#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 07, 2021; 1:38 GMT TreeBASE (cc) 1994-2008 Study reference: Baldwin B.G., Kalisz S., & Armbruster W.S. 2011. Phylogenetic perspectives on diversification, biogeography, and floral evolution of Collinsia and Tonella (Plantaginaceae). American Journal of Botany, 98(4): 731-753. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S11078] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=29; TAXLABELS Collinsia_antonina_2 Collinsia_bartsiifolia_var_bartsiifolia_2 Collinsia_callosa_3 Collinsia_childii_3 Collinsia_concolor_2_Collinsia_parryi_1 Collinsia_corymbosa_4 Collinsia_grandiflora_4 Collinsia_greenei_3 Collinsia_heterophylla_21_CYC1_clone_D3P1 Collinsia_heterophylla_21_CYC1_clones_D3_D4 Collinsia_linearis_14 Collinsia_metamorphica_7 Collinsia_multicolor_2 Collinsia_parviflora_12 Collinsia_rattanii_3 Collinsia_sparsiflora_var_collina_1 Collinsia_sparsiflora_var_sparsiflora_4_5 Collinsia_tinctoria_1_ETS_clone2 Collinsia_tinctoria_1_ETS_clone3 Collinsia_tinctoria_1_ETS_clone7 Collinsia_tinctoria_1_ETS_clones1_5_6_8_10_11_12 Collinsia_tinctoria_1_ETS_clones4_9 Collinsia_torreyi_3 Collinsia_verna_3 Collinsia_violacea_2 Collinsia_wrightii_12 Keckiella_cordifolia Tonella_floribunda_2 Tonella_tenella_4 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=47; TAXLABELS Chelone_glabra Collinsia_antonina_2 Collinsia_bartsiifolia_var_bartsiifolia_2 Collinsia_callosa_1 Collinsia_callosa_2 Collinsia_childii_3 Collinsia_childii_6_clone1 Collinsia_childii_6_clone2 Collinsia_childii_6_clone4 Collinsia_concolor_1b_clone1_4_5 Collinsia_concolor_2_Collinsia_parryi_1 Collinsia_corymbosa_3b Collinsia_grandiflora_4 Collinsia_greenei_3_clones1_10 Collinsia_greenei_3_clones2_6 Collinsia_heterophylla_20_clone1_2 Collinsia_heterophylla_20_clone3 Collinsia_heterophylla_21_cloneA1 Collinsia_heterophylla_21_cloneA2 Collinsia_heterophylla_21_cloneA3 Collinsia_heterophylla_21_cloneD1_2 Collinsia_heterophylla_21_cloneD3_4 Collinsia_heterophylla_21_cloneD3P1 Collinsia_heterophylla_8_clone1 Collinsia_heterophylla_8_clone2_4 Collinsia_linearis_14 Collinsia_metamorphica_3_clone5 Collinsia_metamorphica_3_clone6 Collinsia_metamorphica_3_clones2_3 Collinsia_metamorphica_7 Collinsia_multicolor_2 Collinsia_parviflora_12 Collinsia_rattanii_3 Collinsia_rattanii_8 Collinsia_sparsiflora_var_collina_1 Collinsia_sparsiflora_var_sparsiflora_4_5 Collinsia_sparsiflora_var_sparsiflora_6 Collinsia_tinctoria_1 Collinsia_torreyi_3 Collinsia_verna_3 Collinsia_violacea_2 Collinsia_wrightii_12 Keckiella_cordifolia Penstemon_hartwegii Tonella_floribunda_2_clone1_2 Tonella_floribunda_2_clone3_4 Tonella_tenella_4 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=61; TAXLABELS Chelone_glabra Collinsia_antonina_1_3 Collinsia_antonina_2 Collinsia_bartsiifolia_var_bartsiifolia_1to3_var_davidsonii_1to5_Collinsia_corymbosa_1to3 Collinsia_callosa_1to3 Collinsia_childii_1_3to6 Collinsia_childii_2 Collinsia_concolor_1_2_4_5_Collinsia_parryi_1_2 Collinsia_concolor_3 Collinsia_grandiflora_1to5 Collinsia_greenei_1to4 Collinsia_heterophylla_1 Collinsia_heterophylla_15 Collinsia_heterophylla_16 Collinsia_heterophylla_19 Collinsia_heterophylla_2to8_10to14_17_18_21_Collinsia_tinctoria_7 Collinsia_heterophylla_9 Collinsia_latifolia_1 Collinsia_latifolia_2 Collinsia_latifolia_3_4 Collinsia_linearis_13_19 Collinsia_linearis_2_9_14 Collinsia_linearis_8 Collinsia_metamorphica_1_2 Collinsia_metamorphica_3to5 Collinsia_metamorphica_6 Collinsia_metamorphica_7_8 Collinsia_multicolor_1_2 Collinsia_parviflora_1_2_4to8_11to14_Collinsia_grandiflora_6 Collinsia_parviflora_3_9_10 Collinsia_rattanii_1_6to9_Collinsia_linearis_1_3to5_6_10_12_15to18_20 Collinsia_rattanii_2_Collinsia_linearis_7 Collinsia_rattanii_3_Collinsia_linearis_11 Collinsia_rattanii_4 Collinsia_sparsiflora_var_collina_5 Collinsia_sparsiflora_var_sparsiflora_17 Collinsia_sparsiflora_var_sparsiflora_1to6_10_14_16_18to20 Collinsia_sparsiflora_var_sparsiflora_7_8_12_13_15 Collinsia_sparsiflora_var_sparsiflora_9_11 Collinsia_tinctoria_1 Collinsia_tinctoria_2 Collinsia_tinctoria_3 Collinsia_tinctoria_4 Collinsia_tinctoria_5_6 Collinsia_tinctoria_8 Collinsia_torreyi_1to4 Collinsia_verna_1to3 Collinsia_violacea_1to3 Collinsia_wrightii_1a_b_12 Collinsia_wrightii_2_6 Collinsia_wrightii_3_4_10_11 Collinsia_wrightii_5 Collinsia_wrightii_7 Collinsia_wrightii_8 Collinsia_wrightii_9 Keckiella_cordifolia Penstemon_hartwegii Tonella_floribunda_1_2 Tonella_tenella_1 Tonella_tenella_2_3 Tonella_tenella_4 ; END; BEGIN TAXA; TITLE Taxa4; DIMENSIONS NTAX=148; TAXLABELS Chelone_glabra Collinsia_antonina_1 Collinsia_antonina_2 Collinsia_antonina_3 Collinsia_bartsiifolia_var_bartsiifolia_1 Collinsia_bartsiifolia_var_bartsiifolia_2_3 Collinsia_bartsiifolia_var_davidsonii_B1_5 Collinsia_bartsiifolia_var_davidsonii_B2to4 Collinsia_callosa_1 Collinsia_callosa_2 Collinsia_callosa_3 Collinsia_childii_1 Collinsia_childii_2 Collinsia_childii_3 Collinsia_childii_4 Collinsia_childii_5 Collinsia_childii_6 Collinsia_concolor_1a_2_4_5_Collinsia_parryi_1_2 Collinsia_concolor_1b Collinsia_concolor_3 Collinsia_corymbosa_1_2_3a_3b Collinsia_grandiflora_1_2a Collinsia_grandiflora_2b Collinsia_grandiflora_3_5 Collinsia_grandiflora_4 Collinsia_greenei_1_2_4 Collinsia_greenei_3 Collinsia_heterophylla_1 Collinsia_heterophylla_10 Collinsia_heterophylla_12_13 Collinsia_heterophylla_15 Collinsia_heterophylla_16 Collinsia_heterophylla_17 Collinsia_heterophylla_18_ITS_clone11 Collinsia_heterophylla_18_ITS_clone6 Collinsia_heterophylla_18_ITS_clones2_12 Collinsia_heterophylla_19 Collinsia_heterophylla_20_14 Collinsia_heterophylla_21 Collinsia_heterophylla_2a_b Collinsia_heterophylla_3 Collinsia_heterophylla_4_5 Collinsia_heterophylla_6_11 Collinsia_heterophylla_7 Collinsia_heterophylla_8 Collinsia_heterophylla_9 Collinsia_latifolia_1 Collinsia_latifolia_2 Collinsia_latifolia_3_4 Collinsia_linearis_1_4 Collinsia_linearis_10 Collinsia_linearis_11 Collinsia_linearis_13 Collinsia_linearis_14 Collinsia_linearis_15to18 Collinsia_linearis_19 Collinsia_linearis_2 Collinsia_linearis_20 Collinsia_linearis_3_5_12 Collinsia_linearis_6a Collinsia_linearis_6b Collinsia_linearis_7 Collinsia_linearis_8 Collinsia_linearis_9 Collinsia_metamorphica_1_2 Collinsia_metamorphica_3_4 Collinsia_metamorphica_5 Collinsia_metamorphica_6 Collinsia_metamorphica_7 Collinsia_metamorphica_8 Collinsia_multicolor_1_2 Collinsia_parviflora_1_2_6_7_Collinsia_grandiflora_6 Collinsia_parviflora_10a Collinsia_parviflora_10b Collinsia_parviflora_11 Collinsia_parviflora_12 Collinsia_parviflora_13 Collinsia_parviflora_14 Collinsia_parviflora_3 Collinsia_parviflora_4 Collinsia_parviflora_5 Collinsia_parviflora_8 Collinsia_parviflora_9 Collinsia_rattanii_1 Collinsia_rattanii_2 Collinsia_rattanii_3 Collinsia_rattanii_4 Collinsia_rattanii_6 Collinsia_rattanii_7_8 Collinsia_rattanii_9 Collinsia_sparsiflora_var_collina_1 Collinsia_sparsiflora_var_collina_2 Collinsia_sparsiflora_var_collina_4 Collinsia_sparsiflora_var_collina_5 Collinsia_sparsiflora_var_sparsiflora_12_15 Collinsia_sparsiflora_var_sparsiflora_17 Collinsia_sparsiflora_var_sparsiflora_19 Collinsia_sparsiflora_var_sparsiflora_1to5_10_16_18_20_var_collina_3 Collinsia_sparsiflora_var_sparsiflora_6_14 Collinsia_sparsiflora_var_sparsiflora_7_13 Collinsia_sparsiflora_var_sparsiflora_8 Collinsia_sparsiflora_var_sparsiflora_9_11 Collinsia_tinctoria_1_ETS_clone2 Collinsia_tinctoria_1_ETS_clone3 Collinsia_tinctoria_1_ETS_clone7 Collinsia_tinctoria_1_ETS_clones1_5_6_8_10to12 Collinsia_tinctoria_1_ETS_clones4_9 Collinsia_tinctoria_2 Collinsia_tinctoria_3 Collinsia_tinctoria_4_ITS_clone1 Collinsia_tinctoria_4_ITS_clone12 Collinsia_tinctoria_4_ITS_clone5 Collinsia_tinctoria_4_ITS_clones2_3_7_10 Collinsia_tinctoria_4_ITS_clones4_6_8_9_11 Collinsia_tinctoria_6 Collinsia_tinctoria_7 Collinsia_tinctoria_8_ITS_clone11 Collinsia_tinctoria_8_ITS_clone3 Collinsia_tinctoria_8_ITS_clone5 Collinsia_tinctoria_8_ITS_clone6 Collinsia_tinctoria_8_ITS_clones1_4_7to9_12 Collinsia_tinctoria_8_ITS_clones2_10 Collinsia_torreyi_1a_2_4 Collinsia_torreyi_1b Collinsia_torreyi_3 Collinsia_verna_1_3 Collinsia_verna_2 Collinsia_violacea_1 Collinsia_violacea_2 Collinsia_violacea_3 Collinsia_wrightii_11 Collinsia_wrightii_12 Collinsia_wrightii_1a_b Collinsia_wrightii_2 Collinsia_wrightii_3 Collinsia_wrightii_4_10 Collinsia_wrightii_5 Collinsia_wrightii_6 Collinsia_wrightii_7 Collinsia_wrightii_8 Collinsia_wrightii_9 Keckiella_cordifolia Penstemon_hartwegii Tonella_floribunda_1_2 Tonella_tenella_1 Tonella_tenella_2 Tonella_tenella_3 Tonella_tenella_4 ; END; BEGIN TAXA; TITLE Taxa5; DIMENSIONS NTAX=139; TAXLABELS Chelone_glabra Collinsia_antonina_1 Collinsia_antonina_2 Collinsia_antonina_3 Collinsia_bartsiifolia_var_bartsiifolia_1 Collinsia_bartsiifolia_var_bartsiifolia_2_3 Collinsia_bartsiifolia_var_davidsonii_1_5 Collinsia_bartsiifolia_var_davidsonii_2to4 Collinsia_callosa_1 Collinsia_callosa_2 Collinsia_callosa_3 Collinsia_childii_1 Collinsia_childii_2 Collinsia_childii_3 Collinsia_childii_4 Collinsia_childii_5 Collinsia_childii_6 Collinsia_concolor_1a_2to5_Collinsia_parryi_1_2 Collinsia_concolor_1b Collinsia_corymbosa_1_2_3a_3b Collinsia_grandiflora_1_2a Collinsia_grandiflora_2b Collinsia_grandiflora_3_5 Collinsia_grandiflora_4 Collinsia_greenei_1_2_4 Collinsia_greenei_3 Collinsia_heterophylla_1 Collinsia_heterophylla_10 Collinsia_heterophylla_12_13 Collinsia_heterophylla_12_14 Collinsia_heterophylla_15 Collinsia_heterophylla_16 Collinsia_heterophylla_17 Collinsia_heterophylla_18_ITSclone11 Collinsia_heterophylla_18_ITSclone6 Collinsia_heterophylla_18_ITSclones2_12 Collinsia_heterophylla_21 Collinsia_heterophylla_2a_b Collinsia_heterophylla_3 Collinsia_heterophylla_4_5 Collinsia_heterophylla_6_11_19 Collinsia_heterophylla_7 Collinsia_heterophylla_8 Collinsia_heterophylla_9 Collinsia_latifolia_1 Collinsia_latifolia_2 Collinsia_latifolia_3_4 Collinsia_linearis_1_4 Collinsia_linearis_10 Collinsia_linearis_11 Collinsia_linearis_13 Collinsia_linearis_14 Collinsia_linearis_15to18 Collinsia_linearis_19 Collinsia_linearis_2 Collinsia_linearis_20 Collinsia_linearis_3_5_12 Collinsia_linearis_6a Collinsia_linearis_6b Collinsia_linearis_7 Collinsia_linearis_8 Collinsia_linearis_9 Collinsia_metamorphica_1_2_6 Collinsia_metamorphica_3_4 Collinsia_metamorphica_5 Collinsia_metamorphica_7 Collinsia_metamorphica_8 Collinsia_multicolor_1_2 Collinsia_parviflora_1_2_6_7_Collinsia_grandiflora_6 Collinsia_parviflora_10a Collinsia_parviflora_10b Collinsia_parviflora_11 Collinsia_parviflora_12 Collinsia_parviflora_13 Collinsia_parviflora_14 Collinsia_parviflora_3 Collinsia_parviflora_4 Collinsia_parviflora_5 Collinsia_parviflora_8 Collinsia_parviflora_9 Collinsia_rattanii_1_2_4 Collinsia_rattanii_3 Collinsia_rattanii_6 Collinsia_rattanii_7_8 Collinsia_rattanii_9 Collinsia_sparsiflora_var_collina_1 Collinsia_sparsiflora_var_collina_2 Collinsia_sparsiflora_var_collina_4 Collinsia_sparsiflora_var_collina_5 Collinsia_sparsiflora_var_sparsiflora_17 Collinsia_sparsiflora_var_sparsiflora_19 Collinsia_sparsiflora_var_sparsiflora_1to5_9to12_15_16_18_20_var_collina_3 Collinsia_sparsiflora_var_sparsiflora_6_7_13_14 Collinsia_sparsiflora_var_sparsiflora_8 Collinsia_tinctoria_1_ETSclone2 Collinsia_tinctoria_1_ETSclone3 Collinsia_tinctoria_1_ETSclone7 Collinsia_tinctoria_1_ETSclones1_5_6_8_10_11_12 Collinsia_tinctoria_1_ETSclones4_9 Collinsia_tinctoria_2 Collinsia_tinctoria_3 Collinsia_tinctoria_4_ITS_clone1 Collinsia_tinctoria_4_ITS_clone12 Collinsia_tinctoria_4_ITS_clone5 Collinsia_tinctoria_4_ITS_clones2_3_7_10 Collinsia_tinctoria_4_ITS_clones4_6_8_9_11 Collinsia_tinctoria_6 Collinsia_tinctoria_7 Collinsia_tinctoria_8_ITSclone11 Collinsia_tinctoria_8_ITSclone3 Collinsia_tinctoria_8_ITSclone5 Collinsia_tinctoria_8_ITSclone6 Collinsia_tinctoria_8_ITSclones1_4_7_8_9_12 Collinsia_tinctoria_8_ITSclones2_10 Collinsia_torreyi_1a_2_4 Collinsia_torreyi_1b Collinsia_torreyi_3 Collinsia_verna_1_3 Collinsia_verna_2 Collinsia_violacea_1 Collinsia_violacea_2 Collinsia_violacea_3 Collinsia_wrightii_11 Collinsia_wrightii_12 Collinsia_wrightii_1a_b Collinsia_wrightii_2 Collinsia_wrightii_3 Collinsia_wrightii_4_5_10 Collinsia_wrightii_6 Collinsia_wrightii_7 Collinsia_wrightii_8 Collinsia_wrightii_9 Keckiella_cordifolia Penstemon_hartwegii Tonella_floribunda_1_2 Tonella_tenella_1 Tonella_tenella_2 Tonella_tenella_3 Tonella_tenella_4 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7302] TITLE Collinsia_CYC1_matrix; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1029; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Chelone_glabra ?????????????????????????????????CACGAC---CTCCTTTCGACTCATCACTACTTAGCCGCAGCA---GGGCCCGCCAACAATCTTGAG------GCCGCGTTTGCCCTGTACAAC---GACTTCCACCAA---GAT------------------------------------GTCGTTGACCATTCT---ACCATGGTCAACTCG---TTTCCTAAGAAA---CATTCC---------ACC---AAAAAAGATAGGCACAGCAAAATACACACTGCTCATGGACCGAGGGACAGGAGAGTTAGGCTCTCCATCGGCATTGCACGTAAGTTTTTTGATCTTCAGGAGTTGCTAAATTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTAACCAAATCCAAGGAGGCCATTAAGGAACTAGTCCAATCGAAAAGTGGT---AATAAT------ACTACTACTACTTCGAATTCTGAAGTCGAAGTA------------------GCT---TGTGAGATCAATGACAAC------------TCTTTTCCGAAAGGGAAA---TCTCATGTAGTGGTGAATAGTAGTAATTACAATTATAAATGTAGTAAAGGAGTCGTA---CTAAAG---GATTCGATTGCGAAGGAATCGAGAGTTAAGGCGAGGGCGAGGGCGAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCTCAATTAAAT---GAAACTACTAGAAAT---------------TGTAATTGGGGT------------CCAGTACAATTTGAT---CAG---GAT------------------TGTCCAATGACTTGT---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTGATCAAGAAGAAGATG---------------------ATGTTCAGTTTTCATCAA---CAAAATGTC------------TCAAGTAAT------------GAGAATTGGGATTATAGTAATCTTGCATCACAGTCCAAC Collinsia_antonina_2 ?????????CATAATGAAATC------------CAAGAC---CTACTTGCAGCTCATAATTACTTAATTGCCACTCACAACAATGCGCCAATTCATGAGGCTCAAGCCGCGGCGGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGC---TTTCCTAAGAAAGTACAGCCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGC---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAA---GGGCCTAACAATATTCTTCATTGTCCAATGACGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---GACTACACA---CCAATGTTCGGTTTTCATCAA---CAAATTCCCACGACG------TCTTCAAATGCAACC------GAGAATTGGGAATATAGTAATTTCAACTCGCAGCCCAAC Collinsia_bartsiifolia_var_bartsiifolia_2 ?????????CATAATGAAATC------------CAAGACCTACTACTTGCAGCTCATAATTACTTAATTGCCACTCAC---AATGCTCCAATTCTTGAGGCTGAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTTGTTAACGGCCAGCTCAAT------GGGGCTGTACTTGACCATTCTACAAACATGGTCAATGGGGCCTTTCCTAAGAAAGTACAACCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCTAAAAATGGT---AAGAGT------AATGCTACTTCTTCTAATTCTGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTC---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGTATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCGACTAATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGATTTTCACCAA---CAAAATCCCACTACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCAACTCGCAGTCCAAC Collinsia_callosa_1 ACTTCACAGCATAATGAAATC------------CAAGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAATGCGCCAATTCTTGAGGCTCAAGCTGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGCCTTTCCTAACAAA---CAGCCT------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------ACTGCTACTTCTTCTAATTCCGAGGTC---------GAC------ATA---GCT---TGTGAC---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---CTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---AAAGCTACTAGAAAT------TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAGTTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAG---CAAAATCCCACAACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCGCAGTCCAAC Collinsia_callosa_2 ?????????CATAATGAAATC------------CAAGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAATGCGCCAATTCTTGAGGCTCAAGCTGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTTACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGCCTTTCCTAACAAA---CAGCCT------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------ACTGCTACTTCTTCTAATTCCGAGGTC---------GAC------ATA---GCT---TGTGAC---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---CTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAT------TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAGTTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAG---CAAAATCCCACAACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCGCAGTCCAAC Collinsia_childii_3 ?????????CATAATGAAATC------------CAAGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTCAC---AATGCGCCAATTCTTGAGGCTCAAGCTGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCCTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACTACCATGGTCAATGGCGCCTTTCCTAAGAAGGTACAGCCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGATC---------GAC------ATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGGA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAT------TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAG---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCGACTAATTAC---GAAGAC---CTAATTCAAGAATCCGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCCCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCGCAATCCAAC Collinsia_childii_6_clone1 ACTTCACAGCATAATGAAATC------------CAAGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTCAC---AATGCGCCAATTCTTGAGGCTCAAGCTGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCCTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACTACCATGGTCAATGGCGCCTTTCCTAAGAAGGTACAGCCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTC---------GAC------ATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGGA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAT------TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAG---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCGACTAATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCCCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCGCAATCCAAC Collinsia_childii_6_clone2 ACTTCACAGCATAATGAAATC------------CAAGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTCAC---AATGCGCCAATTCTTGAGGCTCAAGCTGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCCTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACTACCATGGTCAATGGCGCCTTTCCTAAGAAGGTACAGCCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTC---------GAC------ATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGGA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAT------TATAAGGGTAGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAG---GGGCCTAATAATATTCTTCACTGTCCAATGACGTCGACTAATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCCCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCGCAATCCAAC Collinsia_childii_6_clone4 ACTTCGCAGCATAATGAAATC------------CAAGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTCAC---AATGCGCCAATTCTTGAGGCTCAAGCTGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCCTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACTACCATGGTCAATGGCGCCTTTCCTAAGAAGGTACAGCCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTC---------GAC------ATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGGA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAT------TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAG---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCGACTAATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCCCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATATCGCCTCGCAATCCAAC Collinsia_concolor_1b_clone1_4_5 ACTTCACAACATAATGAAATC------------CAAGAC---CTACTTGCAGCTCATAATTACTTAATTGCCACTCACAACAATGCGCCAATTCTTGAGGCTCAAGCCGCGGCGGCCTTGTATAAT---GACTTCAATCACTTAGAT---GTCGTTAACAGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGGAGCTTCCCTAAGAAAGTACAGCCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------------ACTTCTTCTAATTCTGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---GTTAAA---GATTTGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTCGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---GAGTACACA---CCAATGTTCGGTTTTCATCAA---CAAATTCCCACGACG------TCGTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCAACTCGCAGTCCAAC Collinsia_concolor_2_Collinsia_parryi_1 ?????????CATAATGAAATC------------CAAGAC---CTACTTGCAGCTCATAATTACTTAATTGCCACTCACAACAATGCGCCAATTCTTGAGGCTCAAGCCGCGGCGGCCTTGTATAAT---GACTTCAATCACTTAGAT---GTCGTTAACAGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGGAGCTTCCCTAAGAAAGTACAGCCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------------ACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---GTTAAA---GATTTGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTCGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---GAGTACACA---CCAATGTTCGGTTTTCATCAA---CAAATTCCCACGACG------TCGTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCAACTCGCAGTCCAAC Collinsia_corymbosa_3b ?????????CATAATGAAATC------------CAAGAC---CTACTTGCAGCTCATAATTACTTAATTGCCACTCAC---AATGCTCCAATTCTTGAGGCTGAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAAACATGGTCAATGGGGCCTTTCCTAAGAAAGTACAACCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATTGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCTAAAAATGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTC---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGTATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT------AGTACTCATGTACAATTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCGACTAATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGATTTTCATCAA---CAAAATCCCACTACG------TCTTCAAATGCTACC------GAGAATTGGGAATATAGTAATTTCAACTCGCAGTCCAAC Collinsia_grandiflora_4 ?????????CATAATGAAATC------------CATGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTAACAAC---TCTCCAATTCTCGAGGCTCAA---GCCGCCGCCTTGTATAAC---GACTTCAACCACTTAGAT---GTCGTTCACGGCCAGCTCAAT------GGAGTTGTACTTGAGCATTCTACTACCATGGTCAATGGC---TTTCCTAAGAAA---CAGCCG---GCTCCCGCCGCTAAGAAAGACCGTCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTCTCACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AGGAAT------GCTGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC------ATA---GCT---TGTGAGAACAATGGCAAC---TCT------TCTTCACTGAAAGGAAAA---TCT---GTGATGGTGAATAGT------------AATAAATGT---AAAGGA---GTA---GTTAAA---GATTCGGTTACAAAGGAGTCGAGGGTTAAGGCAAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGTATTAAGGCACAATTAAAT---GAAGCCACTAGAAATAAT---TATAAGGATTATAGTTGGAGT---AGTAGTACTCAAGTACAATTTGATGATCAGGCAGGGCCTAATAACATTCTTCATTGTCCAATGACATCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGGTGTCATTAAGAAGAAGATGAAGCAGCAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCTCACG---------TCATCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCGCAGTCCAAC Collinsia_greenei_3_clones1_10 ?????????CATAATGAAATC------------CAAGAA---CTACTTGCAGCTCATAATTACTTAATTGCCACTCACAACAACGCGCCAATTCTTGAGGCTCAAGCCGCGGCGGCCTTGTATAAC---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAC------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGGCTTTCCTAAGAAAGTACAACCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAAATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAAGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------------ACTTCTTCTAATTCGAAGGTCGAAGTTGGAGACGACGTCATA---GCTAATTGTGAGAATAATGGGAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGGA---CTTAAAGTAGATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGTACTAGTAGTACTCAAGTACAATTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCGACTAATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCACTAAGAAGAAGATGAAG---CAGTACACTACACCTATGTTCGGTTTTAATCAA---CAAAATCTCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCACAGTCCAAC Collinsia_greenei_3_clones2_6 ?????????CATAATGAAATC------------CAAGAA---CTACTTGCAGCTCATAATTACTTAATTGCCACTCACAACAACGCGCCAATTCTTGAGGCTCAAGCCGCGACGGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAC------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGAGGCTTTCCTAAGAAAGTACAACCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAAATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAAGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCGGAGGTCGAAGTTGGAGACTACGTCATA---GCTAGTTGTGAGAATAATGGGAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGGA---CTTAAAGTAGATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAACTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGTACTAGTAGTACTCAAGTACAATTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCGACTAATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACTACACCAATGTTCGGTTTTAATCAA---CAAAATCTCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCGCAGTCCAAC Collinsia_heterophylla_20_clone1_2 ?????????CATAATGAAATC------------CATGAA---CTTCTTGCAGCTCATAATTACTTAGTATCCACTCAC---AATGCGCCAATTCTTGAGGCTCAAGCCACGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGGTTTTCCTAAGAAA---CAGCCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGGAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAT------TATAAGGGTTGTAGTTGGAGT------AGTAACCAAGTACAATTTGATGATCAA---GGGCCTAATAATGTTCTTCATTGTCCAATGACGTCGACTAATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATG---------TACACA---CCTATGTTTGGTTTTCATCAA---CAAAATCCCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCACCTCGCAGTCCAAC Collinsia_heterophylla_20_clone3 ?????????CATAATGAAATC------------CATGAA---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTCAC---AATGCGCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGCCAATGGCGGCTTTCCTAAAAAA---CAACCC------CCCGCCGCCAAGAAAGACCGTCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATGGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT------AGTAATCAAGTACAATTTGGTGATCAA---GGGCCTAACAATATTCTTCATTGTCCAATGGCGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---GAGTACACA---CCAATGTTCGGTTTTCATCAA---CAAATTCCCACAACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCAACTCGCAGTCCAAC Collinsia_heterophylla_21_cloneA1 ?????????CATAATGAAATC------------CATGAA---CTTCTTGCAGCTCATAATTACTTAGTATCCACTCAC---AATGCGCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGGTTTTCCTAAGAAA---CAGCCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGGAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAT------TATAAGGGTTGTAGTTGGAGT------AGTAACCAAGTACAATTTGATGATCAA---GGGCCTAATAATGTTCTTCATTGTCCAATGACGTCGACTAATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATG---------TACACA---CCTATGTTTGGTTTTCATCAA---CAAAATCCCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCACCTCGCAGTCCAAC Collinsia_heterophylla_21_cloneA2 ?????????CATAATGAAATC------------CATGAA---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTCAC---AATGCGCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGGTTTTCCTAAGAAA---CAGCCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGGAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---GTTAAA---GATTCGATTACAAAGGGGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAT------TATAAGGGTTGTAGTTGGAGT------AGTAACCAAGTACAATTTGATGATCAA---GGGCCTAATAATGTTCTTCATTGTCCAATGACGTCGACTAATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATG---------TACACA---CCTATGTTTGGTTTTCATCAA---CAAAATCCCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCACCTCGCAGTCCAAC Collinsia_heterophylla_21_cloneA3 ?????????CATAATGAAATC------------CATGAA---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTCAC---AATGCGCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGCCAATGGCGGCTTTCCTAAAAAA---CAACCC------CCCGCCGCCAAGAAAGACCGTCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT------AGTAATCAAGTACAATTTGATGATCAA---GGGCCTAACAATATTCTTCATTGTCCAATGGCGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---GAGTACACA---CCAATGTTCGGTTTTCATCAA---CAAATTCCCACAACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCAACTCGCAGTCCAAC Collinsia_heterophylla_21_cloneD1_2 ?????????CATAATGAAATC------------CATGAA---CTTCTTGCAGCTCATAATTACTTAGTATCCACTCAC---AATGCGCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGGTTTTCCTAAGAAA---CAGCCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------GAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGAGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAT------TATAAGGGTTGTAGTTGGAGT------AGTAATCAAGTACAATTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCGACTAATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATG---------TACACA---CCTATGTTTGGTTTTCATCAA---CAAAATCCCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCACCTCGCAGTCCAAC Collinsia_heterophylla_21_cloneD3_4 ?????????CATAATGAAATC------------CATGAA---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTCAC---AATGCGCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGGCTTTCCTAAAAAA---CAACCC------CCCGCCGCCAAGAAAGACCGTCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGGAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAT------TATAAGGGTTGTAGTTGGAGT------AGTAACCAAGTACAATTTGATGATCAA---GGGCCTAATAATGTTCTTCATTGTCCAATGACGTCGACTAATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATG---------TACACA---CCTATGTTTGGTTTTCATCAA---CAAAATCCCTCGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCACCTCGCAGTCCAAC Collinsia_heterophylla_21_cloneD3P1 ??????????????????ATC------------CATGAA---CTTCTTGCAGCTCATAATTACTTAGTTGCTACTCAC---AATGCGCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGCCAATGGCGGCTTTCCTAAAAAA---CAACCC------CCCGCCGCCAAGAAAGACCGTCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT------AGTAATCAAGTACAATTTGATGATCAA---GGGCCTAACAATATTCTTCATTGTCCAATGGCGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---GAGTACACA---CCAATGTTCGGTTTTCATCAA---CAAATTCCCACAACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCACCTCGCAGTCCAAC Collinsia_heterophylla_8_clone1 ?????????CATAATGAAATC------------CATGAA---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTCAC---AATGCGCCAATTATTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGAGACTTTCCTAAGAAA---CAGCCT------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAGGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGA---GTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGAGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAT------TATAAGGGTTGTAGTTGGAGT------AGTAATCAAGTACAATTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCGACTAATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATG---------TACACA---CCTATGTTTGGTTTT??????????????TCCCACGACG------TCTTCAATTGCTACC------GAGAAT????????????????????????????????? Collinsia_heterophylla_8_clone2_4 ?????????CATAATGAAATC------------CATGAA---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTCAC---AATGCGCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGGCTTTCCTAAAAAA---CAACCC------CCCGCCGCCAAGAAAGACCGTCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAATGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGGA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT------AGTAATCAAGTACAATTTGATGATCAA---GGGCCTAACAATATTCTTCATTGTCCAATGGCGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---GAGTACACA---CCAATGTTCGGTTTTCATCAA---CAAATTCCCACAACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCAACTCGCAGTCCAAC Collinsia_linearis_14 ?????????CATAATGAAATC------------CATGAC---CTTCTTGCAGCCCATAATTACTTAGTTGCCACCAACAATAATACACAAATTCTTGAGGGTCAAGCCGCTGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAGCGGTCAACTCAAC------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGC---TTTCCTAAGAAA---CAACCA---GCCCCCGCCGCCAAGAAAGACCGCCATAGCAAAATATACACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCGATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT---------GCTACTTCTTCTGATTCCGAGGTTGAAGTTGGAGAT------GTA---GCGAATTGTGAG---AATGGAAAC---TCT------TCTTCATTGAAAGGTAAA---TCT---GTGGTGGTGAATAGT------------AGTAAATGT---AAAGGA---GTA---GTTAAA---GATTCGATTACAAAGGATTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTAATAGAAATAAT---TTTAAGGGTTGTAGTTGGAGT---AGTAATACTCAAGTACAATTTGATGATCAG---GGGCCTAATACTATGCTTCATTGTCCAATGACTTCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTGATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAACAACAAAATCTCACA---------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCGCAGTCCAAC Collinsia_metamorphica_3_clone5 ACTTCACAGCATAATGAAATC------------CAAGAC---CTACTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAATGCACCAATTCTTGAGGCTCAAGCCGCCGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGGCTTTCCTAAGAAAGTACAACCC------CCCGCCGCTAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCGAGAGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTCCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCAATCAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAACTCCGAGGTG---------GAC------ATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---CCTAAAGCAGATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCGCAATTAAAT---GAAGCTACTATAAAT------TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAG---GGGCCTAATAATATCCTTCATTGTCCAATGACGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCCCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGTCTCGCAGTCCAAC Collinsia_metamorphica_3_clone6 ?????????CATAATGAAATC------------CAAGAC---CTACTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAATGCACCAATTCTTGAGGCTCAAGCCGCCGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGGCTTTCCTAAGAAAGTACAACCC------CCCGCCGCTAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCGAGAGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAACTCCGAGGTG---------GAC------ATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---CCTAAAGCAGATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTATAAAT------TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAG---GGGCCTAATAATATCCTTCATTGTCCAATGACGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTCTCATCAA---CAAAATCCCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGTCTCGCAGTCCAAC Collinsia_metamorphica_3_clones2_3 ACTTCACAGCATAATGAAATC------------CAAGAC---CTACTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAATGCACCAATTCTTGAGGCTCAAGCCGCCGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGGCTTTCCTAAGAAAGTACAACCC------CCCGCCGCTAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCGAGAGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAACTCCGAGGTG---------GAC------ATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---CCTAAAGCAGATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTATAAAT------TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAG---GGGCCTAATAATATCCTTCATTGTCCAATGACGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCCCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGTCTCGCAGTCCAAC Collinsia_metamorphica_7 ACTTCACAGCATAATGAAATC------------CAAGAC---CTACTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAATGCACCAATTCTTGAGGCTCAAGCCGCCGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGGCTTTCCTAAGAAAGTACAACCC------CCCGCCGCTAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCGAGAGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTTAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAACTCCGAGGTG---------GAC------ATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---CCTAAAGCAGATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTATAAAT------TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAG---GGGCCTAATAATATCCTTCATTGTCCAATGACGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCCCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGTCTCGCAGTCCAAC Collinsia_multicolor_2 ?????????CATAATGAAATC------------CAAGAC---CTACTTGCAGCTCATAATTACTTAATTGCCACTCACAACAATGTGCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTTAATGGGGACTTTCCTAAGAAAGTACAACCC------CCCACCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTC---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT------AGTAATCAAGTACAATTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---GAGTACACA---CCAATGTTCGGTTTTCATCAA---CAAATTCCCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCAACTCGCAGTCCAAC Collinsia_parviflora_12 ?????????CATAATGAAATC------------CAAGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTAACAAC---TCTCCGATTCTCGAGGCTCAA---GCCGCCGCCTTGTATAAC---GACTTCAACCACTTAGAT---GTCGTTCACGGCCAGCTCAAT------GGAGTTGTACTTGACCATTCTACAACCATGGTCAATGGC---TTTCCTAAGAAA---CAGCCG---GCTCCCGCCGCTAAGAAAGACCGTCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGACCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTCTCACCAAATCAAAGGAGGCAATTAAGGATTTGGTGAAGTCCAAAAGTGGT---AAGAGT------GCTGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGA---------------GCT---TGTGAGAACAATGGCAAC---TCT------TCTTCACTGAAAGGAAAA---TCT---GTGGTGGTGAATGGT------------AATAAATGT---AAAGGA---GTA---GTTAAA---GATTCGGTTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGTATTAAGGCACAATTAAAT---GAAGCCACTAGAAATAAT---TATAAGGATTGTAGTTGGAGT---AGTAGTACTCAAGTACAATATGATGATCAGGCAGGGCCTAATAACATTCTTCATTGTCCAATGACATCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGGTGTCATTAAGAAGAAGATGAAGCAGCAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCTCACG---------TCATCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCGCAGTCCAAC Collinsia_rattanii_3 ?????????CATAATGAAATC------------CATGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTAACAATAATACACAAATTCTTGAGGGTCAAGCCGCTGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAGCGGTCAACTCAAC------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGC---TTTCCTAAGAAA---CAACCTGCAGCCCCCGCCGCCAAGAAAGACCGCCATAGCAAAATATACACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCGATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT---------GCTACTTCTTCTGATTCCGAGGTTGAAGTTGGAGAT------GTA---GCGAATTGTGAG---AATGGCAAC---TCT------TCTTCATTGAAAGGTAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGA---GTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTAATAGAAATAAT---TTTAAGGGTTGTAGTTGGAGT---AGTAATACTCAAGTACAATTTGATGATCAG---GGGCCTAATAACATCCTTCATTGTCCAATGACTTCA---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTGATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCTCACA---------TCTTCAAATGATACC------GAGAATTGGGATTATAATAATTTCGCCTCGCAGTCCAAC Collinsia_rattanii_8 ?????????CATAATGAAATC------------CATGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTAACAATAATACACAAATTCTTGAGGGTCAAGCCGCTGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAGCGGTCAACTCAAC------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGC---TTTCCTAAGAAA---CAACCTGCAGCCCCCGCCGCCAAGAAAGACCGCCATAGCAAAATATACACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCGATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT---------GCTACTTCTTCTGATTCCGAGGTTGAAGTTGGAGAT------GTA---GCGAATTGTGAG---AATGGCAAC---TCT------TCTTCATTGAAAGGTAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGA---GTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTAATAGAAATAAT---TTTAAGGGTTGTAGTTGGAGT---AGTAATACTCAAGTACAATTTGATGATCAG---GGGCCTAATAACATCCTTCATTGTCCAATGACTTCA---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTGATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCTCACA---------TCTTCAAATGATACC------GAGAATTGGGATTATAATAATTTCGCCTCGCAGTCCAAC Collinsia_sparsiflora_var_collina_1 ?????????CATAATGAAATC------------CAAGAA---CTACTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAACGCGCCAATTCTCGAGGCTCAAGCTGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTTGTTAACGGCCAGCTTAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGCCTTTCCTAAGAAAGTACAACCC------CCCGCCGCTAAGAAAGACCGACATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACTAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATAGGCGCT---TGTGAG---GATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AGTAAATGT---AAAGGAGGAGGAGGACTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAC---GAAGCTACTAGAAAT------TATAAGGAATGTAGTTGGAGT------AGTAATCAAGTACAATTTGAT---CAG---GGGCCTAATAATAATCTTCATTGTCAAATGACGTCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACTACACCTATGTTCGGTTTTCATCAA---CAAAATCTCACAACA------TCTTCAAATGCTACT------GAGAATTGGGATTATAGTAATTTCGCCTCTCAGTCCAAC Collinsia_sparsiflora_var_sparsiflora_4_5 ?????????CATAATGAAATC------------CAAGAA---CTACTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAACGCGCCAATTCTCGAGGCTCAAGCTGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTTGTTAACGGCCAGCTTAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGCCTTTCCTAAGAAAGTACAACCC------CCCGCCGCTAAGAAAGACCGACATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACTAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATAGGCGCT---TGTGAG---GATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTAGTGAATAGT------------AGTAAATGT---AAAGGAGGAGGAGGACTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAC---GAAGCTACTAGAAAT------TATAAGGAATGTAGTTGGAGT------AGTAATCAAGTACAATTTGAT---CAG---GGGCCTAATAATAATCTTCATTGTCAAATGACGTCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACTACACCTATGTTCGGTTTTCATCAA---CAAAATCTCACAACA------TCTTCAAATGCTACT------GAGAATTGGGATTATAGTAATTTCGCCTCG????????? Collinsia_sparsiflora_var_sparsiflora_6 ?????????CATAATGAAATC------------CAAGAA---CTACTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAACGCGCCAATTCTCGAGGCTCAAGCTGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTTGTTAACGGCCAGCTTAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGCCTTTCCTAAGAAAGTACAACCC------CCCGCCGCTAAGAAAGACCGACATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACTAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATAGGCGCT---TGTGAG---GATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTAGTGAATAGT------------AGTAAATGT---AAAGGAGGAGGAGGACTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAC---GAAGCTACTAGAAAT------TATAAGGAATGTAGTTGGAGT------AGTAATCAAGTACAATTTGAT---CAG---GGGCCTAATAATAATCTTCATTGTCAAATGACGTCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACTACACCTATGTTCGGTTTTCATCAA---CAAAATCTCACAACA------TCTTCAAATGCTACT------GAGAATTGGGATTATAGTAATTTCGCCTCG????????? Collinsia_tinctoria_1 ?????????CATAATGAAATC------------CAGGAC---CTACTTGCAGCTCATAATTACTTAGTTGCTACTCAC---AATGCTCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTT{AG}GAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGGGGCTTCCCTAAGAAAGTACAGCCC------CCCGCCACCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGGA---CTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAATGAAGAAGCTACTAGAAATTATAAGTATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACA{AG}TTTGATGATCAA---GGGCCTAATAATATTCTTC{AC}TTGTCCAATGACATCGACTAATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---{CG}AGTACACA---CCTATGTTCGATTTTCATCAACAT{CG}AAAATCCCACTACG------TCTTCAAATGCTACC------GAGAATTGGGATTA{CT}AGTAATTTCGCCTCGCAGTCCAAC Collinsia_torreyi_3 ?????????CATAATGAAATC------------CAAGAC---CTCTTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAATGCGCCGATTCTTGAAGCTCAAGCCGCCGCCGCCTTGTATAACAACGACTACAACCACTTAGATCATGTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTGAATGGC---TTTCCTATGAAA---CAACCC------CCCGCCGCCAAGAAAGACCGACATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGATGTTGAACTTCGACAAGCCTAGCAAAACCCTTGATTGGCTTCTAACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGTGGTAAGAGTACTACTACTGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGACGTTGACATA---GCTAATTGTGAG---AATGGCAACTACTCT------TCTTCAATGAAAGGAAAA---TCT---GTGGTGGTGAATAGTAGT---------AATAAATGT---AAAGGGTCAGGA---CTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGAGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGTAGTAGTAGTACTCAAGTACAATTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACATCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CATTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCTCACA---------TCTTCAAATGCTACC------GAGAATTGGGATTATAATAATTTCTCCTCGCAGTCAAAC Collinsia_verna_3 ?????????CATAATGAAATC------------CATGAC---CTTCTTGCAACTCATAATTACTTAGTTGCCACTAACAAC---TCGCCAATTCTCGAGGCTCAAGCCGCTGCCGCCTTGTATAAC---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAC------GGGGTTGTACTTGACCATTCTACT------------GGC---TTTCCTAAGAAA---CAGCCT---GCCCCGGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------GCTGCTACTTCTTCTAATTCCGAGGTCGAAATTGGAGAC------ATA---GCT---TGTGAAAATAATGGCAAC---TCT------TCTTCATTGAAAGGAAAA---TCTCATGTGGTGATGAATAGT------------AATAAATGT---AAAGGA---GTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTTCTACAAATAAT---TATAAGGGTTGTAGTTGGAGT---AGTAGTACTCAAGTACAATTTGATGATCAG---GGGCCTAATAATATTCTTCATTGTCCAATGACATCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAGCAGCAGTACACA---CCTATGTTTGGTTTTCATCAA---CAAAATCTCACG---------TCATCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCGCAGTCCAAC Collinsia_violacea_2 ?????????????????????????????????????????????CTTGCAGCTCATAATTACTTAGTTTCCACCAACAAC---TCGTCAATTCTCGAGGCTCAAGCCGCGGCCTCCTTGTATAAC---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAC------GGGGTTGTACTTGACCATTCTACT------------GGC---TTTCCTAAGAAA---CAGCCT---GCCCCGGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCGAGAGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTTACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------GCTGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC------ATA---GCT---TGTGAGAATAATGGCAAC---TCT------TCTTCATTGAAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGA---GTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTTCTAGGAATAAT---TATAAGGGTTGTAGTTGGAGT---AGTAGTACTCAAGTACAATTTGATGATCAG---GGGCCTAATAATATTCTTCATTGTCCAATGACATCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAGCAGCAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCTCACG---------TCATCAAATGCTACC------GAGAACTGGGATTATAGTAATTTCACCTCGCAG?????? Collinsia_wrightii_12 ?????????CATAATGAAATC------------CAAGAC---CTCTTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAACGCGCCTATTCTTGAAGCTCAA---GCCGCCGCGTTGTATAAC---GACTTCAACCACTTAGAT---GCGGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGC---TTTCCTATGAAACAACAACCC------CCCGCCGCCAAGAAAGACCGACATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGATGTTGAACTTCGACAAGCCTAGCAAAACCCTTGATTGGCTTCTAACCAAATCAAAGGAGGCAATTAAGGATTTGGTTAAGTCCAAAAGTGGT---AAGAGT---ACTACTGCTACTTCTTCTAATTCTGAGGTCGAAGTTGGAGACGACGTCATA---GCT---TGTGAG---AATGGCAACAACTCT------TCATTAATGAAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGCTGGAGTA---GTTAAA---GATTCGATTACAAAGGAGGCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT---AGTAGTACTCAAGTACACTTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTCTCATTAAGAAGAAGATGAAG---CATTACACA---CCTATGTTTGGTTTTCATCAA---CAAAATCTCACT---------TCTTCGAATGCTACC------GAGAATTGGGATTATAGTAATTTCTCCTCGCAGTCAAAC Keckiella_cordifolia ?????????????????????????????????????????????CTTTCGGCTCATAATTACTTAATTGCCACCAAC---AATGCTCCTGTTCTTGAA---------GCTGCCTCCTTGTATAAT---GACTTCAACCACATAGAT---GTTGTCAACGGG---CTCAAC------GGGGTTGTCGTTGACCATTCTACTACCATGGTCAATGCT---TTTCCTAAGAAA---CAGTCC---------TCCGCGAAGAAAGACCGGCATAGCAAAATATATACTGTTCATGGACCGAGGGACCGGAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGTTGTTGAATTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTAACGAAATCCAAGGAGGCAATTAAGGATTTGGTCAACTTGAAAAGTGGT---AAGACT------ACTACTACTTCTTCTAATTCAGATGTCGAAGTTGGGGAC------TTA---GCT---TGTGAGATTAATGGCAAC------------TCTTCATTGAAAGGGAAA---TCT---GTGGTGGTGAATAGCCAT---------AATAAATGT---AAAGGG---------GCAAAG---GAATCGATTGTGAAAGAGTCGAGGGTTAAGGCGAGGGCAAGAGCAAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAT------TATAAGGGTTGTGATTGGAAT---------ACTCAAGTACAATTTGAT---CAG---GCG---ACTAATATTCTTCATTGTCCAATAACTTCT---AATTAT---GAAGAC---CTAATTCAAGAATCTATTGTGAATAAGAAGAAGATGAAG---CAGTATCCA---CCGATGTTGGGTTTTAATCAA---CAAAATCTCGGTAGTATCGCATCTGCAAATGCTACT------GAGAATTGGGATTATAGTAATTTTGCCTCACAGTCCAAC Penstemon_hartwegii ACTTCACAACACAATGAAATCCTCGTCCACCACCACGAC---CTCCTTTCGGCTCATCATTACTTAGCCGGG------GGGGCCACCAACAACCTTGAG------GCTGCGGCCGCCCTGTATAAC---GACTTCAACCAA---GAT------------------------------------GTCGTTGACCATTCT---ACCATGGTCAACCCT---TATCCTAAGAAA---CAACCC---------ACG---AAAAAAGATAGGCATAGCAAAATACATACTGCTCATGGACCGAGGGATAGGAGAGTTAGGCTCTCCATCGGCATTGCACGTAAGTTTTTCGATCTTCAAGAGTTGCTCAATTTCGACAAGCCAAGCAAAACACTTGATTGGCTTCTAACGAAATCGAAGGAGGCCATTAAGGAACTAGTCCAGTCGAAAAGTGGT---AATAAG---------ACTACTTCGTCTAATTCGGAGGACTTGGACTTGGAC------TTA---GCT---TGTGAGATGAATGGCAAC---------------------AAAGGGAAGAAATCTCATGGGGTGGTGAATAGTAGTAATTACAATTACAAATGT---AAA------GTA---GTAAAG---GATTCGATTGCCAAGGAGTCGAGGGTTAAGGCGAGGGCGAGGGCGAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGTCACAATTAAAT---GAAGCTACTAGAAAT---------------TGTAATTGGGGT------------CAACTACAATTTAAT---CAG---GCGCCTTATAATATTGGACAA---------------------TAT---GAAGAC---CCAATTCAAGAATCTGTTGTGATCAAGAAGAAGATGAAG---CAGTTACCA---CTTATGTTCGGTTTTCATCAA---CAAAATCATATCTCAACGAGTACTTCATCTGCGCCACCGCCTGAGAATTGGGATTATAGTAATCTTGCATCACAGTCCAAC Tonella_floribunda_2_clone1_2 ?????????????????????????????????????????????CTTGCAGCTCATAATTACTTAGTTGCCACTAACAACAACGCGCCCATTTTTGAGGGTAAT---GCCGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTTGTTAACGGCCAACTCAACGTGAACGGTGTTGTACTTGACCATTCTACATCGATGGTCAATGGC---TTTCCTAAAAAA---CAGTCG---------GCCGTCAAGAAAGACCGGCATAGCAAAATATATACTGTTCATGGACCAAGGGACCGGAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCCAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT---------GCTACTTCTTCTAATTCTGAAGTCGAAGTTGGTGAC------GTA---GCT---TGTGAG---AATGGCAACTCTTTTGGAATAGATTTGTTGAAAGGAAAA---TCT---GTGGTGATGAATAGTAAT---------AATAAATGT---AAAGGAGGA------CTTAAA---GATTCGATTACAAAGGAGGCGAGGGTTAAGGCAAGAGCAAGGGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAC------TATAAGGGTTGTAGTTGGAGT------AGTAGTCAAGTACAATATGAT---CAG---GGGGCTAATAATATTCTTCATTTTCCAATAACTTCT---AATTAT---GAAGATCACCTAATTCAAGAATCTGTTGTGATTAAGAAGAAGCTGAAG---CAGTACCCA---CCTATCTTCGGTTATCATCAA---CAAAATCTCACA---------TCTTCAAATGCTACTGAT---CAGAATTGGGATTATAGTAATTTCGCCTCGCAGTCCAAC Tonella_floribunda_2_clone3_4 ?????????????????????????????????????????????CTTGCAGCTCATAATTACTTAGTTGCCACTAACAACAACGCGCCCATTTTTGAGGGTAAT---GCCGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTTGTTAACGGCCAACTCAACGTGAACGGTGTTGTACTTGACCATTCTACATCGATGGTCAATGGC---TTTCCTAAAAAA---CAGTCG---------GCCGTCAAGAAAGACCGGCATAGCAAAATATATACTGTTCATGGACCAAGGGACCGGAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCCAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT---------GCTACTTCTTCTAATTCTGAAGTCGAAGTTGGTGAC------GTA---GCT---TGTGAG---AATGGCAACTCTTTTGGAGTGGATTTGTTGAAAGGAAAA---TCT---GTGGTGATGAATGGTAAT---------AATAAATGT---AAAGGAGGA------CTCAAA---GATTCGATTACAAAGGAGGCGAGGGTTAAGGCAAGAGCAAGGGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAC------TATAAGGGTTGTAGTTGGAGT------AATAGTCAAGTACAATATGAT---CAT---GGGCCTAATAATATTCTTCATTGCCCAATGACTTCT---AATTAC---GAAGATCACCTAATTCAAGAATCTGTTGTGATTAAGAAGAAGCTAAAG---CAGTACCCA---CCTATCTTCGGTTATCATCAA---CAAAATCTCACA---------TCTTCAAATGCTACT------GAGAATTGGGATTATAGTAATTTCGCCTCGCAGTCCAAC Tonella_tenella_4 ?????????CACAATGAAATC------------CATGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTAACAACAACGCGCCTATTCTTGAGGGTAAT---GCCGCCGCCTTGTATAAC---GAGTTCAACCACTTAGAT---GTTGTTAACGGCCAACTCAAC------------GTTCTTGACCATTCTACAACCATGGTTAATGGC---TTTCCGAAAAAA---CAGTCC---------GCCGTTAAAAAAGACCGGCATAGCAAAATATATACTGTTCATGGACCAAGGGACCGGAGAGTTAGGCTTTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCCAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT---------GCTACTTCTTCTAATTCTGAGGTCGAAGTTGGTGAT---------------------GAG---AATGGCAACTCTTTTGGAGTG---------AAAGGAAAA---TCT---GTGGTGATGAATAGTAAT---------AATAAATGT---AAAGGAGCGGTA---CTTAAA---GATTCGATTACAAAGGAGGCGAGGGTTAAGGCAAGAGCAAGGGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAC------TATAAGGGTTGTAGTTGGAGT------ACTAGTCAAGTACAATTTGAT---CAG---GGG------------CTTCATTGTCCAATGACTTCT---AATTATATTGGAGATCACCTAATTCAAGAATCTGTTGTGATTAAGAAGAAGATGAAG---CAGTACCCA---CCTATCTTCGGTTATCATCAA---CAAAATCTCACA---------TCTTCAAATGCTACT------GAGAATTGGGATTATAATAATTTCGCCTCGCAGTCCAAC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7297] TITLE 'Collinsia all-partitions'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2534; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Collinsia_antonina_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGGCC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCGTCGACCTCCTCGATTGACCCGTTAGCGGTGCTGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG-CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAGATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGCGGATTGA---TATTGACCCATTGGCTCACTTACGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCCAAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTTAAAATGTCCCTTTTCCACTAAGT-GCCGTTTCATTCGTGAAATGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCTTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTTCGACGTCGATGAGGAATGCAACTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACTTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAAGAC---CTACTTGCAGCTCATAATTACTTAATTGCCACTCACAACAATGCGCCAATTCATGAGGCTCAAGCCGCGGCGGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGC---TTTCCTAAGAAAGTACAGCCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGC---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAA---GGGCCTAACAATATTCTTCATTGTCCAATGACGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---GACTACACA---CCAATGTTCGGTTTTCATCAA---CAAATTCCCACGACG------TCTTCAAATGCAACC------GAGAATTGGGAATATAGTAATTTCAACTCGCAGCCCAAC Collinsia_bartsiifolia_var_bartsiifolia_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGTACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG-CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGCGGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGCCCAAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CAT{CT}CATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGTTTCATTCGTGAAATGGTG-CGAGGTGGAACTATAACG--GCGATGTGCGTGTTTCCTTTTTCCCACACTATTGTGTTG{AG}GTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCG{AG}CGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGATTAATTACAAATAAAAATTCTT------------AGGCCTTATAAA-------TAG-AAGTTTTTCCTAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAATACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------GATTCAACTTTTTTAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAAGACCTACTACTTGCAGCTCATAATTACTTAATTGCCACTCAC---AATGCTCCAATTCTTGAGGCTGAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTTGTTAACGGCCAGCTCAAT------GGGGCTGTACTTGACCATTCTACAAACATGGTCAATGGGGCCTTTCCTAAGAAAGTACAACCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCTAAAAATGGT---AAGAGT------AATGCTACTTCTTCTAATTCTGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTC---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGTATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCGACTAATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGATTTTCACCAA---CAAAATCCCACTACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCAACTCGCAGTCCAAC Collinsia_callosa_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------AAT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TGGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGATCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAACGGGGG-CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---AAC-GCCTTGCCA--TCTTGTCG-TTGCGGCGGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACCGAGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--TATTTGCCTTGCCCAAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAATGTCCCTTTTCCACCTAGC-GTTGTTTCATTTGTGAAATGCTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTATTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACCCGTGCCATTATCAGTCCCTTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGGGATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAGAGCTTTGTCCATTTTGGGGATAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTAAAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAAGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAATGCGCCAATTCTTGAGGCTCAAGCTGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTTACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGCCTTTCCTAACAAA---CAGCCT------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------ACTGCTACTTCTTCTAATTCCGAGGTC---------GAC------ATA---GCT---TGTGAC---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---CTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAT------TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAGTTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAG---CAAAATCCCACAACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCGCAGTCCAAC Collinsia_childii_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGATCGGCCCGTTAGCGGTGCCGATCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG-CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGCGGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTTGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCCGCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCTGTTCGAAATGTCCCTTTTCCACTTAGT-GTCGTTTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCTGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAAACAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTCATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAAGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTCAC---AATGCGCCAATTCTTGAGGCTCAAGCTGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCCTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACTACCATGGTCAATGGCGCCTTTCCTAAGAAGGTACAGCCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGATC---------GAC------ATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGGA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAT------TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAG---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCGACTAATTAC---GAAGAC---CTAATTCAAGAATCCGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCCCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCGCAATCCAAC Collinsia_concolor_2_Collinsia_parryi_1 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGGCC-GAGGC-----------------ACT-AGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTGAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGATCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG-CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGCGGATCGA---TATTGACCCATTGGCTCACTCACGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCCAAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGTTTCATTCGTGAAATGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTCGGCCCATGC--ACACCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATCAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTGGGGGTAGTATATAAAAGTAGAATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAAGAC---CTACTTGCAGCTCATAATTACTTAATTGCCACTCACAACAATGCGCCAATTCTTGAGGCTCAAGCCGCGGCGGCCTTGTATAAT---GACTTCAATCACTTAGAT---GTCGTTAACAGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGGAGCTTCCCTAAGAAAGTACAGCCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------------ACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---GTTAAA---GATTTGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTCGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---GAGTACACA---CCAATGTTCGGTTTTCATCAA---CAAATTCCCACGACG------TCGTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCAACTCGCAGTCCAAC Collinsia_corymbosa_4 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG-CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGCGGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGCCCAAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGTTTCATCCGTGAAATGGTG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTAATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGATTAATTACAAATAAAAATTCTT------------AGGCCTTATAAA-------TAG-AAGTTTTTCCTAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAATACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------GATTCAACTTTTTTAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAAGAC---CTACTTGCAGCTCATAATTACTTAATTGCCACTCAC---AATGCTCCAATTCTTGAGGCTGAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAAACATGGTCAATGGGGCCTTTCCTAAGAAAGTACAACCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATTGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCTAAAAATGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTC---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGTATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT------AGTACTCATGTACAATTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCGACTAATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGATTTTCATCAA---CAAAATCCCACTACG------TCTTCAAATGCTACC------GAGAATTGGGAATATAGTAATTTCAACTCGCAGTCCAAC Collinsia_grandiflora_4 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGTACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG-CGGACATTGGCCTCCCGTGCGCGTCAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGTGGATTACA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCCACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTTGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGATTTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCAATTTTTTAAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGGTTAATTACAAATAAAAATTCTT------------AGACCTTAGAAA--GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAA------TATTCTACTTTTTTT--AATCTTTCTAAGA-AAGGAAATGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CATGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTAACAAC---TCTCCAATTCTCGAGGCTCAA---GCCGCCGCCTTGTATAAC---GACTTCAACCACTTAGAT---GTCGTTCACGGCCAGCTCAAT------GGAGTTGTACTTGAGCATTCTACTACCATGGTCAATGGC---TTTCCTAAGAAA---CAGCCG---GCTCCCGCCGCTAAGAAAGACCGTCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTCTCACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AGGAAT------GCTGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC------ATA---GCT---TGTGAGAACAATGGCAAC---TCT------TCTTCACTGAAAGGAAAA---TCT---GTGATGGTGAATAGT------------AATAAATGT---AAAGGA---GTA---GTTAAA---GATTCGGTTACAAAGGAGTCGAGGGTTAAGGCAAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGTATTAAGGCACAATTAAAT---GAAGCCACTAGAAATAAT---TATAAGGATTATAGTTGGAGT---AGTAGTACTCAAGTACAATTTGATGATCAGGCAGGGCCTAATAACATTCTTCATTGTCCAATGACATCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGGTGTCATTAAGAAGAAGATGAAGCAGCAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCTCACG---------TCATCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCGCAGTCCAAC Collinsia_greenei_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACA-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTC-TCGATCGGCCCGTTAGCGGTGCTGGTCGGGATGAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG-CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCGAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTTGTCG-TTGCATCGGATTGA---TATTGACCCATCGGCTCACTTAGGTGAACTTTCGACCGTGCAGCGACAATGTCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TCTGCCTTGCCCAAATATCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTTCGTTCAAAATGTCCCTTTTCCACTTAGC-GCCGTTTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAATG--GCGATGGGCGTGTTTCCTTTTTCCCACATTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCTGTACGTGGCACTCGTGCCATTATCAGTCCTTTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGTCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGATTAATTACAAATAAAAATTCTT------------AGGCTTTGGAAA-------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTAAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAAGAA---CTACTTGCAGCTCATAATTACTTAATTGCCACTCACAACAACGCGCCAATTCTTGAGGCTCAAGCCGCGGCGGCCTTGTATAAC---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAC------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGGCTTTCCTAAGAAAGTACAACCC------CCCGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAAATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAAGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------------ACTTCTTCTAATTCGAAGGTCGAAGTTGGAGACGACGTCATA---GCTAATTGTGAGAATAATGGGAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGGA---CTTAAAGTAGATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGTACTAGTAGTACTCAAGTACAATTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCGACTAATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCACTAAGAAGAAGATGAAG---CAGTACACTACACCTATGTTCGGTTTTAATCAA---CAAAATCTCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCACAGTCCAAC Collinsia_heterophylla_21_CYC1_clone_D3P1 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TTGAATC-GGAGGGGGG-CGGACATTGGCCTCCCGTGCG{CT}GTCAGCGCGCGGCCGGCCCAAATGCAAATCCCT{CT}ATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCA{AG}CGGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCCAAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GC{CT}GTTTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT??????????????????ATC------------CATGAA---CTTCTTGCAGCTCATAATTACTTAGTTGCTACTCAC---AATGCGCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGCCAATGGCGGCTTTCCTAAAAAA---CAACCC------CCCGCCGCCAAGAAAGACCGTCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT------AGTAATCAAGTACAATTTGATGATCAA---GGGCCTAACAATATTCTTCATTGTCCAATGGCGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---GAGTACACA---CCAATGTTCGGTTTTCATCAA---CAAATTCCCACAACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCACCTCGCAGTCCAAC Collinsia_heterophylla_21_CYC1_clones_D3_D4 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TTGAATC-GGAGGGGGG-CGGACATTGGCCTCCCGTGCG{CT}GTCAGCGCGCGGCCGGCCCAAATGCAAATCCCT{CT}ATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCA{AG}CGGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCCAAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GC{CT}GTTTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CATGAA---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTCAC---AATGCGCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGGCTTTCCTAAAAAA---CAACCC------CCCGCCGCCAAGAAAGACCGTCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGGAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAT------TATAAGGGTTGTAGTTGGAGT------AGTAACCAAGTACAATTTGATGATCAA---GGGCCTAATAATGTTCTTCATTGTCCAATGACGTCGACTAATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATG---------TACACA---CCTATGTTTGGTTTTCATCAA---CAAAATCCCTCGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCACCTCGCAGTCCAAC Collinsia_linearis_14 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG-CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGTGAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATC{CT}CGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CT{CT}GCCTTGGCCAAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAATTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTAT{CT}GTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTTGGTTA-TTACAAATAAAAATTCTT------------AGACTTTGGAAA--GGAAATCT-AAGTTTTTCTTAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA--AATCTTTCTAAGA-AAGGAAATGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CATGAC---CTTCTTGCAGCCCATAATTACTTAGTTGCCACCAACAATAATACACAAATTCTTGAGGGTCAAGCCGCTGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAGCGGTCAACTCAAC------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGC---TTTCCTAAGAAA---CAACCA---GCCCCCGCCGCCAAGAAAGACCGCCATAGCAAAATATACACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCGATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT---------GCTACTTCTTCTGATTCCGAGGTTGAAGTTGGAGAT------GTA---GCGAATTGTGAG---AATGGAAAC---TCT------TCTTCATTGAAAGGTAAA---TCT---GTGGTGGTGAATAGT------------AGTAAATGT---AAAGGA---GTA---GTTAAA---GATTCGATTACAAAGGATTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTAATAGAAATAAT---TTTAAGGGTTGTAGTTGGAGT---AGTAATACTCAAGTACAATTTGATGATCAG---GGGCCTAATACTATGCTTCATTGTCCAATGACTTCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTGATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAACAACAAAATCTCACA---------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCGCAGTCCAAC Collinsia_metamorphica_7 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACT-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGGTCGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG-CGGACATTGGCCTCCCGTGCGCGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGCGGATTGA---TATCGACCCATCGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCCGCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGTTCGAAATGTCCCTTTTCCACTTAGT-GCCGTTTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACT{CT}GTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTTGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTTGGAATTATTAGAAGAATTTCTTAGGTCAGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTGGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGATTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-------TAT-AAGTTTTTCCTAAAAAAA--TAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTTACTTCACAGCATAATGAAATC------------CAAGAC---CTACTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAATGCACCAATTCTTGAGGCTCAAGCCGCCGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGGCTTTCCTAAGAAAGTACAACCC------CCCGCCGCTAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCGAGAGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTTAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAACTCCGAGGTG---------GAC------ATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTA---CCTAAAGCAGATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTATAAAT------TATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACAATTTGATGATCAG---GGGCCTAATAATATCCTTCATTGTCCAATGACGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCCCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGTCTCGCAGTCCAAC Collinsia_multicolor_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------AAT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTTCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGGGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG-CGGACATTGGCCTCCCGTGCGCCTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGCGGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTATCGGAACAAGCGC--T-TTCGCCTTGCCCAAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCCAAAATGTCCCTTTTCCACTTAGT-GCCGTTTCATTCGTGAAATGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTTGAGTCCTC--GTGGCTTGCATGATACGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATTAGTGATTTGATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA-------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGT----AATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAAGAC---CTACTTGCAGCTCATAATTACTTAATTGCCACTCACAACAATGTGCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTTAATGGGGACTTTCCTAAGAAAGTACAACCC------CCCACCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGTC---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT------AGTAATCAAGTACAATTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---GAGTACACA---CCAATGTTCGGTTTTCATCAA---CAAATTCCCACGACG------TCTTCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCAACTCGCAGTCCAAC Collinsia_parviflora_12 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--{AT}CGTATC-GAAGGGGGG-CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGTGGATTAAAAATATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCCACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGATTTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTA{AC}CGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTAAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA--GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAA------TATTCTACTTTTTTT--AATCTTTCTAAGA-AAGGAAATGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAAGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTAACAAC---TCTCCGATTCTCGAGGCTCAA---GCCGCCGCCTTGTATAAC---GACTTCAACCACTTAGAT---GTCGTTCACGGCCAGCTCAAT------GGAGTTGTACTTGACCATTCTACAACCATGGTCAATGGC---TTTCCTAAGAAA---CAGCCG---GCTCCCGCCGCTAAGAAAGACCGTCATAGCAAAATATATACTGTTCATGGACCGAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGACCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTCTCACCAAATCAAAGGAGGCAATTAAGGATTTGGTGAAGTCCAAAAGTGGT---AAGAGT------GCTGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGA---------------GCT---TGTGAGAACAATGGCAAC---TCT------TCTTCACTGAAAGGAAAA---TCT---GTGGTGGTGAATGGT------------AATAAATGT---AAAGGA---GTA---GTTAAA---GATTCGGTTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGTATTAAGGCACAATTAAAT---GAAGCCACTAGAAATAAT---TATAAGGATTGTAGTTGGAGT---AGTAGTACTCAAGTACAATATGATGATCAGGCAGGGCCTAATAACATTCTTCATTGTCCAATGACATCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGGTGTCATTAAGAAGAAGATGAAGCAGCAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCTCACG---------TCATCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCGCAGTCCAAC Collinsia_rattanii_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG-CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGTGAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCCAAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTGCT-GTCAATTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTTGGTTA-TTACAAATAAAAATTCTT------------AGACTTTGGAAA--GGAAATCT-AAGTTTTTCTTAAATAAA--CAAGAAAAAA-----------------------------TAGGATTAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA--AATCTTTCTAAGA-AAGGAAATGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CATGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTAACAATAATACACAAATTCTTGAGGGTCAAGCCGCTGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTCGTTAGCGGTCAACTCAAC------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGC---TTTCCTAAGAAA---CAACCTGCAGCCCCCGCCGCCAAGAAAGACCGCCATAGCAAAATATACACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCGATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT---------GCTACTTCTTCTGATTCCGAGGTTGAAGTTGGAGAT------GTA---GCGAATTGTGAG---AATGGCAAC---TCT------TCTTCATTGAAAGGTAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGA---GTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTAATAGAAATAAT---TTTAAGGGTTGTAGTTGGAGT---AGTAATACTCAAGTACAATTTGATGATCAG---GGGCCTAATAACATCCTTCATTGTCCAATGACTTCA---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTGATTAAGAAGAAGATGAAG---CAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCTCACA---------TCTTCAAATGATACC------GAGAATTGGGATTATAATAATTTCGCCTCGCAGTCCAAC Collinsia_sparsiflora_var_collina_1 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG-CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGTGGATTAA---CATCGACCCACCGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCCAAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGTTTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA-------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAAGAA---CTACTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAACGCGCCAATTCTCGAGGCTCAAGCTGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTTGTTAACGGCCAGCTTAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGCCTTTCCTAAGAAAGTACAACCC------CCCGCCGCTAAGAAAGACCGACATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACTAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATAGGCGCT---TGTGAG---GATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AGTAAATGT---AAAGGAGGAGGAGGACTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAC---GAAGCTACTAGAAAT------TATAAGGAATGTAGTTGGAGT------AGTAATCAAGTACAATTTGAT---CAG---GGGCCTAATAATAATCTTCATTGTCAAATGACGTCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACTACACCTATGTTCGGTTTTCATCAA---CAAAATCTCACAACA------TCTTCAAATGCTACT------GAGAATTGGGATTATAGTAATTTCGCCTCTCAGTCCAAC Collinsia_sparsiflora_var_sparsiflora_4_5 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG-CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGTGGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCCAAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGTTTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA-------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAAGAA---CTACTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAACGCGCCAATTCTCGAGGCTCAAGCTGCGGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTTGTTAACGGCCAGCTTAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGCGCCTTTCCTAAGAAAGTACAACCC------CCCGCCGCTAAGAAAGACCGACATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACTAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATAGGCGCT---TGTGAG---GATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTAGTGAATAGT------------AGTAAATGT---AAAGGAGGAGGAGGACTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAC---GAAGCTACTAGAAAT------TATAAGGAATGTAGTTGGAGT------AGTAATCAAGTACAATTTGAT---CAG---GGGCCTAATAATAATCTTCATTGTCAAATGACGTCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CAGTACACTACACCTATGTTCGGTTTTCATCAA---CAAAATCTCACAACA------TCTTCAAATGCTACT------GAGAATTGGGATTATAGTAATTTCGCCTCG????????? Collinsia_tinctoria_1_ETS_clone2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG-CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGCGGATCGA---TATTGACCCATTGGCTCACTTACGTGAGCTTTCGA?????????????????????????AGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCCAAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCTGTTTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA-------TAT-AAGTTTTTCCGAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAGGAC---CTACTTGCAGCTCATAATTACTTAGTTGCTACTCAC---AATGCTCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTT{AG}GAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGGGGCTTCCCTAAGAAAGTACAGCCC------CCCGCCACCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGGA---CTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAATGAAGAAGCTACTAGAAATTATAAGTATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACA{AG}TTTGATGATCAA---GGGCCTAATAATATTCTTC{AC}TTGTCCAATGACATCGACTAATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---{CG}AGTACACA---CCTATGTTCGATTTTCATCAACAT{CG}AAAATCCCACTACG------TCTTCAAATGCTACC------GAGAATTGGGATTA{CT}AGTAATTTCGCCTCGCAGTCCAAC Collinsia_tinctoria_1_ETS_clone3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG-CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGCGGATCGA---TATTGACCCATTGGCTCACTTACGTGAGCTTTCGA?????????????????????????AGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCCAAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGTTTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACGATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA-------TAT-AAGTTTTTCCGAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAGGAC---CTACTTGCAGCTCATAATTACTTAGTTGCTACTCAC---AATGCTCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTT{AG}GAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGGGGCTTCCCTAAGAAAGTACAGCCC------CCCGCCACCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGGA---CTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAATGAAGAAGCTACTAGAAATTATAAGTATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACA{AG}TTTGATGATCAA---GGGCCTAATAATATTCTTC{AC}TTGTCCAATGACATCGACTAATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---{CG}AGTACACA---CCTATGTTCGATTTTCATCAACAT{CG}AAAATCCCACTACG------TCTTCAAATGCTACC------GAGAATTGGGATTA{CT}AGTAATTTCGCCTCGCAGTCCAAC Collinsia_tinctoria_1_ETS_clone7 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG-CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGCGGATCGA---TATTGACCCATTGGCTCACTTACGTGAGCTTTCGA?????????????????????????AGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCCAAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGTTTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA-------TAT-AAGTTTTTCCGAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAGGAC---CTACTTGCAGCTCATAATTACTTAGTTGCTACTCAC---AATGCTCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTT{AG}GAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGGGGCTTCCCTAAGAAAGTACAGCCC------CCCGCCACCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGGA---CTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAATGAAGAAGCTACTAGAAATTATAAGTATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACA{AG}TTTGATGATCAA---GGGCCTAATAATATTCTTC{AC}TTGTCCAATGACATCGACTAATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---{CG}AGTACACA---CCTATGTTCGATTTTCATCAACAT{CG}AAAATCCCACTACG------TCTTCAAATGCTACC------GAGAATTGGGATTA{CT}AGTAATTTCGCCTCGCAGTCCAAC Collinsia_tinctoria_1_ETS_clones1_5_6_8_10_11_12 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG-CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGCGGATCGA---TATTGACCCATTGGCTCACTTACGTGAGCTTTCGA?????????????????????????AGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCCAAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGTTTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA-------TAT-AAGTTTTTCCGAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAGGAC---CTACTTGCAGCTCATAATTACTTAGTTGCTACTCAC---AATGCTCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTT{AG}GAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGGGGCTTCCCTAAGAAAGTACAGCCC------CCCGCCACCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGGA---CTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAATGAAGAAGCTACTAGAAATTATAAGTATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACA{AG}TTTGATGATCAA---GGGCCTAATAATATTCTTC{AC}TTGTCCAATGACATCGACTAATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---{CG}AGTACACA---CCTATGTTCGATTTTCATCAACAT{CG}AAAATCCCACTACG------TCTTCAAATGCTACC------GAGAATTGGGATTA{CT}AGTAATTTCGCCTCGCAGTCCAAC Collinsia_tinctoria_1_ETS_clones4_9 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG-CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGCGGATCGA---TATTGACCCATTGGCTCACTTACGTGAGCTTTCGA?????????????????????????AGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCCAAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGTTTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA-------TAT-AAGTTTTTCCGAAATAAA--CAAGAAAAAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAGGAC---CTACTTGCAGCTCATAATTACTTAGTTGCTACTCAC---AATGCTCCAATTCTTGAGGCTCAAGCCGCGGCCGCCTTGTATAAT---GACTTCAACCACTT{AG}GAT---GTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGGGGCTTCCCTAAGAAAGTACAGCCC------CCCGCCACCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTTGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTTTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------AATGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC---GTCATA---GCT---TGTGAG---AATGGCAAG---------------------AAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGAGGAGGA---CTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAATGAAGAAGCTACTAGAAATTATAAGTATAAGGGTTGTAGTTGGAGT------AGTACTCAAGTACA{AG}TTTGATGATCAA---GGGCCTAATAATATTCTTC{AC}TTGTCCAATGACATCGACTAATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---{CG}AGTACACA---CCTATGTTCGATTTTCATCAACAT{CG}AAAATCCCACTACG------TCTTCAAATGCTACC------GAGAATTGGGATTA{CT}AGTAATTTCGCCTCGCAGTCCAAC Collinsia_torreyi_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC---ACGATCGCAAGGTCGCT-CGTCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGATCTC-TCGGTTAGCCCGTTCGCGGTGCTAGTCGGGAGGGCCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-G-AGGGGGA-CGGACATTGGCCTCCCGTGTGCGTTAGTATGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTT---TCT-GTCATGTCA--TTCCGTCG-TTGCGGTGGATTAA---TATTGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGTCCACC--TCGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATCAAAATGTCTCTTTTCCACCTAGT-GTCATTTCATTCGTGAAGTGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAATCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAACCGTTATTATTCGAGTTCTC--GTGACTTGTGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA--GGAAATAT-AAGTTTTTCCTAACTAAA--CAAGAAAAA------------------------------TAGGATCAACACTATTATGAAATGTTGATATAGTATGTAAATAAGGGTTAAATTAAGTTGAG------TATTCCACTTTTTTAA-AACATTTCTAAGA-AAGGAAATGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CAAGAC---CTCTTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAATGCGCCGATTCTTGAAGCTCAAGCCGCCGCCGCCTTGTATAACAACGACTACAACCACTTAGATCATGTCGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTGAATGGC---TTTCCTATGAAA---CAACCC------CCCGCCGCCAAGAAAGACCGACATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGATGTTGAACTTCGACAAGCCTAGCAAAACCCTTGATTGGCTTCTAACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGTGGTAAGAGTACTACTACTGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGACGTTGACATA---GCTAATTGTGAG---AATGGCAACTACTCT------TCTTCAATGAAAGGAAAA---TCT---GTGGTGGTGAATAGTAGT---------AATAAATGT---AAAGGGTCAGGA---CTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGAGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGTAGTAGTAGTACTCAAGTACAATTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACATCT---AATTAC---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAG---CATTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCTCACA---------TCTTCAAATGCTACC------GAGAATTGGGATTATAATAATTTCTCCTCGCAGTCAAAC Collinsia_verna_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACAAATC--GGGGACC-GAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTAGCGGTGCTAGTGGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAACGGGGG-CGGACATTGGCCTCCCGTGCGCGTCAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTCTCTTCTTTAC-GTCGTGCCA--TCTCGTCG-TTGCAATGGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-TTTGCCTTGTCCACA--TCGATTTCCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTCA-AAACGTCCCTTTTCCACCAAGTCGGAATTTCACTCGTGAAACTCTAACGAGGTGGAACTCTAAAG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTCGAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCTTGATGCGGCT{CT}CGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAGATTGGGTTCGGAATTAGTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTGTTTGATCCTTCCAAAAGCTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCATTGATTTGGTTAATTACAAATAAAAATTCTT------------AGACTTTGGAAATAGGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAACAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTAA-AATCTTTCTAAGA-AAGGAAATGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????CATAATGAAATC------------CATGAC---CTTCTTGCAACTCATAATTACTTAGTTGCCACTAACAAC---TCGCCAATTCTCGAGGCTCAAGCCGCTGCCGCCTTGTATAAC---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAC------GGGGTTGTACTTGACCATTCTACT------------GGC---TTTCCTAAGAAA---CAGCCT---GCCCCGGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------GCTGCTACTTCTTCTAATTCCGAGGTCGAAATTGGAGAC------ATA---GCT---TGTGAAAATAATGGCAAC---TCT------TCTTCATTGAAAGGAAAA---TCTCATGTGGTGATGAATAGT------------AATAAATGT---AAAGGA---GTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTTCTACAAATAAT---TATAAGGGTTGTAGTTGGAGT---AGTAGTACTCAAGTACAATTTGATGATCAG---GGGCCTAATAATATTCTTCATTGTCCAATGACATCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAGCAGCAGTACACA---CCTATGTTTGGTTTTCATCAA---CAAAATCTCACG---------TCATCAAATGCTACC------GAGAATTGGGATTATAGTAATTTCGCCTCGCAGTCCAAC Collinsia_violacea_2 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACAAATC--GGGGACC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TCGATCGGCCCGTTAGCGGTGCCAGTCGCGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG-CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCGAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTCTCTTCTTTAC-GTCGTGTCA--TATCGTCG-CTGCAGCGGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-TTTGCCTTGTCCAC{AG}--TCGATTTCCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGAATTTCATTCGTGAAACTCTAACGAGGTGGAACTCTAAAG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGCCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCTTGATGCGGCTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAGATTGGGTTCGGAATTAGTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCCTTCCAAAAGCTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGGTTAATTACAAATAAAAATTCTT------------AGACTTTGGAAATAGGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAACAA-----------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTTA-AATCTTTCTAAGA-AAGGAAATGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT?????????????????????????????????????????????CTTGCAGCTCATAATTACTTAGTTTCCACCAACAAC---TCGTCAATTCTCGAGGCTCAAGCCGCGGCCTCCTTGTATAAC---GACTTCAACCACTTAGAT---GTCGTTAACGGCCAGCTCAAC------GGGGTTGTACTTGACCATTCTACT------------GGC---TTTCCTAAGAAA---CAGCCT---GCCCCGGCCGCCAAGAAAGACCGCCATAGCAAAATATATACTGTTCATGGACCGAGAGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTTACCAAATCAAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT------GCTGCTACTTCTTCTAATTCCGAGGTCGAAGTTGGAGAC------ATA---GCT---TGTGAGAATAATGGCAAC---TCT------TCTTCATTGAAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGGA---GTA---GTTAAA---GATTCGATTACAAAGGAGTCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTTCTAGGAATAAT---TATAAGGGTTGTAGTTGGAGT---AGTAGTACTCAAGTACAATTTGATGATCAG---GGGCCTAATAATATTCTTCATTGTCCAATGACATCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTGTCATTAAGAAGAAGATGAAGCAGCAGTACACA---CCTATGTTCGGTTTTCATCAA---CAAAATCTCACG---------TCATCAAATGCTACC------GAGAACTGGGATTATAGTAATTTCACCTCGCAG?????? Collinsia_wrightii_12 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGGCGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGTGGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCCACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCATTTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTTGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGTCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATGGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGCTTAATTACAAATAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA--GGAAATAT-AAGTTGATCCTAAATAAA--CAAGAAAAA-TAAGTTGATTCTAAATAAACAAGAAAAAATAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TCGAG------TATTCCGTTTTTTTTTTAATCTTTCTAAGATAAGGAAATGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCGTT?????????CATAATGAAATC------------CAAGAC---CTCTTTGCAGCTCATAATTACTTAGTTGCCACTCACAACAACGCGCCTATTCTTGAAGCTCAA---GCCGCCGCGTTGTATAAC---GACTTCAACCACTTAGAT---GCGGTTAACGGCCAGCTCAAT------GGGGTTGTACTTGACCATTCTACAACCATGGTCAATGGC---TTTCCTATGAAACAACAACCC------CCCGCCGCCAAGAAAGACCGACATAGCAAAATATATACTGTTCATGGACCAAGGGATCGAAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGATGTTGAACTTCGACAAGCCTAGCAAAACCCTTGATTGGCTTCTAACCAAATCAAAGGAGGCAATTAAGGATTTGGTTAAGTCCAAAAGTGGT---AAGAGT---ACTACTGCTACTTCTTCTAATTCTGAGGTCGAAGTTGGAGACGACGTCATA---GCT---TGTGAG---AATGGCAACAACTCT------TCATTAATGAAAGGAAAA---TCT---GTGGTGGTGAATAGT------------AATAAATGT---AAAGCTGGAGTA---GTTAAA---GATTCGATTACAAAGGAGGCGAGGGTTAAGGCGAGAGCAAGAGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAATAAT---TATAAGGGTTGTAGTTGGAGT---AGTAGTACTCAAGTACACTTTGATGATCAA---GGGCCTAATAATATTCTTCATTGTCCAATGACGTCT---AATTAT---GAAGAC---CTAATTCAAGAATCTGTTCTCATTAAGAAGAAGATGAAG---CATTACACA---CCTATGTTTGGTTTTCATCAA---CAAAATCTCACT---------TCTTCGAATGCTACC------GAGAATTGGGATTATAGTAATTTCTCCTCGCAGTCAAAC Keckiella_cordifolia TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTT--AAACA--TCTCGGGGGCC-GAGGCGCGAGGGTCGCGAGACCCCCGTGCCGAGG-CCCTCCGTCCGTGCGACGCTCGCGTCGTGCGGGCTAACTAA-CCCCGGCGCGGCATGCGCCAAGGAAAACTCAAAAAAGAATCACCGACCCC-CCG{AG}CTGCCCCGTTCGCGGTGCGCGTCGGGAGGACCCGGTGTATCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCAATCCCTCGGGTT-GACGGGGG--CGGACATTGGCCTCCCGTGCGCGCGAGCGTGCGGCCGGCCCAAATGCAA-TCCCGCATCGACGGATGTCACGACCAGTGGTGGTTGAACCCTCAACTCGCG----TGCTGTCGTGCCGTGCTCCGTCGCTTGTCGTGGAATCG---TATCGACCCAACGGC--GCA---ATGCGCTTTCGATCTGGCAGCGACAGCGTCCCGTGCTCGCCTT{CT}TCATTTGTT{AG}GCACAAGTG{CT}{AG}TG-TTTGCCTTGGCCGC{AG}--TCG{AG}TTTTCCTGTGTTGTATACCTGTTGTGAAGG-CACTCTTTCGGATTAAAATGACCCTCTTCCACCAAGT-{AG}CTGCTTCATTCGTGATGCGGCG-C{AG}AGGTGGAACCCCA-{CT}G--G{CT}GATCGGC{AG}TGT{CT}ACC{CT}CTTTCCCGCACATTTGTGACGG{AG}CGATTGGCCCA{CT}GCC-GTAT{CG}GTG{CT}GATCTCTCGGGTGCGGAATACATTGTGGGTACGTGGCCCTCGTGCCACTATTTGCCCCATAACAAG{AC}GTTCAACGCTTCACG{CT}GAATGAC{CT}GTCGGTGT{CT}GTGTTCAT-CGGGTCCTC--GCGGCTCGCATCATG{CT}GGCACC{AG}{AG}CGTCGGTGAGGAATGCAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGCTCGGAATTATTGGAAGAATTTCTTATGTCAGAAGAAGACGTTCTTTTTTTGACCTTCCCAAAAGCTTCTTCCACTTTGCGGGGAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGGTTAATTACAAATAAAAATTATG------------AGACCTTGGAAA-------TAT-AAATTTTTCCTAAAAAAAAATA-TAAAAA------------------------------TGGGATTTCCACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATCAA-CTGAG------TATTCAACTTTTAAA--AGTCTTTCTAAGA-AAGGAAATGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGGGATTTTTCTTT?????????????????????????????????????????????CTTTCGGCTCATAATTACTTAATTGCCACCAAC---AATGCTCCTGTTCTTGAA---------GCTGCCTCCTTGTATAAT---GACTTCAACCACATAGAT---GTTGTCAACGGG---CTCAAC------GGGGTTGTCGTTGACCATTCTACTACCATGGTCAATGCT---TTTCCTAAGAAA---CAGTCC---------TCCGCGAAGAAAGACCGGCATAGCAAAATATATACTGTTCATGGACCGAGGGACCGGAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGTTGTTGAATTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTAACGAAATCCAAGGAGGCAATTAAGGATTTGGTCAACTTGAAAAGTGGT---AAGACT------ACTACTACTTCTTCTAATTCAGATGTCGAAGTTGGGGAC------TTA---GCT---TGTGAGATTAATGGCAAC------------TCTTCATTGAAAGGGAAA---TCT---GTGGTGGTGAATAGCCAT---------AATAAATGT---AAAGGG---------GCAAAG---GAATCGATTGTGAAAGAGTCGAGGGTTAAGGCGAGGGCAAGAGCAAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAT------TATAAGGGTTGTGATTGGAAT---------ACTCAAGTACAATTTGAT---CAG---GCG---ACTAATATTCTTCATTGTCCAATAACTTCT---AATTAT---GAAGAC---CTAATTCAAGAATCTATTGTGAATAAGAAGAAGATGAAG---CAGTATCCA---CCGATGTTGGGTTTTAATCAA---CAAAATCTCGGTAGTATCGCATCTGCAAATGCTACT------GAGAATTGGGATTATAGTAATTTTGCCTCACAGTCCAAC Tonella_floribunda_2 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATATT--GGGGACC-GAGGCTCGTTGGTCGAAAGATCACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTTAAAA-AGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCTCGTCGGGAGAAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ACCTCGATC--TCGAATC-GAATGGGGG-CGGACATTGGCCTCCCGTGCGCGTGAGTGCGCGGCCGGCCTAAATGCAAATCCCTCATGGACGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTT---CGC-GTCTTGATG--TCTCGTCT-TTGCGGTGGATTCA---TATCGACCCATTGGCTCACTTAGGTGGGTTTTCGATCGGGCAGCGACAATATCTCGTGCAAGCCTTTTCATT-GTCGGAACAAGTGC--T-TTTGCCTTGTCCTCA--TCGGATTTCCTGTGTTGTATACCTATTGTAAAGG-CATTCATTCGGATCAAAATGTCCCTTTTCCACCGAGT-GTCATTTCATTCGTGAAACGACA-TGAGGTGGAACTCCAACG--ACGATGTGTGTGTTTCCTCTTTCCCGCACAATTGTGCCGGGATCTTGGCCCACGC--ATATCGTACGATCTCTCGGGTTCGGAATACATTGTCGGTACATGGCACTCGTGCCACTATAAGTCCCGTAA-AAGCGTTCTACGCTTCGAGCGAACGACTGTCGTAGCCGTTATCATTCGAGTCCTC--GTGGCTTGACTGAAGCGGTTCCGGCGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATTAGGCTCGGAATTATTGGAAGAATTTCTTATATCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCATTTTGCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-------TAT-AAGTTTTTCCT----------AA-AAAAA------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA-AGTCTTTCTAAGA-AAGGAAATGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGGTTTTTATTT?????????????????????????????????????????????CTTGCAGCTCATAATTACTTAGTTGCCACTAACAACAACGCGCCCATTTTTGAGGGTAAT---GCCGCCGCCTTGTATAAT---GACTTCAACCACTTAGAT---GTTGTTAACGGCCAACTCAACGTGAACGGTGTTGTACTTGACCATTCTACATCGATGGTCAATGGC---TTTCCTAAAAAA---CAGTCG---------GCCGTCAAGAAAGACCGGCATAGCAAAATATATACTGTTCATGGACCAAGGGACCGGAGAGTTAGGCTCTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGATGTTGAACTTTGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCCAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT---------GCTACTTCTTCTAATTCTGAAGTCGAAGTTGGTGAC------GTA---GCT---TGTGAG---AATGGCAACTCTTTTGGAATAGATTTGTTGAAAGGAAAA---TCT---GTGGTGATGAATAGTAAT---------AATAAATGT---AAAGGAGGA------CTTAAA---GATTCGATTACAAAGGAGGCGAGGGTTAAGGCAAGAGCAAGGGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAC------TATAAGGGTTGTAGTTGGAGT------AGTAGTCAAGTACAATATGAT---CAG---GGGGCTAATAATATTCTTCATTTTCCAATAACTTCT---AATTAT---GAAGATCACCTAATTCAAGAATCTGTTGTGATTAAGAAGAAGCTGAAG---CAGTACCCA---CCTATCTTCGGTTATCATCAA---CAAAATCTCACA---------TCTTCAAATGCTACTGAT---CAGAATTGGGATTATAGTAATTTCGCCTCGCAGTCCAAC Tonella_tenella_4 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATATC--GGGGACC-GAGGCTCGTTGGTCGTAAGATCACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGTGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCTGGTCGGGAGAAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ACCTCGATC--TCGAATC-GAATGGGGG-CGGACATTGGCCTCCCGTGCGCGTGAGTGTGCGGCCGGCCTAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTT---CGC-GTCTTGACG--TCTCGTCT-TTGCGGTGGATTCA---TATTGACCCATTGGCTCACTTAGGTGGGTTTTCGATCGGGCAGCGACAATATCTCGTGCAAGCCTTTTCATT-GTTGGAACAAGTGC--T-TTTGCCTTGTCCTCA--TCGGATTTCCTGTGTTGTATACCTATTGTAAAGG-CATCCATTCGGTTAAAAATGTCCCTTTTCCACTGAGT-CTCATTTCATTCGTGAAACGATG-CGAGGTGGAACTCCAAGG--ACGATGTGTGTGTTTCCTCTTTCCCTCACAATTGTGTTGGGATCTTGGCCCATGC--ATATCGTACGATCTCTCGGGTTCGGAATATAATTTCGGTACATGGCACTCGTGCCACTATAAGTCCCGTAA-AAGCGTTCAACGCTTCGAGCGAACGACTGTCGCAGCTGTTATCATTCGAGTCCTC--GTGGCTTGACTGAGGCGGTTTCGGCGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATTAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCATTTTGCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTTGGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-------TAT-AAGTTTTTCCTAAATAAA--CAA-AAAAA------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA-AGTTTTTCTAAGA-AAGGAAATGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGGTTTTTCTTT?????????CACAATGAAATC------------CATGAC---CTTCTTGCAGCTCATAATTACTTAGTTGCCACTAACAACAACGCGCCTATTCTTGAGGGTAAT---GCCGCCGCCTTGTATAAC---GAGTTCAACCACTTAGAT---GTTGTTAACGGCCAACTCAAC------------GTTCTTGACCATTCTACAACCATGGTTAATGGC---TTTCCGAAAAAA---CAGTCC---------GCCGTTAAAAAAGACCGGCATAGCAAAATATATACTGTTCATGGACCAAGGGACCGGAGAGTTAGGCTTTCCATCGGCATTGCGCGTAAGTTTTTCGATCTTCAAGAGATGTTGAACTTCGACAAGCCAAGCAAAACCCTTGATTGGCTTCTGACCAAATCCAAGGAGGCAATTAAGGATTTGGTCAAGTCCAAAAGTGGT---AAGAGT---------GCTACTTCTTCTAATTCTGAGGTCGAAGTTGGTGAT---------------------GAG---AATGGCAACTCTTTTGGAGTG---------AAAGGAAAA---TCT---GTGGTGATGAATAGTAAT---------AATAAATGT---AAAGGAGCGGTA---CTTAAA---GATTCGATTACAAAGGAGGCGAGGGTTAAGGCAAGAGCAAGGGCTAGGGAAAGGACTAAGGAGAAAATGTGCATTAAGGCACAATTAAAT---GAAGCTACTAGAAAC------TATAAGGGTTGTAGTTGGAGT------ACTAGTCAAGTACAATTTGAT---CAG---GGG------------CTTCATTGTCCAATGACTTCT---AATTATATTGGAGATCACCTAATTCAAGAATCTGTTGTGATTAAGAAGAAGATGAAG---CAGTACCCA---CCTATCTTCGGTTATCATCAA---CAAAATCTCACA---------TCTTCAAATGCTACT------GAGAATTGGGATTATAATAATTTCGCCTCGCAGTCCAAC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7301] TITLE Collinsia_cpDNA_matrix; LINK TAXA = Taxa3; DIMENSIONS NCHAR=524; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Chelone_glabra AAGTACTGTACGTGCTTTTTTGAAAAGATTAGGCTCGGAATTATTGGAAGAATTTCTTATGTCAGAAGAAGACGTTCTTTTTTTGACCTTCCCAAAAGCTTCTCCCACTTTGCGGGGAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTG------------AGATCTTGGAAA----------------------------TAT-AAATTTTTCCTAAAAAAA--TA-GAAAAAA----------------------------------------------------------------TGGGATTTCCACTATTATGAAATGTTGATATAGTATGTAAATAAGGGTTAAATCGA-CTGAG------TATTCAACTTTTTAA---AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGGGATTTTTCTTT Collinsia_antonina_1_3 AACTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACTTTTCCAAAAGCTTTGTCCATTTTTTGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_antonina_2 AACTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACTTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_bartsiifolia_var_bartsiifolia_1to3_var_davidsonii_1to5_Collinsia_corymbosa_1to3 AAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTATAAA----------------------------TAG-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAATACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------GATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_callosa_1to3 AAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGGGATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAGAGCTTTGTCCATTTTGGGGATAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTAAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_childii_1_3to6 AAGTACTGTACGCACTTTTTTGAAAAAAACAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTCATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_childii_2 AAGTACTGTACGCACTTTTTTGAAAAAAACAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAATAAAAAATAAAAAA---------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTCATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_concolor_1_2_4_5_Collinsia_parryi_1_2 AAGTACTGTACGCGCTTTTTTGAAAAAATCAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTGGGGGTAGTATATAAAAGTAGAATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_concolor_3 AAGTACTGTACGCGCTTTTTTGAAAAAATCAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTGGGGGTAGTATATAAAAGTAGAATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTAGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGA????????? Collinsia_grandiflora_1to5 AAGTACTGTACGCAATTTTTTAAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTAGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAA------TATTCTACTTTTTTT---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_greenei_1to4 AAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCTTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_1 ????ACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGGGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_15 ??????????????????????????AATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAA-----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_16 AAGTACTGTACGTACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAA-----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_19 AAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAGTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_2to8_10to14_17_18_21_Collinsia_tinctoria_7 AAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_9 AAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAAGGAAATGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_latifolia_1 AAGTACTGTACGCACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------ACACTTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTAATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTAA--AATCGTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTATTT Collinsia_latifolia_2 AAGTACTGTACGCACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACTTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTAATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTAA--AATCGTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_latifolia_3_4 AAGTACTGTACGCACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTTATTT-GGTTAATTACAAATAAAAATTCTT------------AGACTTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTAATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTAA--AATCGTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_linearis_13_19 AAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAAGGAAATCTAAGTTTTTCGAAA--GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_linearis_2_9_14 AAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTGGAAA-----------------------GGAAATCT-AAGTTTTTCTTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_linearis_8 AAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTGGAAA-----------------------GGAAATCT-AAGTTTTTCTTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACAGTTTGGGGAGAGATTTTTCTTT Collinsia_metamorphica_1_2 AAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTAGGTCAGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTGGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--TAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_metamorphica_3to5 AAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTAGGTCAGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTGGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--TAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----CGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_metamorphica_6 AAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTAGGTCAGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--TAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----CGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_metamorphica_7_8 AAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTTGGAATTATTAGAAGAATTTCTTAGGTCAGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTGGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAAAAAA--TAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_multicolor_1_2 AAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATTAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGT----AATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_parviflora_1_2_4to8_11to14_Collinsia_grandiflora_6 AAGTACTGTACGCACTTTTTTAAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAA------TATTCTACTTTTTTT---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_parviflora_3_9_10 AAGTACTGTACGCAATTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCTACTTTTTTTT--AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_rattanii_1_6to9_Collinsia_linearis_1_3to5_6_10_12_15to18_20 AAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAA-----------------------GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_rattanii_2_Collinsia_linearis_7 AAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTTCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTGGAAA-----------------------GGAAATCT-AAGTTTTTCTTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_rattanii_3_Collinsia_linearis_11 AAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTGGAAA-----------------------GGAAATCT-AAGTTTTTCTTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATTAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_rattanii_4 AAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAA-----------------------GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_sparsiflora_var_collina_5 AAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTCTTTT Collinsia_sparsiflora_var_sparsiflora_17 AAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAAGGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_sparsiflora_var_sparsiflora_1to6_10_14_16_18to20 AAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_sparsiflora_var_sparsiflora_7_8_12_13_15 AAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACTTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_sparsiflora_var_sparsiflora_9_11 AAGTACTGTACGCGCTTTTTTGAAAAAATCAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_1 AAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCGAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_2 AAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTTTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_3 AAGTACTGTACGCGCTTTTTTGAAAAAATTCGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_4 AAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTT-AA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_5_6 AAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_8 AAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGGTTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_torreyi_1to4 AAGTACTGTACGCACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAACTAAA--CAAGAAAAA-----------------------------------------------------------------TAGGATCAACACTATTATGAAATGTTGATATAGTATGTAAATAAGGGTTAAATTAAGTTGAG------TATTCCACTTTTTTAA--AACATTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_verna_1to3 AAGTACTGTACGCACTTTTTTGAAAAGATTGGGTTCGGAATTAGTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTGTTTGATCCTTCCAAAAGCTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCATTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACTTTGGAAA---------------------TAGGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAACAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTAA--AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_violacea_1to3 AAGTACTGTACGCACTTTTTTGAAAAGATTGGGTTCGGAATTAGTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCCTTCCAAAAGCTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACTTTGGAAA---------------------TAGGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAACAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTTA--AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_wrightii_1a_b_12 AAGTACTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATGGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GCTTAATTACAAATAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-AAGTTGATCCTAAATAAA--CAAGAAAAA------------------------------------TAAGTTGATTCTAAATAAACAAGAAAAAATAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TCGAG------TATTCCGTTTTTTTTTT-AATCTTTCTAAGATAAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCGTT Collinsia_wrightii_2_6 AAGTACTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATGGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GCTTAATTACAAATAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-AAGTTGATCCTAAATAAA--CAAGAAAAA------------------------------------TAAGTTGATTCTAAATAAACAAGAAAAAATAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TCGAG------TATTCTGTTTTTTTTTT-AATCTTTCTAAGATAAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCGTT Collinsia_wrightii_3_4_10_11 AAGTACTGTACGTAATTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGATCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTTTTTGTATCAGTGATTTTGCTTAATTACAAACAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-ATTTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TCGAG------TCTTCCATTTTTTTTA--AATCTTTCTAAGA-AAGTAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_wrightii_5 AAGTACTGTACGTAATTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGATCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTTTTTGTATCAGTGATTTTGCTTAATTACAAACAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-ATTTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TCGAG------TCTTCCATTTTTTTTT--AATCTTTCTAAGA-AAGTAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_wrightii_7 AAGTACTGTACGTAATTTTTTGAAAAAATTAGGTTCGGAATTATGGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GCTTAATTACAAATAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-AAGTTGATCCTAAATAAA--CAAGAAAAA------------------------------------TAAGTTGATTCTAAATAAACAAGAAAAAATAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TCGAG------TATTCCGTTTTTTTTTTTAATCTTTCTAAGATAAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCGTT Collinsia_wrightii_8 AAGTACTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATGGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GCTTAATTACAAATAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-AAGTTGATCCTAAATAAA--CAAGAAAAA--------TAAGTTGATTCTAAATAAACAAGAAAAATAAGTTGATTCTAAATAAACAAGAAAAAATAGGATCAAC{AC}CTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TCGAG------TATTCCGTTTTTTTTTT-AATCTTTCTAAGATAAGGAAA-----TGATGTA{CT}ACATAGGGAAA{CG}CTGTG???????????????????????????????????????????? Collinsia_wrightii_9 AAGTACTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATGGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GCTTAATTACAAATAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-AAGTTGATCCTAAATAAA--CAAGAAAAA------------------------------------TAAGTTGATTCTAAATAAACAAGAAAAAATAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTTAATTAA-TCGAG------TATTCCGTTTTTTTTTT-AATCTTTCTAAGATAAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCGTT Keckiella_cordifolia AAGTACTGTACGTGCTTTTTTGAAAAGATTAGGCTCGGAATTATTGGAAGAATTTCTTATGTCAGAAGAAGACGTTCTTTTTTTGACCTTCCCAAAAGCTTCTTCCACTTTGCGGGGAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTATG------------AGACCTTGGAAA----------------------------TAT-AAATTTTTCCTAAAAAAAAATA-TAAAAA-----------------------------------------------------------------TGGGATTTCCACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATCAA-CTGAG------TATTCAACTTTTAAA---AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGGGATTTTTCTTT Penstemon_hartwegii AAGTACTGTACGTGCTTTTTTCAAAAGATTAGGCTCGGAATTATTGGAAGAATTTCTTATGTCAGAAGAAGACGTTCTTTTTTTGACCTTCCCAAAAGCTTCTTCCACTTTGCGGGGAGTATCTAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTGAATTACAAATAAAAATTCTG------------AGACCTTGGAAA----------------------------TCG-AAATTTTTC--AAAAAAAA-TA-GAAAAAA----------------------------------------------------------------TGGAATTTCCACTATTATGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATCAA-CTGAG------TATTCAACTTTTTAA---AGTTTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGGGATTTTTCTTT Tonella_floribunda_1_2 AAGTACTGTACGCACTTTTTTGAAAAAATTAGGCTCGGAATTATTGGAAGAATTTCTTATATCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCATTTTGCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCT----------AA-AAAAA-----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGGTTTTTATTT Tonella_tenella_1 AAGTACTGTACGCACTTTTTTGAAAAAATTAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCATTTTGCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAA-AAAAA-----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TAGTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGGTTTTTCTTT Tonella_tenella_2_3 AAGTACTGTACGCACTTTTTTGAAAAAATTAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCATTTTGCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAA-AAAAA-----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGGTTTTTCTTT Tonella_tenella_4 AAGTACTGTACGCACTTTTTTGAAAAAATTAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCATTTTGCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAA-AAAAA-----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTTTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGGTTTTTCTTT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7303] TITLE 'Collinsia nrDNA+cpDNA matrix'; LINK TAXA = Taxa4; DIMENSIONS NCHAR=1576; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Chelone_glabra TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTT--AAAAA--TCGAGGGGAC--GAGGTGCGAGGGTCGCAAGACCCCCGTGCCGAGAACCCTCCGCTCGCGCGACGCTC{GT}CGTCGTGCGGGCTAACTAA-CCCCGGCGCGGCATGCGCCAAGGAAAACTCAAAA-GGAAGCATCGGCCCC--CGGCTCTCCCGTTCGCGGTGCGCGTC-GGAGGACCCGGTGTATCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-TTCTCAATCCCTCGGGTT-GATGGGGGG------CGGACATTGGCCTCCCGTGCGCGCGAGCGTGCGGCCGGCCCAAATGCAA-TCCCGCATCGACGGATGTCACGACCAGTGGTGGTTGAACCCTCAACTTGCG----TGCTGTCGTGACGCGCTCCGTCGCTTGCTGC-GGAATCG---TATCGACCCAACGGC--GCT--GGCGCGCTTTCGATCGGGCAGCGACAACATCCCGTGCTCGCCTTTTCATTC-TTGGCACAAGTGCATT-CTTGCCTTGGCC-GCG--TCGGTTTTCCTGTGCTGTATACCCGCTGTGTAGGGCACTCTTTCGGATAAAAATGACCCATTTCCACCAAGT-GCTGC-CTCATTCGTGCGGTGGCG-CGAGGTGGGACCCAAAAAAAGCGGTCGACGTGTTACCTCTTTCCCTCACGTTTGTGATGGGAAATTGGCCCACGTT-GCATCGCTCGATCTCTCGGGTGCGGAATATCGTGTGGGTACGAGGC-CTCGTGCCTCTATTTGCCCCGTAACAAGCGTTCTACGCTTCACGCGAACGACCGCCCTTGTCGTTTTGATT-GGGTCCTC--GCGGCTCGTATCATGCGGCACCGGCGTCGGTGAGGAATGCAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGCTCGGAATTATTGGAAGAATTTCTTATGTCAGAAGAAGACGTTCTTTTTTTGACCTTCCCAAAAGCTTCTCCCACTTTGCGGGGAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTG------------AGATCTTGGAAA----------------------------TAT-AAATTTTTCCTAAAAAAA--TA-GAAAAAA----------------------------------------------------------------TGGGATTTCCACTATTATGAAATGTTGATATAGTATGTAAATAAGGGTTAAATCGA-CTGAG------TATTCAACTTTTTAA---AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGGGATTTTTCTTT Collinsia_antonina_1 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAA{AG}CATACT--GGGGGCC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCGTCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAGATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTACGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTAAGT-GCCGT-TTCATTCGTGAAATGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCTTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTTCGACGTCGATGAGGAATGCAACTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACTTTTCCAAAAGCTTTGTCCATTTTTTGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_antonina_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGGCC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCGTCGACCTCCTCGATTGACCCGTTAGCGGTGCTGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAGATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTACGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTTAAAATGTCCCTTTTCCACTAAGT-GCCGT-TTCATTCGTGAAATGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCTTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTTCGACGTCGATGAGGAATGCAACTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACTTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_antonina_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGGCC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCGTCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCAGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAGATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTACGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTAAGT-GCCGT-TTCATTCGTGAAATGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCTTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTTCGACGTCGATGAGGAATGCAACTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACTTTTCCAAAAGCTTTGTCCATTTTTTGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_bartsiifolia_var_bartsiifolia_1 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGTACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTATAAA----------------------------TAG-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAATACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------GATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_bartsiifolia_var_bartsiifolia_2_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGTACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTATAACG--GCGATGTGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTATAAA----------------------------TAG-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAATACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------GATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_bartsiifolia_var_davidsonii_B1_5 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGTACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTATAACG--GCGGTGTGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTATAAA----------------------------TAG-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAATACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------GATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_bartsiifolia_var_davidsonii_B2to4 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTATAACG--GCGGTGTGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTATAAA----------------------------TAG-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAATACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------GATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_callosa_1 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAA{AG}CATACT--GGGGACC-GAGGC-----------------AAT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TGGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGATCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAACGGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---AAC-GCCTTGCCA--TCTTGTCG-TTGCGAC-GGATTCA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACCGAGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--TATTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAATGTCCCTTTTCCACCTAGC-GTTGT-TTCATTTGTGAAATGCTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTATTGGCCCATGC--ACATCGTACGATCTCTCGGGTTTGGAATACAATGTCGGTACATGGCACCCGTGCCATTATCAGTCCCTTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGGGATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAGAGCTTTGTCCATTTTGGGGATAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTAAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_callosa_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------AAT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TGGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGATCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAACGGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---AAC-GCCTTGCCA--TCTTGTCG-TTGCGGC-GGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACCGAGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--TATTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAATGTCCCTTTTCCACCTAGC-ATTGT-TTCATTTGTGAAATGCTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTATTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACCCGTGCCATTATCAGTCCCTTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGGGATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAGAGCTTTGTCCATTTTGGGGATAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTAAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_callosa_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------AAT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TGGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGATCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAACGGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---AAC-GCCTTGCCA--TCTTGTCG-TTGCGGC-GGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACCGAGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--TATTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAATGTCCCTTTTCCACCTAGC-GTTGT-TTCATTTGTGAAATGCTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTATTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACCCGTGCCATTATCAGTCCCTTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGGGATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAGAGCTTTGTCCATTTTGGGGATAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTAAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_childii_1 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAA{AG}CATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGATCGGCCCGTTAGCGGTGCCGATCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCTGTTCGAAATGTCCCTTTTCCACTTAGT-GTCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAAACAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTCATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_childii_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGATCGGCCCGTTAGCGGTGCCGATCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCTGTTTGAAATGTCCCTTTTCCACTTAGT-GTCCT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTTGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAAACAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAATAAAAAATAAAAAA---------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTCATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_childii_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGATCGGCCCGTTAGCGGTGCCGATCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTTGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCTGTTCGAAATGTCCCTTTTCCACTTAGT-GTCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCTGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAAACAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTCATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_childii_4 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGATCGGCCCGTTAGCGGTGCCGATCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCATGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCTGTTCGAAATGTCCCTTTTCCACTTAGT-GTCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCTGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAAACAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTCATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_childii_5 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGATCGGCCCGTTAGCGGTGCCGATCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGA????????????????????????????????????TTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCTGTTCGAAATGTCCCTTTTCCACTTAGT-GTCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTACTTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAAACAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTCATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_childii_6 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGATCGGCCCGTTAGCGGTGCCGATCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCATGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCATCA-TTGCGGC-GGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCTGTTCGAAATGTCCCTTTTCCACTTAGT-GTCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCC-ACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCTGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAAACAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTCATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_concolor_1a_2_4_5_Collinsia_parryi_1_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGGCC-GAGGC-----------------ACT-AGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTGAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGATCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTCGGCCCATGC--ACACCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATCAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTGGGGGTAGTATATAAAAGTAGAATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_concolor_1b TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGGCC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTGAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGATCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTCGGCCCATGC--ACACCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATCAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTGGGGGTAGTATATAAAAGTAGAATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_concolor_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGGCC-GAGGC-----------------ACT-AGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTGAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGATCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTCGGCCCATGC--ACACCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATCAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTGGGGGTAGTATATAAAAGTAGAATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTAGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGA????????? Collinsia_corymbosa_1_2_3a_3b TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATCCGTGAAATGGTG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTAATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTATAAA----------------------------TAG-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAATACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------GATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_grandiflora_1_2a TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGTACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTACA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCAATTTTTTAAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTAGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAA------TATTCTACTTTTTTT---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_grandiflora_2b TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGTACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATAAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCA{AG}AATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTACA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCAATTTTTTAAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTAGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAA------TATTCTACTTTTTTT---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_grandiflora_3_5 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGTACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTACA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCAATTTTTTAAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTAGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAA------TATTCTACTTTTTTT---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_grandiflora_4 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGTACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTACA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTTGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCAATTTTTTAAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTAGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAA------TATTCTACTTTTTTT---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_greenei_1_2_4 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACA-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTC-TCGATCGGCCCGTTAGCGGTGCTGGTCGGGATGAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAATGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCGAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTTGTCG-TTGCATC-GGATTGA---TATTGACCCATCGGCTCACTTAGGTGAGCTTTCGACCGTGCAGCGACAATGTCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TCTGCCTTGCCC-AAATATCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTTCGTTCAAAATGTCCCTTTTCCACTTAGC-GCCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAATG--GCGATGGGCGTGTTTCCTTTTTCCCACATTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCTGTACGTGGCACTCGTGCCATTATCAGTCCTTTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGTCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCTTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_greenei_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACA-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTC-TCGATCGGCCCGTTAGCGGTGCTGGTCGGGATGAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCGAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTTGTCG-TTGCATC-GGATTGA---TATTGACCCATCGGCTCACTTAGGTGAACTTTCGACCGTGCAGCGACAATGTCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TCTGCCTTGCCC-AAATATCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTTCGTTCAAAATGTCCCTTTTCCACTTAGC-GCCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAATG--GCGATGGGCGTGTTTCCTTTTTCCCACATTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCTGTACGTGGCACTCGTGCCATTATCAGTCCTTTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGTCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCTTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_1 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TT{AC}TCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGA{AT}CGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGACG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC????ACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGGGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_10 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TC{CT}TGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGACG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACAT{CT}GTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_12_13 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGAT{CT}GGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_15 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-{CT}GCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAA-GAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTAAGT-GCCGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGC??????????????????????????AATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAA-----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_16 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTAAGT-GCCGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGTACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAA-----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_17 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGACG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_18_ITS_clone11 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCACTGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GC{CT}GT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_18_ITS_clone6 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTA{AG}CGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TTTTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GC{CT}GT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_18_ITS_clones2_12 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGG-------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GC{CT}GT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_19 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGACG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAGTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_20_14 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_21 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TTGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCG{CT}GTCAGCGCGCGGCCGGCCCAAATGCAAATCCCT{CT}ATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCA{AG}C-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GC{CT}GT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_2a_b TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCTGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_4_5 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTAGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TAGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_6_11 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGACG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_7 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTC{AT}AAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGC{AG}CGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCAT{CT}GGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGA{CT}G-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_8 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCG{CT}GAGGACCCGGTGTGTCTTGAATGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCACGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGACG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_heterophylla_9 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGG{AC}-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GC{CT}GT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACT{CT}GTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAAGGAAATGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_latifolia_1 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTATAAACATACT--GGGGGCC-GAGGC---ATGATCGCAAGATCACT-CGCCAAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAAGGGGG-------CGGACATTGGCCTCCCGTGCGCGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTTTCTT---CAT-GTCTTGTCA--TCCCCTCG-TTGCGGT-GGATTAT---TATTGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-CTTGCCTTGTCC-ACG--TCGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATCAAAATGTCCCTTTTCCACCTAGT-GTCAT-TTCATTCGTGAATTGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTCTTTCCCACACAATTGTGCTGGGTTCTTGGCACATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------ACACTTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTAATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTAA--AATCGTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTATTT Collinsia_latifolia_2 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTATAAACATACT--GGGGGCT-GAGGC---ATGATCGCAAGATCACT-CGCCAAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAAGGGGG-------CGGACATTGGCCTCCCGTGCGCGTTAGCGTGCGGCCGGCC{CT}AAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTAT{CT}GACTTTCTT---CAT-GTCTTGTCA--TCCCCTCG-TTGCGGT-GGATTAT---TATTGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-CTTGCCTTGTCC-ACG--TCGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATCAAAATGTCCCTTTTCCACCTAGT-GTCAT-TTCATTCGTGAATTGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTCTTTCCCACACAATTGTGCTGGGTTCTTGGCACATG{CT}--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTC{AG}AGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACTTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTAATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTAA--AATCGTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_latifolia_3_4 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGGCC-GAGGC---ATGATCGCAAGATCACT-CGCCAAGG-TCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGGTCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGAGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTTTCTT---CAT-GTCTTGTCA--TCCCCTCG-TTGCGGT-GGATTAT---TATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTACGAGCCTCTTCATTTGTCGGAACAAGTGC--T-CTTGCCTTGTCC-ACG--TCGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATCAAAATGTCCCTTTTCCACCTAGT-GCCAT-TTCATTCATGAATTGTTG-CGAGGTGGAACTCTAACG--GCGATGGACGTGTTTCCTCTTACCCACACTATTGTGCTGGGTTCTTGGCACATGT--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTTATTT-GGTTAATTACAAATAAAAATTCTT------------AGACTTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTAATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTAA--AATCGTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_linearis_1_4 TCGAAACCTGCAAAGCAGACCCGCGAACGT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGG{GT}TTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGGCGCAAGTGCCATTATTAGTCCCGTAA-TAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCGTTGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAA-----------------------GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_linearis_10 TCGAAACCTGCAAAGCAGACCCGCGAACGT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATCGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAATAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGGCGCAAGTGCCATTATTAGTCCCGTAA-TAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCGTTGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAA-----------------------GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_linearis_11 TCGAAACCTGCAAAGCAGACCCGCGAACGT--GTTAACAAA{CT}ATATC--GGGGA{CT}C-GACGC-----------AAGAT{CT}GCT-TGCCGAGG-{CT}CCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGAT{AG}AAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-C{AT}TGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGGCGCA{AC}GTGCCATTATTAGTCCCGTAA-{GT}AGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCG{AT}TGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTGGAAA-----------------------GGAAATCT-AAGTTTTTCTTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATTAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_linearis_13 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTG{AG}ATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTAT{CT}GTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAAGGAAATCTAAGTTTTTCGAAA--GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_linearis_14 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATC{CT}CGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CT{CT}GCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTAT{CT}GTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTGGAAA-----------------------GGAAATCT-AAGTTTTTCTTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_linearis_15to18 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATCGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAA-----------------------GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_linearis_19 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATC{CT}CGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTT{CT}CCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAAGGAAATCTAAGTTTTTCGAAA--GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_linearis_2 TCGAAACCTGCAAAGCAGACCCGCGAACGT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATCACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTTTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGATCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGTTTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGGCGCAAGTGCCATTATTAGTCCCGTAA-TAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCGTTGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTGGAAA-----------------------GGAAATCT-AAGTTTTTCTTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_linearis_20 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATC{CT}CGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CT{CT}GCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATCGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAA-----------------------GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_linearis_3_5_12 TCGAAACCTGCAAAGCAGACCCGCGAACGT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATCGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGGCGCAAGTGCCATTATTAGTCCCGTAA-TAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCGTTGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAA-----------------------GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_linearis_6a TCGAAACCTGCAAAGCAGACCCGCGAAC{AG}T--GTTAACAAA{CT}ATATC--GGGGA{CT}C-GACGC-----------AAGATTGCT-TGCCGAGG-{CT}CCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAA{CT}TCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGG{GT}TTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGG{CT}GCAAGTGCCATTATTAGTCCCGTAA-TAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCGTTGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAA-----------------------GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_linearis_6b TCGAAACCTGCAAAGCAGACCCGCGAAC{AG}T--GTTAACAAA{CT}ATATC--GGGGA{CT}C-GACGC-----------AAGAT{CT}GCT-TGCCGAGG-{CT}CCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGG{GT}TTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGGCGCAAGTGCCATTATTAGTCCCGTAA-TAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCGTTGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAA-----------------------GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_linearis_7 TCGAAACCTGCAAAGCAGACCCGCGAAC{AG}T--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-{CT}CCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--T{CT}GAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGA????????????????TCTCGTGCA-GCCTCTTCATTTAACGGAACAAGTGC--T-C{AT}TGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGG{CT}GCAAGTGCCATTATTAGTCCCGTAA-{GT}AGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTTCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTGGAAA-----------------------GGAAATCT-AAGTTTTTCTTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_linearis_8 TCGAAACCTGCAAAGCAGACCCGCGAAC{AG}T--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TTGAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGA????????????????TCTCGTGCA-GCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGG{CT}GCA{AC}GTGCCATTATTAGTCCCGTAA-{GT}AGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCG{AT}TGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTGGAAA-----------------------GGAAATCT-AAGTTTTTCTTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACAGTTTGGGGAGAGATTTTTCTTT Collinsia_linearis_9 TCGAAACCTGCAAAGCAGACCCGCGAACGT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-{CT}CCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--T{CT}GAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGA????????????????TCTCGTGCA-GCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCC--ACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGGCGCA{AC}GTGCCATTATTAGTCCCGTAA-{GT}AGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCG{AT}TGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTGGAAA-----------------------GGAAATCT-AAGTTTTTCTTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_metamorphica_1_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGGTCGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATCGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGTTCGAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTAGGTCAGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTGGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--TAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_metamorphica_3_4 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGGTCGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTG---C-GGATTGA---TATCGACCCATCGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGTTCGAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTTGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTAGGTCAGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTGGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--TAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----CGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_metamorphica_5 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGGTCGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATCGGCTCACTTAGGTGAACTTTCGACTGGG{CT}AGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTG{CT}CC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGTTCGAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCT{CT}GGGTTCGGAATACAATG{CT}CGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTAGGTCAGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTGGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--TAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----CGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_metamorphica_6 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGGTCGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATCGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGTTCGAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTAGGTCAGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--TAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----CGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_metamorphica_7 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACT-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGGTCGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATCGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGTTCGAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACT{CT}GTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTTGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTTGGAATTATTAGAAGAATTTCTTAGGTCAGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTGGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAAAAAA--TAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_metamorphica_8 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGGTCGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATCGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCCCGCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCAGTTCGAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTTGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTTGGAATTATTAGAAGAATTTCTTAGGTCAGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTGGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAAAAAA--TAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_multicolor_1_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------AAT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTTCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGGGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCCTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTATCGGAACAAGCGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTTGAGTCCTC--GTGGCTTGCATGATACGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATTAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGT----AATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_parviflora_1_2_6_7_Collinsia_grandiflora_6 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCAACCGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTAAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAA------TATTCTACTTTTTTT---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_parviflora_10a TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCG{GT}TCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCAATTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCTACTTTTTTTT--AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_parviflora_10b TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAA{AG}GGGGG------CGGACATTGGCCTCCCGTGCGCGT{CT}AGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCG{GT}TCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCAATTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCTACTTTTTTTT--AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_parviflora_11 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTAAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAA------TATTCTACTTTTTTT---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_parviflora_12 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--{AT}CGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAAAATATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTA{AC}CGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTAAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAA------TATTCTACTTTTTTT---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_parviflora_13 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCACTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTAAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAA------TATTCTACTTTTTTT---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_parviflora_14 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGTATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGT--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCATATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCAACCGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTAAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAA------TATTCTACTTTTTTT---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_parviflora_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGG{CT}CGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAAGGGGG------CGGACATTGGCCTCCCGTGCGCGT{CT}AGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATG{CT}TG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCAATTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCTACTTTTTTTT--AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_parviflora_4 TCGAAACCTGCAAAGCAGACCTGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATATCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGAC{CT}GGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGC{AT}A{AC}CGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATA{CT}AATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTAAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAA------TATTCTACTTTTTTT---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_parviflora_5 TCGAAACCTGCAAAGCAGACC{CT}GCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAAT{AG}TCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--T{CT}GTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGA????????????????????GTGCA-GCCTCTTCATTTATCGGAACAAGTG{CT}--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGC{AT}A{AC}CGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATA{CT}AATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTAAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAA------TATTCTACTTTTTTT---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_parviflora_8 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAACGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--ACGTATC-GAAGGGGGG------TGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTTGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTAAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAA------TATTCTACTTTTTTT---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_parviflora_9 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATT{CT}--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAAGGGGG------CGGACATTGGCCTCCCGTGCGCGTTAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGCTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCAATTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCTTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATACTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCTACTTTTTTTT--AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_rattanii_1 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAA-----------------------GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_rattanii_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTTCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTGGAAA-----------------------GGAAATCT-AAGTTTTTCTTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_rattanii_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTGCT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTGGAAA-----------------------GGAAATCT-AAGTTTTTCTTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATTAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_rattanii_4 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTAGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAA-----------------------GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_rattanii_6 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCATGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAAATTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAATG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAA-----------------------GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_rattanii_7_8 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCATGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAA-----------------------GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_rattanii_9 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCATGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTGGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTCCTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAACTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTCTCAGTGATTT-GGTTA-TTACAAATAAAAATTCTT------------AGACTTTCGAAA-----------------------GGAAATCT-AAGTTTTTCTTAACTAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTA---AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_sparsiflora_var_collina_1 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACCGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_sparsiflora_var_collina_2 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCT{AC}TTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_sparsiflora_var_collina_4 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGA????????????????TCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCACATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_sparsiflora_var_collina_5 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCC{CT}-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTCTTTT Collinsia_sparsiflora_var_sparsiflora_12_15 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACTTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_sparsiflora_var_sparsiflora_17 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CACCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GAA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAAGGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_sparsiflora_var_sparsiflora_19 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCATTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_sparsiflora_var_sparsiflora_1to5_10_16_18_20_var_collina_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_sparsiflora_var_sparsiflora_6_14 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGTTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_sparsiflora_var_sparsiflora_7_13 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGTTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACTTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_sparsiflora_var_sparsiflora_8 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGAGCTGGTCGGGAAGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACTTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_sparsiflora_var_sparsiflora_9_11 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATCAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_1_ETS_clone2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTTACGTGAGCTTTCGA?????????????????????????AGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCTGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCGAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_1_ETS_clone3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTTACGTGAGCTTTCGA?????????????????????????AGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACGATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCGAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_1_ETS_clone7 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTTACGTGAGCTTTCGA?????????????????????????AGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCGAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_1_ETS_clones1_5_6_8_10to12 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTTACGTGAGCTTTCGA?????????????????????????AGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCGAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_1_ETS_clones4_9 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTTACGTGAGCTTTCGA?????????????????????????AGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCGAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGA{AC}CCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTTTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATAT{CT}TCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGT{CG}TTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTCGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_4_ITS_clone1 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAA-GAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGG-------CGGACATTGGCCTCCCGTGCGTCTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTT-AA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_4_ITS_clone12 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-CGTCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCAGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGATCGTGAGGACTCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATATCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTGAGCGCGCGGCCGGCCCAAATGCAAATCCCTTATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTT-AA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_4_ITS_clone5 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-CGTCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGATCGTGAGGACTCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTGAGCGCGCGGCCGGCCCAAATGCAAATCCCTTATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTT-AA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_4_ITS_clones2_3_7_10 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAA-GAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGTCCCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGG-------CGGACATTGGCCTCCCGTGCGTCTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTT-AA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_4_ITS_clones4_6_8_9_11 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAA-GAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTT-AA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_6 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACT{AC}AAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCT{CT}--GTGGCTTGCATGATGC{AG}GTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_7 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGG{AT}CGGGAGGAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATC{CT}CGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCG{AC}CAATATATCGT{AC}CAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATCAGGCTCGAAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCATTTTTGGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TATTAAGTTTTTTCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAGTATGAGTATTCAACTTTTTAAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_8_ITS_clone11 TCGAAACCTGCAAAGCAGACCCGCGAAC--------------------------CC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCACCCC--ATCCCGATC--TCGAATC-GGAGGGGG-------CGGACATTGGCCTCCCGTGCGTGTGAGCGCGCGGCCGGCCCAAATGCAAATCCCTTGTCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAGCTTTCGACCGG-CAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAG{CT}CCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGGTTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_8_ITS_clone3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTGAGCGCGCGGCCGGCCCAAATGCAAATCCCTTATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCA?C-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAGCTTTCGACCGG-CAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAG{CT}CCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGGTTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_8_ITS_clone5 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAATAAAAGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGACCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--ACGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTGAGCGCGCGGCCGGCCCAAATGCAAAACCCTTATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAGCTTTCGACCGG-CAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAG{CT}CCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGGTTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_8_ITS_clone6 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGCCGGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGG-CAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAG{CT}CCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGGTTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_8_ITS_clones1_4_7to9_12 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCAAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGG-CAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAG{CT}CCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGGTTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_tinctoria_8_ITS_clones2_10 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCAGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGG-------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGG-CAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAG{CT}CCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCGCTTTTTTGAAAAAATTAGGCTCGGAATTATTAGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTTGTCCAGTTTTGGGGTAGTATATAGAAGTAGGGTTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GATTAATTACAAATAAAAATTCTT------------AGGCCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACCTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_torreyi_1a_2_4 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC---ACGATCGCAAGGTCGCT-CGTCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGATCTC-TCGGTTAGCCCGTTCGCGGTGCTAGTCGGGAGGGCCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-G-AGGGGGA------CGGACATTGGCCTCCCGTGTGCGTTAGTATGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTT---TCT-GTCATGTCA--TTCCGTCG-TTGCGGT-GGATTAA---TATTGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATCAAAATGTCTCTTTTCCACCTAGT-GTCAT-TTCATTCGTGAAGTGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAATCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAACCGTTATTATTCGAGTTCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAACTAAA--CAAGAAAAA-----------------------------------------------------------------TAGGATCAACACTATTATGAAATGTTGATATAGTATGTAAATAAGGGTTAAATTAAGTTGAG------TATTCCACTTTTTTAA--AACATTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_torreyi_1b TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC---ACGATCGCAAGGTCGCT-CGTCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGATCTC-TCGGTTAGCCCGTTCGCGGTGCTAGTCGGGAGGGCCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-G-AGGGGGA------CGGACATTGGCCTCCCGTGTGCGTTAGTATGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTT---TCT-GTCATGTCA--TT{CT}CGTCG-TTGCGGT-GGATTAA---TATTGACCCATTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATCAAAATGTCTCTTTTCCACCTAGT-GTCAT-TTCATTCGTGAAGTGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAATCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAACCGTTATTATTCGAGTTCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAACTAAA--CAAGAAAAA-----------------------------------------------------------------TAGGATCAACACTATTATGAAATGTTGATATAGTATGTAAATAAGGGTTAAATTAAGTTGAG------TATTCCACTTTTTTAA--AACATTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_torreyi_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC---ACGATCGCAAGGTCGCT-CGTCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGATCTC-TCGGTTAGCCCGTTCGCGGTGCTAGTCGGGAGGGCCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-G-AGGGGGA------CGGACATTGGCCTCCCGTGTGCGTTAGTATGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTT---TCT-GTCATGTCA--TTCCGTCG-TTGCGGT-GGATTAA---TATTGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATCAAAATGTCTCTTTTCCACCTAGT-GTCAT-TTCATTCGTGAAGTGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAATCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAACCGTTATTATTCGAGTTCTC--GTGACTTGTGTGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA-----------------------GGAAATAT-AAGTTTTTCCTAACTAAA--CAAGAAAAA-----------------------------------------------------------------TAGGATCAACACTATTATGAAATGTTGATATAGTATGTAAATAAGGGTTAAATTAAGTTGAG------TATTCCACTTTTTTAA--AACATTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_verna_1_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACAAATC--GGGGACC-GAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTAGCGGTGCTAGTGGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAACGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTCTCTTCTTTAC-GTCGTGCCA--TCTCGTCG-TTGCAAT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-TTTGCCTTGTCC-ACA--TCGATTTCCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTCA-AAACGTCCCTTTTCCACCAAGTCGGAAT-TTCACTCGTGAAACTCTAACGAGGTGGAACTCTAAAG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTCGAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCTTGATGCGGCTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAGATTGGGTTCGGAATTAGTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTGTTTGATCCTTCCAAAAGCTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCATTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACTTTGGAAA---------------------TAGGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAACAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTAA--AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_verna_2 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACAAATC--GGGGACC-GAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTAGCGGTGCTAGTGGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATATCGATC--TCGAATC-GAACTGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTCTCTTCTTTAC-GTCGTGCCA--TCTCGTCG-TTGCAAT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-TTTGCCTTGTCC-ACA--TCGATTTCCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTCA-AAACGTCCCTTTTCCACCAAGTCGGAAT-TTCACTCGTGAAACTCTAACGAGGTGGAACTCTAAAG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTCGAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCTTGATGCGGCTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAGATTGGGTTCGGAATTAGTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTGTTTGATCCTTCCAAAAGCTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCATTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACTTTGGAAA---------------------TAGGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAACAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTAA--AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_violacea_1 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACAAATC--GGGGACC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TCGATCGGCCCGTAAGCGGTGCCAGTCGCGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCGAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTCTCTTCTTTAC-GTCGTGTCA--TCTCGTCG-CTGCAGC-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGA????????????????TCTCGTGCA-GCCTCTTCATTTAACGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TCGATTTCCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGAAT-TTCATTCGTGAAACTCTAACGAGGTGGAACTCTACAG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGCCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCTTGATGCGGCTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAGATTGGGTTCGGAATTAGTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCCTTCCAAAAGCTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACTTTGGAAA---------------------TAGGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAACAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTTA--AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_violacea_2 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACAAATC--GGGGACC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TCGATCGGCCCGTTAGCGGTGCCAGTCGCGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCGAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTCTCTTCTTTAC-GTCGTGTCA--TATCGTCG-CTGCAGC-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-TTTGCCTTGTCC-AC{AG}--TCGATTTCCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGAAT-TTCATTCGTGAAACTCTAACGAGGTGGAACTCTAAAG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGCCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCTTGATGCGGCTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAGATTGGGTTCGGAATTAGTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCCTTCCAAAAGCTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACTTTGGAAA---------------------TAGGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAACAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTTA--AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_violacea_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAA{AG}CAAATC--GGGGACC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TCGATCGGCCCGTTAGCGGTGCCAGTCGCGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCGAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTCTCTTCTTTAC-GTCGTGTCA--TATCGTCG-CTGCAGC-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTA-CGGAACAAGTGC--T-TTTGCCTTGTCC-AC{AG}--TCGATTTCCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGAAT-TTCATTCGTGAAACTCTAACGAGGTGGAACTCTAAAG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGCCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCTTGATGCGGCTCCGACGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAGATTGGGTTCGGAATTAGTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCCTTCCAAAAGCTTCGTCCATTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACTTTGGAAA---------------------TAGGAAATAT-AAGTTTTTCCTAAATAAA--CAAGAAACAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCCACTTTTTTTA--AATCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGATTTTTCTTT Collinsia_wrightii_11 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGGG----CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTATAGT-GGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGTCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGTAATTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGATCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTTTTTGTATCAGTGATTTTGCTTAATTACAAACAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-ATTTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TCGAG------TCTTCCATTTTTTTTA--AATCTTTCTAAGA-AAGTAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_wrightii_12 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGG-----CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTTGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGTCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATGGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GCTTAATTACAAATAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-AAGTTGATCCTAAATAAA--CAAGAAAAA------------------------------------TAAGTTGATTCTAAATAAACAAGAAAAAATAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TCGAG------TATTCCGTTTTTTTTTT-AATCTTTCTAAGATAAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCGTT Collinsia_wrightii_1a_b TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGG-----CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATTGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGCCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTTGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATGGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GCTTAATTACAAATAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-AAGTTGATCCTAAATAAA--CAAGAAAAA------------------------------------TAAGTTGATTCTAAATAAACAAGAAAAAATAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TCGAG------TATTCCGTTTTTTTTTT-AATCTTTCTAAGATAAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCGTT Collinsia_wrightii_2 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGGG----CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGA????????????????TCTCGTTCA-GCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATTGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGCCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTTGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATGGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GCTTAATTACAAATAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-AAGTTGATCCTAAATAAA--CAAGAAAAA------------------------------------TAAGTTGATTCTAAATAAACAAGAAAAAATAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TCGAG------TATTCTGTTTTTTTTTT-AATCTTTCTAAGATAAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCGTT Collinsia_wrightii_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAA{AG}CATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGATC--TATGATC-GAAGGGGGGGG----CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCAATGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGTCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGTAATTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGATCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTTTTTGTATCAGTGATTTTGCTTAATTACAAACAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-ATTTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TCGAG------TCTTCCATTTTTTTTA--AATCTTTCTAAGA-AAGTAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_wrightii_4_10 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGATC--TATGATC-GAAGGGGGGG-----CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCAATGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGTCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGTAATTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGATCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTTTTTGTATCAGTGATTTTGCTTAATTACAAACAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-ATTTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TCGAG------TCTTCCATTTTTTTTA--AATCTTTCTAAGA-AAGTAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_wrightii_5 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGATC--TATGATC-GAAGGGGGGG-----CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCAATGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGTCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGTAATTTTTTGAAAAAATTAGGTTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGATCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTTTTTGTATCAGTGATTTTGCTTAATTACAAACAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-ATTTTTTTCCTAAATAAA--CAAGAAAAAA----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAATTAAGGGTTAAATTAA-TCGAG------TCTTCCATTTTTTTTT--AATCTTTCTAAGA-AAGTAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCTTT Collinsia_wrightii_6 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGGGG---CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATTGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGCCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTTGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATGGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GCTTAATTACAAATAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-AAGTTGATCCTAAATAAA--CAAGAAAAA------------------------------------TAAGTTGATTCTAAATAAACAAGAAAAAATAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TCGAG------TATTCTGTTTTTTTTTT-AATCTTTCTAAGATAAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCGTT Collinsia_wrightii_7 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGGGGG--CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGTCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGTAATTTTTTGAAAAAATTAGGTTCGGAATTATGGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GCTTAATTACAAATAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-AAGTTGATCCTAAATAAA--CAAGAAAAA------------------------------------TAAGTTGATTCTAAATAAACAAGAAAAAATAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TCGAG------TATTCCGTTTTTTTTTTTAATCTTTCTAAGATAAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCGTT Collinsia_wrightii_8 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGG-----CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTT{CT}T{CT}GTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATTGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGCCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTTGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATGGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GCTTAATTACAAATAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-AAGTTGATCCTAAATAAA--CAAGAAAAA--------TAAGTTGATTCTAAATAAACAAGAAAAATAAGTTGATTCTAAATAAACAAGAAAAAATAGGATCAAC{AC}CTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TCGAG------TATTCCGTTTTTTTTTT-AATCTTTCTAAGATAAGGAAA-----TGATGTA{CT}ACATAGGGAAA{CG}CTGTG???????????????????????????????????????????? Collinsia_wrightii_9 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGGGGGGGCGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGTCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGCAAGTACTGTACGTACTTTTTTGAAAAAATTAGGTTCGGAATTATGGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGTTTCGTCCGTTTTTCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GCTTAATTACAAATAAAAATTCTTATAAAAATTTTTAGACCTTGGAAA-----------------------GGAAATAT-AAGTTGATCCTAAATAAA--CAAGAAAAA------------------------------------TAAGTTGATTCTAAATAAACAAGAAAAAATAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTTAATTAA-TCGAG------TATTCCGTTTTTTTTTT-AATCTTTCTAAGATAAGGAAA-----TGATGTATACATAGGGAAAGCTGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGAGATTTTTCGTT Keckiella_cordifolia TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTT--AAACA--TCTCGGGGGCC-GAGGCGCGAGGGTCGCGAGACCCCCGTGCCGAGG-CCCTCCGTCCGTGCGACGCTCGCGTCGTGCGGGCTAACTAA-CCCCGGCGCGGCATGCGCCAAGGAAAACTCAAAAAAGAATCACCGACCCC-CCG{AG}CTGCCCCGTTCGCGGTGCGCGTCGGGAGGACCCGGTGTATCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCAATCCCTCGGGTT-GACGGGGG-------CGGACATTGGCCTCCCGTGCGCGCGAGCGTGCGGCCGGCCCAAATGCAA-TCCCGCATCGACGGATGTCACGACCAGTGGTGGTTGAACCCTCAACTCGCG----TGCTGTCGTGCCGTGCTCCGTCGCTTGTCGT-GGAATCG---TATCGACCCAACGGC--GCA---ATGCGCTTTCGATCTGGCAGCGACAGCGTCCCGTGCTCGCCTT{CT}TCATTTGTT{AG}GCACAAGTG{CT}{AG}TG-TTTGCCTTGGCC-GC{AG}--TCG{AG}TTTTCCTGTGTTGTATACCTGTTGTGAAGG-CACTCTTTCGGATTAAAATGACCCTCTTCCACCAAGT-{AG}CTGC-TTCATTCGTGATGCGGCG-C{AG}AGGTGGAACCCCA-{CT}G--G{CT}GATCGGC{AG}TGT{CT}ACC{CT}CTTTCCCGCACATTTGTGACGG{AG}CGATTGGCCCA{CT}GCC-GTAT{CG}GTG{CT}GATCTCTCGGGTGCGGAATACATTGTGGGTACGTGGCCCTCGTGCCACTATTTGCCCCATAACAAG{AC}GTTCAACGCTTCACG{CT}GAATGAC{CT}GTCGGTGT{CT}GTGTTCAT-CGGGTCCTC--GCGGCTCGCATCATG{CT}GGCACC{AG}{AG}CGTCGGTGAGGAATGCAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGCTCGGAATTATTGGAAGAATTTCTTATGTCAGAAGAAGACGTTCTTTTTTTGACCTTCCCAAAAGCTTCTTCCACTTTGCGGGGAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTATG------------AGACCTTGGAAA----------------------------TAT-AAATTTTTCCTAAAAAAAAATA-TAAAAA-----------------------------------------------------------------TGGGATTTCCACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATCAA-CTGAG------TATTCAACTTTTAAA---AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGGGATTTTTCTTT Penstemon_hartwegii TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTT--AAACA--TCGAGGGGTCT--AGGAGCGAGGGTCGCAAGTCCCCCCTTCCGACGCCCCTCCGCCCGCGCGACGCTCGCGCCGTGCGGGCTAACTAA-CCCCGGCGCGGCATGCGCCAAGGAAAACTCAAAA-GGAAGCATCGGCCCC-CCGGCTGCCCCGTTCGCGGTGCGCGTC-GGAGGACCCGGTGTATCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCAATCCCTCGGGTTTGATGGGGG-------CGGACATTGGCCTCCCGTGAGCGCGAG{CG}GCGCGGCCGGCCCAAATGCAA-TCCCGCATCGACGGATGTCACGACCAGTGGTGGTTGAACCCTCAACTCGCG----TGCTGTCGTGCCTCGCTCCGTCGCTTGCCGT-GGAATCG---TATCGACCCAACGGC--GCTT--ACGCGCTTTCGATCGGGCAGCGACAACATCCCGTGCTCGCCTTTTCATTC-TTGGCACAAGTGCACG-TTTGCCTTGGCC-GCG--TCGGTTTTCCTGTGTTGCATACCTGCTGTGAAGG-CACTCTTTCGGATATAAATGACCCATTTCCACCAAGT-GCTGC-CTCTTTCGTGCGGTGGCG-CGAGGTGGAACCCCAAAT--GCGGTCGACGTGTTTCCTCTTTCCCGTTCATTAAAGACGGGCGATTGGCCCACGTTTGCATCGTGCGATCTCTCGGTTGCGGAGTATCATGTGGGTACGTGGC-CTTGTGCCTCTATTTGCCCCGTAACAAGCGTTCTACGCTTCACGCGAACGACCGTCGTTGTCGTTTTGAT-CGGGTCCTC--GCGGCTCGTACCATGCGGCACCGGCGTCGGTGAGGAATGCAAGTACTGTACGTGCTTTTTTCAAAAGATTAGGCTCGGAATTATTGGAAGAATTTCTTATGTCAGAAGAAGACGTTCTTTTTTTGACCTTCCCAAAAGCTTCTTCCACTTTGCGGGGAGTATCTAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTGAATTACAAATAAAAATTCTG------------AGACCTTGGAAA----------------------------TCG-AAATTTTTC--AAAAAAAA-TA-GAAAAAA----------------------------------------------------------------TGGAATTTCCACTATTATGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATCAA-CTGAG------TATTCAACTTTTTAA---AGTTTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGGGATTTTTCTTT Tonella_floribunda_1_2 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATATT--GGGGACC-GAGGCTCGTTGGTCGAAAGATCACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTTAAAA-AGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCTCGTCGGGAGAAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ACCTCGATC--TCGAATC-GAATGGGGG------CGGACATTGGCCTCCCGTGCGCGTGAGTGCGCGGCCGGCCTAAATGCAAATCCCTCATGGACGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTT---CGC-GTCTTGATG--TCTCGTCT-TTGCGGT-GGATTCA---TATCGACCCATTGGCTCACTTAGGTGGGTTTTCGATCGGGCAGCGACAATATCTCGTGCAAGCCTTTTCATT-GTCGGAACAAGTGC--T-TTTGCCTTGTCC-TCA--TCGGATTTCCTGTGTTGTATACCTATTGTAAAGG-CATTCATTCGGATCAAAATGTCCCTTTTCCACCGAGT-GTCAT-TTCATTCGTGAAACGACA-TGAGGTGGAACTCCAACG--ACGATGTGTGTGTTTCCTCTTTCCCGCACAATTGTGCCGGGATCTTGGCCCACGC--ATATCGTACGATCTCTCGGGTTCGGAATACATTGTCGGTACATGGCACTCGTGCCACTATAAGTCCCGTAA-AAGCGTTCTACGCTTCGAGCGAACGACTGTCGTAGCCGTTATCATTCGAGTCCTC--GTGGCTTGACTGAAGCGGTTCCGGCGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATTAGGCTCGGAATTATTGGAAGAATTTCTTATATCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCATTTTGCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCT----------AA-AAAAA-----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAA-TAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGGTTTTTATTT Tonella_tenella_1 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATATC--GGGGACC-GAGGCTCGTTGGTCGTAAGATCACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGACTGGCCCGTTCGCGGTGCTGGTCGGGAGAAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ACCTCGATC--TCGAATC-GAATGGGGG------CGGA-ATTGGCCTCCCGTGCGCGTGAGTGTGCGGCCGGCCTAAATGCAAATCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTT---CGC-GTCTTGACG--TCTCGTCT-TTGCGGT-GGATTCA---TATTGACCCATTGGCTCACTTAGGTGGGTTTTCGATCGGGCAGCGACAATATCTCGTGCAAGCCTTTTCATT-GTCGGAACAAGTGC--T-TTTGCCTTGTCC-TCA--TCGGATTTCCTGTGTTGTATACCTATTGTAAAGG-CATCCATTCGGTTTAAAATGTCCCTTTTCCACCGAGC-GTCAT-TTCATTCGTGAAACGATG-CGAGGTGGAACTCCAACG--ACGATGTGTGTGTTTCCTCTTTCCCTCACAATTGTGTTGGGATCTTGGCCCATGC--ATATCGTACGATCTCTCGGGTTCGGAATACAATTTCGGTACATGGCACTCGTGCCACTATAAGTCCCGTAA-AAGCGTTCTACGCTTCGAGCGAACGACTGTCGCAGCCGTTATCATTCGAGTCCTC--GTGGCTTGACTGATGCGGTTCCGGCGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATTAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCATTTTGCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAA-AAAAA-----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TAGTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGGTTTTTCTTT Tonella_tenella_2 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATATC--GGGGACC-GAGGCTCGTTGGTCGTAAGATCACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGACTGGCCCGTTCGCGGTGCTGGTCTGGAGAAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ACCTCGATC--TCGAATC-GAATGGGGG------CGGA-ATTGGCCTCCCGTGCGCGTGAGTGTGCGGCCGGCCTAAATGCAAATCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTT---CGC-GTCTTGACG--TCTCGTCT-TTGCGGT-GGATTCA---TATTGACCCATTGGCTCACTTAGGTGGGTTTTCGATCGGGCAGCGACAATATCTCGTGCAAGCCTTTTCATT-GTCGGAACAAGTGC--T-TTTGCCTTGTCC-TCA--TCGGATTTCCTGTGTTGTATACCTATTGTAAAGG-CATCCATTCGGTTTAAAATGTCCCTTTTCCACCGAGC-GTCAT-TTCATTCGTGAAACGATG-CGAGGTGGAACTCCAACG--ACGATGTGTGTGTTTCCTCTTTCCCTCACAATTGTGTTGGGATCTTGGCCCATGC--ATATCGTACGATCTCTCGGGTTCGGAATACAATTTCGGTACATGGCACTCGTGCCACTATAAGTCCCGTAA-AAGCGTTCTACGCTTCGAGCGAACGACTGTCGCAGCCGTTATCATTCGAGTCCTC--GTGGCTTGACTGATGCGGTTCCGGCGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATTAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCATTTTGCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAA-AAAAA-----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGGTTTTTCTTT Tonella_tenella_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATATC--GGGGACC-GAGGCTCGTTGGTCGTAAGATCACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGACTGGCCCGTTCGCGGTGCTGGTCGGGAGAAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ACCTCGATC--TCGAATC-GAATGGGGG------CGGACATTGGCCTCCCGTGCGCGTGAGTGTGCGGCCGGCCTAAATGCAAATCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTATCGACTTTCTT---CGC-GTCTTGACG--TCTCGTCT-TTGCGGT-GGATTCA---TATTGACCCATTGGCTCACTTAGGTGGGTTTTCGATCGGGCAGCGACAATATCTCGTGCAAGCCTTTTCATT-GTCGGAACAAGTGC--T-TTTGCCTTGTCC-TCA--TCGGATTTCCTGTGTTGTATACCTATTGTAAAGG-CATCCATTCGGTTTAAAATGTCCCTTTTCCACCGAGC-GTCAT-TTCATTCGTGAAACGATG-CGAGGTGGAACTCCAACG--ACGATGTGTGTGTTTCCTCTTTCCCTCACAATTGTGTTGGGATCTTGGCCCATGC--ATATCGTACGATCTCTCGGGTTCGGAATACAATTTCGGTACATGGCACTCGTGCCACTATAAGTCCCGTAA-AAGCGTTCTACGCTTCGAGCGAACGACTGTCGCAGCCGTTATCATTCGAGTCCTC--GTGGCTTGACTGATGCGGTTCCGGCGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATTAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCATTTTGCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAA-AAAAA-----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTCTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGGTTTTTCTTT Tonella_tenella_4 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATATC--GGGGACC-GAGGCTCGTTGGTCGTAAGATCACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGTGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCTGGTCGGGAGAAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ACCTCGATC--TCGAATC-GAATGGGGG------CGGACATTGGCCTCCCGTGCGCGTGAGTGTGCGGCCGGCCTAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTT---CGC-GTCTTGACG--TCTCGTCT-TTGCGGT-GGATTCA---TATTGACCCATTGGCTCACTTAGGTGGGTTTTCGATCGGGCAGCGACAATATCTCGTGCAAGCCTTTTCATT-GTTGGAACAAGTGC--T-TTTGCCTTGTCC-TCA--TCGGATTTCCTGTGTTGTATACCTATTGTAAAGG-CATCCATTCGGTTAAAAATGTCCCTTTTCCACTGAGT-CTCAT-TTCATTCGTGAAACGATG-CGAGGTGGAACTCCAAGG--ACGATGTGTGTGTTTCCTCTTTCCCTCACAATTGTGTTGGGATCTTGGCCCATGC--ATATCGTACGATCTCTCGGGTTCGGAATATAATTTCGGTACATGGCACTCGTGCCACTATAAGTCCCGTAA-AAGCGTTCAACGCTTCGAGCGAACGACTGTCGCAGCTGTTATCATTCGAGTCCTC--GTGGCTTGACTGAGGCGGTTTCGGCGTCGATGAGGAATGCAAGTACTGTACGCACTTTTTTGAAAAAATTAGGCTCGGAATTATTGGAAGAATTTCTTATGTCGGAAGAAGACGTTCTTTTTTTGACCTTTCCAAAAGCTTCGTCCATTTTGCGGGTAGTATATAAAAGTAGGATTTGGTATTTGGATATTCTTTGTATCAGTGATTT-GGTTAATTACAAATAAAAATTCTT------------AGACCTTGGAAA----------------------------TAT-AAGTTTTTCCTAAATAAA--CAA-AAAAA-----------------------------------------------------------------TAGGATCAACACTATTCTGAAATGTTGATATAGTATGTAAGTAAGGGTTAAATTAA-TTGAG------TATTCAACTTTTTTAA--AGTTTTTCTAAGA-AAGGAAA-----TGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGAGGTTTTTCTTT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7298] TITLE Collinsia_nrDNA_matrix; LINK TAXA = Taxa5; DIMENSIONS NCHAR=1052; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Chelone_glabra TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTT--AAAAA--TCGAGGGGAC--GAGGTGCGAGGGTCGCAAGACCCCCGTGCCGAGAACCCTCCGCTCGCGCGACGCTC{GT}CGTCGTGCGGGCTAACTAA-CCCCGGCGCGGCATGCGCCAAGGAAAACTCAAAA-GGAAGCATCGGCCCC--CGGCTCTCCCGTTCGCGGTGCGCGTC-GGAGGACCCGGTGTATCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-TTCTCAATCCCTCGGGTT-GATGGGGGG------CGGACATTGGCCTCCCGTGCGCGCGAGCGTGCGGCCGGCCCAAATGCAA-TCCCGCATCGACGGATGTCACGACCAGTGGTGGTTGAACCCTCAACTTGCG----TGCTGTCGTGACGCGCTCCGTCGCTTGCTGC-GGAATCG---TATCGACCCAACGGC--GCT--GGCGCGCTTTCGATCGGGCAGCGACAACATCCCGTGCTCGCCTTTTCATTC-TTGGCACAAGTGCATT-CTTGCCTTGGCC-GCG--TCGGTTTTCCTGTGCTGTATACCCGCTGTGTAGGGCACTCTTTCGGATAAAAATGACCCATTTCCACCAAGT-GCTGC-CTCATTCGTGCGGTGGCG-CGAGGTGGGACCCAAAAAAAGCGGTCGACGTGTTACCTCTTTCCCTCACGTTTGTGATGGGAAATTGGCCCACGTT-GCATCGCTCGATCTCTCGGGTGCGGAATATCGTGTGGGTACGAGGC-CTCGTGCCTCTATTTGCCCCGTAACAAGCGTTCTACGCTTCACGCGAACGACCGCCCTTGTCGTTTTGATT-GGGTCCTC--GCGGCTCGTATCATGCGGCACCGGCGTCGGTGAGGAATGC Collinsia_antonina_1 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAA{AG}CATACT--GGGGGCC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCGTCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAGATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTACGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTAAGT-GCCGT-TTCATTCGTGAAATGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCTTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_antonina_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGGCC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCGTCGACCTCCTCGATTGACCCGTTAGCGGTGCTGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAGATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTACGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTTAAAATGTCCCTTTTCCACTAAGT-GCCGT-TTCATTCGTGAAATGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCTTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_antonina_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGGCC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCGTCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCAGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAGATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTACGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTAAGT-GCCGT-TTCATTCGTGAAATGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCTTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_bartsiifolia_var_bartsiifolia_1 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGTACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_bartsiifolia_var_bartsiifolia_2_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGTACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTATAACG--GCGATGTGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_bartsiifolia_var_davidsonii_1_5 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGTACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTATAACG--GCGGTGTGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_bartsiifolia_var_davidsonii_2to4 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTATAACG--GCGGTGTGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_callosa_1 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAA{AG}CATACT--GGGGACC-GAGGC-----------------AAT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TGGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGATCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAACGGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---AAC-GCCTTGCCA--TCTTGTCG-TTGCGAC-GGATTCA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACCGAGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--TATTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAATGTCCCTTTTCCACCTAGC-GTTGT-TTCATTTGTGAAATGCTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTATTGGCCCATGC--ACATCGTACGATCTCTCGGGTTTGGAATACAATGTCGGTACATGGCACCCGTGCCATTATCAGTCCCTTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_callosa_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------AAT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TGGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGATCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAACGGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---AAC-GCCTTGCCA--TCTTGTCG-TTGCGGC-GGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACCGAGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--TATTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAATGTCCCTTTTCCACCTAGC-ATTGT-TTCATTTGTGAAATGCTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTATTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACCCGTGCCATTATCAGTCCCTTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_callosa_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------AAT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TGGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGATCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAACGGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---AAC-GCCTTGCCA--TCTTGTCG-TTGCGGC-GGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACCGAGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--TATTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAATGTCCCTTTTCCACCTAGC-GTTGT-TTCATTTGTGAAATGCTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTATTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACCCGTGCCATTATCAGTCCCTTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_childii_1 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAA{AG}CATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGATCGGCCCGTTAGCGGTGCCGATCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCTGTTCGAAATGTCCCTTTTCCACTTAGT-GTCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_childii_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGATCGGCCCGTTAGCGGTGCCGATCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCTGTTTGAAATGTCCCTTTTCCACTTAGT-GTCCT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTTGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_childii_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGATCGGCCCGTTAGCGGTGCCGATCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTTGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCTGTTCGAAATGTCCCTTTTCCACTTAGT-GTCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCTGACGTCGATGAGGAATGC Collinsia_childii_4 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGATCGGCCCGTTAGCGGTGCCGATCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCATGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCTGTTCGAAATGTCCCTTTTCCACTTAGT-GTCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCTGACGTCGATGAGGAATGC Collinsia_childii_5 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGATCGGCCCGTTAGCGGTGCCGATCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGA????????????????????????????????????TTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCTGTTCGAAATGTCCCTTTTCCACTTAGT-GTCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTACTTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_childii_6 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGATCGGCCCGTTAGCGGTGCCGATCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCATGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCATCA-TTGCGGC-GGATTGA---TATCGACCCATTGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCTGTTCGAAATGTCCCTTTTCCACTTAGT-GTCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCC-ACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCTGACGTCGATGAGGAATGC Collinsia_concolor_1a_2to5_Collinsia_parryi_1_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGGCC-GAGGC-----------------ACT-AGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTGAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGATCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTCGGCCCATGC--ACACCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_concolor_1b TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGGCC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTGAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGATCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTCGGCCCATGC--ACACCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_corymbosa_1_2_3a_3b TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATCCGTGAAATGGTG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTAATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_grandiflora_1_2a TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGTACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTACA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_grandiflora_2b TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGTACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATAAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCA{AG}AATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTACA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_grandiflora_3_5 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGTACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTACA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_grandiflora_4 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGTACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTACA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTTGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_greenei_1_2_4 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACA-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTC-TCGATCGGCCCGTTAGCGGTGCTGGTCGGGATGAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAATGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCGAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTTGTCG-TTGCATC-GGATTGA---TATTGACCCATCGGCTCACTTAGGTGAGCTTTCGACCGTGCAGCGACAATGTCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TCTGCCTTGCCC-AAATATCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTTCGTTCAAAATGTCCCTTTTCCACTTAGC-GCCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAATG--GCGATGGGCGTGTTTCCTTTTTCCCACATTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCTGTACGTGGCACTCGTGCCATTATCAGTCCTTTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGTCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_greenei_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACA-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTC-TCGATCGGCCCGTTAGCGGTGCTGGTCGGGATGAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCGAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTTGTCG-TTGCATC-GGATTGA---TATTGACCCATCGGCTCACTTAGGTGAACTTTCGACCGTGCAGCGACAATGTCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TCTGCCTTGCCC-AAATATCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTTCGTTCAAAATGTCCCTTTTCCACTTAGC-GCCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAATG--GCGATGGGCGTGTTTCCTTTTTCCCACATTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCTGTACGTGGCACTCGTGCCATTATCAGTCCTTTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGTCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_1 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TT{AC}TCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGA{AT}CGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGACG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_10 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TC{CT}TGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGACG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACAT{CT}GTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_12_13 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGAT{CT}GGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_12_14 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_15 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-{CT}GCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAA-GAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTAAGT-GCCGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_16 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTAAGT-GCCGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_17 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGACG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_18_ITSclone11 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCACTGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GC{CT}GT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_18_ITSclone6 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTA{AG}CGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TTTTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GC{CT}GT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_18_ITSclones2_12 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGG-------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GC{CT}GT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_21 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TTGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCG{CT}GTCAGCGCGCGGCCGGCCCAAATGCAAATCCCT{CT}ATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCA{AG}C-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GC{CT}GT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_2a_b TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCTGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_4_5 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTAGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TAGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_6_11_19 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGACG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_7 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTC{AT}AAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGC{AG}CGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCAT{CT}GGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGA{CT}G-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_8 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCG{CT}GAGGACCCGGTGTGTCTTGAATGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCACGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGACG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_heterophylla_9 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACCTCTGG{AC}-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATCGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATCGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GC{CT}GT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACT{CT}GTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTCGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_latifolia_1 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTATAAACATACT--GGGGGCC-GAGGC---ATGATCGCAAGATCACT-CGCCAAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAAGGGGG-------CGGACATTGGCCTCCCGTGCGCGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTTTCTT---CAT-GTCTTGTCA--TCCCCTCG-TTGCGGT-GGATTAT---TATTGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-CTTGCCTTGTCC-ACG--TCGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATCAAAATGTCCCTTTTCCACCTAGT-GTCAT-TTCATTCGTGAATTGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTCTTTCCCACACAATTGTGCTGGGTTCTTGGCACATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_latifolia_2 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTATAAACATACT--GGGGGCT-GAGGC---ATGATCGCAAGATCACT-CGCCAAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAAGGGGG-------CGGACATTGGCCTCCCGTGCGCGTTAGCGTGCGGCCGGCC{CT}AAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTAT{CT}GACTTTCTT---CAT-GTCTTGTCA--TCCCCTCG-TTGCGGT-GGATTAT---TATTGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-CTTGCCTTGTCC-ACG--TCGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATCAAAATGTCCCTTTTCCACCTAGT-GTCAT-TTCATTCGTGAATTGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTCTTTCCCACACAATTGTGCTGGGTTCTTGGCACATG{CT}--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTC{AG}AGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_latifolia_3_4 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGGCC-GAGGC---ATGATCGCAAGATCACT-CGCCAAGG-TCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGGTCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGAGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTTTCTT---CAT-GTCTTGTCA--TCCCCTCG-TTGCGGT-GGATTAT---TATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTACGAGCCTCTTCATTTGTCGGAACAAGTGC--T-CTTGCCTTGTCC-ACG--TCGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATCAAAATGTCCCTTTTCCACCTAGT-GCCAT-TTCATTCATGAATTGTTG-CGAGGTGGAACTCTAACG--GCGATGGACGTGTTTCCTCTTACCCACACTATTGTGCTGGGTTCTTGGCACATGT--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_linearis_1_4 TCGAAACCTGCAAAGCAGACCCGCGAACGT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGG{GT}TTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGGCGCAAGTGCCATTATTAGTCCCGTAA-TAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCGTTGAGGAATGC Collinsia_linearis_10 TCGAAACCTGCAAAGCAGACCCGCGAACGT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATCGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAATAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGGCGCAAGTGCCATTATTAGTCCCGTAA-TAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCGTTGAGGAATGC Collinsia_linearis_11 TCGAAACCTGCAAAGCAGACCCGCGAACGT--GTTAACAAA{CT}ATATC--GGGGA{CT}C-GACGC-----------AAGAT{CT}GCT-TGCCGAGG-{CT}CCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGAT{AG}AAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-C{AT}TGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGGCGCA{AC}GTGCCATTATTAGTCCCGTAA-{GT}AGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCG{AT}TGAGGAATGC Collinsia_linearis_13 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTG{AG}ATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTAT{CT}GTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_linearis_14 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATC{CT}CGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CT{CT}GCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTAT{CT}GTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_linearis_15to18 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATCGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_linearis_19 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATC{CT}CGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTT{CT}CCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_linearis_2 TCGAAACCTGCAAAGCAGACCCGCGAACGT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATCACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTTTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGATCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGTTTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGGCGCAAGTGCCATTATTAGTCCCGTAA-TAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCGTTGAGGAATGC Collinsia_linearis_20 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATC{CT}CGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CT{CT}GCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATCGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_linearis_3_5_12 TCGAAACCTGCAAAGCAGACCCGCGAACGT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATCGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGGCGCAAGTGCCATTATTAGTCCCGTAA-TAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCGTTGAGGAATGC Collinsia_linearis_6a TCGAAACCTGCAAAGCAGACCCGCGAAC{AG}T--GTTAACAAA{CT}ATATC--GGGGA{CT}C-GACGC-----------AAGATTGCT-TGCCGAGG-{CT}CCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAA{CT}TCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGG{GT}TTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGG{CT}GCAAGTGCCATTATTAGTCCCGTAA-TAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCGTTGAGGAATGC Collinsia_linearis_6b TCGAAACCTGCAAAGCAGACCCGCGAAC{AG}T--GTTAACAAA{CT}ATATC--GGGGA{CT}C-GACGC-----------AAGAT{CT}GCT-TGCCGAGG-{CT}CCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGG{GT}TTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGGCGCAAGTGCCATTATTAGTCCCGTAA-TAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCGTTGAGGAATGC Collinsia_linearis_7 TCGAAACCTGCAAAGCAGACCCGCGAAC{AG}T--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-{CT}CCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--T{CT}GAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGA????????????????TCTCGTGCA-GCCTCTTCATTTAACGGAACAAGTGC--T-C{AT}TGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGG{CT}GCAAGTGCCATTATTAGTCCCGTAA-{GT}AGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_linearis_8 TCGAAACCTGCAAAGCAGACCCGCGAAC{AG}T--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TTGAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGA????????????????TCTCGTGCA-GCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGG{CT}GCA{AC}GTGCCATTATTAGTCCCGTAA-{GT}AGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCG{AT}TGAGGAATGC Collinsia_linearis_9 TCGAAACCTGCAAAGCAGACCCGCGAACGT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-{CT}CCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-CCGATTGGCCCGTTAGCGGTGTTAGTAGGGATGACCCGATGTGTCTTGGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--T{CT}GAATT-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---GAC-GTCTTGTCA--TCTTGTCG-TTGCGGT-GGATTGAT--TATTGACCCATTGGCTCACTTAGGTGAACTTTCGA????????????????TCTCGTGCA-GCCTCTTCATTTAACGGAACAAGTGC--T-CTTGCCTTGTCC-TAA--TCGGTTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTTTTTTCC--ACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGCACGATCTCTCGGGTTCGGAAGACAATGTCGGTACATGGCGCA{AC}GTGCCATTATTAGTCCCGTAA-{GT}AGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTTGGGCGAGTCCACCCGTGATCT-CTTGATGCGGTTCCGACGTCG{AT}TGAGGAATGC Collinsia_metamorphica_1_2_6 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGGTCGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATCGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGTTCGAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_metamorphica_3_4 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGGTCGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTG---C-GGATTGA---TATCGACCCATCGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGTTCGAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTTGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_metamorphica_5 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGGTCGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATCGGCTCACTTAGGTGAACTTTCGACTGGG{CT}AGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTG{CT}CC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGTTCGAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCT{CT}GGGTTCGGAATACAATG{CT}CGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_metamorphica_7 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACT-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGGTCGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATCGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-GCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGTTCGAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACT{CT}GTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTTGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_metamorphica_8 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGGTCGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAC-GCCTTGCCA--TCTCGTCG-TTGCGGC-GGATTGA---TATCGACCCATCGGCTCACTTAGGTGAACTTTCGACTGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGCCCCGCA--TCGATTTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCAGTTCGAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCGGTCCCGTAA-GAGCGTCCCACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTTGAGTCCTC--GTGGCTTGCTTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_multicolor_1_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------AAT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTTCTCGATTGGCCCGTTAGCGGTGCTGGTCGGGGGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGCCTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCATTTATCGGAACAAGCGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTTGAGTCCTC--GTGGCTTGCATGATACGGTTCCGACGTCGATGAGGAATGC Collinsia_parviflora_1_2_6_7_Collinsia_grandiflora_6 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCAACCGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_parviflora_10a TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCG{GT}TCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_parviflora_10b TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAA{AG}GGGGG------CGGACATTGGCCTCCCGTGCGCGT{CT}AGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCG{GT}TCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_parviflora_11 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_parviflora_12 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--{AT}CGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAAAATATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTA{AC}CGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_parviflora_13 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCACTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_parviflora_14 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGTATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGT--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCATATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCAACCGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_parviflora_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGG{CT}CGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAAGGGGG------CGGACATTGGCCTCCCGTGCGCGT{CT}AGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATG{CT}TG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_parviflora_4 TCGAAACCTGCAAAGCAGACCTGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATATCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGAC{CT}GGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGC{AT}A{AC}CGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATA{CT}AATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_parviflora_5 TCGAAACCTGCAAAGCAGACC{CT}GCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAAT{AG}TCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--T{CT}GTATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGA????????????????????GTGCA-GCCTCTTCATTTATCGGAACAAGTG{CT}--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGC{AT}A{AC}CGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATA{CT}AATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_parviflora_8 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATTC--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAACGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--ACGTATC-GAAGGGGGG------TGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTTGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_parviflora_9 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACAATT{CT}--GGGGGCC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCCAGTCGTGAGAACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGTATC-GAAAGGGGG------CGGACATTGGCCTCCCGTGCGCGTTAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTGG--TAC-GTCTTGTCA--TCTCGTCG-TTGCAGT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTATCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGATTTCCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGGAT-TTCATTCGTGAAATGCTG-CGAGGTGGAACTCTTATG--GCGATGTGCGTGTTTCCTCTTTCCCACGCTAACGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTACTAGTCCCTTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_rattanii_1_2_4 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_rattanii_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTGCT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_rattanii_6 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAATGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCATGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAAATTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAATG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_rattanii_7_8 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCATGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTAGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_rattanii_9 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTAACAAACATATC--GGGGACC-GACGC-----------AAGATTGCT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAATCATCGATCTC-CCGATTGACCCGTTAGCGGTGTTAGTAGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-CTCTCGATC--TCGAATC-GAAAGGGGG------CGGAGATTGGCCTCCCGTGCGTGTTAGCGTGCGGTTGGCCCAAATGCAAGTCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTC---AAC-GTCTTGTCA--TCTTGTTG-ATGCGGT-GAATTAAT--TATTGACCCGTTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCATGCCTCTTCATTTAACGGAACAAGTGC--T-CTCGCCTTGGCC-AAA--TCGGATTTCCTGTGTTGCATACCTGTTGTGAAGG-CATCCATTCGGATAAAAATGTCCCTTTTCCACCTGGT-GTCAA-TTCATTCGTGAAATGTTG-CGAGGTGGAACTCTAACG--GTGATGGGCGTGTTTCCTTTTTTCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCACACGATCTCTCGGGTTCGGAAGACAATGTCGGTATATGGCACACGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTTAAGCGAACGACCGTTGGAGCCGTTGTCGGTCGAGTCCACCCGTGACTTGCTTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_sparsiflora_var_collina_1 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACCGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_sparsiflora_var_collina_2 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCT{AC}TTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_sparsiflora_var_collina_4 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGA????????????????TCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCACATGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_sparsiflora_var_collina_5 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCC{CT}-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_sparsiflora_var_sparsiflora_17 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CACCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GAA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_sparsiflora_var_sparsiflora_19 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCATTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_sparsiflora_var_sparsiflora_1to5_9to12_15_16_18_20_var_collina_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGGTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_sparsiflora_var_sparsiflora_6_7_13_14 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGTGCTGTTCGGGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_sparsiflora_var_sparsiflora_8 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC-----------------ACT-CGCCGAGG-CCCT-----------------------------CTAACTAAAACCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-GGAAGCATCGACCTC-TCGTTCGGCCCGTTAGCGGAGCTGGTCGGGAAGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--CCGAATC-GGA-GGGGG------CGGACATTGGCCTCCCGTGCGTGTCAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCGGT-GGATTAA---CATCGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCAGTTATCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTTCGAAACGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGACG-CGAGGTGGAACTCTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTACTGTGTTGGGTTCTTGGCACACGC--ACATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACGAGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGCAGCCGTTATTATTCGAGTCCCCT-GTGGCTTGCGTGATGCGGTTTCGACGTCGATGAGGAATGC Collinsia_tinctoria_1_ETSclone2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTTACGTGAGCTTTCGA?????????????????????????AGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCTGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_1_ETSclone3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTTACGTGAGCTTTCGA?????????????????????????AGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACGATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGCCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_1_ETSclone7 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTTACGTGAGCTTTCGA?????????????????????????AGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_1_ETSclones1_5_6_8_10_11_12 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTTACGTGAGCTTTCGA?????????????????????????AGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_1_ETSclones4_9 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTTACGTGAGCTTTCGA?????????????????????????AGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAACGATG-CGAGGTGGAACTATAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTCGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_2 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGA{AC}CCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_3 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATAT{CT}TCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGT{CG}TTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_4_ITS_clone1 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAA-GAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGG-------CGGACATTGGCCTCCCGTGCGTCTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_4_ITS_clone12 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-CGTCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCAGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGATCGTGAGGACTCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATATCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTGAGCGCGCGGCCGGCCCAAATGCAAATCCCTTATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_4_ITS_clone5 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-CGTCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGATCGTGAGGACTCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTGAGCGCGCGGCCGGCCCAAATGCAAATCCCTTATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAGCTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_4_ITS_clones2_3_7_10 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAA-GAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGTCCCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGG-------CGGACATTGGCCTCCCGTGCGTCTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_4_ITS_clones4_6_8_9_11 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAA-GAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_6 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACT{AC}AAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAACG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCT{CT}--GTGGCTTGCATGATGC{AG}GTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_7 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGG{AT}CGGGAGGAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATC{CT}CGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGGGCAGCG{AC}CAATATATCGT{AC}CAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAGTCCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_8_ITSclone11 TCGAAACCTGCAAAGCAGACCCGCGAAC--------------------------CC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCACCCC--ATCCCGATC--TCGAATC-GGAGGGGG-------CGGACATTGGCCTCCCGTGCGTGTGAGCGCGCGGCCGGCCCAAATGCAAATCCCTTGTCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAGCTTTCGACCGG-CAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAG{CT}CCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_8_ITSclone3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAAAAGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTGAGCGCGCGGCCGGCCCAAATGCAAATCCCTTATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCA?C-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAGCTTTCGACCGG-CAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAG{CT}CCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_8_ITSclone5 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAATAAAAGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGATCGTGAGGACCCGGTGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGACCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--ACGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTGAGCGCGCGGCCGGCCCAAATGCAAAACCCTTATCGATGGATGTCACGGCTAGTGGTGGTTG--TTATCGACTCTCTT---TAT-GCCTTGCCA--TCTTGTCG-TTGCAGC-GGATCGA---TATTGACCCATTGGCTCACTCACGTGAGCTTTCGACCGG-CAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAG{CT}CCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_8_ITSclone6 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGCCGGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGG-CAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAG{CT}CCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_8_ITSclones1_4_7_8_9_12 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCAAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GGAGGGGGG------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGG-CAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAG{CT}CCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_tinctoria_8_ITSclones2_10 TCGAAACCTGCAAAGCAGACCCGCGAACAT--GTTTACAAACATACT--GGGGACC-GAGGC-----------------ACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTCCTCGATTGGCCCGTTAGCGGTGCCGGTCAGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCGATC--TCGAATC-GGAGGGGG-------CGGACATTGGCCTCCCGTGCGTGTTAGCGCGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGGCTAGTGGTGGTTG--TTCTCGACTCTCTT---TAT-GCCTTGCCA--TCATGTCG-TTGCAGC-GGATTGA---TATTGACCCATTGGCTCACTTATGTGAACTTTCGACCGG-CAGCGACAATATATCGTACAAGCCTCTTCAGT-GTCGGAACAAGTGC--T-TTCGCCTTGCCC-AAA--TCGATTTTCCTGTGTTGTATACCTGTTGCAAAGG-CATCCATTCGGTTCAAAATGTCCCTTTTCCACTTAGT-GCCGT-TTCATTCGTGAAATGGTG-CGAGGTGGAACTTTAATG--GCGGTGGGCGTGTTTCCTTTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAGTCCCGTAA-GAGCGTTCTACGCATCAAGCGAACGACCGTCGTAGCTGTTATTATTCGAG{CT}CCTT--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_torreyi_1a_2_4 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC---ACGATCGCAAGGTCGCT-CGTCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGATCTC-TCGGTTAGCCCGTTCGCGGTGCTAGTCGGGAGGGCCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-G-AGGGGGA------CGGACATTGGCCTCCCGTGTGCGTTAGTATGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTT---TCT-GTCATGTCA--TTCCGTCG-TTGCGGT-GGATTAA---TATTGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATCAAAATGTCTCTTTTCCACCTAGT-GTCAT-TTCATTCGTGAAGTGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAATCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAACCGTTATTATTCGAGTTCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_torreyi_1b TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC---ACGATCGCAAGGTCGCT-CGTCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGATCTC-TCGGTTAGCCCGTTCGCGGTGCTAGTCGGGAGGGCCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-G-AGGGGGA------CGGACATTGGCCTCCCGTGTGCGTTAGTATGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTT---TCT-GTCATGTCA--TT{CT}CGTCG-TTGCGGT-GGATTAA---TATTGACCCATTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATCAAAATGTCTCTTTTCCACCTAGT-GTCAT-TTCATTCGTGAAGTGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAATCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAACCGTTATTATTCGAGTTCTC--GTGACTTGCGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_torreyi_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACC--GGGGGCC-GAGGC---ACGATCGCAAGGTCGCT-CGTCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGATCTC-TCGGTTAGCCCGTTCGCGGTGCTAGTCGGGAGGGCCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-G-AGGGGGA------CGGACATTGGCCTCCCGTGTGCGTTAGTATGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTTTCTT---TCT-GTCATGTCA--TTCCGTCG-TTGCGGT-GGATTAA---TATTGACCCACTGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTACAAGCCTCTTCATTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACC--TCGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATCAAAATGTCTCTTTTCCACCTAGT-GTCAT-TTCATTCGTGAAGTGTTG-CGAGGTGGAACTCTAACG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--ACATCGTACGATCTCTTGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATCAATCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGTCGTAACCGTTATTATTCGAGTTCTC--GTGACTTGTGTGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_verna_1_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACAAATC--GGGGACC-GAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTAGCGGTGCTAGTGGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAACGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTCTCTTCTTTAC-GTCGTGCCA--TCTCGTCG-TTGCAAT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-TTTGCCTTGTCC-ACA--TCGATTTCCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTCA-AAACGTCCCTTTTCCACCAAGTCGGAAT-TTCACTCGTGAAACTCTAACGAGGTGGAACTCTAAAG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTCGAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCTTGATGCGGCTCCGACGTCGATGAGGAATGC Collinsia_verna_2 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACAAATC--GGGGACC-GAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTAGCGGTGCTAGTGGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATATCGATC--TCGAATC-GAACTGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGTGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTCTCTTCTTTAC-GTCGTGCCA--TCTCGTCG-TTGCAAT-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-TTTGCCTTGTCC-ACA--TCGATTTCCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTCA-AAACGTCCCTTTTCCACCAAGTCGGAAT-TTCACTCGTGAAACTCTAACGAGGTGGAACTCTAAAG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTCGAGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCTTGATGCGGCTCCGACGTCGATGAGGAATGC Collinsia_violacea_1 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACAAATC--GGGGACC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TCGATCGGCCCGTAAGCGGTGCCAGTCGCGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGCGCGGCCGGCCGAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTCTCTTCTTTAC-GTCGTGTCA--TCTCGTCG-CTGCAGC-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGA????????????????TCTCGTGCA-GCCTCTTCATTTAACGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TCGATTTCCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGAAT-TTCATTCGTGAAACTCTAACGAGGTGGAACTCTACAG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGCCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCTTGATGCGGCTCCGACGTCGATGAGGAATGC Collinsia_violacea_2 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACAAATC--GGGGACC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TCGATCGGCCCGTTAGCGGTGCCAGTCGCGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCGAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTCTCTTCTTTAC-GTCGTGTCA--TATCGTCG-CTGCAGC-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTAACGGAACAAGTGC--T-TTTGCCTTGTCC-AC{AG}--TCGATTTCCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGAAT-TTCATTCGTGAAACTCTAACGAGGTGGAACTCTAAAG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGCCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCTTGATGCGGCTCCGACGTCGATGAGGAATGC Collinsia_violacea_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAA{AG}CAAATC--GGGGACC-AAGGC-----------------TTT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGACCTC-TCGATCGGCCCGTTAGCGGTGCCAGTCGCGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCGATC--TCGAATC-GAAGGGGGG------CGGACATTGGCCTCCCGTGCGCGTCAGCGTGCGGCCGGCCGAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTCTCGACTCTCTTCTTTAC-GTCGTGTCA--TATCGTCG-CTGCAGC-GGATTAAA--TATTGACCCAACGGCTCACTTAGGTGAACTTTCGACCGGGCAGCGACAATATCTCGTGCAAGCCTCTTCATTTA-CGGAACAAGTGC--T-TTTGCCTTGTCC-AC{AG}--TCGATTTCCCTGTGTTGTATACCTGTTTCAAAGG-CATCCATTCGGTCC-AAACGTCCCTTTTCCACCAAGTCGGAAT-TTCATTCGTGAAACTCTAACGAGGTGGAACTCTAAAG--GCGATGGGCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCATGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCGGTACATGGCACTCGTGCCATTATTAGTCCCGTAA-GAGCGTTCTACGCTTCAAGCGAACGACCGCCGTAGCCGTTATTATTCGAGTCCTC--GTGACTTGCTTGATGCGGCTCCGACGTCGATGAGGAATGC Collinsia_wrightii_11 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGGG----CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTATAGT-GGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGTCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_wrightii_12 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGG-----CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTTGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGTCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_wrightii_1a_b TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGG-----CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATTGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGCCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTTGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_wrightii_2 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGGG----CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGA????????????????TCTCGTTCA-GCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATTGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGCCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTTGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_wrightii_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAA{AG}CATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGATC--TATGATC-GAAGGGGGGGG----CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCAATGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGTCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_wrightii_4_5_10 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGATC--TATGATC-GAAGGGGGGG-----CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCAATGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGTCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_wrightii_6 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGGGG---CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATTGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGCCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTTGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_wrightii_7 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGGGGG--CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGTCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_wrightii_8 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGG-----CGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTT{CT}T{CT}GTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATTGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGCCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTTGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Collinsia_wrightii_9 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATACT--GGGGACC-GAGGC---ATGATCGCAAGATCACT-CGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAA-AGAAGCATCGACCTC-TCGATTGGCCCGTTCGCGGTGCTAGTCGGGAGGACCCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCTCGACC--TATGATC-GAAGGGGGGGGGGGGCGGACATTGGCCTCCCGTGCGTGTTAGCGTGCGGCCGGCCCAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATTGACTTTCTT---CGC-GTCTTGTCA--TCCCGTCG-TTGCAGT-GGATTAA---TATTGACCCATTGGCTCACTTCGGTGAACTTTCGACCGGGCAGCGACAATTTCTCGTTCAAGCCTCTTCAGTTGTCGGAACAAGTGC--T-TTTGCCTTGTCC-ACG--TTGGATTTCCTGTGTTGTATACCTGTTGTAAAGG-CATCCATTCGGATGAAAAT-TCCCCATTCCACCTAGT-GTCAT-TTCATTCGTGAAATGTTG-CGAGGTGAAACTCTAACG--GCGATGGTCGTGTTTCCTCTTTCCCACACTATTGTGTTGGGTTCTTGGCCCACGC--TCATCGTACGATCTCTCGGGTTCGGAATACAATGTCTGTACATGGCACTCGTGCCATTATCAGTCTCATAA-GAGCGTTCTACGCTTCATGCGAACGACCGTCGTAGCCGTTATTATTCGAGTCCTC--GTGGCTTGCATGATGCGGTTCCGACGTCGATGAGGAATGC Keckiella_cordifolia TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTT--AAACA--TCTCGGGGGCC-GAGGCGCGAGGGTCGCGAGACCCCCGTGCCGAGG-CCCTCCGTCCGTGCGACGCTCGCGTCGTGCGGGCTAACTAA-CCCCGGCGCGGCATGCGCCAAGGAAAACTCAAAAAAGAATCACCGACCCC-CCG{AG}CTGCCCCGTTCGCGGTGCGCGTCGGGAGGACCCGGTGTATCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCTCAATCCCTCGGGTT-GACGGGGG-------CGGACATTGGCCTCCCGTGCGCGCGAGCGTGCGGCCGGCCCAAATGCAA-TCCCGCATCGACGGATGTCACGACCAGTGGTGGTTGAACCCTCAACTCGCG----TGCTGTCGTGCCGTGCTCCGTCGCTTGTCGT-GGAATCG---TATCGACCCAACGGC--GCA---ATGCGCTTTCGATCTGGCAGCGACAGCGTCCCGTGCTCGCCTT{CT}TCATTTGTT{AG}GCACAAGTG{CT}{AG}TG-TTTGCCTTGGCC-GC{AG}--TCG{AG}TTTTCCTGTGTTGTATACCTGTTGTGAAGG-CACTCTTTCGGATTAAAATGACCCTCTTCCACCAAGT-{AG}CTGC-TTCATTCGTGATGCGGCG-C{AG}AGGTGGAACCCCA-{CT}G--G{CT}GATCGGC{AG}TGT{CT}ACC{CT}CTTTCCCGCACATTTGTGACGG{AG}CGATTGGCCCA{CT}GCC-GTAT{CG}GTG{CT}GATCTCTCGGGTGCGGAATACATTGTGGGTACGTGGCCCTCGTGCCACTATTTGCCCCATAACAAG{AC}GTTCAACGCTTCACG{CT}GAATGAC{CT}GTCGGTGT{CT}GTGTTCAT-CGGGTCCTC--GCGGCTCGCATCATG{CT}GGCACC{AG}{AG}CGTCGGTGAGGAATGC Penstemon_hartwegii TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTT--AAACA--TCGAGGGGTCT--AGGAGCGAGGGTCGCAAGTCCCCCCTTCCGACGCCCCTCCGCCCGCGCGACGCTCGCGCCGTGCGGGCTAACTAA-CCCCGGCGCGGCATGCGCCAAGGAAAACTCAAAA-GGAAGCATCGGCCCC-CCGGCTGCCCCGTTCGCGGTGCGCGTC-GGAGGACCCGGTGTATCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ATCCCAATCCCTCGGGTTTGATGGGGG-------CGGACATTGGCCTCCCGTGAGCGCGAG{CG}GCGCGGCCGGCCCAAATGCAA-TCCCGCATCGACGGATGTCACGACCAGTGGTGGTTGAACCCTCAACTCGCG----TGCTGTCGTGCCTCGCTCCGTCGCTTGCCGT-GGAATCG---TATCGACCCAACGGC--GCTT--ACGCGCTTTCGATCGGGCAGCGACAACATCCCGTGCTCGCCTTTTCATTC-TTGGCACAAGTGCACG-TTTGCCTTGGCC-GCG--TCGGTTTTCCTGTGTTGCATACCTGCTGTGAAGG-CACTCTTTCGGATATAAATGACCCATTTCCACCAAGT-GCTGC-CTCTTTCGTGCGGTGGCG-CGAGGTGGAACCCCAAAT--GCGGTCGACGTGTTTCCTCTTTCCCGTTCATTAAAGACGGGCGATTGGCCCACGTTTGCATCGTGCGATCTCTCGGTTGCGGAGTATCATGTGGGTACGTGGC-CTTGTGCCTCTATTTGCCCCGTAACAAGCGTTCTACGCTTCACGCGAACGACCGTCGTTGTCGTTTTGAT-CGGGTCCTC--GCGGCTCGTACCATGCGGCACCGGCGTCGGTGAGGAATGC Tonella_floribunda_1_2 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATATT--GGGGACC-GAGGCTCGTTGGTCGAAAGATCACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTTAAAA-AGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCTCGTCGGGAGAAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ACCTCGATC--TCGAATC-GAATGGGGG------CGGACATTGGCCTCCCGTGCGCGTGAGTGCGCGGCCGGCCTAAATGCAAATCCCTCATGGACGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTT---CGC-GTCTTGATG--TCTCGTCT-TTGCGGT-GGATTCA---TATCGACCCATTGGCTCACTTAGGTGGGTTTTCGATCGGGCAGCGACAATATCTCGTGCAAGCCTTTTCATT-GTCGGAACAAGTGC--T-TTTGCCTTGTCC-TCA--TCGGATTTCCTGTGTTGTATACCTATTGTAAAGG-CATTCATTCGGATCAAAATGTCCCTTTTCCACCGAGT-GTCAT-TTCATTCGTGAAACGACA-TGAGGTGGAACTCCAACG--ACGATGTGTGTGTTTCCTCTTTCCCGCACAATTGTGCCGGGATCTTGGCCCACGC--ATATCGTACGATCTCTCGGGTTCGGAATACATTGTCGGTACATGGCACTCGTGCCACTATAAGTCCCGTAA-AAGCGTTCTACGCTTCGAGCGAACGACTGTCGTAGCCGTTATCATTCGAGTCCTC--GTGGCTTGACTGAAGCGGTTCCGGCGTCGATGAGGAATGC Tonella_tenella_1 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATATC--GGGGACC-GAGGCTCGTTGGTCGTAAGATCACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGACTGGCCCGTTCGCGGTGCTGGTCGGGAGAAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ACCTCGATC--TCGAATC-GAATGGGGG------CGGA-ATTGGCCTCCCGTGCGCGTGAGTGTGCGGCCGGCCTAAATGCAAATCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTT---CGC-GTCTTGACG--TCTCGTCT-TTGCGGT-GGATTCA---TATTGACCCATTGGCTCACTTAGGTGGGTTTTCGATCGGGCAGCGACAATATCTCGTGCAAGCCTTTTCATT-GTCGGAACAAGTGC--T-TTTGCCTTGTCC-TCA--TCGGATTTCCTGTGTTGTATACCTATTGTAAAGG-CATCCATTCGGTTTAAAATGTCCCTTTTCCACCGAGC-GTCAT-TTCATTCGTGAAACGATG-CGAGGTGGAACTCCAACG--ACGATGTGTGTGTTTCCTCTTTCCCTCACAATTGTGTTGGGATCTTGGCCCATGC--ATATCGTACGATCTCTCGGGTTCGGAATACAATTTCGGTACATGGCACTCGTGCCACTATAAGTCCCGTAA-AAGCGTTCTACGCTTCGAGCGAACGACTGTCGCAGCCGTTATCATTCGAGTCCTC--GTGGCTTGACTGATGCGGTTCCGGCGTCGATGAGGAATGC Tonella_tenella_2 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATATC--GGGGACC-GAGGCTCGTTGGTCGTAAGATCACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGACTGGCCCGTTCGCGGTGCTGGTCTGGAGAAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ACCTCGATC--TCGAATC-GAATGGGGG------CGGA-ATTGGCCTCCCGTGCGCGTGAGTGTGCGGCCGGCCTAAATGCAAATCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTT---CGC-GTCTTGACG--TCTCGTCT-TTGCGGT-GGATTCA---TATTGACCCATTGGCTCACTTAGGTGGGTTTTCGATCGGGCAGCGACAATATCTCGTGCAAGCCTTTTCATT-GTCGGAACAAGTGC--T-TTTGCCTTGTCC-TCA--TCGGATTTCCTGTGTTGTATACCTATTGTAAAGG-CATCCATTCGGTTTAAAATGTCCCTTTTCCACCGAGC-GTCAT-TTCATTCGTGAAACGATG-CGAGGTGGAACTCCAACG--ACGATGTGTGTGTTTCCTCTTTCCCTCACAATTGTGTTGGGATCTTGGCCCATGC--ATATCGTACGATCTCTCGGGTTCGGAATACAATTTCGGTACATGGCACTCGTGCCACTATAAGTCCCGTAA-AAGCGTTCTACGCTTCGAGCGAACGACTGTCGCAGCCGTTATCATTCGAGTCCTC--GTGGCTTGACTGATGCGGTTCCGGCGTCGATGAGGAATGC Tonella_tenella_3 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATATC--GGGGACC-GAGGCTCGTTGGTCGTAAGATCACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGACTGGCCCGTTCGCGGTGCTGGTCGGGAGAAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ACCTCGATC--TCGAATC-GAATGGGGG------CGGACATTGGCCTCCCGTGCGCGTGAGTGTGCGGCCGGCCTAAATGCAAATCCCTCATCGACGGATGTCACGACTAGTGGTGGTTG--TTATCGACTTTCTT---CGC-GTCTTGACG--TCTCGTCT-TTGCGGT-GGATTCA---TATTGACCCATTGGCTCACTTAGGTGGGTTTTCGATCGGGCAGCGACAATATCTCGTGCAAGCCTTTTCATT-GTCGGAACAAGTGC--T-TTTGCCTTGTCC-TCA--TCGGATTTCCTGTGTTGTATACCTATTGTAAAGG-CATCCATTCGGTTTAAAATGTCCCTTTTCCACCGAGC-GTCAT-TTCATTCGTGAAACGATG-CGAGGTGGAACTCCAACG--ACGATGTGTGTGTTTCCTCTTTCCCTCACAATTGTGTTGGGATCTTGGCCCATGC--ATATCGTACGATCTCTCGGGTTCGGAATACAATTTCGGTACATGGCACTCGTGCCACTATAAGTCCCGTAA-AAGCGTTCTACGCTTCGAGCGAACGACTGTCGCAGCCGTTATCATTCGAGTCCTC--GTGGCTTGACTGATGCGGTTCCGGCGTCGATGAGGAATGC Tonella_tenella_4 TCGAAACCTGCAAAGCAGACCCGCGAACAC--GTTTACAAACATATC--GGGGACC-GAGGCTCGTTGGTCGTAAGATCACT-TGCCGAGG-CCCT-----------------------------CTAACTAAACCCCGGCGCGGAAAGTGCCAAGGAAAACTAAAAA-AGAAGCATCGATCTC-TCGATTGGCCCGTTCGCGGTGCTGGTCGGGAGAAACCGATGTGTCTTGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ACCTCGATC--TCGAATC-GAATGGGGG------CGGACATTGGCCTCCCGTGCGCGTGAGTGTGCGGCCGGCCTAAATGCAAATCCCTCATCGATGGATGTCACGACTAGTGGTGGTTG--TTATCGACTCTCTT---CGC-GTCTTGACG--TCTCGTCT-TTGCGGT-GGATTCA---TATTGACCCATTGGCTCACTTAGGTGGGTTTTCGATCGGGCAGCGACAATATCTCGTGCAAGCCTTTTCATT-GTTGGAACAAGTGC--T-TTTGCCTTGTCC-TCA--TCGGATTTCCTGTGTTGTATACCTATTGTAAAGG-CATCCATTCGGTTAAAAATGTCCCTTTTCCACTGAGT-CTCAT-TTCATTCGTGAAACGATG-CGAGGTGGAACTCCAAGG--ACGATGTGTGTGTTTCCTCTTTCCCTCACAATTGTGTTGGGATCTTGGCCCATGC--ATATCGTACGATCTCTCGGGTTCGGAATATAATTTCGGTACATGGCACTCGTGCCACTATAAGTCCCGTAA-AAGCGTTCAACGCTTCGAGCGAACGACTGTCGCAGCTGTTATCATTCGAGTCCTC--GTGGCTTGACTGAGGCGGTTTCGGCGTCGATGAGGAATGC ; END; BEGIN TREES; TITLE MCC_tree_Collinsia_all_partitions; LINK TAXA = Taxa1; TRANSLATE 1 Keckiella_cordifolia, 2 Tonella_tenella_4, 3 Tonella_floribunda_2, 4 Collinsia_torreyi_3, 5 Collinsia_wrightii_12, 6 Collinsia_rattanii_3, 7 Collinsia_linearis_14, 8 Collinsia_parviflora_12, 9 Collinsia_grandiflora_4, 10 Collinsia_verna_3, 11 Collinsia_violacea_2, 12 Collinsia_callosa_3, 13 Collinsia_childii_3, 14 Collinsia_metamorphica_7, 15 Collinsia_bartsiifolia_var_bartsiifolia_2, 16 Collinsia_corymbosa_4, 17 Collinsia_tinctoria_1_ETS_clones1_5_6_8_10_11_12, 18 Collinsia_tinctoria_1_ETS_clone2, 19 Collinsia_tinctoria_1_ETS_clone3, 20 Collinsia_tinctoria_1_ETS_clones4_9, 21 Collinsia_tinctoria_1_ETS_clone7, 22 Collinsia_greenei_3, 23 Collinsia_sparsiflora_var_collina_1, 24 Collinsia_sparsiflora_var_sparsiflora_4_5, 25 Collinsia_multicolor_2, 26 Collinsia_antonina_2, 27 Collinsia_concolor_2_Collinsia_parryi_1, 28 Collinsia_heterophylla_21_CYC1_clone_D3P1, 29 Collinsia_heterophylla_21_CYC1_clones_D3_D4; TREE TREE1 = [&R] (((2:4.996895981706,3:4.996895981706):10.00310401829,((6:1.451951778605,7:1.451951778605):10.26138086912,((((13:5.171665867959,12:5.171665867959):1.637654648318,(14:5.598717335587,(((23:0.2134580887397,24:0.2134580887397):3.390094740589,22:3.603552829329):1.231609447495,((((26:2.117624796378,27:2.117624796378):0.6663185465433,(28:1.042285409577,29:1.042285409577):1.741657933344):0.7825584841126,25:3.566501827034):0.4688112287162,(((19:0.2480995120404,20:0.2480995120404):0.2296564329948,(21:0.1950378973763,(17:0.02519311244086,18:0.02519311244086):0.1698447849354):0.2827180476589):2.834882436462,(16:1.429646587749,15:1.429646587749):1.882991793749):0.722674674253):0.7998492210736):0.7635550587628):1.21060318069):3.541530977802,(4:6.053899523064,5:6.053899523064):4.296951971014):0.5348201248631,((8:1.477658641864,9:1.477658641864):4.725628023373,(10:3.620054971857,11:3.620054971857):2.583231693379):4.682384953705):0.8276610287842):3.286667352274):3.698816276383,1:18.69881627638); END; BEGIN TREES; TITLE 50%_MajRuleCons_Collinsia_nrDNA; LINK TAXA = Taxa5; TRANSLATE 1 Penstemon_hartwegii, 2 Chelone_glabra, 3 Keckiella_cordifolia, 4 Tonella_tenella_1, 5 Tonella_tenella_4, 6 Tonella_tenella_2, 7 Tonella_tenella_3, 8 Tonella_floribunda_1_2, 9 Collinsia_torreyi_1a_2_4, 10 Collinsia_torreyi_3, 11 Collinsia_torreyi_1b, 12 Collinsia_wrightii_1a_b, 13 Collinsia_wrightii_12, 14 Collinsia_wrightii_2, 15 Collinsia_wrightii_9, 16 Collinsia_wrightii_7, 17 Collinsia_wrightii_8, 18 Collinsia_wrightii_3, 19 Collinsia_wrightii_4_5_10, 20 Collinsia_wrightii_11, 21 Collinsia_wrightii_6, 22 Collinsia_latifolia_1, 23 Collinsia_latifolia_3_4, 24 Collinsia_latifolia_2, 25 Collinsia_rattanii_3, 26 Collinsia_rattanii_7_8, 27 Collinsia_rattanii_9, 28 Collinsia_rattanii_1_2_4, 29 Collinsia_rattanii_6, 30 Collinsia_linearis_11, 31 Collinsia_linearis_15to18, 32 Collinsia_linearis_20, 33 Collinsia_linearis_19, 34 Collinsia_linearis_1_4, 35 Collinsia_linearis_3_5_12, 36 Collinsia_linearis_6a, 37 Collinsia_linearis_6b, 38 Collinsia_linearis_2, 39 Collinsia_linearis_7, 40 Collinsia_linearis_9, 41 Collinsia_linearis_8, 42 Collinsia_linearis_10, 43 Collinsia_linearis_14, 44 Collinsia_linearis_13, 45 Collinsia_parviflora_4, 46 Collinsia_parviflora_5, 47 Collinsia_parviflora_11, 48 Collinsia_parviflora_1_2_6_7_Collinsia_grandiflora_6, 49 Collinsia_parviflora_12, 50 Collinsia_parviflora_3, 51 Collinsia_parviflora_8, 52 Collinsia_parviflora_14, 53 Collinsia_parviflora_13, 54 Collinsia_parviflora_9, 55 Collinsia_parviflora_10a, 56 Collinsia_parviflora_10b, 57 Collinsia_grandiflora_1_2a, 58 Collinsia_grandiflora_3_5, 59 Collinsia_grandiflora_4, 60 Collinsia_grandiflora_2b, 61 Collinsia_verna_1_3, 62 Collinsia_verna_2, 63 Collinsia_violacea_3, 64 Collinsia_violacea_2, 65 Collinsia_violacea_1, 66 Collinsia_callosa_1, 67 Collinsia_callosa_3, 68 Collinsia_callosa_2, 69 Collinsia_childii_1, 70 Collinsia_childii_6, 71 Collinsia_childii_2, 72 Collinsia_childii_5, 73 Collinsia_childii_4, 74 Collinsia_childii_3, 75 Collinsia_metamorphica_1_2_6, 76 Collinsia_metamorphica_3_4, 77 Collinsia_metamorphica_7, 78 Collinsia_metamorphica_8, 79 Collinsia_metamorphica_5, 80 Collinsia_bartsiifolia_var_bartsiifolia_1, 81 Collinsia_bartsiifolia_var_davidsonii_2to4, 82 Collinsia_bartsiifolia_var_bartsiifolia_2_3, 83 Collinsia_bartsiifolia_var_davidsonii_1_5, 84 Collinsia_corymbosa_1_2_3a_3b, 85 Collinsia_tinctoria_6, 86 Collinsia_tinctoria_2, 87 Collinsia_tinctoria_3, 88 Collinsia_tinctoria_7, 89 Collinsia_tinctoria_1_ETSclones1_5_6_8_10_11_12, 90 Collinsia_tinctoria_1_ETSclone2, 91 Collinsia_tinctoria_1_ETSclone3, 92 Collinsia_tinctoria_1_ETSclones4_9, 93 Collinsia_tinctoria_1_ETSclone7, 94 Collinsia_tinctoria_8_ITSclones1_4_7_8_9_12, 95 Collinsia_tinctoria_8_ITSclones2_10, 96 Collinsia_tinctoria_8_ITSclone3, 97 Collinsia_tinctoria_8_ITSclone5, 98 Collinsia_tinctoria_8_ITSclone6, 99 Collinsia_tinctoria_8_ITSclone11, 100 Collinsia_tinctoria_4_ITS_clone1, 101 Collinsia_tinctoria_4_ITS_clones2_3_7_10, 102 Collinsia_tinctoria_4_ITS_clones4_6_8_9_11, 103 Collinsia_tinctoria_4_ITS_clone5, 104 Collinsia_tinctoria_4_ITS_clone12, 105 Collinsia_greenei_1_2_4, 106 Collinsia_greenei_3, 107 Collinsia_sparsiflora_var_collina_1, 108 Collinsia_sparsiflora_var_sparsiflora_1to5_9to12_15_16_18_20_var_collina_3, 109 Collinsia_sparsiflora_var_sparsiflora_6_7_13_14, 110 Collinsia_sparsiflora_var_sparsiflora_19, 111 Collinsia_sparsiflora_var_sparsiflora_17, 112 Collinsia_sparsiflora_var_collina_2, 113 Collinsia_sparsiflora_var_sparsiflora_8, 114 Collinsia_sparsiflora_var_collina_4, 115 Collinsia_sparsiflora_var_collina_5, 116 Collinsia_multicolor_1_2, 117 Collinsia_antonina_1, 118 Collinsia_antonina_2, 119 Collinsia_antonina_3, 120 Collinsia_concolor_1a_2to5_Collinsia_parryi_1_2, 121 Collinsia_concolor_1b, 122 Collinsia_heterophylla_4_5, 123 Collinsia_heterophylla_17, 124 Collinsia_heterophylla_1, 125 Collinsia_heterophylla_10, 126 Collinsia_heterophylla_6_11_19, 127 Collinsia_heterophylla_21, 128 Collinsia_heterophylla_7, 129 Collinsia_heterophylla_12_13, 130 Collinsia_heterophylla_12_14, 131 Collinsia_heterophylla_3, 132 Collinsia_heterophylla_2a_b, 133 Collinsia_heterophylla_15, 134 Collinsia_heterophylla_16, 135 Collinsia_heterophylla_8, 136 Collinsia_heterophylla_9, 137 Collinsia_heterophylla_18_ITSclones2_12, 138 Collinsia_heterophylla_18_ITSclone11, 139 Collinsia_heterophylla_18_ITSclone6; TREE con_50_majrule = [&R] (1:0.603561,2:0.710093,(3:0.522438,((((4:0.021371,6:0.043636,7:0.043249)0.95:0.067493,5:0.286801)1.00:0.152875,8:0.386531)1.00:0.67012,((((9:0.022568,10:0.042614)0.76:0.039699,11:0.02931)1.00:0.571901,((((12:0.020509,14:0.021192,17:0.02116,21:0.021077)1.00:0.084568,13:0.042124,15:0.02137,16:0.020617,20:0.064071)0.70:0.044463,(18:0.020401,19:0.020221)0.92:0.049043)1.00:0.599421,((22:0.023004,24:0.043798)1.00:0.092129,23:0.26009)1.00:0.241031)0.55:0.086495)0.99:0.194632,((((25:0.063698,((26:0.021589,27:0.043399)0.94:0.0434,29:0.047564)0.80:0.043382,28:0.021595,32:0.034958,43:0.021213)0.50:0.043277,(31:0.035165,44:0.021692)0.66:0.048798,33:0.039247)1.00:0.405752,((30:0.021937,34:0.021825,35:0.021311,36:0.021475,37:0.021565,38:0.107851,40:0.022008,41:0.04004,42:0.043958)0.52:0.041629,39:0.022611)1.00:0.289211)1.00:0.909251,(((45:0.061421,46:0.044248,47:0.021247,(48:0.021397,52:0.087896)0.75:0.053757,49:0.021747,((50:0.021063,54:0.038131)0.89:0.066905,55:0.021749,56:0.021307,((57:0.022361,60:0.042851)1.00:0.043344,58:0.020795,59:0.04287)1.00:0.064915)0.93:0.04267,51:0.107693,53:0.042617)1.00:0.512074,((61:0.022446,62:0.065115)1.00:0.227044,((63:0.021233,64:0.022264)0.97:0.043359,65:0.095606)1.00:0.1919)1.00:0.299045)1.00:0.398342,(((66:0.087933,67:0.022978,68:0.042469)1.00:0.422684,(((((80:0.03277,(81:0.03254,(82:0.044201,83:0.021745)0.76:0.040248)0.51:0.044768,84:0.064533,(85:0.022389,(86:0.021925,87:0.022292,88:0.042316,94:0.06599,(95:0.044879,(100:0.022338,101:0.065864)1.00:0.045561)0.81:0.041899,98:0.021951,102:0.021946)0.86:0.043369,(89:0.022678,90:0.044049,((91:0.045094,(((((122:0.092648,132:0.047259)0.85:0.044453,((123:0.035199,124:0.022212,125:0.029559,126:0.026601)0.61:0.037593,135:0.066914)1.00:0.064199,128:0.021608,136:0.022382,137:0.043773,138:0.064688)1.00:0.065971,139:0.087714)1.00:0.083772,127:0.045028,130:0.022153,131:0.062284)0.59:0.046591,(129:0.022401,(133:0.042437,134:0.023513)0.90:0.043664)0.51:0.036076)1.00:0.264254)0.98:0.080035,92:0.032818)1.00:0.126003,93:0.057297,(96:0.022064,97:0.110342,99:0.067502,(103:0.022371,104:0.065514)1.00:0.087378)1.00:0.21831)0.97:0.131038)0.88:0.088827)0.90:0.110102,((117:0.022614,118:0.065782,119:0.044007)1.00:0.135128,(120:0.043778,121:0.023048)1.00:0.177687)0.91:0.062894)0.93:0.062773,116:0.277073)1.00:0.175309,(((107:0.044142,108:0.02185,109:0.044368,110:0.043248,111:0.065869,113:0.06608,115:0.021979)0.90:0.044868,112:0.024315)0.85:0.044691,114:0.026439)1.00:0.66912)0.89:0.110792,(105:0.044731,106:0.044683)1.00:0.560337)0.92:0.136571)0.99:0.158488,((69:0.020915,((70:0.067435,73:0.022425)0.98:0.045111,74:0.045222)0.96:0.044915,71:0.087237,72:0.046273)1.00:0.079455,(75:0.02207,76:0.049709,(77:0.044248,78:0.045115)1.00:0.065767,79:0.022363)0.98:0.085784)1.00:0.230478)1.00:0.361937)0.92:0.116165)0.99:0.158476)1.00:0.472968)1.00:2.797749)1.00:0.572135); END; BEGIN TREES; TITLE 50%_MajRuleCons_Collinsia_nrDNA_cpDNA; LINK TAXA = Taxa4; TRANSLATE 1 Penstemon_hartwegii, 2 Chelone_glabra, 3 Keckiella_cordifolia, 4 Tonella_tenella_1, 5 Tonella_tenella_4, 6 Tonella_tenella_2, 7 Tonella_tenella_3, 8 Tonella_floribunda_1_2, 9 Collinsia_torreyi_1a_2_4, 10 Collinsia_torreyi_3, 11 Collinsia_torreyi_1b, 12 Collinsia_wrightii_1a_b, 13 Collinsia_wrightii_12, 14 Collinsia_wrightii_2, 15 Collinsia_wrightii_9, 16 Collinsia_wrightii_7, 17 Collinsia_wrightii_8, 18 Collinsia_wrightii_3, 19 Collinsia_wrightii_5, 20 Collinsia_wrightii_4_10, 21 Collinsia_wrightii_11, 22 Collinsia_wrightii_6, 23 Collinsia_latifolia_1, 24 Collinsia_latifolia_3_4, 25 Collinsia_latifolia_2, 26 Collinsia_rattanii_3, 27 Collinsia_rattanii_4, 28 Collinsia_rattanii_7_8, 29 Collinsia_rattanii_9, 30 Collinsia_rattanii_1, 31 Collinsia_rattanii_2, 32 Collinsia_rattanii_6, 33 Collinsia_linearis_11, 34 Collinsia_linearis_15to18, 35 Collinsia_linearis_20, 36 Collinsia_linearis_19, 37 Collinsia_linearis_1_4, 38 Collinsia_linearis_3_5_12, 39 Collinsia_linearis_6a, 40 Collinsia_linearis_6b, 41 Collinsia_linearis_2, 42 Collinsia_linearis_7, 43 Collinsia_linearis_9, 44 Collinsia_linearis_8, 45 Collinsia_linearis_10, 46 Collinsia_linearis_14, 47 Collinsia_linearis_13, 48 Collinsia_parviflora_4, 49 Collinsia_parviflora_5, 50 Collinsia_parviflora_11, 51 Collinsia_parviflora_1_2_6_7_Collinsia_grandiflora_6, 52 Collinsia_parviflora_12, 53 Collinsia_parviflora_3, 54 Collinsia_parviflora_8, 55 Collinsia_parviflora_14, 56 Collinsia_parviflora_13, 57 Collinsia_parviflora_9, 58 Collinsia_parviflora_10a, 59 Collinsia_parviflora_10b, 60 Collinsia_grandiflora_1_2a, 61 Collinsia_grandiflora_3_5, 62 Collinsia_grandiflora_4, 63 Collinsia_grandiflora_2b, 64 Collinsia_verna_1_3, 65 Collinsia_verna_2, 66 Collinsia_violacea_3, 67 Collinsia_violacea_2, 68 Collinsia_violacea_1, 69 Collinsia_callosa_1, 70 Collinsia_callosa_3, 71 Collinsia_callosa_2, 72 Collinsia_childii_1, 73 Collinsia_childii_6, 74 Collinsia_childii_2, 75 Collinsia_childii_5, 76 Collinsia_childii_4, 77 Collinsia_childii_3, 78 Collinsia_metamorphica_1_2, 79 Collinsia_metamorphica_3_4, 80 Collinsia_metamorphica_7, 81 Collinsia_metamorphica_8, 82 Collinsia_metamorphica_6, 83 Collinsia_metamorphica_5, 84 Collinsia_bartsiifolia_var_bartsiifolia_1, 85 Collinsia_bartsiifolia_var_davidsonii_B2to4, 86 Collinsia_bartsiifolia_var_bartsiifolia_2_3, 87 Collinsia_bartsiifolia_var_davidsonii_B1_5, 88 Collinsia_corymbosa_1_2_3a_3b, 89 Collinsia_tinctoria_6, 90 Collinsia_tinctoria_2, 91 Collinsia_tinctoria_3, 92 Collinsia_tinctoria_7, 93 Collinsia_tinctoria_1_ETS_clones1_5_6_8_10to12, 94 Collinsia_tinctoria_1_ETS_clone2, 95 Collinsia_tinctoria_1_ETS_clone3, 96 Collinsia_tinctoria_1_ETS_clones4_9, 97 Collinsia_tinctoria_1_ETS_clone7, 98 Collinsia_tinctoria_8_ITS_clones1_4_7to9_12, 99 Collinsia_tinctoria_8_ITS_clones2_10, 100 Collinsia_tinctoria_8_ITS_clone3, 101 Collinsia_tinctoria_8_ITS_clone5, 102 Collinsia_tinctoria_8_ITS_clone6, 103 Collinsia_tinctoria_8_ITS_clone11, 104 Collinsia_tinctoria_4_ITS_clone1, 105 Collinsia_tinctoria_4_ITS_clones2_3_7_10, 106 Collinsia_tinctoria_4_ITS_clones4_6_8_9_11, 107 Collinsia_tinctoria_4_ITS_clone5, 108 Collinsia_tinctoria_4_ITS_clone12, 109 Collinsia_greenei_1_2_4, 110 Collinsia_greenei_3, 111 Collinsia_sparsiflora_var_collina_1, 112 Collinsia_sparsiflora_var_sparsiflora_1to5_10_16_18_20_var_collina_3, 113 Collinsia_sparsiflora_var_sparsiflora_6_14, 114 Collinsia_sparsiflora_var_sparsiflora_19, 115 Collinsia_sparsiflora_var_sparsiflora_17, 116 Collinsia_sparsiflora_var_collina_2, 117 Collinsia_sparsiflora_var_sparsiflora_9_11, 118 Collinsia_sparsiflora_var_sparsiflora_12_15, 119 Collinsia_sparsiflora_var_sparsiflora_7_13, 120 Collinsia_sparsiflora_var_sparsiflora_8, 121 Collinsia_sparsiflora_var_collina_4, 122 Collinsia_sparsiflora_var_collina_5, 123 Collinsia_multicolor_1_2, 124 Collinsia_antonina_1, 125 Collinsia_antonina_2, 126 Collinsia_antonina_3, 127 Collinsia_concolor_1a_2_4_5_Collinsia_parryi_1_2, 128 Collinsia_concolor_1b, 129 Collinsia_concolor_3, 130 Collinsia_heterophylla_4_5, 131 Collinsia_heterophylla_17, 132 Collinsia_heterophylla_1, 133 Collinsia_heterophylla_10, 134 Collinsia_heterophylla_6_11, 135 Collinsia_heterophylla_21, 136 Collinsia_heterophylla_7, 137 Collinsia_heterophylla_12_13, 138 Collinsia_heterophylla_20_14, 139 Collinsia_heterophylla_3, 140 Collinsia_heterophylla_2a_b, 141 Collinsia_heterophylla_19, 142 Collinsia_heterophylla_15, 143 Collinsia_heterophylla_16, 144 Collinsia_heterophylla_8, 145 Collinsia_heterophylla_9, 146 Collinsia_heterophylla_18_ITS_clones2_12, 147 Collinsia_heterophylla_18_ITS_clone11, 148 Collinsia_heterophylla_18_ITS_clone6; TREE con_50_majrule = [&R] (1:0.672804,2:0.675795,(3:0.509743,((((4:0.037764,6:0.03833,7:0.038251)0.96:0.060737,5:0.27706)0.99:0.128979,8:0.3954)1.00:0.595067,((((9:0.018753,10:0.037594)0.77:0.035249,11:0.025253)1.00:0.591309,(((((12:0.015268,(14:0.01548,22:0.014931)0.99:0.029945,17:0.015464)1.00:0.061041,13:0.030668,15:0.030114)0.55:0.02737,16:0.023376)1.00:0.157864,((18:0.018893,19:0.036948,20:0.018774)0.97:0.051967,21:0.059593)1.00:0.166561)1.00:0.690114,((23:0.058097,25:0.038272)1.00:0.081766,24:0.246758)1.00:0.276331)0.66:0.080952)1.00:0.246971,(((26:0.077315,(27:0.03828,((28:0.01923,29:0.038119)0.99:0.039093,32:0.040094)0.95:0.038635,30:0.018862,((34:0.027232,47:0.015731)0.97:0.040953,36:0.038435)0.61:0.038423,35:0.030905)1.00:0.058032,31:0.038141,46:0.019467)1.00:0.380747,(33:0.039461,(37:0.019353,(38:0.01935,45:0.037987)0.65:0.034328,39:0.019382,40:0.01998)1.00:0.058446,41:0.112183,42:0.039634,43:0.019827,44:0.057182)1.00:0.274773)1.00:0.999278,(((((48:0.054355,49:0.039162,50:0.018949,(51:0.019245,55:0.075598)0.74:0.048458,52:0.019459,54:0.096897,56:0.038715)0.93:0.056464,((60:0.018977,63:0.038596)0.99:0.038358,61:0.019394,62:0.038422)1.00:0.080848)0.98:0.077672,(53:0.019363,57:0.034221)0.88:0.059327,58:0.019663,59:0.019813)1.00:0.581454,((64:0.019199,65:0.058026)1.00:0.264091,((66:0.018365,67:0.018714)0.97:0.03837,68:0.083468)1.00:0.183254)1.00:0.390986)1.00:0.36557,(((69:0.077705,70:0.019367,71:0.037748)1.00:0.492935,(((((((84:0.029032,(85:0.029667,(86:0.03908,87:0.019542)0.68:0.03451)0.51:0.038807)0.63:0.033439,88:0.058678)1.00:0.122748,(89:0.019892,((90:0.038901,91:0.038728,(98:0.059459,99:0.057934,102:0.020034)0.87:0.038922,(104:0.01891,105:0.058291)1.00:0.055823,106:0.019514)0.66:0.038262,((93:0.019967,94:0.039529,(95:0.098241,96:0.021927)1.00:0.120215,97:0.058614)0.94:0.047792,((100:0.019663,101:0.098896,103:0.059536)0.90:0.039306,(107:0.020217,108:0.058133)1.00:0.080341)1.00:0.194503)1.00:0.118023)0.50:0.031563)0.97:0.092215)0.85:0.096161,((92:0.181343,(((((130:0.080799,140:0.040727)0.88:0.039023,(((131:0.033484,133:0.026952)0.54:0.037002,132:0.038568,134:0.019127,141:0.039561)0.63:0.033359,144:0.059111)1.00:0.057917,136:0.019412,145:0.019561,146:0.038739,147:0.05692)1.00:0.05935,148:0.075107)1.00:0.078532,135:0.038539,138:0.018787,139:0.052478)0.80:0.040712,137:0.019352,(142:0.037092,143:0.029101)0.95:0.05136)1.00:0.317902)0.79:0.088667,((124:0.019611,126:0.039149)0.99:0.038532,125:0.05865)1.00:0.169426,((127:0.019748,129:0.038571)0.99:0.038952,128:0.019706)1.00:0.206596)0.90:0.181023)0.82:0.069737,123:0.262674)0.87:0.162504,(((111:0.039221,112:0.01888,(113:0.030165,119:0.038069)0.52:0.03886,114:0.038275,115:0.078659,117:0.038572,(118:0.019827,120:0.059185)0.61:0.033017,122:0.057568)0.89:0.038819,116:0.02)0.86:0.03828,121:0.022343)1.00:0.569913)0.64:0.099767,(109:0.03653,110:0.038024)1.00:0.54042)1.00:0.290402)0.98:0.136993,((72:0.019256,((73:0.058936,76:0.020585)0.98:0.03913,77:0.038841)0.96:0.039064,74:0.097931,75:0.039376)1.00:0.152052,(((78:0.019575,(80:0.039301,81:0.038884)1.00:0.097338)0.64:0.033952,79:0.055282,83:0.019641)0.52:0.038987,82:0.030298)1.00:0.243653)0.99:0.162945)1.00:0.456278)0.66:0.1072)0.67:0.124178)1.00:0.506492)1.00:2.854651)1.00:0.499428); END; BEGIN TREES; TITLE 50%_MajRuleCons_Collinsia_cpDNA; LINK TAXA = Taxa3; TRANSLATE 1 Penstemon_hartwegii, 2 Chelone_glabra, 3 Keckiella_cordifolia, 4 Tonella_tenella_1, 5 Tonella_tenella_4, 6 Tonella_tenella_2_3, 7 Tonella_floribunda_1_2, 8 Collinsia_torreyi_1to4, 9 Collinsia_wrightii_1a_b_12, 10 Collinsia_wrightii_2_6, 11 Collinsia_wrightii_9, 12 Collinsia_wrightii_7, 13 Collinsia_wrightii_8, 14 Collinsia_wrightii_3_4_10_11, 15 Collinsia_wrightii_5, 16 Collinsia_latifolia_1, 17 Collinsia_latifolia_3_4, 18 Collinsia_latifolia_2, 19 Collinsia_rattanii_3_Collinsia_linearis_11, 20 Collinsia_rattanii_4, 21 Collinsia_rattanii_1_6to9_Collinsia_linearis_1_3to5_6_10_12_15to18_20, 22 Collinsia_rattanii_2_Collinsia_linearis_7, 23 Collinsia_linearis_13_19, 24 Collinsia_linearis_2_9_14, 25 Collinsia_linearis_8, 26 Collinsia_parviflora_1_2_4to8_11to14_Collinsia_grandiflora_6, 27 Collinsia_parviflora_3_9_10, 28 Collinsia_grandiflora_1to5, 29 Collinsia_verna_1to3, 30 Collinsia_violacea_1to3, 31 Collinsia_callosa_1to3, 32 Collinsia_childii_1_3to6, 33 Collinsia_childii_2, 34 Collinsia_metamorphica_1_2, 35 Collinsia_metamorphica_3to5, 36 Collinsia_metamorphica_7_8, 37 Collinsia_metamorphica_6, 38 Collinsia_bartsiifolia_var_bartsiifolia_1to3_var_davidsonii_1to5_Collinsia_corymbosa_1to3, 39 Collinsia_tinctoria_5_6, 40 Collinsia_tinctoria_2, 41 Collinsia_tinctoria_3, 42 Collinsia_heterophylla_2to8_10to14_17_18_21_Collinsia_tinctoria_7, 43 Collinsia_tinctoria_1, 44 Collinsia_tinctoria_8, 45 Collinsia_tinctoria_4, 46 Collinsia_greenei_1to4, 47 Collinsia_sparsiflora_var_sparsiflora_1to6_10_14_16_18to20, 48 Collinsia_sparsiflora_var_sparsiflora_17, 49 Collinsia_sparsiflora_var_sparsiflora_9_11, 50 Collinsia_sparsiflora_var_sparsiflora_7_8_12_13_15, 51 Collinsia_sparsiflora_var_collina_5, 52 Collinsia_multicolor_1_2, 53 Collinsia_antonina_1_3, 54 Collinsia_antonina_2, 55 Collinsia_concolor_1_2_4_5_Collinsia_parryi_1_2, 56 Collinsia_concolor_3, 57 Collinsia_heterophylla_1, 58 Collinsia_heterophylla_19, 59 Collinsia_heterophylla_15, 60 Collinsia_heterophylla_16, 61 Collinsia_heterophylla_9; TREE con_50_majrule = [&R] (1:0.317355,2:0.162255,(3:0.158244,(((4:0.076243,5:0.075773,6:0.03836,7:0.119033)0.83:0.077973,(((8:0.226629,(16:0.117226,17:0.076063,18:0.03907)1.00:0.153392)0.53:0.077936,(((9:0.025808,10:0.052316,11:0.051868,12:0.042848,13:0.026165)1.00:0.274596,(14:0.070776,15:0.036539)1.00:0.355337)1.00:0.272562,((26:0.064502,28:0.094194)1.00:0.157749,27:0.05436)1.00:0.185295)0.96:0.142185)0.87:0.100908,((19:0.076863,(20:0.075795,21:0.037461,23:0.038285)1.00:0.116407,22:0.07652,24:0.039565,25:0.077538)1.00:0.364926,(29:0.149625,30:0.074612)1.00:0.243932)0.63:0.070683)1.00:0.204465)0.69:0.091372,(((31:0.195716,((32:0.037725,33:0.075689)1.00:0.11507,(42:0.037765,57:0.07606,58:0.074847,59:0.03913,60:0.072184,61:0.037684)1.00:0.115037,(53:0.075191,54:0.037836)1.00:0.115426)0.90:0.076754)0.65:0.070522,(55:0.038081,56:0.076515)0.98:0.088154)0.85:0.111252,((34:0.037768,(35:0.038823,37:0.077345)0.93:0.076452,36:0.116026)1.00:0.160116,(38:0.231674,(39:0.038262,40:0.076835,41:0.075895,43:0.075306,44:0.075906,45:0.037468)0.92:0.076218,46:0.113257,47:0.038205,48:0.075701,49:0.074613,50:0.076843,51:0.112792,52:0.075069)0.98:0.152587)1.00:0.185529)0.99:0.162394)1.00:0.850323)0.81:0.077624); END; BEGIN TREES; TITLE 50%_MajRuleCons_Collinsia_CYC1; LINK TAXA = Taxa2; TRANSLATE 1 Penstemon_hartwegii, 2 Chelone_glabra, 3 Keckiella_cordifolia, 4 Tonella_tenella_4, 5 Tonella_floribunda_2_clone1_2, 6 Tonella_floribunda_2_clone3_4, 7 Collinsia_torreyi_3, 8 Collinsia_wrightii_12, 9 Collinsia_rattanii_3, 10 Collinsia_rattanii_8, 11 Collinsia_linearis_14, 12 Collinsia_parviflora_12, 13 Collinsia_grandiflora_4, 14 Collinsia_verna_3, 15 Collinsia_violacea_2, 16 Collinsia_callosa_2, 17 Collinsia_callosa_1, 18 Collinsia_childii_3, 19 Collinsia_childii_6_clone1, 20 Collinsia_childii_6_clone2, 21 Collinsia_childii_6_clone4, 22 Collinsia_metamorphica_7, 23 Collinsia_metamorphica_3_clones2_3, 24 Collinsia_metamorphica_3_clone5, 25 Collinsia_metamorphica_3_clone6, 26 Collinsia_bartsiifolia_var_bartsiifolia_2, 27 Collinsia_corymbosa_3b, 28 Collinsia_tinctoria_1, 29 Collinsia_greenei_3_clones1_10, 30 Collinsia_greenei_3_clones2_6, 31 Collinsia_sparsiflora_var_collina_1, 32 Collinsia_sparsiflora_var_sparsiflora_4_5, 33 Collinsia_sparsiflora_var_sparsiflora_6, 34 Collinsia_multicolor_2, 35 Collinsia_antonina_2, 36 Collinsia_concolor_2_Collinsia_parryi_1, 37 Collinsia_concolor_1b_clone1_4_5, 38 Collinsia_heterophylla_21_cloneD3P1, 39 Collinsia_heterophylla_21_cloneD3_4, 40 Collinsia_heterophylla_21_cloneD1_2, 41 Collinsia_heterophylla_21_cloneA1, 42 Collinsia_heterophylla_21_cloneA2, 43 Collinsia_heterophylla_21_cloneA3, 44 Collinsia_heterophylla_20_clone1_2, 45 Collinsia_heterophylla_20_clone3, 46 Collinsia_heterophylla_8_clone2_4, 47 Collinsia_heterophylla_8_clone1; TREE con_50_majrule = [&R] (1:0.090607,2:0.081859,(3:0.071186,((4:0.023227,(5:0.010445,6:0.011431)1.00:0.018234)1.00:0.035762,((((7:0.020709,8:0.03022)1.00:0.024011,((16:0.002881,17:0.00292)1.00:0.011598,((18:0.004342,19:0.001406,20:0.004218,21:0.004103)1.00:0.011414,(((22:0.003189,(23:0.001436,24:0.005592,25:0.002853)0.81:0.002766)1.00:0.020714,((26:0.007024,27:0.005783)1.00:0.017663,28:0.015949)0.66:0.007416,((29:0.006972,30:0.010897)1.00:0.015481,(31:0.002903,(32:0.001442,33:0.001416)0.95:0.002838)1.00:0.035865)1.00:0.00882,(34:0.011662,(35:0.013394,(36:0.001412,37:0.002919)1.00:0.012958)0.88:0.005083,((38:0.004303,43:0.001439,45:0.004335)0.88:0.002863,46:0.004499)1.00:0.014705)0.99:0.009349)0.56:0.003786,((39:0.007751,((41:0.001431,44:0.002871)0.97:0.00429,42:0.002905)0.71:0.002666)1.00:0.007322,(40:0.006954,47:0.011302)0.81:0.003066)1.00:0.009746)0.95:0.004807)0.98:0.005559)1.00:0.009862)1.00:0.009727,((12:0.01103,13:0.010644)1.00:0.029239,(14:0.011479,15:0.017377)0.99:0.005975)1.00:0.011486)1.00:0.009727,((9:0.001401,10:0.001377)1.00:0.00774,11:0.013026)1.00:0.034884)1.00:0.02092)1.00:0.060471)1.00:0.136364); END;