCCTGCGCAC-C-C-T-CTTC--A-----GCGATGGTGCTTCGACC Ilex_paraguariensis C--AACGTAGA-CCCGGCGAACT-TGTT----AAA-ATACG---CTG-G-GGGGGTT-TGGGAA-GGGGTGCGCGAG-C-CCCCCCG--AACACACTC--CCC-CGC--------CCTC-GGGACTGGGCT-TGTGTTCCCCTCCCTAGGGGGGGGACTCGGTC-GA-GCTCCCGAC-A--AACGAA----CCCCGGCGCTGTC-TGTGCCAAGGAACCATAAC-CGAAG--AGCTGG-TCTCCCGATGT-CCCGTTCGCGGTGCGC--AC---G-GGAGGCATT-TGCATCTTTTTGA---AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCC-A---ACC--C--CAAT-GCCC---G----GAT-GTTGCGGGGGAG---TTG---GGGG-CGGAAATTGGCCTCCCGTC--CA--CA{CT}--G---ATCGTGAGCGGTTGGCCC-----------AAAAA-GTGAGTTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCG-CCTAGTCTGTAGCGAGCTCTAACCGTGGA-CC-CTG-CGCACCTAATT-C-GTT-CGAGAAG---A-GCGACGGTGCTTCGACC Ilex_pedunculosa C--AAAGTAGAC-CCGGCGAACT-CGTT-A--AAATATATG---G-C-T-GGGGGTC-TGGGAA-GGGGTGCGCGAG-C-CCCCCAAC-A-CACTCC---CCCAGCC-------CGCTC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACTCGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCACAAC-TGAAG--GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGC-AAC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCAAGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCAAGCT---T----GCTGGGTATTGCGGGA---GCT---GGGG-CGGAAATTGGCCTCCCGT---C---CAC--G---ACCGTGCGCGGTTGGCCC-------A---TAAAA-ATGAGTTCCTGACGATTGACGTCACGACAAGTGGTGGTTGAAAGACCTC-A{CT}GCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--CT---GA-TC-GTG-ACCCTTCGCAC-C-TTC-TCTA--AT-G--GGATGGTGCTTCCGACC Ilex_percoriacea C--AAAGTAGAC-CCGGCGAACT-CGTT----AAA-ATATATG-G-C-T-GGGGGTC-TGGGAA-GGGGTGCGCGAG---CCCCCCA--A-CACACT---CCC-CCAGCCC----GCTC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACTCGGCC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTT-TGCGCCAAGGAACCACAAC-TGAAG--GGCTGG-CCTCTCGATGT-CCCGTTCGCGGTGTGCA-AC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCCCCA-A---CCC--CAAT--T---GC--------G--GG--AGT-CGGGG---GCGG--AAAT-TGGCCTCCCGTCCA-C-G-------AAC--G---TGCACGGTTGGCC--C-A-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GA-CC-GTG-ACCCTGTGCA--C-C-TCCTTC--G-----CGGATGGTGCTCCGACC Ilex_pseudobuxus C--AAAGTAGAC-CCGGCGAACC-TGTT-A--AAATATTTG---G-C-CGGGGGTTT-GAGAA--GGGGTGCGCGAG-C-CCCCCCG--A-CACACT---CCC-CCG-----C-CCCTC-GGGA-TTCGGC-TTG-CGT-TC-CCCT-GCCGGGG-ACCCGGTC-GA-GCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCCGATGC-CCCGTTCGCGGTGTGC--AC-GGGAGGAGGCATT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGTTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG-----CCC-CCA-A---CCC--CAACGCCCGGCT-A{CT}T---GGCTGGACGTTGCGGGA---GCT---GGGG-CGGAAATTGGCCTCCCGT--CC--ACAC--G---ACCGTGCGCGGTTGGCCC------AA---AAAAA-ACGAGCTCCTGACGATGGACGTCCCGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTGGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--CT---GA-TC-GTG-ACCCTGTGCAC-C-TCC-TTAT--TA-G--GGGACGGTGCTTCGACC Ilex_rotunda C--AAAGTAGAC-CCGGCGAACT-CGTT----AAA-ATATG---C-G-T-GGGGGTT-TGAGAA-GGGGTGCGCGAG-C-CCCCCCG--A-CACATT---CCC-CCA----C--CCCCC-GGGA-CTTGGC-CCG-GGT-TC-CCCT-TGCGGGG-ACTCGGCC-AAGGCTCCCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAAC-CGAAG--AGCTGG-CCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCGTA-CGCATC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGC-----CC-CCA-AC--CCCGACAATGCCCGGCTG--G-CA-GCCGGATATTGCGGGA---GTTG--CGGG-CGGAGATTGGCCTCCCGT---C---CAC--G---ACCGTGCACGGTTGGCCC-----------AAAAA-GCGAGTTCTTGACGACGGACGTCACGACGAGTGGTGGTTGGAAGACCTC-TTGCGTCGAGTCGTGAGGCACCCGAGTCTGTAACGAG--CT--CT---GA-CC-GCG-ACCCTGTGCGC-C-TTC-CTTA--G-----GGGGCGGCGCTCCGACC Ilex_rugosa C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG---C-C-T-GGGGGTT-TGAGAA-GGGGTGCGCGAG---CCCCCCA--A-CACACT---CCC-CCA--------CCTC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACTTGGTC-AA-GCTACCGAC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCTGTTGT-CCCGTCTGCGGTGTGC--AC---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACCA-A---CCC--CAATG-C---CT---A----GCTGGATATTG{AC}GGGA---GTTG--GGGG-CGGAAATTGGCCTCCCGT---C---CAC--G---AACGTGCGCGGTTGGCCC--------AA-AAAAA-ATGAGTTCTTGACGATGGACGTCACGATAAGTGGTGGTTGAAAGACCTA-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GA-CC-GTG-ACCCTGTGCA--C-CTT-CTTC--A-----TGGATGGTGCTTCGACC Ilex_serrata C--AAAATAGAC-C{CT}GGCGAACT-TGTT----AAA-ATATG---C-T-T-GGGGGTT-TGAGAA-GGGGTGCGCGAG-T-CCCCCCG--A-CACACT---CCC-CCA-------CCCCC-GGGA-TTTGGC-TTG-CGT-CC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCTTAAC-CGAAG--AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCGTA-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACACATCACGTCG------CC-CCA-A---CCC--CAATGCCTAGTT---G----GTTAGGCATTGTTGGA---GTTG--GGGG-CGGAAATTGGCCTCCCGT---C---CAC--G---ATTGTGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAACGAG--CT--CT---AA-CC-GTG-ACCCTGTGCAC-C-TTC-TTTA--G-----GGGATGGTGCTCCGACC Ilex_taubertiana C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAATATTTG---G-C-CGGGGGTTT-GAGAAG-GGGGTGCGCGAG-C-CCCCCC{AG}--A-CACA{CT}T---CCC-CCG-------CCCTG-GGAT-TTGGGT-TTG-CGT-TC-CCCT-ACCGGGG-ACCCGGT{CG}-GA-GCTCCCG{AC}C----ACCAA{AC}----CCCCGGCGCTGTT-TGCGCCAAGGAACCTTAAC-TGAA?--A?CTGGCCCCCCCGATGT-CCCGTTC?CGGTGTGC--AC--GG-GGAGGCATT-TGCGTC-TTTTG----AATT---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGT{CT}TGCCTGGGCGTCACGCATCACGT{CT}G------CC-CCA-A---CCC--CAATGCCCGGCT-ACT---A{AG}CTGGACGTT{CT}CGGGA---{AG}CT---GGGG-CGGAAATTGGCCTCCCGT--CC--ACAC--G---ACCGTGGGCGGTTGGCCC---AAAAA---AAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGGCCTC-TTGCGTCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--TT---GA-TC-GTG-ACCCTGTGCGC-C-TCC-TTAT--TA-G--GGGACGGTGCTTCGACC Ilex_theezans C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAATATTTG---G-C-CGGGGGGTT-TGAGAA-GGGGTGCGCGAG-C-CCCCCCG--A-CACA{CT}T---CCC-CCG-------CCCCC-GGGA-TTTGG{CGT}-TTG-{CG}GT-TC-CCCT-AGCGGGG-ACCCGGCC-GA-GCTCCCGAC----AACGAA----CCCCGG{CG}G{CG}TGTC-TGCGCCAAGGAACCTTAAC-TGAA{AG}A-AGCT{AG}GCCCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATT-TGCGTC-TTTTG----AATC---CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCTGGCT-ACC---AGC{CT}GGACGTTGCGGGA---GCT---GGGG-CGGAAATTGGCCTCCCGT--CC--ACAC--G---{AG}CCGTG{CGT}GCGGTTGGCCC------AA---AAAAA-ATGAGCTCTCACCGATGGG{CG}GTCACG{AG}CAAGTGGTGGTTGAAAGGCCTC-TAGCATCTAGTCGTGAGGC{AT}-CCGAGTTTACAGCGAG--CT--CT---GA-TC-GTG-ACCCTGTGCAC-C-TTC-TTAT--TAGG--GGGA{CT}GGTGCTTTGACC Ilex_theezans_Gbk C--AAAGTAGAC-CCGGCGAACT-TGTT-A--AAATATTTG---G-C-CGGGGGTTT-GAGAA--GGGGTGCGCGAG-C-CCCCCCG--A-CACACT---CCC-CCG-------CCCCC-GGGA-TTCGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACCCGGTC-GA-GCTCCCGTC----AACGAA----CCCCGGCGCTGTC-TGCGCCAAGGAACCTTAA?-TGAAG-AAGCTGGCCCCCCCGATGT-CCCGTTCGCGGGGTGC--AC-GGG-GGAGGCATT-TGCGTC-TTTCG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCCGGCT-ACC---AGCTGGACGTTGCGGGA---GCT---GGGG-CGGAAATTGGCCTCCCGT--CC--ACAC--G---ACCGTGCGCGGTTGGCCC-----AAA---AAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAATCTGTAGCGAG--CT--CT---GA-TC-GTG-ACCCTGTGCAC-CTTCT-TTAT--TA-G--GGGACGGTGCTTTGACC Ilex_vomitoria C--AAAGTAGA--CCGGCGAACT-TGTT----AAA-ATATG---C-T-G-GGGGTTTGAGAAAAGGGGGTGCGCGAGCC-CCCCCCA--A-CACACT---CCC-CCA--------CCTC-GGGA-TTTGGC-TTG-TGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC--A-AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--AGCTGG-CCTCCCGATGT-CCCGTTCGCGGCGCGC--AC---G-GGGGGTATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATG-C---CT---A----GCTGGATATCGTGGGA---GTT---GGGG-CGGAAATTGGCCTCCCGT---T---CGC--G---ACCGTGAGCGGTTGGCCC-----------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAG--CT--CT---AA-CC-GTG-ACCCTGTGCA--C-CTT-CTTC--A-----GAGACGGTGCTTCGACC Ilex_warburgii C--AAAGTAGAC-CCGGCGAACT-TGTT----AAA-ATATG---C-C-T-GGGGGTT-TGAGAA-GGGGTGCGCGAG---CCCCCCA--A-CACACT---CCC-CCAGCGC----CCTC-GGGA-TTTGGC-TTG-CGT-TC-CCCT-AGCGGGG-ACTCGGTC-AA-GCTCCCGAC----AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAACCATAAC-TGAAG--GGCTGG-CCTCCCGATGT-CCCGTTCGCGGTGTGC--AG---G-GGAGGCATT-TGCATC-TTTTG----AATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CCACCA-A---CCC--CAATG-C---CC---G----GCTGGATATTACGGGA---GTTG--GGGG-CGGAAATTGGCCTCCCGT-C-C-A-TAT--G---AACGCGCGCGGTTGGCCC-----------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GA-CT-GCG-ACCCTGTGCAC-C-CTTCCTTC--A-----CGGATGGTGCTCCGACC Ilex_yunnanensis C--AAAGTAGAC-CCAGCGAACT-TGTT----AAA-ATATG---C-C-C-GGGGGTT-TGAGAA-GGGGTGCGCGAG---CCCCCCG--A-CACAAT---CCC-CCA-------CCCCC-GGGA-TCTGGC-TTG-CGT-TC-CCAT-AGCGGGG-ACTGGGTC-AG-GCTCCCGGC----AACGAA----CCCCGGCGCTATC-TGCGCCAAGGAATCTTAAC-TGAAG--AGCTGG-CCCCCCGATGT-CCCGTTCGCGGTGTGC--AC---G-GGAGGCATA-TGCATC-TTTTG---AAATC---TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG------CC-CCA-A---CCC--CAATGCCTAGCT---A----GCTGGATATTGCGGGA---GTT---GGGG-CGGAAATTGGCCTCCCGT---C---CAC--G---ACCGTGCGCGGTTGGCCC--A----A---AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--CT---GA-CC-GTG-ACCCTGCGCAC-C-TTC-TCT---AT----GGGATGGTGCTTCGACC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_1021) = N: 1-734; CODONPOSSET CodonPositions (CHARACTERS = ITS_1021) = N: 1-734; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2479] TITLE ITS_811; LINK TAXA = Taxa1; DIMENSIONS NCHAR=715; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Helwingia_chinensis C--AAAATAGACCCGCGAACATGTTC----ATC-CATCG---GG-G--GTTGGCGAGGGGTGCGCGAGCCCCC---AATCC-ACC-CCCTCTC-CGGC-G-AT---GCT-GCTTTGAATTGT-CGCC-AAT--G-CGGT-GGCATCC-ATTGTTGT-GTCGACTGAAC---AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG--AGCCAGTCTTCGA-AAGC-CCCGTACGCGGTGCGC--TT--G-GGAGG{CT}GT-TGGCGTC-TTTAA---AATCATCATAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG-----CC-C-C-C-AAC--C-CACTC-CACAC---AC-GAA-T-TG-CGG-T---GT----T-GCT-TTGGGGGCGG-AGATTGG--C--CTC------CC-ATACAAAATAAGCTT---------GCGTG-GTTGGCCTAAAAGCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGG-TTAAATATGCCTCTTGCGTA-TTATCGCGAGACAACC--CA--TC---TCCGGCGTGTGCTCTTT--G-A---GA-CC-CC---A-AT-G-ACGATGC-TTCGATT Helwingia_japonica C--AAAATAGACCCGCGAACATGTTC----ATC-CATC----GG-G--GTTGGCGAGGGGTGCGCGAGCCCCC---AATCC-ACC-CCCTCTC-CGGC-G-AT---GCT-GCTTTGAATTGT-CGCC-AAT--G-CGGT-GGCATCC-ATTGTTGT-GTCGACTGAAC---AACGAA----CCCCGGCGCAAACAAGCGCCAAGGAACCATAACACAAAG--AGCCAGTCTTCGA-AAGC-CCCGTACGCGGTGCGC--TT--G-GGAGGCGT-TGGCGTC-TTTAA---AATCATCATAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATGTCACGTCG-----CC-C-C-C-AAC--C-CACTC-CACAC---AC-GGA-T-TG-CGG-T---GT----T-GCT-TTGGGGGCGG-AGATTGG--C--CTC------CC-ATACAAAATAAGCTT---------GCGTG-GTTGGCCTAAAAGCGAGTGCTCGGGGATGGGTCTCACGATAAGTGGTGG-TTAAATATGCCTCTTGCGTA-TTATCGCGAGACAACC--CA--TC---TCCGGCGTGTGCTCTTT--G-A---GA-CC-CC---A-AT-G-ACGATGC-TTCGATT Ilex_amelanchier C--AAAGTAGACCCGGTGAACTTGTT----AAA-ACATG---CC-C--GGGGGTTTGAGAAGGGGTGCGCGAG--CCCCCC-CGA-CACACT--CCCC---CA----CC-TCGGGATTTGGC-TTGT-GTT--C-CCCT-AGCGGGG-ACTCGGTC-AAGCTCCCAAC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG--AGCTGGCCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCAT-TTGCATC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTTG---C-CCCA-A--CCCC--C-AATTCCTATAT---AGTTGGATATTGTGTAA---GTT---G-GGGCCGGAAATTGGCCTCCCGT--C--CAC--G---ACCGTGAGCGGTTGGCCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGGGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAG--CT--CT---AACCGTGACCCTATATG--CGC---CT-TC-TT-C-A-GT-G-ATGGTGC-TTCGACC Ilex_anomala C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATG---CA-T---GGGGTTTGAGAAGGGGTGCGCGAG---CCCCC-CAA-CACACT---CCC---CC---ACC-TCGGGATTTGGC-TTGT-GTT--C-ACCT-AGTGGAG-ACTCGGTCAAAGGTCCCGAC---AACGAA----CCCCGGCGC-TATATGTGCCAAGGAACCATAAC-TGAAG--AGCTGGCCTCTCG-ATGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCAT-TTGCATC-TTTTG---AATC-T-ATAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CC-C-C-A-ACC--C-CAATG-CTGGA---TA-TTA-C-GG-GAG-T---TG----G-GGG-CGGAAATTGGCCTCCCGT--A--CAC--G---GCTGTGCGCGGTTGGCCC---------AAAAA-TTGAGCTCTGGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCAAGTTGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GACTGTGACCCTGTGCA--C-C---TT-CT-TT---A-GG-GAATGGTGC-TTCGACT Ilex_argentina C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATT---TGGGC-GGGGGTTTGAGAAGGGGTGCGCGAG-C-CCCCC-CGA-CACACT--CTCC---CA---CCC-ACGGGATTTGGC-TTGC-GTT--C-CCCT-AGTGGGG-ACCCGGTC-GACCTCCCGAC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG--AGCTAGCCCCCTG-ATGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCAT-TTGCGTC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCA---C-CCCA-A-CCCCA--ATGCCTGGCTACC---AGCTGGACGTTGCGGGA---GCT---G-GGG-CGGAAATTGGCCTCCCGT-CC-ACAC--G---ACCGTGTGCGGTTGGCCC--------AAAAAA-ATGAGCTCTTGACGATGGACGTCACCACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTATAGCGAG--CT--CT---GATCGTGACCCTGTGCA--C-C--TTC-TTATT-A-G-GG-G-ATGGTGC-TTTGACC Ilex_argentina_Gbk C--AAAGTAGA-CCGGCGAACTTGTT----AAA-ACATG---CT-G--GGGGGTTTGAGAAGGGGTGCGTGAG-C-CCCCC-CAA-CACACT-CCCCC---CA---CCT-CGGGATTTCGGC-TTGC-GTC--C-CCCT-AGCGGGG-ACTCGGTC-AAGCTCCCGACAA-AACGAA-C--CCCCGGCGC-TATCTGCGCCAAGGAACCACAAC-TGAAG--AGCTGGCCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCATCATGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCC-C-CCCCTC-CACCC--C-AATGCCCACCT---AGCTGGATATTGTGGGAGTCGTC---G-GCG-CGGAAATTGGTCTCCCGT-CC-GCAC--G---ATCGGGAGCGGTTGGCCC--------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAG--CT--CT---AACCGTGACCCTGCGCA--C-C---TT-CT-TC-A---GC-G-ATGGTGC-TTCGACC Ilex_beecheyi C--AAAGTAGACCCGGCGAACTCGTT----AAA-ATATATG-GC-T--GGGGGTCTGGGAAGGGGTGCGCGAG---CCCCC-CAA-CACACTC-CCCCAG-CC---CGC-TCGGGATTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACTTGGCC-AAGCTCCCGAC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCACAAC-TGAA---GGCTGGCCTCTCG-ATGT-CCCGTTCGCGGTGTGCA-AC--G-GGAGGCAT-TTGCATC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CC-C-C-C-AAC--C-CCA---ATTGC---GG-GAG-T-CG-GGG-G----C----G-GAA-ATTGGCCT-CCCGTCCA---C---GA--A---CGTGCACGGTTGGCCC-A---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GACCGTGACCCTGTGCA--C-C---TC-CT-TC---G-CG-G-ATGGTGC-TCCGACC Ilex_brasiliensis C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATT---TGGCCGGGGGGTTTGAGAAGGGGTGCGCGAG-C-CCCCC-CGA-CACACT--CCCC---CG---CCC-CCGGGATTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACCCGGCC-TAGCTCCCGAC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AAGCTAGCCCCCCC-GTGT-CCCGTTCGCGGCGTGC--AC--G-GGAGGCAT-TTGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C-CCCA-A-CCCCA--ATGCCTGGCTACC---AGCCGGACGTTGCGGGA---GTT---G-GGG-CGGAAATTGGCCTCCCGT-CC-ACAC--G---ACCGTGTGCGGTTGGCCC-------AAAAAAA-ATGAGCTCTCACCGATGGGCGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTACAGCGAG--CT--CT---GATCGTGACCCTGCGCA--C-C--TTC-TTATT-AGG-GG-G-ATGGTGC-TTTGACC Ilex_brevicuspis C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATT---TGGCCGGGGGTTTGAGAAGGGGGTGCGCGAG-C-CCCCC-CGA-CACACT--CCCC---CG--CCCC-TCGGGATTTGGC-TTAC-GTT--C-CCCT-ACTGGGG-ACCCGGTC-GAGCTCCCGAC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCAT-TTGCGTC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C-CCCA-A-CCCCA--ATGCCTGGCTACT---AGCTGGACGTTGCGGGA---GCT---G-GGG-CGGAAATTGGCCTCCCGT-CC-ACAC--G---ACCGTGCGCGGTTGGCCC------AAAAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGGCCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--CT---GATCGTGACCCTGTGCA--C-C--TCC-TTATT-A-G-GG-T-ATGGTGC-TTCGACC Ilex_buergeri CA-AAAGTAGACCCGGCGAACTTGTT----AAA-ATATG---CC-T--GGGGGTTTGAAAAGGGGTGCGCGAG---CCCCC-CAA-CACACTC-CCCCAG-CC---CCC-TCGGGATTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACTCGGTC-AAGCTCCCGAC---AACGAA----CCCCGGCGC-TATTTGCGCCAAGGAACCATAAC-TGAAG--GGCTGGCCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AG--G-GGAGGCAT-TTGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CCAC-C-A-ACC--C-CAATGCCCAGC---TG-GATAT-TGCGGGAG---TTG---G-GGG-CGGAAATTGGCCTCCCGT--C--CAT--G---AACGCGCGCGGTTGGCCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GACCGCGACCCTGTGCA-CC-C---TTCCT-TC---A-CG-G-ATGGTGC-TCCGACC Ilex_canariensis C--AAAGTAGACCCGGCGAACCCGTT----AAA-ACATG---CC-T--GGGGGTTTGAGAAGGGGCGCGCAAG-C-CCCCCGACG-CACTCC--CCCA---CC---CCC-CGGGGGTTTGGC-TTGG-GTT--C-CCCT-AGCGGGG-ACCCGGTC-AGGCTCCCGGC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-AGAAG--AGCTGGCCCCCCG-GTGTCCCCGTTCGCGGTGTGC-ACT--G-GGAGGCAT-TTGCGTC-TTTCG---AATC----TGAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGCTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCAAGGGCACGTCTGCCTGGGCGTCACCCATCACGTCG----CCCCC-A-A-CCC--C-AATGCCTGGCT---AGCCGGGTATCGCGGGA---GTT---G-GGG-CGGAAATTGGCCTCCCGT--C--CACAGG---ACCGTGCGCGGTTGGCCC-AAA----AAACAA-ATGAGTTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGGGGCA-CCGAGTCTATGGCGAG--CT--CC---GACCGGGACCCTGCGCA--C-A---CT-CC-TCCG-G-GG-G-ATGGTGC-TCCGACC Ilex_cassine C--AAAGTAGA-CCGGCGAACTTGTT----AAA-ACATG---CT-G--GGGGGTTTGAGAAGGGGTGCGTGAG-C-CCCCC-CAA-CACACT-CCCCC---CA---CCT-CGGGATTTCGGC-TTGC-GTC--C-CCCT-AGCGGGG-ACTCGGTC-AAGCTCCCGACAA-AACGAA-C--CCCCGGCGC-TATCTGCGCCAAGGAACCACAAC-TGAAG--AGCTGGCCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCATCATGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCC-C-CCCCTC-CACCC--C-AATGCCCACCT---AGCTGGATATTGTGGGAGTCGTC---G-GGG-CGGAAATTGGCCTCCCGT-CC-GCAC--G---ATCGTGAGCGGTTGGCCC--------AAAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCACGTCGTGAGGCA-CCGAGTCTGTGGCGAG--CT--CT---AACCGTGACCCTGCGCA--C-C---CT-CT-TC-A---GC-G-ATGGTGC-TTCGACC Ilex_collina C--AAAGTAGA-CCCGCGAACTTGTT----AAA-ATATG---CT-G--GGGGTTTGAGGTTAGGGGGTGCGCG---AG-CC-CCC-CCAACAC-ACTCCC-CC---ACC-TCGGGATTTGGCTTTGT-GTT--C-CCCT-AGTGGGG-ACTCGGTC-AGGCTCCCGAC--AAACGAA----CCCCGGCGC-TATCTGCGCCAAGGAATCATAAC-TGAAG--AGCTGGCCTCCCG-ATGT-CCCGTTCGCGGCGCGC--AC--G-GGGGGCAT-TTGCATC-TTTTG---AATC----TAAAA{CT}GACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CC-C-C-A-ACC--C-CAATGCCTAGT---TG-GATAT-TGTGGGAG---TT----G-GGG-CGGAAATTGGCCTCCCGT--C--CAT--G---ACCGTGAGCGGTTGGCCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAG--CT--CT---AATCGTGACCCTG{CT}GCA--C-C---TT-CT-TC---A-AC-G-ACGGTGC-TTCGACC Ilex_cornuta C--AAAGTAGACCCGGCGAACTTGTT-A--AAA-ATATG---CC-T--GGGGGTTTGAGAAGGGGTGCGCGAG---CCCCC-CAA-CACACTC-CCCCAG-CC---CCC-TCGGGATTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACGCGGCC-AAGCTCCCGAC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG--GGCTGGCCTCCCG-GTGT-CCCGTTCGCGGCGTGC--AC--G-GGAGGCAT-TTGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG-----CCAC-C-A-ACC--C-CAATGCCCAGC---CG-GATAT-TGCGGGAG---TTG---G-GGG-CGGAAATTGGCCTCC?GT--T--?AC--G---AACGTGCGCGGTTGGCCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GACCGCGACCCTGTGCA-CC-C---TT-CT-TC---A-CG-G-ATGGTGC-TCCGACC Ilex_crenata C--AAAGTA{AC}A-CCGGCGAACTTGTT----AAA-ACATG---C-CG--GGGGGTTTGAGAAGGGGTGCGCGAG-C-CCCCC-CAAT-AAGGT--TCCC---CC---ACC-TCCGGATTTGGC-TTGT-TTT-CC-CCCT-GGCGGGGAACTCGGCC-CAGCTCCCGAC-A-AACGAA----CCCCGGCGC-TGTTTGCGCCAAGGAACCATAAC-CGAAG--AGCTGGTCTCCCG-GTGC-CCCGTCCGCGGTGTGC--AC--G-GGAGGCGT-TTGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C-CCCA-ACCCCC------CAACG-GCCT---AGCCGGATATTGCGGGA---GTT---G-GGG-CGGAGATTGGCCTCCCGT-CC-GCGC--G---ACCGTGAGCGGTTGGCCC---------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TCGCATCACGTCGTGGGGCG-CCTAGTCTGTAGCGAG--CT--CC---GACCCTGTGCACCTGAT--T-C--GCT-CTAG----G--GCG-A-GGTGC-TTCGACC Ilex_decidua C--AAAGTAGA-CCGGCGAACTTGTT----AAA-ATATG---CT-G--GGGGTTTGAGAAAAGGGGGTGCGCG---AG-CC-CCC-CCAACAC-ACTCCC-CC---ACC-TCGGGATTTGGCTTTGT-GTT--C-CCCT-AGCGGGG-ACTCGGTC-AAGCTCCCGAC--AAACGAA----CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG--AGCTGGCCTCCCG-ATGT-CCCGTTCGCGGCGCGC--AC--G-GGGGGTAT-TTGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CC-C-C-A-ACC--C-CAATGCCTAGC---TG-GATAT-CGTGGGAG---TT----G-GGG-CGGAAATTGGCCTCCCGT--T--CGC--G---ACCGTGAGCGGTTGGCCC---------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAG--CT--CT---AACCGTGACCCTGTGCA--C-C---TT-CT-TC---A-GA-G-ACGGTGC-TTCGACC Ilex_dimorphophylla C--AAAGTAGACCCGGCGAACTTGTT-A--AAA-ATATG---CC-T--GGGGGTTTGAGAAGGGGTGCGCGAG---CCCCC-CAA-CGCACTC-CCCCAG-CC---CCC-TCGGGGTTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACGCGGCC-AAGCTCCCGAC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG--GGCTGGCCTCCCG-GTGT-CCCGTTCGCGGCGTGC--AC--G-GGAGGCAT-TTGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG-----CCAC-C-A-ACC--C-CAATGCCCAGC---CG-GATAT-TGCGGGAG---TTG---G-GGG-CGGAAATTGGCCTCCCGT--T--CAC--G---AACGTGCGCGGTTGGCCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GACCGCGACCCTGTGCA-CC-C---TT-CT-TG---A-CG-G-ATGGTGC-TCCGACC Ilex_dumosa_dumosa C--AAAGTAGACCGGCGAACTCTGTT----AAA-ACATG---CTGG--GGGGGTTTGAGAAGGGGTGCGCGAG-C-CCCCC-CAATCACGCT--CCCC---CC---ACC-TCGGGATCTGG{CT}-TTGT-TTT-CC-CCCT-GGCGGGGAACTCGGCG-GAGCTCCCGAC-A-AACGAA----CCCCGGCGC-TGTATGCGCCAAGGACCCATAAC-CGAA{AG}--AGCTGGTCTCCCG-TTGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCAT-CTGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C-CCCA-A-CCCCA--A-AAAACG-TCCT---AGGTGGACATTGTGGGA---GTT---G-GGG-CGGAGATTGGCCTCCCGT-CC-ACAC--GT--CCCGTGAGCGGTTGGCCC--------AAAAAA-ACGAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTTGCATCATGTCGTGAGGCG-CCTAGT?TGCAACGA?--CT--CC---GACCCTGTGCACCTAGT--T-G--TCC-GCTGT-A-G-GGCG-ACGGTGC-TTCGACC Ilex_dumosa_guaranina C--AAAGTAGACCGGCGAACTCTGTT----AAA-ACATG---CTGG--GGGGGTTTGAGAAGGGGTGCGCGAG-C-CCCCC-CAATCACGCT--CCCC---CC---ACC-TCGGGATCTGGC-TGGT-TTT-CC-CCCT-GGCGGGGAACTCGGCC-GAGCTCCCGAC-A-AACGAA----CCCCGGCGC-TGTATGCGCCAAGGACCCATAAC-CGAAG--AGCTGGTCTCCCG-TTGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCAT-CTGCGTC-TTTTG---AATC----CAAAAC{CG}ACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTT?AACGCAAGTTGCGCCCAAAGCCAT?AGGCCAAGGGCACGTCT?CCTGGGCGTCACGCATCACGTCG---C-CCCA-A-CCCCA--A-AAAACG-TCCT---AGGTGGACATTGTGGGA---GTT---G-GGG-CGGAGATTGGCCTCCCGT-CC-ACAC--GT--CCCGTGAGCGGTTGGCCC--------AAAAAA-A?GAGTTCTTGACGACGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTCGCATCATGTCGTGAGGCG-CCTAGTCTGCAACGAT--CT--CC---GACCCTGTGCACCTAGT--T-G--TCC-GCTGT-A-G-GGCG-ACGGTGC-TTCGACC Ilex_glabra C-AAAAGTAGACCCGGCGAACCTGTT--A-AAA-ATATG---CA-T--GGGGGTCTGAGAAAGGGTGCGCGAG---CCCCC-CGA-CACATT--CCCC---CA----CC-CCGGGATTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACTCGGTC-AAGCTCCCGAC-A-AACGAA---CCCCCGGCGC-TATCTGCGCCAAGGAACCTTAAC-{CT}GAAG--AGCTGGCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCAT-TTGCATC-TTTTG-A-AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C-CCCC-A-ACCCC--C-AATGCCTGGCT---AGCTGGGTATTGCGGGA---GTT---G-GGG-CGGAAATTGGCCTCCCGT--C--CAC--G---ACCGTGCGCGGTTGGCCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CA---GACCGGGACCCTGTGTG--CAC---AT-TC-TT-T-AGGG-G-ATGGTGC-TTCGACC Ilex_integerrima C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATT---TGGCCGGGGGTTTGAGAA-GGGGTGCGCGAG-C-CCCCC-CGA-CACACT--CCCC---CG---CCC-CCGGGATTCGGC-TTGC-GTT--A-CCCT-A{AG}CGGGG-ACCCGGTC-GAGCTCCCGTC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAGAAGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--ACGGG-GGAGGCAT-TTGCGTC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGT??????????GTC{CG}--CC-CCC{AGT}-A-CCCCA--AAGCCCGGTTACC---AGCTGGACCTTGCGGGA---?CT---G-GGG-CGGAAATTGGCCTCCCGT-CC-ACAC--G---ACCGTGCGCGGTTGGCCC------?AAAAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGAAGACCTC-TTGCAT?TAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--CT---GATCGCGACCCTGTGCA--C-C-TTCT-TTATT-A-G-GG-G-ACGGTGC-TTTGACC Ilex_integra C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATATG-CC-T--GGGGGTTTGAGAAGGGGTGTGCGAG---CCCCC-CAA-CAAAATT-CCCCAG-CC---CCCTTGGGGATTTGGC-TTGC-GTT--C-CCCT-AGGGGGG-ATTGGGCC-AAGTTCCGGAA---AACGAA----CCCGGGCGC-TTTTTGCGCCAAGGAACCATAAC-TGAAG--GGCTGGCCTCCCG-ATTT-CCCGTCCGCGGTGTGC--AC--G-GGAGGCAT-TTGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CC-C-C-C-AAC--C-CCA---ATTGC---GG-GAG-T-TG-GGG-G----C----G-GAA-ATTGGCCT-CCCGTCCA---C---GA--A---CGTGCGCGGTTGGCCCAA---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GACCGCGACCCTGTGCA--C-C---TT-CT-TC---A-CG-G-ATGGTGC-TTCGACC Ilex_kiusiana C--AAAGTAGACCC{CT}GCGAACT{CT}GTT----TAA-ATATGT--CC-T--GGGGGTCAGACAAGGGGTGCGCGAGC--CCCCC-CAA-CACACTC-CCCCAG-GC---CCC-TCGGGATTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACTCGGTC-AAGCTCCCGAC---AACGAA----CCCCGGCGC-TATTTGCGCCAAGGAACCATAAC-TGAAG--GGCTGGCCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AG--G-GGAGGCAT-TTGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CC-C-C-C-AAC--C-CCA---ATTGC---GG-GAT-T-{CG}A-GGG-G----C----G-GAA-ATTGGCCT-CCCGTACAT--C--TGA--A---CGTGCGCGGTTGGCCCCG---------AAAAA-ATG{AG}GTTCTTGAATAAGGACGTCACGACAAGTGTTGGTTGAAATACGCC-TTGAGTCATGTCTTGAGGCA-CCTAGTCTGTAACGAG--CT--CT---GACCGCAACTCTGTGCAG-C-CA--TC-CT-TC---A-TG-G-ATCGTGC-TTCAACC Ilex_latifolia C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATG---CC-T--GGGGGTTTGAGAAGGGGTGCGCGAG---CCCCC-CAA-CACACTC-CCCCAG-CC---CCC-TCGGGATTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACTCGGTC-AAGCTCCCGAC---AACGAA----CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG--GGCTGGCCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AG--G-GGAGGCAT-TTGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CCAC-C-A-ACC--C-CAATGCCCAGC---TG-GATAT-TGCGGGAG---TTG---G-GGG-CGGAAATTGGCCTCCCGT--C--CAT--G---AACGCGCGCGGTTGGCCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGC{AG}TCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GAC{CT}GCGACCCTGTGCA-CC-C---TTCCT-TC---A-CG-G-ATGGTGC-TTCGACC Ilex_liukiuensis C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATG---CC-T--GGGGGTTTGAGAAGGGGTGCGCGAG---CCCCC-CAA-CACACTC-CCCCAG-CG---CCC-TCGGGTTTTGGC-TTGC-GTT--C-CCCT-AGTGGGG-ACTCGGTC-AAGCTCCCGAC---AACGAA----CCCCGGCGC-TATCTGCG----GGAACCATAAC-TGAAG--GGCTGGCCTCCCG-ATGT-CCGGTTCGCGGTGTGC--AG--G-GGAGGCAT-TTGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTTAATTGCAGAATCCCGTGAACCATCGAGTTTTTGATCGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CCAC-C-A-ACC--C-CAATGCGCGGC---TG-GATAT-TACGGGAG---TTG---G-GGG-CGGAAATTGGCCTCCCGT-----TAT--G---AACGCGCGCGGTTGGCCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGCCTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GACTGCGACCCTGTGCA-AC-C---TTCCT-TC---A-CG-T-ATGGTGC-TCCGACC Ilex_macropoda C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATG---TT-T--GGGGGTTTGAGAAGGGGTGCGCGAG---CCCCC-CCG-ACACAC--TCCC---CC---ACC-TCGGGGTTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACTCGGTC-AGGCTCCCGAC---AACGAA----CCCCGGCGC-TATTTGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCAT-ATGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CCCC-A-A-CCC--C-AATGCCTACCT---GGCTGGATATTGCAGGA---GTT---G-GGG-CGGAAATTGGCCTCCCGT--C--CAC--G---ACTGTGTGTGGTTGGCCCA-------AAAAAA-AAGAATTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-TCGAGTCTTTGGCGAG--CT--CT---GACCGTGACCCTGTGC---A-C---TT-CT-TT---C-GG-G-ATGGTGC-TTCGACC Ilex_maximowicziana C--AAAGTAGACCCGGCGAACTCGTT----AAA-ATATG---CC-T--GGGGGTTTGAGAAGGGGTGCGCGAG---CCCCC-CAA-CACACTC-CCCCAG-CC---CCC-TCGGGATTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACTCGGTC-AAGCTCCCGAC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG--GGCTGGCCTCCGG-GTGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCAT-TTGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCG-----CCAC-C-A-ACC--C-CGATGCCCATC---TG-GATAT-TGCGGGAG---TTG---G-GGG-CGGAAATTGGCCTCCCGT--T--CAC--G---AACGTGCGCGGTTGGCCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTACCGAG--CT--CT---GGCCGCGACCCTGCGCA-CC-C---TT-CT-TC---A-CG-G-ATGGTGC-TCCGACC Ilex_mertensii C--AAAGTAGACCCGGCGAACTCGTT----AAA-ATATATG-GC-T--GGGGGTCTGGGAAGGGGTGCGCGAG---CCCCC-CAA-CACACTC-CCCCAG-CC---CGC-TCGGGATTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACTCGGCC-AAGCTCCCGAC---AACGAA----CCCCGGCGC-TGTTTGCGCCAAGGAACCACAAC-TGAAG--GGCTGGCCTCTCG-ATGT-CCCGTTCGCGGTGTGCA-AC--G-GGAGGCAT-TTGCATC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACAATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CC-C-C-C-AAC--C-CCA---ATTGC---GG-GAG-T-CG-GGG-G----C----G-GAA-ATTGGCCT-CCCGTCCA---C---GA--A---CGTGCACGGTTGGCCC-A---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GACCGTGACCCTGTGCA--C-C---TC-CT-TC---G-CG-G-ATGGTGC-TCCGACC Ilex_micrococca C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATG--CTT-T--GGGGGTTTGAGAAGGGGTGCGCGAG---CCCCC-CGA-CACACT--CCCC---CC---ACC-TCGGGATTTGGC-TTG{CT}-GTT--C-CCCT-AGCGGGG-ACTCGGTC-AGGCTCCCGAC---AACGAAC---CCCCGGCGC-TATTTGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCAT-ACGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CCCC-C-A-CCC--C-AATGCCTAGCT---GGCTGGATATTGCGGGA---GTTGG-G-GGG-CGGAAATTGGCCTCCCGT--C--CAC--G---ACCGTGCGCGGTTGGCCCA-------AAAAAATAAGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCGAGTCTCTAGCGAG--CT--CT---GATCGTGACCCTGCGCG--C-C---TC-CT-TC---C-GG-G-ATGGCGC-TTTGACC Ilex_microdonta C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATT---TGGCCGGGGGTTTGAGAA-GGGGTGCGCGAG-C-CCCCC-CGA-CACACT--CCCC---CG-C-CCC-TCGGGATTTGGC-TTGC-GTT--C-CCCT-ACCGGGG-ACCCGGTC-GAGCTCCCGAC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTCAAC-TGAAG-AGCTGGCCCCCCCG-ATGC-CCCGTTCGCGGTGTGC--ACGGGAGGAGGCAT-TTGCGTC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCATGTCG--CC-CCCA-A-CCCCA--ACGCCTGGCTACT---AGCCGGACGTTGCGGGA---GCT---G-GGG-CGGAAATTGGCCTCCCGT-CC-ACAC--G-ACACCGTGCGCGGTTGGCCC-------AAAAAAA-ATGAGCTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--CT---GATCGTGACCCTGTGCA--C-C--TCC-TTATT-A-G-GG-G-ATGGTGC-TTCGACC Ilex_microdonta_Gbk C--AAAGTAGACCCGGCGAACTTGTT---AAAA-ATATT---TGGCCGGGGGTTTGAGAA-GGGGTGCGCGAG-C-CCCCC-CGA-CACACT--CCCC---CG---CCC-TCGGGATTTGGC-TTGC-GTT--C-CCCT-ACCGGGG-ACCCGGTC-GAGCTCCCGAC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--ACGGGAGGAGGCAT-TTGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG--CC-CCCA-A-CCCCA--ACGCCCGGCTACT---GGCTGGACGTTGCGGGG---GCT---G-GGG-CGGAAATTGGCCTCCCGT-CC-ACAC--G---ACCGTGCGCGGTTGGCCC-------AAAAAAA-ATGAGCTCCTGACGATGGACGTCGCGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--CT---GATCGTGACCCTGTGCA--C-C--TCC-TTATT-A-G-GG-G-ATGGGGC-TTCGACC Ilex_mitis C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATG---CC-T--GGGGGTTTGAGAAGGGGTGCGCGAG-C-CCCCC-CGA-CACACT--CCCC---CA---CCT-CGGGATTTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACTCGGCC-AGGCTCCCGAA---AACGAA--C-CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG--AGCTGGCCCCCCG-ACGT-CCCGTTCGCGGTGTGC-ACG--G-GGAGGCAT-GTGCGTC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CCCC-A-A-CCC--C-AATGCCTAGCT---AGCTGGATATTGTGGGA---GTT---G-GGG-CGGAAATTGGCCTCCCGT--C--CAC--G---ACCGTGCGCGGTTGGCCC-AAA----AAAAAA-AGGAGTTCTTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTA-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--CT---GACCGTGACCCTGCGCA--C-C---TT-CT-TTAA-C-GG-A-ATGGTGC-TCCGACC Ilex_mucronata C--AAAGTAGACCCAGCGAACTTGTT----AAA-ACATG---CT-T--GGGGGTTTGAGAAGGGGTGCGCGAG---CCCCC-CGA-CACACT--CCCC---CA----CC-TCGGGATTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACTCGGTC-AAGCTCCCGAC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG--AGCTGGCCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCAT-TTGCATC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C-CCCA-A-CCCCC--C-AATTCCTATGT---ACCTGGATATTGTGGGA---GAT---G-GGG-CGGAAATTGGCCTCCCGT--A--CAC--G---ACCGTGAGCGGTTGGCCC---------AAATA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAG--CT--CT---AACCGTGACCCTATATG--CAC---CT-TC-TT-C-A-GC-G-ATGGTGC-TTCGACC Ilex_mutchagara C--AAAGTAGA-CCGGCGAACTTGTT----TAA-ACATG---C-GG--GGGGG{GT}TTGAAAAAGGGTTCGCGAA-C-CCCCC-CAATCACGCT--CCCC---CC---ACC-TCGGGATCTGGC-TCGT-TTTCCC-CCCT-GGCGGGGAACTCGGCC-AAGCTCCCGAC-A-AACGAA----CCCCGGCGC-TGTTTGCGCCAAGGAACAATAAC-CGAAG--AGCTGGTCTCCCG-GTGC-CCCGTCCGCGGCGTGC--AC--G-GGAGGCGC-TTGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C-CCCA-A-CCCC------CACCG-GCCC---AGCCGGATACTGCGGGA---GTT---G-GGG-CGGAGATTGGCCTCCCGT-CC-GCGC--G---ACCGTGAGCGGTTGGCCC---------AAAAA-ACGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TCGCATCATGTCGTGGGGCG-CCTAGTCCGCAGCGAG--CT--CC---GACCCTGTGCACCTGAT--T-C--GCT-CTCG----G--GCG-ACGGTGC-TTCGACC Ilex_opaca C--AAAGTAGA-CCGGCGAACTTGTT----AAA-ACATG---CT-G--GGGGGTTTGAGAAGGGGTGCGTGAG-C-CCCCC-{GT}AA-CACACT--CCCC---CA---CCT-CGGGATTTTGGC-TTGC-GTC--C-CCCT-AGCGGGG-ACTCGGTC-AAGCTCCCGAC-A-AACGAA----CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG--AGCTGGCCTCCCG-TTGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCGTCATGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C-CCCC-C-CACCC--C-AATGCCCACCT---AGCTGGATATTGCGGGA---GTC---G-GGG-CGGAAATTGGCCTCCCGT-CC-GCAC--G---ATCGTGAGCGGTTGGCCC--------AAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCAAGTCTGTGGCGAG--CT--CT---AACCGTGACCCTGCGCA--C-C---CT-CT-TC-A---GC-G-ATGGTGC-TTCGACC Ilex_paraguariensis C--AACGTAGACCCGGCGAACTTGTT----AAA-ATACG---CTGG--GGGGGTTTGGGAAGGGGTGCGCGAG-C-CCCCC-CGAACACACT--CCCC---CG---CCC-TCGGGACTGGGC-TTGTGTTCCCCTCCCTAGGGGGGGGACTCGGTC-GAGCTCCCGAC-A-AACGAA----CCCCGGCGC-TGTCTGTGCCAAGGAACCATAAC-CGAAG--AGCTGGTCTCCCG-ATGT-CCCGTTCGCGGTGCGC--AC--G-GGAGGCAT-TTGCATCTTTTTGA--AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C-CCCC-A-ACCC------CAA-T-GCCC----GGATGTTGCGGGGGAG---TTG---G-GGG-CGGAAATTGGCCTCCCGT-CC-ACA{CT}--G---ATCGTGAGCGGTTGGCCC---------AAAAA-GTGAGTTCCTGACGACGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCG-CCTAGTCTGTAGCGAGCTCTAACCGTGGACCCTGCGCACCTAAT--T-C--GTT-CGAGA-A-G-AGCG-ACGGTGC-TTCGACC Ilex_pedunculosa C--AAAGTAGACCCGGCGAACTCGTTA---AAATATATG---GC-T--GGGGGTCTGGGAAGGGGTGCGCGAG-C-CCCCCAACA-CACTCC--CCCA--GCC---CGC-TCGGGATTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACTCGGCC-AAGCTCCCGAC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCACAAC-TGAAG--GGCTGGCCTCTCG-ATGT-CCCGTTCGCGGTGTGC-AAC--G-GGAGGCAT-TTGCATC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCAAGTCTGCCTGGGCGTCACGCATCACGTCG-----CCCC-A-A-CCC--C-AATGCCAAGCT---TGCTGGGTATTGCGGGA---GCT---G-GGG-CGGAAATTGGCCTCCCGT--C--CAC--G---ACCGTGCGCGGTTGGCCC--------ATAAAA-ATGAGTTCCTGACGATTGACGTCACGACAAGTGGTGGTTGAAAGACCTC-A{CT}GCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--CT---GATCGTGACCCTTCGCA--C-C---TT-CT-CTAA-T-GG-G-ATGGTGCTTCCGACC Ilex_percoriacea C--AAAGTAGACCCGGCGAACTCGTT----AAA-ATATATG-GC-T--GGGGGTCTGGGAAGGGGTGCGCGAG---CCCCC-CAA-CACACTC-CCCCAG-CC---CGC-TCGGGATTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACTCGGCC-AAGCTCCCGAC---AACGAA----CCCCGGCGC-TGTTTGCGCCAAGGAACCACAAC-TGAAG--GGCTGGCCTCTCG-ATGT-CCCGTTCGCGGTGTGCA-AC--G-GGAGGCAT-TTGCATC-TTTTG---AATC----TAAAATGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAACCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CC-C-C-C-AAC--C-CCA---ATTGC---GG-GAG-T-CG-GGG-G----C----G-GAA-ATTGGCCT-CCCGTCCA---C---GA--A---CGTGCACGGTTGGCCC-A---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GACCGTGACCCTGTGCA--C-C---TC-CT-TC---G-CG-G-ATGGTGC-TCCGACC Ilex_pseudobuxus C--AAAGTAGACCCGGCGAACCTGTT----AAA-ATATT---TGGCCGGGGGTTTGAGAA-GGGGTGCGCGAG-C-CCCCC-CGA-CACACT--CCCC---CG-C-CCC-TCGGGATTCGGC-TTGC-GTT--C-CCCT-GCCGGGG-ACCCGGTC-GAGCTCCCGAC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-TGAAG-AGCTGGCCCCCCCG-ATGC-CCCGTTCGCGGTGTGC--ACGGGAGGAGGCAT-TTGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGTTAAGGGCACGTCTGCCTGGGCGTCACGCATCAAGTCG--CC-CCCA-A-CCCCA--ACGCCCGGCTA{CT}T---GGCTGGACGTTGCGGGA---GCT---G-GGG-CGGAAATTGGCCTCCCGT-CC-ACAC--G---ACCGTGCGCGGTTGGCCC-------AAAAAAA-ACGAGCTCCTGACGATGGACGTCCCGACAAGTGGTGGTTGAAAGACCTC-TTGCATCTGGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--CT---GATCGTGACCCTGTGCA--C-C--TCC-TTATT-A-G-GG-G-ACGGTGC-TTCGACC Ilex_rotunda C--AAAGTAGACCCGGCGAACTCGTT----AAA-ATATG---CG-T--GGGGGTTTGAGAAGGGGTGCGCGAG-C-CCCCC-CGA-CACATT--CCCC---CAC--CCC-CCGGGACTTGGC-CCGG-GTT--C-CCCT-TGCGGGG-ACTCGGCC-AAGGCTCCCGA-C-AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAAC-CGAAG--AGCTGGCCCCCCG-{AG}TGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCGT-ACGCATC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C-CCCC-A-ACCCCGAC-AATGCCCGGCTGGCAGCCGGATATTGCGGGA---GTT---GCGGG-CGGAGATTGGCCTCCCGT--C--CAC--G---ACCGTGCACGGTTGGCCC---------AAAAA-GCGAGTTCTTGACGACGGACGTCACGACGAGTGGTGGTTGGAAGACCTC-TTGCGTCGAGTCGTGAGGCACCCGAGTCTGTAACGAG--CT--CT---GACCGCGACCCTGTGCG--C-C---TT-CC-TT-A-G-GG-G-GCGGCGC-TCCGACC Ilex_rugosa C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATG---CC-T--GGGGGTTTGAGAAGGGGTGCGCGAG---CCCCC-CAA-CACACT---CCC---CC---ACC-TCGGGATTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACTTGGTC-AAGCTACCGAC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCATAAC-TGAAG--AGCTGGCCTCCTG-TTGT-CCCGTCTGCGGTGTGC--AC--G-GGAGGCAT-TTGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGG?TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CCAC-C-A-ACC--C-CAATGCCTAGC---TG-GATAT-TG{AC}GGGAG---TTG---G-GGG-CGGAAATTGGCCTCCCGT--C--CAC--G---AACGTGCGCGGTTGGCCCA-------AAAAAA-ATGAGTTCTTGACGATGGACGTCACGATAAGTGGTGGTTGAAAGACCTA-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GACCGTGACCCTGTGCA--C-C---TT-CT-TC---A-TG-G-ATGGTGC-TTCGACC Ilex_serrata C--AAAATAGACC{CT}GGCGAACTTGTT----AAA-ATATG---CT-T--GGGGGTTTGAGAAGGGGTGCGCGAG-T-CCCCC-CGA-CACACT--CCCC---CA---CCC-CCGGGATTTGGC-TTGC-GTC--C-CCCT-AGCGGGG-ACTCGGTC-AAGCTCCCGAC---AACGAA----CCCCGGCGC-TATCTGCGCCAAGGAACCTTAAC-CGAAG--AGCTGGCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCGT-ATGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACACATCACGTCG-----CCCC-A-A-CCC--C-AATGCCTAGTT---GGTTAGGCATTGTTGGA---GTT--GG-GGG-CGGAAATTGGCCTCCCGT--C--CAC--G---ATTGTGCGCGGTTGGCCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAACGAG--CT--CT---AACCGTGACCCTGTGCA--C-C---TT-CT-TT-A-G-GG-G-ATGGTGC-TCCGACC Ilex_taubertiana C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATT---TGGCCGGGGGTTTGAGAAGGGGGTGCGCGAG-C-CCCCC-C{AG}A-CACA{CT}T--CCCC---CG---CCC-TGGGATTTGGGT-TTGC-GTT--C-CCCT-ACCGGGG-ACCCGGT{CG}-GAGCTCCCG{AC}C---ACCAA{AC}----CCCCGGCGC-TGTTTGCGCCAAGGAACCTTAAC-TGAA?-A?CTGGCCCCCCCG-ATGT-CCCGTTC?CGGTGTGC--AC-GG-GGAGGCAT-TTGCGTC-TTTTG---AATT----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGT{CT}TGCCTGGGCGTCACGCATCACGT{CT}G---C-CCCA-A-CCCCA--ATGCCCGGCTACT---A{AG}CTGGACGTT{CT}CGGGA---{AG}CT---G-GGG-CGGAAATTGGCCTCCCGT-CC-ACAC--G---ACCGTGGGCGGTTGGCCC----AAAAAAAAAA-ATGAGCTCTTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGGCCTC-TTGCGTCTAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--TT---GATCGTGACCCTGTGCG--C-C--TCC-TTATT-A-G-GG-G-ACGGTGC-TTCGACC Ilex_theezans C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATT---TGGCCGGGGGGTTTGAGAAGGGGTGCGCGAG-C-CCCCC-CGA-CACA{CT}T--CCCC---CG---CCC-CCGGGATTTGG{CGT}-TTG{CG}-GTT--C-CCCT-AGCGGGG-ACCCGGCC-GAGCTCCCGAC---AACGAA----CCCCGG{CG}G{CG}-TGTCTGCGCCAAGGAACCTTAAC-TGAA{AG}-AAGCT{AG}GCCCCCCCG{AG}TGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCAT-TTGCGTC-TTTTG---AATC----CAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C-CCCA-A-CCCCA--ATGCCTGGCTACC---AGC{CT}GGACGTTGCGGGA---GCT---G-GGG-CGGAAATTGGCCTCCCGT-CC-ACAC--G---{AG}CCGTG{CGT}GCGGTTGGCCC-------AAAAAAA-ATGAGCTCTCACCGATGGG{CG}GTCACG{AG}CAAGTGGTGGTTGAAAGGCCTC-TAGCATCTAGTCGTGAGGC{AT}-CCGAGTTTACAGCGAG--CT--CT---GATCGTGACCCTGTGCA--C-C--TTC-TTATT-AGG-GG-G-A{CT}GGTGC-TTTGACC Ilex_theezans_Gbk C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATT---TGGCCGGGGGTTTGAGAA-GGGGTGCGCGAG-C-CCCCC-CGA-CACACT--CCCC---CG---CCC-CCGGGATTCGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACCCGGTC-GAGCTCCCGTC---AACGAA----CCCCGGCGC-TGTCTGCGCCAAGGAACCTTAA?-TGAAGAAGCTGGCCCCCCCG-ATGT-CCCGTTCGCGGGGTGC--ACGGG-GGAGGCAT-TTGCGTC-TTTCG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG---C-CCCA-A-CCCCA--ATGCCCGGCTACC---AGCTGGACGTTGCGGGA---GCT---G-GGG-CGGAAATTGGCCTCCCGT-CC-ACAC--G---ACCGTGCGCGGTTGGCCC------AAAAAAAA-ATGAGCTCCTGACGATGGGCGTCACGACAAGTGGTGGTTGGAAGACCTC-TTGCATCTAGTCGTGAGGCA-CCGAATCTGTAGCGAG--CT--CT---GATCGTGACCCTGTGCA--C-C-TTCT-TTATT-A-G-GG-G-ACGGTGC-TTTGACC Ilex_vomitoria C--AAAGTAGA-CCGGCGAACTTGTT----AAA-ATATG---CT-G--GGGGTTTGAGAAAAGGGGGTGCGCG---AGCCC-CCC-CCAACAC-ACTCCC-CC---ACC-TCGGGATTTGGC-TTGT-GTT--C-CCCT-AGCGGGG-ACTCGGTC-AAGCTCCCGAC--AAACGAA----CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG--AGCTGGCCTCCCG-ATGT-CCCGTTCGCGGCGCGC--AC--G-GGGGGTAT-TTGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CC-C-C-A-ACC--C-CAATGCCTAGC---TG-GATAT-CGTGGGAG---TT----G-GGG-CGGAAATTGGCCTCCCGT--T--CGC--G---ACCGTGAGCGGTTGGCCC---------AAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCATGTCGTGAGGCA-CCTAGTCTGTAGCGAG--CT--CT---AACCGTGACCCTGTGCA--C-C---TT-CT-TC---A-GA-G-ACGGTGC-TTCGACC Ilex_warburgii C--AAAGTAGACCCGGCGAACTTGTT----AAA-ATATG---CC-T--GGGGGTTTGAGAAGGGGTGCGCGAG---CCCCC-CAA-CACACTC-CCCCAG-CG---CCC-TCGGGATTTGGC-TTGC-GTT--C-CCCT-AGCGGGG-ACTCGGTC-AAGCTCCCGAC---AACGAA----CCCCGGCGC-TATCTGCGCCAAGGAACCATAAC-TGAAG--GGCTGGCCTCCCG-ATGT-CCCGTTCGCGGTGTGC--AG--G-GGAGGCAT-TTGCATC-TTTTG---AATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CCAC-C-A-ACC--C-CAATGCCCGGC---TG-GATAT-TACGGGAG---TTG---G-GGG-CGGAAATTGGCCTCCCGTC-CA-TAT--G---AACGCGCGCGGTTGGCCC---------AAAAA-ATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTC-TTGCGTCATGTCGTGAGGCA-CCAAGTCTGTAGCGAG--CT--CT---GACTGCGACCCTGTGCA-CC-C---TTCCT-TC---A-CG-G-ATGGTGC-TCCGACC Ilex_yunnanensis C--AAAGTAGACCCAGCGAACTTGTT----AAA-ATATG---CC-C--GGGGGTTTGAGAAGGGGTGCGCGAG---CCCCC-CGA-CACAAT--CCCC---CA---CCC-CCGGGATCTGGC-TTGC-GTT--C-CCAT-AGCGGGG-ACTGGGTC-AGGCTCCCGGC---AACGAA----CCCCGGCGC-TATCTGCGCCAAGGAATCTTAAC-TGAAG--AGCTGGCCCCCCG-ATGT-CCCGTTCGCGGTGTGC--AC--G-GGAGGCAT-ATGCATC-TTTTG--AAATC----TAAAACGACTCTCGGCAACGGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCG-----CCCC-A-A-CCC--C-AATGCCTAGCT---AGCTGGATATTGCGGGA---GTT---G-GGG-CGGAAATTGGCCTCCCGT--C--CAC--G---ACCGTGCGCGGTTGGCCCA-------AAAAAA-ATGAGTTCCTGACGATGGACGTCACGACAAGTGGTGGTTGAAAGACCTC-TTGCATCAAGTCGTGAGGCA-CCGAGTCTGTAGCGAG--CT--CT---GACCGTGACCCTGCGCA--C-C---TT-CT-CT-A-T-GG-G-ATGGTGC-TTCGACC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_811) = N: 1-715; CODONPOSSET CodonPositions (CHARACTERS = ITS_811) = N: 1-715; END; BEGIN TREES; TITLE Tb6721; LINK TAXA = Taxa1; TRANSLATE 1 Helwingia_japonica, 2 Helwingia_chinensis, 3 Ilex_mertensii, 4 Ilex_percoriacea, 5 Ilex_beecheyi, 6 Ilex_integra, 7 Ilex_kiusiana, 8 Ilex_buergeri, 9 Ilex_maximowicziana, 10 Ilex_pedunculosa, 11 Ilex_liukiuensis, 12 Ilex_dimorphophylla, 13 Ilex_latifolia, 14 Ilex_cornuta, 15 Ilex_rotunda, 16 Ilex_warburgii, 17 Ilex_rugosa, 18 Ilex_macropoda, 19 Ilex_micrococca, 20 Ilex_serrata, 21 Ilex_paraguariensis, 22 Ilex_dumosa_guaranina, 23 Ilex_dumosa_dumosa, 24 Ilex_crenata, 25 Ilex_mutchagara, 26 Ilex_decidua, 27 Ilex_vomitoria, 28 Ilex_collina, 29 Ilex_opaca, 30 Ilex_cassine, 31 Ilex_mitis, 32 Ilex_glabra, 33 Ilex_canariensis, 34 Ilex_theezans, 35 Ilex_brasiliensis, 36 Ilex_argentina, 37 Ilex_pseudobuxus, 38 Ilex_integerrima, 39 Ilex_mucronata, 40 Ilex_microdonta, 41 Ilex_taubertiana, 42 Ilex_brevicuspis, 43 Ilex_yunnanensis, 44 Ilex_amelanchier, 45 Ilex_anomala, 46 Ilex_theezans_Gbk, 47 Ilex_argentina_Gbk, 48 Ilex_microdonta_Gbk; TREE strict_141 = [&R] (1,(2,(45,((44,39),(((28,(26,27)),((29,(47,30)),(21,((24,25),(23,22))))),((17,((9,(14,12)),(8,13,(11,16)),(6,7,(5,3,4)))),(((20,(32,(33,15))),(43,(31,(18,19)))),(10,(((42,41),(40,(37,48))),((38,46),(36,(35,34)))))))))))); END; BEGIN TREES; TITLE Tb6720; LINK TAXA = Taxa1; TRANSLATE 1 Helwingia_japonica, 2 Helwingia_chinensis, 3 Ilex_mertensii, 4 Ilex_percoriacea, 5 Ilex_beecheyi, 6 Ilex_integra, 7 Ilex_kiusiana, 8 Ilex_buergeri, 9 Ilex_maximowicziana, 10 Ilex_pedunculosa, 11 Ilex_liukiuensis, 12 Ilex_dimorphophylla, 13 Ilex_latifolia, 14 Ilex_cornuta, 15 Ilex_rotunda, 16 Ilex_warburgii, 17 Ilex_rugosa, 18 Ilex_macropoda, 19 Ilex_micrococca, 20 Ilex_serrata, 21 Ilex_paraguariensis, 22 Ilex_dumosa_guaranina, 23 Ilex_dumosa_dumosa, 24 Ilex_crenata, 25 Ilex_mutchagara, 26 Ilex_decidua, 27 Ilex_vomitoria, 28 Ilex_collina, 29 Ilex_opaca, 30 Ilex_cassine, 31 Ilex_mitis, 32 Ilex_glabra, 33 Ilex_canariensis, 34 Ilex_theezans, 35 Ilex_brasiliensis, 36 Ilex_argentina, 37 Ilex_pseudobuxus, 38 Ilex_integerrima, 39 Ilex_mucronata, 40 Ilex_microdonta, 41 Ilex_taubertiana, 42 Ilex_brevicuspis, 43 Ilex_yunnanensis, 44 Ilex_amelanchier, 45 Ilex_anomala, 46 Ilex_theezans_Gbk, 47 Ilex_argentina_Gbk, 48 Ilex_microdonta_Gbk; TREE strict_211 = [&R] (1,(2,(21,(((24,25),(23,22)),((28,(26,27)),((45,(17,((9,(14,12)),(8,13,(11,16)),(6,7,(5,3,4))))),(((32,(15,20)),((44,39),(29,(47,30)))),(18,(19,(43,((33,31),(10,(((42,41),(40,(37,48))),((38,46),(36,(35,34)))))))))))))))); END; BEGIN TREES; TITLE Tb6715; LINK TAXA = Taxa1; TRANSLATE 1 Helwingia_japonica, 2 Helwingia_chinensis, 3 Ilex_mertensii, 4 Ilex_percoriacea, 5 Ilex_beecheyi, 6 Ilex_integra, 7 Ilex_kiusiana, 8 Ilex_buergeri, 9 Ilex_maximowicziana, 10 Ilex_pedunculosa, 11 Ilex_liukiuensis, 12 Ilex_dimorphophylla, 13 Ilex_latifolia, 14 Ilex_cornuta, 15 Ilex_rotunda, 16 Ilex_warburgii, 17 Ilex_rugosa, 18 Ilex_macropoda, 19 Ilex_micrococca, 20 Ilex_serrata, 21 Ilex_paraguariensis, 22 Ilex_dumosa_guaranina, 23 Ilex_dumosa_dumosa, 24 Ilex_crenata, 25 Ilex_mutchagara, 26 Ilex_decidua, 27 Ilex_vomitoria, 28 Ilex_collina, 29 Ilex_opaca, 30 Ilex_cassine, 31 Ilex_mitis, 32 Ilex_glabra, 33 Ilex_canariensis, 34 Ilex_theezans, 35 Ilex_brasiliensis, 36 Ilex_argentina, 37 Ilex_pseudobuxus, 38 Ilex_integerrima, 39 Ilex_mucronata, 40 Ilex_microdonta, 41 Ilex_taubertiana, 42 Ilex_brevicuspis, 43 Ilex_yunnanensis, 44 Ilex_amelanchier, 45 Ilex_anomala, 46 Ilex_theezans_Gbk, 47 Ilex_argentina_Gbk, 48 Ilex_microdonta_Gbk; TREE strict_441 = [&R] (1,(2,(45,((17,((7,(6,(5,3,4))),((9,(14,12)),(8,13,(11,16))))),(((44,39),((28,(26,27)),((29,(47,30)),(21,(24,25,(23,22)))))),(10,((33,32),(((15,20),(43,(31,(18,19)))),(36,(((35,34),(38,46)),((42,41),(40,(37,48))))))))))))); END; BEGIN TREES; TITLE Tb6717; LINK TAXA = Taxa1; TRANSLATE 1 Helwingia_japonica, 2 Helwingia_chinensis, 3 Ilex_mertensii, 4 Ilex_percoriacea, 5 Ilex_beecheyi, 6 Ilex_integra, 7 Ilex_kiusiana, 8 Ilex_buergeri, 9 Ilex_maximowicziana, 10 Ilex_pedunculosa, 11 Ilex_liukiuensis, 12 Ilex_dimorphophylla, 13 Ilex_latifolia, 14 Ilex_cornuta, 15 Ilex_rotunda, 16 Ilex_warburgii, 17 Ilex_rugosa, 18 Ilex_macropoda, 19 Ilex_micrococca, 20 Ilex_serrata, 21 Ilex_paraguariensis, 22 Ilex_dumosa_guaranina, 23 Ilex_dumosa_dumosa, 24 Ilex_crenata, 25 Ilex_mutchagara, 26 Ilex_decidua, 27 Ilex_vomitoria, 28 Ilex_collina, 29 Ilex_opaca, 30 Ilex_cassine, 31 Ilex_mitis, 32 Ilex_glabra, 33 Ilex_canariensis, 34 Ilex_theezans, 35 Ilex_brasiliensis, 36 Ilex_argentina, 37 Ilex_pseudobuxus, 38 Ilex_integerrima, 39 Ilex_mucronata, 40 Ilex_microdonta, 41 Ilex_taubertiana, 42 Ilex_brevicuspis, 43 Ilex_yunnanensis, 44 Ilex_amelanchier, 45 Ilex_anomala, 46 Ilex_theezans_Gbk, 47 Ilex_argentina_Gbk, 48 Ilex_microdonta_Gbk; TREE strict_411 = [&R] (1,(2,(21,(24,25,(23,22),(32,(44,39),(15,20),(28,(26,27)),(29,(47,30)),(45,(17,((9,(14,12)),((13,(8,(11,16))),(7,(6,(5,3,4))))))),(18,19,43,((33,31),(10,((36,(35,34)),((42,41),(38,46),(48,(40,37)))))))))))); END; BEGIN TREES; TITLE Tb6719; LINK TAXA = Taxa1; TRANSLATE 1 Helwingia_japonica, 2 Helwingia_chinensis, 3 Ilex_mertensii, 4 Ilex_percoriacea, 5 Ilex_beecheyi, 6 Ilex_integra, 7 Ilex_kiusiana, 8 Ilex_buergeri, 9 Ilex_maximowicziana, 10 Ilex_pedunculosa, 11 Ilex_liukiuensis, 12 Ilex_dimorphophylla, 13 Ilex_latifolia, 14 Ilex_cornuta, 15 Ilex_rotunda, 16 Ilex_warburgii, 17 Ilex_rugosa, 18 Ilex_macropoda, 19 Ilex_micrococca, 20 Ilex_serrata, 21 Ilex_paraguariensis, 22 Ilex_dumosa_guaranina, 23 Ilex_dumosa_dumosa, 24 Ilex_crenata, 25 Ilex_mutchagara, 26 Ilex_decidua, 27 Ilex_vomitoria, 28 Ilex_collina, 29 Ilex_opaca, 30 Ilex_cassine, 31 Ilex_mitis, 32 Ilex_glabra, 33 Ilex_canariensis, 34 Ilex_theezans, 35 Ilex_brasiliensis, 36 Ilex_argentina, 37 Ilex_pseudobuxus, 38 Ilex_integerrima, 39 Ilex_mucronata, 40 Ilex_microdonta, 41 Ilex_taubertiana, 42 Ilex_brevicuspis, 43 Ilex_yunnanensis, 44 Ilex_amelanchier, 45 Ilex_anomala, 46 Ilex_theezans_Gbk, 47 Ilex_argentina_Gbk, 48 Ilex_microdonta_Gbk; TREE single_221 = [&R] (1,(2,(21,(((24,25),(23,22)),((29,(47,30)),((28,(26,27)),((44,39),((45,(17,((7,(6,(5,3,4))),((9,(14,12)),(8,13,(11,16)))))),(10,((33,32),(((15,20),(43,(31,(18,19)))),(36,(((35,34),(38,46)),((42,41),(40,(37,48)))))))))))))))); END; BEGIN TREES; TITLE Tb6711; LINK TAXA = Taxa1; TRANSLATE 1 Helwingia_japonica, 2 Helwingia_chinensis, 3 Ilex_mertensii, 4 Ilex_percoriacea, 5 Ilex_beecheyi, 6 Ilex_integra, 7 Ilex_kiusiana, 8 Ilex_buergeri, 9 Ilex_maximowicziana, 10 Ilex_pedunculosa, 11 Ilex_liukiuensis, 12 Ilex_dimorphophylla, 13 Ilex_latifolia, 14 Ilex_cornuta, 15 Ilex_rotunda, 16 Ilex_warburgii, 17 Ilex_rugosa, 18 Ilex_macropoda, 19 Ilex_micrococca, 20 Ilex_serrata, 21 Ilex_paraguariensis, 22 Ilex_dumosa_guaranina, 23 Ilex_dumosa_dumosa, 24 Ilex_crenata, 25 Ilex_mutchagara, 26 Ilex_decidua, 27 Ilex_vomitoria, 28 Ilex_collina, 29 Ilex_opaca, 30 Ilex_cassine, 31 Ilex_mitis, 32 Ilex_glabra, 33 Ilex_canariensis, 34 Ilex_theezans, 35 Ilex_brasiliensis, 36 Ilex_argentina, 37 Ilex_pseudobuxus, 38 Ilex_integerrima, 39 Ilex_mucronata, 40 Ilex_microdonta, 41 Ilex_taubertiana, 42 Ilex_brevicuspis, 43 Ilex_yunnanensis, 44 Ilex_amelanchier, 45 Ilex_anomala, 46 Ilex_theezans_Gbk, 47 Ilex_argentina_Gbk, 48 Ilex_microdonta_Gbk; TREE single_1011 = [&R] (1,(2,((7,(6,(5,3,4))),(45,((27,(28,26)),(17,(((9,(14,12)),(8,13,(11,16))),(((44,(32,39)),((29,(47,30)),((24,25),(21,(23,22))))),(15,(20,(((33,31),(43,(18,19))),(10,(36,((35,34),(42,(41,((38,46),(48,(40,37))))))))))))))))))); END; BEGIN TREES; TITLE Tb6723; LINK TAXA = Taxa2; TRANSLATE 1 Ilex_theezans_Gbk, 2 Ilex_argentina_Gbk, 3 Ilex_microdonta_Gbk, 4 Ilex_anomala, 5 Ilex_amelanchier, 6 Ilex_yunnanensis, 7 Ilex_brevicuspis, 8 Ilex_taubertiana, 9 Ilex_microdonta, 10 Ilex_mucronata, 11 Ilex_integerrima, 12 Ilex_pseudobuxus, 13 Ilex_argentina, 14 Ilex_brasiliensis, 15 Ilex_theezans, 16 Ilex_canariensis, 17 Ilex_glabra, 18 Ilex_mitis, 19 Ilex_cassine, 20 Ilex_opaca, 21 Ilex_collina, 22 Ilex_vomitoria, 23 Ilex_decidua, 24 Ilex_mutchagara, 25 Ilex_crenata, 26 Ilex_dumosa_dumosa, 27 Ilex_dumosa_guaranina, 28 Ilex_paraguariensis, 29 Ilex_serrata, 30 Ilex_micrococca, 31 Ilex_macropoda, 32 Ilex_rugosa, 33 Ilex_warburgii, 34 Ilex_rotunda, 35 Ilex_cornuta, 36 Ilex_latifolia, 37 Ilex_dimorphophylla, 38 Ilex_liukiuensis, 39 Ilex_pedunculosa, 40 Ilex_maximowicziana, 41 Ilex_buergeri, 42 Ilex_kiusiana, 43 Ilex_integra, 44 Ilex_beecheyi, 45 Ilex_percoriacea, 46 Ilex_mertensii, 47 Helwingia_chinensis, 48 Helwingia_japonica; TREE strict_111 = [&R] (48,(47,(((25,24),(26,27)),(28,((20,(2,19)),((21,(23,22)),(4,(5,10),(32,((43,42,(44,46,45)),((40,(35,37)),(41,36,(38,33))))),(29,(17,(16,34)),((6,(18,(31,30))),(39,(13,(((14,15),(11,1)),((7,8),(9,(12,3))))))))))))))); END; BEGIN TREES; TITLE Tb6713; LINK TAXA = Taxa1; TRANSLATE 1 Helwingia_japonica, 2 Helwingia_chinensis, 3 Ilex_mertensii, 4 Ilex_percoriacea, 5 Ilex_beecheyi, 6 Ilex_integra, 7 Ilex_kiusiana, 8 Ilex_buergeri, 9 Ilex_maximowicziana, 10 Ilex_pedunculosa, 11 Ilex_liukiuensis, 12 Ilex_dimorphophylla, 13 Ilex_latifolia, 14 Ilex_cornuta, 15 Ilex_rotunda, 16 Ilex_warburgii, 17 Ilex_rugosa, 18 Ilex_macropoda, 19 Ilex_micrococca, 20 Ilex_serrata, 21 Ilex_paraguariensis, 22 Ilex_dumosa_guaranina, 23 Ilex_dumosa_dumosa, 24 Ilex_crenata, 25 Ilex_mutchagara, 26 Ilex_decidua, 27 Ilex_vomitoria, 28 Ilex_collina, 29 Ilex_opaca, 30 Ilex_cassine, 31 Ilex_mitis, 32 Ilex_glabra, 33 Ilex_canariensis, 34 Ilex_theezans, 35 Ilex_brasiliensis, 36 Ilex_argentina, 37 Ilex_pseudobuxus, 38 Ilex_integerrima, 39 Ilex_mucronata, 40 Ilex_microdonta, 41 Ilex_taubertiana, 42 Ilex_brevicuspis, 43 Ilex_yunnanensis, 44 Ilex_amelanchier, 45 Ilex_anomala, 46 Ilex_theezans_Gbk, 47 Ilex_argentina_Gbk, 48 Ilex_microdonta_Gbk; TREE single_821 = [&R] (1,(2,(21,(((24,25),(23,22)),((29,(47,30)),(((15,20),((43,(18,19)),((33,31),(10,(36,(((35,34),(38,46)),((42,41),(48,(40,37))))))))),((44,(32,39)),((27,(28,26)),((45,((6,7),(5,3,4))),(17,((9,(14,12)),(8,13,(11,16))))))))))))); END; BEGIN TREES; TITLE Tb6710; LINK TAXA = Taxa1; TRANSLATE 1 Helwingia_japonica, 2 Helwingia_chinensis, 3 Ilex_mertensii, 4 Ilex_percoriacea, 5 Ilex_beecheyi, 6 Ilex_integra, 7 Ilex_kiusiana, 8 Ilex_buergeri, 9 Ilex_maximowicziana, 10 Ilex_pedunculosa, 11 Ilex_liukiuensis, 12 Ilex_dimorphophylla, 13 Ilex_latifolia, 14 Ilex_cornuta, 15 Ilex_rotunda, 16 Ilex_warburgii, 17 Ilex_rugosa, 18 Ilex_macropoda, 19 Ilex_micrococca, 20 Ilex_serrata, 21 Ilex_paraguariensis, 22 Ilex_dumosa_guaranina, 23 Ilex_dumosa_dumosa, 24 Ilex_crenata, 25 Ilex_mutchagara, 26 Ilex_decidua, 27 Ilex_vomitoria, 28 Ilex_collina, 29 Ilex_opaca, 30 Ilex_cassine, 31 Ilex_mitis, 32 Ilex_glabra, 33 Ilex_canariensis, 34 Ilex_theezans, 35 Ilex_brasiliensis, 36 Ilex_argentina, 37 Ilex_pseudobuxus, 38 Ilex_integerrima, 39 Ilex_mucronata, 40 Ilex_microdonta, 41 Ilex_taubertiana, 42 Ilex_brevicuspis, 43 Ilex_yunnanensis, 44 Ilex_amelanchier, 45 Ilex_anomala, 46 Ilex_theezans_Gbk, 47 Ilex_argentina_Gbk, 48 Ilex_microdonta_Gbk; TREE strict_1021 = [&R] (1,(2,(21,(25,(24,((23,22),((29,(47,30)),((44,(32,39)),(((27,(28,26)),(45,(17,((9,(14,12)),(8,13,(16,(11,(7,(6,(5,3,4)))))))))),((15,20),((33,31),(43,(18,19)),(10,(36,(42,41,(35,34),(38,46),(48,(40,37)))))))))))))))); END; BEGIN TREES; TITLE Tb6722; LINK TAXA = Taxa1; TRANSLATE 1 Helwingia_japonica, 2 Helwingia_chinensis, 3 Ilex_mertensii, 4 Ilex_percoriacea, 5 Ilex_beecheyi, 6 Ilex_integra, 7 Ilex_kiusiana, 8 Ilex_buergeri, 9 Ilex_maximowicziana, 10 Ilex_pedunculosa, 11 Ilex_liukiuensis, 12 Ilex_dimorphophylla, 13 Ilex_latifolia, 14 Ilex_cornuta, 15 Ilex_rotunda, 16 Ilex_warburgii, 17 Ilex_rugosa, 18 Ilex_macropoda, 19 Ilex_micrococca, 20 Ilex_serrata, 21 Ilex_paraguariensis, 22 Ilex_dumosa_guaranina, 23 Ilex_dumosa_dumosa, 24 Ilex_crenata, 25 Ilex_mutchagara, 26 Ilex_decidua, 27 Ilex_vomitoria, 28 Ilex_collina, 29 Ilex_opaca, 30 Ilex_cassine, 31 Ilex_mitis, 32 Ilex_glabra, 33 Ilex_canariensis, 34 Ilex_theezans, 35 Ilex_brasiliensis, 36 Ilex_argentina, 37 Ilex_pseudobuxus, 38 Ilex_integerrima, 39 Ilex_mucronata, 40 Ilex_microdonta, 41 Ilex_taubertiana, 42 Ilex_brevicuspis, 43 Ilex_yunnanensis, 44 Ilex_amelanchier, 45 Ilex_anomala, 46 Ilex_theezans_Gbk, 47 Ilex_argentina_Gbk, 48 Ilex_microdonta_Gbk; TREE strict_121 = [&R] (1,(2,(45,(((44,39),((28,(26,27)),((29,(47,30)),(21,((24,25),(23,22)))))),(17,((6,7,(5,3,4)),((9,(14,12)),(8,13,(11,16))))),(10,((32,(33,15)),(20,(43,(31,(18,19)))),(36,(((35,34),(38,46)),((42,41),(40,(37,48))))))))))); END; BEGIN TREES; TITLE Tb6714; LINK TAXA = Taxa1; TRANSLATE 1 Helwingia_japonica, 2 Helwingia_chinensis, 3 Ilex_mertensii, 4 Ilex_percoriacea, 5 Ilex_beecheyi, 6 Ilex_integra, 7 Ilex_kiusiana, 8 Ilex_buergeri, 9 Ilex_maximowicziana, 10 Ilex_pedunculosa, 11 Ilex_liukiuensis, 12 Ilex_dimorphophylla, 13 Ilex_latifolia, 14 Ilex_cornuta, 15 Ilex_rotunda, 16 Ilex_warburgii, 17 Ilex_rugosa, 18 Ilex_macropoda, 19 Ilex_micrococca, 20 Ilex_serrata, 21 Ilex_paraguariensis, 22 Ilex_dumosa_guaranina, 23 Ilex_dumosa_dumosa, 24 Ilex_crenata, 25 Ilex_mutchagara, 26 Ilex_decidua, 27 Ilex_vomitoria, 28 Ilex_collina, 29 Ilex_opaca, 30 Ilex_cassine, 31 Ilex_mitis, 32 Ilex_glabra, 33 Ilex_canariensis, 34 Ilex_theezans, 35 Ilex_brasiliensis, 36 Ilex_argentina, 37 Ilex_pseudobuxus, 38 Ilex_integerrima, 39 Ilex_mucronata, 40 Ilex_microdonta, 41 Ilex_taubertiana, 42 Ilex_brevicuspis, 43 Ilex_yunnanensis, 44 Ilex_amelanchier, 45 Ilex_anomala, 46 Ilex_theezans_Gbk, 47 Ilex_argentina_Gbk, 48 Ilex_microdonta_Gbk; TREE single_811 = [&R] (1,(2,(45,((7,(6,(5,3,4))),((27,(28,26)),(((9,(14,12)),(8,13,(11,16))),(17,((18,19),(43,((20,(10,(33,31))),((15,(32,(44,39))),((29,(47,30)),(((23,22),(21,(24,25))),(36,((35,34),(42,(41,((38,46),(48,(40,37)))))))))))))))))))); END; BEGIN TREES; TITLE Tb6716; LINK TAXA = Taxa1; TRANSLATE 1 Helwingia_japonica, 2 Helwingia_chinensis, 3 Ilex_mertensii, 4 Ilex_percoriacea, 5 Ilex_beecheyi, 6 Ilex_integra, 7 Ilex_kiusiana, 8 Ilex_buergeri, 9 Ilex_maximowicziana, 10 Ilex_pedunculosa, 11 Ilex_liukiuensis, 12 Ilex_dimorphophylla, 13 Ilex_latifolia, 14 Ilex_cornuta, 15 Ilex_rotunda, 16 Ilex_warburgii, 17 Ilex_rugosa, 18 Ilex_macropoda, 19 Ilex_micrococca, 20 Ilex_serrata, 21 Ilex_paraguariensis, 22 Ilex_dumosa_guaranina, 23 Ilex_dumosa_dumosa, 24 Ilex_crenata, 25 Ilex_mutchagara, 26 Ilex_decidua, 27 Ilex_vomitoria, 28 Ilex_collina, 29 Ilex_opaca, 30 Ilex_cassine, 31 Ilex_mitis, 32 Ilex_glabra, 33 Ilex_canariensis, 34 Ilex_theezans, 35 Ilex_brasiliensis, 36 Ilex_argentina, 37 Ilex_pseudobuxus, 38 Ilex_integerrima, 39 Ilex_mucronata, 40 Ilex_microdonta, 41 Ilex_taubertiana, 42 Ilex_brevicuspis, 43 Ilex_yunnanensis, 44 Ilex_amelanchier, 45 Ilex_anomala, 46 Ilex_theezans_Gbk, 47 Ilex_argentina_Gbk, 48 Ilex_microdonta_Gbk; TREE strict_421 = [&R] (1,(2,(21,(((24,25),(23,22)),((29,(47,30)),((28,(26,27)),((44,39),(((45,(6,7,(5,3,4))),(17,((9,(14,12)),(8,13,(11,16))))),(32,((15,20),((43,(18,19)),((33,31),(10,((36,(35,34)),((42,41),(38,46),(48,(40,37))))))))))))))))); END; BEGIN TREES; TITLE Tb6709; LINK TAXA = Taxa3; TRANSLATE 1 Ilex_microdonta_Gbk, 2 Ilex_argentina_Gbk, 3 Ilex_theezans_Gbk, 4 Ilex_anomala, 5 Ilex_amelanchier, 6 Ilex_yunnanensis, 7 Ilex_brevicuspis, 8 Ilex_taubertiana, 9 Ilex_microdonta, 10 Ilex_mucronata, 11 Ilex_integerrima, 12 Ilex_pseudobuxus, 13 Ilex_argentina, 14 Ilex_brasiliensis, 15 Ilex_theezans, 16 Ilex_canariensis, 17 Ilex_glabra, 18 Ilex_mitis, 19 Ilex_cassine, 20 Ilex_opaca, 21 Ilex_collina, 22 Ilex_vomitoria, 23 Ilex_decidua, 24 Ilex_mutchagara, 25 Ilex_crenata, 26 Ilex_dumosa_dumosa, 27 Ilex_dumosa_guaranina, 28 Ilex_paraguariensis, 29 Ilex_serrata, 30 Ilex_micrococca, 31 Ilex_macropoda, 32 Ilex_rugosa, 33 Ilex_warburgii, 34 Ilex_rotunda, 35 Ilex_cornuta, 36 Ilex_latifolia, 37 Ilex_dimorphophylla, 38 Ilex_liukiuensis, 39 Ilex_pedunculosa, 40 Ilex_maximowicziana, 41 Ilex_buergeri, 42 Ilex_kiusiana, 43 Ilex_integra, 44 Ilex_beecheyi, 45 Ilex_percoriacea, 46 Helwingia_japonica, 47 Helwingia_chinensis, 48 Ilex_mertensii; TREE strict_1041 = [&R] (46,(47,(28,((24,(25,(26,27))),((20,(2,19)),((21,23,22),(((4,(42,(43,(44,48,45)))),(32,((40,(35,37)),(41,36,(38,33))))),((17,(5,10)),((34,29),(((16,18),(6,(31,30))),(39,(13,((14,15),((7,8),((11,3),(1,(9,12))))))))))))))))); END; BEGIN TREES; TITLE Tb6708; LINK TAXA = Taxa1; TRANSLATE 1 Helwingia_japonica, 2 Helwingia_chinensis, 3 Ilex_mertensii, 4 Ilex_percoriacea, 5 Ilex_beecheyi, 6 Ilex_integra, 7 Ilex_kiusiana, 8 Ilex_buergeri, 9 Ilex_maximowicziana, 10 Ilex_pedunculosa, 11 Ilex_liukiuensis, 12 Ilex_dimorphophylla, 13 Ilex_latifolia, 14 Ilex_cornuta, 15 Ilex_rotunda, 16 Ilex_warburgii, 17 Ilex_rugosa, 18 Ilex_macropoda, 19 Ilex_micrococca, 20 Ilex_serrata, 21 Ilex_paraguariensis, 22 Ilex_dumosa_guaranina, 23 Ilex_dumosa_dumosa, 24 Ilex_crenata, 25 Ilex_mutchagara, 26 Ilex_decidua, 27 Ilex_vomitoria, 28 Ilex_collina, 29 Ilex_opaca, 30 Ilex_cassine, 31 Ilex_mitis, 32 Ilex_glabra, 33 Ilex_canariensis, 34 Ilex_theezans, 35 Ilex_brasiliensis, 36 Ilex_argentina, 37 Ilex_pseudobuxus, 38 Ilex_integerrima, 39 Ilex_mucronata, 40 Ilex_microdonta, 41 Ilex_taubertiana, 42 Ilex_brevicuspis, 43 Ilex_yunnanensis, 44 Ilex_amelanchier, 45 Ilex_anomala, 46 Ilex_theezans_Gbk, 47 Ilex_argentina_Gbk, 48 Ilex_microdonta_Gbk; TREE MajRule = [&R] (1,(2,((((24,25),(23,22)),((29,(47,30)),(28,(26,27)),(45,(17,(((6,(5,3,4)),7),((9,(14,12)),(8,13,(11,16)))))),(44,39),((20,15),32,((33,31),43,(18,19),(10,(36,((35,34),(38,46),((42,41),((40,37),48))))))))),21))); END; BEGIN TREES; TITLE Tb6718; LINK TAXA = Taxa1; TRANSLATE 1 Helwingia_japonica, 2 Helwingia_chinensis, 3 Ilex_mertensii, 4 Ilex_percoriacea, 5 Ilex_beecheyi, 6 Ilex_integra, 7 Ilex_kiusiana, 8 Ilex_buergeri, 9 Ilex_maximowicziana, 10 Ilex_pedunculosa, 11 Ilex_liukiuensis, 12 Ilex_dimorphophylla, 13 Ilex_latifolia, 14 Ilex_cornuta, 15 Ilex_rotunda, 16 Ilex_warburgii, 17 Ilex_rugosa, 18 Ilex_macropoda, 19 Ilex_micrococca, 20 Ilex_serrata, 21 Ilex_paraguariensis, 22 Ilex_dumosa_guaranina, 23 Ilex_dumosa_dumosa, 24 Ilex_crenata, 25 Ilex_mutchagara, 26 Ilex_decidua, 27 Ilex_vomitoria, 28 Ilex_collina, 29 Ilex_opaca, 30 Ilex_cassine, 31 Ilex_mitis, 32 Ilex_glabra, 33 Ilex_canariensis, 34 Ilex_theezans, 35 Ilex_brasiliensis, 36 Ilex_argentina, 37 Ilex_pseudobuxus, 38 Ilex_integerrima, 39 Ilex_mucronata, 40 Ilex_microdonta, 41 Ilex_taubertiana, 42 Ilex_brevicuspis, 43 Ilex_yunnanensis, 44 Ilex_amelanchier, 45 Ilex_anomala, 46 Ilex_theezans_Gbk, 47 Ilex_argentina_Gbk, 48 Ilex_microdonta_Gbk; TREE strict_241 = [&R] (1,(2,(45,((17,((6,(7,(5,3,4))),((9,(14,12)),(8,13,(11,16))))),(((44,39),((28,(26,27)),((29,(47,30)),(21,((24,25),(23,22)))))),(10,((33,32),((15,20),(43,(31,(18,19)))),(36,(((35,34),(38,46)),((42,41),(40,(37,48)))))))))))); END; BEGIN TREES; TITLE Tb6712; LINK TAXA = Taxa1; TRANSLATE 1 Helwingia_japonica, 2 Helwingia_chinensis, 3 Ilex_mertensii, 4 Ilex_percoriacea, 5 Ilex_beecheyi, 6 Ilex_integra, 7 Ilex_kiusiana, 8 Ilex_buergeri, 9 Ilex_maximowicziana, 10 Ilex_pedunculosa, 11 Ilex_liukiuensis, 12 Ilex_dimorphophylla, 13 Ilex_latifolia, 14 Ilex_cornuta, 15 Ilex_rotunda, 16 Ilex_warburgii, 17 Ilex_rugosa, 18 Ilex_macropoda, 19 Ilex_micrococca, 20 Ilex_serrata, 21 Ilex_paraguariensis, 22 Ilex_dumosa_guaranina, 23 Ilex_dumosa_dumosa, 24 Ilex_crenata, 25 Ilex_mutchagara, 26 Ilex_decidua, 27 Ilex_vomitoria, 28 Ilex_collina, 29 Ilex_opaca, 30 Ilex_cassine, 31 Ilex_mitis, 32 Ilex_glabra, 33 Ilex_canariensis, 34 Ilex_theezans, 35 Ilex_brasiliensis, 36 Ilex_argentina, 37 Ilex_pseudobuxus, 38 Ilex_integerrima, 39 Ilex_mucronata, 40 Ilex_microdonta, 41 Ilex_taubertiana, 42 Ilex_brevicuspis, 43 Ilex_yunnanensis, 44 Ilex_amelanchier, 45 Ilex_anomala, 46 Ilex_theezans_Gbk, 47 Ilex_argentina_Gbk, 48 Ilex_microdonta_Gbk; TREE strict_841 = [&R] (1,(2,(21,((25,(24,(23,22))),((29,(47,30)),((27,(28,26)),(((45,(7,(6,(5,3,4)))),(17,((9,(14,12)),(8,13,(11,16))))),((44,39),(32,((15,20),((33,31),(43,(18,19)),(10,(36,(35,34),((42,41),(38,46),(48,(40,37)))))))))))))))); END;