#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 18:38 GMT TreeBASE (cc) 1994-2008 Study reference: Cusimano N., Bogner J., Mayo S., Wong S.Y., Hesse M., Hetterscheid W., Keating R.C., & French J. 2011. Relationships within the Araceae: comparison of morphological patterns with molecular phylogenies. American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S11083] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=117; TAXLABELS Acorus_calamus_M91625 Aglaodorum_griffithii_AM905758 Aglaonema_modestum_AM905757 Alloschemone_occidentalis_AM905744 Alocasia_odora_AM905802 Ambrosina_bassii_AM905798 Amorphophallus_hottae_AM905785 Amydrium_humile_AM905745 Anadendrum_sp._AM905740 Anaphyllopsis_americana_AM905753 Anaphyllum_wightii Anchomanes_difformis_AM905761 Anthurium_acaule_AM905735 Anubias_barteri_AM905756 Aridarum_nicolsonii_AM905784 Ariopsis_peltata_AM905804 Arisaema_franchetianum_AM905806 Arisarum_vulgare_AM905797 Arophyton_buchetii_AM905820 Arum_hygrophilum_AM905809 Asterostigma_cubense Bakoa_lucens Biarum_tenuifolium_AM905810 Bognera_recondita_AM905765 Bucephalandra_motleyana_AM905822 Caladium_lindenii_AM905788 Calla_palustris_AM905819 Calla_palustris2 Callopsis_volkensii_AM905773 Carlephyton_glaucophyllum_AM905821 Cercestis_mirabilis_AM905817 Chlorospatha_sp._AM905791 Colletogyne_perrieri_AM905823 Colocasia_esculenta_AM905800 Croatiella_integrifolia Cryptocoryne_lingua_AM905779 Culcasia_liberica_AM905816 Cyrtosperma_macrotum_AM905750 Dieffenbachia_aglaonematifolia_AM905764 Dracontioides_desciscens_AM905754 Dracontium_polyphyllum_AM905747 Dracunculus_vulgaris_AM905812 Eminium_spiculatum_AM905813 Epipremnum_pinnatum_AM905746 Filarum_manserichense_AM905795 Furtadoa_sumatrensis Gearum_brasiliense_AM905763 Gonatopus_angustus_AM905777 Gorgonidium_sp._AM905767 Gymnostachys_anceps_AM905727 Hapaline_benthamiana_AM905787 Hedyosmum_mexicanum_AM905824 Helicodiceros_muscivorus_AM905811 Heteropsis_oblongifolia_AM905737 Holochlamys_beccarii_AM905736 Homalomena_magna_AM905774 Incarum_pavonii_AM905768 Jasarum_steyermarkii_AM905792 Lagenandra_ovata_AM905780 Landoltia_punctata_AY034223 Lasia_spinosa_AM905749 Lasimorpha_senegalensis_AM905755 Lazarum_brownii Lemna_minor_AM905730 Lysichiton_americanus_AM905728 Mangonia_tweedieana_AM905766 Monstera_adansonii_AM905743 Montrichardia_arborescens_AM905818 Nephthytis_afzelii_AM905759 Orontium_aquaticum_AM905729 Pedicellarum_paiei_AM905733 Peltandra_virginica_AM905815 Philodendron_deltoideum_AM905775 Philonotion_americanum Phymatarum_borneense_AM905783 Pinellia_pedatisecta_AM905807 Piptospatha_ridleyi_AM905781 Pistia_stratiotes_AM905799 Podolasia_stipitata_AM905752 Pothoidium_lobbianum_AM905734 Pothos_scandens_AM905732 Protarum_sechellarum_AM905805 Pseudodracontium_lacourii_AM905786 Pseudohydrosme_gabunensis_AM905760 Pycnospatha_arietina_AM905751 Remusatia_vivipara_AM905803 Rhaphidophora_crassifolia_AM905741 Rhodospatha_oblongata_AM905739 Sauromatum_horsfieldii_hirsutum Scaphispatha_gracilis_AM905793 Schismatoglottis_trifasciata_AM905782 Schottarum_sarikeense Scindapsus_hederaceus_AM905742 Spathantheum_intermedium_AM905769 Spathicarpa_hastifolia_AM905772 Spathiphyllum_wallisii_AJ235807 Spirodela_polyrrhiza_AM905731 Stenospermation_ulei_AM905738 Steudnera_colocasiifolia_AM905801 Stylochaeton_bogneri_AM905776 Symplocarpus_foetidus_L10247 Synandrospadix_vermitoxicus_AM905771 Syngonium_auritum_AM905789 Taccarum_weddellianum_AM905770 Theriophonum_dalzellii Tofieldia_pusilla_AJ286562 Typhonium_blumei_AM905808 Typhonodorum_lindleyanum_AM905814 Ulearum_sagittatum_AM905794 Urospatha_sagittifolia_AM905748 Wolffia_columbiana_AY034255 Wolffiella_oblonga_AY034242 Xanthosoma_helleborifolium_AM905790 Zamioculcas_zamiifolia_AM905778 Zantedeschia_albomaculata_AM905762 Zomicarpa_steigeriana_EU542592 Zomicarpella_amazonica_AM905796 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7333] TITLE Araceae; LINK TAXA = Taxa1; DIMENSIONS NCHAR=4494; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4210 4220 4230 4240 4250 4260 4270 4280 4290 4300 4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 4410 4420 4430 4440 4450 4460 4470 4480 4490 4500 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Acorus_calamus_M91625 ATGGAAGAATTCAAAGTCTATTTC------GAAAAAGATGGGTCTCGTCAACAATACTTCCTATATCCACTTCTCTTTCAGGAGTACATCTACGCACTTGCTCATAATCATGTTTTA---------AATGGATTGA------TTTTTTACGAATCCTCGGAAAATTTCGTTTATGATAATAAATTTAGTTTAATAATTGTAAAACGTTTAATTACTCAAATGTATCAAAAGAATTCTTTGAGTAATTTGGTTAATGATTCTAACCGAAATCGATTAGTTCGGCAA-AACAAGAATTTTTATTATCAAACGATATT-GAGGGTTTTTCAGTCATTATGGAAATTCCATTCTCGATAATATTTTTATCTTCCGTTGAAGAAAAAAAAGCAAAAATACCAAAAATTCAGAATTTACGATCTATTCATACAACATTTCCCTTTTTAGAAGACAAATTATCACATTTAAATCATGTATCAGATATATTAATACCCTATCCCATCCATCTCGAAATCCTGGTTCAAGTTCTTCAAGGCTGGATACAAGATGTTCCGTCTTTACATTTATTGCGATTCTTTCTCCATGAGTTTCATAATTGGAATAGTCTCATTACTCCAAAGAAATCCATTTCTTTTCTTTTTTCAAAAGGGAATCAAAGACTCTTCTTGTTCTTATATAATTCTTATGTATTTGAGTGTGAATCCGCATTAGTCTTTCTCCGTAAACAATCCTTTTATTTACGATCAACATCTTTTGGAACCTTTGTTGAGCGAACACATTTCTATGTAAAAATAGAG---CATATTGTAGTAGTGCGTAGGAATAATTTTCAAAAGGCCTTATCTTTGTTCAAAGATCCTTTCATCCATTATATCCGATATAAAGGAAAATCAATTCTGGCTTCAAAGGGGACTGATTTTCTGATGAAGAAATGGAAATATCACCNTCTAAATTTCTGGCAATGTCATTTTCACTTTTGGTCTCAACCGCATAGGATTCATATAAACCGNNTATCAAATCGTTCTTTCTATTTTATGGGCTATCTTTCAAGTGTACGAATCAATTTTTCAACGGTAAGGAGTCAAATGCTAGAGAGTTCATTTCTAATGGATACTCCTACTAAAAAATTCGATACTATAGTCCCAATTATTCCTCTAATCGGATCATTGT-TAAAGCTAAGTTTTGTAACGTATCGGGGCATCCTGTTAGTAAGCCGGTCTGGGCTGATTTGTCAGATGCTGATATTATCGATCGATTTGGACGAATATGTAGAAATCTTTCTCATTATCACAGTGGATCCTCAAAAAAACAGAGTTTGTATCGAGTAAAGTATATACTTCGCCTTTCGTGTGCGAGAACTTTGGCCCGTAAACATAAAAGTACAGTGCGCGCTTTTTTCAAACGATTAGGTTCAGAATTCTTAGACGAATTCTTTACGGATAAAGAACAAGTTCTTTCTTTGATCTTCCCTTCCCTTCGTTCACCTTCACAC------AGGGTCCATAAA---------------GGAGAACGTATTTGGTATTTGGATATTATACGTATCAATGACCTGGTG----AATAATTC---------------ATGATT----TGTCATGGGACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTTCCACCCGA{AG}GAAGCAGGGGCTGCGGTAGCTGCCGAATCCTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGCCGATGCTACCACATCGAGCCCGTTGTTGGGGAGCAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTACGAGCTCTACGTTTGGAGGATCTTCGAATTCCCCCTGCTTATTCCAAAACTTTCCAAGGCCCGCCCCATGG{AG}ATCCAGGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCGAAGAACTACGGTAGAGCAGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCACAGCCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCTGAAGCATTTTATAAAGCGCAAGC{CG}GAAACAGGTGAAATCAAAGGACATTATTTGAATGCTACTGCGGGTACATGTGAAGAAATGATGAGAAGGGCCCAATGTGCCAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGTGGATTCACTGCAAATACTAGCTTGGCTATTTATTGCCGAAACAACGGCCTACTTCTTCACATCCATCGTGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCGCTACGTATGTCTGGTGGAGATCACATTCACGCCGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAAATGACTTTAGGTTTTGTTGATTTACTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTTTGCCCGTAGCTTCCGGTGGTATTCACGTTTGGCATATGCCTGCCTTGACCGAGAACTTTGGGGATGATTCTGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGCGAAAGTACTCAAATTATCCGTGAAGCTTGTAAATGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAAAA-GCTTGTTTGACTTACT------AACTATCTATCCTCTTTGTTTT-GTCAGCGGTTCCAAATTAAATATGTTTCTTTTTGACTC--TATT-TTTCACAAA--TAAATGCATCGGAGTCAAAATTTTTGAATCT----TATCAAAAGTCTTGTGATACGATATACGTACAAATGCACAT------------------ATCTGGGC------AAGGAATCCCCATTATTGAAT------------CATTCACAGTTCATATGATTAC----------------CCTTTTACTTA-----------GAAGT-------------AAAGTCTTCTCTTTTT--------------GAAAATGAAA---AAACTCAAAAG-----GCGGGGTAAGATTTTGGAATACAATTT----CGAT-C----TCTTT--AAT--TT-----------------------------ATTGACAAAAACACAAAT---ACTCT-----AGTAAGATGA-----TCTATCGGGAATAG-----CCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGGAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATTAAAAATGGGCAATCCTGAGCCAAATCCNTGTTTT-----GAT-AAAACAAAGTTTCATTTCAT----------AAAACGAGAAT-AAAAAA--GGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGACTGCATTACGTTGGTAGC-GGAAT----CCTTTCTATCGAGAAATTACA----------GAGAGGAAGACCCTATTT--ATATACGTAATACCGATGTATACGTAGTA------------------------------T-ACATATCAAA-------CGATTAAT---GA--TGAC-CCA-AATTCTGAATCCTAATTTCC-GAA-TTCTTTGGAAA------AGA---ATTGGGAATCCACTCC-----AA-GTT------GAAGGAAGAATCAAATATTCAGTGATCAAATAATTCACTCCAGAATATGCTAGATC-----TTTTGAAAAACTGATTAATCCGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGT-CAAGTCC-TCTATCCCC Aglaodorum_griffithii_AM905758 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACATAATTATTTAATCAATTCTGTTAATGATTCCAACCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGCCATTGTGGAAATTCCTTTCTCGCTGCGATTAGCATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCTGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTTTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCAAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCCTATATAATTCTTATGTAGTTGAATGTGAATTTATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGACCCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGGACAACAGCTTATAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTGGAAATCTTTCTCATTATTACAGTGGGTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTCCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAATTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAATGGAATAGAAA------------CACAAATTATCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACAGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGATTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTGATTCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAAATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTCGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATAAAAA----CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AAGTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTT--------ATTT------AAGACCAAA-AAAATTCCAAGG-----ATTAGATAAGGGTTTT----------------AAAACTT---TTTTTGTCCTGTT----------------------------AACGGACATAAACACAAGC----CCCT-----AGTAAGATAAAGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGCNNNATTGT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTGTTTTGAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTTTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTTTTATTTATTGAATTCAAAA-TTTTATGAAAAAATT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC------TTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCANNNNNNNNNNTCCCC Aglaonema_modestum_AM905757 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAAATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCG{CT}GGAAATTTCAGGTTATGACAATAAATTTAGCCCATT{AT}CTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTAATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAACGATATCAGAGGGTTTTGCTGCCATTGTGGAAATTCCTTTCTCTCTGCGATTAGCATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTACCACATTTAAATTATGTATCAGATATACTAATACCCTATCCTGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTCTACATTTATTACGATTTTTTTTTCACGAATATCATAATTGGAATAATCTCATTACCTCAAAGAAATCTAGTTAT---GGGTTTTCAAAAGAGAATCCAAGACTATTCCGGTTCCTATATAATTCTTATGTAGTCGAATGGGAATCTATATTAGTTTTTCTCCGTAAACAATCCTTTTATTTACGATCAACATCTTATGGACCCTTTCTTGAGCGAACACATTTCTTTGAAAAAATAGAACAACATCTTATAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTTAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTTACTTTTGGTCTCAACCCTGTAGGATCTACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCTGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTCCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAATTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTCGTCATGAGACCATGTAAATG-AAATGGAATAGAAA------------CAAAAATTATCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTCGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATGTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAGAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGATTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGCGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTGATTCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAAATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGGAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATAAAAA----CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AAGTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTTTT-----ATTT------AAGACCAAA-AAAATTCCAAGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTTTGTCCTGTT----------------------------AACGGACATAAACACAAGC----CCCT-----AGTAAGATAAAGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAG-GGACTGAA--TCNNNNNNNNNNGATGT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTGTTTTGAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCATTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTTTTATTTATTGAATTAAAAA-TTTTATGAAAAAATT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC------TTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Alloschemone_occidentalis_AM905744 ATGGAAGAATTTAAAGGATATTTT------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATAGATTCGTTGGGCAT-AACCAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCAAGGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAATTCTTATGTAGCTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTATTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAATCTTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTGCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGCTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGTTTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATTCTTTACATTTACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTC---------------ATGATTCATTGGTCATCAGACCCCGTAAATG-AAATAGAATAGAAA------------CCCAAATTAACAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCGCNNTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTTGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTACTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACGGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCAAAGCAGTAGATACTCTAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCATTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCGCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATCAAA-------------AAGTCTTCCTTTTTTT----------------AAGACCCAA-AAATTTCCAGGG-----------TAAGGT--------------------AAAACTT---TTTTTGTCCTTTT----------------------------TATGGACATAAAAACAAGC---CTTCTAATCTAATAAGATAAAGTGATGCATGGAAAACGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCCT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAA-----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTTTTCTTT-CTATC--TAATTTACA----------GAAAGGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCGAATCCATAATATTTATTTATTAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTTGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATCAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Alocasia_odora_AM905802 ATGGAAGAATTAAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCTGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATGGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCCTTCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTATATCAGATATACTAATACCTTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTTTTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATTCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATTAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAGCCAATTCTCAAACTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTCCTAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCGGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCGGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGCGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAAGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTGTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGTATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGCGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATCCCTGTAGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATAAAAA-----CCATTTGACCTCCT------AAGGATTTTTCCTCC---TTTCCGCCGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTTACAAA------AAGATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAATCTTCCTTTTT--------ATTT------AAGACCAAA--AAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAGTCCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTTGAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTGGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCC------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATGAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCCATTCT-----AA-ATTGAAATTGAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGGCGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAA-TCGTGAGGGT-CAAGTCC-TCTATCCCC Ambrosina_bassii_AM905798 ATGGAAGAATTAAAGGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTACTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATAGA---AATGGTTCAA------TTTTTTACGAACCCGCAGAGATTTCAGGTTATGACAAGAAATTTTGTTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAGTTCTGTTAATGATTCTAAACAAAATAGATTCATTGGGTAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGCCATTGTGGAAATTCCTTTCTCATTGGGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTATTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTCACTATTATGGTTTTTCAAAAGAGAATCCAAGATTATTGTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTCGTTTTTCTCCGTAAACAATCCTTTTATTTACGGTCAACGTCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATTTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCTTATGGTTGTTCAAGGACCCTTTCATGTATTATGTTAGATATCAAGGAAGATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATATTACATTGTCAATTTTTGGCAATGTCATTTTAACTTTTGGTCTCAACCCAGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCCGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATAGAATAGAAA------------CTCAAATTCTCAAG---AGAGACAAAATGTCAGTC-----ATTT---TCATTCCGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTA------GGGATCTAATCTATGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCGCGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGCCGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAGTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTTCAAGGGCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTACGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGCGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGAGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGCGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAATACGAACCAGTAGATAAGCTAGATAAAAA----CCAATTTTACCTCCTAAGTT-AAGTATTTTTCCTCC---TTTCCGTCGGTGACTAAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGTGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGCAT-----TTTTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA--------------AGTCTTCCTTTTTTTT---------------AAGACCAAA-AATACGTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT-----TTTGTCCTTTTA----------------------CTTTTGATGGGCAGAAACACAAGCAAGCCGCC-----AGTAAGATAAGGCAATGCATGGAAAAGGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCNNTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAAAGGGCAATCCTGAGCCAAATCCTTGTGTGTTTTTGAGAAAAA-----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGTTAGCTGGAATTCTTCTTT-CTATG--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCGCGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTCAAAA-TTTTATGAAAAAATA-AAGAGTTATTGCGAATCCATTCT-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCGGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCAGACAAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Amorphophallus_hottae_AM905785 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCGAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCCT------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATGGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTACCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTTTGTTCCTATATAATTCTTATGTAATTGAATGTGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTCGAGCGAGCACATTTCTATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAGTGGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGAGCATTGTCAAAAGCGAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCCGATTCTGATATTATTGATCGATTTGGTCGGACATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACAGTACGCGCCTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGCTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAGCGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGATCATGAAAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGNTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGGTGCTACCACATCGAACCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCGAAGGCCCACCTCACGGTATCCAAAGCGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGTGTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAACGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACCTAACAGGGGGATTCACCGCAAATACGAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGTATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGACCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGATTTGGAAAGCGATCAAATTCGAATTCGAACCGGTAGATAAGCTAGATAA--------CCATTTTACCTCTT------AAGTATTTTTCTTCT---TTTCTGTCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATTCGAGCGT-----TTTATGTTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAGAT------------------ATGTGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTTATTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AGGTCCTCCTTTTTATTTAATTATTT------AAGACCAAA-AAATTTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT----TTTTGTCCTTTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNGCA--TGAGCCTTAGTATGGAAACCTACTAAGTGGTAACTTCCAA-CTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACACACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATAATTAT----AAAATTCAAAA-TTTTATGAAAAATAA-AAGAGTTATTGCGAATCCATTCT-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATT-----------------------------TGAAAAAATGATTAAGCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGT-CAAGTCCCTCTATCCCC Amydrium_humile_AM905745 ATGGAAGAATTCAAAGGATATTTAGAAATAGAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCATGGTTTAAATGTA---AATGGATCAATATCCATTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACATTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTTTTAATGATTCTAATAAAAATAGATTCGTTGGTCAC-AACCAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCCATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCTGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTCTTTTTTCATGAATATCATAATTGGAATAATCTCATTACTCCAAGGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTTCTATATAATTCTTATGTAGTTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATTTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTTTCCCATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAATCCTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTTATAGATACTGTTGCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATTCTTTACATTTACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATAA-----------ATGATTGATTCATTGGTCATCAGACCACGTAAATG-AAATAGAATAGAAA------------CCAAAATTAACAAG---AGAGGAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTCCTTTTCGGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAGAACTGCAAGCACGNTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTATCACATCGAACCCGTTGTTGGGGAGGAAGATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTAGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGTCCCTATCGTAATGCATGACTACTTAACAGGTGGATTCACTGCAAATACTAGTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCAAACCAGTAGATACGATAGATA--------CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCATTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TATTCTTTCACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCAC-----GTAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATCAAA-------------AAGTCTTCCTTTTTTT----------------AAGACCCCA-AAATTTCCAGGG-----------TAAGGT--------------------AAAACTT---TTTTTGTCCTTTT----------------------------TATGGACATAAACACAAGC---CCTCTAATCTAATAAGATAAAGTGATGCATGGAAAACGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAA-----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTTGTCTTT-CTATC--TAATTTACA----------GAAAGGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATTAAA-------CGATTAATCACGACCCGAATCCATAATATTTATTTATTAAATAAATAG-TTTTATTAAAAAT{GT}G-AAGAGTTATTGTGA-TCC----------AA-ATT------GAAGTAAGAGTTGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATCAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGG-TTCAAGTCCCTCTATCCCC Anadendrum_sp._AM905740 ATGGAAGAATTCAAAGGATATTTAGAAATAGAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCATGGTTTAAATGTA---AATGGATCAATATCCATTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATAGATTCGTTGGGCAC-AACCAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTACTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCCATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCTCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCAAGGAAACCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTTCTATATAATTCTTATGTAGTTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATTTTACTTTGTCCATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCCATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAATCTTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTTATAGATACTGTTGCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATTCTTTACATTTACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATGA-----------ATGATTGATTCATTGGTCATCAGACCACGTAAATG-AAATAGAATAGAAA------------CCAAAATTAACAAG---AGAGGAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTCCTTTTCGGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCATTGTTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACCTTTTAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACGAGTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTTTGGAAAGAGATCAAATTCGAGTTCAAACCAGTAGATACGCTAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCATTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TATTCTTTCACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCAT-----GCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATAAAA-------------AAGTCTTCCTTTTTTT----------------AAAACCCCA-AAATTACCAGGG-----------TAAGGT--------------------AAAACTT---TTTTTGTCCTTTT----------------------------TATGGGCATAAACACAAGC---CCTCTAATCTAATAAGATAAAGTGATGCATGGAAAACGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTTGTCTTT-CTATC--TAATTTACA----------GAAAGGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA--------GATTAATCACGACACGAATCCATAATATTTATTTATTAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTTGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATCAATCAGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Anaphyllopsis_americana_AM905753 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAGCAACATTTCCTATATCCGCTTCTTCTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGATCCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTTTTAATAATTCCAACCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACACATAAATTATGTATCAGATATACTAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTCGATTCCTATATAATTCTTATGTAATTGAATGCGAATCCGTATTAGTTTTTCTCCTTAAACAATCCTCTTATTTACGATCAACATCTTTTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCCTACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTCTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTTTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAGTACTTCAGCGGCAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGGATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGTTCATGAGACCATGTAAATG-ACATAGAATAGAAA------------CCCACATTTTCAAG---AGAGAAAAAATGTCAGTC-----GTTC---TAATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCCAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCCGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATAAAAA--CCCATTCGACTTCCT------GAGTATTTTTCCTCT---TTTCTGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAAAT----ATATGTATGAAGATATATGTAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTT----------------------GACCCCT-AAAATTCTAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTTTGTCCTTTT----------------------------AATGGACATAAACACAAGC---CCCCT-----AGTAAGATAGGGTAATGCATGGGAAATTG-----TCGGGATAGCTCAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----AAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCATATATATATA--------------------------------CTGATATATCAAA-------CGATTAATTACGACCCGAATCC------TGAATTTATTAAATTCAAAT-TTTTATGAAAAATTT-AAGAGTTATTGTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATTGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAA-TCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Anaphyllum_wightii NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCAACCAAAATAGATTCGTTGGGCAC-AACAAGAATTTNTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCCGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACACATAAATTATATATCAGATATACTAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGANNNTCCAAGACTTTTTCGGTTCCTGTATAATTCTTATGTAATTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN----NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN-NNNNNNNNNNNNNN------------NNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNN-----NNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Anchomanes_difformis_AM905761 ATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGTTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCCA------TTTTTTATGAACCCGCAGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTAATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGCCATTGTGGAAATTCCTTTCTCGCTGCGATTAGCATCCTCCCTCGAAGAAAAAAAAGAA---ATACCCAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCTGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCAAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCCTATATAATTCTTATGTAGTTGAATGTGAATCTATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGACCCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGGACAACATCTTATAGTACTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGACCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTTTGGCTTCAAAAAGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAATCCTTCAGCAGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTCCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAATAGAATAGAAA------------CCCAAATTATCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCANNNNNNNNNNNNNNNNNNNTCAAAGCCGGTGTTAAANNTTACAAATTGACTTATTATACTCCCGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCTGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCGAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTGTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGCGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTGCAGTTCGGTGGAGGAACTATAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGCAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCGTCGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTTTGTTTTGTTTAGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTT--------ATTT------AAGACCCCC-AAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACCT---TTTTTGTCCTTTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA--CNNNNNNNNNNTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCGACGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGATAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTTATCACGACCCAAATCCATAATTTTTATTTATAAAATTCAAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Anthurium_acaule_AM905735 ATGGAAGAATTCAAAGAATATTTA------GAAAAAGGTAGATCTAAACAACGACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTATTCATGATCGTGGTTTAAATGTA---AATGGACCTT------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAAAAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATAGATTCGTTGGGCAC-AGCCGTAATTTGGATTCTCAAATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCCCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTTTCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCATCCATCTGGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCGTTACTCCAAAGAAATCTAGTTAT---GATTTTTCAAAAGAGAATCCAAGACTAATTTTGTTCCTGTATAATTCTTATGTAGTTGAAT{AG}CGAATCCATATTAGTTTTTCTCTTTAAACAATCCTCTTATTTACGATCAACATTTTTTGGACCTTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAA---GATCTTGTAGTAGTTTGGTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTAGCTTCAAAAGGGACTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGCCTCAACCCTGTAGGATCCACATAAATCAATTCCCCAGTTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCCGCGGTAAAGAGTAAAATGCTAGAGAATTCTTTTTTAATAGATACTATTGCTAATAAATTTGAAACTATACTTCCAATTATTCTTATGATTGGATCATTGTCGAAAGCTAAATTTTGTAACGTATCAGGAAATCCTATTAGTAAGCCAGTTTGGACCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCCTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGGCTGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACATTTACATAAGTTATAT------------------AGAGAACGNATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGGCCGTGTAAATG-AAATAGAATAGAAA------------CAAAAATTACCAAG---AGAGAAGAGATGTCAGTC-----ATTT---TCATTCTGAAATGCTCGTACAATAATGGTGGAATCAAGTGAGTATTCAAGTTTC---GACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAATGGCAAGCACGATCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAGGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATTGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCACCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCTTATTGGGATGTACGATTAAACCAAAATTAGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACGGGTGAAATAAAAGGGCATTACCTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCCGGTACAGTAGTAGGTAAACTGGAAGGCGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGGGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAACGAGGGGCGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCCAACCAGTGGATACGCTAGATNNNNNNNNNNNNNNNNNNNTTCCT------AAGTCTTTTTCCTCT---TTTTCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA--AAAAAAGATCTGAGCAT-----TTTATGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTTGAGTATTGAAT-----TATTCACTATTTGCAATCTACGTTGTT-----------AGGTTACCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTT------------------AAGACCCA--AAAATTCCAGGG-----------TAAGGGTTTT----------------AAATTTT---TTTTTGTCCTTTT----------------------------AATGGACATAAACACAAGC---CCTCTAATCTAATAAGATAAGGTGATGCATGGAAAA-GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAA-----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGGGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--CAATTTACA----------GAAAGGATAACCCTATTCCTATATACTTAATACGCACATATATATATATATATA------------------------CTGACATATCAAA-------CGATTAATCACGACCCGAATCCATAAATTTTATTTATATTATAAATAA-TTTTATGAAAAATTG-AAGAATTATTGTGAATCCATTCCAA-ACAA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCAGACGAGAATAAAGAGAGAGTCCCATTCTAGATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGANNNNNNNNNNNNNNNNNNNNNN Anubias_barteri_AM905756 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTACATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTCTATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATAATTCTAACCAAAATAGATTCATTGGGCAC-AACAAGAATTTTGATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTATACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTCGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACCCATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAAGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTTATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCGAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTGCCAATAAATCCTTCAGCGGTAAAAAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCTGTAAACATAAAAGTACGGTACGCGCTTTTTTGCCAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAATAGAATAGAAA------------CCAAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTTTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACNNTCAAGGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGTTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATAAAA---CCCATTTTACTTCCT------AAGTATTTTTCCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAT------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTATTTT---ATTT------AAGACCCCA-AAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTTTGTCCTTTT----------------------------AATGGACATATACACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAANNNNNNNNNNNNNNTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTGTTTTGAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGTTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAAATAATCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACAACCCAAATCCATAATTTTTATTTATTAAATTCAAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTTTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCTATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Aridarum_nicolsonii_AM905784 ATGGAAGAATTAAAAGGATATTTA------GAAAAAACTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------ATTTTGATGAACCTGCGGAAATTTCAGATTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCCAACGATATCAGAGAGTCTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCTTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACAATTCTTTTTTCACGAATATAATAATTGGAATAATCTCATTACTCTAAAAAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTTATTCCTATATAATTCTTATGTAGTTGAATGCGAATCCCTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCAAAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTTACTAAAAATTTTGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCAGATTCTGATATTATTGATCGATTTGGTTGGATATGTAGAAATCTTTTTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATNNNNNNTGACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATGAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAAT-----AGAAA------------CAAAAAT-CTCAAG---AGAGATAAAATGTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAATAGTCAAGTTTTTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGACAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTATGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATAGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATAAAGA--CCCATTTTACTTCCT------AAGTATTTTTCCTCT---TTTCCGCTAGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATATACGTACAAATGAAGAT----------------ATATATGTACAAAA-CAAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTATT-----------AGGTTATCCTTATGCTTAT-----AAATATCAAAA-------------AGTCTTCCTTTTTTTT---------------AAGACCCCC-CAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTTTGTCCTGTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTAACTTCCAAATTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAAGAAA------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTGCA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTTGAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAATCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Ariopsis_peltata_AM905804 NTGGAAGAATTAAAGGGATATTTA------GAAAAAAGTAAATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAATATATTTACGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCCA------TTTTTTGTGAACCCCCTGAAATTTCAGGTTATGACAATAAATTAAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGGACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATTAGAGGGTTTTGCTGTCATTGTGGAAATTCCTCTCTCATTGCGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACAAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTATATCAGATATACTAATACCGTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGGTGGATACAAGATGTTTCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCCAAAGAAATCGAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCTATACAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTCGTAGTACCTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTCGATATCAAGGAAAATCAATTCTGGCTTCAAAGGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCGGTAGGATCCACATAAGCCAATTCTCCAAATTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCCGTAAAGAGTCAAATGCTAGAGAGTTATTTTTTAATAGATACTGTTACTCAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTTAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTATAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTCGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATCGAATAGGAA------------CTCAAATTCTAAAG---AGAGAAAAA-TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCCGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGGTAAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTATTTAACAGGGGGATTCACTGCAAATACGAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTAGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGCGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATAAAAAA----CTATTTTACCTCCT------AAGTATTTTTCCTCC---TTTCCGCCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAAATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACCCGTACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCGGGTATTGCAT-----TTTTCAATATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAATCTTCCTTTTTT-------A---------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC-T-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAGTCCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTTGAGAAAAAAA---------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGACTAATCACGACCCCAATCCATAATTATTATTTATTATATTAAATA-TTTTATGAAAAATGA-AATAGTTATTGCGAATCCATTCT-----AA-ATTGAAATTGAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Arisaema_franchetianum_AM905806 ATGGAAGAATTAAGAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCTGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATGGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCCTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTACGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAGCCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTCCAAATAAATCCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTTACTAAAAAATTAGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATCGATCGATTTGGTCGTATATGTGGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGCGCTAGAACTGTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTATGGAAGAAGAAAAGGTGCTTTCTTTAATCTTACCAGGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATAGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-TGTCAGTC-----ATTT---TTATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTT------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAACTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATCGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACGGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCGAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAACTGGCCGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATAAAAAA----CCATTTGACCTCCT------AAGTATTTTTCCTCC---TTTC-GCCGGTGACTCCAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--TAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAATCTTCCTTTTTTTT---------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------CAAACTT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAGTCCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTACAT-TGAGCCTTGGTATGGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCATTCT-----AA-ATTTAAATTTAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAGAAA-GATTAATCAGACGAGAATAAAGAGAAAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Arisarum_vulgare_AM905797 ATGGAAGAATTAAAGGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGG------------TTTTTATGAACCCGCGGAGATTTCAGGTTATGACAATAAATTGAGTTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAAACAAAATAGATTCATTGGGCAT-AACAATAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGGGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAACGAGAATCCAAGACTATTGTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTTTTATTTACGATCAACATTTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCTTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAGAGCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATATTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATAATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCCGTTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATCGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAAACCATGTAAATG-AAATAGAATAGAAA------------CTCCAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGCCGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAGTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGGCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGAGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGCGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGAGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAACCGTGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGCGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAACTGCTGCTTGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAA----CCAATTTTACCTCCTAAGTT-AAGTATTTTTCC-----------GTCAGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAG----------CAATACACGTACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTTTTT--------------AAGACCAAA-AAAATGTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT-----TTTGTCCTTTT----------------------------AATAGGCATAAACACAAGCAAGCCCCC-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TTGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTGTTTTTTTGAGAAAAAAAAA-------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATGAAATTTAAAA-TTTTATGAAAAAATA-AAGAGTTATTGCGAATCCATTCT-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCGGGGTCTGATTGATC-----TTTAAAAAAAATGATTAATCAGACAAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Arophyton_buchetii_AM905820 ATGGAAGAATTAAAGGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCGTGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTTTTTGATCAATTCTGTTAATGATTCTAAACAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCCTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATTTCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTTATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAACCAATTCTCAAAATTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATACTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTATTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATAGAATAGAAA------------CTCAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGCCGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGAGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATACGAACCAGTAGATAAGCTAGATAA--------CCATTTTACCTCTTAA-TT-TAGTATTTTTCCTCT---TTTCCGTTGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAAATCCGAGC--------------TTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCCAAATCTATATTGTT-----------AGTTTATCCTTACACTTAT-----AAATATAAAA-------------AAGTCTTCCTTTTTT-------ATTT------AAGAC-----AAAAG------------ATTAGGTAAGGATTTT----------------CAAACTT--TTTTTTGTCCTTTT----------------------------AATGGACATAAGCACAAGC----CCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCATGACCCAAATCCATAATTATTATTTATTAATTTCAAAA-TTTTATGAAAAAATA-AAGAGTTATTGCGAATCCATTCT---------------------AAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCAGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Arum_hygrophilum_AM905809 ATGGAAGAATTAAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCAGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACACAATTTTTTGATCCATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAATAATTTTTATTCTCAAACGATATCAGAGGGTTTTGCTGTCATTATGGAAATTCCTTTCTCATTGCGACTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACAAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAAAAATCTCATTACTCTAAAGAAATCTAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGGTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTCGTAGTGCTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCAAGTAGGATCCACATAAGCCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAGTGTCCCCAAAAATCCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTTACTAAAAGATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAGGAATTCTTTACGGAAGAAGAAAAGGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGATTGAATCCACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------AGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGTGTTATGAATGTCTCCGCGGTGGGCTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACATAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATAAAAAA----CCATTTGACCTCCT------AAGTATTTTTCCTCC---TTTCCGCCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT-------------AAAATATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAATCTTCCTTTTTTTTT--------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTA----------------AAAACTT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAGTCCCT-----AGTAAGATAAGGCAATGCATGGGAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNNNNNGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAAAGGGCAATCCTGAGCCAAATCCTTGTTTTTTT--GAGTAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCGTTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA-------ACAGAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTAAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCCATTCT-----AACATTGAAATTGAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTTTGATTGATC-----TTTTGAAAAAAGGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACTGACAACAATGAAATTTATAGTAAGAGGAAANNNNNNNNNNNNNNNNNNNNNNNNGGGTTCAAGTCCCTCTATCCCC Asterostigma_cubense ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCGCGGAATTTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTTATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAGTTTTTATTCTCAAATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACATGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATATCATTACTCCAAAAAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCCTATATAACTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTAACTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGAATCCACATAAACCAATTCTCGAATTTTGCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAGCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTACTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTATAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGCAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTCCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCA------------------------CATTGGTCATGAGACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGGAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGA----ATGGAGTTGATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCGCGTATATATA--------------------------------CTGACATATCAAA-------TGATTAATCACGACCCAAATCCATAATTTTTATTTAATAAATTCAAAA-TATTATGAAAAATTT-AAGAGTTATTGTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAA-GATTAATCGGATGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Bakoa_lucens NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------ATTTTGATGAACCCGCGGAAATTTCAGATTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCCAATGATATCAGAGAGTCTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCTTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACAATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCTAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTATATTCCTATATAATTCTTATGTAGTTGAATGCGAATCCCTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCAAAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTTACTCAAAATTTTGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCAGATTCTGATATTATTGATCGATTTGGTTGGATATGTAGAAATCTTTTTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTAGTCGTATGAATGACTTGGTG----AATCATTT---------------ATGATTCGTTGGTCATGAGACCATGTAAATG-AAATAGAAA-----------------CAAAAAT-CTCAAG---AGAGATAAAATGTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN--AAAGA--CCCATTTTACTTCCT------AAGTATTTTTCCTCT---TTTCCGCTAGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATATACGTACAAATGAAGAT----------------ATATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTATT-----------AGGTTATCCTTATGCTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTTTT---------------AAGACCCCC-CAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACCT---TTTTTGTCCTGTT----------------------------AATGGACATAAACACAAAC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Biarum_tenuifolium_AM905810 ATGGAAGAATTAAAAGGATATTTA------GAAAATAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTACGAACCCCCAGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACACAAATTTTTGATCAATTCTGTTAATGATTCTAACCAAAATATATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAACGATATCAGAGGGTTTTGCTGTCATTATGGAAATTCCTTTCTCATTGCGACTAGTATACTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCTAAAGAAATCTAACTATTATGTTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGCCTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCCTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTCGTAGTGCTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTAATTTTCACTTTTGGTCTCAACCAAGTAGGATCCACATAAGCCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAGTGTCCCAAAAAATCCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAGGAATTCTTTACGGAAGAAGAAAAGGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATCGAATAGAAA------------CTCAAATTATAAAG---AGAGAAAAA-TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGATTGAATCCACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------AGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCGCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGCGGTGGGCTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCGATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGCTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATAAAAAA----CCATTTGACCTCCT------AAGTATTTTTCCTCC---TTTCCGCCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAATCTTCCTTTTTTTTT--------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTA----------------AAAACTT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAGTCCCT-----AGTAAGATAAGGCAATGCATGGGAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA-------ACAGAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCCATTCT-----AACATTGAAATTGAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAAATTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Bognera_recondita_AM905765 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAAAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCAAAGACTATTTCGGTTCCTATATAACTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATACTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTAACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAGCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTACTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAAATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTATAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCNNNNNNNNNNNNNNNNNNGACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTCCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCA------------------------CATTGGTCATGAGACCACGTAAATG-AAATAGAATAGAAA------------CAACAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAATCCGTTATTGGGGAGGACAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAGGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGCGCCGAAGCAATTTATAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTCCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGCGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATACGCTAGATATAAGAA--CCCATTTTACTTCCT------AAGTATTTTTCCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTTTGTTTAGTTTAGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATAAAAA----------AAAAGTCTTCCTTTTTATTTAA--ATTT------AAGACCCCA-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------AAAATAAAACTT---TTTCTGTCTTTTT----------------------------AATAGACATAAAAACAAGC----CC------------GATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCCCTGCAT-TGAGCCTTGGTATGGAAACTTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGA----ATGGAGTTGATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTTTTATTTAATAAATTAAAAA-TATTATGAAATATTT-AAGAGTTATTGTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Bucephalandra_motleyana_AM905822 ATGGAAGAATTAAAAGGATATTTA------GAAAAAACTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------ATTTTGATGAACCTGCGGAAATTTCAGATTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCCAATGATATCAGAGAGTCTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCTTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACAATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCTAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTTATTCCTATATAATTCTTATGTAGTTGAATGCGAATCCCTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTATAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTAACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCCAAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTTACTAAAAATTTGGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCAGATTCTGATATTATTGATCGATTTGGTTGGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTAGTCGTATGAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAATAGAAA-----------------CAAAAAT-CTCAAG---AGAGATAAAGTGTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTAAATAGTCAAGTTTTTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGACAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGGTCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATAGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATAAAGA--CCCATTTTACTTCCTAAGCT-AAGTATTTTTCCTCT---TTTCCGCTAGTGGCTCAAAATGCACTATGTTTTC-----------TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATATACGTACAAATGAAGAT----------------ATATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTATT-----------AGGTTATCCTTATGCTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTTTT---------------AAGACCCCC-CAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTTTGTCCTGTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAAGAAA------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTGCA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATAAATTTGAAA--TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAATCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Caladium_lindenii_AM905788 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGTACTTGCTCATGATCATGGTTTAAATGGA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAAAAATTTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGGACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCTCGAGGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTCTCACATTTAAATTGTGTATTAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTTATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCGTCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGCCAATGTCATTTTCACTTTTGGTCTCAACCCTCTAGGATCCACATAAACCAATTCTCACATTTTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTTTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTTCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGGCTTGGTG----AATCATTT---------------ATGGTTCATTAGTCATAAGACCGTGTAAATG-AAATAGAATAGAAA------------CAAGAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCCATGGNNNNNNNNNNNNNNNTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGACAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGCGGAGGAACTATAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATAAAAA----CCCATTTTACCTCTTAA-TT-AAGTATTTTTCCTCT---TTTCCGTTGGTGACTCAAAATTCACTATGTTTTCTATTTACTC--TACTCTTTCACAAA------AAGATCCGAGC--------------TTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAGAT------------------ATATGTAC------AAAGATTCTCGAGTATTGAAT-----GTTTCACTATTCACAATCTATATTGTT-----------AGTTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTT--------ATTT------AAGACAAAA--AAATTTCATGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTTTGTCCTTTT----------------------------AAGGGACATAAGCACAAGC----CCCT-----AGTAAGATAAGGCAATGCATGCAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACNNNNNNNNNNNNNNNNNNTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGGGTTGATTGCATTGCGTTGGTAACTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCCATTCT-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAAA-TCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCTATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Calla_palustris_AM905819 ATGGAAGAATTAAAAGGATATTTA------GAAAAAATTAGATCTAAA------CACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTAAAAAATGGATCCA------TTTTTTATGAACCCTCGGAAATTTCAGGTTATAACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATGGATTCGTCGGACAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCCATTCATTCAATATTTCCATTTTTTGAGGACAAATTCTCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAGGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTCTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTATGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAGTGGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTAATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAACGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTTTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGTCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCACTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAATTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGCCCATGTAAGTG-AAATAGAATAGAAA------------CAAAAATTATCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TAATTGTGAAATGCTCATGCAGTAATGGTTGAATCAACTTAGTATTCAAGTTTTTTAGA--------CC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAACTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTGTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAGGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGAGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATTGTAATGCATGACTACATAACAGGGGGATTCACAGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGGAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATCTAAAAA--CCCATTTGACTTCCT------AAGTATTTTCCCTCT---TTTCTGTTGGTGGCTCAAAATTAACTACGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCGAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAATATTCTAGAGTAGTGAAT-----TATTCACTATTAACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATAAAA-------------AAGTCTTCCTTTCTTTTT----ATTT------AAGACCCCA-AAAATTCTAGGG-----ATTAGATAAGGG------------------------CTT---TTTTTGTCCTGTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGAGATGCATGAAAAAAGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTAGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----GTGGAGTTGATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTCATCACGACCCAAATCCATAATTTTTATTTATAAAATTCCAAA-TTTTATGAAAAATTT-AAGAGTTATTTTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTAAAATATTCAGTGATCGAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Calla_palustris2 ATGGAAGAATTAAAAGGATATTTA------GAAAAAATTAGATCTAAA------CACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTAAAAAATGGATCCA------TTTTTTATGAACCCTCGGAAATTTCAGGTTATAACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATGGATTCGTCGGACAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCCATTCATTCAATATTTCCATTTTTTGAGGACAAATTCTCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAGGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTCTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTATGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAGTGGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTAATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAACGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTTTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGTCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCACTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAATTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAGTG-AAATAGAATAGAAA------------CAAAAATTATCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TAATTCTGAAATGCTCATGCAGTAATGGTTGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Callopsis_volkensii_AM905773 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAAATCTAAACAACA---CTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTTAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGACAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATCATGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTCTTTTTTCACGAATATCATGATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGATTCCTATATAATTCTTATGTGGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAATTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCTGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATTCTTTACAT------AAGTTATAT------------------AAAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCGTGTAAATG-AAATAGAATAGAAA------------CCAAAATTCTCAAG---AGAGAAAAAATGTAAGTC-----ATTT---TTATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTCCCGCCTGAAGAAGCGGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGAATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATAAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGCGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCCAACCAGTAGATACGCTGGATATAAAAA--CCAATTTGACTTCCT------AAGTATTTTTCCTTT---TTTCCATTGGTGGCTCAAAATTCACTACGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTACAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCCATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA------TATCAAAAAGTCTTCCTTTTT--------ATTT------AAGACCCCA-AAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------CAAACTT----TTTTGTCCTTTT----------------------------AATGGACATAAGCACAAGC----CCCT-----AGTAAGATAAGACGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTCCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCATGACCCAAATCCCTAATTTTTATTTATTAAATTCAAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Carlephyton_glaucophyllum_AM905821 ATGGAAGAATTTAAGGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCGTGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTTTTTGATCAATTCTGTTAATGATTCTAAACAAAATGGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCATAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGTTTTTC-AAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTATATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTTCGGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTTGTCTCAACCCAGTAGGATCCACATAAACCAATTCTCAAAATTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGNNNNNNNNNNGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTATTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGCATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATAGAATAGAAA------------CTCAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGCCGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTTGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGTCTGAGATCTTTGGAGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATACGAACCAGTAGATAAGCTAGATAAAAA----CCCATTTTACCTCCTAAGTT-AAGTATTTTTCCTCT---TTTCCGTCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--TCAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-----------AGGGTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTTT----------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACCT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAG-CCCCT----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATCGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTGTTTTTTTGAGAAAAAAAAAA------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCCTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAATTTCAAAA-TTTTATGAAAAAATA-AAGAGTTATTGCGAATCCATTCT---------------------AAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCAGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Cercestis_mirabilis_AM905817 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCT------CAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCTGCAGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAAAAGATTCATTGGGCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAAGGTTTTGCTGTCATTGTGGAAATTCCTTTCTTGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGGA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAAAAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATTTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACTCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATTCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTATCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGATCTTCAAAAAAACAGAGTTTGTATCGAATAAGGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGCATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAATAGAATAGAAA------------CCCAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGAATTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAG{AG}GCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCTAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATTCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGGCGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGTTAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCGTCGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTTTGTTTTGTTTAGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTT--------ATTT------AAGACCCCC-AAAATTCCAGGG-----TTAAGGTAAGGGTTTT----------------AAAACCT---TTTTTGTCCTTTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTAGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCGACGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGATAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTTATCACGACCCAAATCCATAATTTTTATTTATAAAATTCAAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Chlorospatha_sp._AM905791 ATGGAAGAATTAAAAGGATTTTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGTACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTTGGGTTATGACAAAAATTTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCATCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATTAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTTACGAATATCATAATTGGAATAATCTTATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTCTTTTTGTTCCTATATAATTCTTATGTGGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGCTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCGTCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTTACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTTCTATGGTTGGATCATTGTCAAAAGCGAAATTTTGTAATGTATCGGGGAATCCTATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGGTTTGGTCGGATATGTAGAAATCTTTCTCATTATTATAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTATTCTTACCAAGAATTTCTTATCCTTTACAT------AAGTCTTATCCTTTACATAAGTTATATAGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGNTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAAGTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACGTCGAAGCCGTTGTTGGGGAGGAAACTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCGGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTACTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGAATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCGGAACTAGCTGCTGCTTGTGAGATTTGGAAAGCGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATAAAAAA----CCATTTTACCTCTTAA-TT-AAGTATTTTTCCTCT---TTTCCGTTGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCTT--------------AGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGCAT-----TTTTCACTATTCCCAATCTATATTGTT-----------AGTTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTT-------ATTT------AAGACAACC--AAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT--TTTTTTGTCCTTTT----------------------------AATGGACATAAGCACAAGC----CCCT-----AGTAAGATAAGGCAATGCCTGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGATTGCATTGCGTTGGTAACTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATAATT---TATTAAATTCAAAA-TTTTATGAAAAATTA-AAGAGTTATTGCGAATCCATTCT-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAAAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Colletogyne_perrieri_AM905823 ATGGAAGAATTTAAGGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCGTGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTTTTTGATCAATTCTGTTAATGATTCTAAACAAAATGGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCATAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTATATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTTGTCTCAACCCAGTAGGATCCACATAAACCAATTCTCAAAATTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATGCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTATTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGCATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATAGAATAGAAA------------CTCAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGCCGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTTGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAA----CCCATTTTACCTCCTAAGTT-AAGTATTTTTCCTCT---TTTCCGTCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--TCAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-----------AGGGTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTTT----------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACCT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAG-CCCCT----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATCGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTGTTTTTTTGAGAAAAAAAAA-------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAATTTCAAAA-TTTTATGAAAAAATA-AAGAGTTATTGCGAATCCATTCT---------------------AAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCAGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Colocasia_esculenta_AM905800 ATGGAAGAATTAAAGGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTGTGAACCCCCTGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATTAGAGGGTTTTGCTGTCATTGTGGAAATTCCTCTCTCATTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGGTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACAATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTGCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAGCCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGACCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTATTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGATTTGGTG----AACCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATCGAATAGAAA------------TTCAAATTCTAAAG---AGAGAAAAA-TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATAGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCACTTTTTAAAGCACAGTCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAACCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTACTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATAAAAAA----CCATTTTACCTCCT------AAGTATTTTTCCTCC---TTTCCGCCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAAATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAATCTTCCTTTTTTTT---------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAGTCCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTTGAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGAGAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCCAATCCATAATTATTATTTATTAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCCATTCT-----AA-ATTGAAATTGAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTTTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Croatiella_integrifolia ATGGAAGAATTANAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATTATGGTTTTAATGGA---AATGGGTCCA------TTTTTTATGAACCCGCGGAATTTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTTTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAGTTTTTATTATCAAATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGTTGGATACATGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAAAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAACTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGGTGGAATGATTTTCAGAAAACCCTATGGGTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGGTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGGCTCAACCCTGTACAATCCACATAAACCAATTCTCGAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAGCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATGACTTTTTAATAGATACTGTTACTAAAAAATTAGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGNACGGCACGTGCTTTTTTGCAAAGATTANGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTCCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGNTATAT------------------AGAGAACGCATTTGGCATTTGGATATTATTCNGATAAATGACTTGGCT----AATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN-NNNNNNNNNNNNNN------------NNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNN-----NNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGC-T-TGNGCCTTGGTATGGAAACCTACTATTCCCTAACTTCCAAACTCAGAGAAACCCTGGNNTAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAAG----------------------------------------------GATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGA----ATGGAGTTGATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAGGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTTTTCTTTA-TAAATTAAAAA-TATTATGAAAAATTT-AAGAGTTATTGTGAATTCATTCC---------------------AAAGAGTCGAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTANAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Cryptocoryne_lingua_AM905779 ATGGAAGAATTAAAAGGATATTTT------GAAAAAACTAGATCTAAACAACAACACTTCTTATACCCGCTTCTCTTTCAAGAGTCTATTTATTCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------ATTTTGATGAATCTGCGGAAATTTCAGATTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCCAATGATATCAGAGGGTCTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAATACCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCGTTTTTTGAGGACAAATTTTTACATTTAAATTATGTATCAGATATACTAATACCCTATTCCGTCCATCTAGAATTTTTGGTTCAAATTTTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTATTTTTTCACGAATATCATAATTGGAAAAATCTCATTACTCTCAAAAAATCTAGTTAT---GGGTTTTCAAAAGAGAATCCAAGAATATATGTATTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGCAATGATTTTCATAAAACCCTATGGTTATTCAAGGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTATTTTTTAAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCTTGTAGGATCCACATAAACCAATTCCCAAAATTTGCTTTCTATTTTCTGGGTTATCTTTTAAGTGTATCAATAAATCCTTCGGTGGTAAAGAGTCAAATGCTAGATAATTCCTTTTTAATGGATACTGTTACTAAAAAATGGGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCGGATTCTGATATTATTGATCGATTTGGTTGGATATGTAGAAATATTTTTCATTATTGCAGTGGATCTTCAAAAAAACAGAATTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAAAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACACATTTGGTATTTGGATATTATTCGTATGAATGACTTGGTA----AATCATTT---------------ATGATTCATTGGTCATGAGACCGTGTAAATG-AAATAGAATAGAAA------------CAAAAAT-TTCGAG---AGAGATAAAATGTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAAT-----------CTGAATAGTCAAGTTTTTTAGACTTTCTATTC------GGGATCT-----AAGTTTTAGATGTATACATAGGTAAAGTCGTGTACAANNNNNNNNNNNNNNNNNNTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGGCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCTGTTCCTGGCGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAGAGAGACAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCCATTTATAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATTAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGGGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTAGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGGAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCTGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATAGGGTAGCTTTAGAAGCGTGTGTACAAGCGCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCTTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAACAGATTAAATTTGAATTCGAACCAGTGGATAAACTAGATATAACGA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCTTTTTT-----------------AAGACCCCTTCCCCTTACAGGG-----ATTAGGTAAGAGTTTT----------------CAAACTT-----TTTGTCCTGTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN--NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTCAAGTCCCTCTATCCCC Culcasia_liberica_AM905816 ATGGAAGAATTAAAAGGATATTTA------GAAAAAGGTGGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATCTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAAAAGATTCATTGGGCAC-AACAAGAATCTTGATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGGA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTAGAATGCTGGATACAAGATGTTCACTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAAAAATCTCATTACTCCAAATAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATACAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATTTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTATTCAAGGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCCTTTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCATATAAACCAATTCTCACATTTTTATTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAGGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAATAGAATAGAAA------------CCAAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAACTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTATTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGGCGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCTGTACTACAGTTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAATTCCAAGCAGTAGATACGATANNNATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTTTTTCACAAA------AAGATCCGAGCGT-----TTTTTGTTT--ATTAGCCCGAGTTTTT--GTGCAATACACGTACAAATGAGGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT----------------------------------------TT--------ATTT------AAGACCCAA-AAAATTCCAGGG-----ATTTGGTAAGGGTTTT----------------AAAACCC---TTTTTGTCCTTTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCGACGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGATGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACACATCAAA-------CGATTTATCACGACCCAAATCCATAATTTTTATTTATAAAATTCAAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTCGAATAGTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Cyrtosperma_macrotum_AM905750 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAATGAGATCTAAACAGCAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGATCCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTATGGATTCCAACCAAAATAGATTCGTTGAGCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAAGGTTTTGCTGCCATTGTGGAAATTCCCTTTTCGCTGCGA------TCCTTCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCACTTTTAGAGGACAAATTATCACACATAAATTATGTATCAGATATACTAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTCGGTTCCTATATAATTCTTATGTAATTGAATGCGAATCCGTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTTTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCCTACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTCTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAGTACTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATATTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCCCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGGATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGTTCATGAGACCATGTAAATG-ACATAGAATAGAAA------------CCCACACTTTCAAG---AGAGAAAAAATGTCAGTC-----GTTC---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCCAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTTCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCACGACTATTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGAAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATAAAAG--CCCATTCGATTTCCT------AAGTATTTTTCCTCT---TTTCTGTTGGTGGCTCAAAATTCACTACGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT----ATATGTATGAAGATATATGTAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAA-----------------TCTTCCTTT----------------------GACCCCT-AAAATTCTAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTTTGTCCTTTT----------------------------AATGGACATAAACACAAGC---CCCCT-----AGTAAGATAGGGTAATGCATGGGAAATTG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACACTAAATTACAGAAAAGATAACCCT------ATATACCTAATACGCATATATATATATA------------------------------CTGATATATCAAA-------CGATTAATTACGACCCGAATCCATAATTTGAATTTATTAAATTCAAAATTTTTATGAAAAATTT-AAGAGTTATTGTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Dieffenbachia_aglaonematifolia_AM905764 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCGCGGAATTTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAGTTTTTATTCTCAAATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAAAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAACTCTTATGTAGTTGAATGCGAATCCATATTCGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTCCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATTGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAGCCCTCGGCGGTAAAGAGTCAAATGCTAGAGAATGACTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTTTTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTGGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAGAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGGATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTCCTTTGATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATAGCTTGGTG----AATCA------------------------CATTGGTCATGAGACTACATAAATG-AAATAGAATAGAAA------------CAACGATTTTCAAG---AGAGAAAGGGTGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATGTAAGTTTTAGATGTATACATAGGTAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCAGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCCCTTTTTAAAGCACAAGTCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTCCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTAGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCCGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATACGCTAGATATAAGAA--CCCATTTTACTTCCT------AAGTATTTTTCCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTTTCTATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATCAAAA---------AAAAAGTCTTCATTTTTATTTAA--ATTT------AAGACCCCC-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------AAAATCAAACTT---TTTCTGTCCTTTTAATAGAGCTTTTTCTGTCTTTTT-----AATAGACATAAAAACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAG-GGACTGAA--TNNNNNNNNNNNNGC-T-TGAGC-TTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGA----ATGGAGTTGATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGTACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCAAAATCCATAATTTTTATTTAATAAATTAAAAA-TATTATGAAATATTT-AAGAGTTATTGTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Dracontioides_desciscens_AM905754 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAGCAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGATCCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCCAACCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACACATAAATTATGTATCAGATATACTAATACCCTATCCCATCCATTTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTCGGTTCCTATATAATTCTTATGTAATTGAATGCGAATCCGTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTTTGGAACTTTTATTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTATTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCCTACCTTGTCAATTTTTGGCAATGTTATTTTCACTTTTGGTCTCAACCCTCTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAGTACTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAAGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGGATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGTTCATGAGACCATGTAAATG-ACATAGAATAGAAA------------CCCACATTTTCAAG---AGAGAAAAAATGTCAGTC-----GTTC---TAATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCCAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCAAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCCTTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTGTGCCAGAGAATTAGGAGTCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATAAAAA--CCCATTCGACTTCCT------GAGTATTTTTCCTCT---TTTCTGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT----ATATGTATGAAGATATATGTAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTT----------------------GACCCCT-AAAATTCTAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTC---TTTTTGTCCTTTT----------------------------AATGGACATAAAAGCAAGC---CCCCT-----AGTAAGATAGGGTAATGCATGGGAAATTG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTATA----------GAAAAGATAACCCT------ATATACCTAATACGCATATATATA----------------------------------CTGATATATCAAA-------CGATTAATTACGACTCGAATCC------TGAATT-ATTAAATTCAAAT-TTTTATGAAAAATTT-AAGAGTTATTGTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATTGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Dracontium_polyphyllum_AM905747 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAGCAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGATCCCGCGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCCAACCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAATAATATCGGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACACATAAATTATGTATCAGATATACTAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTCGGTTCCTATATAACTCTTATGTAATTGAATGCGAATCCGTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTTTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCCTACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTCTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAGTACTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGGATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGTTCATGAGACCATGTAAATG-ACATAGAATAGAAA------------CCCACATTTTCAAG---AGAGAAAAAATGTCAGTC-----GTTC---TAATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCNNNNTC{AC}AAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATTGAACCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGCCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTTTAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGAGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATAAAAA--CCCATTCGACTTCCT------GAGTATTTTTCCTCT---TTTCTGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT----ATATGTATGAAGATATATGTAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTT----------------------GACCCCT-AAAATTCTAGGG-----ATTAGGTAAGTGTTTT----------------AAAACTT---TTTTTGTCCTTTT----------------------------AATGGACATAAACACAAGC---CCCCT-----AGTAAGATAGGGTAATGCATGGGAAATTG-----TCGGGATAGCTCAGTTGGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCATATATATATA--------------------------------CTGATATATCAAA-------CGATTAATTACGACCCGAATCCT------GAATTTATTAAATTAAAAT-TTTTATGAAAAATTT-AAGAGTTATTGTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATTGAACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Dracunculus_vulgaris_AM905812 ATGGAAGAATTAAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCAGATATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACACAATTTTTTGATCAATTCTGTTAATGATTCTAACCAAAATGGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAACGATATCAGAGGGTTTTGCTGTCATTATGGAAATTCCTTTTTCATTGCGACTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAAAAATCTCATTACTCTAAAGAAATCTAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTCGTAGTGCTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTTAAAAGGGACTCACCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCAAGTAGGATCCACATAAGCCAATTCTCAAATTTTTCTTTATACTTTCTGGGTTATCTTTCAAGTGTCCCAAAAAATCCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAGGAATTCTTTACGGAAGAAGAAAAGGCGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGATTGAATCCACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------AGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGGCTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGCGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATAAA-------CCATTTGACCTCCT------AAGTATTTTTCCTCC---TTTCCGCCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAATCTTCCTTTTTTTT---------------AAGACCAAA--AAATTTCAGGG-----ATTAGGTAAGGGTTTA----------------AAAACTT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAGTCCCT-----AGTAAGATAAGGCAATGCATGGGAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA-------ACAGAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTAT------------TTTTATGAAAAATGA-AAGAGTTATTGCGAATCCATTCT-----AACATTGAAATTGAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTGCACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Eminium_spiculatum_AM905813 ATGGAAGAATTAAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCAGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACACAATTTTTTGATCAATTCTGTTAATTATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAACGATATCAGAGGGTTTTGCTGTCATTATGGAAATTCCTTTCTCATTGCGACTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGAAAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCATGAATATTATAATTGGAATAATCTCATTACTCTAAAGAAATCTAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTGTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTCGTAGTGCTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCAAGTAGGATCCACATAAGCCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAGTGTCCCAAAAAATCCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTTACTAAAAAATTGGAAACCATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAGGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTATTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AAAGAAAAA-TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATTATTGAATCCACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------AGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAGTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTATGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGGCTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACGGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGCGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATAAAAAA----TCATTTGACCTCCT------AAGTATTTTTCCTCC---TTTCCGCCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATAAAA-------------AAATATTCCTTTTTTT----------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTA----------------AAAACTT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAGTCCCT-----AGTAAGATAAGGCAATGCATGGGGAACGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTTGAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCCATTCT-----AACATTGAAATTGAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Epipremnum_pinnatum_AM905746 ATGGAAGAATTCAAAGGATATTTAGAAATAGAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCATGGTTTAAATGTA---AATGGATCAATATCCATTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTTTTAATGATTCTAATAAAAATAGATTCGTTGGTCAC-AACCAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCCATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTCTTTTTTCATGAATATCATAATTGGAATAATCTCATTACTCCAAGGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATTTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCCATTTTTCTTTCTATTTTCCGGGTTATCTTTCAAGTGTACTAATAAATCCTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTTATAGATACTGTTGCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATTCTTTACATTTACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATAA-----------ATGATTGATTCATTGGTCATCAGACCACGTAAATG-AAATAGAATAGAAA------------CCAAAATTAACAAG---AGAGGAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTCCTTTTCGGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAGAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGTTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCATGACTACTTAACAGGTGGATTCACTGCAAATACTAGTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCGTTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCAAACCAGTAGATACGATAGATATAAAAA--CCCATTTGACTTCCTAAGTCTAAGTATTTTTCCTCT---TTTCCATTGGTAGCTCAAAATTCACTATGTTTTCCATTTACTC--TATTCTTTCACAAA------AAGATCCGAGCAT-----TTT-----T-----AGCCCAAGTTTTT--GGGCAATACACGTATAAATGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCAC-----GCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATCAAA-------------AAGTCTTCCTTTTTTT----------------AAGACCCCA-AAATTTCCAGGG-----------TAAGGT--------------------CAAACTT---TTTTTGTCCTTTT----------------------------TATGGACATAAACACAAGC---CCTCTAATCTAATAAGATAAAGTGATGGATGGAAAACGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGT-ACNNNNNNNNNNNCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAA-----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTTGTCTTT-CTATC--TAATTTACA----------GAAAGGATAACCCC------ATATACCTAATACGCATGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCGAACCCATAATATTTATTTATTAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTTGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATCAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNC Filarum_manserichense_AM905795 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCACTTCTCTTTCAAGAGTATATTTTTGTACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCGGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTGATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCTCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAATTTGTGTATTAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATAATAATTGGAGTAATCTTATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAGTCCTCTTATTTACGATCAACATCCTCTGGAACCTTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCGTTTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAATCCTGTAGGATCCACATAAACCAATTCCCCAATTTTTCTTTACATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCCGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTCTAGTTCCAATTATTTCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAACCCGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGGTTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCCTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT------ATGAT----ATGATTTATTAGTCATAAGACCTTGTAAATG-AAAT-----AGAAA------------CAAAAAATCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGAT--AATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGAAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTATGGACTGATGGACTTACTAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACAGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGCGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAGCTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATAAAAAA----CCATTTTACCTCTTAA-TT-AAGTATTTTTTCTCT---TTTCCGTTGGTGACTCAAAATTCACTATGTTTTCCACTTACTC--TACTCTTTCACAAA------AAGATCCGAGCTT--------AAGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCCCAATCTATATTGTT-----------AGTTTACCCTTACACTTAT-----AAATATCAAA-------------AAGTGTTCCTTTTTT-------ATTT------AAGACAAAA--AAATTTCAGGG-----ATTAGGTAA----------------------------------------------------------------------------TGGACATAAGCACAAGT----CCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN--NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATC-----TTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Furtadoa_sumatrensis ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTTCTCATGATCATGGTTTAAATGTA---AATGAATCCAA------TTTTTATGAACCCGCGGAAATTTCAGGTTATAACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAAAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATGCCTTTCTCGCTGCGGTTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAAATATACTAATACCCCATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTTCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAATTCCTATGTAGTTGAATGCGAATCCATATTCGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTATAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGAAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATATTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAATCCTTTAGCGGTAAAGAGTCAAATGCTAGAGGATTCCTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCGTTGTCAAAAGCTAAATTTTGTAATGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTATCAGATTCTGACATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTATAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAAAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTTGGTGAATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAATAGAATAGAAA------------CCAAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Gearum_brasiliense_AM905763 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCGCGGAATTTTCAGGTTATAACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTTGTTGGGCAC-AACAAGAGTTTTTATTCTCAAATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAAAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAACTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTTTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCCGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAGCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTACTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTATGGAAGAAGAAAAAGTTCTTCCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCA------------------------CATTGGTCATGAGGCCACGTAAATG-AAATAGAATAGGAA------------CAACAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTTAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCACTTTATAAAGCACAAGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTTTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATACGCTAGATATAAAAA--CCCATTTTACTTCCT------AAGTATTTTTCCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATAAAA----------AAAAAGTCTTCCTTTTTATTTAA--ATTT------AAGACCCTA-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------AAAATCAAACTT---TTTCTGTCCTTTT----------------------------AATAGACATAAAAACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGA----ATGGAGTTGATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTTTTATTTAATAAATTCAAAA-TATTATGAAATATTT-AAGAGTTATTGTGAATTCATTCA-----AA-ATT------GAAGTAAGAGTCGAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCGTTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Gonatopus_angustus_AM905777 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTATATCTAAACAACAACACTTCCTATATCCACTTCTCTTTCAAGAGTATATTTACACATTTGCTCATGATCATGGTTTAAATGTA---AATGGATCCA------TTTTTTATGAACCCACGGAATTTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTATCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCCCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAATAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAATTCTTATGTAATTGAATGCGAGTCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATTAACATCTTCTGGAACCTTTATTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTCGTTTGTTGTAATGATTTTCAGAAAATCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGCCATTTTCGCTTTTGGTCTCAACCCTGTAGGATCCGCATAAACCAATTCTCAAAAATTTCTTTCTATATTTTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAACGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTGGAAACTCTAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAATGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGGTATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCACAAAACCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCACTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTATTTCTTTAATCTTACCAAGAATTTATTATCCTTTACATATACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTTGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGACTCATTGGTCATGAGACCATGTAAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTT------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGATAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGTCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGCCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAAGGCTGTGTTTGCCAGAGAATTGGGAGCTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTTTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGCATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTAGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGGGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCGGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGCAATCAAATTCGAGTTCGAACCAGTAGATAAGCTAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTT---GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTTTTT----ATTT------AAGACCCCC-----TTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACCT---TTTTTGTCCCTTT----------------------------AATGGACATAAACACAAGT---CCCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACCAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAA-----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTG-----GTAGCTGGAATTCTTATTT-CTATA--TAAATTACA----------GAAAAGATAATCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA--TCAAACGCTTAATCACGACCCGAATCCATAATTTTTATTTCTTTATATAAAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATTGA----GAAGTAAGAATCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Gorgonidium_sp._AM905767 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTACGAACCCGCGGAATTTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAGTTTTTATTCTCAAATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAACTTTCAGAATTTACGATCTATTCATTCAATATTTTCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTACAAAAAAATCTAGTTAT---GGGTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAACTCTTATGTAGTTGAATGCGAATCCATATTCGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTAGGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATTTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCCATTTTTCTTTCTACTTTCTGGGTTATCTTTCCAATGTACCAATAAAGCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTACTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTCCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAGTGCCTTGGTG----GATCA------------------------CATTGGTCATGAGACCACGTAAATG-AAATAGAATAGAAA------------CAACAATTCTCAAA---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAGCTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAAGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCAATTTATAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTCCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGATTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATACGCTAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCC-----------GTTGGTGGCTCAAAATTCACTATGTTTTCCATTGACTC--TACTCTTTCACAAA------AAAATTCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATCAAAT---------AAAAAGTCTTCCTTTTTATTTCA--ATTT------AAGACCCCA-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------AAAATCAAACTT---TTTCTGTCCTTTT----------------------------AATAGACATAAAAA-AAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGA----ATGGAGTTGATTACATTGCGTTGGTAGCTGAAATTCTTCTTTTCTATC--TAAATTACA----------GAAAAGAGAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTTTTATTGAATAAATTCAAAA-TATTATGAAATATTT-AAGAGTTATTCTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Gymnostachys_anceps_AM905727 ATGGAAGAATTAAAAGGATATTTA------GAAAAAGATAGATCTCGGCAACAACACTTCCTATATACGCTTCTCTTTCAGGAGTATATTTACGCGCTTGCTCACGATCATGGTTTA---------AATGGATCAA------TTTTTTATGAACCCGTGGAAATTTTAGGTTATGACACTAAATCCAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTATCAACAGAATTATTTGATTAATTCGGTTAATGATTCTAACCAAAATGGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCAGTTATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCTCCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGACAAATTATCACATTTAAATTATGTGTCAGATATACTAATACCCTATCCCATCCATCTCGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGCTCCCTCTTTACATTTATTGCGATTCTTTCTTCACGAATATCATAATTGGAATAGTTTCATTACTCCAAAGAAATCTATTTAC---GTTTTTTCAAAAGAGAATCGAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGGGAATCCATATTAGTTTTTATTCGTAAACAATCCTCTTATTTACGATCAACATCTTCCGGAGCCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAACGAAAATCAATTCTGGCTTCAAAAGGGACTCAGCTTCTGATGAAGAAATGGAAATGTCATCTTGTGAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCATATAGAATCCATATAAACCAATTCTCAAATTATTCCTTCTATTTTCTGGGCTATCTTTCAAGTGTACTAAAAAATCCTTCATCGGTAAGGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAATAAATTCGATACTATAGTCCCAATTATTCCTATGATTGGATCATTGTCTAAAGCTAAATTTTGTAATGTATTGGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATCACAGTGGGTCCTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGGTTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTGATCTTACCAAGAACCTCTTTTCCTTTACAT------AAGTCATAT------------------AGAGAGCGTATTTGGTATTTGGATATTATTCGTATCAATGACTTGGTG----AATCATTT---------------ATGATT----GGTCATGAGACCCTCTTAATA-AAATGGAATAGAAATGG-------TCTATAAATGATCCAG---AGAAAAAAAATGTCATTC-----ATTT---TCATTCCGAAATGCTCATGCAGTAGTGGTGGAATCAATTGAGTAGTCAAGTTTCTTAGACTTTCTTTTC------GGGATCT-----AAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAAATGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCGGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACAACATCGAGGCCCTTGTTGGGGAAGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCTTTACGAGCTCTACGTCTGGAGGATCTTCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGGCCGCCCCATGGCATCCAAGTTGAGAGAGATAAATTAAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCGCAGGCCGAAACAGGTGAAATCAAAGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCTGTGTTTGCTAGAGAATTGGGAGCCCCTATTGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACCAGTTTGGCTTATTATTGCCGAGACAACGGCCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTAGAAGGTGAGCGTGAGATGACTTTGGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGCCCGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCGTGGGGAAATGCACCCGGTGCAGTAGCTAATCGGGTGGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAGGAGATCAAATTCGAATTCGCCCCAGTAGATCCAGATGTCATAAAAA--CCCATTTTACTTCCT------AAGTATTTTTACTCTT--TTTTCGTTGGTGGTTCAAAATTCGCTATGTTTCCCATTCACTC--TACTCTTTCACAAA------TGGATCCGAGCAG-----TTTGTGTCT----TATCCCAGGTTTTT--GTATGATACACGTACAAATGAACAC------------------ATATGGGC------AAGGAATCTCCATTATTGAAT------------TATACGTAGTCCATATCTTC------------------CCTTACACTTA-----------CAAAG-------------AAAGTCTTCTTTTT----------------GAAGATCCAA--GAAATTCCGGGG-----ACTAGGTAAGATTTTTTAATACTTTTT---AAAATAC---TTTTTTAGTCCCTTT----------------------------AATGGACATAAACACAAGT---CCTAT-----AGTAGGATAA-----TGCATGGGGAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGGAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATTAAAAATGGGCAATCCTGAGCCAAATCCTTTTTTT-----T-------------------------------------------TCAAAAAA---GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAATTGACTGCGTTGCGTTGGTAGCTGGAATTTTTCCTT-CTCTC--GAAATTAAA----------GAAAGGATGACC-T------ATATACCTAATACGGACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCGAATCCATAATTTATTTTTTTATAAATTCAAAATTTTATAAAAAATTT-AAGAGTTATTGTGAATCCATTCCAATCCAA-GTT------GAAGTAAGAGTCAAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Hapaline_benthamiana_AM905787 ATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGTACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTGGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAAATTTGATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCCCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATTAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTTATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTCATTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAACATCTCGTGGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTAACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAAGAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTCAAAAATTCGAAACTATAGTTCCAATTTTTTCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTAATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATTCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTTGTATAAATGACTTGGTG----AATCATTT---------------ATGGTTCATTAGTCATAAGACCATGTAAATG-AAATAGAATAGAAA------------CAAAGATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATCAGACAAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAAGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCTAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTGCTTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACAGCGGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTATAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGAGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATAAAA-----CCCATTTTACCTCTT------AAGTATTTTTCCTCT---TTTCCGTTGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTATT--TGTG-----AGTTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTT--------ATTT------AAGACAAAA--AAATTTCAGGG-----GTT---TAA------------------------AAACTT---TTTTTGTCCTTTT----------------------------AATGGACATAAGCACAAGT----CCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAG----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGAGATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTCAAAT-TTTTATGAAAAATTA-AAGAGTTATTGCGAATCCATTCT-----AA-ATT------GAAGTAAGAGTCAAATATTCAGTGATCAAATCATTCATTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Hedyosmum_mexicanum_AM905824 ATGGAGGAATTACAAGGATATCTA------GAAATTGATAGATCTCGTCAACAACACTTCCTATACCCGCTTTTCTTCCAAGAGTATATCTACGTACTTGCTCATGATCATGGTTTA---------AATGGTTCGA------TTCTTTACGAACCCATGGAAAATTTAGGTTATGACAATAAATCCAGTTCACTAATTGTCAAACGTTTAATTATTCAAATGCATCAACAGAATCATTTGAGAATTTCGGTGAATCATTCTAACCAAAATAGATTCCTTGGGTAC-AACAAGAATTTTTATTCTCA-ATGATACCAGAGAGTTTTGCAGTCATTGTGGAAATTCCATTCTCTCTGCAATTAGTATCTTCCCTAGAAGAAAAAAAAGAA---CTACCAAAATCTCATAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGACAAATTATCACATTTAAATCATGTGTCAGATATCCTAATACCTTACCCCATCCATCTGGAAATCTTGGTTCAAACCCTTCACTACTGGGTACAAGATGCTCCCTCTTTGCATTTATTGCGATTCTTTCTCCACGAGTATCATAATTGGAATAGTTTCATTACTCCAAAGAAATCCATTTATTTTTTTTTTTCAAAAGAGAATCAAAGATTCTTCTGGTCCCTATATAATTCTCATGTATATGAATGTGAATCTGTATTAGTTTTTCTCCGTAAACAATCCTCTCATTTACGATCAACATCTTCTGGAGCCTTTATTGAGCGAACACATTTCTATGGGAAAATAGA----TTTCTTGTGGTAGGGCTTCGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTCAGATATCGAGGAAAATCACTTCTGGCTTCAAAAGGAACTCATCTTCTGATGAAGAAATGGAAATATCACCTTGTCAATTTCTGGCAATGCCATTTTTACATGTGGTCCCAACCGGATAGGATCCATATAAACCTATTATCCAACCATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTCCTAAATCTTTCGGCGGTAAGGAGTCAAATGCTAGAAAATCCATTTCTAATGGATACTTCTATTAAGAAATTCGATACCATAGTTCCAATTATTCCTCTGATTGGAGCATTGGCTAAAGCCAAATTTTGTAACGTATCAGGGCATCCTATTAGTAAGCCGGCCTGGTCCGATTTGTCAGATTCTGACATTATCGATCGATTTGGGCGGATATACAGAAATCTTTCTCATTATCATAGTGGATCCTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATCCTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTGCGGTACGCACTTTTATGAAAAGATTAGGTTCGGAATTATTAGAAGAATTCCTTACAGAGGAAGAACAAGTTATTTCTTTGATCTTCCCAAGAAACTCTTCGCCTTCGCAC------AGGTCACAT------------------AGAGAACGAATTTGGTATTTGGATATTATCCGTATCAATGACCTGGCC----AATCATGA---------------ATGATT----GGTCATGAGACCA-GGTAATGTAAATGCGAACCATCCCT------AAATGATAGATATAATG--AAGAAAAAAAATGAAATTC-----ATTT---TCATTCTGAAATGCCCATGCAGTTGTAGTTGAATCAACTGAGTATTCAACTTTCTTCTACTTTCTTATA------GAGAG--AA-CTGAGTTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTCAAAGCCGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATATGACACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATTGAGCCCGTTGCTGGGGAGGAAAATCAATACATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTACGAGCTCTACGTCTGGAGGATCTGAGAATTCCTCCTGCTTATACCAAAACTTTCCAAGGCCCACCCCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCCAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCCCTTTTTAAAGCACAGTGCGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATGAAAAGGGCTGTATTTGCCAGAGAATTAGGAGTTCCTATTGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATACACTTTCGCGTACTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACCGTAGTAGGTAAACTGGAAGGAGAACGTGGTATCACTTTGGGTTTTGTTGATTTACTACGTGATGATTATATTGAAAAAGACCGAAGTCGCGGTCTTTATTTCACTCAAGATTGGGTCTCTCTGCCAGGTGTTCTGCCTGTGGCTTCGGGGGGTATTCACGTTTGGCATATGCCTGCCCTAACCGAGATTTTTGGGGATGATTCCGTACTACAGTTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGGCGTGATCTTGCTCGTGAAGGAAATGAAGTTATCCGTGAAGCTAGCAAATGGAGCCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATTCGAATTCGAAGCAATGGATACTGTGTAAATCAAAAAGACCGTTTTACTCCCT------AACTATTTATCCTCTT--TTTTCGTCAGCGGTTCAAAATGGAATATGTTTCTCATTCACTC--TACTCTTTCACAAA------TGGATCCGAGCAGAAATGTTTCTCTCT----TATCACA----TTG--TTACGATATACATACAAAATAACAT------------------ATATGGGTATGATCAAAGAATGACCATTATTGAAT------------CATTCACAGTCTATCTCATCA---------------------------------------------------------CCCTTACACTTACTATTTTT--TTTT---GAAAGATCCAA--GA--CTTGCGGA-----CCTAGGTAAAATTTTTG----------------ATGC----TTGTTAGCCCCTTT----------------------------AATTGACATAGACCCAAGT---TCTCT-----AGTAGGATGA-----GGCATAGGGAATGGCCGGGTCGGGATAGCTCAGCCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGGAT-TGAGCCTTGGTATGGAAACCTACCAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATTAAAAATGGGCAATCCTGAGCCAAATCCT-GTTTT-----CATAAAAAAAAAGAATTTAGAAAG--------TGAAAA---TAATCAAAA-----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGACTGCGTTACGTTGGTAGA-GGAAT----CCTT-CTATC--GAAATTGCG----------GAAAGGATGATCCC------ATATATG--ATA----CATATACATA--------------------------------TTGAAATATCAAA-------CGATTAATCACAA------------------------------CTTTTTTTATATGCAAAATTT-CAGAGTTATTGTGAATCGATTCC-----AA-GTT------GAAGGAAGAATCCAATATTCAGCGAGC----CGATCACTTCAGAGTCTGATAGATC-----TTTTGAAGAATTCATTCATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACCTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Helicodiceros_muscivorus_AM905811 ATGGAAGAATTAAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCAGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACACAATTTTTTGATCAATTCTGTTAATGATTCTAACCAAAATGGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAACGATATCAGAGGGTTTTGCTGTCATTATGGAAATTCCTTTCTCATTGCGACTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACTAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAATAATCTCATTACTTTAAAGAAATCTAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAGCAACATCTCGTAGTGCTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCAAGTAGGATCCACATAAGCCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAGTGTCCCAAAAAATCCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAGGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTTATTAGTCATAAGACCATGTAAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGATAAAAA-TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGATTGAATCCACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------AGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATTTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCCAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGGCTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATAAAAAA----CCATTTGACCTCCT------AAGTATTTTTCCTCC---TTTCCGCCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAATCTTCCTTTTTTTTT--------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTA----------------AAAACTT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAGTCCCT-----AGTAAGATAAGGCAATGCATGGGAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCNNNNNNNNNNTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTT--GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCAC--ATATA----------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTAATATTTTCTAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCCATTCT-----AACATTGAAATTGAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Heteropsis_oblongifolia_AM905737 ATGGAAGAATTTAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCATGGTTTAAATGTA---AATGGATCTA------TTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAAGCAAAATGGATTCGTTGGGCAT-AACCAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCAAGGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAATTCTTATGTAGCTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACTTTTATTGAGCGAACACATTTCTATGGAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGCCTCGTCTTTTGATGAATAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTATTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAATCTTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTGCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAATGTATCGGGGAATCCCATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGTTTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATTCTTTACATTTACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATGA---------------ATGATTCATCGGTAATCAGACCACGTAAATG-AAATAGAA---------------------AAATTAACAAG-----AGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACAGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCCGGGGCTGCGGTAGCCGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGTTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTTGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACGGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTACTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACGGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTGGGGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAGCTAGCCGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAGTTCGCAGCAGTAGATACTCTAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCCCT---TTTCCATTG--------AAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCCAGTTTTT--GTGCAATACACGTACAAATGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCGCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATAAAA-------------AAGTCTTCCTTTTTTTTTTTT-ATTTT-----AAGACCCCA-AAATTTCCAGGG-----------TAAGGT--------------------AAAACCT--TTTTTTGTCCTTTT----------------------------TATGGACATAAACACAAGC---CTTCTAATCTAATAAGATAAAGTGATGCGTGGAAAACGG-----TCGGGATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAA-----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTTTTCTTT-CTATC--TAATTTACA----------GAAAGGATAACCCT------ATATACCT-----GCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCCAATCCATAATATTTATTTATTAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTTGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATCAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Holochlamys_beccarii_AM905736 ATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATGGATTCGTTGGGCAC-AACCAGAATTTGGATTCTCAAATGATATCAGAGGGTTTTGTTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTTCATTTTTAGAGGATAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGTTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCAAGGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCTATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACCCATTTCTATGGAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATCGTTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAATCCTTCAGTAGTAAAGAGTCAATTGCTAGAACATTCTTTTTTAATAGATACTGTTGCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGCCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATATTACCAAGAATTTCTTATTCTTTACATTTACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGCG----AATCATAA---------------ATGATTCATTGGTCATCAGACCACGTAAATG-AAATAGAATAGAGA------------CAAAAATTANCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGAATCTAATCAATGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAACCGTTGTTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAAGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAAGGCTGTGTTTGCCAGAGAATTGGGCGTCCCTATCGTAATGCATGACTATTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCGGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTGTTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTTTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGCGAGGTTTGGAAAGAGATCAAATTTGAGTACAAACCAGTAGATACGCTAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCATTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TATTCTTTCACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGATAGATATATG----------TATGTAC------AAAGACTCTCAACTATTGAAT-----TATTCACTATTCGCAATCTACATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTTT----------------AAGACCCAA-AAATTCCCAGGG-----------TAAGGT--------------------AAAACTT---TTTTTGTCCTTTT----------------------------TATGGACATAAACACAAGC---CCTCTAATCTAATAAGATAAAGTGATGCATGGAAAACGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTTTGCTTT-CTATC--TAATTTACA----------GAAAGGATAATCCT------ATATACCTAATACACACGTATATATA--------------------------------CTGACATATCAAA-------TGATTAATCACGACCCGAATCCATAAT----------TAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTTGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTTATC-----TTTTGAAAAAATGATAAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Homalomena_magna_AM905774 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTTCTCATGATCATGGTTTAAATGTA---AATGAATCCC------ATTTTTATGAACCCGCGGAAATTTCAGGTTATAACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAAAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGGCATTGTGGAAATGCCTTTCTCGCTGCGGTTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAAATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTTCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAATTCCTATGTAGTTGAATGCGAATCCATATTCCGTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTATAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATATTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAATCCTTTAGCGGTAAAGAGTCAAATGCTAGAGGATTCCTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCGTTGTCAAAAGCTAAATTTTGTAATGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTATCAGATTCTGACATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTATAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAAAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTTGGTGAATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTCTTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATCCCTAGGGAAAGTCGTGTGCATTGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTAAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCAAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGCTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCATGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGTTAGATATAAAAC--CCCATTTTACTTCCT------AAGTATTTTTCCTCT---TTTC-GTTGGTGGCTCAAAATTCACTATGTTT-CCATTTACTC--TATTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTTGTTTAGCCCAAGTTTTT--GTGCAATACATGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTAGAGTATTGAAT-----TATTTACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAG-----TAATATCAAA-------------AAGTCTTCTTTTTT--------ATTT------AAGACCAAA-TAATTTCCAGGG-----------TAAGGGTTTT----------------AAAACTT----TTTTGTCCTTTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGTTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAATCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATT---ATTTTTATAATAAATAA-TTTTATGAAAAATTT-AAGAG-----GTGAATCCATTAC-----AA-ATT------GAAGTAAGAGTCAAATATTCATTGATCAAATCATTCACTCCAGAGTTTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATGGTGAGGGTTCAAGTCCCTCTATCCCC Incarum_pavonii_AM905768 ATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCGCGGAATTTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAGTTTTTATTCTCAAATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAACTTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACAAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTACAAAAAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAACTCTTATGTAGTTGAATGCGAATCTATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACGTCTTCTGGAATCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTAGGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCCATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAGCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATGACTTTTTAATAGATACTGTTACTAACAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTCCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAGTGACTTGGTG----AATCA------------------------CATTGGTCATGAGACCACGTAAATG-AAATAGAATAGAAA------------CAACAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAAGTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCCGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCCATTTATAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGGATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGATTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATACGCTAGATATAAAAA--CCCATTTTACTTCCT------AAGTATTTTTCC-----------GTTGGTGGCTCAAAATGCATTATGTTTTCCATTTATTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCCAGTTTTT--GGGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATCAAAA---------AAAAAGTCTTTCTTTTTATTTAA--ATTT------AAGACCCCA-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------AAAATCAAACTT---TTTATGTCCTTTTAATAGAACTTTTTCTGTCTTTTT-----AATAGACATAAAAA-AAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGA----ATGGAGTTGATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGAGAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTTTTATTGAATAAATTCAAAA-TATTATGAAATATTT-AAGAGTTATTCTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Jasarum_steyermarkii_AM905792 ATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGTACTTGCTCATGATCGTGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTGCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATTAGATATACTAATACCCTATTCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTTATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCGTGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTAACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGCATTTTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTTCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTTTCATTATTACAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCACTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATAGAATAGAAA------------CAAAAACTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTATTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCACTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCGTTTATGCGTTGGAGAGACCGTTTCGTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCATAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACAAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTTTGCCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATAAAAAA----CCATTTTACCTCTT------AAGTATTTTTCCTCT---TTTCCGTTGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTTTGTTTAGTTTAGCACAAGTTTTT--GTGCAATACACGCACAA--GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-----------AGTTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTTTTT--------------AAGACAAAA--AAAGTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT--TTTTTTGTCCTTTT----------------------------AATGGACATAAGCACAAGC----CCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATGCGCACGTCTATATA--------------------------------CTGACATATCAAA-------TGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTCAAAA-TTTTATGAAAAATTA-AAGAGTTATTGCGAATCCATTCT-----AA-ATT------GAAGTAAGAGTCGAATATTCAGCGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Lagenandra_ovata_AM905780 ATGGAAGAATTAAAAGGATATTTC------GAAAAAACTAGATCGAAACAACAACACTTTCTATACCCGCTTCTCTTTCAAGAGTCTATTTATTCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------ATTTTGATGAATCTGCGGAAATTTCAGATTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCCAATGATATCAGAGGGTCTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAATACCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATTATATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAATTTTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTATTTTTTCACGAATATCATAATTGGAAAAATCTCATTACTCTCAAAAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGAATATATATATTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGCAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTTTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCTTGTAGGATCCACATAAACCAATTCCCAAAATTTTCTTTCTATTTTCTGGGTTATCTTTTAAGTGTATCAATAAATCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATGGATACTGTTACTAAAAAATGGGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCGGATTCTGATATTATTGATCGATTTGGTTGGATATGTAGAAATCTTTTTCATTATTACAGTGGATCTTCAAAAAAACAGAATTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAAAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATGAATGACTTGGTA----AATCATTT---------------ATGATTCATTGGTCATGAGACCGTGTAAATG-AAATAGAATAGAAA------------CAAAAAT-TTCGAG---AGAGATAAAATGTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAAT-----------CTGAATAGTCAAGTTTTTTAGACTTTCTTTTC------GGGATCT-----AAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAATTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGGCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGTTGCTACCACATCGAACCTGTTCCTGGCGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTCGAGAGAGACAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCCATTTATAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATTAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGGAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATAGGGTAGCTTTAGAAGCGTGTGTACAAGCGCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCTTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAACAGATTAAATTTGAATTCGAACCAGTGGATAAGCTAGATATAACGA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCTTTTTT-----------------AAGACCCC------TTACGGGG-----ATTAGGTAAGGGTTTT----------------CAAACTT-----TTTGTCCTGTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN--NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTCAAGTCCCTCTATCCCC Landoltia_punctata_AY034223 ATGGAAGAATTAAAAGGATATTTA------CAAAAAGGTGGATTTAAACAACAACACTTACTATATCCACTTCTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCAGGGTTTAAATGTG---AATGCATCAA------CTTTTAATGAACCCGCTGAAATTTCCGGTTATGACAATAAATATAGCTCATTACTTGTGAAACGGTTAATTACTCGAATATACCAACAGAATAGTTTGATCCATTCTGTTAATGATTCTAAGCAAAATAGATTCATTGGACAC-AACAAGAATTTTTATTATCAAATGATATCCGAGGGTTTTGCTATCGTAGTAGAAATTCCGTTTTCAATGCGATTAGTATCTTCTCTC---AAAAAAAAAGAA---ATACCGAAATATCAGAATTTACGATCTATTCATTCAATATTCCCATTTTTAGAGGATAAATTTGCACATTTAAATTATGTATCAGATATACTGATACCTTATCCGGTTCATCTAGAAATATTGGTTCAAATTCTACAATGCTGGGTACAGGATGTTCCCGCTTTACATTTATTACGATTGCTTTTTCATGACTATCATAATGGGAGTAATTGCATTACTCCAAAAAAATCTAGTTAT---GGTTTTTCAAAAGATAATCCAAGACTCTATAGGTTCCTATATAATTCTTATGTAGTCGAATGCGAATCCATATTTGTTTTTCTTCGTAAATCATCCTCTTATTTACGATCAACATCTTTTGGATCCCTTCTTGAGCGAACACACTTCTATGGAAAAATGAAA---CATATTGGAGTAACTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGGTATCAAGGAAAATCCATTATGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTGAATTTATGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATACACATAAACCAATTCCCCCATTTTTCTTTCTATTTTTTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCATCCGTGAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACCGTTACTCCAAAATTTGAAACGATGATATCAATTATTCCTATGATTGGGTCATTGGCAAAAGCTAAATTTTGTAATCTATCGGGGAATCCTATTAGCAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTAGAATATGTAGAAACCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTATATCGAATAAAGTATATACTTAGACTTTCATGTGCTCGAACTTTGGCGCGTAAACATAAAAGTACAGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAGTTTTTCGAAGAATTCTTTATGGAAGAAGAAAAAGTTCTTTCTTTAATTTTACCAAGAACTTCTTATCCTTTACAT------CAGTTATAT------------------AGAGAACCTATTTGGTATTTGGATATTGGTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATAAATGATAAAACCGTGTAAATCAATATAGAATAGAAA------------ACAAAATTATCAAG--------TAAAATGTTAGTC-----ATCT---TTATTATGAAATGCTCATACAGTAGTGGTTGAATCAACTGAGTAGTCAGATTTCTTACACTTTCTTTTC------GGGATCTAATCTAAATTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAGACAAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCTGCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACCGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCCGTTGCTGGAGAAGAAAATCAATATATTGCTTATGTAGCGTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAAGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCTAGGCCCACCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACCATCAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCTGAAGCAATTTATAAAGCACAAGCTGAAACAGGTGAAATTAAAGGGCATTACCTAAATGCTACTGCAGGTAATTGTGAAGACATGATGAAAAGGGCTGTGTTTGCTAGAGAATTGGCAGTACCTATTGTAATGCATGACTACTTAACAGGTGGATTCACTGCAAATACTAGTTTAGCAGATTATTGCCGAGACAACGGCCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTCATTGAAAAAGACAGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGTGGCGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGTGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGACCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAATTAGCCGCTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAA----CGATTTGACTTCCT------AAGTCTTTTTCCTCT---TTTCCATTGGTGACTCAAAATTAACTCTATTTTAGAGTTATTC--TACTCCTTCACTAA------AAGATCCGAGCAT-----TTT--------------CCAAGTTTTT--GTGTAATACACGTCCAAATGAAGAT------------------ATATGGAC------AAAGA--------TAGTGAATGGAATTATTCACTATTAACAATCTCTATTCTT------AGGTTAGGTTATCTTTACACT-AT------AATATAAATGTT-----------CAAATTCCTTTTT------------------AAGACCAAA-AAAA---GAAAA--------AGGTAAGGGTTTC------------AAATAAAACTT---TTTTTGTCCTTTTGTT-------------------------AATGGACAAAAACAGAAGC---CCTGG-----AGTAAGATAAGGTGATGCATGTAAAACAGTCGGGTCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATAGGTGCAGAGACTCAATGGAAGATGTTCTAACGA----ATGGAGTTGATTGCGTTG-----GTATCCGGAATTATGCTTT-CTCTC--TAA----------------GAAAGAGTAACCCT------CTATACCTAACACACACGTATATATA--------------------------------CCAACATTTCAAC-------TGATTAATCAGGACCCGAATCCATAATTTTTATTTTTATTAAATATATATCTAATTT--------AAGAGTTATTCTGAATTCATTAC-----AA-ATT------CAAGTAACAGTGGAATGTTAAGTTATCAAATCATTCACTCCAAAGTCTGATTATTT---TATTTTTTCACAATAATAAATTGGACAAGAATAAAGAGAGATTCCCATTCTACATGTCACTACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Lasia_spinosa_AM905749 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAGCAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGATCCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCCAACCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCCTTTTCGCTTCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACACATAAATTATGTATCAGATATACTAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTCGGTTCCTATATAATTCTTATGTAATTGAATGCGAATCCGTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTTTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCCTACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTCTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAGTACTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCCCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTTAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGGATTTCTTATCCTTTACAT------AAGTTATAT------------------GGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGTTCATGAGACCATGTAAATG-ATATAGAACAGAAA------------CCCACACTTTCAAG---AGAGAAAAAATGTCAGTC-----GTTC---TTATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGCGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCGGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATTCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCTGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGGAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATAAAAA--CCCATTCGACTTCCT------AAGTATTTTTCCTCT---TTTCTGTTGGTGGCTCAAAATTAACTATGTTTTCCATTTACTC--TACTCTTTCACA--CACAAAAAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT----ATATGTATGAAGATATATGTAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAA-----------------TCTTCCCTT----------------------GACCCCT-AAAATTCTAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT----TTTTGTCCCTTTAATGGACA--------------------TATGGACATAAACACAAGC---CCCCT-----AGTAAGATAGGGTAATGCATGGGAAATTG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCATATATATATATATA----------------------------CTGATATATCAAA-------CGATTAATTACGACCCGAATCCATAATTTTAATTTATTAAATTAAAAT-TTTTATGAAAAATTT-AAGAGTTATTGTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTNNNNNTCCCTCTATCCCC Lasimorpha_senegalensis_AM905755 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAGCAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACACACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTGATGATCCTGCGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCCAACCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTTCATTTTTGGAGGACAAATTATCACACATAAATTATATATCAGATATATTAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACGAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTCGGTTCCTATATAATTCTTATGTAATTGAATGCGAATCCGCATTAGTTTTTCTCCGTAAACAATCCATTTATTTACGATCAACATCTTTTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATTTTCTGATGAAGAAATGGAAATACTACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCTTCTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAGTACTTCAGCGGTAAAGAGTCAAATGCTAGAGGATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCCCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGCCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGGATTTATTATCCTTTACAT------AAGTTATAT------------------AGAGAACGTATTTGGTATTTGTATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGTTCATGAGACCATGTAAATG-ACATAGAATAGAAA------------CCCACACTTTCAAG---AGAGAAAAAATGTCAGTC-----GTTC---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCCAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCTAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCACTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGCGAAGCTAGCAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATAAAAA--CCCATTCGACTTCCT------AAGTATTTT-CCTCT---TTTCTGTTGGTAGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAACACAAAAAGATCCGAGCAT-----TTTATGTTT-----AGTCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT----ATATGTATGAAGATATATGTAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAA-----------------TCTTTCTTT----------------------GACCCCT-AAATTTCTAGGG-----ATTAGGTAAGGGTTTG----------------AAAACTT---TTTTTGTCCTTTT----------------------------AATGGACATAAACACAAGC---CCCCT-----AGTAAGATAGGGTAATGCATGGGAAATTG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCATTTCTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCATATATATATA--------------------------------CTGATATATCAAA-------CGATTAATTACGACCCGAATCCATAATTTTAAATTATTAAATTCAAAT-TTTTATGAAAAATTT-AAGAGTTATTGTGAACTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Lazarum_brownii ATGGAAGAATTAAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCACTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCTGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTATGGAAATTCCTTTCTCATTGCGACTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTCGTAGTGCTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAGCCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAGTGTCCCAATAAATCCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTATCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCGTTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAG-TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGATTGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Lemna_minor_AM905730 ATGGAAGAATTCAAAGGATATTTA------CAAAAAGGTGGATTTAAACAACAACACTTCCTATATCCACTTCTCTTTCAAGAGTATATTTATGCACTTGCTCACGATCATGGTTTAAATGTA---AATGCATCAA------CTTTTAACGAACCCCCTGAAATTTCAGGTTATGGCAATAAATATAGCTCATTACTTGTGAAACGGTTAATTACTCGAATATACCAACAGAATAGTTTTATCTATTCTGTCAATAATTCTAAGCAAAATAGATTCGTTGGACAC-AATAAGAATTTTTATTATAAAATGATATCAGAGGGTTTTGCTATTGTTGTAGAAATTCCGTTTTCACTGCGATTAGTATCTTCTCTCAAAGAAAAAAAAGAA---ATAACGAAATCTCAGAATTTACGATCTATTCATTCACTATTTCCATTTTTAGAGGATAAATTTTCACATTTAAATTATGTATCAGATATACTAATACCTTATCCGGTCCATCTAGAAATATTGGTTCAAATTCTACAATGCTGGATACAAGATCTTCCCACTTTACATTTATTACGATTGATTTTTCACGACTATCACAATGGGAGTAATAGCATTCCTCCAAATAAATCTAGTTTT---GGTTTTTCAAAAGATAATCCAAGACTCTATAGGTTCCTATATAATTCTTATGTAGTCGAATGCCAATCCATATTTGATTTTCTTCGTAAATCATCCTCTTATTTACGATCAACATCTTTTGGACCCCTTCTTGAGCGAACACACTTCTATGGAAAAATGAAA---CATATTGGAGTAACTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGGTATCAAGGAAAATGCATTATGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTGAATTTATGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATACACATAAACCAATTCCCCCATTTTTCTTTCTATTTATTGGGTTATCTTTCAAGTGTGCCAATAAATCCTTCATCCGCGAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATAGCTTTACTCCAAAATTTGAAACAATGATATCAATTATTCCTATGATTGGGTCATTGGGCAAAGCTAAATTTTGTAATCTATCAGGGAATCCTATTAGCAAGCCAGCTTGGGCAGATTTGTCAGATTCTGATATTATTGATCGATTTGGTAGAATATATAGAAACCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAATATATACTTAGACTTTCCTGTGCTCGAACTTTGGCTCGTAAACATAAAAGTACAGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAGTTTTTCGAAGAATTCTTTATGGAACAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAACTTCTTATCCTTTACAT------CAGTTATCT------------------AGAGAACCCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTA----AATCATTTCGATTT---------ATGATTCATTGGTGATAAAACAGTATAAATC-AAATAGAAAAAAAC------------------TTATCAAG--------TAAAATCTTAGTC-----ATCT---TTATTCTGAAATGCTCATACAGTAGTGGTTGAATCAACTGAGTAGTCAGTTTTCTTACA----CTTTTC------GGGATCTAATCTAAATTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCGCGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAGACAAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCCGTTGCTGGAGAAGAAAATCAATTTATTGCTTATATAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACCTCCATTGTAGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTTTGGAAGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCACCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACCATCAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAAGCCGAAACAGGTGAAATTAAAGGGCATTACTTAAATGCTACTGCAGGTACTTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCTAGAGAATTGGGAGTCCCTATTGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTTCTTTAGCATATTATTGCCGAGACAACGGCCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGGGGGGATCACGTTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACAGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGTGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGTGGCGGAACTTTAGGACACCCTTGGGGAAATGCACCAGGTGCTGTAGCTAGCCGTGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGACCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAACTGGAGTCCTGAATTAGCGGCTGCTTGTGAAGTTTGGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAA----CGATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCT-------------ATTGACTAT--------TTC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTTT-----------AAG-------------------------------------------------------------------------------ACAAAA-A-----------------------AAG------------------AAAAAAAA-----------------------------------------------AATGGACAAAAACAGAAAC---CCTGG-----AGTAATATAAGGTGACGCATGTCAAATAG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNNNNNNNTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATGAAAAAGGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGATGTTCTAACGA----ATGGAGTTGATTGCATTGCGGTGGTATCTGGAATTATTCTTT-CTCTC--TAA----------------GAAAGGGTAACCCT-----------CTTAACACGCACATATATA----------------------------------CTGCAAC-------------TGATTAATCAGGACCCGAATCCATAATTTTTATTTCTATCA-ATAATTTTCTAAATT--------AAGAGTTATTCTGAATTCATTCC-----AA-ATT------CAAGTAATAGTGGAATATTCAGTGATCAAATCATTCACTCCAAAGTGTTATTTTTT-----TTTTCAAAAAATAATAAATTGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCACTACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Lysichiton_americanus_AM905728 ATGGAAGAGTTAAAAGGATATTTA------GAAAAAGATAGATCTCGGCAACAACACTTCCTATATCCGCTTATCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAA---TA---AAGGGATCAA------TTTTTTACGAATCCACGGAAATTTTAGGTTATGACAATAAATCCAGCTCATTACTTGTTAAACGTTTAATTACTCGAATGTATCAACAGAATTATTTGATTAATTCGGTTAAGGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTTTTCTCAAATGCTATCAGAGGGTTTTGCAGTCATTGTGGAAATTCCCTTCTCGCTACGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAGATCTCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAGGACAAATTCTCACATTTAAATTATGTGTCAGATATATTAATACCCTACCCCATTCATCTTGAAATCTTGGTTCAAATTCTACAATGCAGTATACAAGATCTTCCCTCTTTGCATTTATTGCGATTCTTTCTTCACGAATATCATAATTGGAATAGTCTCATTACTCCAAATAAATCTAGTTAC---ATTTTTTCAAAAGAAAATAAAAGACTATTTCGGTTCCTATATAGTTCTTATGTATTTGAATGGGAATCTATATTAGTTTTTCTACGTAAGCAATCCTCTTATTTACGATTAACATCTTACGGATCTTTTATTGAGCGAACACTTTTCTATGGAAAAGTGGAA---CATCTTTTAGTAGTTTGTCGTAATGATTTTCAGAAGACCCTATGGTTATTCAAGGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGAACTCATCTTATGATGAAGAAATGGAAATGTCACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCGTACAGAATCCATATAAAGCAATTCTCAACTTATTCCTTCTATTTTCTGGGCTATCTTTCAAGTGTGCTAAAAAGTCCTTCCGCGGTTAGGAGTCAAATGTTAGAGAATTTTTTTTTAATAGATACTGTTACTAATAAATTCGATATTATAGTCCCAATTATTTCTATGATTGGATCATTGTCTAAAGCTAAATTTTGTAATGTATCAGGGCATCCTATTAGTAAGCCGGTTTGGGCCGATTTGCCGGATTCTGATATTATTGATCGATTTGGTAGGATATGTAGAAATCTTTCTCATTATCACAGTGGATCCTCAAAAAAACAGAGTTTGTATGGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTCGGCTCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTGGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTTTTTTTTCCAAGAACCTCTTTTCCTTTACAT------AGGTCATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATCAATGACTTGGTG----AATCATTT---------------ATGATT----GGTTATGAGACTCTGTAAAAA-AAATGGAATAGAAATGATCTA---TCTATAAATGATCAAG---AGATAAAAAA-TTCATTC-----ATTTTTTGAATTCTGAAATGCTCATA-----GTGGTTGAATCAATTACGTAGTCAAGTTTATTAGACTTTCTTTTC------GGGATCT-----AGGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAAATGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTGCTCAACCCGGAGTTCCACCTGAAGAAGCAGGTGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGGCCATTGTTGGAGAGGAAAATCAATTTTTTGCTTATGTAGCGTACCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCTTTACGAGCTCTACGTCTGGAGGATCTTCGAATTCCTCCGGCTTATTCCAAAACTTTCCAAGGCCCACCCCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCGCAGGCCGAAACAGGTGAAATCAAAGGACATTATTTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTTCCCATCGTAATGCATGACTACTTGACAGGGGGATTCACTGCAAATACTAGTTTGTCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTAGAAGGTGAACGTGGGATGACTTTGGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCCGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTGTTGAAGGTAATCAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTATGGAAGGAGATCAAATTTGATTTCGCTCCAGTAGATCCGGATCCGAAAAAA----CAATTTGACTTCCTAAGTATAAGTATTTTTCCTCTT--TTTTCGTCGGTGGTTCAAAATTCACTATGTTTTCCATTCACTC--TACTATTTCACAAA------CGGATCCGCGCAG-----TTTGTGTCT----TATCCCAAGTTTTT--GTACGATACACGTACAAATAAACAT------------------ATATGGGC------AAGGAATCTCCATTATTGAAT------------TATTCACAGTCCATATTTTT---------------------------------------------------------------------------------------------AC------------------------------------------------------------------------------------------------------------GG-CATAAACATAAGT---CCTCT-----AGTAGGATAA-----CGCATGGGGAATGG-----CCGGGATAGCTCAGTTGGTAGAGCAGAGGAC-GANNNNNNNNNNNNNNNTGGAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATTAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GTGAAAAAGGAGGTTTTTATATATATAAAATATAAAAACTAGAATAAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGAATGGAGTTGACTGCGTTGCGTTGGTAACTGGAATTCTTCCTT-ATATC--GAAATTACA----------GAAAGGATGACTCT------ACATACCTAATACGTACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATTACGACCTGAATCCATAATTTATATTTATATAAATAATTAAATTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCCAATCCAA-ATT------AAAGGAAGAGTCGAATATTCATTGATCAAATCATTCACTCCGAAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTTGAAATCGTGGGGGTTCAAGTCCCTCTATCCCC Mangonia_tweedieana_AM905766 ATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCGCGGGATTTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAGTTTTTATTCTCAAATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTCGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCCTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAAAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCAAAGACTATTTTGGTTCCTATATAACTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGACCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACGAATTCTCCAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAGTCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATGACTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATTGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTAGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTCCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCA------------------------CATTGGTCATGAGACCACGTAAATG-AAATAGAATAGAAA------------CAACAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTCGAATCAGCTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAACCGTTGTTGGGGAGGAAAATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCCATTTTTAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAACCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTCCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGGGTAGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGTAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATACGCTAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCATTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGGTTAGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTAACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATCAAAA---------AAAAAGTCTTCCTTTTTATTTAA--ATTT------AAGACCCCC-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------AAAATCAAACTT---TTTCTGTCCTTTT----------------------------AATAGACATAAAAACAAGC----CCCT-----AGTAAGATAAGGCGATAGATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGGGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGA----ATGGAGTTGATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTTTTATTTTATAAATTCAAAA-TATTATGAAATATTT-AAGAGTTATTGTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCATTGATCAAGTCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATAAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Monstera_adansonii_AM905743 ATGGAAGAATTCAAAGGATATTTAGAAATAGAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCATGGTTTAAATGTA---AATGGATCAATATCCATTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATAGATTCGTTGGGCAC-AACCAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCCATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTCTTTTTTCATGAATATCATAATTGGAATAATCTCATTACTCCAAGGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTTCTATATAATTCTTATGTAGTTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATTTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCCATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTATTAATAAATCCTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTTATAGATACTGTTGCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTATTTCTTTAATCTTACCAAGAATTTCTTATTCTTTACATTTACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATAA-----------ATGATTGATTCATTGGTCATCAGACCACGTAAATG-AAATAGAATAGAAA------------CCCAAATTAACAAG---AGAGGAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTTAGTATTCAAGTTTTTTAGACTTTCTTTTCCTTTTCGGAATGTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGGAAACTGCANNNNNNNTCAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTATTGGGGAGGAAGATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTATAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCTGTACTACAGTTCGGTGGAGGAACTATAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGTAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAGTTCAAACCAGTAGATACGATAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTTT---TTTCCATTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TATT-----ACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCAC-----GCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATCAAA-------------AAGTCTTCCTTTTTTT----------------AAGACCCAA-AAATTTCCAGGG-----------TAAGGT--------------------AAAACTT---TTTTTGTCCTTTT----------------------------TATGGACATAAACACAAGC---CCTCTAATCTAATAAGATAAAGTGATGCATGGAAAACGG-----TCGGGATAGCTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAAA---------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTTGTCTTT-CTATC--TAATTTACT-----TTACAGAAAGGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATTAAA-------CGATTAATCACGACCCGAATCCATAATATTTATTTATTAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTTGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATCAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGANNNNNNNNNNNNNNNNNNNNNC Montrichardia_arborescens_AM905818 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAATAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCACAGAAATTTCAGGTTATGACAATAAATTTAACTCATTACTTGTGAAACGTTTAATTACTCGAATATACCAACAGAATTATTTGACCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAATAATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCCGATATATTAATACCCTATCCCGTTCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGGGAATCCAAGACTATTTCGGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTAATAAAGAAATGGAAATCTTATTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTTTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGTGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTGGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGACATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGCGACCATGTAAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGTACGGTCAAAGCTGGTGTTAAAGATTACAAATTAACTTATTATACTCCTGACTATGAGACAAAAGATACCGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACGACTGTGTGGACTGATGGACTTACCAGCCTTGACCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCCAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCCGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAATCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCGAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAATTCAAACCAGTAGATACGCTAGATATAAAAA--CCCATTTTACTTCCT------AAGTATTTTTCCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAACCCAGGGTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------GGGGTATCCTTACACTTAT-----AAATATAAAA-------------AAGTCTTCTTTTTT--------ATTT------AAGACCCAA-TAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTTTGTCCTTTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGACGATGCATAGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTGTTTTGAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGTTGTTCTAATGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTTTTATTTATATAAACAAATAATTTTATGAAAAATTT-AAAATTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTAATTGATC-----TTTTGAAAAAATGATTAATCAGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Nephthytis_afzelii_AM905759 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGTTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCAGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTAATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGTCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGCCATTGTGGAAATTCCTTTCTTGCTGCGATTAGCATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCTGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCAAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCCTATATAATTCTTATGTAGTTGAATGTGAATCTATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGACCCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGGACAACATCTTATAGTACTTTGTTGTAATGATTTTCAGAAAACTCTATGGTTGTTCAAGGACCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAATCTTTCAGCAGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTCCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATAACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAATAGAATAGAAA------------CTCAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCGCGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACTACATCGAACCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTAAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTGTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTATAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATGTGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTGAT-----AAATATCAAA-------------AAGTCTTCCTTTTT--------ATTT------AAGACCCAA-AAAATTCCAAGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTATGTCCTGTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAAGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTNNNNNNNNNNNNNNNNNTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTGTTTTGAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTTTTATTTATTGAATTCAAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTGG-----TCATTGATCAAATCATTAACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTTTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Orontium_aquaticum_AM905729 ATGGAAGAGTTAAAAGGGTATTTA------GAAAAAGATAGATCTCGGCAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTA---------AACGGATCAA------TTTTTTACGAATCCATGGAAATTTTAGGTTATGACAATAAATTCAGCTCATTACTTGTTAAACGTTTAATTACTCGAATATATCAACAGAATTATTTGATTAATTCTGTTAATGATTCTAATCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTTTTCTCAAATGCTATCGGAGGGTTTTGCAGTCATTGTGGAAATTCCCTTCTCGCTACGATTAGTATCTTCCTTCGAAGAAAAAAAGGAA---ATACCAAAATCTCAAAGTTTACGATCTATTCATTCAATATTTCCTTTTTTAGAGGACAAATTATCACATTTAAATTATGTGTCAGATATATTAATACCCTATCCCATTCATCTTGAAATCTTGGTTCAAATTCTACAATGCTGTATACAAGATCTTCCCTCTTTGCATTTATTGCGATTCTTTCTTCACGAATATCATAATTGGAATAGTCTCATTACTCCAAAGAAATCTAGTTAC---ATTTTTTCAAAAGAAAATCAAAGACTATTTCGGTTCCTATATAATTCTTATGTATTTGAATCGGAATCTATATTCGTTTTTATCTGTAAGCAGTCCTCTTATTTACGATCAACATCTTACGGATCTTTTATTGAGCGAACACATTTCCATGGAAAAGTAGAA---CAGCTTATAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGAACTCATCTTCTGATGAAGAAATGGAAATATCACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCGCACAGAATCCATATAAACCAATTCTCAACTTATTCCTTCTATTTTCTAGGCTATCTTTCAAGTGTACTAAAAAATCCTTACCCGGTTAGGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAGAAATTCGATACTCTAGTCCCAATTATTCCTATGATTGGATCATTATCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTATTAGTAAGCCGGTTTGGGACGATTTGCCGGATTCTGATATTCTTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATCACAGTGGATCCTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTCGGCTCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAGAGATTGGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAATTCTTTCTTTGATTTTACCAAGAACTTCTTTTCCTTTACAT------AGGTCATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATCAATGACTTGGTA----AATCATTT---------------ATGATT----GGTCATGAGACCCTGTAAATA-AAATGGAATAGAAACGGTCTATAGTCTATAAATGATCAAG---AGAGAAAAAA-TGCATTC-----ATTT---GAATTCTGAAATGCTCATA-----GTGGTTGAATCAATTGCGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCT-----AGGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAAATGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGTGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGACCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCGTACCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCTTTACGAGCTCTACGTCTGGAGGATCTTCGAATTCCTACGGCTTATACAAAAACTTTCCAAGGCCCACCCCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCGCAGGCCGAAACAGGTGAAATCAAAGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGAACAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTCCCCATCATAATGCATGACTACTTGACAGGTGGATTCACTGCGAATACTAGTTTGTCTCATTATTGTCGAGACAATGGCCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATACATTTCCGTGTACTAGCTAAAGCATTACGTATGTCCGGTGGAGATCATATTCACGCCGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTGGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGACGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCCGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCACTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCCGGTGCAGTAGCTAATCGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTGTTGAAGGTACTCAAATTATCCGTGACGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTATGGAAGGAGATCAAATTCATATTCCCTGCAGTAGATCCGGACGNNAAAAA----CCATTTTGACTTCCTAAGTATAAGTATTTTTCCTCTT--TTTTCGTCGGTGGTTCAAAATTCGCTATGTTTTCCATTCACTC--TACTATTTCACAAA------CGGATCCGCGCAG-----TTTGTGTCT----TATCCCAAGTTTTT--GTACGATACACGTACAAATAAACAT------------------ATATGGGC------AAGGAATCTCCATTATTGAAT------------TATTCACAGTCCATATTTT----------------------------------------------------------------------------------------------AC------------------------------------------------------------------------------------------------------------GG-CATAAACATAAGT---CCTCT-----AGTAGGATAA-----CGCATGGGGAATGG-----CCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGAAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATTAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----ACGAAAAAGGGGGTTTTACTATATATAAAATATAAAAACTAGAATCAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGACTGCGTTGCGTTGGTAGCTGGAATTCTTCCTT-CTATC--GAAATTACA------TACAGAAAGGATGACCCT------ATATACCTAATACGTACGTATATATA--------------------------------CTGACATATCAAA-------TGATTAATCACGACCTGAATCCATAATTTCTATTTTTAGAAATAATCCATTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCTAATCCAA-GTT------GAAGGAAGAGTCGAATATTCATTGATCAAATCATTCACTCCGGAGTCTGATTTATC-----TTTTGAAAAAATGATTAATCGTACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Pedicellarum_paiei_AM905733 ATGGAAGAATTCAAAGAATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTATTCATGATCGTGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCACGGAAATTTCCAGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATAGATTCGTCGGGCAC-AACCAAAATTATTATTCTCAAATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCGTTCTCGCTGCGATTAGTACCCTCCCTCGAAGAAAAAAAAAAAGAAATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTCGAAATTCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTATATTTATTACGATTCTTTTTTCACGAATATCATAATTGGGATAATCTTGTTACTCCAAAGAAATCTAGTTAT---GATTTTTCAAAAGAGAATCCAAGACTATTTAGGTTCTTATATAATTCTTATGTAGTTGAGTGCGAATCTATATTAGTTTTTTTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTATTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAATTCTATGGTTATTCAAAGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGACTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTGAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCCCCAGTTTTTCTTTCTATTTTATGGGTTATCTTTTAAGTGTACAAATAAATCTTTCAGCGGTAAACAGTCAAATGCTAGCGAATTCTTTTTTAATAGATACTATTGCTAAAAAATGGGAAACTATACTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAATTTTGTAACGTATCAGGGAATCCTATTAGTAAGCCAGTTTGGACCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAAAGTTTGNNNNNNNNNNNNNNNNNNNNNNGACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTATTATCCTTTACATTTACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATAACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAATAGAATTGAAA------------TCAAAATTACCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAATAATAGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGAATCTAATCTCAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAATTGCAAGCCCGATCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGCGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACCGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGATTACTTAACAGGAGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGGGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGGCAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTATAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCGAACCAGTAGATAAGCTAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTTCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCAT-----TCTTTGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTTATTATTTGCA---------------------------------------------------ATCA---------------AAGTCTTCCTTTTT------------------AAGACCCCA-AAAATTCCAAGG-----------TAAGGGTTTT----------------AAAACTT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGC---CCTCTAATCTAATAAGATAAGGTGATGCACGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAA-----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAATTTACA----------GAAAGGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTAACATATCAAA-------CGATTAATCACGACCCGAATCCATAATTTTTATTTATATTATAAAAAA-TATCATGAAAAATTTTAAGAATTATTGTGAATCCATTCCAA-CCAA-ATT------GAAATAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAGAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Peltandra_virginica_AM905815 NTGGAAGAATTAAAGGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCAGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTAAAACGTTTAATTACTCGAATGTACCAACAGAATTTTTTGATCAATTCTGTTAATGATTCTAAACAAAATAGATTCGTTGGGCAT-AACAAGAATTTGGATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCTTCCCTCGAAGCAAAAAAAGAA---ATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTCTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATTTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCACCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGCTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTAAAATGCTAGAGAATTCTTTTTTAATAGATACTGTGATTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATATTTCGACTTTCCTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTATTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTAGTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATAGAATAGAAA------------CTCAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGCCGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCCGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATACGAACCAGTGGATAAGCTAGATAAAAA----CCCATTTTACCTCCTAAGTT-AAGTATTTTTCCTCT---TTTCCGTCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGCTTAGTTTAACACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTAACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTTTTCCTTTTTTTTT--------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACCT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAGCCCCT-----AGTAAGATAAGGCAATGCATGGAAAAAGG-----TCGGGATAGCTCAGTTG-TAGAGCAG-GGACTGAA--TNNNNNNNNNNNNGC-T-TGAGC-TTAGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTGTTTTTTTGAGAAAAAG----------------------------------------------GGATAGGTGCAGAAACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CAATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTCAATA-TTTTATGAAAAAATA-AAGAGTTATTGCGAATCCATTCT-----AA-ATT------GAAGTAAGAGTTGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCAGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Philodendron_deltoideum_AM905775 ATGGAAGAATTAAAAGGATTTTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTTCTCATGATCATGGTTTAAATGTA---AATGGATCAA------ATTTTTATGAACCCGCGGAAATTTCAGGTTATAACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAAAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATGCCTTTCTCGCTGCGGTTAGTATCCTCTCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCCAATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTTCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATTTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAATTCCTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTATAGTATTTTGTTGTAATGATTTTCAGAAAACCCTAGGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATATTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCGCATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAATCCTTTAGCGGTAAAGAGTCAAATGCTAGAGGATTCCTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCGTTGTCAAAAGCTAAATTTTGTAATGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTATCAGATTCTGACATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTATAGCGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCTTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAAAATTTCTTATCCTTTAGAT------AAGTTATAT------------------AGAGAACGAATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTTGGTGAATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCGTGCAGTAATGGTTGAATCAACTGAGTATTCAAATTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGAATTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTAAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCAAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCGGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGCTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTATCTTTAGAAGCATGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATAAAAC--CCCATTTGACTTCCT------AAGTCTTTTTCCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTT-CCATTTACTC--TATTCTTTC-----------AAGATCCGAGCGT-----TTTATGTTTTGTTTAGCCCAAGTTTTT--GTGCAATACATGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTAGAGTATTGAAT-----TATTTACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAG-----GAATATCAAA-------------AAGTCTTCTTTTTT--------ATTT------AAGACCAAA-AAATTTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT----TTTTGTCCTTTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGGTGGTAGAGAGGAGGANNNNNNNNNNNNNNNNNNNTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGTTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATT---ATTTTTTAAATAAAAAA-TTCTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTCAAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Philonotion_americanum NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCCC------ATTTTTATGAACCCGCAGAAATTGCAGATTACGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTATCAAATGATATCAGAGGGTCTTGCTGTCATTGTGGAAATTCCTTTCTTACTGCGGTTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTATTTTTTCACGAATATCATAATTGGAATAATCTCATTACTTTAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTCTTTTTATTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTATAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATGCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTTACTAAAAATTTGGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCCGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCGGATTCTGATATTATTGATCGATTTGGTTGGATATGTAGAAATCTTTTTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAAATTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATGAATGACTTGGTG----AATGATTT---------------ATGATTCATTGGTCATAAGACCATGTAAATG-AAATAGAATAGAAAA------------AAAAAT-CTCAAG---AGAGATAAAATGTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAACGGTTGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN--AAAGA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCGCTAGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATTCGAGCGT-----TTTATGTTTAGTTTAGCCCAAATTTTT--GTGCAATACACGTACAAATGAAGAT--------------ATATATATGTAC------AAAGGCTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTATT-----------AGGTTATCCTTATGCTTAT-----AAATATCAAA-------------AACTCTTCCTTTTATTTA----ATTT------AAGACCCCC-AAAATTCCAGGG-----GTTAGGTAAGGGTTTT----------------AAAACTT----TTTTGTCCTGTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Phymatarum_borneense_AM905783 ATGGAAGAATTAAAAGGATATTTA------GAAAAAACTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------ATTTTGATGAACCTGCGGAAATTTCAGATTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCCAATGATATCAGAGAGTCTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCTTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACAATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCTAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTTATTCCTATATAATTCTTATGTAGTTGAATGCGAATCCCTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATTTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCAAAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAATCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTTACTAAAAATTTGGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCAGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCAGATTCTGATATTATTGATCGATTTGGTTGGATATGTAGAAATCTTTTTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATGAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAAT------------------------AAAAT-CTCAAG---AGAGATAAAATGTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAATAGTCAAGTTTTTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCACTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGACAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATAGGGTAGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATAAAGA--CCCATTTTACTTCCT------AAGTATTTTTCCTCT---TTTCCGCTAGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATATACGTACAAATGAAGAT----------------ATATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTATT-----------AGGTTATCCTTATGCTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTTTT---------------AAGACCCCC-CAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTTTGTCCTGTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTGCA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTTGAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAATCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTTATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Pinellia_pedatisecta_AM905807 ATGGAAGAATTTAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCTGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTTGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACTAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCCTTTCTCACGAATATTATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGTTCTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTTTCCGTAAACAATCCTCTTATTTACGATCAACATCTTTTAGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTCGTAGTACTTCGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTTATACATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAAATTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAGCCAATTCTCCATTTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTCCCAATAAATCCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCCAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCGGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCACTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCGTTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-TGTTAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACCGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGAGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTATTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGAAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTGCAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATAAAAAA----CCATTTGACCTCCT------AAGTATTTTTCCTCC---TTTCCGCCGTTGAAAAAAAATTCACTATGTTTTCCATTTACTC--TATTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT------------------ATATGTAC------AAAGGCTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAATCTTCTTTTTTTTT---------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT-----TTTGTCCTTTT----------------------------AATAGACATAAACACAAGCAAGTCCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTT-GAGAAAAAAA---------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCCAATCCATAATTTTTATT---GAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCCATTCT-----AA-ATTGAAATTGAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGGGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Piptospatha_ridleyi_AM905781 ATGGAAGAATTAAAAGGATATTTA------GAAAAAACTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------ATTTTGATGAACCTGCGGAAATTTCAGATTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCCAATGATATCAGAGAGTCTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCTTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACAATCCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCTAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTTATTCCTATATAATTCTTATGTAGTTGAATGCGAATCCCTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCCAAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATGGATACTGTTACTAAAAATTTGGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCAGATTCTGATATTATTGATCGATTTGGTTGGATATGTAGAAATCTTTTTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATGAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATGTAAATGAAATAGAAA------------CAAAAAT-CTCAAG---AGAGATAAAATCTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAATAGTCAAGTTTTTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAGAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGACAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGAGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATAGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATAAAGA--CCCATTTTACTTCCT------AAGTATTTTTCCTCT---TTTCCGCTAGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATCTTTAGTTTAGCCCAAGTTTTT--GTGCAATATACGTACAAATGAAGAT----------------ATATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTATT-----------AGGTTATCCTTATGCTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTTTT---------------TAGACCCCC-AAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTTTGTCCTGTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTGCA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTTGAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAATCGAATATTCAG--------------ACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Pistia_stratiotes_AM905799 ATGGAAGAATTCAAAGGATATTTC------GAAAAGAGTGGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCCA------TTTTTTATGAACTCCCGGAAATTTCCGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAGTATACCAACAGAATTATTTGATCAATTCTGTTAATCATTCTAACCCCAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTAGAAATTCCTTTCTCATTGCGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAATTTCTCACATTTAAATTGGATATCAGATATACTAATTCCTTATCCCGTACACTTAGAAATGTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGGGTAATCCCATTACTCCAAGGAAATCCAACTATTATGGTCTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAATTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATTTTATGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCTTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCGCTTTTGGTCTCAACCTGGTAGGATCCACATAAGCCAATTCTCAAAATTTTCGTTCTATTTTCTAGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATATTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATAATTGGATCATTGTCAAAAGCGAAATTTTGTAACGTATCGGGGAATCCCATTAGTAAGCCAGTTTGGGCGGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGAAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCGGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATAACTTAGCG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATCTAAATG-AAATCAAATAGAAA------------CTCACATTCTAAAG---AGAGAAAAA-TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATATATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCNNNNTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAGACAAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCAGGGGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCTGTTCCTGGAGAAGAAAGTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCCGTTACCAACATGTTTACTTCCATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTGCGTCTAGAGGATTTGCGAATTCCTCCCGCGTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTTTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCGGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAGTTAGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGCGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATAACTTTAGGTTTTGTTGACTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATCCCTGTCGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGAGACGATTCCGTCTTGCAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATAGGGTAGCTTTGGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGCAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGAAATCAAATTCGAATACCAACCAGTTGATACGATTTNNAAAA-----TCCATTTTACCTCCTAAGCT-AAGTATTTTTCCTCC---TTTCTGCCGGAAACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCAAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACATACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTCTTGAAT-----TTTTTACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAATCTTCCTTTTT--------ATTT------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTTTTTTTTTGGTCCTGTT----------------------------TATGGACATAAACACAAGCAAGTCCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA-TCCTCGTGTCANNNNNNNNNNNNNNNNNNATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTTAAGAAACAAA---------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACATATATATA--------------------------------CTGGCATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTCAAAA-TTTTATGAAAAATTA-AAGAGTTATTGCGAAGCCATTCT-----AA-ACT------TAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNC Podolasia_stipitata_AM905752 ATGGAAGAATTGAAAGGATATTTA------GAAAAAAGTAGATCTAAACAGCAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGATCCCACGGGAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCCAACCAAAATAGATTCGTTGGGCAC-AACAAGAGTTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACACATAAATTATGTATCAGATATACTAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTCGGTTCCTATATAATTCTTATGTAATTGAATGCGAATTCGTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTTTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCCTACCTTGTCAATTTTTGGCAATGTCATTTTAACTTTTGGTCTCAACCCTCTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAGTACTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATATTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCCCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGGATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGTTCATGAGACCATGTAAATG-ACATAGAATAGAAA------------CCCACACTTTCAAG---AGAGAAAAAATGTCAGTC-----GTTC---TCATTCTGAAATGCTCATGCAGTAATCGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGAGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCCAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACTTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATAAAAA--CCCATTCGACTTCCT------AAGTATTTTTCCTCT---TTTCTGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT----ATATGTATGAAGATATATGTAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAA-----------------TCTTCCTTT----------------------GACCCCT-AAAATTCTAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTTTGTCCTTTT----------------------------AATGGACATAAACACAAGC---CCCCT-----AGTAAGATAGGGTAATGCATAGGAAATTG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCATATATATATATA------------------------------CTGATATATCAAA-------CGATTAATTACGACCCGAATCCATAATTTGAATTTATTAAATTCAAAT-TTTTATGAAAAATTT-AAGAGTTATTGTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATTTTCAGTGATCAAATCATTCACTCCAGAG------TGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Pothoidium_lobbianum_AM905734 ATGGAAGAATTCAAAGAATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTATTCATGATCGTGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCACGGAAATTTCCAGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATAGATTCGTTGGGCAC-AACCAGAATTTGTATTCTCAAATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCGTTCTCGCTACGATTAGTACACTCCCTCGAAGAAAAAAAAAAAGAAATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTCGAAATTCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGGATAATCTAGTTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCTTATATAATTCTTATGTAGTTGAATACGAATCTATATTAGTTTTTTTCCGTAAACAATTCTCTTATTTACGATCAACATCTTCTGGAACCTTTATTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAATTCTATGGTTATTCAAGGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGACTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTGAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCCCCAGTTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACAAATAAATCTTTCAGCGGTAAACAGTCAAATGCTAGCGAATTTTTTTTTAATAGATACTATTGCTAAAAAATGGGAAACTATACTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGTCAGTTTGGACCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAACAGTTTGATCGAATAAAATATNNNNNNNGACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACATTTACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATAACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAATAGAATTGAAA------------TCAAAATTACCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAATAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAATTGCAAGCACGATCAAAGCTGGTGTTAAAGATTACAAATTGAATTATTATACTCCTGATTATGCGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACCGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTACTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGATTACTTAACAGGAGGATTCACTGCAAATACTAGTTTAGCTTATTATTGCCGGGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCGAACCAGTAGATAAGCTAGATATAAAAA--CCCATTTGACTTTCT------AAGTATTTTTCCTCT---TTTTCGTTGGTGGCTCAAAATTCACTACGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCAT-----TTTTTGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCATTATTTGCAATCTACGTCGTT-----------AGGTTATCCTTACACTTA----------ATCAAA-------------AAATCTTCCTTTTT------------------AAGACCCCC-AAAATTCCAAGG-----------TAAGGGTTTT----------------AAAACTT----TTTTGTCCTTTTCTTTT-----------------------AATGGACATAAGCACAAGC---CCTCTAATCTAATAATCTAAGGTGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGAAATTCTTCTTT-CTATC--TAATTTACA----------GAAAGGATAACCCT------ATATACCTAATGCGCACGTATATATA--------------------------------CTAACATATCAAA-------CGATTAATCACGACCCGAATCCATAATTTTTATTTATATTATAAAAAA-TTTCATGAAAAATTTTAAGAATTATTGTGAATCCATTCCAA-CCAA-ATT------GAAATAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAGAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Pothos_scandens_AM905732 ATGGAAGAATTCAAAGAATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATACCCGCTTCTCTTTCAAGAGTATATTTATGCATTTATTCATGATTGTGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCACAGAAATTTCCAGTTATGACAATAAATCTAGCTCATTACTTGCGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATAGATTCGTTGGGCAC-AACCAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCGTTCTCGCTGCGATTAGTACCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTCGAAATTCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGGATAATCTCGTTACTCCAAAGAAATCTAGTTAT---GATTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCTTATATAATTCTTATGTAGTTGAATACGAATCTATATTAGTTTTTTTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTATTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAATTATATGGTTATTCAAGGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGACTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTGAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCCCCAGTTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACAAATAAATCTTTCAGCGGTAAACAGTCAAATGCTAGCGAATTTTTTTTTAATAGATACTATTGCTAAAAAATTTGAAACTATACTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAATTTTGTAACGTATCAGGGAATCCTATTAGTAAGTCAGTTTGGACCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAACAAAACAAAGTTTGTATCGAATAAAATATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGGATTTCTTATCCTTTACATTTACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGGCCATGTAAATG-AAATAGAATTGAAA------------TCTAAATTACCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAATAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGGAA-TTGCAAGCNNNNTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGCGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACCGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGATTACTTAACAGGAGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGGGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGCAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCGAACCAGTAGATAAGCTAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTTCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTGACAAA------AAGATCCGAGCAT-----TTTTTGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCATTATTTGCAATCTACGTTGTT-----------AGGTTATCCTTACACTTA----------ATCAAA-------------AAATCTTCCTTTTT------------------AAGACCCCA-AAAATTCCAAGG-----------TAAGGGTTTT----------------AAAACTT----TTATGTCCTTTT----------------------------AATGGACATAAACACAAGC---CCTCTAATCTAATAA-----GGTGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAATTTACA----------GAAAGGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTAACATATCAAA-------CGATTAATCACGACCCGAATCCATAATTTTTATTTATATTATAAAAAA-TTTCATGAAAAATTTTAAGAATTATTGTGAATCCATTCCAA-CCAA-ATT------GAAATAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTTTGATTGATC-----TTTTGAAGAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNN Protarum_sechellarum_AM905805 ATGGAAGAATTAAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCGGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATGGATTCGTTGGACAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCGCTTTTGGTCTCAACCCAGTAGGATCCACATAAGCCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCAGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCCAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATAAAAAA----CCATTTTACCTCCT------AAGTATTTTTCCTCC---TTTCCGCCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT------------------ATATGGAC------AAGGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAATCTTCCTTTTTTTTT--------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------CAAACTT-----TTTGTCCTTTGA----------------------CTTTTAATGGACATAAACACAAGCAAGTCCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTTGAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTCCAAA-TTTTATGAAAAATTA-AAGAGTTATTGCGAATCCATTCT-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGCCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Pseudodracontium_lacourii_AM905786 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCGAAACAACAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCCA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGCGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTTCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCTTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTGCGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTACCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAAGAATCTCATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTCTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAACGAGCACATTTCTATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCACTTTTTGGCAATGTCATTTTCACTTTTGGTCTAAACCCTGTAGGATTCACATAAACCAATTCTCAAATTTTTTTTTCTATTTTCTGGGTTATCTTTCAAGTGTATCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAGTGGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGAGCATTGTCAAAAGCGAAATTTTGTAACGTATCAGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCCGATTCTGATATTATTGATCGATTTGGTCGGACATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACAGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGCTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAGCGCGTTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGATCATGAAAATG-AAATAGAATAGAAA------------CACAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGACCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGNNNNNNNNNNNNNNNNNNNNNNNNNTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCGAAGGCCCACCTCACGGTATCCAAAGCGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGTGTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACCTAACAGGGGGATTCACCGCAAATACGAGTTTGTCTCATTATTGCCGAGACAATGGTCTATTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGTATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCCGGTGGGGACCATATTCACGCCGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATAAAAA-----CCATTTTACCTCTT------AAGTATTTTTCCTCT---TTTCTGTCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTTAAT-----TTTTCACTATTCACAATCTATATCGTT-----------AGGTTATCCTTACACTTAT-----AAGTATCAAA-------------AGGTCCTCCTTTTT--------ATTT------AAGACCAAA-AAATTTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACAT----TTTTGTCCTTTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGGTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAGGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATAATTCATAATTAAATTCAAAA-TTTTATGAAAAATTA-AAGAGTTATTGCGAATCCATTCT-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATT-----------------------------TGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Pseudohydrosme_gabunensis_AM905760 ATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGTTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCCA------TTTTTTATGAACCCGCAGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTAATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGCCATTGTGGAAATTCCTTTCTCGCTGCGATTAGCATCCTCCCTCGAAGAAAAAAAAGAA---ATACCCAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCTGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCAAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTGGGTTCCTATATAATTCTTATGTAGTTGAATGTGAATCTATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGACCCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGGACAACATCTTATAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGACCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTTTGGCTTCAAAAAGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAATCCTTCAGCAGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTCCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAATAGAATAGAAA------------CCCAAATTATCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGNNNNNNNNNNNGTTAAAGATTACAAATTGACTTATTATACTCCCGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGCAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCTGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTGTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGCGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTGCAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGCAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATGTGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCGCAATCTATATTGTT-----------AGGTTATCCTTACACTGAT-----AAATATCAAA-------------AAGTCTTCCTTTTT--------ATTT------AAGACCCCA-AAAATTCCAAGG-----ATTAGGTAAGGGTTTT----------------CAAACTT---TTTTTGTCCTGTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAAGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTGTTTTGAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTTTTATTTATTGAATTCCAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTGGAATATTCATTGATCAAATCATTAACTCCAGAGTCTGATTAATC-----TTTTGAAAAATTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Pycnospatha_arietina_AM905751 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAGCAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGATCCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCCAATCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACACATAAATTATGTATCAGATATACTAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTCGGTTCCTATATAATTCTTATGTAATTGAATGCGAATCCGTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTTTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCCTACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTCTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCCATAAGTACTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCCCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATAGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGGATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGTTCATGAGACCATGTAAATG-ACATAGAATAGAAA------------CCCACACTTTCAAG---AGAGAAAAAATGTCAGTC-----GTTC---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCCAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAGCCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTTTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATAAAAA--CCCATTCGACTTCCT------AAGTATTTTTCCTCT---TTTCTGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGTCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT----ATATGTATGAAGATATATATAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAA-----------------TCTTCCTTT----------------------GACCCCT-AAAATTCTAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTTTGTCCTTTT----------------------------AATGGACATAAACACAAGC---CCCCT-----AGTAAGATAGGGTAATGCATGGGAAATTG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCATATATATATATATATATAA---CTGATATA----TCAAAATACTGATATATCAAA-------CGATTAATTACGACCCGAATCCATAATTTGAATTTATTAAATTCAAAT-TTTTATGAAAAATTT-AAGAGTTATTGTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Remusatia_vivipara_AM905803 ATGGAAGAATTAAAGGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTGTGAACCCCCTGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATTAGAGGGTTTTGCTGTCATTGTGGAAATTCCTCTCTCATTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGGTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCCTCTTATTTACAATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTGCAGAAAACCCTATGGGTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAGCCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGACCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAACCAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTGCGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGATTTGGTG----AACCATTT---------------ATGATTCATTAGTCATAAGACCCTGTAAATG-AAATTGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTT------GGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAGAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTATCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCACTTTTTAAAGCACAGTCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAACCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATAAAAAA----CCATTTTACCTCCT------AAGTATTTTTCCTCC---TTTCCGCCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAAATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAATCTTCCTTTTTT-----------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------CAAACTT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAGTCCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTTGAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCAAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCCAATCCATAATGATTATTTATTAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCCATTCT-----AA-ATTTAAATTGAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTTTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Rhaphidophora_crassifolia_AM905741 ATGGAAGAATTCAAAGGATATTTAGAAATAGAAAAAAGTAGATCTAAACAACAACACTTCCTATACCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCATGGTTTAAATGTA---AATGGATCAATATCCATTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATAGATTCGTTGGGCAC-AACCAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCCATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCAAGGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTTCTATATAATTCTTATGTAGTTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTGCTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATTTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCAGTAGGATCCACATAAACCAATTCTCCCATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAATCCTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTTATAGATACTGTTGCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATTCTTTACATTTACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATGA-----------ATGATTGATTCATTGGTCATCAGACCACGTAAATG-AAATAGAATAGAAA------------CCAAAATTAACAAG---AGAGGAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTCCTTTTCGGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACTACATCGAACCCGTTCCTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGTCGAGACAACGGTTTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGCGATCTTGCTAGTGAAGGTAATGCAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAATTTGGAAAGAGATCAAATTCGAGTTCCAACCAGTAGATACGCTAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCATTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TATTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCAC-----GCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATCAAA-------------AAGTCTTCCTTTTTTTT---------------AAGACCCCA-AAATTTCCAGGG-----------TAAGGT--------------------AAAACTT---TTTTTGTCCTTTT----------------------------TATGGACATAAGCACAAGC---CCTCTAATCTAATAAGATAAAGTGATGCATGGAAAACGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGGGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAA-----------------------------------------------GGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTTGTCTTT-CTATC--TAATTTACA----------GAAAAGATAACCCG------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACACGAATCCATAATATTTATTTATTAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTTGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATCAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Rhodospatha_oblongata_AM905739 ATGGAAGAATTTAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCGCTTGTTCATGGTCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATAGATTCGTTGGGCAT-AACCAGAAATTTTATTATCAAATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCAAGGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTATTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAATCTTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTGCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGTTTTTTTAGAAGAATTTTTTACGGAAAAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTATTATTCTTTACATTTACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTC---------------ATGATTCGTTGGTCATCAGCCCCCGTAAATG-GAATAGAATAGGAA------------CCCCAATTTCCCAG---AGAGAAAAAATGTCAGTC-----ATTT---TAATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGACAGTCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTTGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTACTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACGGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCCAAGCAGTAGATACTCTAGATAAAAAAAA-ACCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCATTGGTGGCTCAAAAATCACTACGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCGCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATCAAA-------------AAGTCTTCCTTTTTTTTT--------------AAGACCCCA-AAATTTCCAGGG-----------TAAGGT--------------------AAAACTT---TTTTTGTCCTTTT-----------------------------ATGGACATAAACACAAGC---CTTCTAATCTAATAAGATAAAGTGATGCATGGAAAACGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNNNNNNNTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAA-----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTTTTCTTT-CTATC--TAATTTACA----------GAAAGGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CAATTAATCACGACCCGAATCCATAATATTTATTTATTAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTTGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATCAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCNNNNNNNNNNAAGTCCCTCTATCCCC Sauromatum_horsfieldii_hirsutum NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAATCCCTAGAAATTTCAGGTTATGACAAAAAATTGAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACACAATTTTTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAAAGATATCAGAGGGTTTTGCTGTCATTATGGAAATTCCTTTCTCATTGCGACTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATAAAAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTATACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCCTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCTAAAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGAACACATTTCTATGAAAAAATAGAACAACATCTCGTAGTGCTTTGTGGTAATGATTTTAAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAGGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCAAGTAGGATCCACATAAGCCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAGTGTCCCCAAAAATCCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCCTTTTTAATAGATACTGTTACTAAAAAATTAGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTATCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAGGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAGTTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTTGATATTATTCGTATAAATGACTTGGTG----AATCATTTATGATTCATTCA-TTATGATTCATTAGTCATAAGACCATGTAAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGATTGAATCCACTGAGTATTCAAGTTTCTTAGACTTTCTTTTCG------GGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGGCTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTATAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAAC----CATTTGACCTCCT------AAGTATTTTTCCTCC---TTTCCGCCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAATCTTCCTTTTTTTTT--------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTA----------------AAAACTT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAGTCCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTG--AGAAAAAAG----------------------------------------------GATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCG{AG}ATCCATTCT-----AACATTGAAATTGAGGTAAGAGTCGAATATTCAGTGATCGAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Scaphispatha_gracilis_AM905793 ATGGAAGAATTCAAAGGATATTTA------GAAAAAAATAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGTACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCGGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGGTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATTAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTTATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTATGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAACATTTCGTAGTACTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGGTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCGTCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAAATTTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTTCTATGATTGAATCATTGTCAAAAGCTAAATTTTGTAACGTATCAGGGAATCCCATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGGTTTGGTCGGATATGTCGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTACTTAGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AAAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAATTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGCGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATTGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATAAAAAA----CCATTTTACCTCTTAA-TT-AAGTATTTTTCCTCT---TTTCCATTGGTGACTCAAAATTCACT-----TTCTATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCTT--------------AGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----GTTTCACTATTCACAATCTATATTGTT-----------AGTTTATCCTTACACTTAT-----AAATATCAATCCTTACTATCAAAAAGGCTTCCTTTTT--------ATTT------AAGACAAAA--AAATTTCATGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTTTGTCCTTTT----------------------------AATGGACATAAGCACAAGC----CCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCCGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGCGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGGGTTGATTGCATTGCGTTGGTAACTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCCATTCT-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAAA-TCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Schismatoglottis_trifasciata_AM905782 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------ATTTTGATGAACCTGCGGAAATTTCAGATTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCCAATGATATCAGAGAGTCTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCTTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACAATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCTAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTTATTCCTATATAATTCTTATGTAGTTGAATGCGAATCCCTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCAAAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAATCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTTACTAAAAATTTGGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCAGATTCTGATATTATTGATCGATTTGGTTGGATATGTAGAAATCTTTTTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATGAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAAT-----AGAAA------------CAAAAAT-CTCAAG---AGAGATAAAATGTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAATAGTCAAGTTTTTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCACTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGACAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATAGGGTAGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATAAAGA--CCCATTTTACTTCCT------AAGTATTTTTCCTCT---TTTCCGCTAGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATATACGTACAAATGAAGAT----------------ATATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTATT-----------AGGTTATCCTTATGCTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTTTT---------------AAGACCCCC-AAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTTTGTCCTGTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAAGAAA------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTGCA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTTGAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAATCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTTATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACNNNNNNNNNNNNNNNGGTTCAAGTCCCTCTATCCCC Schottarum_sarikeense NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------ATTTTGATGAACCTGCGGAAATTTCAGATTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCCAATGATATCAGAGAGTCTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCTTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTCCATTTATTACAATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCTAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTATATTCCTATATAATTCTTATGTAGTTGAATGCGAATCCCTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATTGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCAAAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTGGGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTTACTAAAAATTTGGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCAGATTCTGATATTATTGATCGATTTGGTTGGATATGTAGAAATCTTTTTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATGAATGACTTGGTG----AATCATTT---------------ATGACTCATTGGTCATGAGACCATGTAAATG-AAATAGAAA-----------------CAAAAAT-CTCAAG---AGAGATAAAATGTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN--AAAGA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCGCTAGTGGCTAAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATATACGTACAAATGAAGAT----------------ATATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTATT-----------AGGTTATCCTTATGCTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTTTT---------------AAGACCCCC-AAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTTTGTCCTGTT----------------------------AATGGACATAAACACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Scindapsus_hederaceus_AM905742 ATGGAAGAATTAAAAGGATATTTAGAAATAGAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCATGGTTTAAATGTA---AATGGATCAATATCCATTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATAGATTCGTTGGACAC-AACCAGAATTTTGATTCTCAAATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCCATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCAAGGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTTCTATATAATTCTTATGTAGTTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATTTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCCATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTAGTAATAAATCCTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTTATAGATACTGTTGCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATTCTTTACATTTACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATGA-----------ATGATTGATTCATTGGTCATCAGACCACGTAAATG-AAATAGAATAGAAA------------CCAAAATTAACAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTCCTTTTCGGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACTACATCGAACCCGTTGTTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTGTTATACCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGACTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGGGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCAAACCAGTAGATACGATAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCATTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TATTCTTTCACAAA------AAGATCCGAGCAT----------TTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCAC-----GCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATCAAA-------------AAGTCTTCCTTTTTTT----------------AAGACCCCA-AAATTTCCAGGG-----------TAAGGT--------------------CAAACTT---TTTTTGTTCTTTT----------------------------TATGGACATAAACACAAGC---CCTCTAATCTAATAAGATAAAGTGATGCATGGAAAACGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAA-----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTTGTCTTT-CTATC--TAATTTACA----------GAAAGGATAACCCT------ATATACCTAATACGCATGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCGAACCCATAATATTTATTTATTAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTTGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATCAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGNNNNNNNNCCCTCTATCCCC Spathantheum_intermedium_AM905769 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTACGAACCCGCGGAATTTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAGTTTTTATTCTCAAATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAACTTTCAGAATTTACGATCTATTCATTCAATATTTTCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTACAAAAAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAACTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTAGGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATTTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTACTTTCTGGGTTATCTTTCCAATGTACCAATAAAGCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTACTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTCCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAGTGCCTTGGTG----GATCA------------------------CATTGGTCATGAGACCACGTAAATG-AAATAGAATAGAAA------------CAACAATTCTCAAA---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAGCTGCAAGCACGGTCAAAGCTGGTGCTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCAATTTATAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTCCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGATTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATACGCTAGATATAAAAA--CCCATTTTACTTCCT------AAGTATTTTTCC-----------GTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAAATGCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATCAAAT---------AAAAAGTCTTCCTTTTTATTTCA--ATTT------AAGACCCCA-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------AAAATCAAACTT---TTTCTGTCCTTTT----------------------------AATAGACATAAAAA-AAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGA----ATGGAGTTGATTACATTGCGTTGGTAGCTGAAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGAGAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATGTCAAA-------CGATTAATCACGACCCAAATCCATAATTTTTATTGAATAAATTCAAAA-TATTATGAAATATTT-AAGAGTTATTCTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Spathicarpa_hastifolia_AM905772 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGCGTCAA------TTTTTTATGAACCCGCGGAATTTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAGTTTTTATTCTCAAATGATATCAGAGGTTTTTGCTGTCATTGTAGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACATGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAAAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCTAAGACTATTTCGGTTCCTATATAACTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGGAATGATTTTCAGAAAACCTTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTTACTTTTGGTCTCAACCCTGTAGAATCCACATAAACCAATTCTCGAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAGCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATGACTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGGTTTGTCAGATTCTGATATTATTGATCGGTTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTCTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTCCTTTAATCTTACCAAGAATTTCTTATACTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCA------------------------CATTGGTCATGAGACCACGTAAATG-AAATAGAATAGAAA------------CAACAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAAAGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAATTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCCCTTTTTAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTCTTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCGGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCCGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTGGATACGCTAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAAT-TGAAAT---------AAAAAGTCTTCCTTTTTATTTCA--ATTTAAATTGAAGACCCCA-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------CAAATCAAACTT----TTCTGTCTTTTT----------------------------AATAGACATAAAAACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAA-----------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGA----ATGGAGTTGATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTTTTATTTAATAAATTCAAAA-TATTATGAAAAATTT-TAGAGTTATTGTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Spathiphyllum_wallisii_AJ235807 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTGTTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATAGATTCGTTGGGCAC-AACCAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGTTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAAAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCTGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGTTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCAAGGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCCTATTTGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACCCATTTCTATGGAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATTGTTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCTTGTAGGATCCACATAAACCAATTCTCCCATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAATCCTTCAGTAATAAAGAGTCAATTGCTAGAGCATTCTTTTTTAATAGATACTGTTGCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTTGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATATTACCAAAAATTTCTTATTCTTTACATTTACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTAGTCGTATAAATGACTTGGCG----AATCATAA---------------ATGATTCATTGGTCATCAGACCACGTAAATG-AAATAGAATAGAAA------------CCCAAATTAACCAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGAATCTAATCAATGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGTTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGTCCCTATCGTAATGCATGACTATTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCGGGTACAGTAGTAGGTAAACTGGAAGGTGAACGAGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTTTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGAGGAACTATAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGCGAGGTTTGGAAAGAGATCAAATTTGAGTACAAACCAGTAGATACGCTAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCATTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TATTCTTTCACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTTT--GGGCAATACACGTACAAATGAAGATAGATATATG----------TATGTAC------AAAGACTCTCAACTATTGAAT-----TATTCACTATTCGCAATCTACATTGTT-----------AAGTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTACTTTTTTT----------------AAGACCCCA-AAATTCCCAGG------------TAAGGT--------------------AAAACTT---TTTTTGTCCTTTT----------------------------TATGGACATAAACACAAGC---CCTCTAATCTAATAAGATAAAGTGATGCATGGAAAACGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAA-----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTTTGCTTT-CTATC--TAATTTACACTAATTTACAGAAAGGATAATCCTATATT-ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCGAATCCATAATATTTATTTATTAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTTGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGAGAAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------------------------------------------------------------------TATCCCC Spirodela_polyrrhiza_AM905731 ATGGAAGAATTCAAAGGATATTTA------CAAAAAGGTGGATTTAAACAACAACACTTCCTATATCCACTTCTCTTTCAAGAGTATATTTACGTACTTGCTCATGATCATGGTTTAAATGTA---AATGCATCAA------CTTTTAATGAACCCTCGGAAATTTCAGGTTATGACAATAAATCTAGCTTATTACTTGTGAAACGTTTAATAACTCGAATATACCAACAGAATAGTTTGATCCATTCTGTTAATGATTCTAACCAAAATATATTCGTTGGACAC-AACAAGAATTTTTATTATCAAATGATATCAGAGGGTTTTGCTATCGTTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCTTCTTTCAAAGAAAAAAAAGAA---ATACCGAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTAGAGGATAAATTTGCACATTTAAATTATGTATCAGATATACTAATACCTTATCCCGTCCATCTAGAAATATTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCCTTTTTCACCAATATCACAATGGGAATAATTGCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGATAATCCAAGACTATATAGGTTCCTATATAATTCTTATGTAGTAGAATACGAATCCATATTTGTTTTTCTCCGTAAATCATCCTCTTATTTACGATCAACATCTTTTGGAACCCTTCTTGAGCGAACATACTTCTATGGAAAAATGAAA---AATATTGGAGTAACTCATTCTAATAATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTTATGCATTATGTTAGGTATCAAGGAAAATCAATTATGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTGAATTTATGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAATCAATTCTCCCATTTTTCTTTCTATTTTTTGGGTTATCTTTCAAGTGTCCTAGAAAATCGATCATCGGTAACGACTCAAATGCTAGAGAATTCCTTTTTAATAGAGACCGTTACTAAAAAATTTGAAACGATGGTATCCATTATTCCTATGATTGGTTCATTGTCAAAAGCTAAATTTTGTAACCTATCGGGGAATCCGATTAGCAAGCCTGTTTGGGCCGATTTATCAGATTCTGATATTATTGATCGATTTGGTCGAATATGTAGAAACCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTCGAACTTTGGCGCGTAAGCATAAAAGTACTGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAGTTTTTAGAAGAATTCTTTATGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAACTTCTTATCCTTTACAC------AAGTTATAT------------------AGAGCACCCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATAATTT---------------ATGATTCATTGGTGATAAAACCATGTAAATC-AAATAGAATAGAAA------------AAAAAATTCTCAAGTTAAGAGATAAAATGTTAGTC-----ATCT---TTATTCTGAAATGCTCATACAGTTGTGGTTGAATCAACTGAGTAGTCAAGTTTCTTACACTTTCTTTTC------GGGATCTAATCTAAATTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAGACAAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCCGTTGTTGGAGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAAGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCACCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACCATCAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCTGAAGCAATTTATAAAGCACAAGCTGAAACAGGTGAAATTAAAGGGCATTACTTAAATGCTACTGCAGGTACTTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATTGTAATGCATGACTACTTGACAGGGGGATTCACTGCAAATACTAGTTTAGCACATTATTGCCGAGACAACGGCCTACTTATTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGTGGCGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGTGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTTTGGAAAGCGATCAAATTTGAGTTCGAACCAGTAGATAAGCTAGATAAAAAAAA--CGATTTGACTTCCT------AAGTATTTTTCCTCTTTTTTTCCATCGGTGACTCAAAATTCACTATATTTTCCATTTACTC--TACTCCTTCACTAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTGT--GTGTAATATACGTACAAATGAAGAT------------------ATATGGAC------AAAGATTCTCCTGTATTGAAT-----TATTCAGTATTAACAATCTATATTGTT-----------AGGTTATCCTTACACATTTAA-TATAATATAAATGTT-----------AAAATTCCTTTTTGACT--------------AAGACAAAA-AA----------------------AAGGGTTT-----------------AAAACTT---TTTTTGTCCTGTT----------------------------AATGGACAAAAACGGAAGC---TCTGG-----AGTAAGATAAGGTAATGCATGGAAAATAG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATTAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGATGTTCTAACGA----ATGGAGTTAATTGTATTGCGTTGGTAGCTGGAATTATTCTTT-CTCTC--TAAATTACA----------GAAAGGATAACCCT------CTATACCTAACACGCACGTATATATA--------------------------------CTGACATTTCAAA-------TGATTAATCAGGACCCGAATCCATAATTTTTATTTCT--CAAATAA----ATAATTTT-AATTT-AAGAGTTATTCTGAATCTATTCC-----AA-ATT------CAAGTAAGAGTGGAATATTCAGTGATCCAATCATTCACTCCAGAGTCTGATTGATT-----TTTTGGAAAAATAATTAATTGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Stenospermation_ulei_AM905738 ATGGAAGAATATAAAGGATATTTA------GAAAAAAGTAGATCTANACAACAACACTCACTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCATGGTTTAAATGTA---AATGGATCAA------GGTTTTATGAACCCACGAAAATTTCAGGCTATGACAATAAATCTAGCTCATTACTTGAGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATAGATTCGTTGGGCAT-AACCAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTCTCATTGTGGAAATTCCTTTCTCACTGCGATTAGTATCTTCCCTCGAAGAAAAAAAAGAT---GTACCATNNTCTCACAATTTACGATCTATTCATTCAATATTTCCATTCTTAGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCAAGGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAAGAATCCTCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTCCATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTATTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAATCTTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACCGTTGCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCCGTTTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATTCTTTACATTTACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTTGTATAAATGACTTGGTG----AATCATGA---------------ATGATTCATTGGTCATCAGACCAAGTAAATT-AAATAGAATAGAAA------------CCCAAATTAACAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTC------GGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTTGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTACTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACGGTAGTAGGTAAACTGGAAGGCGAACGTGAGATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCTGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCAAACCAGTAGATACACTAGATATAAAAA---CCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCATTGGTGGCTCAAAATTCACTATGTTTTCCATTCACTC--TACTCTTTCACAAA--CAAAAAGATCCGAGCAT-----TT---------------------------------------------------------------------------------------GACTCTCGAGTATTGAAT-----TATTCACTATTCGCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATAAAA-------------AAGTCTTCCTTTTTTT----------------AAGACCCCA-AAATTTCCAGGG-----------TAAGGT--------------------AAAACCT--TTTTTTGTCCTTTT----------------------------TATGGACATAAACACAAGC---CTTCTAATCTAATAAGATAAAGTGATGCATGGAAAACGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNAGCCTTGGTATGGAAACCTACTAAGTGCTAGCTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAA-----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTTGTCTTT-CTATC--TAATTTACA----------GAAAGGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCGAATCCATAATATTTATTTATTAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTTGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATCAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAG-CCCTCTATCCCC Steudnera_colocasiifolia_AM905801 ATGGAAGAATTAAAGGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTGTGAACCCCCTGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATTAGAGGGTTTTGCTGTCATTGTGGAAATTCCTCTCTCATTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGGTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTCGTTTTTCTCCGTAAACAATCCTCTTATTTACAATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTGCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCTACATAAGCCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGACCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGATTTGGTG----AGCCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACGGCAAGCACGGTCAAAGCTGGTGTTAGAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCACTTTATAAAGCACAGTCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAACCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATAAAAAA----CCATTTTACCTCCT------AAGTATTTTTCCTCC---TTTCCGCCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAAATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAATCTTCCTTTTTTTT---------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAGTCCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTTGAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCCAATCCATAATTATTATTTATTAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCCATTCT-----AA-ATTGAAATTGAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTTTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Stylochaeton_bogneri_AM905776 ATGGAAGAATTAAAAGGATATTTA------GAAAAAGGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTTTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTATTAATGATTCTAACCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCTTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCTATTTTTGGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGCTCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCCTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTCTCAAAAGAGAATCCAAGACTCTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCCTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTATTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTAGTTTGTTGTAATGATTTTTATAAAACCCCATGGTTGTTCAAGGATCCTTTCATGCATTATATTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTTATCTTCTTATGAAGAAATGGAAATCCTACTTTGTCAATTTTTGGCAATGTCATTTTCGCTTTTGGTCTCAACCCTGTAGGATCTACATAAACCAATTCTCCAATTTTTCTTTCTATTTTTGGGGTTATCTTTCAAGTGTACCAAAAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAATGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTGCCAAGAATTTCTTATCCTTTGCAT------AAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTTGTCATGAGACTATGTAAATG-AAATAGAATATAAA------------CCCCAATTCTCAAG---AGAGAAAAAATGTCAGTC--------------ATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTAGTCAAGTTTCTTAGACTTTCGTTTT------GGGATCT-----AAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAAAAGCAAGNNNNNTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTACAAAGCACAGCCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATTAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGGTTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGTAATGCGCCTGGTGCAGTAGCTAATAGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTACTGAACTAGCTGCTGCCTGTGAGATTTGGAAAGCGATCAAATTTGAGTTCGAACCAGTAGATAAGCTAGATATAAAA---CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTTCGCTGGTGGCTCAAAATTCACTATGTTTTCCATCTACTCCTCACTCTTTCACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTTT--GTGCAATACACATACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTTACAATCTATATTGTA-----------AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTT--------ATTT------AAGACCCCC-AAAATTCCAGGG-----ATTGGGTAAGGGTTTT----------------AAAACTT----TTTTGTCCTGTT----------------------------AATGGACATAAACACAAGC---CCCCT-----AGTAAGAAAAGATGATGCATGGAAACTGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATAGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCGAATCCATAAGTTTTATTTATTAAATAAATAA-TTTTATGAAAAACTT-AAGAGTTATTGTGAATCCATTCC-----AA-ACT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAAAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTATACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Symplocarpus_foetidus_L10247 ATGGAAGAGTTAAAAGGATATTTA------GAAAAAGAGAGATCTCGGCAACAACACTTCCTATATCCGCTTATCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTA---------AAGGGATCAA------TTTTTTACGAATCCACGGAAATTTTAGGTTATGACAATAAATCCAGCTCATTACTTGTTAAACGTTTAATTACTCGAATGTATCAACAGAATTATTTGATTAATTCCGTTAATGATTCTAACCAAAATGGATTCGTTGGGCAT-AACAAGAATTTTTTTTCTCAAACGCTATCAGAGGGTTTTGCAGTCATTGTGGAAATTCCCTTCTCGCTACGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAGGACAAATTCTCACATTTAAATTATGTGTCAGATATATTAATACCCTACCCCATTCATCTTGAAATCTTGGTTCAAATTCTACAATGCTGTATACAAGATCTTCCCTCTTTGCATTTATTGCGATTCTTTCTTCACGAATATCATAATTGGAATAGTCTCATTACTCCAAATAAATCTAGTTAC---ATTTTTTCAAAAGAAAATCAAAGACTATTTCGGTTCCTATATAATTCTTATGTATTTGAATGGGAATCTATATTAGTTTTTCTACGTAAGCAATCCTCTTATTTACGATCAACATCTTACGGATCTTTTATTGAGCGAACACTTTTCTATGGAAAAGTGGAA---CATCTTTTAGTAGTTTGTCGTAATGATTTTCAGAAGACCCTATGGTTATTCAAGGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGAACTCATCTTATGATGAAGAAATGGAAATGTCACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCGTACAGAATCCATATAAAGCAATTCTCAACTTATTCCTTCTATTTTCTGGGCTATCTTTCAAGTGTGCTAAAAAATCCTTCCGCGGTTAGGAGTCAAATGTTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGATATTATAGTCCCAATTATTCCTATGATTGGATCATTGTCTAAAGCTAAATTTTGTAATGTATCAGGGCATCCTATTAGTAAGCCGGTTTGGGCCGATTTGCCAGATTCTGATATTATTGATCGATTTGGTAGGATATGTAGAAATCTTTCTCATTATCACAGTGGATCCTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTCGGCTCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTGGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTGATTTTACCAAGAACCTTTTTTCCTTTACAT------AGGTCATAT------------------AGAGAACGTATTTGGTATTTTGATATTATTCGTATCAATGACTTGGTG----AATCATTT---------------ATGATT----GGTTATGAAACTCTGTAAAAA-AAATGGAATATAAATGATCTA---TCTATAAATGATCAAG---AGATAAAAAA-TTCATTC-----ATTTTTTTAATTCTGAAATGCTCATA-----GTGGTTGAATCAATTACGTAGTCAAGTTTATTAGACTTTCTTTTC------GGGATCT-----AGGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAAATGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTGCTCAACCCGGAGTTCCACCTGAAGAAGCAGGTGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGGCCATTGTTGGAGAGGAAAATCAATTTATTGCTTATGTAGCGTACCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCTTTACGAGCTCTACGTCTGGAGGATCTTCGAATTCCTCCGGCTTATTCAAAAACTTTCCAAGGCCCACCCCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCGCAGGCCGAAACAGGTGAAATCAAAGGACATTATTTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAACTCCCATCGTAATGCATGACTACTTGACAGGGGGATTCACTGCAAATACTAGTTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGGGATGACTTTGGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCCGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCCGGTGCAGTAGCTAATCGGGTGGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTGTTGAAGGTAATCAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTATGGAAGGAGATCAAATTTGATTTCGCTCCAGTAGATCCGGACCCAAAAAAA----CCATTTTACTTCCTAAGTATAAGTATTTTTCCTCTT--TTTGCGTCGGTGACTCAAAATTCACTATGTTTTCCATTCACTC--TACTATTTCACAAA------CGGATCCGCGCAG-----TTTGTGTCT----TATCCCAAGTTTTT--GTACGATACACGTACAAATAAACAT------------------ATATGGGC------AAGGAATCCCCATTATTGAAT-----TATTCACAG--CACAGTCCATATTTTT---------------------------------------------------------------------------------------------AC------------------------------------------------------------------------------------------------------------GG-CATAAACATAAGT---CCTCT-----AGTAGGATAA-----CACATGGGGAATGG-----CCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGGAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATTAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GCAAAAAAGGAGGTTTATATATATAAAAAATATAAAAACTAGA-CTAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGAATGGAGTTGACTGCGTTGCGTTGGTAACTGGAATTATTCCTT-ATATC--AAAATTACA----------GAAAGGGTGACCCT------ACATACCTAATACGTACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATTACGACCTGAATCCATAATTTATATTTATATAAATATATAAATTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCCAATCCAA-ATT------AAAGGAAGAGTCGAATATTCATTGATCAAATCATTCACTCCGAAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTTGAAATCGTGGGGGTTCAAGTCCCTCTATCCCC Synandrospadix_vermitoxicus_AM905771 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCGCGGAATTTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AGCAAGAGTTTTTATTCTCAAATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCTCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACATGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAAAATTCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAACTCTTATGTAATTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAGATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCGATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGAATCCACATAAACCAATTCTCGAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAGCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTACTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTCCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCA------------------------CATTGGTCATGAGACCACGTAAATA-AAATAGAATAGAAA------------CAACAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCAATTTTTAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTACCAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTCCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTGGATACGCTAGATATAAAAA--CCCATTTTACTTCCT------AAGTATTTTTCCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GGGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATAAAAA---------AAAAAGTCTTCCTTTTTATTTAA--ATTT------AAGACCCCA-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------CAAATCAAACTT---TTTCTGTCCTTTTAATAGAACTTTTTCTGTCCTTTTTTTTTAATAGACATAAAAACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGA----ATGGAGTTGATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATCACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTTTTATTTAAAAAATTAAAAA-TATTATGCAAAATTT-AAGAGTTATTGTGAATTCATTCC---------------------AAAGAGTCGAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Syngonium_auritum_AM905789 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGTACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCAGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGGACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCTCGAGGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTCTCACATTTAAATTGTGTATTAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTTATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAACGAACACATTTCCATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCGTCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCACATTTTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTTTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTAGAGTTCCAATTATTTCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAGCAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTA----AATCATTT---------------ATGATTCATTAGTCATAAGACCGTGTAAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGTTGGGGAGGACAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTACTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAATCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATCAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATAAAAAA----CCATTTTACCTCTTA-----AGGTATTTTTCCTCT---TTTCCGTTGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-----------AGTTTATCCTTACACTTAT-----AAATATCAAA------TATCAAAAAGTCTTCCTTTTT--------ATTT------AAGACAAAA--AAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT--TTTTTTGTCCTTTT----------------------------AATGGACATAAGCACAAGC----CCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGA----------CCCCAATCCATAATTATTATTTATTAAATTCAAAA-TTTTATGAAAAATTA-AAGAGTTATTGCGAATCCATTCT-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Taccarum_weddellianum_AM905770 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCGCGGAATTTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACAAAAATAGATTCGTTGGGCAC-AACAAGAGTTTTTATTCTCAAATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACATGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAAAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAACTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGAATCCACATAAACCAATTCTCGAATTTTGCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAGCCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATGACTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTATAGTGGGTCCTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGCAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTCCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCA------------------------CATTGGTCATGAGACCACGTAAATG-AAATAGAATAGAAA------------CAACAATTTTCAAG----GAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCCCTTTTTAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGGTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCAATATTGCCGAGACAACGGTTTACTCCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATACGCTAGATATAAAAA--TCCATTTGACTTCCT------AAGTATTTTTTCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTTTACATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATAAA-----------AAAAAGTCTTCCTTTTTATTTAA--ATTT------AAGACCCCC-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------CAAATCAAACTT---TTTCTGTCTTTTT-----------------------TTTTTAATAGACATAAAAACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGA----ATGGAGTTGATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCGCGTATATATA--------------------------------CTAACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTTTTATTTAATAAATTCAAAA-TATTATGAAAAATTT-AAGAGTTATTGTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Theriophonum_dalzellii ATGGAAGAATTAAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCTGAAATTTCAGGTTATGACAAAAAAATTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATAATATCAGAGGGTTTTGCTGTCATTATGGAAATTCCTTTCTCATTGCGACTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTCGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTCGTAGTGCTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACNTTTGGTCTCCACCCAGTAGGATCCATATAAGCCAATTCTCAAACTTTTCTTTCTACTTTCTGGGTTATCTTTCAAGTGTCCCAATAAATCCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAGGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGATTGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAAC----CATTTGACCTCCT------AAGTATTTTTCCTCC---TTTCCGCCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGACCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAATCTTCTTTTTTTTT---------------AAGACCAAA-AAAATTTCAGGGAAGGGATTAAGTAAGGGTTTT----------------AAAACTT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAG-AAGTCCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTTGAGAAAAAAG----------------------------------------------GATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATCGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCC------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATTTCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAACCCATTCT-----AACATTGAAATTGAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Tofieldia_pusilla_AJ286562 ATGGAAGAATTAAAAGGATATTTA------GAAAAATATAGATCTCGGCAACAACGCTTCTTATATCCGTTACTCTTTCAGGAGTATATTTATACACTTGCTCATGATCATGGTTTA---------AATGAATCGG------TTTTTCACGAACCCATGGAAATTTTAGGTTATGACAATAAATTCAGTTCAGTACTTGTGAAACGTTTAATTAATCGAATGTCTCAACAGAATTATTTGATTCATTCGGTTAATTATTTTAACCAAAATCGATTTGTTGTGCATCAACAAGAATTTGTATTCTCAAATAATATCAGAGGTTTTTGCAGTCGTTTTGGAAATTCCTTTCTCATCGCGATTGGTGTCTTTCCTTGAAGAAAAAAAAGAA---ATACCAAAATCAAAGAATTTACGATCCATTCATTCAATATTTTCTTTTTTAGAGGACAAATTATTACATTTAAATTATGTGTCAGATATATTAATACCCCATCCCATCCATCTTGAAATATTGGTTCAAATTCTACAATGTCGGATACAAGATGTTCCCTCTTTACATTTATTGCGATTTTTTCTCCACGAATATCATAATTGGAATAGTCTAATTACTCCAAAGAAATCTATTTCTCC---TTTTTTAAAAGAGAATCAAAGACTCTTTCGGTTCCTATATAATTCTTATGTATCTGAATATGAATCCGTATTCGTTTTTTTTCGTAAACAATCCTCTTATTTACGAGCAACATCTTCTGGAGCCTTTCTTGAGCGAACACATTTCTATGGAAAGATAGAG---CATCTTATAGTAGTTTGTCGTAATGGTTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCGAGGAAAATCAATTCTAGCTTCAAAGGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACCTTGTCAATTTTTGGCAATGTAATTTTTACTTTTGGTCTCAACCATATAGGATCCATATAAAGCAATTCTCGAATTATTCCTTCTATTTTCTGGGCTATATTTCTAGTATACTAATAAAGCCTTCAGCTGTAAGGAGTCAAATGCTAGATAATTCATTTCTAATGGATACTGTTACTAAAAAATTCGATACTATAGTCCCAATTTTTCCTCTGATTGGAGCATTGTGCAAAGCGAAATTTTGTAACGTATCAGGGCATCCCATTAGTAAGCCGATCTGGGCAGATTTGTCAGATTCTGATATTATTGATCGATTTAGTCGAATATGTAAAAATCTTTCTCATTATCACAGCGGATCCTCAAAAAAACAGAGTTTATATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAATACAGTACGTGCTTTTTTTAAAAAATTAGGTTCTGGGTTTTTAGAAGAATTCTTTACGGAAGAAAAAAAAGTGCTTTCTTTGATCTTACCAAGAATTTCTTTTTCTTCACAT------AGGTTAGAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATCAATGACTTGGTG----AATCATTC---------------ATGATT----GGTTATGAGACCATGG----A-AAGCGGAA-----ATGG-------TCT------GATCAAT---AGAGAAAAAATG-CATTT-----ATTTG---CATTTTGAAATGCNNATGCAGTAGTGATTGAATCAATTGAGTA-TTTAATTTCTTAAACTTTCTT----------------------------------------------------------------------------TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAGGGACGATGCTACCACATCGAGACTGTTGTTGGGGAGGAAAATCAGTATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTTTTTGGGTTCAAAGCTCTACGAGCTCTACGTTTGGAGGATCTGCGAATTCCTCCTTCTTATTCCAAAACTTTCCAAGGCCCGCCCCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAATATGGCCGTCCCCTATTGGGATGTACTATTAAACCAAAATTAGGATTATCCGCAAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAAGCGCAGGCCGAAACAGGTGAAATCAAAGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGCTAAAAAGGGCCATATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGTCTCATTATTGCCGAGACAACGGCCTTCTTCTGCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCAAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCCGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACCTTGGGTTTTGTTGATTTACTACGTGATGATTTGATTGAAAAAGACCGAAGTCGAGGTATTTTTTTCACTCAAGATTGGGTTTCTATGCCGGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCACATGCCTGCCCTAACTGAGATCTTTGGAGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCCGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGCCCCGAACTGGCGGCTGCTTGTGAGGTATGGAAGGAAATCAAATTCGAGTTCGAACCAGTGGATAAGATAGA-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAA------AAG-TCC--------AT-TTT--------------AC-----TTGC-TAACAATA-----ACAAT--------------------------TATGGGC------AAGGAATCTCCGTTATTGAAT------------CATTCACAGTCCATATCATTACCCTTCCATT--TACAAACATTTACAAACATTTC-----GAAATACAAGG-------AAAGTCTTCT-TTTTA---------------AAGATCCAAG--AAATTCCATAAACTAAGTTAGGTAAGATTTTTGACTACTTTTT----TAGT-C-----CTTT-GAA---TT--------------------------------GACATAAACACAAGT---CCTCC-----AGTAGTATAA-----TACGTGGAGAATAG-----TCGGGATAGCTCATTTGGTAGAGCAGAGGACTGAAAATCCTCNNNNNNNTGGCT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATTAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----TAT-AAAACCTTGTTTT-AT--------------AAAACTAGAAT-AAAAAA--GGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGACTGCGTTGCATTGGTAGTCGGAAT----CCTC-CTAT------ATTATG----------GAAAGGATAG----------GATAGCCTTATA--TATGTATACATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCGAATCCATAATTTAT------AATTCTAGGAAA-----TGCAAAATTT-CAGAGTTATTTGGAATCCATTCTAATCCAA-GTTGATT--GAAGGAAGAATCGAATATTCAGTGATAAAACCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATGAATCGGACAAGAATAAAGAGAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Typhonium_blumei_AM905808 ATGGAAGAATTAAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTGCTCATAATCATGGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCTGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGCGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAACGATATCAGAGGGTTTTGCTGTCATTATGGAAATTCCTTTCTCATTGCGACTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCAGGAATATTATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGTTTTTCGAAAGATAATCCAAGACTTTTTTTTTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTACGGAATCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTCGTAGTGCTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACGTAAGCCAATTCTCAAAATTTTCTTTCCACTTTCTGGGTTATCTTTCAAGTGTCCCCAAAAATCCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTTATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCGAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCGGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAATTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGATCATGTAAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGATTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTATAGGACACCCTTGGGGAAATGCACCAGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATAAAAAA----CCATTTGACCTCCT------AAGTATTTTTTCTCC---TTTCCGCCGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATACTTACACTTAT-----AAATATCAAA-------------AAATCTTCCTTTTTTTTTT-------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTA----------------AAAACTT-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAGTCCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTT-GAGAAAAAAA---------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCCATTCT-----AACATTGAAATTGAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGNNNNNNNATCCCC Typhonodorum_lindleyanum_AM905814 ATGGAAGAATTAAAGGGATATTTA------GAAAAAAGTAGATCTAAACAACAAAACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------ATTTTTATGAACCCGCAGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTTTTTGATCAATTCTGTTAATGATTCTAAACAAAATGGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAACGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCTAAGACTATTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATTTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATAGAATAGAAA------------CTCAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGCCGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGAGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATACGAACCAGTAGATAAGCTAGATAAAAA----TCCATTTTATCTCCTAAGTT-AAGTATTTTTCCTCT---TTTCCGTCGATGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGCTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAAAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TTTTCAATATTCACAATCTATATTGTA-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTTTT---------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------TAAACCC-----TTTGTCCTTTT----------------------------AATGGACATAAACACAAGCAAGCCCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTATTTATTAATTTAAAAA-TTTTATGAAAAAATA-AAGAGTTATTGCGAATCCATTCT---------------------AAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCAGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Ulearum_sagittatum_AM905794 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAATACTTCCTATATCCACTTCTCTTTCAAGAGTATATTTATGTACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCGGGTTATGACAAAAAATTTAGCTCATTACCTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATGGATTCGTTGGGCAT-AACAAGAATTTTGATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAATTTGTGTATTAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTTATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAGTCCTCTTATTTACGATCAACATCCTCTGGAACCCTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCGTTTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTTATTTTCACTTTTGGTCTCAACCCTGTAGGATCTACATAAACCAATTCTCCAATTTTTCTTTACATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCCGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTCTAGTTCCAATTATTTCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAACCCGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGGTTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCCTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTTATTAGTCATAAGACCATGTAAATG-AAATAGAATA----------------CAAAAAATCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATTAGAGTTTTAGATGTATACATAGGGAAAGTCGTGTGAAATGAAAGCTGCAAGCTCGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTATGGACTGATGGACTTACTAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAA{CG}CCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTATGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCATTTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAACGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACAGCAAATACTAGTTTAGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATCGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATAAAAAA----CCATTTTACCTCTTAA-TT-AAGTATTTTTTCTCT---TTTCCGTTGGTGACTCAAAATTCACTATGTTTTCCACTTACTC--TACTCTTTCACAAA------AAGATCCGAGCTT--------------AGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCCCAATCTATATTGTT-----------AGTTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTGTTCCTTTTT--------ATTT------AAGACAAAA--AAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT-TTTTTTTGTCCTTTT----------------------------AATGGACATAAGCACAAGT----CCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAACTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGATTAATCACGACCCAAATCCATAATTATTTTATTATAAATTCAAAA-TTTTATGAAAAATTA-AAGAGTTATTGCGAATCCATTCT-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAAAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Urospatha_sagittifolia_AM905748 ATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTAGATCTAAACAGCAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGACCGA------TTTTTTATGATCCCACGGAAATTTCAGGTTATGACAATAAATCTAGTTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGAGAAGTTCTGTTAATGATTCCAACCAAAATGGATTCGTTGGACAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTATCGCTGCGATTAGGATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTAGAGGACAAATTATCACACATAAATTATATATCAGATATACCAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACAATTCTTTTTTCATGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTTGGTTCCTATATAATTCTTATGTAATTGAATGCGAATCCGTATTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTTTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA---CATCTTGTATTAGTTTGTTGTAATGATTTTAATAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCCTACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTCTAGGATCCGCATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTATACCAATAAGTACTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCAATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAACAGAGTTTGTATGGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAGTTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGGATTTCTTATCCTTTACAT------AAGTTATAT------------------AGAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGTTCATAAGACCGTGTAAATG-ACATAGAATAGAAA------------CCCACATTTTCAAG---AGAGAAAAAATGTCAGTC-----GTTC---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTTTTTTC------GGGATTTAATTTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCCAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACCCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCTGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCATATCGAAGCTGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTACCGAAGCCCTTTTTAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCGGGTACGTGTGAAGAAATGATTAAAAGGGCTGTGTGTGCCAGAGAATTAGGAGTCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATAAAAA--CCCATTCGACTTCCT------AAGTATTTTTCCTCT---TTTCTGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCA------TTTTTGTTT-----AGCCCAAGTTTTT--GTGCAATACACGTACAAATGAAGAT----ATATGTATGAAGATATATGTAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTT----------------------GACCCCT-AAAATTATAGGG-----ATTGGGTAAGGGTTTT----------------CAAACTT---TGTTTGTCCTTTT----------------------------AATAGACATAAACACAAGC---CCCCT-----AGTAAGATAGGGTAATGTATGGGAAATTG-----TCGGGGTAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCNNNNNNNTGCGT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAACTGGCATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCATATATATATATATATATATATACTGATACTGATATATCAATACTGATATATCAAATATCAAACGATTAATTTCGACCCGAATCCATAATTTGAATTTATTAAATTCAAAT-TTTTATGAAAAATTT-AAGAGTTATTGTGAATTCATTCC-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTCTATCCCC Wolffia_columbiana_AY034255 ATGGAAGAATTCAAAGGATATTTA------CGAAAAGGTGGATTGAAACAACAACACTTCCTATATCCCCTTCTCTTCAAAGAGTATATTTATGCACTTGCGCATGATCAGGGTTTAAAT---------GCATCAA------CTTTTAATGAACCCGCTGATATTTCAGGTTATGACAAAAAATATAGCTCATTACTTGTCAAACGGTTAATTAAGAGACTATATCAACAGAATAGCTTGATACGTTCTGTTAATAAAGCTAAGCAAACTAGATTCGTCGGACAC-AACAAGAATTTTTATTATCAAATGGTATCAGAGGGTTTTGCTATCGTTTTAGAAATTCCCTTGTCCCTACGATTAGTATCTTCGCTCAAAGAAAAAAAAGAA---ATACCGAAATATCAGAATTTACGATCTATTCATTCAATATTTTCTTTTTTAGAGGACAAATTTCCACATTTACATTATGTATCAGATATACTGATACCTTATCCGGNCCATCTAGAAAAATTGATTCCAATTTTACAATGCTGGATACATGATGTTCCCACTTTACATTTATTACGATTGTTTTTTCATGACTATCACAATTGGAGTAATTGCATTACTACAAATAAATCTAGTTAT---GGTTTTTCAAAAGAAAATCCAAGATTATATAGGTTTCTATATAATTCTTATGTAGTTGAAGCCGAATCCATATTTGTTTTTCTTCGTAAATTTTCATCCTATTTACGATCAACATCTTTTGGACCTCTTCTTGAGCGAACACACTTCTATGGAAAAATGAAA---CATATTGGCGTAACTCGTTGTAATTATTTTCAGAAACCCCTAGGGCTCTTCAAGGATCCTATGATGCATTATGTTAGGTATCAATCAAAAGTTCTTATCGCTTCAAGGGGGACTCATCTTCTTTTGAAGAAATGGAAATCTTACTTTATGAATTTATGGCAATGTCATTTTGACTTTTGGTCTGAACCCAGTAGGATACACATAAACCAATTTCCAAAATTTTCTTTCTATTTTTTGGGTTATCTTTCAAGTATAGAAATGACTCCTTCATCCATAAAAAGTCAAATGCTCGAGAATGCTTTTTTAATAGATACTGTTACTCCCAAATTTCAAACTATCATAGCCATTATTCCGATCATTGAGTCATTGGCCAGAGCTAGATTTTGTAATCTATCGGGGAATCCTATTAGCAAGCCAGTTTGGACCGATTTGTCAGATTCTGAGATTATTGATCGATTTGGTAGACTATGTCGAAATCTTTCACATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTAGACTTTCATGTGCTCGAACTTTGGCGCGGAAACACAAAACGACAGTGCGCACTTTTTTGCAAAGATTAGGTTCAGAGTTTTTTGAAGAATTCTTTATGGAAGAAGAAAAAGTTCTTTCTTTAATGTTATCAAGAACTTCTTATCCTTTACAT------CAGTTATAT------------------AGAGAACCTATTTGGTTTTTGGATATTATTCGTCTAAATGACTTGGTG----AATCATTT---------------ATGATTAAGTTGTGATAA----GTGTAAATC-AAATAGAACCCAAAAG----------TCT------TC-CAT--ACAC-------GTTA-TC-----ACCT---TTATACTGAAATGCTCATATAGTAGTGGTTGAATCAACTGAGTTGTCAGGTTTCTTACACTTTCTTTTC------GGGATCTAATCTAAATTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGGGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGTCTTACCAGTCTTGATCGTTACAAAGGACGCTGCTACCATATCGAACCTGTTGCTGGAGAGGAAAATCAATATATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAATATGTTTACTTCCATTGTAGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAAGATTTGAGAATTCCTCCTGCTTATTCCAAAAGTTTCCAAGGACCACCTCACGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTACTAGGATGTACCATCAAACCAAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCTGAAGCAATTTATAAAGCACAAGCTGAAACAGGTGAAATTAAAGGGCATTACCTAAATGCTACCGCAGGTACTTGTGAAGAAATGATCAAAAGAGCTGTGTTTGCTAGAGAATTGGGAGTCCCTATTGTTATGCATGACTACTTAACAGGTGGATTCACTGCAAATACTAGTTTAGCACATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGTGCAATGCATGCGGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGGATGTCTGGTGGGGACCATATTCACGCTGGTACCGTAGTAGGTAAGCTGGAAGGTGAGCGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACAGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTATCTATGCCTGGTGTTATCCCTGTAGCTTCAGGTGGTATTCATGTTTGGCATATGCCTGCACTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGTGGCGGAACTTTAGGACACCCTTGGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAA----CGATTTGACTTCCT------TAGTATTTTTCCTCT---TTTTGATCGGTGACCCAAAATTCACTCTCTTTTACACATTGACTCTACTGCTTCACTAA------AAGATCCGAGCAT-----TTTTTGTTT-----AGCCCAAGTTTTT--GTGTA---TACGTACAAATGAATAT------------------ATATGGAC------AACGA-----GACTATTGAAGTGACTTATTTACTATTCAAAATATCT-----------------AGGCTATTCTTCCACTTAT------ACTATCAACCTT-----------GAAATTCCTGTTTAAGTT-------------AAGACCAAA-A-------------------AAGTCA------------------AAAAAAAAACGT--TTTAACCGCCTATTCTTTTTTTTCTTGTTATTGT--------AATGAACACAAACAGAAGT---ACTGGA-TGGAGTAAGATAAGGTAATGCATGTCAAATAG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATTAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGATGTTCTAACGA----ATGGAGTTGATTGCGTTGGGTTGGTATG-----TTATTTTGA-CTATC--TAA----------------GAAAGAGTAACCCT------CTCTACTAAATACACACGTATATATATA------------------------------CTGACATTTCAAC-------TAAGTAATCAGGACCCGAATCCAGAATATTCATTTATGACAAATTTT---CTAATTTCAGATTT-AAGAGTTATTCTGAATTCATTCC-----AA-ATT------CAACTAATAGTTGAATATTCAGTAATCAAATCATTCACTCCACAGTCTGATTTATTGGTTTTTTTGAAAAAA-----AATTGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATGCTGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGGAATCGTGAGGGTTCAAGTCCCTCTATCCCC Wolffiella_oblonga_AY034242 ATGGAAGAATTCAAAGGATATTTA------GAAAAGGGTGGATTTAAACAACAACACTTCCTATATCCACTTCTCTTTCAAGAGTATATTTATGCACTTGCTTATGATCAGGGTTTAAATGTA---AATGCATCAA------CTTTTAATGAACCCGTTGAAATTTCAGGTTATGACAAAAAATATAGCTCATTACTTGTCAAAAGGTTAATTAAGAGACTATACCAACAGAATAGCTTGATACATTCTGTTAATAATGCTAAACAAAATAGATTTGTCGGACAC-AACAAGAACTTTTATTATCAAATGATATCAGAGGGTTTTTCTATCGTTGTAGAAATTCCCTTTTCACTTCGATTAATATCTTCACTAAAAGAAAAAAAAGAA---ATACCGAAATATCAGAATTTACGATCTATTCATTCAATATTTTCATTTTTAGAGGATAAATTTGCACATTTAAATTATATATCAGATATACTGATACCTTATCCAGTCCATCTAGAAAAATTGATTCAAATTCTACAATGCTGGATACAGGATGTTCCCACCTTACATTTATTACGATTGTTTTTTCATGACTATCACAATTGGAGTAATGACATTACTACAAATAAATCGACTTAT---GGTTTTTCAAAAGATAATGCAAGACTCTATAGGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTTCGCAAATCATCATCCTATTTACAATCAACATCTTTTGGACCCCTTCTTGAGCGAACACACTTCTATGGAAAAATGAAA---GATATTGGAATAATTTCTTGTAATGATTTTCAGAAACCCCTAGGGTTATTCAAGGATCCTTTCATGCATTATGTTAGGTATCAAGGAAAATCTATTATCGCTTCAAGAGGGACTGATCTTCTTTTGAAGAAATGGAAATCTTACTTTCTAAATTTATGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATACACATAAACGAATTTGCACATTTTTCTTTCTATTTTTTGGGTTATCTTTCAAGTGTACAAATGAATCCTTCTTCCATGAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTTACTCCAAAATTTCAAACTCTGATAGCAATTATTCCGATGATTGGGTCATTGGCCAGAGCTAAATTTTGTAATCTATCGGGTAATCCTATTAGCAAGCCAGTTTGGACCGATTTGTCAGATTCTGAGATTATTGATCGATTTGGTAGACTATGTCGAAACATTTCACATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTACCGAATAAAGTATATACTTAGACTTTCATGTGCTCGAACTTTGGCGCGGAAACATAAAACGACAGTACGCACTTTTTTGCAAAGATTAGGGTCAGAGTTTTTCGAAGAATTCTTTATGGAAGAGGAAAAAGTTCTTTCTTTAATGTTAGCAAGAACTTCTTATCCTTTACAT------CAGTTATAT------------------AGAGAACCCATTTGGTATTTGGATATTATTCGCATCAATGACTTGGTG----AATCATTT---------------ATGATTCAGTTGTGATAAACCTGTGTAAATC-AACTAGAATAAAAA-------------AAAAATTCTCACAT--AAACATAAAAGGGTAATC-----ACCT---TTATACTGAAATGCTCATACAGGAGTGGTTGAATCAACTGAGTCGTCAGGTTTCTTACACTTTCTTTTC------GGGATCTAATCTAAATTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATGAGACAAAAGATACGGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCGGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGGCTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAGGAAAATCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAAGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCACCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTAGGATGTACCATCAAACCAAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCTGAAGCAATTTATAAATCACAAGCTGAAACTGGTGAAATTAAAGGGCATTACCTAAATGCTACCGCAGCTACTTGTGAAGAAATGATCAAAAGAGCTGTGTTTGCTAGAGAATTGGGAGTCCCTATTGTTATGCATGACTACTTAACAGGTGGATTCACTGCAAATACTAGTTTAGCCTTTTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGTGCAATGCATGCGGTTATTGATAGACAGAAAAACCATGGTATCCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGACCATATTCACTCTGGTACCGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACAGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGTGGTATTCATGTTTGGCATATGCCTGCACTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGTGGCGGAACTTTAGGACACCCTTGGGGTAATGCACCTGGTGCAGTAGCTAACCGTGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGACCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAATTAGCTGCTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAA----CGATTTGAATTCCT------AAGTATTTTTCCGCT---TTTTCATCGGTGACTCAAAATTCACGATATTTTACATTTACTC--TACTCCTTCACTAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTTTTTGTCTAATATACGTACAAAT-------------------------------C------TTATATTCTCGAATAGTGAAATAACCTATTCACTATTAACAATCTCTAATGTT-----------AGGTTATCTTTCCAATTAT------AATATAAATCTT-----------GAAATTCCTGGT-------------------AACGC---------------------------GTA----TT----------------------CTT---TTTTTGTCCTGTTATTTT-----------------------AATGAACACAAACAGAAGT---ACTGGA---GAGTAAGATAAGGTGATGCATGTCAAATAG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATAGGTGCAGAGACTCAATGGAAGATATTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTATCTGGAATTATTCTTT-CTATC--TAA----------------GAAAGGGTAACCCT------CTAGACCAAACACACACATATATATA--------------------------------CTGACATTTGAAC-------TGATGAATCAAGACCCGAATCCAGAATATTAATTCCTCTCAAAAATTTT-CTAATTTCAGATTT-CAGAATTATTCTGAATTCATTCC-----AA-ATT------CAAGTAATAGTGGAATATTCTGTAATCAAATCATTCACTCCAGAGTCTGATTTCTT-GTTATTATT-AAC--TAATAAATTGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCACTACTGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Xanthosoma_helleborifolium_AM905790 ATGGAAGAATTAAAAGGATTTTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGTACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTTGGGTTATGACAAAAATTTGAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATAGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCATCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATTAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATTTGATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTCTTTTTGTTCCTATATAATTCTTATGTGGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCCTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGCTTAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCGTCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTCGAGAATTCTTTTTTAACAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTTCTATGGTTGGATCATTGTCAAAAGCGAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGGTTTGGTCGGATATGTAGAAATCTTTCTCATTATTATAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTCTTATCCTTTCATAAGGTTATATAGAGAGCGCATTTGGTATTTGGATATTATTGGTATAAATGACTTGGTG----GCTCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATAGGATAGAAA------------CAAAAATTCTCAAG---AGAGAGAAGATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGATAGTCGTGTGCAATGGGGACTTTTCAAAGGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAACTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTGCTTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGCGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATAAAAA-----CTATTTTACCTCTTA-----AGGTATTTTTCCTCT---TTTCCGTTGGTGACTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----TTTATGTTTAGTTTAGCACAAGTTTTT--GTGCAATACACGTACAA--GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-----------AGTTTATCCTTACACTTAT-----AAATATCAAA------TATCAAAAAGTCTTCCTTTTT--------ATTT------AAGACAAAA--AAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT--TTTTTTGTCCTTTT----------------------------AATGGACATAAGCACAAGC----CCCT-----AGTAAGATAAGGCAATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAANNNNNNNNNNNNNGCATCTGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA-------CGA----------CCCCAATCCATAATTATTATTTATTAAATTCAAAA-TTTTATGAAAAATTA-AAGAGTTATTGCGAATCCATTCT-----AA-ATT------GAAGTAAGAGTCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Zamioculcas_zamiifolia_AM905778 ATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCACTTCTCTTTCAAGAGTATATTTACACACTTGCTCATGATCATGGTTTAAATGTA---AATGGACCCA------TTTTTTATGAACCCACGGAATTTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAATCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTATCAGATATACTAATCCCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCTATATAATTCTTATGTAGTTGAATGCGAGTCCATATTAGTGTTTCTCCGTAAACAATCCTCTTATTTACGATTAACATCTTCTGGAACCTTTATTGAGCGAACACTTTTCTATGAAAAAATAGAACAACATCTTGTAGTCGTTTGTTGTAATGATTTTCGGAAAACCCTATGGTTGCTTAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTAATTTTCGCTTTTGGTCTCAACCCTGTAGGATCCGCATAAACCAATTCTCAAAAATTTCTTTCTATATTTTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAACGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTGGAAACTCTAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAATGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGGTATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCACAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGGTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTATTATCCTTTACATATACATAAGTTATAT------------------AGAGAACGTATTTGGTATTTTGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCATTGGTCATGAGACCATGTAAATG-AAATAGAATAGAAA------------CCAAAATTTTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTTTTAGACTTTCTTTTT------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGGCTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGATAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTGACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGTCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTTTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGCATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGGGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCGGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAGTTCGAACCAGTAGATACGCTAGATATGAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTTTTTCACAAA------AAGATCCGAGCAT-----TTTATGTTT-----AGCCCAAGTTTT---GTGCAATACACGGACAAATGAAGAT------------------ATATGTAC------AAAGACTTTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA-------------AAGTCTTCCTTTTTTTTTTTT-ATTT------AAGACCCCCTAAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTT---TTTTTGTCCCTTT----------------------------AATGGACATAAACACAAGC---CCCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAANNNNNNNNNNNNNNNGCAT-TGAGCCTTGGTATGGAAACCCACCAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAA-----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTATTT-CTATA--TAAATTACA------TACAGAAAAGATAATCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA--TCAAACGATTAATCACGACCCGAATCCATAATTTTTATTTCTTTATATAAAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATTGA----GAAGTAAGAATCGAATATTCAGTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Zantedeschia_albomaculata_AM905762 ATCGAAGAATTAAAAGGATATTTA------GAAAAAAGTCAATCTAAACAACAACACTTCCTATATCCGCTACTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGG---------GTTATGGCAATAAATTTAGCTTATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTTTTTGATAAATTCTGTTAATGATTCTAATCAAAATAGATTCGTTGGGCAC-AACAAGAATTTTGATTCTCAAATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAGGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTCTCACATTTAAATTATGTATCAGATATACTAATACCCTATCCTGTCCATCTAAAAATCTTGGTTCAAATTTTACAATGCTGGATACAAGACATTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCAAAAAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTTCTATATAATTCTTATGTAGTTGAATGCGAATCCATACTAGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCCGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAATCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCCGTAGGATCCACATAAACCAATTCTCAAAATTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAACCCTTCAGCAGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTGTTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAATGTATTAGGGAATCCTATTAGTAAGCCAATTTGGGCTGATTTGTTAGATTCTGACATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCACTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTATTTCTTTAGCTTTACCAAGAATTTCTTATCCCTTACAT------AAGTTATAT------------------AGAGAACGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT---------------ATGATTCGTTGGTCATGATACTATGTAAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAATTTCAGTC-----ATTT---TCATTCTGAAATGCTCATGTAGTAATGGTTGAATCAACTAAATACTCAAGTTTCTTAGACTTTCTTTTG------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGNNNNNTCAAGGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACGGATGGGCTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAAGAAAATCAATATATTGCTTATGTAGCCTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATCGTGGGTAATGTCTTTGGGTTTAAAGCTTTACGAGCTCTACGTTTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTGGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGACATTACTTGAATGCTACTGCAGGTACGTGCGAAGAAATGATAAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACGGGGGGATTCACGGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCCATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCTGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAGGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAAGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTACTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGAGATAAAATTCGAATTCGAACCAGTAGATAAGATAGATATAAAAA--CCCATTTGACTTCCT------AAGTATTTTTCCTCT---TTTCCGTTGGTGGCTCAAAATTCACTATGTTTTCCATTTACTC--TACTCTTTCACAAA------AAGATCCGAGCGT-----CTTATGTTTAGTTTAGCCCAAGTTTTT--GGGCAATACACGTACAAATGAAGAT------------------ATGTGTA------------CTCTAGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGCAATCCTAACACTTAT-----AAATATCAAA--------------AGTCTTCCTTTTTATTTT---ATTT------TAGACTCCC-AAAATTCCAAGG-----ATTTG-TAAAGGTTTT----------------CAAACTT---TTTTTGTCC-----------------------------------GGACATAGACACAAGC----CCCT-----AGTAAGATAAGGCGATGCATGGAAAATGG-----TCGGGATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCTCGTGTCACTGCAT-TGAGCCTTGGTATGGAAACCTATTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTGTTTTGAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACGA----ATGGAGTTGATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAGGATA---------------ACCTAATACGCACGTATATATA--------------------------------CTGACATATCAAA---CAA-CGATTAATCACGACCCAAATCCT-----TTTATTTATAAAATTCAAAA-ATTTATGAAAAATTT-AAGAGTTATTGTGAATCCATTCC-----AA-ATT------GAAGTAAGAGTCGAATACTCATTGATCAAATCATTCACTCCAGAGTCTGATTGATC-----TTTTGAAAAAATAATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC Zomicarpa_steigeriana_EU542592 ATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGTACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCGGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATGGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGGTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATTAGATATACAAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTTATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTCTTTTTGTTCCTATATAATTCTTATGTGGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAACATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGCTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCGTCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTG{GT}AGGATCCACATAAACCAATTCTCAAAAATTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTTCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCAGGGAATCCTATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGGTTTGGTCGGATATGTCGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTAGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATATAGAGTACATAAGTTATATAGAGAACGCATTTGGTACTTAGAAATTATTCGTATAAATGACTTGGTA----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGG{GT}TGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Zomicarpella_amazonica_AM905796 NNNNNNNNNTTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGTACTTGCTCATGATCATGGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCGGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAATGATTCTAACCAAAATGGATTCGTTGGGCAT-AACAAGAATTTTTATTCTCAAATGATATCAGAGGGGTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATTAGATATACAAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTTATTACTCCAAAGAAATCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTATGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTACATGAAAAAATAGAACAACATTTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGGTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCGTCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAAAATTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTTCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCAGGGAATCCTATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTTTCGTGTGCTAGAACTTTAGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCAAGAATTTCTTATCCTTTACAT------AAGTTATATAGAGTACATAAGTTATATAGAGAACGCATTTGGTACTTAGAAATTATTCGTATAAATGACTTGGTA----AATCATTT---------------ATGATTCATTAGTCATAAGACCATGTAAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAATGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTATTCAAGTTTCTTAGACTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGCGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTACGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN--NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT-----GAGAAAAAA----------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA----ATGAGGTTGATTGCATTGCGTTGGTAACTGGAATTCTTCTTT-CTATC--TAAATTACA----------GAAAAGATAACCCT------ATATACCTAATACGCACGTATATATA--------------------------------CTGAATACTGACATATCAAACGATTAATCACGACCCAAATCCATAATTATTATTTATTAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCCATTCT-----AA-ATT------GAAGTAAGAGTCGA-----CAGTGATCAAATCATTCACTCCAAA-TCTGATTGATC-----TTTTGAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN ; END; BEGIN TREES; TITLE Bayes_phylogeny; LINK TAXA = Taxa1; TRANSLATE 1 Hedyosmum_mexicanum_AM905824, 2 Tofieldia_pusilla_AJ286562, 3 Acorus_calamus_M91625, 4 Aglaodorum_griffithii_AM905758, 5 Aglaonema_modestum_AM905757, 6 Alloschemone_occidentalis_AM905744, 7 Alocasia_odora_AM905802, 8 Ambrosina_bassii_AM905798, 9 Amorphophallus_hottae_AM905785, 10 Amydrium_humile_AM905745, 11 Anadendrum_sp._AM905740, 12 Anaphyllopsis_americana_AM905753, 13 Anchomanes_difformis_AM905761, 14 Anthurium_acaule_AM905735, 15 Anubias_barteri_AM905756, 16 Aridarum_nicolsonii_AM905784, 17 Ariopsis_peltata_AM905804, 18 Arisaema_franchetianum_AM905806, 19 Arisarum_vulgare_AM905797, 20 Arophyton_buchetii_AM905820, 21 Arum_hygrophilum_AM905809, 22 Biarum_tenuifolium_AM905810, 23 Bognera_recondita_AM905765, 24 Bucephalandra_motleyana_AM905822, 25 Caladium_lindenii_AM905788, 26 Calla_palustris_AM905819, 27 Callopsis_volkensii_AM905773, 28 Carlephyton_glaucophyllum_AM905821, 29 Cercestis_mirabilis_AM905817, 30 Chlorospatha_sp._AM905791, 31 Colletogyne_perrieri_AM905823, 32 Colocasia_esculenta_AM905800, 33 Cryptocoryne_lingua_AM905779, 34 Culcasia_liberica_AM905816, 35 Cyrtosperma_macrotum_AM905750, 36 Dieffenbachia_aglaonematifolia_AM905764, 37 Dracontioides_desciscens_AM905754, 38 Dracontium_polyphyllum_AM905747, 39 Dracunculus_vulgaris_AM905812, 40 Eminium_spiculatum_AM905813, 41 Epipremnum_pinnatum_AM905746, 42 Filarum_manserichense_AM905795, 43 Gearum_brasiliense_AM905763, 44 Gonatopus_angustus_AM905777, 45 Gorgonidium_sp._AM905767, 46 Gymnostachys_anceps_AM905727, 47 Hapaline_benthamiana_AM905787, 48 Helicodiceros_muscivorus_AM905811, 49 Heteropsis_oblongifolia_AM905737, 50 Holochlamys_beccarii_AM905736, 51 Homalomena_magna_AM905774, 52 Incarum_pavonii_AM905768, 53 Jasarum_steyermarkii_AM905792, 54 Lagenandra_ovata_AM905780, 55 Landoltia_punctata_AY034223, 56 Lasia_spinosa_AM905749, 57 Lasimorpha_senegalensis_AM905755, 58 Lemna_minor_AM905730, 59 Lysichiton_americanus_AM905728, 60 Mangonia_tweedieana_AM905766, 61 Monstera_adansonii_AM905743, 62 Montrichardia_arborescens_AM905818, 63 Nephthytis_afzelii_AM905759, 64 Orontium_aquaticum_AM905729, 65 Pedicellarum_paiei_AM905733, 66 Peltandra_virginica_AM905815, 67 Philodendron_deltoideum_AM905775, 68 Phymatarum_borneense_AM905783, 69 Pinellia_pedatisecta_AM905807, 70 Piptospatha_ridleyi_AM905781, 71 Pistia_stratiotes_AM905799, 72 Podolasia_stipitata_AM905752, 73 Pothoidium_lobbianum_AM905734, 74 Pothos_scandens_AM905732, 75 Protarum_sechellarum_AM905805, 76 Pseudodracontium_lacourii_AM905786, 77 Pseudohydrosme_gabunensis_AM905760, 78 Pycnospatha_arietina_AM905751, 79 Remusatia_vivipara_AM905803, 80 Rhaphidophora_crassifolia_AM905741, 81 Rhodospatha_oblongata_AM905739, 82 Scaphispatha_gracilis_AM905793, 83 Schismatoglottis_trifasciata_AM905782, 84 Scindapsus_hederaceus_AM905742, 85 Spathantheum_intermedium_AM905769, 86 Spathicarpa_hastifolia_AM905772, 87 Spathiphyllum_wallisii_AJ235807, 88 Spirodela_polyrrhiza_AM905731, 89 Stenospermation_ulei_AM905738, 90 Steudnera_colocasiifolia_AM905801, 91 Stylochaeton_bogneri_AM905776, 92 Symplocarpus_foetidus_L10247, 93 Synandrospadix_vermitoxicus_AM905771, 94 Syngonium_auritum_AM905789, 95 Taccarum_weddellianum_AM905770, 96 Typhonium_blumei_AM905808, 97 Typhonodorum_lindleyanum_AM905814, 98 Ulearum_sagittatum_AM905794, 99 Urospatha_sagittifolia_AM905748, 100 Wolffia_columbiana_AY034255, 101 Wolffiella_oblonga_AY034242, 102 Xanthosoma_helleborifolium_AM905790, 103 Zamioculcas_zamiifolia_AM905778, 104 Zantedeschia_albomaculata_AM905762, 105 Zomicarpella_amazonica_AM905796, 106 Anaphyllum_wightii, 107 Asterostigma_cubense, 108 Bakoa_lucens, 109 Calla_palustris2, 110 Croatiella_integrifolia, 111 Furtadoa_sumatrensis, 112 Philonotion_americanum, 113 Schottarum_sarikeense, 114 Theriophonum_dalzellii, 115 Sauromatum_horsfieldii_hirsutum, 116 Lazarum_brownii, 117 Zomicarpa_steigeriana_EU542592; TREE MB = [&R] ((2:0.085737,(1:0.105712,3:0.114976):0.026241):0.0117575,((46:0.028734,(64:0.025627,(59:0.008633,92:0.010612)0.92:0.018632)1.00:0.028856)1.00:0.006941,((88:0.020772,(58:0.036675,(55:0.029392,(100:0.061151,101:0.034788)1.00:0.041211)0.98:0.003128)1.00:0.023252)0.89:0.066305,(((14:0.031326,(74:0.006333,(65:0.008189,73:0.008665)1.00:0.002373)1.00:0.015662)0.73:0.008418,((89:0.012918,(49:0.010092,(6:0.002731,81:0.009326)1.00:0.001304)1.00:0.001964)0.68:0.004759,((50:0.006773,87:0.007392)0.64:0.009857,((11:0.005685,80:0.0063)0.73:9.35E-4,(84:0.005297,(61:0.009036,(10:0.004265,41:0.003865)1.00:0.001894)0.91:0.001346)1.00:9.27E-4)0.99:0.003468)1.00:0.001007)1.00:0.015676)1.00:0.007728,((56:0.006295,((57:0.007626,106:0.008376)1.00:0.00316,(35:0.007885,(78:0.003254,(72:0.003704,(99:0.019374,(38:0.004328,(12:0.005763,37:0.005813)1.00:5.93E-4)1.00:0.00187)0.98:0.001119)0.96:6.59E-4)1.00:6.35E-4)0.75:6.81E-4)0.58:0.001076)1.00:0.022025,((91:0.024842,(44:0.007279,103:0.007391)0.99:0.015064)1.00:0.003099,(27:0.014033,(15:0.011144,(62:0.020511,(((4:0.005116,5:0.010731):0.006513,(63:0.005613,(13:0.007238,77:0.003025):0.005284):0.005139):0.005551,((29:0.007953,34:0.01318):0.006182,(67:0.008389,(51:0.004527,111:0.003163):0.004404):0.015747):0.001642,(104:0.033864,(23:0.008497,(43:0.004838,((36:0.011587,(60:0.009935,(52:0.006426,(45:0.002552,85:0.001187):0.00587):0.003211):8.13E-4):0.001054,((93:0.005189,110:0.016402):0.001227,(86:0.006996,(95:0.002016,107:0.006353):0.003905):0.001223):0.002074):0.0015):9.62E-4):0.017387):0.001582):0.00145,((112:0.016782,((33:0.011469,54:0.003154)1.00:0.026651,(70:0.00325,(16:0.002231,24:0.004343,108:0.004344,113:0.004236,(68:0.001466,83:4.58E-4)1.00:0.002095)1.00:8.78E-4)1.00:0.003594)0.62:0.002961)0.87:0.013716,((26:0.002216,109:6.6E-4)1.00:0.022376,(((9:0.007808,76:0.010747):0.013074,((47:0.01269,53:0.008149)1.00:0.001199,((25:0.007115,94:0.005367):0.003474,((42:0.005224,98:0.007397)1.00:0.009918,((30:0.006138,102:0.012574)1.00:0.006751,(82:0.005002,(105:0.002343,117:0.003715)1.00:0.005178)1.00:0.006477)1.00:6.63E-4):0.002622):0.001301):0.007343):0.002128,(((8:0.015216,19:0.008632):0.008069,(66:0.011697,(97:0.005418,(20:0.007892,(28:0.001631,31:7.96E-4):0.004794):0.001432):0.001172):0.001361):0.003601,(75:0.005283,(71:0.040079,((17:0.014291,(32:0.002677,(79:0.004514,90:0.001813):8.24E-4):0.003541):0.002805,(7:0.009581,((18:0.013886,69:0.012416):5.27E-4,((114:0.006216,116:0.003387):0.001515,(96:0.008515,(115:0.009729,(40:0.007107,(48:0.003717,(22:0.005705,(21:0.005135,39:0.003743):8.51E-4):0.001031):5.82E-4):7.35E-4):0.004062):0.001274):0.002083):0.001194):0.001325):0.002185):9.02E-4):0.008611):0.003176):0.011769):0.00157):0.001434):9.77E-4):0.00126):0.003317):0.001452):0.004455):0.005452):0.050432):0.0117575); END; BEGIN TREES; TITLE ML_phylogeny; LINK TAXA = Taxa1; TRANSLATE 1 Hedyosmum_mexicanum_AM905824, 2 Tofieldia_pusilla_AJ286562, 3 Acorus_calamus_M91625, 4 Aglaodorum_griffithii_AM905758, 5 Aglaonema_modestum_AM905757, 6 Alloschemone_occidentalis_AM905744, 7 Alocasia_odora_AM905802, 8 Ambrosina_bassii_AM905798, 9 Amorphophallus_hottae_AM905785, 10 Amydrium_humile_AM905745, 11 Anadendrum_sp._AM905740, 12 Anaphyllopsis_americana_AM905753, 13 Anchomanes_difformis_AM905761, 14 Anthurium_acaule_AM905735, 15 Anubias_barteri_AM905756, 16 Aridarum_nicolsonii_AM905784, 17 Ariopsis_peltata_AM905804, 18 Arisaema_franchetianum_AM905806, 19 Arisarum_vulgare_AM905797, 20 Arophyton_buchetii_AM905820, 21 Arum_hygrophilum_AM905809, 22 Biarum_tenuifolium_AM905810, 23 Bognera_recondita_AM905765, 24 Bucephalandra_motleyana_AM905822, 25 Caladium_lindenii_AM905788, 26 Calla_palustris_AM905819, 27 Callopsis_volkensii_AM905773, 28 Carlephyton_glaucophyllum_AM905821, 29 Cercestis_mirabilis_AM905817, 30 Chlorospatha_sp._AM905791, 31 Colletogyne_perrieri_AM905823, 32 Colocasia_esculenta_AM905800, 33 Cryptocoryne_lingua_AM905779, 34 Culcasia_liberica_AM905816, 35 Cyrtosperma_macrotum_AM905750, 36 Dieffenbachia_aglaonematifolia_AM905764, 37 Dracontioides_desciscens_AM905754, 38 Dracontium_polyphyllum_AM905747, 39 Dracunculus_vulgaris_AM905812, 40 Eminium_spiculatum_AM905813, 41 Epipremnum_pinnatum_AM905746, 42 Filarum_manserichense_AM905795, 43 Gearum_brasiliense_AM905763, 44 Gonatopus_angustus_AM905777, 45 Gorgonidium_sp._AM905767, 46 Gymnostachys_anceps_AM905727, 47 Hapaline_benthamiana_AM905787, 48 Helicodiceros_muscivorus_AM905811, 49 Heteropsis_oblongifolia_AM905737, 50 Holochlamys_beccarii_AM905736, 51 Homalomena_magna_AM905774, 52 Incarum_pavonii_AM905768, 53 Jasarum_steyermarkii_AM905792, 54 Lagenandra_ovata_AM905780, 55 Landoltia_punctata_AY034223, 56 Lasia_spinosa_AM905749, 57 Lasimorpha_senegalensis_AM905755, 58 Lemna_minor_AM905730, 59 Lysichiton_americanus_AM905728, 60 Mangonia_tweedieana_AM905766, 61 Monstera_adansonii_AM905743, 62 Montrichardia_arborescens_AM905818, 63 Nephthytis_afzelii_AM905759, 64 Orontium_aquaticum_AM905729, 65 Pedicellarum_paiei_AM905733, 66 Peltandra_virginica_AM905815, 67 Philodendron_deltoideum_AM905775, 68 Phymatarum_borneense_AM905783, 69 Pinellia_pedatisecta_AM905807, 70 Piptospatha_ridleyi_AM905781, 71 Pistia_stratiotes_AM905799, 72 Podolasia_stipitata_AM905752, 73 Pothoidium_lobbianum_AM905734, 74 Pothos_scandens_AM905732, 75 Protarum_sechellarum_AM905805, 76 Pseudodracontium_lacourii_AM905786, 77 Pseudohydrosme_gabunensis_AM905760, 78 Pycnospatha_arietina_AM905751, 79 Remusatia_vivipara_AM905803, 80 Rhaphidophora_crassifolia_AM905741, 81 Rhodospatha_oblongata_AM905739, 82 Scaphispatha_gracilis_AM905793, 83 Schismatoglottis_trifasciata_AM905782, 84 Scindapsus_hederaceus_AM905742, 85 Spathantheum_intermedium_AM905769, 86 Spathicarpa_hastifolia_AM905772, 87 Spathiphyllum_wallisii_AJ235807, 88 Spirodela_polyrrhiza_AM905731, 89 Stenospermation_ulei_AM905738, 90 Steudnera_colocasiifolia_AM905801, 91 Stylochaeton_bogneri_AM905776, 92 Symplocarpus_foetidus_L10247, 93 Synandrospadix_vermitoxicus_AM905771, 94 Syngonium_auritum_AM905789, 95 Taccarum_weddellianum_AM905770, 96 Typhonium_blumei_AM905808, 97 Typhonodorum_lindleyanum_AM905814, 98 Ulearum_sagittatum_AM905794, 99 Urospatha_sagittifolia_AM905748, 100 Wolffia_columbiana_AY034255, 101 Wolffiella_oblonga_AY034242, 102 Xanthosoma_helleborifolium_AM905790, 103 Zamioculcas_zamiifolia_AM905778, 104 Zantedeschia_albomaculata_AM905762, 105 Zomicarpella_amazonica_AM905796, 106 Anaphyllum_wightii, 107 Asterostigma_cubense, 108 Bakoa_lucens, 109 Calla_palustris2, 110 Croatiella_integrifolia, 111 Furtadoa_sumatrensis, 112 Philonotion_americanum, 113 Schottarum_sarikeense, 114 Theriophonum_dalzellii, 115 Sauromatum_horsfieldii_hirsutum, 116 Lazarum_brownii, 117 Zomicarpa_steigeriana_EU542592; TREE ML = [&R] ((2:0.07806606411,(1:0.09639024762,3:0.1041245081):0.02336951464):0.01062360639,((46:0.02604551927,(64:0.02316419608,(59:0.00756218898,92:0.009497097978)100:0.01679602893)64:0.02613234048)55:0.00600775952,((88:0.01868823747,(58:0.03322754197,(55:0.02661385801,(100:0.05571977894,101:0.03125023056)20:0.03737481081)36:0.002479055513)100:0.02098087418)44:0.06031186515,(((14:0.02839262406,(74:0.00548672846,(65:0.007264283297,73:0.007650648949):0.001868673684):0.01407674422):0.007536512244,((89:0.01153907423,(49:0.008957990287,(6:0.002191884601,81:0.008287775415):8.995759479E-4):0.001524362233):0.004066589881,((50:0.005926289128,87:0.006477599172):0.008712767857,((11:0.004939339769,80:0.005434872818):5.549372115E-4,(84:0.004559919016,(61:0.008079258576,(10:0.003660151509,41:0.003237732701):0.001441303271):9.306625752E-4):5.729677221E-4):0.00288994378):6.106680668E-4):0.01394968892):0.006841366124,((56:0.005371988838,((57:0.006338907234,106:0.004999807206)100:0.002029469652,(35:0.007015614494,(78:0.002777932975,(72:0.003160251259,(99:0.01773885832,(38:0.003678792228,(12:0.00495379764,37:0.004916679958)31:2.497849352E-4)40:0.001372772385)100:7.663803097E-4)97:2.983390299E-4)99:2.833944652E-4)98:2.857567756E-4)55:7.263093568E-4)48:0.0197494025,((91:0.0224709112,(44:0.006413846825,103:0.006527103653):0.0134229955):0.00270785637,(27:0.01256929695,(15:0.01009011452,(62:0.01854968166,(((((4:0.004437729663,5:0.009524431077)97:0.005642610758,(63:0.004845460494,(13:0.006377127931,77:0.002444424076)77:0.004578862866)53:0.004447440586)100:0.004904850023,((29:0.006900176318,34:0.01182776085)29:0.005518659196,(67:0.007385179177,(51:0.003795040723,111:0.002458486959)46:0.003793128648)82:0.01400445268)56:0.0012835325)96:1.047434021E-6,(104:0.03059566306,(23:0.007364799021,(43:0.004215262778,((36:0.01045910154,(60:0.008812913014,(52:0.005573488146,(45:0.002067569607,85:8.074850847E-4)100:0.005101150104)100:0.002618547339)88:3.294369091E-4)100:6.04199226E-4,((93:0.004428722796,110:0.01430907294)64:7.579766837E-4,(86:0.006247325003,(95:0.0013929717,107:0.005262801456)76:0.003499241077)85:8.532351013E-4)100:0.001581394551)100:0.001160323445)74:4.845951932E-4)57:0.01560328083)99:0.001161534975)100:9.449105324E-4,((112:0.0149433004,((33:0.01015753855,54:0.002603793814):0.02412343063,(70:0.002632895823,((16:0.001899533654,(24:0.003565978208,108:0.003476549946):5.011039384E-4):3.906686394E-4,(113:0.003412698498,(68:0.001163185207,83:1.047434021E-6):0.001995771994):1.047434021E-6):5.816328233E-4):0.002930821947):0.002244013874):0.01231237002,((26:0.001448294776,109:1.047434021E-6):0.02030034875,(((9:0.006904473777,76:0.009518193267)40:0.01169639757,((47:0.01127340499,53:0.007055620546)49:8.112141578E-4,((25:0.006181556919,94:0.004624776065)74:0.002863055984,((42:0.004353893485,98:0.006436326331)100:0.008788926086,((30:0.005341877516,102:0.0113106552)75:0.005879919107,(82:0.004279630681,(105:0.001619017059,117:0.002878459023)68:0.004562336335)100:0.005688991145)81:2.657676323E-4)100:0.002165548265)75:8.330905026E-4)100:0.00656043576)100:0.001635530445,(((8:0.01362461489,19:0.007651409688):0.007168183065,(66:0.01055863486,(97:0.004782894342,(20:0.006944589179,(28:0.001206209751,31:3.261416143E-4)100:0.004105957842):0.00100824752):7.352819638E-4):8.904448146E-4):0.003039114282,(75:0.004633662086,(71:0.03660587982,((17:0.01273971008,(32:0.002190089631,(79:0.003881195709,90:0.001339685511):4.649155162E-4):0.002950600901):0.002317780768,(7:0.008465803745,((18:0.01244420331,69:0.01110354919):1.263285835E-4,((114:0.005456935773,116:0.00249865974):7.79208625E-4,(96:0.00753376899,(115:0.008555072965,(40:0.006303917929,(48:0.003134075263,(22:0.00493695854,(21:0.004472018153,39:0.003144085817):4.187104732E-4):6.362288528E-4):2.747467317E-4):3.248030476E-4):0.00333299962):8.795681417E-4):0.001592725137):8.27779076E-4):9.250014116E-4):0.001590161313):5.358039975E-4):0.007607431393):0.002556379238):0.0106659788):0.00113707737):0.001094225305):3.102026709E-4):4.130776684E-4):7.639315763E-4):0.002873821149):9.70638803E-4):0.003605575292):0.004938031987):0.04583216209):0.01062360639); END;