#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 18:34 GMT TreeBASE (cc) 1994-2008 Study reference: Weeks A., & Simpson B. 2004. Molecular genetic evidence for intraspecific hybridization among endemic Hispaniolan Bursera (Burseraceae). American Journal of Botany, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1102] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=22; TAXLABELS Bursera_brunea_clone1I Bursera_brunea_clone2II Bursera_brunea_clone3I Bursera_discolor Bursera_fagaroides Bursera_frenningae Bursera_gracilipes_clone2I Bursera_gracilipes_clone2II Bursera_gracilipes_clone3I Bursera_inaguensis Bursera_lancifolia Bursera_longipes Bursera_microphylla Bursera_morelensis Bursera_nashii Bursera_odorata Bursera_ovata Bursera_schlechtendalii Bursera_simaruba Bursera_simarubaDR Bursera_spinescens Bursera_tecomaca ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=60; TAXLABELS Bursera_brunea_clone11 Bursera_brunea_clone12 Bursera_brunea_clone13 Bursera_brunea_clone4 Bursera_brunea_clone8 Bursera_discolor_clone1 Bursera_discolor_clone2 Bursera_discolor_clone3 Bursera_fagaroides_clone1 Bursera_fagaroides_clone5 Bursera_fagaroides_clone6 Bursera_frenningae_clone1 Bursera_frenningae_clone2 Bursera_frenningae_clone3 Bursera_gracilipes_clone2 Bursera_gracilipes_clone3 Bursera_gracilipes_clone4 Bursera_gracilipes_clone5 Bursera_inaguensis_clone1 Bursera_inaguensis_clone2 Bursera_inaguensis_clone3 Bursera_lancifolia_clone1 Bursera_lancifolia_clone2 Bursera_lancifolia_clone3 Bursera_longipes_clone1 Bursera_longipes_clone2 Bursera_longipes_clone3 Bursera_microphylla_clone1 Bursera_microphylla_clone6 Bursera_microphylla_clone7 Bursera_morelensis_clone1 Bursera_morelensis_clone2 Bursera_morelensis_clone3 Bursera_nashii_clone1 Bursera_nashii_clone2 Bursera_nashii_clone3 Bursera_odorata_clone1 Bursera_odorata_clone3 Bursera_odorata_clone5 Bursera_ovata_clone10 Bursera_ovata_clone11 Bursera_ovata_clone24 Bursera_ovata_clone2II Bursera_ovata_clone3 Bursera_ovata_clone3II Bursera_schlechtendalii_clone1 Bursera_schlechtendalii_clone2 Bursera_schlechtendalii_clone3 Bursera_simaruba_clone1 Bursera_simaruba_clone2 Bursera_simaruba_clone3 Bursera_simarubaDR_clone3 Bursera_simarubaDR_clone4 Bursera_simarubaDR_clone5 Bursera_spinescens_clone1 Bursera_spinescens_clone11 Bursera_spinescens_clone5 Bursera_tecomaca_clone1 Bursera_tecomaca_clone2 Bursera_tecomaca_clone3 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=30; TAXLABELS Bursera_brunea_clone11 Bursera_brunea_clone12 Bursera_brunea_clone13 Bursera_brunea_clone4 Bursera_brunea_clone8 Bursera_discolor Bursera_fagaroides Bursera_frenningae Bursera_gracilipes_clone2 Bursera_gracilipes_clone3 Bursera_gracilipes_clone4 Bursera_gracilipes_clone5 Bursera_inaguensis Bursera_lancifolia Bursera_longipes Bursera_microphylla Bursera_morelensis Bursera_nashii Bursera_odorata Bursera_ovata_clone10 Bursera_ovata_clone11 Bursera_ovata_clone24 Bursera_ovata_clone2II Bursera_ovata_clone3 Bursera_ovata_clone3II Bursera_schlechtendalii Bursera_simaruba Bursera_simarubaDR Bursera_spinescens Bursera_tecomaca ; END; BEGIN TAXA; TITLE Taxa4; DIMENSIONS NTAX=21; TAXLABELS Bursera_brunea_clone10 Bursera_brunea_clone8 Bursera_brunea_clone9 Bursera_discolor Bursera_fagaroides Bursera_frenningae Bursera_gracilipes_clone1 Bursera_gracilipes_clone3 Bursera_inaguensis Bursera_lancifolia Bursera_longipes Bursera_microphylla Bursera_morelensis Bursera_nashii Bursera_odorata Bursera_ovata Bursera_schlechtendalii Bursera_simaruba Bursera_simarubaDR Bursera_spinescens Bursera_tecomaca ; END; BEGIN TAXA; TITLE Taxa5; DIMENSIONS NTAX=27; TAXLABELS Bursera_brunea_clone1 Bursera_brunea_clone2 Bursera_brunea_clone5 Bursera_discolor Bursera_fagaroides Bursera_frenningae Bursera_gracilipes_clone1 Bursera_gracilipes_clone2 Bursera_gracilipes_clone3 Bursera_gracilipes_clone4 Bursera_gracilipes_clone5 Bursera_inaguensis Bursera_lancifolia Bursera_longipes Bursera_microphylla Bursera_morelensis Bursera_nashii Bursera_odorata Bursera_ovata_clone1 Bursera_ovata_clone2 Bursera_ovata_clone3 Bursera_ovata_clone5 Bursera_schlechtendalii Bursera_simaruba Bursera_simarubaDR Bursera_spinescens Bursera_tecomaca ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M773] TITLE ETS_condensed; LINK TAXA = Taxa3; DIMENSIONS NCHAR=370; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Bursera_brunea_clone11 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCTGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCATGCCCGTCTCGAGCCCACGGCCGTCCGGCCCGTCGGGTCTCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_brunea_clone12 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCTGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCATGCCCGTCTCGAGCCCACGGCCGTCCGGCCCGTCGGGTCTCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_brunea_clone13 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGATGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAACAACGCACTTGTCCATCGACGCGAACGACCGTCGCTCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_brunea_clone4 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAACAACGCACTTGTCCATCGACGCGAACGACCGTCGCTCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_brunea_clone8 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGATGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCTGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCATGCCCGTCTCGAGCCCACGGCCGTCCGGCCCGTCGGGTCTCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_discolor TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCTCACGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAGGCCTCGTGTTCCCGGCACGCCTCGCCCAGTTGCGTGGCTGCCCAGGCCCACGGGGCGCACTGCCCGTGCTCTCGGATGCGGAACGTTACGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCCTCGACACGAACGACCGTCGAACCCGTCTTGAGCGCGCGGCCGTACGGCCAGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_fagaroides TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGT{CT}TCGTTGGTCCCTCTCCGCCCCATGCCCT{AC}GCGGGTGGT-GGGGTGGACGTCAGGCAAGCC{CT}CGTGTTCCCGGCACGCCTCGCCCAGTTGCGTGGCTGCC{CT}AGGCCCACGGGGCGCGTTGCCCGTGCTCTCGGATGCGGAACGTTGTGCGCGGGCGTGGGGTCT{CT}TTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCCTCGACACGAACGACCGTCGAACC{CT}GTCTTGAGCACGCGGCCGCAC{GT}GCCGGTCGGGTCTCA{CT}GCGGGCGTCGGC{AG}TCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_frenningae TTCGGTATCCTGTGTTGCTTACCCATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCATCGCATTTGTCCATC{AG}ACACGAACGACCGTCACGCCCGTCTCGAGCCCAGGGTCGTCCGGCCCGTCGGGTATCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_gracilipes_clone2 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTTGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAG-TGCACCGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCCCCCGTCTCGGGCCCACGGCCGTCAGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_gracilipes_clone3 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCTGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCACTTGTCCATCGACGCGAACGACCGTCGCTCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_gracilipes_clone4 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCTGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCACTTGTCCATCGACGCGAACGACCGTCGCTCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_gracilipes_clone5 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTACCTCGGCCCACGAG-TGCACCGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCG-CGGCCGTTAGGCCAGTCGGGTCTCGTGCGGGCGTCAACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_inaguensis TTCGGTATCCTGTGTTGCTTACCCATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGCGGGGTCTGTCGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCACGCCCGTCTCGAGCCCAGGGCCGTCCGGCCCGTCGGGTATCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_lancifolia TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGTTGGTTTCGTCGGTCCCT{CT}TCCGCCCCACGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCTGGCACGCCTCGCCCAGCTGCGTGGCTGCCTCGGCCCACGGGGCGCATTGCCCGTGCTCTCGGATGCGGAACGTCATGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCATCGACACGAACGACGGTCGCGCCCGTCTTGAGCCC---------------GTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_longipes TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCGGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_microphylla TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGATGGTTTCGTTGGTCCCTTTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGGGGCGCATT{CG}CCCGTGCTCT{AC}GGATGCGGAACGTTACGCGCGGGCGTGGG{CG}TCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGT{CG}GCGTCCGTCTTGAGCCCGCGGCCGTACGGCCCGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_morelensis TTCGGTATCCTGTGTTGCTTACCTAT{CT}GAAAGGAATCCGACGGTTCGGTTGGTCCCTTTCCGCCCCA{CT}GCCCTCGCGGGTT{AG}T-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGGGGCGCATTGCCCGTGCTCTCGGATGCGGAACGTTACGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCAATCGACACGAACGACTGTCGTGCCCGTCTTGAGCCCGCGGCCGTACGGCCCGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_nashii TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGATGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCC{CT}GTGCTCTCGGATGCGGAACGTTATGCGCGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCATGCCCGTCTCGAGCCCACGGCCGTCCGGCCCGTCGGGTCTCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_odorata TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTTTCCGCCCCATGCCCTCGCGGGTGGT-GGGGTGGACGT{AC}AGGCAAGCCTCGTGTTCCCGGCACGCCTCGCCCAGTTGCGCGGCTGCCCAGGCCCACGGGGCGCATTGCCCGTGCTCTCGGATGCGGAACGTTACGCGCGGGCGTGGGGTCTT{CT}TGGCTCCGTCGGCCCGAGCAACGCATTTGTCCCTCGACACGAACGACCGTCGAACCCGTCTTGAGCGCGCGGCCGTACGGCCAGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_ovata_clone10 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCGGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGTGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAATGACCGTCGCGCCCGTCTCGAGCCG-CGGCCGTTAGGCCAGTCGGGTCTCGTGCGGGCGTCAACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_ovata_clone11 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAG-TGCACCGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCCACGGCCGTCAGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_ovata_clone24 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCGGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCCACGGCCGTCAGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_ovata_clone2II TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAG-TGCACCGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCG-CGGCCGTTAGGCCAGTCGGGTCTCGTGCGGGCGTCAACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_ovata_clone3 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCGGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCCACGGCCGTCAGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_ovata_clone3II TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAG-TGCACCGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCCACGGCCGTCAGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_schlechtendalii TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTGGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCCTCGCCCAGTTGCGTGGCTGCC{CG}AGGCCCACGGGGCGCGTTGCCCGTGCTCTCGGATGCGGAACGTTGTGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATT{GT}GTCCCTCGACACGAACGACCGTCGAACCCGTCTTGAGCAC--------------------GTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_simaruba TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACG{AG}GGTGCACTGCC{CT}GTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGC{CT}CGAACAACGCACTTGTCCATCGACGCGAACGACCGTCGCTCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_simarubaDR TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATC{AG}GACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCC{CT}GGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCACTTGTCCATCGACGCGAACGACCGTCGCTCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_spinescens TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCG{AG}CACGCTTCGCCCAGTTGCGTGGCTGC{AC}TCGGCCCACGAG-TGCACCGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCCACGGC{CT}GTCAGGCCCGTCGGGTCTCG{CT}GCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_tecomaca TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGATGGTTTCGTTCGTCCCTTTCCGCCCCCTGCCCTCACGGGTTTTCGGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCATGCTTCGCCCAGCTGCGTCGCTGCCTCGGCCCATGAGGTGCTTTGCCCGTGCTCTCGGATGCGGAATGTTATGTGCGGGCGTGGGGTCTCTTGGCTCCGTTTGCCCAAGCAACGCATTTGTCCATCGACACGAACGACTGCCGTGCCCGTCTTGAGCCCGCGG{ACT}CGTACGGCCCGTCGGG{CT}CTCATGCGGGCGT{AC}GGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M144] TITLE rps16_intron; LINK TAXA = Taxa1; DIMENSIONS NCHAR=842; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Bursera_brunea_clone1I AGATGTAGATAAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAATGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTTT-CTTCTTTTTCGAAAAAGAAGAAAAAAAA-TATTCGTACTCCCCTAACTCAAGTTAGATAACTTTCAAACAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTTTCAATTCCAAATAATTTTCTTTTTGGATTTTAAAAATTTCTCGAATTGGATACTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTTCATCATGTACTATTTACATTACAACTCAACAAAAAACATTGGCGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCT-GATAATATAAAATGGGAA-TGGGGGATGTAAAA Bursera_brunea_clone2II AGATGTAGATAAACAATACCCCCCC-TAGAAACGTATAAAAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAATGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTTT-CTTCTTTTTCGAAAAAGAAGAAAAAAAA-TATTCGTACTCCCCTAACTCAAGTTAGATAACTTTCAAACAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTTTCAATTCCAAATAATTTTCTTTTTGGATTTTAAAAATTTCTCGAATTGGATACTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTTCATCATGTACTATTTACATTACAACTCACCAAAAAACATTGGCGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCT-GATAATATAAAATGGGAA-TGGGGGATGTAAAA Bursera_brunea_clone3I AGATGTAGATAAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAATGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTTT-CTTCTTTTTCGAAAAAGAAGAAAAAAAA-TATTCGTACTCCCCTAACTCAAGTTAGATAACTTTCAAACAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTTTCAATTCCAAATAATTTTCTTTTTGGATTTTAAAAATTTCTCGAATTGGATACTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTTCATCATGTACTATTTACATTACAACTCAACAAAAAACATTGGCGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCT-GATAATATAAAATGGGAA-TGGGGGATGTAAAA Bursera_discolor AGATGTAGATGAACAATACCCCCCCCTAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAACGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTT--CTTCTTTTTCGAAAAAGAAGAAAAAAAAATATTCGTACTCTCCTAACTCAAGTTGGATAACTTTCAAATAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGGGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATGGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTACCAATTCCAAATAATTTTCCTTTTGGATTTTCAAAATTTCTCGAATTGGATCCTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCATGTACTATTTACATTACAACTCAACAAAAAACATTGGCGAGGATTGTAGTAGAACGGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCTAGATAATATAAAATGGAAAATGGTGGATGTAAAA Bursera_fagaroides AGATGTAGATGAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAACGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTT--CTTCTTTTTCGAAAAAGAAGAAAAAAA--TATTCGTACTCTCCTAACTCAAGTTGGATAACTTTCAAATAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTACCAATTCCAAATAATTTTCCTTTTGGATTTTAAAAATTTCTCGAATTGGATCCTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCCTGTACTATTTACATTACAACTCAACAAAAAACATTGGCGAGGATTGTAGTAGAATAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTACTAGATAATATAAAATGGAAAATGGTGGATGTAAAA Bursera_frenningae AGATGTAGATAAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAATGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTTT-CTTCTTTTTCGAAAAAGAAGAAAAAAAA-TATTCGTACTCTCCTAACTCAAGTTAGATAACTTTCAAACAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTTTCAATTCCAAATAATTTTCTTTTTGGATTTTAAAAATTTCTCGAATTGGATACTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCATGTACTATTTACATTACAACTCAACAAAAAACATTGGCGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCT-GATAATATAAAATGGGAA-TGGTGGATGTAAAA Bursera_gracilipes_clone2I AGATGTAGATAAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAATGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTTT-CTTCTTTTTCGAAAAAGAAGAAAAAAAA-TATTCGTACCCTCCTAACTCAAGTTGGATAACTTTCAAACAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTTTCAATTCCAAATAATTTTCCTTTTGGATTTTCAAAATTTCTCGAATTGGATCCTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCATGTACTATTTACATTACAATTCAACAAAAAACATTGGCGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCT-GATAATAGAAAATGGAAAATGGTGGATGTAAAA Bursera_gracilipes_clone2II AGATGTAGATAAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAATGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTTT-CTTCTTTTTCGAAAAAGAAGAAAAAAAA-TATTCGTACCCTCCTAACTCAAGTTGGATAACTTTCAAACAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTTTCAATTCCAAATAATTTTCCTTTTGGATTTTCAAAATTTCTCGAATTGGATCCTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCATGTACTATTTACATTACAATTCAACAAAAAACATTGGCGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCT-GATAATAGAAAATGGAAAATGGTGGATGTAAAA Bursera_gracilipes_clone3I AGATGTAGATAAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAATGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTTT-CTTCTTTTTCGAAAAAGAAGAAAAAAAA-TATTCGTACTCTCCTAACTCAAGTCGGATAACTTTCAAACAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGGATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTTTCAATTCCAAATAATTTTCCTTTTGGATTTTCAAAATTTCTCGAATTGGATCCTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCATGTACTATTTACATTACAATTCAACAAAAAACATTGGCGAGGATTGTAGTAGAACAGAACAAA-GATGTCGAGCCAAGAGCCCATTCATTCCT-GATAATAGAAAATGGAAAATGGTGGATGTAAAA Bursera_inaguensis AGATGTAGATAAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAATGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTTT-CTTCTTTTTCGAAAAAGAAGAAAAAAAA-TATTCGTACTCTCCTAACTCAAGTTAGATAACTTTCAAACAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTTTCAATTCCAAATAATTTTCTTTTTGGATTTTAAAAATTTCTCGAATTGGATACTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCATGTACTATTTACATTACAACTCAACAAAAAACATTGGCGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCT-GATAATATAAAATGGGAA-TGGTGGATGTAAAA Bursera_lancifolia AGATGTAGATGAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAACGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTT--CTTCTTTTTCGAAAAAGAAGAAAAAAAG-TATTCGTACTCTCCTAACTCAAGTTGGATAACTTTCAAATAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTACCAATTCCAAATAATTTTCCTTTTGGATTTTAAAAATTTCTCGAATTGGATCCTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCATGTACTATTTACATTACAACTCAACAAAAAACATTGGCGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCTAGATAATATAAAATGGAAAATGGTGGATGTAAAA Bursera_longipes AGATGTAGATGAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAATGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTTT-CTTCTTTTTCGAAAACGAAGAAAAAAA--TATTCGTACTCTCCTAACTCAAGTTGGATAACTTTCAAACAGCCCCAAAAAAAATCCTTAGGCAATCTACTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTATTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACGCACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTACCAATTCCAAATAATTTTCCTTTTGGATTTTAAAAATTTATCGAATTGGATCCTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCATGTACTATTTACATTACAACTCAACAAAAAACATTGGTGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCTAGATAATATAAAATGGAAAATGGTGGATGTAAAA Bursera_microphylla AGATGTAGATGAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAACGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTT--CTTCTTTTTCGAAAAAGAAGAAAAAAAAATATTCGTACTCTCCTAACTCAAGTTGGATAACTTTCAAATAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCGTACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTACCAATTCCAAATAATTTTCCTTTTGGATTTTAAAAATTTCTCGAATTGGATCCTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCATGTACTATTTACATTACAACTCAACAAAAAACATTGACGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCTAGATAATATAAAATGGAAAATGGTGGATGTAAAA Bursera_morelensis AGATGTAGATGAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAACGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTT--CTTCTTTTTCGAAAAAGAAGAAAAAAAA-TATTCGTACTCTCCTAACTCAAGTTGGATAACTTTCAAATAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTT-GTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTACCAATTCCAAATAATTTTCCTTTTAGCTTTTTAAAATTTCTCGAATTGGATCCTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTCCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAAAAATAAATAAATACTTTCTACTCGAGCTCCATCATGTACTATTTACATTACAACTCAACAACAAACATTGGCGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCTAGATAATATAAAATGGAAAATGGTGGATGTAAAA Bursera_nashii AGATGTAGATAAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAATGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTTT-CTTCTTTTTCGAAAAAGAAGAAAAAAAA-TATTCGTACTCTCCTAACTCAAGTTAGATAACTTTCAAACAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTTTCAATTCCAAATAATTTTCTTTTTGGATTTTAAAAATTTCTCGAATTGGATACTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTTCATCATGTACTATTTACATTACAACTCAACAAAAAACATTGGCGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCT-GATAATATAAAATGGGAA-TGGTGGATGTAAAA Bursera_odorata AGATGTAGATGAACAATACCCCCCC-TAGAAACGTATA{AG}{AG}AAGTT-GTCTCCTCGTACGGCTCGAGAAAAAACGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTT--CTTCTTTTTCGAAAAAGAAGAAAAAAAAATATTCGTACTCTCCTAACTCAAGTTGGATAACTTTCAAATAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCGTACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTACCAATTCCAAATAATTTTCCTTTTGGATTTTAAAAATTTCTCGAATTGGATCCTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCATGTACTATTTACATTACAACTCAACAAAAAACATTGACGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCTAGATAATATAAAATGGAAAATGGTGGATGTAAAA Bursera_ovata AGATGTAGATGAACAATACCCCCCC-TAGAAACGTATAAGAAGTTTGTCTCCTCGTACGGCTCGAGAAAAAATGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTTTTCTTCTTTTTCGAAAAAGAAGAAAAAAAA-TATGCGTACTCTCCTAACTCAAGTTGGATAACTTTCAAACAGCCCCCAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTATGGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTT--AAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTACCAATTCCAAATAATTT-CCCTTTGGATTTTAAAAATTTCTCGAATTGGATCCTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCATGTACTATTTACATTACAACTCAACAAAAAACATTGGTGAGGATTGTAGTATAACAGAACAAAGGATGTCGAGCCAAGAGACCATTCATTCCTAGATAATATAAAATGGAAAATGGTGGATGTAAAA Bursera_schlechtendalii AGATGTAGATGAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAACGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTT--CTTCTTTTTCGAAAAAGAAGAAAAAAA--TATTCGTACTCTCCTAACTCAAGTTGGATAACTTTCAAATAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTACCAATTCCAAATAATTTTCCTTTTGGATTTTAAAAATTTCTCGAATTGGATCCTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCCTGTACTATTTACATTACAACTCAACAAAAAACATTGGCGAGGATTGTAGTAGAATAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTACTAGATAATATAAAATGGAAAATGGTGGATGTAAAA Bursera_simaruba AGATGTAGATGAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAATGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTTT-CTTCTTTTTCGAAAAAGAAGAAAAAAAA-TATTCGTACTCTCCTAACTCAAGTTGGATAACTTTCAAACAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTATTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTACCAATTCCAAATAATTTTCCTTTTGGATTTTAAAAATTTCTCGAATTGGATCCTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCATGTACTATTTACATTACAACTCAACAAAAAACATTGGTGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCTAGATAATATAAAATGGAAAATGGTGGATGTAAAA Bursera_simarubaDR AGATGTAGATGAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAATGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTT--CTTCTTTTTCGAAAAAGAAGAAAAAAAA-TATTCGTACTCTCCTAACTCAAGTTGGATAACTTTCAAACAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTATTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTACCAATTCCAAATAATTTTCCTTTTGGATTTTAAAAATTTCTCGAATTGGATCCTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCATGTACTATTTACATTACAACTCAACAAAAAACATTGGTGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCTAGATAATATAAAATGGAAAATGGTGGATGTAAAA Bursera_spinescens AGATGTAGATAAACAATACCCCCCC-TAGAAACGTATAAGGAGTTT-TCTCCTCGTACGGCTCGAGAAAAAATGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTTT-CTTCTTTTTCGAAAAAGAAGAAAAAAAA-TATTCGTACTCTCCTAACTCAAGTTGGATAACTTTCAAACAGCCCCAAAAAAAATCCTTAGGCAATCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTTTCAATTCCAAATAATTTTCCTTTTGGATTTTCAAAATTTCTCGAATTGGATCCTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCATGTACTATTTACATTACAATTCAACAAAAAACATTGGCGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCT-GATAATATAAAATGGAAAATGGTGGATGTAAAA Bursera_tecomaca AGATGTAGATGAACAATACCCCCCC-TAGAAACGTATAAGAAGTTT-TCTCCTCGTACGGCTCGAGAAAAAATGATTCGAAGTTATTATGTATCAAATTCGAATGTCAACTAGATCTATAAAATCATCAAATCAATTCGAGATTTAAGTCCTTCTTTTTTTTT-CTTCTTTTTCGAAAAAGAAGAAAAAAAAATATTCGTACTCTCCTAACTCAAGTTGGATAACTTTCAAATAGCCCCAAAAAAAATCCTTAGGCACTCTCCTTTTTTGAGTGGTCTCTAACCCCCTTTTTGTTTGTCTCCTTTCGAATCTATTTGTGGATTCTTCATTCTGGATCTAATTGTTGAGACAATTGGAAACGGTATTTCCTTGTTCCAGGATCTTTTATCTTTGTCTTGAATCATTGGGTTTAGACATTACTTCGGTGATCTTTAATCGTTTTAAAAAACGGCAGCAACACACCCCTTTTTGTGATTTCTTTCTATCAAAGAATCATACGAACAATTGATTCTTGCATGATACACTTTTGATCGAAAGAGTTTTACCAATTCCAAAGAATTTTCCTTTTGGATTTTAAAAATTTCTCGAATTGGATCCTTTCGATTTCTATATCAAAAAATATACTTACGAAGTTTGTTCCAACCTATTAATTGGTATTAACCCTAGACCCTTGCCCCTGAGAAATAAATAAATACTTTCTACTCGAGCTCCATCATGTACTATTTACATTACAACTCAACAAAAAACATTGGCGAGGATTGTAGTAGAACAGAACAAAGGATGTCGAGCCAAGAGCCCATTCATTCCTAGATAATAGAAAATGGAAAATGGTGGATGTAAAA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M771] TITLE 'psbA-trnH spacer'; LINK TAXA = Taxa4; DIMENSIONS NCHAR=557; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Bursera_brunea_clone10 CCTTGATCCACTTGGCTACATCCGCCCCCTACACTACTTCGATTTAAATATAAATAAAAAAATCCAAAGATTTCTATTTAT-------ATCATTTTTT---------AATCATCATTC-------TTTTTTATCTTAACGTATGAAGATAGAAATTCAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTT----ATATTATTCTATATATTCGATTAGTTTATATATATTAGTATATTAAGTTAGTATATTAAGGATATAAGGAAGGGACTCAATCAAAGGCATAAAAATACTTTTGTTTTGTTGAAAAC---------------------------------------AAGGATATGGAAAGAAAAAA-GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_brunea_clone8 CCTTGATCCACTTGGCTACATCCGCCCCCTACACTACTTCGATTTAAATATAAATAAAAAAATCCAAAGATTTCTATTTAT-------ATCATTTTTT---------AATCATCATTC-------TTTTTTATCTTAACGTATGAAGATAGAAATTCAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTT---ATATTATTCTATATATTCGATTAGTTTATATATATTAGTATATTAAGTTAGTATATTAAGGATATAAGGAAGGGACTCAATCAAAGGCATAAAAATACTTTTGTTTTGTTGAAAAC---------------------------------------AAGGATATGGAAAGAAAAAA-GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_brunea_clone9 CCTTGATCCACTTGGCTACATCCGCCCCCTACACTACTTCGATTTAAATATAAATAAAAAAATCCAAAGATTTCTATTTAT-------ATCATTTTTT---------AATCATCATTC-------TTTTTTATCTTAACGTATGAAGATAGAAATTCAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTT---ATATTATTCTATATATTCGATTAGTTTATATATATTAGTATATTAAGTTAGTATATTAAGGATATAAGGAAGGGACTCAATCAAAGGCATAAAAATACTTTTGTTTTGTTGAAAAC---------------------------------------AAGGATATGGAAAGAAAAAA-GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_discolor CCTTGATCCACTTGGCTACATCCGCCCC-TACACTATTTCGATTTAAA------TAAAAAAATCCAAAGATTTCAATTTCT-------AGCATTTTTT---------GATCATCATTC-------TTTTTTATCTTAACTTATGAAGATAGAAATTTAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTTTTTCTATTATTCTATATATTGGATTAGTCTATAATTATTAGTATAT----------------------AAGGAAGGGACTAAATCAAAGGCATAAAAATACTTGTGTTTTGTTGAAAAC---------------------------------------AAAGATATGGAAAAAAAAA--GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_fagaroides CCTTGATCCACTTGGCTACATCCGCCCC-TACACTATTTCGATTTAAA------TAAAAAAATAAAAAGATTTCAATTTCT-------AGCATTTTTT---------GATCATCATTC-------TTTTTTATCTTAACTTATGAAGATAGAAATTTAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATAGTAGTTTTTTTTT--CTATTATTCTATATATTGGATTAGTCTATAATTATTAGACTAT----------------------AAGGAAGGGACTAAATCAAAGGCATAAAAATACTTGTGTTTTGTTGAAAAC---------------------------------------AAAGATATGGAAAAAAAA---GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_frenningae CCTTGATCCACTTGGCTACATCCGCCCCCTACACTACTTCGATTTAAATATAAATAAAAAAATCCAAAGATTTCTATTTAT-------ATCATTTTTT---ATTTTTAATCATCATTC-------TTTTTTATCTTAACGTATGAAGATAGAAATTCAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTT---ATATTATTCTATATATTCGATTAGTTTATATATATTAGTATATTAAGTTAGTATATTAAGGATATAAGGAAGGGACTCAATCAAAGGCATAAAAATACTTTTGTTTTGTTGAAAAC---------------------------------------AAGGATATGGAAAGAAAAAA-GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_gracilipes_clone1 CCTTGATCCACTTGGCTACATCCGCCCC-TACACTACTTCGATTTAAA------TAAAAAAATCCAAAGATTTCTATTTAT-------ATCATTTTTT---------GATCATCATTC-------TTTTTTATCTTAACTTATGAAGATAGAAATTCAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTT---ATATTATTCTATATATTCGATTAGTCTATAATTATCAGTATATT-------------AAGGATATAAGGAAGGGACTCAATCAAAGGCATAAAAAAACTTTTGTTTTGTTGAAAAC---------------------------------------AAGGATATGGAAAGAAAAAA-GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGTTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGCGCTTCAATAGCAG Bursera_gracilipes_clone3 CCTTGATCCACTTGGCTACATCCGCCCC-TACACTACTTCGATTTAAA------TAAAAAAATCCAAAGATTTCTATTTAT-------ATCATTTTTT---------GATCATCATTC-------TTTTTTATCTTAACTTATGAAGATAGAAATTCAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTT---ATATTATTCTATATATTCGATTAGTCTATAATTATTAGTATATT-------------AAGGATATAAGGAAGGGACTCAATCAAAGGCATAAAAAAACTTTTGTTTTGTTGAAAAC---------------------------------------AAGGATATGGAAAGAAAAAA-GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGTTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGCGCTTCAATAGCAG Bursera_inaguensis CCTTGATCCACTTGGCTACATCCGCCCCCTACACTACTTCGATTTAAATATAAATAAAAAAATCCAAAGATTTCTATTTAT-------ATCATTTTTT---------AATCATCATTC-------TTTTTTATCTTAACGTATGAAGATAGAAATTCAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTT---ATATTATTCTATATATTCGATTAGTTTATATATATTAGTATATTAAGTTAGTATATTAAGGATATAAGGAAGGGACTCAATCAAAGGCATAAAAATACTTTTGTTTTGTTGAAAAC---------------------------------------AAGGATATGGAAAGAAAAAA-GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_lancifolia CCTTGATCCACTTGGCTACATCCGCCCC-TACACATATTCGATTTAAA------TAAAAAAATCAAAAGATTTCAATTTAT-------AGCATTTTTT---------GATCATCATTC-------TTTTTTATCTTAACTTATGAAGATAGAAATTTAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTTTT-CTATTATTCTATATATTGGATTAGTCTATAATTATTAGTATAT----------------------AAGGAAGGGACTAAATCAAAGGCATAAAAATACTTGTGTTTTGTTGAAAACAAAGATAAGGCATAAAAATACTTGTGTTTTGTTGAAAACAAAGATATGGAAAAAAAAA--GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_longipes CCTTGATCCACTTGGCTACATCCGCCCC-TACACTATTTCGATTTAAA------TAAAAAAATCCAAAGATTTCAATTTCT-------ATCATTTTTT---------GATCATCATTC-------TTTTTTATCTTAACTTATGAAGATAGAAATTCAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTT---CTATTATTCTATATATTCGATTCGTCTATAATTATTAGTATATT---------------------AAGGAAGGGACTAAATCAAAGGCATAAAAATACTTTTGTTTTGTTGAAAAC---------------------------------------AAGGATATGGAAAGAAAAAA-GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_microphylla CCTTGATCCACTTGGCTACATCCGCCCC-TACACTATTTCGATTTAAA------TAAAAAAATCCAAAGATTTCAATTTCT-------AGCATTTTTT---------GATCATCATTC-------TTTTTTATCTTAACTTATGAAGTTAGAAATTTAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTT---CTATTATTCTATATATTGGATTAGTCTATAATTATTAGTATAT----------------------AAGGAAGGGACTAAATCAAAGGAATAAAAATACTTGTGTTTTGTTGAAAAC---------------------------------------AAAGATATGGAAAAAAAAAA-GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_morelensis CCTTGATCCACTTGGCTACATCCGCCCC-TACACTATTTCGATTTAAA------TAAAAAAATCCAAAGATTTCAATTTAT-------AGCATTTTTT---------GATCATCATTC-------TTTTTTATCTTAACTTATGAAGATAAAAATTTAGATCCAAGAGGTATAAAATTGCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTT---CTATTATTCTATATATTGGATTAGTCTATAATTATTAGTATAT----------------------AAGGAAGGGACTAAATCAAAGGCATAAAAATACTTGTGTTTTGTTGAAAAC---------------------------------------AAAGATATGGAAAAAAAAA--GTACTAAAGAAAAAAAAACTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_nashii CCTTGATCCACTTGGCTACATCCGCCCCCTACACTACTTCGATTTAAATATAAATAAAAAAATCCAAAGATTTCTATTTAT-------ATCATTTTTT---------AATCATCATTC-------TTTTTTATCTTAACGTATGAAGATAGAAATTCAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTT---ATATTATTCTATATATTCGATTAGTTTATATATATTAGTATATTAAGTTAGTATATTAAGGATATAAGGAAGGGACTCAATCAAAGGCATAAAAATACTTTTGTTTTGTTGAAAAC---------------------------------------AAGGATATGGAAAGAAAAAA-GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_odorata CCTTGATCCACTTGGCTACATCCGCCCC-TACACTATTTCGATTTAAA------TAAAAAAATCCAAAGATTTCAATTTCT-------AGCATTTTTT---------GATCATCATTC-------TTTTTTATCTTAACTTATGAAGATAGAAATTTAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTT---CTATTATTCTATATATTGGATTAGTCTATAATTATTAGTATAT----------------------AAGGAAGGGACTAAATCAAAGGAATCAAAATACTTGTGTTTTGTTGAAAAC---------------------------------------AAAGATATGGAAAAAAAAAAAGTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_ovata CCTTGATCCACTTGGCTACATCCGCCCC-TACACTATTTCGATTTAAA------TAAAAAAATCCAAAGATTTCAATTTCT-------ATCATTTTTT---------GATCATCATTC-------TTTTTTATCTTAACTTATGAAGTTAGAAATTCAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTTT--ATATTATTCTATATATTCGATTCGTCCTTAATTATTAGCATAT----------------------AAGGACGGGACTAAATCAAAGGCATAAAAATACTTTTGTTTTGTTGAAAAC---------------------------------------AAGGATATGGAAAGAAAAAA-GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_schlechtendalii CCTTGATCCACTTGGCTACATCCGCCCC-TACACTATTTCGATTTAAA------TAAAAAAATAAAAAGATTTCAATTTCT-------AGCATTTTTT---------GATCATCATTC-------TTTTTTATCTTAACTTATGAAGATAGAAATTTAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATAGTAGTTTTTTTTT--CTATTATTCTATATATTGTATTAGTCTATAATTATTAGACTAT----------------------AAGGAAGGGACTAAATCAAAGGCATAAAAATACTTGTGTTTTGTTGAAAAC---------------------------------------AAAGATATGGAAAAAAAA---GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_simaruba CCTTGATCCACTTGGCTACATCCGCCCC-TACACTATTTCGATTTAAA------TAAAAAAATCCAAAGATTTCAATTTCT-------ATCATTTTTT---------GATCATCATTC-------TTTTTTATCTTAACTTATGAAGATAGAAATTCAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTT----CTATTATTCTATATATTCGATTCGTCTATAATTATTAGTATATT---------------------AAGGAAGGGACTAAATCAAAGGCATAAAAATACTTTTGTTTTGTTGAAAAC---------------------------------------AAGGATATGGAAAGAAAAAA-GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGAACCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_simarubaDR CCTTGATCCACTTGGCTACATCCGCCCC-TACACTATTTCGATTTAAA------TAAAAAAATCCAAAGATTTCAATTTCT-------ATCATTTTTT---------GATCATCATTT-------TTTTTTATCTTAACTTATGAAGATAGAAATTCAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTT---CTATTATTCTATATATTCGATTCGTCTATAATTATTAGTATATT---------------------AAGGAAGGGACTAAATCAAAGGCATAAAAAAACTTTTGTTTTGTTGAAAAC---------------------------------------AAGGATATGGAAAGAAAAAA-GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGAGCTTCAATAGCAG Bursera_spinescens CCTTGATCCACTTGGCTACATCCGCCCC-TACACTACTTCGATTTAAA------TAAAAAAATCCAAAGATTTCTATTTAT-------ATCATTTTTT---------GATCATCATTC-------TTTTTTATCTTAACTTATGAAGATAGAAATTCAGATCCAAGAGGCATAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTT---ATATTATTCTATATATTCGATTAGTCTATAATTATTAGTATATT-------------AAGGATATAAGGAAGGGACTCAATCAAAGGCATAAAAAAACTTTTGTTTTGTTGAAAAC---------------------------------------AAGGATATGGAAAGAAAAAA-GTACTAAAGAAAAA----CTAGTAAATAGCAATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGTTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGATGGCGCTTCAATAGCAG Bursera_tecomaca CCTTGATCCACTTGGCTACATCCGCCCC-TACACTATTTCGATTTAAA------TAAAAAAATCCAAAGATTTCAATTTCTAGCATTGATCATT-------ATTTTTGATCATCATTCTTTATTCTTTTTTATCTTAACTTATAAAGATAGAAATTCAGATCCAAGAGGCAGAAAATTCCAACTTTTATCTTTTTATCTAATCGATTCTAGTTTCTATATTAGTTTTTTTT---CTATTATTCTATATATTCGATTAGTCTATAATTATAT--ATATT----------ATT----ATATAAGGAAGGGACTAAATAAAAGGCATAAAAAGACTTTTGTTTTGTTGAAAAC---------------------------------------AAAGATATGGAAAGAAAAAA-GTACTAAAGAAAAA----CTACTAAATAGCGATAACGGAACAATACCGACCCTCTTGCAAGAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACAAAGACCGAAATCTTATCCATTTGTAGACGGAGCTTCAATAGCAG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M770] TITLE ETS_all_clones; LINK TAXA = Taxa2; DIMENSIONS NCHAR=370; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Bursera_brunea_clone11 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCTGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCATGCCCGTCTCGAGCCCACGGCCGTCCGGCCCGTCGGGTCTCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_brunea_clone12 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCTGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCATGCCCGTCTCGAGCCCACGGCCGTCCGGCCCGTCGGGTCTCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_brunea_clone13 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGATGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAACAACGCACTTGTCCATCGACGCGAACGACCGTCGCTCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_brunea_clone4 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAACAACGCACTTGTCCATCGACGCGAACGACCGTCGCTCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_brunea_clone8 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGATGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCTGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCATGCCCGTCTCGAGCCCACGGCCGTCCGGCCCGTCGGGTCTCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_discolor_clone1 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCTCACGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAGGCCTCGTGTTCCCGGCACGCCTCGCCCAGTTGCGTGGCTGCCCAGGCCCACGGGGCGCACTGCCCGTGCTCTCGGATGCGGAACGTTACGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCCTCGACACGAACGACCGTCGAACCCGTCTTGAGCGCGCGGCCGTACGGCCAGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_discolor_clone2 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCTCACGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAGGCCTCGTGTTCCCGGCACGCCTCGCCCAGTTGCGTGGCTGCCCAGGCCCACGGGGCGCACTGCCCGTGCTCTCGGATGCGGAACGTTACGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCCTCGACACGAACGACCGTCGAACCCGTCTTGAGCGCGCGGCCGTACGGCCAGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_discolor_clone3 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCTCACGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAGGCCTCGTGTTCCCGGCACGCCTCGCCCAGTTGCGTGGCTGCCCAGGCCCACGGGGCGCACTGCCCGTGCTCTCGGATGCGGAACGTTACGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCCTCGACACGAACGACCGTCGAACCCGTCTTGAGCGCGCGGCCGTACGGCCAGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_fagaroides_clone1 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTGGT-GGGGTGGACGTCAGGCAAGCCCCGTGTTCCCGGCACGCCTCGCCCAGTTGCGTGGCTGCCCAGGCCCACGGGGCGCGTTGCCCGTGCTCTCGGATGCGGAACGTTGTGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCCTCGACACGAACGACCGTCGAACCCGTCTTGAGCACGCGGCCGCACGGGCGGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_fagaroides_clone5 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCT{AC}GCGGGTGGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCCTCGCCCAGTTGCGTGGCTGCCCAGGCCCACGGGGCGCGTTGCCCGTGCTCTCGGATGCGGAACGTTGTGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCCTCGACACGAACGACCGTCGAACC{CT}GTCTTGAGCACGCGGCCGCAC{GT}GCCGGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_fagaroides_clone6 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTCTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTGGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCCTCGCCCAGTTGCGTGGCTGCCTAGGCCCACGGGGCGCGTTGCCCGTGCTCTCGGATGCGGAACGTTGTGCGCGGGCGTGGGGTCTCTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCCTCGACACGAACGACCGTCGAACCCGTCTTGAGCACGCGGCCGCACGGCCGGTCGGGTCTCACGCGGGCGTCGGCATCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_frenningae_clone1 TTCGGTATCCTGTGTTGCTTACCCATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCATCGCATTTGTCCATCGACACGAACGACCGTCACGCCCGTCTCGAGCCCAGGGTCGTCCGGCCCGTCGGGTATCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_frenningae_clone2 TTCGGTATCCTGTGTTGCTTACCCATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCATCGCATTTGTCCATCGACACGAACGACCGTCACGCCCGTCTCGAGCCCAGGGTCGTCCGGCCCGTCGGGTATCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_frenningae_clone3 TTCGGTATCCTGTGTTGCTTACCCATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCATCGCATTTGTCCATCAACACGAACGACCGTCACGCCCGTCTCGAGCCCAGGGTCGTCCGGCCCGTCGGGTATCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_gracilipes_clone2 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTTGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAG-TGCACCGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCCCCCGTCTCGGGCCCACGGCCGTCAGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_gracilipes_clone3 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCTGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCACTTGTCCATCGACGCGAACGACCGTCGCTCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_gracilipes_clone4 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCTGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCACTTGTCCATCGACGCGAACGACCGTCGCTCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_gracilipes_clone5 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTACCTCGGCCCACGAG-TGCACCGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCG-CGGCCGTTAGGCCAGTCGGGTCTCGTGCGGGCGTCAACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_inaguensis_clone1 TTCGGTATCCTGTGTTGCTTACCCATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGCGGGGTCTGTCGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCACGCCCGTCTCGAGCCCAGGGCCGTCCGGCCCGTCGGGTATCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_inaguensis_clone2 TTCGGTATCCTGTGTTGCTTACCCATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGCGGGGTCTGTCGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCACGCCCGTCTCGAGCCCAGGGCCGTCCGGCCCGTCGGGTATCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_inaguensis_clone3 TTCGGTATCCTGTGTTGCTTACCCATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGCGGGGTCTGTCGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCACGCCCGTCTCGAGCCCAGGGCCGTCCGGCCCGTCGGGTATCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_lancifolia_clone1 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGTTGGTTTCGTCGGTCCCTTTCCGCCCCACGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCTGGCACGCCTCGCCCAGCTGCGTGGCTGCCTCGGCCCACGGGGCGCATTGCCCGTGCTCTCGGATGCGGAACGTCATGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCATCGACACGAACGACGGTCGCGCCCGTCTTGAGCCC---------------GTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_lancifolia_clone2 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGTTGGTTTCGTCGGTCCCTCTCCGCCCCACGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCTGGCACGCCTCGCCCAGCTGCGTGGCTGCCTCGGCCCACGGGGCGCATTGCCCGTGCTCTCGGATGCGGAACGTCATGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCATCGACACGAACGACGGTCGCGCCCGTCTTGAGCCC---------------GTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_lancifolia_clone3 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGTTGGTTTCGTCGGTCCCTTTCCGCCCCACGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCTGGCACGCCTCGCCCAGCTGCGTGGCTGCCTCGGCCCACGGGGCGCATTGCCCGTGCTCTCGGATGCGGAACGTCATGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCATCGACACGAACGACGGTCGCGCCCGTCTTGAGCCC---------------GTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_longipes_clone1 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCGGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_longipes_clone2 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCGGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_longipes_clone3 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCGGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_microphylla_clone1 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGATGGTTTCGTTGGTCCCTTTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGGGGCGCATTGCCCGTGCTCTCGGATGCGGAACGTTACGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGTCCGTCTTGAGCCCGCGGCCGTACGGCCCGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_microphylla_clone6 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGATGGTTTCGTTGGTCCCTTTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGGGGCGCATTCCCCGTGCTCTAGGATGCGGAACGTTACGCGCGGGCGTGGGCTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGTCCGTCTTGAGCCCGCGGCCGTACGGCCCGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_microphylla_clone7 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGATGGTTTCGTTGGTCCCTTTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGGGGCGCATTGCCCGTGCTCTCGGATGCGGAACGTTACGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTGGCGTCCGTCTTGAGCCCGCGGCCGTACGGCCCGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_morelensis_clone1 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTCGGTTGGTCCCTTTCCGCCCCATGCCCTCGCGGGTTAT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGGGGCGCATTGCCCGTGCTCTCGGATGCGGAACGTTACGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCAATCGACACGAACGACTGTCGTGCCCGTCTTGAGCCCGCGGCCGTACGGCCCGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_morelensis_clone2 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTCGGTTGGTCCCTTTCCGCCCCACGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGGGGCGCATTGCCCGTGCTCTCGGATGCGGAACGTTACGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCAATCGACACGAACGACTGTCGTGCCCGTCTTGAGCCCGCGGCCGTACGGCCCGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_morelensis_clone3 TTCGGTATCCTGTGTTGCTTACCTATTGAAAGGAATCCGACGGTTCGGTTGGTCCCTTTCCGCCCCACGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGGGGCGCATTGCCCGTGCTCTCGGATGCGGAACGTTACGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCAATCGACACGAACGACTGTCGTGCCCGTCTTGAGCCCGCGGCCGTACGGCCCGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_nashii_clone1 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGATGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCATGCCCGTCTCGAGCCCACGGCCGTCCGGCCCGTCGGGTCTCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_nashii_clone2 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGATGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCTGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCATGCCCGTCTCGAGCCCACGGCCGTCCGGCCCGTCGGGTCTCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_nashii_clone3 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGATGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCTCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGCGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCATGCCCGTCTCGAGCCCACGGCCGTCCGGCCCGTCGGGTCTCGTGCTGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_odorata_clone1 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTTTCCGCCCCATGCCCTCGCGGGTGGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCCTCGCCCAGTTGCGCGGCTGCCCAGGCCCACGGGGCGCATTGCCCGTGCTCTCGGATGCGGAACGTTACGCGCGGGCGCGGGGTCTTCTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCCTCGACACGAACGACCGTCGAACCCGTCTTGAGCGCGCGGCCGTACGGCCAGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_odorata_clone3 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTTTCCGCCCCATGCCCTCGCGGGTGGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCCTCGCCCAGTTGCGCGGCTGCCCAGGCCCACGGGGCGCATTGCCCGTGCTCTCGGATGCGGAACGTTACGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCCTCGACACGAACGACCGTCGAACCCGTCTTGAGCGCGCGGCCGTACGGCCAGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_odorata_clone5 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTTTCCGCCCCATGCCCTCGCGGGTGGT-GGGGTGGACGTAAGGCAAGCCTCGTGTTCCCGGCACGCCTCGCCCAGTTGCGCGGCTGCCCAGGCCCACGGGGCGCATTGCCCGTGCTCTCGGATGCGGAACGTTACGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCCTCGACACGAACGACCGTCGAACCCGTCTTGAGCGCGCGGCCGTACGGCCAGTCGGGTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_ovata_clone10 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCGGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGTGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAATGACCGTCGCGCCCGTCTCGAGCCG-CGGCCGTTAGGCCAGTCGGGTCTCGTGCGGGCGTCAACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_ovata_clone11 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAG-TGCACCGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCCACGGCCGTCAGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_ovata_clone24 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCGGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCCACGGCCGTCAGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_ovata_clone2II TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAG-TGCACCGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCG-CGGCCGTTAGGCCAGTCGGGTCTCGTGCGGGCGTCAACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_ovata_clone3 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCGGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCCACGGCCGTCAGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_ovata_clone3II TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAG-TGCACCGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCCACGGCCGTCAGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_schlechtendalii_clone1 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGTGGGTGGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCCTCGCCCAGTTGCGTGGCTGCCGAGGCCCACGGGGCGCGTTGCCCGTGCTCTCGGATGCGGAACGTTGTGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCCTCGACACGAACGACCGTCGAACCCGTCTTGAGCAC--------------------GTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_schlechtendalii_clone2 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTGGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCCTCGCCCAGTTGCGTGGCTGCCCAGGCCCACGGGGCGCGTTGCCCGTGCTCTCGGATGCGGAACGTTGTGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTGGTCCCTCGACACGAACGACCGTCGAACCCGTCTTGAGCAC--------------------GTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_schlechtendalii_clone3 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTGGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCCTCGCCCAGTTGCGTGGCTGCCCAGGCCCACGGGGCGCGTTGCCCGTGCTCTCGGATGCGGAACGTTGTGCGCGGGCGTGGGGTCTTTTGGCTCCGTCGGCCCGAGCAACGCATTTGTCCCTCGACACGAACGACCGTCGAACCCGTCTTGAGCAC--------------------GTCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_simaruba_clone1 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCTGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCACTTGTCCATCGACGCGAACGACCGTCGCTCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_simaruba_clone2 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGGGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAACAACGCACTTGTCCATCGACGCGAACGACCGTCGCTCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_simaruba_clone3 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGGGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCTCGAGCAACGCACTTGTCCATCGACGCGAACGACCGTCGCTCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_simarubaDR_clone3 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCACTTGTCCATCGACGCGAACGACCGTCGCTCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_simarubaDR_clone4 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCACTTGTCCATCGACGCGAACGACCGTCGCTCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_simarubaDR_clone5 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCGGACGGTTTCGTTGGTCCCTCTCCGCCCTATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCTGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAGGTGCACTGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGTGGGGTCTGTTGGCTCCGTTCGCCCGAGCAACGCACTTGTCCATCGACGCGAACGACCGTCGCTCCCGTCTCGAGCCCGCGGCCGTCCGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_spinescens_clone1 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAG-TGCACCGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCCACGGCTGTCAGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_spinescens_clone11 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGACACGCTTCGCCCAGTTGCGTGGCTGCATCGGCCCACGAG-TGCACCGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCCACGGCCGTCAGGCCCGTCGGGTCTCGTGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_spinescens_clone5 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGACGGTTTCGTTGGTCCCTCTCCGCCCCATGCCCTCGCGGGTTGT-GGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCACGCTTCGCCCAGTTGCGTGGCTGCCTCGGCCCACGAG-TGCACCGCCCGTGCTCTCGGATGCGGAACGTTATGCGTGGGCGCGGGGCCTGTTGGCTCCGTCCGCCCGAGCAACGCATTTGTCCATCGACACGAACGACCGTCGCGCCCGTCTCGAGCCCACGGCCGTCAGGCCCGTCGGGTCTCGCGCGGGCGTCGACGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_tecomaca_clone1 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGATGGTTTCGTTCGTCCCTTTCCGCCCCCTGCCCTCACGGGTTTTCGGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCATGCTTCGCCCAGCTGCGTCGCTGCCTCGGCCCATGAGGTGCTTTGCCCGTGCTCTCGGATGCGGAATGTTATGTGCGGGCGTGGGGTCTCTTGGCTCCGTTTGCCCAAGCAACGCATTTGTCCATCGACACGAACGACTGCCGTGCCCGTCTTGAGCCCGCGGTCGTACGGCCCGTCGGGCCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_tecomaca_clone2 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGATGGTTTCGTTCGTCCCTTTCCGCCCCCTGCCCTCACGGGTTTTCGGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCATGCTTCGCCCAGCTGCGTCGCTGCCTCGGCCCATGAGGTGCTTTGCCCGTGCTCTCGGATGCGGAATGTTATGTGCGGGCGTGGGGTCTCTTGGCTCCGTTTGCCCAAGCAACGCATTTGTCCATCGACACGAACGACTGCCGTGCCCGTCTTGAGCCCGCGGCCGTACGGCCCGTCGGGTCTCATGCGGGCGTAGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC Bursera_tecomaca_clone3 TTCGGTATCCTGTGTTGCTTACCTATCGAAAGGAATCCGATGGTTTCGTTCGTCCCTTTCCGCCCCCTGCCCTCACGGGTTTTCGGGGTGGACGTCAGGCAAGCCTCGTGTTCCCGGCATGCTTCGCCCAGCTGCGTCGCTGCCTCGGCCCATGAGGTGCTTTGCCCGTGCTCTCGGATGCGGAATGTTATGTGCGGGCGTGGGGTCTCTTGGCTCCGTTTGCCCAAGCAACGCATTTGTCCATCGACACGAACGACTGCCGTGCCCGTCTTGAGCCCGCGGACGTACGGCCCGTCGGGCCTCATGCGGGCGTCGGCGTCGCGAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M772] TITLE PEPC_intron; LINK TAXA = Taxa5; DIMENSIONS NCHAR=654; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Bursera_brunea_clone1 TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTAAAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTTTTTCTCCACATATAATGGTCATACTTGATGATCTTATCAAAGTATATTGATACTTAGTGAGCATATTACCTCTTGCATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCATTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAAATAAAAAAA--------------------GAAGTAAGATAGCCC-TGCGAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACAGAAGTGTTCATTTTGGATTATT-GGGGCCCTAAGACAGATAATTG-TTATAGTTGCAATGTCACTGTTTGATTATCTATTTGCTCAAAGTGGTGTCTTTGCTTTCATATCTCATCTCCTCTTTCTCCCTCTCTGATAGTCATATCGTCCATGATAATGATACTTTACCATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_brunea_clone2 TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTCTTTCTCCACATATAATGGTCATACTTGATGATCTTATCAAAGTGTATTGATACTTAGTGAGCATATTACCTCTTGTATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCGTTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAAATAAAAAAA--------------------GAAGTAAGATAGCCC-TGCAAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACAGAAGTGTTCATTTTGGATAATT-GGGGGCCTAAGACAGATAATTG-TTATAGTTGCAATGTCACTGTTTGATCATCTATTTGCTCAAAGCAGTGTCTTTGCTTTCATATCTCATCTCCTCTTTCTCCCCCTCTGAGAGTCATATCGTCCATGACAATGATACTTTACCATCTTAAATCTGTCTGATGTGGGCTGTAGGAAACCCAAGGGTAACTTCTGAAGTTACA Bursera_brunea_clone5 TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTAAAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTTTTTCTCCACATATAATGGTCATACTTGATGATCTTATCAAAGTATATTGATACTTAGTGAGCATATTACCTCTTGCATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCATTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAAATAAAAAAA--------------------GAAGTAAGATAGCCC-TGCGAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACAGAAGTGTTCATTTTGGATTATT-GGGGCCCTAAGACAGATAATTG-TTATAGTTGCAATGTCACTGTTTGATTATCTATTTGCTCAAAGTGGTGTCTTTGCTTTCATATCTCATCTCCTCTTTCTCCCTCTCTGATAGTCATATCGTCCATGATAATGATACTTTACCATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_discolor TACTTCCATGAAACAATCTGGAAAGGTGTACCAAGATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGCTTTTCTCCATATATAATGGTCATCCTTGATGATCTTATCAAAGTATATTGATACTTAGTGAGCATATTACCTCTTGCACATGCTAGGTAGTGAGAGATACATTATTGTAACTGTAGATGTTATCTTATTTTCTTTGAAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAAAAAAAAAAGAA------------------GAGGTAGGATAGCCCTTGCGAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACGGAAGTGTTCATTTTGGATTTATTGGGGCCCTAAGACAGATAATTG--------------------TTTTGATTATCTATTTGCTCAAAGTAGTGTCTTTGCTTTCATACCTCATCTCCTCTTTCTCCCTCTTTGAGAATCATATCGTCCATGATGATGATACTTTACCATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAGGTTACA Bursera_fagaroides TACTTCCATGAAACAATCTGGAAAGGTGTACCAAGATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCATTCAATTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGCTTTTCTCCATGTATAATGGTCATCCTTGATGATCTTATCAAAGTATATTGATACTTAATGAGCATATTACCTCTTGCACATGCTATGTAGTGAGAGATACATTATTGTAACTGTAGATGTTATCTTATTTTCTTTGAAGATAAGTCTAATAAAGGGAAGGAATATGGAGGGAAAAAAAAAAAAAAAAA-GAA---------------GAAGTAGGATAGCCCCTGCGAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACGGAAGTGTTCATTTTGGATTATT--GGGGCCTAAGACAGATAATTG--------------------TTTTGATTATCTATTTGCTCAAAGTAGTGTCTTTGCTTTCATACCTCATCTCCTCTTTCTCCCTCTCTGAGAAT-ATATCGTCGATGATGATGATACTTTACCATCCTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_frenningae TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTCTTTCTCCACATATAATGGTCATACTTGATGATCTTATCAAAGTGTATTGATACTTAGTGAGCATATTACCTCTTGTATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCGTTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAAATAAAAAAA--------------------GAAGTAAGATAGCCC-TGCAAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACAGAAGTGTTCATTTTGGATAATT-GGGGGCCTAAGACAGATAATTG-TTATAGTTGCAATGTCACTGTTTGATCATCTATTTGCTCAAAGCAGTGTCTTTGCTTTCATATCTCATCTCCTCTTTCTCCCCCTCTGAGAGTCATATCGTCCATGACAATGATACTTTACCATCTTAAATCTGTCTGATGTGGGCTGTAGGAAACCCAAGGGTAACTTCTGAAGTTACA Bursera_gracilipes_clone1 TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGAGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTTTTTCTCCACGGATAATGGTCATACTTGATGATCTTATCAACGTATATTGATACTTAGTGAGCATATTACCTCTTGCATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCGTTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAA-TAAAAAAA--------------------GAAGA----TAGCCC-TGCCAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGACAGTTCAAATACAGTAGTGTTCATTTTGGATTATT-GGGGACCTAAGACAGATAATTG-TTATAGTTGCAATGTTACTGTTTGATTATCTATTTGCTCAAAGTGGTGTCTTTCCTTTCATATCTCATCTTCTCTTTCTCCCTCTCTGAGAGTCATACCGTCCATGATAATGATACTTTACTATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_gracilipes_clone2 TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGAGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTTTTTCTCCACGGATAATGGTCATACTTGATGATCTTATCAACGTATATTGATACTTAGTGAGCATATTACCTCTTGCATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCGTTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAA-TAAAAAAA--------------------GAAGA----TAGCCC-TGCCAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGACAGTTCAAATACAGTAGTGTTCATTTTGGATTATT-GGGGACCTAAGACAGATAATTG-TTATAGTTGCAATGTTACTGTTTGATTATCTATTTGCTCAAAGTGGTGTCTTTCCTTTCATATCTCATCTTCTCTTTCTCCCTCTCTGAGAGTCATACCGTCCATGATAATGATACTTTACTATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_gracilipes_clone3 TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGAGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTTTTTCTCCACGGATAATGGTCATACTTGATGATCTTATCAACGTATATTGATACTTAGTGAGCATATTACCTCTTGCATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCGTTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAA-TAAAAAAAA-------------------GAAGA----TAGCCC-TGCCAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGACAGTTCAAATACAGTAGTGTTCATTTTGGATTATT-GGGGACCTAAGACAGATAATTG-TTATAGTTGCAATGTTACTGTTTGATTATCTATTTGCTCAAAGTGGTGTCTTTCCTTTCATATCTCATCTTCTCTTTCTCCCTCTCTGAGAGTCATACCGTCCATGATAATGATACTTTACTATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_gracilipes_clone4 TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCT?AAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTTTTTCTCCACATATAATGGTCATACTTGATGATCTTATCAAAGTATATTGATACTTAGTGAGCATATTACCTCTTGCATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCATTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAAAAAAAAAA---------------------GAAGTAAGATAGCCC-TGCGAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACAGAAGTGTTCTTTTTGGATTATT-GGGGCCCTAAGACAGATAATTG-TTATAGTTGCAATGTCACTGTTTGATTATCTATTTGCTCAAAGTGGTGTCTTTGCTTTCATATCTCATCCCCTCTTTCTCCCTCTCTGATAGTCATATCGTCCATGATAATGATACTTTACCATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_gracilipes_clone5 TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTAAAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTTTTTCTCCACATATAATGGTCATACTTGATGATCTTATCAAAGTATATTGATACTTAGTGAGCATATTACCTCTTGCATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCATTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAAAAAAAAAAA--------------------GAAGTAAGATAGCCC-TGCGAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACAGAAGTGTTCATTTTGGATTATT-GGGGCCCTAAGACAGATAATTG-TTATAGTTGCAATGTCACTGTTTGATTATCTATTTGCTCAAAGTGGTGTCTTTGCTTTCATATCTCATCTCCTCTTTCTCCCTCTCTGATAGTCATATCGTCCATGATAATGATACTTTACCATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_inaguensis TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTCTTTCTCCACATATAATGGTCATACTTGATGATCTTATCAAAGTGTATTGATACTTAGTGAGCATATTACCTCTTGTATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCGTTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAAATAAAAAAA--------------------GAAGTAAGATAGCCC-TGCAAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACAGAAGTGTTCATTTTGGATAATT-GGGGGCCTAAGACAGATAATTG-TTATAGTTGCAATGTCACTGTTTGATCATCTATTTGCTCAAAGCAGTGTCTTTGCTTTCATATCTCATCTCCTCTTTCTCCCCCTCTGAGAGTCATATCGTCCATGACAATGATACTTTACCATCTTAAATCTGTCTGATGTGGGCTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_lancifolia TACTTCCATGAAACAATCTGGAAAGGTGTACCAAGATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGCTTTTCTCCATGTATAATGGTCATACTTGATGATCTTATCAAAGTATATTGATACTTAGTGAGCATATTACCTCTTGCACATGCTAGGTAGTGAGAGATACATTATTGTAACTGTAGATGTTATCTTATTTTCTTTGAAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAGAAGAAGAAGAAGAAGAAGAA---------GAAGTAGGATAGCCC-TGCGAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACGGAAGTGTTCATTTTGGATTATT-GGGGCCCTAAGACAGATAATTG-TTATAGTTGCAATGTCACTGTTTGATTATCTATTTGCTCAAAGTAGTGGCTTTGCTTTCATATCTCATCTCCTCTTTCTCCCTCTCTGAGAATCATATCGTCCATGATGATGATACTTTACCATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_longipes TACTTCCATGCAACAATCTGGTAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTAAAGAACATAGGGATAAATGAACGTTTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTTTTTCTCCACATATAATGGTCATACTTGATGATCTTATCAAAGTATATTGATACTTAGTGAGCATATTACCTCTTGCATATGCTAGGTAGTGAGAGA--------------------TGTTGTCTTATTTTCGTTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAATAAATAAAAAAA--------------------GAAGTAAGATAGCCC-TGCGAAATAGGGGGGAAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACAGAAGTGTTCATTTTGGATTATT-GGGGGCCTAAGACAGATAATTG-TTATAGTTGCAATGTCACTGTTTGATTATCTATTTGCTCAAAGTGGTGTCTTTGCTTTCATATCTCATCTCCTCTTTCTCCCTTTCTGAGAGTCATATCATCCATGATAATGATACTTTACCATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_microphylla TACTTCCATGAAACAATCTGGAAAGGTGTACCAAGATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGCTTTTCTCCATGTATAATGGTCATCCTTGATGATCTTATCAAAGTATATTGATACTTAGTGAGCATATTACCTCTTGCACATGCTAGGTAGTGAGAGATACATTATTGTAACTGTAGATGTTATCTTATTTTCTTTGAAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGTAGGATAGCCCCTGCGAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACGGAAGTGTTCATTTTGGATTATT-GGGGCCCTAAGACAGATAATTG-TTATAGTTGCAATGTCACTGTTTGATTATCTATTTGCTCAAAGTAGTGTCTTTGCTTTCATATCTCATCTCCTCTTTCTCCATCTCTGAGAATCATATCGTCCATGATGATGATACTTTACCATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_morelensis TACTTCCATGAAACAATCTGGAAAGGTGTACCAAGATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTTTTTCTCCATGTATAAAGGTCATACTTGATGATCTTATCAAAGTATATTGATACTTAGTGAGCATATTACCTCTTGCATATGCTAGGTAGTGAGAGATACATTATTGTAACTGTAGATGTTATCTTATTTTCTTTGAAGATAAGCCTAATAAAGGGAAGGATTATGGAGGAAAAAAAAAAAGAAGAAGGCGAAGAAGAAGAA-----GAAGTAGGATATCCCTTGCGAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACAGAAGTATTCATTTTGGATTATT-GGGGCCCTAAGACTGATAATTG-TTATAGTTGCAATGTCACTGTTTGATTATCGATTTGCTCAAAGTAGTGTCTTTGCTTTCATATCTCATCTCCTCTTTCTCCCTCTCTGAGAATCATATCGTCCTTGATGATGATACTTTACCATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTCACTTCTGAAGTTACA Bursera_nashii TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTCTTTCTCCACATATAATGGTCATACTTGATGATCTTATCAAAGTGTATTGATACTTAGTGAGCATATTACCTCTTGTATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCGTTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAAATAAAAAAA--------------------GAAGTAAGATAGCCC-TGCAAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACAGAAGTGTTCATTTTGGATAATT-GGGGGCCTAAGACAGATAATTG-TTATAGTTGCAATGTCACTGTTTGATCATCTATTTGCTCAAAGCAGTGTCTTTGCTTTCATATCTCATCTCCTCTTTCTCCCCCTCTGAGAGTCATATCGTCCATGACAATGATACTTTACCATCTTAAATCTGTCTGATGTGGGCTGTAGGAAACCCAAGGCTAACTTCTGAAGTTACA Bursera_odorata TACTTCCATGAAACAATCTGGAAAGGTGTACCAAGATTCTTGCGCCGTGTGGACACGGCTCTTAAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCCTTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGCTTTTCTCCATGTATAATGATCATCCTTGATGATCTTATCAAAGTATATTGATACTTAGTGAGCATATTACCTCTTGCACATGCTAGGTAGTGAGAGATACATTATTGTAACTGTAGATGTTATCTTATTTTCTTTGAAGATAAGTCTAATAAAGGGAAGGAATATGGAGGGAAAAAAAAAAAAAAAAAA------------------GAAGTAGGATAGCCCCTGCGAAATAGGGGG-AAAAAAGAAGGACTTGTCTTACATGAAAGTTCAAATACGGAAGTGTTCATTTTGGATTTATTGGGGCCCTAAGACAGATAATTG--------------------TTTTGATTATCTATTTGCTCAAAGTAGTGTCTTTGCTTTCATACCTCATCTCCTCTTTCTCCCTCTTTGAGAATCATATCGTCCATGATGATGATACTTTACCATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_ovata_clone1 TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGAGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGAAGGTATGTTTTTCTCCACGGATAATGGTCATACTTGATGATCTTATCAACGTATATTGATACTTAGTGAGCATATTACCTCTTGCATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCGTTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAA-TAAAAAAA--------------------GAAGA----TAGCCC-TGCCAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGACAGTTCAAATACAGTAGTGTTCATTTTGGATTATT-GGGGACCTAAGACAGATAATTG-TTATAGTTGCAATGTTACTGTTTGATTATCTATTTGCTCAAAGTGGTGTCTTTCCTTTCATATCTCATCTTCTCTTTCTCCCTCTCTGAGAGTCATACCGTCCATGATAATGATACTTTACTATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_ovata_clone2 TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGAGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTTTTTCTCCACGGATAATGGTCATACTTGATGATCTTATCAACGTATATTGATACTTAGTGAGCATATTACCTCTTGCATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCGTTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAA-TAAAAAAA--------------------GAAGA----TAGCCC-TGCCAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGACAGTTCAAATACAGTAGTGTTCATTTTGGATTATT-GGGGACCTAAGACAGATAATTG-TTATAGTTGCAATGTTACTGTTTGATTATCTATTTGCTCAAAGTGGTGTCTTTCCTTTCATATCTCATCTTCTCTTTCTCCCTCTCTGAGAGTCATACCGTCCATGATAATGATACTTTACTATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_ovata_clone3 TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGAGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTTTTTCTCCACGGATAATGGTCATACTTGATGATCTTATCAACGTATATTGATACTTAGTGAGCATATTACCTCTTGCATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCGTTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAA-TAAAAAAA--------------------GAAGA----TAGCCC-TGCCAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGACAGTTCAAATACAGTAGTGTTCATTTTGGATTATT-GGGGACCTAAGACAGATAATTG-TTATAGTTGCAATGTTACTGTTTGATTATCTATTTGCTCAAAGTGGTGTCTTTCCTTTCATATCTCATCTTCTCTTTCTCCCTCTCTGAGAGTCATACCGTCCATGATAATGATACTTTACTATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_ovata_clone5 TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGAGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTTTTTCTCCACGGATAATGGTCATACTTGATGATCTTATCAACGTATATTGATACTTAGTGAGCATATTACCTCTTGCATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCGTTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAA-TAAAAAAA--------------------GAAGA----TAGCCC-TGCCAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGACAGTTCAAATACAGTAGTGTTCATTTTGGATTATT-GGGGACCTAAGACAGATAATTG-TTATAGTTGCAATGTTACTGTTTGATTATCTATTTGCTCAAAGTGGTGTCTTTCCTTTCATATCTCATCTTCTCTTTCTCCCTCTCTGAGAGTCATACCGTCCATGATAATGATACTTTACTATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_schlechtendalii TACTTCCATGAAACAATCTGGAAAGGTGTACCAAGATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCATTCAATTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGCTTTTCTCCATGTATAATGGTCGTCCTTGATGATCTTATCAAAGTATATTGATACTTAGTGAGCATATTACCTCTTGCACATGCTATGTAGTGAGAGATACATTATTGTAACTGTAGATGTTATCTTATTTTCTTTGAAGATAAGTCTAATAAAGGGAAGGAATATGGAGGGAAAAAAAAAAAAAAA---------------------GAAGTAGGGTAGCCCCTGCGAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACGGAAGTGTTCATTTTGGATTATT-GGGGCCCTAAGACAGATAATTG--------------------TTTTGATTATCTATTTGCTCAAAGTAGTGTCTTTGCTTTCATACCTCATCTCCTCTTTCTCCCTCTCTGAGAAT-ATATCGTCGATGATGATGATACTTTACCATCCTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_simaruba TACTTCCATCAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTAAAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTTTTTCTCCACATATAATGGTCATACTTGATGATCTTATCAAAGTATATTGATACTTAGTGAGCATATTACCTCTTGCATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCATTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAAATAAAAAAA--------------------GAAGTAAGATAGCCC-TGCGAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACAGAAGTGTTCATTTTGGATTATT-GGGGCCCTAAGACAGATAATTG-TTATAGTTGCAATGTCACTGTTTGATTATCTATTTGCTCAAAGTGGTGTCTTTGCTTTCATATCTCATCTCCTCTTTCTCCCTCTCTGATAGTCATATCGTCCATGATAATGATACTTTACCATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_simarubaDR TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTAAAGAACATAGGGATAAATGAACGTGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTTTTTCTCCACATATAATGGTCATACTTGATGATCTTATCAAAGTATATTGATACTTAGTGAGCATATTACCTCTTGCATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCATTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAAATAAAAAAA--------------------GAAGTAAGATAGCCC-TGCGAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGAAAGTTCAAATACAGAAGTGTTCATTTTGGATTATT-GGGGCCCTAAGACAGATAATTG-TTATAGTTGCAATGTCACTGTTTGATTATCTATTTGCTCAAAGTGGTGTCTTTGCTTTCATATCTCATCTCCTCTTTCTCCCTCTCTGATAGTCATATCGTCCATGATAATGATACTTTACCATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_spinescens TACTTCCATGAAACAATCTGGAAAGGTGTACCAAAATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATGAACGAGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTTTTTCTCCACGGATAATGGTCATACTTGATGATCTTATCAACGTATATTGATACTTAGTGAGCATATTACCTCTTGCATATGCTAGGTAGTGAGAGA--------------------TGTTATCTTATTTTCGTTGCAGATAAGTCTAATAAAGGGAAGGAATATGGAGGAAAAAAAA-TAAAAAAA--------------------GAAGA----TAGCCC-TGCCAAATAGGGGG-AAAAAAGAAGGAATTGTCTTACATGACAGTTCAAATACAGTAGTGTTCATTTTGGATTATT-GGGGACCTAAGACAGATAATTG-TTATAGTTGCAATGTTACTGTTTGATTATCTATTTGCTCAAAGTGGTGTCTTTCCTTTCATATCTCATCTTCTCTTTCTCCCTCTCTGAGAGTCATACCGTCCATGATAATGATACTTTACTATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA Bursera_tecomaca TACTTCCATGAAACAATCTGGAAAGGTGTACCGAGATTCTTGCGCCGTGTGGACACGGCTCTGAAGAACATAGGGATAAATAAACGTGTTCCTTATAATGCTCCTCTCATTCAGTTTTCTTCTTGGATGGGTGGAGATCGTGATGGTATGTTTTTCTCCATATATAATGGTCATACTTGATGATCTTATCAAAATATATTGATAATTAGTGAACATATTACCTCTTGCATATGCTAGGTAGTGAGAGATACATTGTTGTAACTGTAGATGTTATCTTGTTTTCTTTGAAGATAAGTCTAATAAAAGGAACGAATATGGAGAAAAAAAGAA----------------------------GAAGTAGGATAGCCC-TGCGAAATAGGGAG--AAAAAAAAGGAATTGTCTTACATGAAAGTTCAAATGCAGAAGTGTTCATTTTAGATTATT-GGGGGCCTAAGACAGATAATTGGTTATAGTTGCAATATCACTGTTCGATTATCTATTTTCTCAAAGTGGTGTCTTTGCTTTCATATCTCATCTCCTCTTTCTCCCTCTCTGAGAATCATGTCGTCCATGATGATGATACTTTACCATCTTAAATCTGTCTGATGTGGACTGTAGGAAACCCCAGGGTAACTTCTGAAGTTACA ; END; BEGIN TREES; TITLE Tb6747; LINK TAXA = Taxa3; TRANSLATE 1 Bursera_gracilipes_clone5, 2 Bursera_gracilipes_clone4, 3 Bursera_gracilipes_clone3, 4 Bursera_gracilipes_clone2, 5 Bursera_brunea_clone13, 6 Bursera_brunea_clone12, 7 Bursera_brunea_clone11, 8 Bursera_brunea_clone8, 9 Bursera_brunea_clone4, 10 Bursera_ovata_clone3II, 11 Bursera_ovata_clone2II, 12 Bursera_ovata_clone24, 13 Bursera_ovata_clone11, 14 Bursera_ovata_clone10, 15 Bursera_ovata_clone3, 16 Bursera_tecomaca, 17 Bursera_spinescens, 18 Bursera_simarubaDR, 19 Bursera_simaruba, 20 Bursera_schlechtendalii, 21 Bursera_odorata, 22 Bursera_morelensis, 23 Bursera_microphylla, 24 Bursera_longipes, 25 Bursera_lancifolia, 26 Bursera_inaguensis, 27 Bursera_frenningae, 28 Bursera_fagaroides, 29 Bursera_discolor, 30 Bursera_nashii; TREE Fig._10 = [&R] ((((((30,8),7,6),(27,26)),24,((19,9,5),18,3,2),(17,15,(14,11,1),13,12,10,4)),((((29,(28,20),21),22),23),25)),16); END; BEGIN TREES; TITLE Tb6750; LINK TAXA = Taxa4; TRANSLATE 1 Bursera_tecomaca, 2 Bursera_gracilipes_clone3, 3 Bursera_gracilipes_clone1, 4 Bursera_brunea_clone9, 5 Bursera_brunea_clone8, 6 Bursera_brunea_clone10, 7 Bursera_spinescens, 8 Bursera_simaruba, 9 Bursera_simarubaDR, 10 Bursera_schlechtendalii, 11 Bursera_ovata, 12 Bursera_odorata, 13 Bursera_morelensis, 14 Bursera_microphylla, 15 Bursera_longipes, 16 Bursera_lancifolia, 17 Bursera_inaguensis, 18 Bursera_frenningae, 19 Bursera_fagaroides, 20 Bursera_discolor, 21 Bursera_nashii; TREE Fig._13 = [&R] (((((21,18,17,6,5,4),(7,3,2)),15,11,9,8),(20,(19,10),16,(14,12),13)),1); END; BEGIN TREES; TITLE Tb6746; LINK TAXA = Taxa2; TRANSLATE 1 Bursera_tecomaca_clone3, 2 Bursera_tecomaca_clone2, 3 Bursera_tecomaca_clone1, 4 Bursera_spinescens_clone11, 5 Bursera_spinescens_clone5, 6 Bursera_spinescens_clone1, 7 Bursera_gracilipes_clone5, 8 Bursera_gracilipes_clone4, 9 Bursera_gracilipes_clone3, 10 Bursera_gracilipes_clone2, 11 Bursera_brunea_clone13, 12 Bursera_brunea_clone12, 13 Bursera_brunea_clone11, 14 Bursera_brunea_clone8, 15 Bursera_brunea_clone4, 16 Bursera_simarubaDR_clone5, 17 Bursera_simarubaDR_clone4, 18 Bursera_simarubaDR_clone3, 19 Bursera_simaruba_clone2, 20 Bursera_simaruba_clone1, 21 Bursera_simaruba_clone3, 22 Bursera_ovata_clone3II, 23 Bursera_ovata_clone2II, 24 Bursera_ovata_clone24, 25 Bursera_ovata_clone11, 26 Bursera_ovata_clone10, 27 Bursera_ovata_clone3, 28 Bursera_odorata_clone5, 29 Bursera_odorata_clone3, 30 Bursera_odorata_clone1, 31 Bursera_morelensis_clone3, 32 Bursera_morelensis_clone2, 33 Bursera_morelensis_clone1, 34 Bursera_microphylla_clone7, 35 Bursera_microphylla_clone6, 36 Bursera_microphylla_clone1, 37 Bursera_schlechtendalii_clone3, 38 Bursera_schlechtendalii_clone2, 39 Bursera_schlechtendalii_clone1, 40 Bursera_longipes_clone3, 41 Bursera_longipes_clone2, 42 Bursera_longipes_clone1, 43 Bursera_lancifolia_clone3, 44 Bursera_lancifolia_clone2, 45 Bursera_lancifolia_clone1, 46 Bursera_inaguensis_clone3, 47 Bursera_fagaroides_clone6, 48 Bursera_fagaroides_clone5, 49 Bursera_fagaroides_clone1, 50 Bursera_discolor_clone3, 51 Bursera_discolor_clone2, 52 Bursera_discolor_clone1, 53 Bursera_nashii_clone3, 54 Bursera_nashii_clone2, 55 Bursera_nashii_clone1, 56 Bursera_inaguensis_clone2, 57 Bursera_inaguensis_clone1, 58 Bursera_frenningae_clone3, 59 Bursera_frenningae_clone2, 60 Bursera_frenningae_clone1; TREE Fig._9 = [&R] (((((55,54,53,14,13,12),((60,59,58),(57,56,46))),42,41,40,(27,(26,23,7),25,24,22,10,6,5,4),(21,20,19,18,17,(16,9,8),15,11)),(((((52,51,50),(49,48,47,39,38,37),(30,29,28)),(33,(32,31))),(36,35,34)),(45,44,43))),((3,1),2)); END; BEGIN TREES; TITLE Tb6749; LINK TAXA = Taxa1; TRANSLATE 1 Bursera_morelensis, 2 Bursera_longipes, 3 Bursera_lancifolia, 4 Bursera_inaguensis, 5 Bursera_frenningae, 6 Bursera_fagaroides, 7 Bursera_discolor, 8 Bursera_nashii, 9 Bursera_tecomaca, 10 Bursera_simarubaDR, 11 Bursera_gracilipes_clone3I, 12 Bursera_gracilipes_clone2II, 13 Bursera_gracilipes_clone2I, 14 Bursera_brunea_clone3I, 15 Bursera_brunea_clone2II, 16 Bursera_brunea_clone1I, 17 Bursera_spinescens, 18 Bursera_simaruba, 19 Bursera_schlechtendalii, 20 Bursera_ovata, 21 Bursera_odorata, 22 Bursera_microphylla; TREE Fig._12 = [&R] (9,(((((8,(16,15,14)),5,4),(17,((13,12),11))),(2,20,18,10)),(7,(6,19),3,1,(22,21)))); END; BEGIN TREES; TITLE Tb6748; LINK TAXA = Taxa5; TRANSLATE 1 Bursera_spinescens, 2 Bursera_gracilipes_clone5, 3 Bursera_gracilipes_clone4, 4 Bursera_gracilipes_clone3, 5 Bursera_gracilipes_clone2, 6 Bursera_gracilipes_clone1, 7 Bursera_brunea_clone1, 8 Bursera_brunea_clone5, 9 Bursera_brunea_clone2, 10 Bursera_simarubaDR, 11 Bursera_simaruba, 12 Bursera_schlechtendalii, 13 Bursera_ovata_clone5, 14 Bursera_ovata_clone3, 15 Bursera_ovata_clone2, 16 Bursera_ovata_clone1, 17 Bursera_odorata, 18 Bursera_morelensis, 19 Bursera_microphylla, 20 Bursera_longipes, 21 Bursera_lancifolia, 22 Bursera_inaguensis, 23 Bursera_frenningae, 24 Bursera_fagaroides, 25 Bursera_discolor, 26 Bursera_nashii, 27 Bursera_tecomaca; TREE Fig._11 = [&R] (27,((((26,23,9),22),(20,(11,10,8,7,(3,2))),(16,15,14,13,6,5,4,1)),((((25,17),(24,12)),(21,19)),18))); END;