#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 21:10 GMT TreeBASE (cc) 1994-2008 Study reference: Pettengill J.B., & Neel M.C. 2010. A Sequential Approach Using Genetic and Morphological Analyses to Test Species Status: the Case of United States Federally Endangered Agalinis acuta (Orobanchaceae). American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S11105] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=36; TAXLABELS Agalinis_acuta_125CT Agalinis_acuta_139RI Agalinis_acuta_13PCMA Agalinis_acuta_161AACRCRI Agalinis_acuta_1BVMA Agalinis_acuta_211HPNY Agalinis_acuta_229MDNY Agalinis_acuta_265SMNY Agalinis_acuta_33SNMA Agalinis_acuta_51MD Agalinis_calycina_1 Agalinis_decemloba_19ADEWCNC Agalinis_decemloba_1ADEL3VA Agalinis_decemloba_45ADEL1VA Agalinis_decemloba_6VA Agalinis_decemloba_9NC Agalinis_obtusifolia_10AOBBCAL Agalinis_obtusifolia_13AL Agalinis_obtusifolia_14AL Agalinis_obtusifolia_169AOBLCSC Agalinis_obtusifolia_177AOBDCSC Agalinis_obtusifolia_18FL3595 Agalinis_obtusifolia_20FL Agalinis_obtusifolia_6AL Agalinis_obtusifolia_8AL Agalinis_skinneriana_106MD Agalinis_skinneriana_78MD Agalinis_skinneriana_90MO Agalinis_tenella_11GA Agalinis_tenella_13GA Agalinis_tenella_1FL Agalinis_tenella_3SC Agalinis_tenella_4GA Agalinis_tenella_79ATEBCGA Agalinis_tenella_91ATEGCGA Agalinis_tenella_9GA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M18338] TITLE rbcL; LINK TAXA = Taxa1; DIMENSIONS NCHAR=651; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Agalinis_acuta_125CT AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTAT-- Agalinis_acuta_139RI AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGT---- Agalinis_acuta_13PCMA AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_acuta_161AACRCRI AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_acuta_1BVMA AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_acuta_211HPNY AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTAT-- Agalinis_acuta_229MDNY AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATCC Agalinis_acuta_265SMNY AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_acuta_33SNMA AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_acuta_51MD AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_calycina_1 -------------------------------------------------------------------------------------------------------------------------------------------------CTGAAGCCTGCGATTTGGTTTTTGATGCAGCAAGTAGTGGAAAACAATTCTTGATTGTTGGTACAAAAAATAAAGCAGCTGATTTAGTAGCATGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTAATAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTCAACCGTCTTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCGTTGATCAGCATGAAGAATATACGGCTCTGCGAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCCGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGCTATATCTTCAATTCGCTTAATTCTTAACAAATTGGTATTC Agalinis_decemloba_19ADEWCNC AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTAT-- Agalinis_decemloba_1ADEL3VA AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_decemloba_45ADEL1VA AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_decemloba_6VA AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_decemloba_9NC --------------------------------------------------------------------------------------------------------------------------------------------------TGAAGCCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_obtusifolia_10AOBBCAL AACATCAACTTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAAGCATGTTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATTTGCGATTTGATTTTTGATGCAGCAAGTAGTGGAAAACAATTCTTGATTGTTGGTACACCAAAGAAAGCAGCTGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGGGTTAATAAAAAATGGTTCCGCGGGATGTTAACGAATTGGTCCATTACAGAAACGAGACTTCAGAAGTTGAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCTTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGAGTTACCCGATATTGTAATCATCGTTGATCAGCATAAAGAATATACGGCTCTGCGAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCCGATCTTGCAGATATTTCGATTCCGTCGAATGATGACGCTAGATCTTCAATTCGCTTAATTCTTAACAAATTGGTATTC Agalinis_obtusifolia_13AL AACATCAACTTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAAGCATGTTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATTTGCGATTTGATTTTTGATGCAGCAAGTAGTGGAAAACAATTCTTGATTGTTGGTACACCAAAGAAAGCAGCTGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGGGTTAATAAAAAATGGTTCCGCGGGATGTTAACGAATTGGTCCATTACAGAAACGAGACTTCAGAAGTTGAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCTTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGAGTTACCCGATATTGTAATCATCGTTGATCAGCATAAAGAATATACGGCTCTGCGAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCCGATCTTGCAGATATTTCGATTCCGTCGAATGATGACGCTAGATCTTCAATTCGCTTAATTCTTAACAAATTGGTATTC Agalinis_obtusifolia_14AL --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_obtusifolia_169AOBLCSC AACATCAACTTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAAGCATGTTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATTTGCGATTTGATTTTTGATGCAGCAAGTAGTGGAAAACAATTCTTGATTGTTGGTACACCAAAGAAAGCAGCTGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGGGTTAATAAAAAATGGTTCCGCGGGATGTTAACGAATTGGTCGATTACAGAAACGAGACTTCAGAAGTTGAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCTTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGAGTTACCCGATATTGTAATCATCGTTGATCAGCATAAAGAATATACGGCTCTGCGAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCCGATCTTGCAGATATTTCGATTCCGTCGAATGATGACGCTAGATCTTCAATTCGCTTAATTCTTAACAAATTGGTATTC Agalinis_obtusifolia_177AOBDCSC AACATCAACTTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAAGCATGTTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATTTGCGATTTGATTTTTGATGCAGCAAGTAGTGGAAAACAATTCTTGATTGTTGGTACACCAAAGAAAGCAGCTGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGGGTTAATAAAAAATGGTTCCGCGGGATGTTAACGAATTGGTCGATTACAGAAACGAGACTTCAGAAGTTGAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCTTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGAGTTACCCGATATTGTAATCATCGTTGATCAGCATAAAGAATATACGGCTCTGCGAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCCGATCTTGCAGATATTTCGATTCCGTCGAATGATGACGCTAGATCTTCAATTCGCTTAATTCTTAACAAATTGGTATTC Agalinis_obtusifolia_18FL3595 AACATCAACTTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAAGCATGTTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATTTGCGATTTGATTTTTGATGCAGCAAGTAGTGGAAAACAATTCTTGATTGTTGGTACACCAAAGAAAGCAGCTGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGGGTTAATAAAAAATGGTTCCGCGGGATGTTAACGAATTGGTCCATTACAGAAACGAGACTTCAGAAGTTGAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCTTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGAGTTACCCGATATTGTAATCATCGTTGATCAGCATAAAGAATATACGGCTCTGCGAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCCGATCTTGCAGATATTTCGATTCCGTCGAATGATGACGCTAGATCTTCAATTCGCTTAATTCTTAACAAATTGGTATTC Agalinis_obtusifolia_20FL AACATCAACTTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAAGCATGTTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATTTGCGATTTGATTTTTGATGCAGCAAGTAGTGGAAAACAATTCTTGATTGTTGGTACACCAAAGAAAGCAGCTGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGGGTTAATAAAAAATGGTTCCGCGGGATGTTAACGAATTGGTCCATTACAGAAACGAGACTTCAGAAGTTGAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCTTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGAGTTACCCGATATTGTAATCATCGTTGATCAGCATAAAGAATATACGGCTCTGCGAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCCGATCTTGCAGATATTTCGATTCCGTCGAATGATGACGCTAGATCTTCAATTCGCTTAATTCTTAACAAATTGGTATTC Agalinis_obtusifolia_6AL AACATCAACTTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAAGCATGTTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATTTGCGATTTGATTTTTGATGCAGCAAGTAGTGGAAAACAATTCTTGATTGTTGGTACACCAAAGAAAGCAGCTGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGGGTTAATAAAAAATGGTTCCGCGGGATGTTAACGAATTGGTCCATTACAGAAACGAGACTTCAGAAGTTGAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCTTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGAGTTACCCGATATTGTAATCATCGTTGATCAGCATAAAGAATATACGGCTCTGCGAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCCGATCTTGCAGATATTTCGATTCCGTCGAATGATGACGCTAGATCTTCAATTCGCTTAATTCTTAACAAATTGGTATTC Agalinis_obtusifolia_8AL --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_skinneriana_106MD AACATCAACTTGGAAGAGATGCTGAAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACGGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTCGTGGAAAACAATTCTTGATTGTTGGTACAAAAAGGGAAGCAGCTGATTTAGTAGCATGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCTTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATGAAGAATATACGGCTCTGCGAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCCGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_skinneriana_78MD AACATCAACTTGGAAGAGATGCTGAAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACGGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTCGTGGAAAACAATTCTTGATTGTTGGTACAAAAAGGGAAGCAGCTGATTTAGTAGCATGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCTTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATGAAGAATATACGGCTCTGCGAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCCGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_skinneriana_90MO ---------------------------------------------------------------------------------------------------------------------------------------------TTATCTGAAGCCTGCGATTTGGTTTGTTATGCAGCAAGTCGTGGAAAACAATTCTTGATTGTTGGTACAAAAAGGGAAGCAGCTGATTTAGTAGCATGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCTTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATGAAGAATATACGGCTCTGCGAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCCGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_tenella_11GA AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_tenella_13GA AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_tenella_1FL AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_tenella_3SC AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_tenella_4GA AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_tenella_79ATEBCGA AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTAT-- Agalinis_tenella_91ATEGCGA ---------------------------------------------------------------------------------------------------------------------------------------------------GAAGCCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC Agalinis_tenella_9GA AACATCAAATTGGAAGAGATGCTGGAGGCAGGCGTTCATTTTGGGCATGGGACTAAGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAGGCATATTACAAATCTTACGAGAACTGCTCGTTTTTTATCCGAAATCTGCGATTTGGTTTGTTATGCAGCAAGTGGTGGAAAACAATTCTTGATTGTTGGTACAAGAAAGCACGCAGCGGATTTAGTAGCACGGGCTGCAATAAAGGCCCGGTGTCATTGTGTTACTAAAAAATGGCTCGGCGGGATGTTAACGAATTGGTCCACTACAGAAACGAGACTTCAGAAGTTCAGGGACTTGAGAATGGAACAAAAAACGGGAAGACTTAACCGCCGTCCGAAAAGAGATGCGGCTGTGGTGAAAAGACAATTATCCCGCTTGCAAACATACCTGGGCGGGATTAAATATATGACAGGGTTACCCGATATTGTAATCATCCTTGATCAGCATAAAGAATATACGGCTCTGCAAGAGTGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATTGTGACCCTGATCTTGCAGATATTTCGATTCCGGCGAATGATGACGGTAGATCTTCAATTCGCTTCATTCTTAACAAATTGGTATTC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M18333] TITLE matK; LINK TAXA = Taxa1; DIMENSIONS NCHAR=367; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Agalinis_acuta_125CT GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_acuta_139RI GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_acuta_13PCMA GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_acuta_161AACRCRI GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_acuta_1BVMA GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAAATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_acuta_211HPNY GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_acuta_229MDNY GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_acuta_265SMNY GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_acuta_33SNMA GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_acuta_51MD GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_calycina_1 GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCAGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCAGCGGGGTAAATCCATTAAAAAGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTATTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_decemloba_19ADEWCNC GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACT---- Agalinis_decemloba_1ADEL3VA GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_decemloba_45ADEL1VA GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_decemloba_6VA GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_decemloba_9NC GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAAATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAAATATTTATACTTCTT Agalinis_obtusifolia_10AOBBCAL GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATGTAGATACTGACAAGATCCTTGTCTCGGGGAATGGACATACTCGAAGCATTCCATTAGTTAGGTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCAGCGGGGGAAATCCATTAAAACGGGAGAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGA-------------------------------------------------------------------- Agalinis_obtusifolia_13AL -GAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATGTAGATACTGACAAGATCCTTGTCTCGGGGAATGGACATACTCGAAGCATTCCATTAGTTAGGTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCAGCGGGGGAAATCCATTAAAACGGGAGAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAAATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAAATATTTATACTTCTT Agalinis_obtusifolia_14AL GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATGTAGATACTGACAAGATCCTTGTCTCGGGGAATGGACATACTCGAAGCATTCCATTAGTTAGGTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCAGCGGGGGAAATCCATTAAAACGGGAGAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAAATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAAATATTTATACTTCTT Agalinis_obtusifolia_169AOBLCSC GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATGTAGATACTGACAAGATCCTTGTCTCGGGGAATGGACATACTCGAAGCATTCCATTAGTTAGGTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCAGCGGGGGAAATCCATTAAAACGGGAGAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_obtusifolia_177AOBDCSC GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATGTAGATACTGACAAGATCCTTGTCTCGGGGAATGGACATACTCGAAGCATTCCATTAGTTAGGTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCAGCGGGGGAAATCCATTAAAACGGGAGAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAAATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAAATATTTATACTTCTT Agalinis_obtusifolia_18FL3595 GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATGTAGATACTGACAAGATCCTTGTCTCGGGGAATGGACATACTCGAAGCATTCCATTAGTTAGGTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCAGCGGGGGAAATCCATTAAAACGGGAGAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_obtusifolia_20FL GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATGTAGATACTGACAAGATCCTTGTCTCGGGGAATGGACATACTCGAAGCATTCCATTAGTTAGGTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCAGCGGGGGAAATCCATTAAAACGGGAGAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAAATATTTATACTTCTT Agalinis_obtusifolia_6AL GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATGTAGATACTGACAAGATCCTTGTCTCGGGGAATGGACATACTCGAAGCATTCCATTAGTTAGGTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCAGCGGGGGAAATCCATTAAAACGGGAGAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAAATATTTATACTTCTT Agalinis_obtusifolia_8AL GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATGTAGATACTGACAAGATCCTTGTCTCGGGGAATGGACATACTCGAAGCATTCCATTAGTTAGGTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCAGCGGGGGAAATCCATTAAAACGGGAGAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAAATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAAATATTTATACTTCTT Agalinis_skinneriana_106MD GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAAGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTCGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCAGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTCCTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_skinneriana_78MD GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAAGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTCGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCAGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTCCTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_skinneriana_90MO GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAAGGGCTCTTGCTATAGCCGAATGCGGGGGGAAGATCATTTATCTCGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATGTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCAGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGACGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTCCTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_tenella_11GA GTAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_tenella_13GA GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_tenella_1FL GTAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_tenella_3SC GGAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_tenella_4GA GTAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGGGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT Agalinis_tenella_79ATEBCGA --AACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAA---------------- Agalinis_tenella_91ATEGCGA -GAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTC-- Agalinis_tenella_9GA GTAACTGGGTTAGAACGACAAGCAGCTCTAGATTCAGGGGCTCTTGCTATAGCCGAATGCGGGGGAAAGATCATTTATCTAGATACTGACAAGATCCTTGTCTCAGGGAATGGACATACTCTAAGCATTCCATTAGTTATCTATCAACGTTCCAACAAAAATACTTGTATGCATCAAAAACCCCAGGTTCGGCGGGGGAAATCCATTAAAACGGGACAAATTTTAGCAGATGGTGCTGCTACGGTGGGTGGCGAACTTGCTTTGGGGAAAAACGTCTTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGATGCTGTACTCATTAGTGAGCGTTTGGTATATGAAGATATTTATACTTCTT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M18335] TITLE rpoB; LINK TAXA = Taxa1; DIMENSIONS NCHAR=617; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Agalinis_acuta_125CT AAGTGTTGGATTCAAAGCGGGTGTT-AAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_acuta_139RI AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_acuta_13PCMA AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_acuta_161AACRCRI AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_acuta_1BVMA AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTCGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_acuta_211HPNY AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_acuta_229MDNY AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_acuta_265SMNY AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_acuta_33SNMA AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_acuta_51MD AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_calycina_1 AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTACTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_decemloba_19ADEWCNC ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_decemloba_1ADEL3VA AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_decemloba_45ADEL1VA AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTA--------- Agalinis_decemloba_6VA AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_decemloba_9NC AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTCGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_obtusifolia_10AOBBCAL ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_obtusifolia_13AL AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCGACCGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_obtusifolia_14AL AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCGACCGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_obtusifolia_169AOBLCSC AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGTAGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_obtusifolia_177AOBDCSC AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTTCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_obtusifolia_18FL3595 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_obtusifolia_20FL AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCGACCGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_obtusifolia_6AL AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCGACCGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_obtusifolia_8AL AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCGACCGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_skinneriana_106MD --------------AAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCGCAATACGAAACCAAAGATACGGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCGGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCGAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCCTTTATGCGTTGGA Agalinis_skinneriana_78MD AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCGCAATACGAAACCAAAGATACGGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCGGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCGAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCCTTTATGCGTTGGA Agalinis_skinneriana_90MO AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCGCAATACGAAACCAAAGATACGGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCGGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCGAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCCTTTATGCGTTGGA Agalinis_tenella_11GA ------TGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATAGTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGATTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA Agalinis_tenella_13GA AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGC------ Agalinis_tenella_1FL --------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_tenella_3SC -----------------------------------------------------------------CCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGATTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGATTTCCTCCCGCTTATATTAAAACTTTCCAAGGTTCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTG------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_tenella_4GA AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATG------------------------------------ Agalinis_tenella_79ATEBCGA ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_tenella_91ATEGCGA ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_tenella_9GA AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAAC--------------------------------------------------------------------------------------------------------------------- ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M18334] TITLE trnT_trnF; LINK TAXA = Taxa1; DIMENSIONS NCHAR=872; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Agalinis_acuta_125CT TTTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATATTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_acuta_139RI -TTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATATTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_acuta_13PCMA TTTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATATTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_acuta_161AACRCRI ------------------------------------------------------------------GGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATT------------------------------------------------------ Agalinis_acuta_1BVMA -TTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATATTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_acuta_211HPNY TTTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATATTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_acuta_229MDNY ------------------------------------------------------------------------------TTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGAC------------------------------------------------ Agalinis_acuta_265SMNY TTTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATATTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_acuta_33SNMA TTTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATATTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_acuta_51MD TTTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATATTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_calycina_1 ----------------------------------------------------------------------------------------------------------------------------ATTACGATTCTTTCTGAACACGTATTGGAATTGGAATAGTCTTATTACTCCAAAGAAAGCCAGTTCCTCTTTTTCAAATTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCGTCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGTTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTGTGAATGTCTTTGTAAAGGTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTATATTAGGTATCAAAGAAAAGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGGTTTATCCAAGAAGGATTTATATAAACCAACCATCCAATCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTAATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCTCTGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGATTTGGGTGTATATGCAGAAATTTTTTTCATTATCATAGTGGATCT Agalinis_decemloba_19ADEWCNC -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_decemloba_1ADEL3VA ----------------------------------------------------------------------------------------------------------------------------ATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCC------------------------------------------------------------------------------------- Agalinis_decemloba_45ADEL1VA ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_decemloba_6VA TTTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATATTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_decemloba_9NC TTTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATATTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_obtusifolia_10AOBBCAL ---------------------------------------------------------------------------------------------------------------------------TATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAAGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATAGCAATCAATTATCCAAGCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTCCGGAGTCTCATTTTAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_obtusifolia_13AL ---------------------------------TATTAGATATACTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTCAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAAGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATAGCAATCAATTATCCAAGCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTCCGGAGTCTCATTTTAGAAAATGCATTTCTAAGCAATAATGCTATTAAGAAAGTCGATACCTTTCTTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTACTATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_obtusifolia_14AL TTTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATACTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTCAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAAGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATAGCAATCAATTATCCAAGCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTCCGGAGTCTCATTTTAGAAAATGCATTTCTAAGCAATAATGCTATTAAGAAAGTCGATACCTTTCTTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTACTATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_obtusifolia_169AOBLCSC ----------------------------------------------------------------------------------------------------------------------------------ATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAAGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATAGCAATCAATTATCCAAGCATTCCTTTGAATTTTTGGGCTATCATTCAAGTTTGCGAATGAACCCTTCAGTGGTCCGGAGTCTCATTTTAGAAAATGCATTTCTAAGCAATAATGCTATTAAGAAAGTCGATACCTTTCTTCCAATTATTCCAATGATTG-------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_obtusifolia_177AOBDCSC TTTTA---------------------------GTATTAGATATACTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTCAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAAGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATAGCAATCAATTATCCAAGCATTCCTTTGAATTTTTGGGCTATCATTCAAGTTTGCGAATGAACCCTTCAGTGGTCCGGAGTCTCATTTTAGAAAATGCATTTCTAAGCAATAATGCTATTAAGAAAGTCGATACCTTTCTTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGC-------------------------------------------------------------------------------------- Agalinis_obtusifolia_18FL3595 -----------------------------------------------------------------------------------ACTCTTCGCTATTGGGTCAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAAGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATAGCAATCAATTATCCAAGCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTCCGGAGTCTCATTTTAGAAAATGCATTTCTAAGCAATAATGCTATTAAGAAAGTCGATACCTTTCTTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGA---------------------------------------------------------------- Agalinis_obtusifolia_20FL ----AGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATACTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTCAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAAGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATAGCAATCAATTATCCAAGCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTCCGGAGTCTCATTTTAGAAAATGCATTTCTAAGCAATAATGCTATTAAGAAAGTCGATACCTTTCTTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTACTATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATC- Agalinis_obtusifolia_6AL --------------------------------GTATTAGATATACTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTCAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAAGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATAGCAATCAATTATCCAAGCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTCCGGAGTCTCATTTTAGAAAATGCATTTCTAAGCAATAATGCTATTAAGAAAGTCGATACCTTTCTTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTACTATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_obtusifolia_8AL TTTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATACTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTCAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAAGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATAGCAATCAATTATCCAAGCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTCCGGAGTCTCATTTTAGAAAATGCATTTCTAAGCAATAATGCTATTAAGAAAGTCGATACCTTTCTTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTACTATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_skinneriana_106MD TTTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATACTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCAGTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATCGAACGTCTTTTGAATGTCTTT------GGAAAGCTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAAGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTCTATCAATCAATTATCCAATCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAATAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTAGCAGATTCGACTATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_skinneriana_78MD --------------------------------GTATTAGATATACTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCAGTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATCGAACGTCTTTTGAATGTCTTT------GGAAAGCTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAAGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTCTATCAATCAATTATCCAATCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAATAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTAGCAGATTCGACTATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_skinneriana_90MO -------------------------------------------ACTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATCGAACGTCTTTTGAATGTCTTT------GGAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAAGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTCTATCAATCAATTATCCAATCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTAGCAGATTCGACTATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_tenella_11GA TTTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATATTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_tenella_13GA TTTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATATTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_tenella_1FL --------------------------------GTATTAGATATATTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_tenella_3SC --------------------------------GTATTAGATATATTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_tenella_4GA TTTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATATTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT Agalinis_tenella_79ATEBCGA -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_tenella_91ATEGCGA ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTG------------------------------------------------------------------------------------------------------------------------------------------ Agalinis_tenella_9GA TTTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATATTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTTACATTTATTACGATTCTGTCTGAACAAGTATTGGAATTGGAATAGTCTTCTTACTCCAAAGAAAGCCAGTTCCTCTTT------TTCAAAAAGAAATCAAAGGTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCATCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGGAAAAATAGAACGTCTTTTGAATGTCTTT------GTAAAGGTTAAGGATTTTCAGGCGAACCTGTGGTTGGTCAAGGAACCTTGCATCCATTCGATTAGGTATCAAAGAAAGGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTTACCTTATCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATCAATCAATTATCCAACCATTCCTTTGAATTTTTGGGCTATCATTCAAGCTTGCGAATGAACCCTTCAGTGGTACGGAGTCTCATTTTAGAAAATTCATTTCTAATCAATAATGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGTTTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M18337] TITLE rps2; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1707; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Agalinis_acuta_125CT -----------TTAGGAATTCCGTTTCAATACACTTTCAATACACTATAGTCTATATAAGTATATATAG-------------------TGTCTCGAAAAAGATAAAAAAGAATAGAATCTATAATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------GGGGAGTTACTAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAGAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGAC------------------------------------------------------------ Agalinis_acuta_139RI TTATTTCTGCATTAGGAATTCCGTTTCAATACACTTTCAATACACTATAGTCTATATAAGTATATATAG-------------------TGTCTCGAAAAAGATAAAAAAGAATAGAATCTATAATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTTTTGGATTCCCATGCCATTTGACATTCTTTTTGTTACCCTTCTCTATTTTCTATCCTATCTTTTCTTAGATTTTGAATTCGATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAGAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGATAGCT- Agalinis_acuta_13PCMA TTATTTCTGCATTAGGAATTCCGTTTCAATACACTTTCAATACACTATAGTCTATATAAGTATATATAG-------------------TGTCTCGAAAAAGATAAAAAAGAATAGAATCTATAATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTTTTGGATTCCCATGCCATTTGACATTCTTTTTGTTACCCTTCTCTATTTTCTATCCTATCTTTTCTTAGATTTTGAATTCGATATTTATTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAGAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGATAGCTC Agalinis_acuta_161AACRCRI -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAA--------------- Agalinis_acuta_1BVMA TTATTTCTGCATTAGGAATTCCGTTTCAATACACTTTCAATACACTATAGTCTATATAAGTATATATAG-------------------TGTCTCGAAAAAGATAAAAAAGAATAGAATCTATAATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTTTTGGATTCACATGCCATTTGACATTCTTTTTGTTACACTTCTCTATTTTCTATCCTATCTATTCTTAGATTTTGAATTCGATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAGAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGATAGCTC Agalinis_acuta_211HPNY -----TCTGCATTAGGAATTCCGTTTCAATACACTTTCAATACACTATAGTCTATATAAGTATATATAG-------------------TGTCTCGAAAAAGATAAAAAAGAATAGAATCTATAATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTTTTGGATTCCCATGCCATTTGACATTCTTTTTGTTACCCTTCTCTATTTTCTATCCTATCTATTCTTAGATTTTGAATTCGATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAGAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGA------ Agalinis_acuta_229MDNY ------CTGCATTAGGAATTCCGTTTCAATACACTTTCAATACACTATAGTCTATATAAGTATATATAG-------------------TGTCTCGAAAAAGATAAAAAAGAATAGAATCTATAATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTTTTGGATTCCCATGCCATTTGACATTCTTTTTGTTACCCTTCTCTATTTTCTATCCTATCTATTCTTAAATTTTGAATTCGATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAGAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGG-------- Agalinis_acuta_265SMNY TTATTTCTGCATTAGGAATTCCGTTTCAATACACTTTCAATACACTATAGTCTATATAAGTATATATAG-------------------TGTCTCGAAAAAGATAAAAAAGAATAGAATCTATAATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTTTTGGATTCCCATGCCATTTGACATTCTTTTTGTTACCCTTCTCTTTTTTCTATCCTATCTTTTCTTAGATTTTGAATTCGATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAGAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGATAGCTC Agalinis_acuta_33SNMA TTATTTCTGCATTAGGAATTCCGTTTCAATACACTTTCAATACACTATAGTCTATATAAGTATATATAGTCTATATAAGTATATATAGTGTCTCGAAAAAGATAAAAAAGAATAGAATCTATAATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTTTTGGATTCCCATGCCATTTGACATTCTTTTTGTTACACTTCTCTATTTTCTATCCTATCTATTCTTAGATTTTGAATTCGATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAAACATTCCTCGGTTTTCATTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAAAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAGAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGATAGCTC Agalinis_acuta_51MD --------GCATTAGGAATTCCGTTTCAATACACTTTCAATACACTATAGTCTATATAAGTATATATAG-------------------TGTCTCGAAAAAGATAAAAAAGAATAGAATCTATAATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTTTTGGATTCCCATGCCATTTGACTTTCTTTTTGTTACCCTTCTCTTTTTTCTATCCTATCTTTTCTTAGATTTTGAATTCGATTTTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAGAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGA------ Agalinis_calycina_1 --------GCATTAGGAATTC-----------------AATACACTATAGTATATATAAGTATATATAG-------------------TGTCTCTAAAAATATAAAAAAGAATAGAATCTATAATTTCTACTAAATATTGAATATATTCATCTTGAATATATTCATCTTATAGAATAGAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCGAATAATATTCGATAGTAAATCTGAAATATTTTTAGATAGTCCAGTTTGCTTTTTTATTTT-GGATTCACATGACATTTGAAATTCTTTTTGTTACACTTCTCTATTTTCTATCCTATCTATTCTTAGATTTTTAATTCTATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGGTTTCATTCGTAAAAGGGGGAGTTAATAATAAAAAATAAAGAATCGACCGTTCAAGTATCCCCGATTGCATGGGAAAAGTGGCAGGAAAAGAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATACAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAGGAAAGAAAGAAAATAC-TTTTTTCGAGATAGTAATGGCTAGCTAATAAATTCAAAGGTTCCAGCATAAATGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTCAAAACAAAGGTTCAGAAAACGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATAAAATGATTGATTAATGATGGCCCAAATCTGTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAAAGAATATTCATTCATCAAATCATTCACTCCATA-----GTCCGATAGATCTTTTAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCAA---------------------------------------------------------AGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATAAATGCCCTTCTCTTATCACATGTGATATAGAATACACATCCAAATTAAGCAAGGAATTCCTATTTGAATGCTTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACCTTTGAAATTTCCCCTTGTCCCTTTAATTGACATAGACCCCAGTCATCTAATAAAATTAGCATAGGA--TGCTACATTGGGAATGGTCGGGATAGCTC Agalinis_decemloba_19ADEWCNC --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCGATTGCACGGG-AAAGTGGCAGGAAAAGAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACA---------------------- Agalinis_decemloba_1ADEL3VA -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAA--------------- Agalinis_decemloba_45ADEL1VA ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTTTTCATTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAGAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTG------------------- Agalinis_decemloba_6VA ---------------------------------------------------------------------------------------------------------------------------ATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCAC-------AATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCT---------------------------------------------------------------- Agalinis_decemloba_9NC ------------------------------------------------------------------------------------------------------------AGAATAGAATCTATAATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTTTTGGATTCACATGCCATTTGACATTCTTTTTGTTACCCTTCTCTATTTTCTATCCTATCTATTCTTAGATTTTGAATTCGATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAGAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGATAGCTC Agalinis_obtusifolia_10AOBBCAL --------------------------------------------------------TATATATATAGAG-------------------TGTCTCTAAAAAGATAAAAAAGAATAGAATCGATAATTTCGACTAAATA---------------TTGAATATATTCATCTTATAGAATAAAACAATTTATATAGCGATATGGAATTTCGATTTCTTGATCCCAATTCGAAATTCGAATACAATTCGAATCAAATACTATTCGATAGTCAATCTGAAATATTTTTAGATAGTCCAGTTTGCTTTTTGATTTT-GGATTCACATGCCATTTGACATTCTTTTTGTTACACTTCTGTATTTTCTATCCTATCTATTCTTAGATTTTGAATTCTATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAGGGGGGAGTTAATAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGAG-AAAGTGGCAGGAAAAGAAAGAGATCTATGGGGTATATATCAATCTATATTGAATTGCCGATACAGAAATAATAAAATCCAATTTGATTAGCTGAAATGCGGGTTTCCTATAG----GAAAGAAAAGAC-TTTTTTCGAGATAGTAATCGCTAGCTAATAAATTCAAAGGTTCCAGCATAACTGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTCTTTTCTTAAAACAAAAGTTCAGAAAACGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCCTAAAGAATATTCATTCATCAAATCATTCACTCCATAGTCCGGTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTAGTTGACTCCTAAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATATCGAATACACATCCAAATTAAGCAAGGAATTCCTATTTGAATGATTCACAATCAATACCATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACCTTTGCAATTTCCCCCTGTCCCTTTAATTGACATAGACCCCAGCCATCTAATAAAATGAGCCTAGGATGTGCTACATTGGGAAT-------------- Agalinis_obtusifolia_13AL TTCTTTCTGCATTAGGAATTC-----------AATTTCAATACACTCTAGTCTATATAAGTATATATAT-------------ATAGAGTGTCTCTAAAAAGATAAAAAAGAATAGAATCGATAATTTCGACTAAATA---------------TTGAATATATTCATCTTATAGAATAAAACAATTTATATAGCGATATGGAATTTCGATTTCTTGATCCCAATTCGAAATTCGAATACAATTCGAATCAAATACTATTCGATAGTCAATCTGAAATATTTTTAGATAGTCCAGTTTGCTTTTTGATTTT-GGATTCACATGCCATTTGACATTCTTTTTGTTACACTTCTGTATTTTCTATCCTATCTATTCTTAGATTTTGAATTCTATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAGGGGGGAGTTAATAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGAG-AAAGTGGCAGGAAAAGAAAGAGATCTATGGGGTATATATCAATCTATATTGAATTGCCGATACAGAAATAATAAAATCCAATTTGATTAGCTGAAATGCGGGTTTCCTATAG----GAAAGAAAAGAC-TTTTTTCGAGATAGTAATCGCTAGCTAATAAATTCAAAGGTTCCAGCATAACTGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTCTTTTCTTAAAACAAAAGTTCAGAAAACGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCCTAAAGAATATTCATTCATCAAATCATTCACTCCATAGTCCGGTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTAGTTGACTCCTAAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATATCGAATACACATCCAAATTAAGCAAGGAATTCCTATTTGAATGATTCACAATCAATACCATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACCTTTGCAATTTCCCCCTGTCCCTTTAATTGACATAGACCCCAGCCATCTAATAAAATGAGCCTAGGATGTGCTACATTGGGAATGGTCGGGATAGCTC Agalinis_obtusifolia_14AL ------CTGCATTAGGAATTC-----------AATTTCAATACACTCTAGTCTATATCAGTATATATAT-------------ATAGAGTGTCTCTAAAAAGATAAAAAAGAATAGAATCGATAATTTCGACTAAATA---------------TTGAATATATTCATCTTATAGAATAAAACAATTTATATAGCGATATGGAATTTCGATTTCTTGATCCCAATTCGAAATTCGAATACAATTCGAATCAAATACTATTCGATAGTCAATCTGAAATATTTTTAGATAGTCCAGTTTGCTTTTTGATTTT-GGATTCACATGCCATTTGACATTCTTTTTGTTACACTTCTGTATTTTCTATCCTATCTATTCTTAGATTTTGAATTCTATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAGGGGGGAGTTAATAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGAG-AAAGTGGCAGGAAAAGAAAGAGATCTATGGGGTATATATCAATCTATATTGAATTGCCGATACAGAAATAATAAAATCCAATTTGATTAGCTGAAATGCGGGTTTCCTATAG----GAAAGAAAAGGC-TTTTTTCGAGATAGTAATCGCTAGCTAATAAATTCAAAGGTTCCAGCATAACTGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTCTTTTCTTAAAACAAAAGTTCAGAAAACGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCCTAAAGAATATTCATTCATCAAATCATTCACTCCATAGTCCGGTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTAGTTGACTCCTAAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATATCGAATACACATCCAAATTAAGCAAGGAATTCCTATTTGAATGATTCACAATCAATACCATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACCTTTGCAATTTCCCCCTGTCCCTTTAATTGACATAGACCCCAGCCATCTAATAAAATGAGCCTAGGATGTGCTACATTGGGAATGGTCGGGATAGCT- Agalinis_obtusifolia_169AOBLCSC ----------------AATTC-----------AATTTCAATACACTCTAGTCTATATAAGTATATATAT-------------ATAGAGTGTCTCTAAAAAGATAAAAAAGAATAGAATCGATAATTTCGACTAAATA---------------TTGAATATATTCATCTTATAGAATAAAACAATTTATATAGCGATATGGAATTTCGATTTCTTGATCCCAATTCGAAATTCGAATACAATTCGAATCAAATACTATTCGATAGTCAATCTGAAATATTTTTAGATAGTCCAGTTTGCTTTTTGATTTT-GGATTCACATGCCATTTGACATTCTTTTTGTTACACTTCTGTATTTTCTATCCTATCTATTCTTAGATTTTGAATTCTATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAGGGGGGAGTTAATAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGAG-AAAGTGGCAGGAAAAGAAAGAGATCTATGGGGTATATATCAATCTATATTGAATTGCCGATACAGAAATAATAAAATCCAATTTGATTAGCTGAAATGCGGGTTTCCTATAG----GAAAGAAAAGAC-TTTTTTCGAGATAGTAATCGCTAGCTAATAAATTCAAAGGTTCCAGCATAACTGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTCTTTTCTTAAAACAAAAGTTCAGAAAACGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCCTAAAGAATATTCATTCATCAAATCATTCACTCCATAGTCCGGTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTAGTTGACTCCTAAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATATCGAATACACATCCAAATTAAGCAAGGAATTCCTATTTGAATGATTCACAATCAATACCATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACCTTTGCAATTTCCCCCTGTCCCTTTAATTGACATAGACCCCAGCCATCTAATAAAATGAGCCTAGGATGTGCTACATTGGGAA--------------- Agalinis_obtusifolia_177AOBDCSC TTCTTTCTGCATTAGGAATTC-----------AATTTCAATACACTCTAGTCTATATAAGTATATATAT-------------ATAGAGTGTCTCTAAAAAGATAAAAAAGAATAGAATCGATAATTTCGACTAAATA---------------TTGAATATATTCATCTTATAGAATAAAACAATTTATATAGCGATATGGAATTTCGATTTCTTGATCCCAATTCGAAATTCGAATACAATTCGAATCAAATACTATTCGATAGTCAATCTGAAATATTTTTAGATAGTCCAGTTTGCTTTTTGATTTT-GGATTCACATGCCATTTGACATTCTTTTTGTTACACTTCTGTATTTTCTATCCTATCTATTCTTAGATTTTGAATTCTATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAGGGGGGAGTTAATAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGAG-AAAGTGGCAGGAAAAGAAAGAGATCTATGGGGTATATATCAATCTATATTGAATTGCCGATACAGAAATAATAAAATCCAATTTGATTAGCTGAAATGCGGGTTTCCTATAG----GAAAGAAAAGAC-TTTTTTCGAGATAGTAATCGCTAGCTAATAAATTCAAAGGTTCCAGCATAACTGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTCTTTTCTTAAAACAAAAGTTCAGAAAACGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCCTAAAGAATATTCATTCATCAAATCATTCACTCCATAGTCCGGTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTAGTTGACTCCTAAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATATCGAATACACATCCAAATTAAGCAAGGAATTCCTATTTGAATGATTCACAATCAATACCATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACCTTTGCAATTTCCCCCTGTCCCTTTAATTGACATAGACCCCAGCCATCTAATAAAATGAGCCTAGGATGTGCTACATTGGGAA--------------- Agalinis_obtusifolia_18FL3595 --------------------------------------------------------------TATAGAG-------------------TGTCTCTAAAAAGATAAAAAAGAATAGAATCGATAATTTCGACTAAATA---------------TTGAATATATTCATCTTATAGAATAAAACAATTTATATAGCGATATGGAATTTCGATTTCTTGATCCCAATTCGAAATTCGAATACAATTCGAATCAAATACTATTCGATAGTCAATCTGAAATATTTTTAGATAGTCCAGTTTGCTTTTTGATTTT-GGATTCACATGCCATTTGACATTCTTTTTGTTACACTTCTGTATTTTCTATCCTATCTATTCTTAGATTTTGAATTCTATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAGGGGGGAGTTAATAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGAG-AAAGTGGCAGGAAAAGAAAGAGATCTATGGGGTATATATCAATCTATATTGAATTGCCGATACAGAAATAATAAAATCCAATTTGATTAGCTGAAATGCGGGTTTCCTATAG----GAAAGAAAAGGC-TTTTTTCGAGATAGTAATCGCTAGCTAATAAATTCAAAGGTTCCAGCATAACTGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTCTTTTCTTAAAACAAAAGTTCAGAAAACGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCCTAAAGAATATTCATTCATCAAATCATTCACTCCATAGTCCGGTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_obtusifolia_20FL -TCTTTCTGCATTAGGAATTC-----------AATTTCAATACACTCTAGTCTATATAAGTATATATAT-------------ATAGAGTGTCTCTAAAAAGATAAAAAAGAATAGAATCGATAATTTCGACTAAATA---------------TTGAATATATTCATCTTATAGAATAAAACAATTTATATAGCGATATGGAATTTCGATTTCTTGATCCCAATTCGAAATTCGAATACAATTCGAATCAAATACTATTCGATAGTCAATCTGAAATATTTTTAGATAGTCCAGTTTGCTTTTTGATTTT-GGATTCACATGCCATTTGACATTCTTTTTGTTACACTTCTGTATTTTCTATCCTATCTATTCTTAGATTTTGAATTCTATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAGGGGGGAGTTAATAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGAG-AAAGTGGCAGGAAAAGAAAGAGATCTATGGGGTATATATCAATCTATATTGAATTGCCGATACAGAAATAATAAAATCCAATTTGATTAGCTGAAATGCGGGTTTCCTATAG----GAAAGAAAAGGC-TTTTTTCGAGATAGTAATCGCTAGCTAATAAATTCAAAGGTTCCAGCATAACTGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTCTTTTCTTAAAACAAAAGTTCAGAAAACGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCCTAAAGAATATTCATTCATCAAATCATTCACTCCATAGTCCGGTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTAGTTGACTCCTAAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATATCGAATACACATCCAAATTAAGCAAGGAATTCCTATTTGAATGATTCACAATCAATACCATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACCTTTGCAATTTCCCCCTGTCCCTTTAATTGACATAGACCCCAGCCATCTAATAAAATGAGCCTAGGATGTGCTACATTGGGAATGGTCGGGATAGCTC Agalinis_obtusifolia_6AL TTCTTTCTGCATTAGGAATTC-----------AATTTCAATACACTCTAGTCTATATAAGTATATATAT-------------ATAGAGTGTCTCTAAAAAGATAAAAAAGAATAGAATCGATAATTTCGACTAAATA---------------TTGAATATATTCATCTTATAGAATAAAACAATTTATATAGCGATATGGAATTTCGATTTCTTGATCCCAATTCGAAATTCGAATACAATTCGAATCAAATACTATTCGATAGTCAATCTGAAATATTTTTAGATAGTCCAGTTTGCTTTTTGATTTT-GGATTCACATGCCATTTGACATTCTTTTTGTTACACTTCTGTATTTTCTATCCTATCTATTCTTAGATTTTGAATTCTATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAGGGGGGAGTTAATAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGAG-AAAGTGGCAGGAAAAGAAAGAGATCTATGGGGTATATATCAATCTATATTGAATTGCCGATACAGAAATAATAAAATCCAATTTGATTAGCTGAAATGCGGGTTTCCTATAG----GAAAGAAAAGAC-TTTTTTCGAGATAGTAATCGCTAGCTAATAAATTCAAAGGTTCCAGCATAACTGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTCTTTTCTTAAAACAAAAGTTCAGAAAACGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCCTAAAGAATATTCATTCATCAAATCATTCACTCCATAGTCCGGTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTAGTTGACTCCTAAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATATCGAATACACATCCAAATTAAGCAAGGAATTCCTATTTGAATGATTCACAATCAATACCATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACCTTTGCAATTTCCCCCTGTCCCTTTAATTGACATAGACCCCAGCCATCTAATAAAATGAGCCTAGGATGTGCTACATTGGGAATGGTCGGGATAGCTC Agalinis_obtusifolia_8AL ------------------------------------------------------TATATATATATAGAG-------------------TGTCTCTAAAAAGATAAAAAAGAATAGAATCGATAATTTCGACTAAATA---------------TTGAATATATTCATCTTATAGAATAAAACAATTTATATAGCGATATGGAATTTCGATTTCTTGATCCCAATTCGAAATTCGAATACAATTCGAATCAAATACTATTCGATAGTCAATCTGAAATATTTTTAGATAGTCCAGTTTGCTTTTTGATTTT-GGATTCACATGCCATTTGACATTCTTTTTGTTACACTTCTGTATTTTCTATCCTATCTATTCTTAGATTTTGAATTCTATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAGGGGGGAGTTAATAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGAG-AAAGTGGCAGGAAAAGAAAGAGATCTATGGGGTATATATCAATCTATATTGAATTGCCGATACAGAAATAATAAAATCCAATTTGATTAGCTGAAATGCGGGTTTCCTATAG----GAAAGAAAAGAC-TTTTTTCGAGATAGTAATCGCTAGCTAATAAATTCAAAGGTTCCAGCATAACTGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTCTTTTCTTAAAACAAAAGTTCAGAAAACGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCCTAAAGAATATTCATTCATCAAATCATTCACTCCATAGTCCGGTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTAGTTGACTCCTAAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATATCGAATACACATCCAAATTAAGCAAGGAATTCCTATTTGAATGATTCACAATCAATACCATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACCTTTGCAATTTCCCCCTGTCCCTTTAATTGACATAGACCCCAGCCATCTAATAAAATGAGCCTAGGATGTGCTACATTGGGAATGGTCGGGATAGCT- Agalinis_skinneriana_106MD TTATTTCTGCATTAGGAATTC-----------AATTTCAATACACTCTAGTCTATATAAGTATATATAG-------------------TGTCTCTAAAAAGATAAAAAAGAATAGAATCTAGAATTTCGACTAAAGA---------------TTGAATATATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTCATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAACTACTATTCGATAGTCAATCGGAAATATTTTTAGATAGTCCAGTTTGCTTTTTTATTTT-GGATTCACATGCCATTTGACATTCTTTTTGTTACACTTCTCTATTTTCTATCCTATCTATTCTTATATTTTGAATTCGATATTTCTTTCGAATTTGATTCATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCAGTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCATTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAGAAAGAGATGTATGGGGTCTATATCAATCTATATTGAATTGCCGATACAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTGCTATAG----GAAAGAAAATACTTTTTTTCGAGATAGTAATCGCTAGCTAATAAATTCAAAGGTTCCAGCATAACTGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAAACAAAAGTTCAGAAAACGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAAAGAATATTCATTCATCAAATCATTCACTCCATA-----GTACGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGGAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCC-AAAAAAGCCTATTTGACTCCTAAAATAGTTATCCTATTCCCCTTTTTCGTTATTCGTTATCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGGGATAGAGAATACACATCCAAATTAAGCAAGGAATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACCTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTACTAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGATAGCTC Agalinis_skinneriana_78MD TTATTTCTGCATTAGGAATTC-----------AATTTCAATACACTCTAGTCTATATAAGTATATATAG-------------------TGTCTCTAAAAAGATAAAAAAGAATAGAATCTAGAATTTCGACTAAAGA---------------TTGAATATATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTCATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAACTACTATTCGATAGTCAATCGGAAATATTTTTAGATAGTCCAGTTTGCTTTTTTATTTT-GGATTCACATGCCATTTGACATTCTTTTTGTTACACTTCTCTATTTTCTATCCTATCTATTCTTATATTTTGAATTCGATATTTCTTTCGAATTTGATTCATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCAGTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCATTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAGAAAGAGATGTATGGGGTCTATATCAATCTATATTGAATTGCCGATACAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTGCTATAG----GAAAGAAAATACTTTTTTTCGAGATAGTAATCGCTAGCTAATAAATTCAAAGGTTCCAGCATAACTGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAAACAAAAGTTCAGAAAACGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAAAGAATATTCATTCATCAAATCATTCACTCCATA-----GTACGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGGAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCC-AAAAAAGCCTATTTGACTCCTAAAATAGTTATCCTATTCCCCTTTTTCGTTATTCGTTATCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGGGATAGAGAATACACATCCAAATTAAGCAAGGAATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACCTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTACTAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGATAGCTC Agalinis_skinneriana_90MO TTATTTCTGCATTAGGAATTC-----------AATTTCAATACACTCTAGTCTATATAAGTATATATAG-------------------TGTCTCTAAAAAGATAAAAAAGAATAGAATCTAGAATTTCGACTAAAGA---------------TTGAATATATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTCATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAACTACTATTCGATAGTCAATCGGAAATATTTTTAGATAGTCCAGTTTGCTTTTTTATTTT-GGATTCACATGCCATTTGACATTCTTTTTGTTACACTTCTCTATTTTCTATCCTATCTATTCTTATATTTTGAATTCGATATTTCTTTCGAATTTGATTCATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCAGTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCATTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAGAAAGAGATATATGGGGTCTATATCAATCTATATTGAATTGCCGATACAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTGCTATAG----GAAAGAAAATACTTTTTTTCGAGATAGTAATCGCTAGCTAATAAATTCAAAGGTTCCAGCATAACTGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAAACAAAAGTTCAGAAAACGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCGATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAAAGAATATTCATTCATCAAATCATTCACTCCATA-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGGAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCC-AAAAAAGCCTATTTGACTCCTAAAATAGTTATCCTATTCCCCTTTTTCGTTATTCGTTATCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGGGATAGAGAATACACATCCAAATTAAGCAAGGAATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACCTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTACTAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGATAGCT- Agalinis_tenella_11GA TTATTTCTGCATTAGGAATTCCGTTTCAATACACTTTCAATACACTATAGTCTATATAAGTATATATAG-------------------TGTCTCGAAAAAGATAAAAAAGAATAGAATCTATAATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTTTTGGATTCACATGCCATTTGACATTCTTTTTGTTACCCTTCTCTTTTTTCTATCCTATCTTTTCTTAGATTTTGAATTCGATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAAAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTCTCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGATAGCT- Agalinis_tenella_13GA TTATTTCTGCATTAGGAATTCCGTTTCAATACACTTTCAATACACTATAGTCTATATAAGTATATATAG-------------------TGTCTCGAAAAAGATAAAAAAGAATAGAATCTATAATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTTTTGGATTCCCATGCCATTTGACATTCTTTTTGTTACCCTTCTCTATTTTCTATCCTATCTATTCTTAAATTTTGAATTCAATTTTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAAAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTCTCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGATAGCTC Agalinis_tenella_1FL TTATTTCTGCATTAGGAATTCCGTTTCAATACACTTTCAATACACTATAGTCTATATAAGTATATATAG-------------------TGTCTCGAAAAAGATAAAAAAGAATAGAATCTATAATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTTTTGGATTCACATGCCATTTGACATTCTTTTTGTTACCCTTCTCTATTTTCTATCCTATCTATTCTTAGATTTTGAATTCGATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAAAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTCTCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGATAGCTC Agalinis_tenella_3SC TTATTTCTGCATTAGGAATTCCGTTTCAATACACTTTCAATACACTATAGTCTATATAAGTATATATAG-------------------TGTCTCGAAAAAGATAAAAAAGAATAGAATCTATAATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTTTTGGATTCACATGCCATTTGACATTCTTTTTGTTACCCTTCTCTTTTTTCTATCCTATCTATTCTTAGATTTTGAATTCGATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAAAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTATCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGATAGCTC Agalinis_tenella_4GA --ATTTCTGCATTAGGAATTCCGTTTCAATACACTTTCAATACACTATAGTCTATATAAGTATATATAG-------------------TGTCTCGAAAAAGATAAAAAAGAATAGAATCTATAATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTTTTGGATTCCCATGCCATTTGACATTCTTTTTGTTACCCTTCTCTTTTTTCTATCCTATCTATTCTTAGATTTTGAATTCGATATTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAAAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTCTCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGATAGCT- Agalinis_tenella_79ATEBCGA ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAAAAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTCTCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGA------ Agalinis_tenella_91ATEGCGA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTCTCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAA--------------- Agalinis_tenella_9GA TTATTTCTGCATTAGGAATTCCGTTTCAATACACTTTCAATACACTATAGTCTATATAAGTATATATAG-------------------TGTCTCGAAAAAGATAAAAAAGAATAGAATCTATAATTTCTACTAAATA---------------TTGAATAGATTCATCTTATAGAATAAAACAATTTATATAGCGATATGTAATTTCGATTTCTTGATCACAATTCGAAATTCGAATACAATTCGAATCAAATAATATTCGATCGTCAATCTGAAATATTTTTAGATAGTCCAGTGTGCTTTTTTTTTTTTGGATTCCCATGCCATTTGACTTTCTTTTTGTTACCCTTCTCTTTTTTCTATCCTATCTTTTCTTAGATTTTGAATTCGATTTTTCTTTCGAATTTGATTAATTAGTTAGAACGATAACTAAAACGAATCAGACATTCCTCGGTTTTCATTCGTAAAAGGGGGAGTTACTAATAAAAA--AAAGAATCGACCGTTCAAGTATCCCCGATTGCACGGG-AAAGTGGCAGGAAAAAAAAGAGATATATGGGGTATATATCAATCTATATTGAATTGCCGATCCAGAAATAATAAAATCCAATTTGATTAGATGAAATGCGGGTTTCCTATAG----GAAAGAAAATAC-TTTTTTCGAGATAGTAATCGCTAGCTAATCAATTCAAAGGTTCCAGCATAACGGAAAGAAAAAAGGAATGATATCATAATAAGATCCTATTCTCAAAACAAAAAAGAGGGGATATGGCGAAATCGGTAGACGCTACGGACTTAATTGAATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAGAAAAAAGGGCAATCCTGAGCCAAATCCTGTTTTCTTAAACCAAAAGTTCAGAAAACG-AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGATTGCGCTGATAGAGGAATGAAACTTCAGAAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAAATCAAATGATTGATTAATGATGGCCCAAATCTCTATCTGTATTTTTGAATACGAAAAGTGGAAGAATTGGTGTGAATTTCTTCCATAACGAATATTCATTCATCAAATCATTCACTCCATC-----GTCCGA---------TAGATCTTTTTTAAAAGATCTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCCCCCAAAAAAGCCTATTTGACTCCTCAAATATTTCTCCTATTCCCCTTTTTCGTTATTCGTTAGCGGTTCCAAATTCCTTATTCTGATTCTTTTTGACAAACGTATTGTGGCATCAATGCCCTTCTCTTCTCACATGTGATAGAGAATACACATCCAAATTAAGCAAGGCATTCCTATTTGAATGATTCACAATCAATAACATTACTCCTACTGAAACTTCGAAAGTCGTCTTTTTGAAGATCCAAGAAATTACAGGACTTGGAGAAACTTTTGAAATTTCCCCTTGTCCCTTTAATTGACCTAGACCCCAGTCATCTAATAAAATGAGCATAGGA--TGCTACATTGGGAATGGTCGGGATAGCTC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M18336] TITLE trnH; LINK TAXA = Taxa1; DIMENSIONS NCHAR=585; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Agalinis_acuta_125CT ACTGCCTTGATCCACTTGGCTACATCCGCCCCTCTATGATATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_acuta_139RI ACTGCCTTGATCCACTTGGCTACATCCGCCCCTCTATGATATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_acuta_13PCMA ACTGCCTTGATCCACTTGGCTACATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTTATATTAATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_acuta_161AACRCRI ACTGCCTTGATCCACTTGGCTACATCCGCCCCTCTATGATATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_acuta_1BVMA ACTGCCTTGATCCACTTGGCTACATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_acuta_211HPNY ACTGCCTTGATCCACTTGGCTACATCCGCCCCTCTATGATATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGGTATTCTTTTCTT-AAAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_acuta_229MDNY ACTGCCTTGATCCACTTGGCTACATCCGCCCCTCTATGATATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_acuta_265SMNY ACTGCCTTGATCCACTTGGCTACATCCGCCCCTCTATGATATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_acuta_33SNMA ACTGCCTTGATCCACTTGGCTACATCCGCCCCTCTATGATATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_acuta_51MD ACTGCCTTGATCCACTTGGCTACATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_calycina_1 ACTGCCTTGATCCACTTGGCTACATCCGCCCCTC-----TATGATTACTATTCAAAATCATCTATTAAGAATTCATATTTTATTGATTTTTTTTTGGACCATTTCATTACGATTTTTCTATAACAAAATGAG------------------AAAATATCTTCTTTCTTTCTGAGATATTCTTTTCTT-TTAAAAAAAAGATTAATCAAAAA-----GTCGAATTGTCAAAACTTCCCAACCTTTTGACAAGAAATTAGATAAATGAAAATAC-AAAAAAAATTACAGAAAAAAAGAATAATACTCAATTATTAATCAACCCTTAATAAAAAATAT----------------------TTATTCCTTCCTTCTCTGTAATGGAAAGAAAAAAGAAAAGGCAAGGACAATACGACTAATTGAAAAGAAAAT-----AAAGGAGCAAAAACCC-CTCTTGATAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCAAAACCTCATATACACTAAGACTAAGTCTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_decemloba_19ADEWCNC ----------------------------CCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_decemloba_1ADEL3VA --------------------TACATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTT------------------------------------------------ Agalinis_decemloba_45ADEL1VA ACTGCCTTGATCCACTTGGCTACATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_decemloba_6VA ACTGCCTTGATCCACTTGGC--CATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_decemloba_9NC ACTGCCTTGATCCACTTGGCTACATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_obtusifolia_10AOBBCAL -------------------------------CTC-----TATGATTACTAGTCAAAATCATCTAGTAAGAATTCTTATTTTCTTGATTTTATTTGCGACCATTTCATTACGATTTTTCGATAACAAAATGAGCAAATATCTTCTTTCTTTCAAATATCTTCTTTCTTTCGGAGATATTCTTTTCTT-AAAAAAAAAAGATGAATCAAAAAGAAGAGAAGAATTGTCAAAACTTCCCAACCTTTTGACAAGAAATTAGATAAATGAAAATAC-AAAACAAATGACAGAAAAAAAGAAGAATACTCAAATATTAATCAACCCTTAAGAAAAAATAT----------------------GTATTCCTCCCTTTTCTGGAATGGAAAGAAAAAAGAAAAGGCAAGTACAATACTCCTAATTGAAAAGAAAATCAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTGATTGCTCCTTAGATT-ATATTATTCGATTTTCCAAACCTCGGATACACTAAGT------CTTATCCAT------------------------------------------ Agalinis_obtusifolia_13AL ACTGCCTTGATCCACTTGGCTACATCCGCCACTC-----TATGATTACTAGTCAAAATCATCTAGTAAGAATTCTTATTTTCTTGATTTTATTTGCGACCATTTCATTACGATTTTTCGATAACAAAATGAGCAAATATCTTCTTTCTTTCAAATATCTTCTTTCTTTCGGAGATATTCTTTTCTT-AAAAAAAAAAGATGAATCAAAAAGAAGAGAAGAATTGTCAAAACTTCCCAACCTTTTGACAAGAAATTAGATAAATGAAAATAC-AAAACAAATGACAGAAAAAAAGAAGAATACTCAAATATTAATCAACCCTTAAGAAAAAATAT----------------------GTATTCCTCCCTTTTCTGGAATGGAAAGAAAAAAGAAAAGGCAAGTACAATACTCCTAATTGAAAAGAAAATCAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTGATTGCTCCTTAGATT-ATATTATTCGATTTTCCAAACCTCGGATACACTAAGT------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_obtusifolia_14AL ACTGCCTTGATCCACTTGGCTACATCCGCCACTC-----TATGATTACTAGTCAAAATCATCTAGTAAGAATTATTATTTTCTTGATTTTATTTGCGACCATTTCATTACGATTTTTCGATAACAAAATGAGCAAATATCTTCTTTCTTTCAAATATCTTCTTTCTTTCGGAGATATTCTTTTCTT-AAAAAAAAAAGATGAATCAAAAAGAAGAGAAGAATTGTCAAAACTTCCCAACCTTTTGACAAGAAATTAGATAAATGAAAATAC-AAAACAAATGACAGAAAAAAAGAAGAATACTCAAATATTAATCAACCCTTAAGAAAAAATAT----------------------GTATTCCTCCCTTTTCTGGAATGGAAAGAAAAAAGAAAAGGCAAGTACAATACTCCTAATTGAAAAGAAAATCAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTGATTGCTCCTTAGATT-ATATTATTCGATTTTCCAAACCTCGGATACACTAAGT------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCA------------------ Agalinis_obtusifolia_169AOBLCSC ACTGCCTTGATCCACTTGGCTACATCCGCCACTC-----TATGATTACTAGTCAAAATCATCTAGTAAGAATTATTATTTTCTTGATTTTATTTGCGACCATTTCATTACGATTTTTCGATAACAAAATGAGCAAATATCTTCTTTCTTTCAAATATCTTCTTTCTTTCGGAGATATTCTTTTCTT-AAAAAAAAAAGATGAATCAAAAAGAAGAGAAGAATTGTCAAAACTTCCCAACCTTTTGACAAGAAATTAGATAAATGAAAATAC-AAAACAAATGACAGAAAAAAAGAAGAATACTCAAATATTAATCAACCCTTAAGAAAAAATAT----------------------GTATTCCTCCCTTTTCTGGAATGGAAAGAAAAAAGAAAAGGCAAGTACAATACTCCTAATTGAAAAGAAAATCAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTGATTGCTCCTTAGATT-ATATTATTCGATTTTCCAAACCTCGGATACACTAAGT------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_obtusifolia_177AOBDCSC ACTGCCTTGATCCACTTGGCTACATCCGCCACTC-----TATGATTACTAGTCAAAATCATCTAGTAAGAATTATTATTTTCTTGATTTTATTTGCGACCATTTCATTACGATTTTTCGATAACAAAATGAGCAAATATCTTCTTTCTTTCAAATATCTTCTTTCTTTCGGAGATATTCTTTTCTT-AAAAAAAAAAGATGAATCAAAAAGAAGAGAAGAATTGTCAAAACTTCCCAACCTTTTGACAAGAAATTAGATAAATGAAAATAC-AAAACAAATGACAGAAAAAAAGAAGAATACTCAAATATTAATCAACCCTTAAGAAAAAATAT----------------------GTATTCCTCCCTTTTCTGGAATGGAAAGAAAAAAGAAAAGGCAAGTACAATACTCCTAATTGAAAAGAAAATCAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTGATTGCTCCTTAGATT-ATATTATTCGATTTTCCAAACCTCGGATACACTAAGT------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_obtusifolia_18FL3595 ---------------------------------C-----TATGATTACTAGTCAAAATCATCTAGTAAGAATTATTATTTTCTTGATTTTATTTGCGACCATTTCATTACGATTTTTCGATAACAAAATGAGCAAATATCTTCTTTCTTTCAAATATCTTCTTTCTTTCGGAGATATTCTTTTCTT-AAAAAAAAAAGATGAATCAAAAAGAAGAGAAGAATTGTCAAAACTTCCCAACCTTTTGACAAGAAATTAGATAAATGAAAATAC-AAAACAAATGACAGAAAAAAAGAAGAATACTCAAATATTAATCAACCCTTAAGAAAAAATAT----------------------GTATTCCTCCCTTTTCTGGAATGGAAAGAAAAAAGAAAAGGCAAGTACAATACTCCTAATTGAAAAGAAAATCAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTGATTGCTCCTTAGATT-ATATTATTCGATTTTCCAAACCTCGGATACACTAAGT------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_obtusifolia_20FL ACTGCCTTGATCCACTTGGCTACATCCGCCACTC-----TATGATTACTAGTCAAAATCATCTAGTAAGAATTATTATTTTCTTGATTTTATTTGCGACCATTTCATTACGATTTTTCGATAACAAAATGAGCAAATATCTTCTTTCTTTCAAATATCTTCTTTCTTTCGGAGATATTCTTTTCTT-AAAAAAAAAAGATGAATCAAAAAGAAGAGAAGAATTGTCAAAACTTCCCAACCTTTTGACAAGAAATTAGATAAATGAAAATAC-AAAACAAATGACAGAAAAAAAGAAGAATACTCAAATATTAATCAACCCTTAAGAAAAAATAT----------------------GTATTCCTCCCTTTTCTGGAATGGAAAGAAAAAAGAAAAGGCAAGTACAATACTCCTAATTGAAAAGAAAATCAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTGATTGCTCCTTAGATT-ATATTATTCGATTTTCCAAACCTCGGATACACTAAGT------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_obtusifolia_6AL ACTGCCTTGATCCACTTGGCTACATCCGCCACTC-----TATGATTACTAGTCAAAATCATCTAGTAAGAATTCTTATTTTCTTGATTTTATTTGCGACCATTTCATTACGATTTTTCGATAACAAAATGAGCAAATATCTTCTTTCTTTCAAATATCTTCTTTCTTTCGGAGATATTCTTTTCTT-AAAAAAAAAAGATGAATCAAAAAGAAGAGAAGAATTGTCAAAACTTCCCAACCTTTTGACAAGAAATTAGATAAATGAAAATAC-AAAACAAATGACAGAAAAAAAGAAGAATACTCAAATATTAATCAACCCTTAAGAAAAAATAT----------------------GTATTCCTCCCTTTTCTGGAATGGAAAGAAAAAAGAAAAGGCAAGTACAATACTCCTAATTGAAAAGAAAATCAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTGATTGCTCCTTAGATT-ATATTATTCGATTTTCCAAACCTCGGATACACTAAGT------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_obtusifolia_8AL -------------ACTTGGCTACATCCGCCACTC-----TATGATTACTAGTCAAAATCATCTAGTAAGAATTCTTATTTTCTTGATTTTATTTGCGACCATTTCATTACGATTTTTCGATAACAAAATGAGCAAATATCTTCTTTCTTTCAAATATCTTCTTTCTTTCGGAGATATTCTTTTCTT-AAAAAAAAAAGATGAATCAAAAAGAAGAGAAGAATTGTCAAAACTTCCCAACCTTTTGACAAGAAATTAGATAAATGAAAATAC-AAAACAAATGACAGAAAAAAAGAAGAATACTCAAATATTAATCAACCCTTAAGAAAAAATAT----------------------GTATTCCTCCCTTTTCTGGAATGGAAAGAAAAAAGAAAAGGCAAGTACAATACTCCTAATTGAAAAGAAAATCAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTGATTGCTCCTTAGATT-ATATTATTCGATTTTCCAAACCTCGGATACACTAAGT------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTC-------------- Agalinis_skinneriana_106MD ACTGCCTTGATCCACTTGGCTACATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CAAATATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGATTAATCAAAAA-----GAAGAATTGTCAAAACTTCCCAACCTTTTGACAAGAAATTAGATAAATGAAAATACAAAAAAAAATGACAGAAAAAAAGAAGAATACGCAATTATTAATCAACCCTTTCAAGATATCATCGTACCGCCTTATGTAGAAATCGTCGACAATCCTTTTCTGGAAAGGAAAGAAAAAAGAAAAGGCAAGTACAATACTCCTAATTGACAAGAAAATAAAAGAAAGGAGCAAAAACTCTTTCTTGGTCTACCAAGA-GGTGTTT-TTGCTCCTT------AGATTATTCTATTTTCCAAACCTCGGATACACTAAGT------CTTATCCATT----------------------------------------- Agalinis_skinneriana_78MD ACTGCCTTGATCCACTTGGCTACATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CAAATATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGATTAATCAAAAA-----GAAGAATTGTCAAAACTTCCCAACCTTTTGACAAGAAATTAGATAAATGAAAATACAAAAAAAAATGACAGAAAAAAAGAAGAATACGCAATTATTAATCAACCCTTTCAAGATATCATCGTACCGCCTTATGTAGAAATCGTCGACAATCCTTTTCTGGAAAGGAAAGAAAAAAGAAAAGGCAAGTACAATACTCCTAATTGACAAGAAAATAAAAGAAAGGAGCAAAAACTCTTTCTTGGTCTACCAAGA-GGTGTTT-TTGCTCCTT------AGATTATTCTATTTTCCAAACCTCGGATACACTAAGT------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_skinneriana_90MO -CTGCCTTGATCCACTTGGCTACATCCGCCCCTT-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CAAATATCTTCTTTCTTTCTGAGATATTCTTTTCTTAAAAAAAAAAAGATTAATCAAAAA-----GAAGAATTGTCAAAACTTCCCAACCTTTTGACAAGAAATTAGATAAATGAAAATACAAAAAAAAATGACAGAAAAAAAGAAGAATACTCAATTATTAATCAACCCTTTCAAGATATCATCGTACCGCCTTATGTAGAAATCGTCGACAATCCTTTTCTGGAAAGGAAAGAAAAAAGAAAAGGCAAGTACAATACTCCTAATTGACAAGAAAATAAAAGAAAGGAGCAAAAACTCTTTCTTGGTCTACCAAGA-GGTGTTT-TTGCTCCTT------AGATTATTCTATTTTCCAAACCTCGGATACACTAAGT------CTTATCCATT----------------------------------------- Agalinis_tenella_11GA ACTGCCTTGATCCACTTGGCTACATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT--AAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_tenella_13GA ACTGCCTTGATCCACTTGGCTACATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT--AAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_tenella_1FL ACTGCCTTGATCCACTTGGCTACATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT--AAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_tenella_3SC ACTGCCTTGATCCACTTGGCTACATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT-AAAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_tenella_4GA ACTGCCTTGATCCACTTGGCTACATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT--AAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_tenella_79ATEBCGA ACTGCCTTGATCCACTTGGCTACATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT--AAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_tenella_91ATEGCGA ACTGCCTTGATCCACTTGGCTACATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT--AAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT Agalinis_tenella_9GA ACTGCCTTGATCCACTTGGCTACATCCGCCCCTC-----TATGATTACTAGTAAAAATCATCTAGTAAGAATTACTATTTTCTTGATTTTATTTGCGACCATTTCAGTACGATTTTTCGATAACAAAATGAG------------------CCACTATCTTCTTTCTTTCTGAGATATTCTTTTCTT--AAAAAAAAAGAAGAATTGAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAGAAAATAAAAGAAAGGAGCAAAAACAC-CTCTTGGTAGACCAAGAAAGAGTTTATTGCTCCTT------ATATTATTCTATTTTCCAAACCTCGGATACACTAAGG------CTTATCCATTTGTTGGAGCTTCAATAGCAGCCAAGTCTAGAGGGAAGTTAT ; END; BEGIN TREES; TITLE Agalinis_acuta_NJT; LINK TAXA = Taxa1; TRANSLATE 1 Agalinis_acuta_125CT, 2 Agalinis_acuta_139RI, 3 Agalinis_acuta_13PCMA, 4 Agalinis_acuta_161AACRCRI, 5 Agalinis_acuta_1BVMA, 6 Agalinis_acuta_211HPNY, 7 Agalinis_acuta_229MDNY, 8 Agalinis_acuta_265SMNY, 9 Agalinis_acuta_33SNMA, 10 Agalinis_acuta_51MD, 11 Agalinis_calycina_1, 12 Agalinis_decemloba_19ADEWCNC, 13 Agalinis_decemloba_1ADEL3VA, 14 Agalinis_decemloba_45ADEL1VA, 15 Agalinis_decemloba_6VA, 16 Agalinis_decemloba_9NC, 17 Agalinis_obtusifolia_10AOBBCAL, 18 Agalinis_obtusifolia_13AL, 19 Agalinis_obtusifolia_14AL, 20 Agalinis_obtusifolia_169AOBLCSC, 21 Agalinis_obtusifolia_177AOBDCSC, 22 Agalinis_obtusifolia_18FL3595, 23 Agalinis_obtusifolia_20FL, 24 Agalinis_obtusifolia_6AL, 25 Agalinis_obtusifolia_8AL, 26 Agalinis_skinneriana_106MD, 27 Agalinis_skinneriana_78MD, 28 Agalinis_skinneriana_90MO, 29 Agalinis_tenella_11GA, 30 Agalinis_tenella_13GA, 31 Agalinis_tenella_1FL, 32 Agalinis_tenella_3SC, 33 Agalinis_tenella_4GA, 34 Agalinis_tenella_79ATEBCGA, 35 Agalinis_tenella_91ATEGCGA, 36 Agalinis_tenella_9GA; TREE PAUP_1 = [&R] (11:0.013014165,((25:0.00107073,(19:2.785E-4,(23:1.0E-8,(24:1.0E-8,(18:1.0E-8,(21:1.0E-8,(20:1.0E-8,(17:3.8996E-4,22:2.7695E-4):0.00142274):9.2347E-4):0.00111967):2.1313E-4):4.2715E-4):2.4049E-4):5.3787E-4):0.0154953,((28:0.00146935,(26:1.0E-8,27:1.0E-8):0.00144516):0.01477751,(4:1.0E-8,((5:3.7613E-4,(16:5.2273E-4,35:5.3204E-4):6.2779E-4):3.1286E-4,((15:1.0E-8,(30:6.9044E-4,((33:2.3071E-4,36:7.0348E-4):1.0E-8,((29:1.0E-8,34:1.0E-8):4.6235E-4,(31:2.5082E-4,32:0.00120344):0.0):4.5825E-4):4.6024E-4):4.5852E-4):0.0,((1:1.0E-8,(6:2.292E-4,7:4.6914E-4):0.0):0.0,((13:1.0E-8,(9:1.0E-8,12:1.0E-8):6.3225E-4):5.966E-5,((2:1.0E-8,3:2.3024E-4):1.0E-8,(8:1.0E-8,(10:1.0E-8,14:1.0E-8):4.6005E-4):2.2855E-4):2.2998E-4):1.0E-8):1.0E-8):2.3211E-4):0.0):0.01088007):0.00402448):0.013014165); END;