#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 20:25 GMT TreeBASE (cc) 1994-2008 Study reference: Tepe E.J., Farruggia F.T., & Bohs L. 2011. A 10-gene phylogeny of Solanum section Herpystichum (Solanaceae) and a comparison of phylogenetic methods. American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S11112] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=22; TAXLABELS 'Solanum anceps Ruiz & Pav.-LB2408' 'Solanum anceps Ruiz & Pav.-LB654' 'Solanum brevifolium Dunal-LB1029' 'Solanum bulbocastanum Dunal -Spooner4' 'Solanum caripense Dunal-LB1026' 'Solanum crassinervium Tepe-LB2397' 'Solanum dalibardiforme Bitter-LB2454' 'Solanum evolvulifolium Greenm.-LB183' 'Solanum evolvulifolium Greenm.-LB2253' 'Solanum evolvulifolium Greenm.-LB2415' 'Solanum evolvulifolium Greenm.-LB2520' 'Solanum evolvulifolium Greenm.-LB709' 'Solanum limoncochaense Tepe-LB2391' 'Solanum limoncochaense Tepe-LB2466' 'Solanum loxophyllum Bitter-LB2396' 'Solanum loxophyllum Bitter-LB2521' 'Solanum lycopersicum L.-RGO340' 'Solanum pacificum Tepe-LB2395' 'Solanum pentaphyllum Bitter-LB2515' 'Solanum phaseoloides Pol.-LB1727' 'Solanum phaseoloides Pol.-LB693' 'Solanum trifolium Dunal-LB2368' ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=22; TAXLABELS 'Solanum anceps Ruiz & Pav.-LB2408' 'Solanum anceps Ruiz & Pav.-LB654' 'Solanum brevifolium Dunal-LB1029' 'Solanum bulbocastanum Dunal-Spooner4' 'Solanum caripense Dunal-LB1026' 'Solanum crassinervium Tepe-LB2397' 'Solanum dalibardiforme Bitter-LB2454' 'Solanum evolvulifolium Greenm.-LB183' 'Solanum evolvulifolium Greenm.-LB2253' 'Solanum evolvulifolium Greenm.-LB2415' 'Solanum evolvulifolium Greenm.-LB2520' 'Solanum evolvulifolium Greenm.-LB709' 'Solanum limoncochaense Tepe-LB2391' 'Solanum limoncochaense Tepe-LB2466' 'Solanum loxophyllum Bitter-LB2396' 'Solanum loxophyllum Bitter-LB2521' 'Solanum lycopersicon L.-RGO340' 'Solanum pacificum Tepe-LB2395' 'Solanum phaseoloides Pol.-LB1727' 'Solanum phaseoloides Pol.-LB693' 'Solanum trifolium Dunal-LB2209' 'Solanum trifolium Dunal-LB2368' ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=20; TAXLABELS 'Solanum anceps Ruiz & Pav.-LB2408' 'Solanum anceps Ruiz & Pav.-LB654' 'Solanum brevifolium Dunal-LB1029' 'Solanum bulbocastanum Dunal -Spooner4' 'Solanum caripense Dunal-LB1026' 'Solanum crassinervium Tepe-LB2397' 'Solanum dalibardiforme Bitter-LB2454' 'Solanum evolvulifolium Greenm.-LB183' 'Solanum evolvulifolium Greenm.-LB2415' 'Solanum evolvulifolium Greenm.-LB2520' 'Solanum evolvulifolium Greenm.-LB709' 'Solanum limoncochaense Tepe-LB2391' 'Solanum limoncochaense Tepe-LB2466' 'Solanum loxophyllum Bitter-LB2396' 'Solanum loxophyllum Bitter-LB2521' 'Solanum lycopersicum L.-RGO340' 'Solanum pacificum Tepe-LB2395' 'Solanum phaseoloides Pol.-LB1727' 'Solanum phaseoloides Pol.-LB693' 'Solanum trifolium Dunal-LB2368' ; END; BEGIN TAXA; TITLE Taxa4; DIMENSIONS NTAX=24; TAXLABELS Solanum_anceps_LB2408 Solanum_anceps_LB654 Solanum_brevifolium_LB1029 Solanum_bulbocastanum_S4 Solanum_caripense_LB1026 Solanum_crassinervium_LB2397 Solanum_dalibardiforme_LB2454 Solanum_dolichorhachis_LB2512 Solanum_evolvulifolium_LB183 Solanum_evolvulifolium_LB2253 Solanum_evolvulifolium_LB2415 Solanum_evolvulifolium_LB2520 Solanum_evolvulifolium_LB709 Solanum_limoncochaense_LB2391 Solanum_limoncochaense_LB2466 Solanum_loxophyllum_LB2396 Solanum_loxophyllum_LB2521 Solanum_lycopersicum_RGO340 Solanum_pacificum_LB2395 Solanum_pentaphyllum_LB2515 Solanum_phaseoloides_LB1727 Solanum_phaseoloides_LB693 Solanum_trifolium_LB2209 Solanum_trifolium_LB2368 ; END; BEGIN TAXA; TITLE Taxa5; DIMENSIONS NTAX=24; TAXLABELS 'Solanum anceps Ruiz & Pav.-LB2408' 'Solanum anceps Ruiz & Pav.-LB654' 'Solanum brevifolium Dunal-LB1029' 'Solanum bulbocastanum Dunal-Spooner4' 'Solanum caripense Dunal-LB1026' 'Solanum crassinervium Tepe-LB2397' 'Solanum dalibardiforme Bitter-LB2454' 'Solanum dolichorhachis Bitter-LB2512' 'Solanum evolvulifolium Greenm.-LB183' 'Solanum evolvulifolium Greenm.-LB2253' 'Solanum evolvulifolium Greenm.-LB2415' 'Solanum evolvulifolium Greenm.-LB2520' 'Solanum evolvulifolium Greenm.-LB709' 'Solanum limoncochaense Tepe-LB2391' 'Solanum limoncochaense Tepe-LB2466' 'Solanum loxophyllum Bitter-LB2396' 'Solanum loxophyllum Bitter-LB2521' 'Solanum lycopersicum L.-RGO340' 'Solanum pacificum Tepe-LB2395' 'Solanum pentaphyllum Bitter-LB2515' 'Solanum phaseoloides Pol.-LB1727' 'Solanum phaseoloides Pol.-LB693' 'Solanum trifolium Dunal-LB2209' 'Solanum trifolium Dunal-LB2368' ; END; BEGIN TAXA; TITLE Taxa6; DIMENSIONS NTAX=23; TAXLABELS 'Solanum anceps Ruiz & Pav.-LB2408' 'Solanum anceps Ruiz & Pav.-LB654' 'Solanum brevifolium Dunal-LB1029' 'Solanum bulbocastanum Dunal-Spooner4' 'Solanum caripense Dunal-LB1026' 'Solanum crassinervium Tepe-LB2397' 'Solanum dalibardiforme Bitter-LB2454' 'Solanum dolichorhachis Bitter-LB2512' 'Solanum evolvulifolium Greenm.-LB183' 'Solanum evolvulifolium Greenm.-LB2253' 'Solanum evolvulifolium Greenm.-LB2415' 'Solanum evolvulifolium Greenm.-LB2520' 'Solanum evolvulifolium Greenm.-LB709' 'Solanum limoncochaense Tepe-LB2391' 'Solanum limoncochaense Tepe-LB2466' 'Solanum loxophyllum Bitter-LB2396' 'Solanum loxophyllum Bitter-LB2521' 'Solanum lycopersicum L.-RGO340' 'Solanum pacificum Tepe-LB2395' 'Solanum pentaphyllum Bitter-LB2515' 'Solanum phaseoloides Pol.-LB1727' 'Solanum phaseoloides Pol.-LB693' 'Solanum trifolium Dunal-LB2368' ; END; BEGIN TAXA; TITLE Taxa7; DIMENSIONS NTAX=19; TAXLABELS 'Solanum anceps Ruiz & Pav.-LB2408' 'Solanum anceps Ruiz & Pav.-LB654' 'Solanum bulbocastanum Dunal-Spooner4' 'Solanum caripense Dunal-LB1026' 'Solanum crassinervium Tepe-LB2397' 'Solanum dalibardiforme Bitter-LB2454' 'Solanum evolvulifolium Greenm.-LB183' 'Solanum evolvulifolium Greenm.-LB2415' 'Solanum evolvulifolium Greenm.-LB2520' 'Solanum evolvulifolium Greenm.-LB709' 'Solanum limoncochaense Tepe-LB2391' 'Solanum limoncochaense Tepe-LB2466' 'Solanum loxophyllum Bitter-LB2396' 'Solanum loxophyllum Bitter-LB2521' 'Solanum lycopersicum L.-RGO340' 'Solanum pacificum Tepe-LB2395' 'Solanum phaseoloides Pol.-LB1727' 'Solanum phaseoloides Pol.-LB693' 'Solanum trifolium Dunal-LB2368' ; END; BEGIN TAXA; TITLE Taxa8; DIMENSIONS NTAX=21; TAXLABELS Solanum_anceps_LB2408 Solanum_anceps_LB654 Solanum_brevifolium_LB1029 Solanum_bulbocastanum_S4 Solanum_caripense_LB1026 Solanum_crassinervium_LB2397 Solanum_dalibardiforme_LB2454 Solanum_evolvulifolium_LB183 Solanum_evolvulifolium_LB2253 Solanum_evolvulifolium_LB2415 Solanum_evolvulifolium_LB2520 Solanum_evolvulifolium_LB709 Solanum_limoncochaense_LB2391 Solanum_limoncochaense_LB2466 Solanum_loxophyllum_LB2396 Solanum_loxophyllum_LB2521 Solanum_lycopersicum_RGO340 Solanum_pacificum_LB2395 Solanum_phaseoloides_LB693 Solanum_trifolium_LB2209 Solanum_trifolium_LB2368 ; END; BEGIN TAXA; TITLE Taxa9; DIMENSIONS NTAX=23; TAXLABELS 'Solanum anceps Ruiz & Pav.-LB2408' 'Solanum anceps Ruiz & Pav.-LB654' 'Solanum brevifolium Dunal-LB1029' 'Solanum bulbocastanum Dunal-Spooner4' 'Solanum caripense Dunal-LB1026' 'Solanum crassinervium Tepe-LB2397' 'Solanum dalibardiforme Bitter-LB2454' 'Solanum evolvulifolium Greenm.-LB183' 'Solanum evolvulifolium Greenm.-LB2253' 'Solanum evolvulifolium Greenm.-LB2415' 'Solanum evolvulifolium Greenm.-LB2520' 'Solanum evolvulifolium Greenm.-LB709' 'Solanum limoncochaense Tepe-LB2391' 'Solanum limoncochaense Tepe-LB2466' 'Solanum loxophyllum Bitter-LB2396' 'Solanum loxophyllum Bitter-LB2521' 'Solanum lycopersicon L.-RGO340' 'Solanum pacificum Tepe-LB2395' 'Solanum pentaphyllum Bitter-LB2515' 'Solanum phaseoloides Pol.-LB1727' 'Solanum phaseoloides Pol.-LB693' 'Solanum trifolium Dunal-LB2209' 'Solanum trifolium Dunal-LB2368' ; END; BEGIN TAXA; TITLE Taxa10; DIMENSIONS NTAX=21; TAXLABELS 'Solanum anceps Ruiz & Pav.-LB2408' 'Solanum anceps Ruiz & Pav.-LB654' 'Solanum brevifolium Dunal-LB1029' 'Solanum bulbocastanum Dunal-Spooner4' 'Solanum caripense Dunal-LB1026' 'Solanum crassinervium Tepe-LB2397' 'Solanum dalibardiforme Bitter-LB2454' 'Solanum evolvulifolium Greenm.-LB183' 'Solanum evolvulifolium Greenm.-LB2253' 'Solanum evolvulifolium Greenm.-LB2415' 'Solanum evolvulifolium Greenm.-LB2520' 'Solanum evolvulifolium Greenm.-LB709' 'Solanum limoncochaense Tepe-LB2391' 'Solanum limoncochaense Tepe-LB2466' 'Solanum loxophyllum Bitter-LB2396' 'Solanum loxophyllum Bitter-LB2521' 'Solanum lycopersicon L.-RGO340' 'Solanum pacificum Tepe-LB2395' 'Solanum phaseoloides Pol.-LB1727' 'Solanum phaseoloides Pol.-LB693' 'Solanum trifolium Dunal-LB2368' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M8567] TITLE 'Herpystichum-trnTtrnF'; LINK TAXA = Taxa4; DIMENSIONS NCHAR=1736; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Solanum_anceps_LB2408 --------------------------ACACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTATAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACGGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATAAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCCGTTTTCTGAAAACAAACAAAGGTTCAGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCGTTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGAACTGATTAATCGGATGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTACTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTT-CTAAGTGTAAATGGCTTTCTCTTATCACAAGTCTTTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTAATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTTAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCACGGAAAGGACTGTAAATCCTCATGT Solanum_anceps_LB654 TAACCCCTGAGCTAAGCGGGCCCACATCACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTATAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACGGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATAAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCCGTTTTCTGAAAACAAACAAAGGTTCAGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCGTTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGAACTGATTAATCGGATGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTACTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTT-ATAAGTGTAAATGGCTTTCTCTTATCACAAGTCTTTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTAATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTTAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCACGGAAAGGACTGTAAATCCTCATGT Solanum_brevifolium_LB1029 TAACCTCTGAGCTAAGCGGGCCCACATCACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATAGATCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTTGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGATAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTAGAAATGAAAGAAAAA------GGAATGACATCACAACGAGATCCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCTGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGAACTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACCCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGTATTTTTTTT-CTAAGCGTAAATGGCTTTCTCTTATCACAA----TTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGAGAAAATTTTTTAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACTACGGAAAGGATTGTAAATCCTCATGT Solanum_bulbocastanum_S4 TAACCTCTGAGCTAAGCGGGCCCACATCACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTATATTCTAT-----------------TATA---TATATATCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATAGATCGGGTATATATCCATCTATATTGAATTGCGTATTCCGAAATGATAAAATCATTTTTGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACGCGTTTTCGAGATAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAATAAAAAGGAATGAAATCACAACGAGATCCTAATCTCAAAATAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTCAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGAACTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTT-CTAAGCGTAAATGGCTTTCTCTTATCACAA----TTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTGGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTTAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACTACGGAAAGGACTGTAAATCCTCATGT Solanum_caripense_LB1026 TAACCTCTGAGCTAAGCGGGCCCACATCACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTATAATTTCGATTTATCACTATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTGCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTCGAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGATCGGGTGTATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTTGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAAAGGAGAAAACACGTTTTAGAGATAGGAATCGGTATCTAATGAATTCAATGGTTCCCGTATAAATGAAAGAAAAATAAAAAGGAATGAAATCACAACGAGATCCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACCCCATAGTCTGATAGATCTTTTGAAGAAGTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTTTCTAAGCGTAAATGGCTTTCTCTTATCACAA----TTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTTAATCGACTTTTGTCCTTATTAATTGACATAGACCCCAGTTATATGCTAAAATGAAGATACCACGAAAAGGATTCGAAATCCTCGTGC Solanum_crassinervium_LB2397 ------------------------CATCACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAATAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGACCTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTT-CTAAGTGTAAATGGCTTTCTCTTATCACA-----TTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTGAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCACGGAAAGGACTGTAAATCCTCACGG Solanum_dalibardiforme_LB2454 ---------------------------CACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACCAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTT-----------------------------------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCT??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTT-CTAAGTGTAAATGGCTTTCTCTTATCACAAGCCTTTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCGCGGCTTTGATAAAATTTTTTAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCACGGAAAGGACTGTAAATCCTCATGT Solanum_dolichorhachis_LB2512 -------------------------ATCACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTACAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGACCTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTT--CTAAGTGGAAATGGCTTTCTCTTATCACAAGCCTTTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTGAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCACGGAAAGGACTCTAAATCCTCATGT Solanum_evolvulifolium_LB183 ---------------------------CACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGACCTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTT-CTAAGTGTAAATGGCTTTCTCTTATCACA-----TTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTGAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCACGGAAAGGACTGTAAATCCTCACGG Solanum_evolvulifolium_LB2253 ------------------------CATCACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAATAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGACCTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTT-CTAAGTGTAAATGGCTTTCTCTTATCACA-----TTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTGGAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCACGGAAAGGACTGTAAATCCTCACGG Solanum_evolvulifolium_LB2415 ---------------------------CACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAATAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATAGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGACCTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTT-CTAAGTGTAAATGGCTTTCTCTTATCACA-----TTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTGAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCACGGAAAGGACTGTAAATCCTCACGG Solanum_evolvulifolium_LB2520 ---------------------------CACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAATAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATAGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGACCTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTT-CTAAGTGTAAATGGCTTTCTCTTATCACA-----TTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTGAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCACGGAAAGGACTGTAAATCCTCACGG Solanum_evolvulifolium_LB709 TAACCTCTGAGCTAAGCGGGCCCACATCACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGACTGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGACCTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTT-CTAAGTGTAAATGGCTTTCTCTTATCACA-----TTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTGAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCACGGAAAGGACTGTAAATCCTCACGG Solanum_limoncochaense_LB2391 ------------------------CA-CACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Solanum_limoncochaense_LB2466 ------------------------------AGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGAACTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGCCAATACCGGCAACAATTAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTT-CTAAGTGTAAATGGCTTTCTCTTATCACAAGCCTTTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTTAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCACGGAAAGGACTGTAAATCCTCATGT Solanum_loxophyllum_LB2396 ------------------------CA-CACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAATAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGACCTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTT-CTAAGTGTAAATGGCTTTCTCTTATCACA-----TTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGAGAAAATTTTTGAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCACGGAAAGGACTGTAAATCCTCACGG Solanum_loxophyllum_LB2521 ---------------------------CACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAATAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGACCTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTT-CTAAGTGTAAATGGCTTTCTCTTATCACA-----TTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGAGAAAATTTTTGAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCACGGAAAGGACTGTAAATCCTCACGG Solanum_lycopersicum_RGO340 TAACCTCTGAGCTAAGCGGGCCCACATCACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTTTTTTTTCATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTATATTCTATATTTGTATATTATATTCTATATTATATATATCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCGGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATAGATCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTTGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAATAAAATCAAAGAGGAGAAAACGCGTTTTCGAGATAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAATAAAAAGGAATGAAATCACAACGAGATCCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACCAAGGTTCAGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTCGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGAACTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTT-CTAAGCGTAAATGGCTTTCTCTTATCACAA----TTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATCCCCCGGCTTTGATAAAATTTTTTAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACTACGGAAAGGACTCTAAATCCTCATGT Solanum_pacificum_LB2395 ------------------------CATCACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTACAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCA-AAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGACCTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTT--CTAAGTGTAAATGGCTTTCTCTTATCACAAGCCTTTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATA-TGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTGAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGCGGATACCACGGAAAGGACTGTAAATCCTCATGT Solanum_pentaphyllum_LB2515 ---------------------------CACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTTTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTATTTAAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAACTCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACAGTCTGATAGATCTTTTGAAGAACTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTTTCTAAGTGTAAATGGCTTTCTCTTATCACAAGCCTTTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTTAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCGCGGAAAGTACTGTAAATCCTCATGT Solanum_phaseoloides_LB1727 ---------------------------CACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTGATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTAGTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTCGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGAACTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACCCTATTCCTTATCTTTCTCATTCACTCTATTCTTTTAGAAATGGATTTTTTTTTCTAAGTGTAAATGGCTTTCTCTTATCACAAGCCTTTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTTAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCGCGGAAAGTACCGTAAATCCTCATGT Solanum_phaseoloides_LB693 TAACCTCTGAGCTAAGCGGGCCCACATCACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTCTTTGATTTTCAATTTGAATTGAATGGTGAATATTCTTTTT------CATTTCTTTTTTTGGCATTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATATATCTCTCATTCTATATTTAGTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGGCAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAAT{CT}GGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTCGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGAACTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACCCTATTCCTTATCTTTCTCATTCACTCTATTCTTTTAGAAATGGATTTTTTTTTCTAAGTGTAAATGGCTTTCTCTTATCACAAGCCTTTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGAAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTTAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCGCGGAAAGTACCGTAAATCCTCATGT Solanum_trifolium_LB2209 ---------------------------CACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTTTTTTATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCAGTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATA--TCTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGACAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTCTTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCGTTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGAACTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTT-CTAAGTGTAAATGGCTTTCTCTTATCACAAGCCTTTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGGAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTTAATCGACTTTTGTCCTT-TTAATTGACATAGACCCCAGTTATATGATAAAATGAGGATACCACGGAAAGGACTGTAAATCCTCACGG Solanum_trifolium_LB2368 ------------------------CA-CACAGAAATCTTATATGCATAGTAATTGACTAAACTACTGGAATTGGAATCTTAGTTATTAACTAGTCAATATTCTATTGAATATTCTAGAGCAT-AAGGATTAATATAGCGATCTAGAATTTCGATTTATCACAATTCTAATACTAATATTATTAAATAGTGATTGTAAATATTGTTAATATTTTTTTATTTTCAATTTGAATTGAATGGTAAATATTCTTTTT------CATTTCTTTTTTTGGCAGTTGAAATACTTTTTATTACAGTTCTATATTTGATTCTAT--------------------ATTATATAT--CTCTCATTCTATATTTATTTCAAATTCTAATTGTTTAATGGAATGGTTAGTTATAACTAATGAGACATTCCTCCGCTTTCAGGGGAAAGTGAAGATAAAAAACAAGAATCGATCGTTCAAGTATTCCAAATTGAATGACAAAATGACAGGAAGCGAGACATATGGGTCGGGTATATATCCATCTATATTGAATTGCGGATTCCGAAATGATAAAATCATTTTAGATTGGACAAAAAAAGGGTCTCCTATAGAAGATAGTTAAGAAAATCAAAGAGGAGAAAACACGTTTTCGAGAGAGGAATCGGTATCTAATGAATTCAATGGTTCCAGTATAAATGAAAGAAAAA------GGAATGACATCACAACGAGATTCTAATCTCAAAACAAAAAGAAAGGGGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCTGAAAACAAACAAAGGTTCAGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAATGGAGTTAAATGCGTTGGTAGAGGACTTCTTACATCGAAACTTCAGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTATTGAATACTATATCAAATGATTAATGACGACCCGAATCCGTAGTTTTTCTATAAAAAATCGAAGAATTGGTGTGAATCCATTCTACATTGAAGAAAGAATCGAATATTCGTTGATCAAATCATTCACTCCATAGTCTGATAGATCTTTTGAAGAACTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACTATTTAACTCCCCAACTATTTATCCGACCCCCTTTCCTTAGCGGTTCCAAATTCCTTATCTTTCTCATTCACTCTATTC-------------------------TTTTAGAAATGGATTTTTTTT-CTAAGTGTAAATGGCTTTCTCTTATCACAAGCCTTTTGATATCTATGATACACATAGAAATGAACATCTTTGAGCAAGGAATCCCTAGTTGAATGATTCCCGATCAATACAATATCATTACTCATACTGAAACTTACAAAGTCATCTTTTTGGAGATCGAAGAAATTCCCCGGCTTTGATAAAATTTTTTAATCGACTTTTGTCCTT-TTAATT--------------------------------------------------------------- ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7413] TITLE 'Herpystichum-cos9B'; LINK TAXA = Taxa10; DIMENSIONS NCHAR=918; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Solanum anceps Ruiz & Pav.-LB2408' TGTGGATAAATTTGGTAACAAATATTATGAGAAGCTAGGCGATACGCAATATGGTTGGTACAGCTGCCTCATGCTTTCGTGCGTCTTAATCAGTTTGCCTTGTACATCTCACTTGTCGTTTATCTTGTTTAATACGAGTGCCACAGAATGTATCTTCAAGGTTGTGGGTTTC{CT}TCGAGTATCGCCTAAAAGTTGAGGGTTCTATCATTTGGTTGTATAGTCTTATGCTGTGT-TATTTTCCCCTTAAGGTGATCACAGGAAAGGCTTTATGTAGCCACATATAAGAAT-G{CG}TTATATTCCCCTTGTTCTAGGTAAAAGAGCAAAGGTCTCTTG---------------------------------CTCTTTATTCACTGAGTAGGTTATATTTTCCTTGTTCTTGGTAAAAGAGCAAAGGTCTCTTGCTCTTTATTCACTGAGTAGTTGTTGCCGTTGCTACTTTGTCAAGACTTATACTTTATGGTGACAGAACTTAGTGCGGTTTAATTGATTTGCTTGAGTATGTGTACTCTACTAATCTCTCTTGGTAGAGGGTGTT-AACTTTACTGGACGCTTATTTGTTTCACTGTGTGAAATAATAGTTTTGGCGTAGTTAAACATGCTTTCTAGGTTGTATTGGGAAGCTTGACTACATTTTCAAATTCTAGAGATATGTTAATCTTGTTTAATACACTAACTGGATAA-CCTTAAGAGTGATGGTTTGGAGTCTCATCGTCCTTAATC{CT}CCAAGTATAGTGGAATGCAGTGATGCCTGTAAACCAAATTTGGGAGACCTTTGACCTCAGTGATTTATTTGTTTATTTTATTTTTATGATTGCTCAAGTAAAA-GAATCTTTTTTTTACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum anceps Ruiz & Pav.-LB654' TGTGGATAAATTTGGTAACAAATATTATGAGAAGCTAGGCGATACGCAATATGGTTGGTACAGCTGCCTCATGCTTTCGTGCGTCTTAATCAGTTTGCCTTGTACATCTCACTTGTCGTT-ATCTTGTTTAATACGAGTGCCACAGAATGTATCTTCAAGGTTGTGGGTTTCCTCGAGTATCGCCTAAAAGTTGAGAGTTCTATCATTTGGTTGTATAGTCTTATGCTGTGA-TATTTTCCCCTTAAGGTGATCACAGGAAAGGCTTTATGTAGCCACATATAAGAAT-GGTTATATTCCCCTTGTTCTAGGTAAAAGAGCAAAGGTCTCTTG---------------------------------CTCTTTATTCACTGAGTAGGTTATATTT{CT}CCTTGTTCTTGGTAAAAGAGCAAAGGTCTCTTGCTCTTTATTCACTGAGTAGTTGTTGCC{AG}TTGCTACTTTGTCAAGACTTATACTTTATGGTGACAGAACTTAGTGCGGTT{CT}AATTGATTT{AG}CTT{CG}AGTATGTGTA{CT}TCTACTAATCTCTCTTGGTAGAGGGTGTT-AACTTTACTGGA{CG}GCTTATTTGTTTCACTGTGTGAAATAATA{AG}TTTTGGCGTAGTTAAACATGCTTTCTAGGT{CT}GTATTGGGAAGCT{GT}GACTACATTTTCAAATTCTAGAGATATGTTAATCTTGTTTAATACACTAACTGGATAA-CCTTAAGAGTGATGGTTTGGAGTCTCATCGTCCTTAATCCCCAAGTATAGTGGAATGCAGTGATGCCTGTAAACCAAATTTGGGAGACCTTTGACCTCAGTGATTTATTTGTTTATTTTATTTTTATGATTGCTCAAGTAAAA-GAATCTTTTTTTTACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum brevifolium Dunal-LB1029' ---------------------ATATTATGAGA-GCTAGGCGATACACAATATGGTTGGTACAGCTGCTTCATGCTTTTGCGAGTCTTAATCAGTTTCCCTTGTACATCTCACTTGTCGTT-ATCTTGTTTAATATGAGTGCCACAAAATGTATCTTCAAGGTTGTGGGTTCCCCCGAGTATCGCCTAAAAGTTGTGGGTTCTATCATTTGGTTGTATAGTCTTATGCTCTGA-TATTT-CACCTTAAGGTGATCAGAGGAAAGGCTTTATGTAGCCACGTATAAGAAT-GGTTATATTTCCCTTGTTCTAGGTAAAAGAGCAAAGTTTACTTTCTCTTTTCGATTAAAAAAAAAAAGGGTTACTTTCTCTTTATTCACTGAGTAGGTTATATTTCCCTTGTTCTAGGTAAAAGAGTAAAGGTCTCTTGCTCTTTATTCACTGAGTAGTTGCTGCTGTTGCTACTTTGTCAAGACTTATACTTTATGGTGACAGAACTTAGTGCGGTTCAATTGATCTGCTTCAGTATGTGTACTCTACTAATC-CTCTTGGTAGAGGATGTT-AACTTTACTGGATGTTTATTTGTTTCACTGTGTGAAATAATAGTTTTTGCCTGGTTAAACATGCTTTCTAGGTCGTATTGGGAAGCTTGACTACATTTTCACATTCTAGAGATATTTTAATCTTGTTTAAGACACTAACTAGATAA-CCTTAAGAGTGATAGTTTGGAGTCTCATTGCCCTGAATCCCCAAGTATAGTGGAATGCAATGATGCCTGTAACCCAAATTTGGGAGACCTTTGACCTCAGTGATTTATTTGTTTACTTTATCTTCATGATTGCTCAAGTAAAA-GCATCTGTTTTTGACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum bulbocastanum Dunal-Spooner4' TGTGGATAAATTTGGTAACAAATATTATGAGAAGCTAGGCGATACACAATATGGTTGGTACAGTTGCTTCATGCTTTTGTGTGTCTTAATTAGTTTCCCTTGTACATCTCACTTGTCGTT-ATCTTGTTTAGTACTAGTGCCACAAAATGTATCTTCAAGGTTGTGGGTTTCCTCGTGTATCGCCTAAAAGTTGAGGGTTCTATCATTTGGTTGTATAATCTTATGCTCTGA-TATTTTCCCCTTAAGGTGATCAGAGGAAAGGCTTTATGTAGCCACATATAAGAAA-GGTTATATTTCCCTTGTTCTAGGTAAAAGAGCAAAGATTTCTTG---------------------------------CTCTTTATTCAATGAGTAGGTTATATTTTCCTTGTTCTATGTAAAAGAGCAAAGGTCTCTTGCTCTTTATTCACTGAGCAGTTGTTGCCGTTGCTACTTTGTCAAGACTTATACTTCATGGTGACAGAACTTAGTGCGGTTCAATTGATCTGCTTCAGTATGTGTACTCTACTAATCTCTCTTGGTAGAGTATATT-AACTTTACTGGAGGCTTATTAGTTTCCTTGTGTGAAATAATAGTTTT{GT}GCCTAGTTAAACATGCTTTCTAGGTCGTATTGTGAAGCTTGACTACATTTTCAAATTCTAGAGATGTGTTAATCTTGTTTAAGACATTAAATGGATAA-CCTTAAGGTTAATAGTTTGGAGTCTCATCGCCCTTAATCTCCTAGTATATTGGAATGCAGTGATGCCTGTAACCCAAATTTGGGAGACCTTAGACCTCAGTGATTTATTTGCTTATTTTATTTTTATGATTGCTCAAGTAAAAAGCATCTTTTTTTGACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum caripense Dunal-LB1026' ---------------------ATATTATGAGA-GCTAGGCGATACGCAATATGGTTGGTACAGCTGCTTCATGCTTTCGTGTGTCTTAATCAGTTTGCCTTGTTCATCTCACTTGTCGTT-ATCTTGTTTAATATGAGTGCCACAGAAT{CG}TATCTTCAAGGTTGTGGGTTCCCTCGAGTATCGCCTAAAAGTTGAGGGTTCTATCATTTGGTTGTATAGTCTTATGCTCTGA-TATTTTCCCCTTAAGGTGATCAAAGGAAAGGCTTTATGTGGCCACATATAAGAAT-GGTTATATTCCCCTTGTTCTAGGTAAAAGAGCAAAGGTTTCTTG---------------------------------CTCTGTATTGACTGAGTAGGTTATATTTCCCTTGTTCTAGGTAAAAGAGCAAAGGTCTCTTTCTCGTTATTCACCGAGTAGTTGTTGCAGTTGCTACTTTGTCAAGACTTGTATTTTATGGTGACAGAACTTAGTGTGGTTCAATTGATCTGCTTTAGTATGTGTACTCTACTAATCTCTGTTGGTAGAGGATGTTTAACTTTACTGGAGGCT-GTGTGTTTCACTGTGTGAAATAATAGTTTTGGCCTAAGTAAACATGCTTTCTAGGTCATATTGGGAAGCTTGACTACATTTTCAAATTCTAGAGACATGTTAATCTTGTTTAAGACACTAACTGGATTAACCTTAAGAGTGAGAGTTTGGAGTCTCATCGC---------------------------AGTGATGCCTGTAACCCAAATTTGAGAGACCTTTG-CCTCAATGATTTATTTGTTTATTTTATTTTCTTGATTGCTCAAGTGAAA-GCATCTGTTTTTGACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum crassinervium Tepe-LB2397' ---------------------ATATTATGAGAAGCTAGGCGATACGCAATATGGTTGGTACATCTGCTTCATGCTTTCATGTGTCTTAATCAGTTTGCATTGCACATCTCACTTGTCGTT-ATCTTGTTTAATACGAGTGCCACAGAATGTATTTTCAAGGTTGTGGGTTCCCTCGAGTATCGCCTAAAAGTTGAGGGTTCTATCATTTGGTTGT{AC}TAGTCTTATG{CG}TCTGA-TATTTTCCCCTTAAGGTGATCAGAGGAAAGGCTTTATGTAGCCACATA{GT}AAGAAT-GGTTATATTCCCCTTGTTCTAGGTAAAAGAGCAAAGAT{CT}TCTTG---------------------------------CTCTATAGTTACTGAG----TTATATTTCCCTTGTTCTAGGTAAAAGAGCTAAGGTTTCTTGCTCCTTATTCACTGAGTAGTTGTTGCTGTTGCTACTTTGTCAAGACTT-TACTTTATGGTGACAGAACTTAGTGTGGTTCAATTGATTTGTTTCAGTATGTGTACTCTACTAATCTCTCTTGGTAGATGATGTTTAACTTTACTGGAGGCT-ATTTGTTTCACTGTGTGAAATAATTGTTTTTGCCTAGGTAAACATGCTTTCTAGGTCGTATTGGGAAGCTTGACTACATTTTCAAATTCTACAGATATGTTAATCTTGTTTAAGACACTAACTGGATAA-CCTTAAGAGTGATAGTTTGGAGT{CT}TCATCGCCTTTAATCCCCAAGTATAGTGGAATGCAGTGATGCCTGTAA{CT}CCAAATTTGGGAG{AT}CCTTTGACCTCAGTGATTTATTTGTTCATTTTATTTGTATGATTGCTCAAGTAAAA-GTATCTTTTTTTGACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum dalibardiforme Bitter-LB2454' TGTGGATAAATTTGGTAACAAATATTATGAGAAGCTAGGCGATACGCAATATGGTTGGTACATCTGCTTCATGCTTTCATGTGTCTTAATCAGTTTGCATTGCACATCTCACTTGTCGTT-ATCTTGTTTAATACGAGTGCCACGGAATGTATTTTCAAGGTTGTGGGTTCCCTCGAGTATCGCCTAAAAGTTGAGGGTTCTATCATTTGGTTGTATAGTCTTATGCGGTGA--------------------TCAGAGGAAAGGCTTTATGTAGCCACATATAAGAAT-GGTTATATTCCCATTGTTCTAGGTAAAAGATCAAAGATCTCTTG---------------------------------CTCTTTATTCACTGAGTAGGTTATATTTCCCTTGTTCTAGGTAAAAGAGCTAAGGTTTCTTGCTCCTTATTCACTGAGTAGTTGTTGCTGTTGCTACTTTGTCAAGACTTGTACTTTATGGTGACAGAACTTAGTGTGGTTCAATTGATCTGCTTCAGTATGCGTACTCTACTAATCTCTCTTGGTAGATGATGTTTAACTTTACTGGAGGCT-ATTTGTTTGACAATGTGAAATAATAGTTTTCGCCTAGGTAAACATGCTTTCTAGGTCGTATTGGGAAGCTTGACTACATTTTCAAATTCTACAGATATGTTAATCTTGTTTAAGACACTAACTGGATAA-CCTTAAGAGTGATAGTTTGGAGTCTCATCGCCTTTAATCCCCAAGTATAGTGGAATGCAGTGATGCCTGTAACCCAAATTTGGGAGACCTTTGACCTCAGTGATTTATTTGTTCATTTTATTTTTATGATTGCTCAAGTAAAA-GTATCTTTTTTTGACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum evolvulifolium Greenm.-LB183' TGTGGATAAATTTGGTAACAAATATTATGAGAAGCTAGGCGATACGCAATATGGTTGGTACATCTGCTTCATGCTTTCATGTGTCTTAATCATTTTGCATTGCACATCTCACTTGTGGTT-ATCTTGTTTAATACGAGTGCCACAGAATGTATTTTCAAGGTTGTGGGTTCCCTCGAGTATCGCCTAAAAGTTGAGGGTTCTATCATTTGGTTGTCTAGTCTTATACTCTGA-TATTTCCCCCTTAAGGTGATCAGAGGAAAGGCTTTATGTAGCCACATAGAAGAAT-GGTTATATTCCCCTTGTTCTAGGTAAAAGAGCAAAGATCTCTTG---------------------------------CTCTATATTTACTGAG----TTATATTTCCCTTGTTCTAGGTAAAAGAGCTAAGGTTTCTTGCTCCTTATTCACTGAGTAGTTGTTGCTGTTGCTACTTTGTCAAGACTT-TACTTTATGGTGACAGAACTTAGTGTGGTTCAATTGATTTGTTTCAGTATGTGTACTCTACTAATCTCTCTTGGTAGATGATGTTTAACTTTACTGGAGGCT-ATTTGTTTCACTGTGTGAAATAATAGTTTTCGCCTAGGTAAACATGCTTTCTAGGTCGTATTGGGGAGCTTGACTACATTTTCAAATTCTACAGATATGTTAATCTTGTTTAAGACACTAATTGGATAA-CCTTAAGAGTGATAGTTTGGAGTCTCATCGCCTTTAATCCCCAAGTATAGTGGAATGCAGTGATGCCTGTAACCCAAATTTGGGAGACCTTTGACCTCAGTGATTTATTTGTTCATTTTATTTGTATGATTGCTCAAGTAAAA-GTATCTTTTTTTGACCTGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum evolvulifolium Greenm.-LB2253' -------------------------------------------------------TGGTACATCTGCTTCATGCTTTCATGTGTCTTAATCAG{AT}TTGCATTGCACATCTCACTTATCGTT-ATCTTGTTTAATACGAGTGCCACAGAATGTATTTTCAAGGTTGTGGGTTCCCTCGAGTATCGCCTAAAAGTTGAGGGTTCTATCATTTGGTTGTATAGTCTTATGCTCTGA-TATTTTCCCCTTAAGGTGATCAGAGGAAAGGCTTTATGTAGCCACATATAAGAAT-GGTTATATTCCCCTTGTTCTAGGTAAAAGATCAAAGATTTCTTC---------------------------------CTCTATATTTACTGAGTAGGTTATATTTCCCTTGTTCTAGGTAAAAGAGCTAAGGTTTCTTGCTCCTTATTCACTGAGTAGTTGTTGCTGTTGCTACTTTGTCAAGACTT-TACTTTATGGTGACAGAACTTAGTGTGGTTCAATTGATTTGCTTCAGTATGTGTACTCTACTAATCTCTCTTGGTAGATGATGTTTAACTTTACTGGAGGCT-ATTTGTTTCACTGTGTGAAATAATAGTTTTCGCCTAGGTAAACATGCTTTCTAGGTCATATTGGGAAGCTTGACTACATTTTCAAATTCTACAGATATGTTAATCTTGTTTAAGACACTAACTGGATAA-CCTTAAGAGTGATAGTTTGGAGTCTCATCGCCTTTAATCCCCAAGTATAGTGGAATGCAGTGATGCCTGTAACCCAAATTTGGGAGACCTTTGGCCTCAGTGATTTATTTGTTCATTTTATTTTTATGATTGCTCAAGTAAAA-GTATCTTTTTT-GACCTGATGATGTAGGAAGACACCGGTGGG-GGAGTATGCA----------- 'Solanum evolvulifolium Greenm.-LB2415' TGTGGATAAATTTGGTAACAAATATTATGAGAAGCTAGGCGATACGCAATATGGTTGGTACATCTGCTTCATGCTTTCATGTGTCTTAATCAGTTTGCATTGCACATCTCACTTGTCGTT-ATCTTGTTTAATACGAGTACCACAGAATGTATTTTCAAGGTTGTGGGTTCCCTCGAGTATCGCCTAAAAGTTAAGGGTTCTATCATTTGGTTGTCTAGTCTTATGCTCTGA-TATTTTCCCCTTAAGGTGATCAGAGGAAAGGCTTTATGTAGCCACATAGAAGAAT-GGTTATATTCCCCTTGTTCTAGGTAAAAGAGCAAAGATCTGTTG---------------------------------CTCTATATTTACTGAG----TTATATTTCCCTTGTTCTAGGTAAAAGAGCTAAGGTTTCTTGCTCCTTATTCACTGAGTAGTTGTTGCTGTTGCTACTTTGTCAAGACTT-TACTTTATGGTGACAGAACTTAGTGCGGTTCAATTGATTTGTTTCAGTATGTGTACTCTACTAATCTCTCTTGGTAGATGATGTTTAACTTTACTGGAGGCT-ATTTGTTTCACTGTGTGAAATAATAGTTTTCGCCTCGGTAAACATGCTTTCTAGGTCGTATTGGGAAGCTTGACTACATTTTCAAATTCTACAGATATGTTAATCTTGTTTAAGACACTAACTGGATAA-CCTTAAGAGTGATAGTTTGGAGTCTCATCGCCTTTAATCCCCAAGTATAGTGGAATGCAGTGATGCCTGTAACCCAAATTTGGGAGTCCTTTGAACTCAGTGATTTATTTGTTCATTTTATTTTTATGATTGCTCAAGTAAAA-GTATCTTTTTTTGACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum evolvulifolium Greenm.-LB2520' ------------------------------------------------------TTGGTACATCTGCTTCATGCTTTCATGTGTCTTAATCAGTTTGCATTGCACATCTCACTTGTCGTT-ATCTTGTTTAATACGAGTACCACAGAATGTATTTTCAAGGTTGTGGGTTCCCTCGAGTATCGCCTAAAAGTTAAGGGTTCTATCATTTGGTTGTCTAGTCTTATGCTCTGA-TATTTTCCCCTTAAGGTGATCAGAGGAAAGGCTTTATGTAGCCACATAGAAGAAT-GGTTATATTCCCCTTGTTCTAGGTAAAAGAGCAAAGATCTGTTG---------------------------------CTCTATATTTACTGAG----TTATATTTCCCTTGTTCTAGGTAAAAGAGCTAAGGTTTCTTGCTCCTTATTCACTGAGTAGTTGTTGCTGTTGCTACTTTGTCAAGACTT-TACTTTATGGTGACAGAACTTAGTGCGGTTCAATTGATTTGTTTCAGTATGTGTACTCTACTAATCTCTCTTGGTAGATGATGTTTAACTTTACTGGAGGCT-ATTTGTTTCACTGTGTGAAATAATAGTTTTCGCCTCGGTAAACATGCTTTCTAGGTCGTATTGGGAAGCTTGACTACATTTTCAAATTCTACAGATATGTTAATCTTGTTTAAGACACTAACTGGATAA-CCTTAAGAGTGATAGTTTGGAGTCTCATCGCCT??????????????????????????????TGCCTGTAACCCAAATTTGGGAGTCCTTTGAACTCAGTGATTTATTTGTTCATTTTATTTTTATGATTGCTCAAGTAAAA-GTATCTTTTTTTGACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum evolvulifolium Greenm.-LB709' TGTGGATAAATTTGGTAACAAATATTATGAGAAGCTAGGCGATACGCAATATGGTTGGTACATCTGCTTCATGCTTTCATGTGTCTTAATCATTTTGCATTGCACATCTCACTCGTGGTT-ATCTTGTTTAATACGAGTGCCACAGAATGTATTTTCAAGGTTGTGGGTTCCCTCGAGTATCGCCTAAAAGTTGAGGGTTCTATCATTTGGTTGTCTAGTCTTATACTCTGA-TATTTCCCCCTTAAGGTGATCAGAGGAA-GGCTTTATGTAGCCACATAGAAGAAT-GGTTATATTCCCCTTGTTCTAGGTAAAAGAGCAAAAATCTCTTG---------------------------------CTCTATATTTACTGAG----TTATATTTCCCTTGTTCTAGGTAAAAGAGCTAAGGTTTCTTGCTCCTTATTCACTGAGTAGTTGTTGCTGTTGCTACTTTGTCAAGACTT-TACTTTATGGTGACAGAACTTAGTGTGGTTCAATTGATTTGTTTCAGTATGTGTACTCTACTAATCTCTCTTGGTAGATGATGTTTAACTTTACTGGAGGCT-ATTTGTTTCACTGTGTGAAATAATAGTTTTCGCCTAGGTAAACATGCTTTCTAGGTCATATTGGGGAGCTTGACTACATTTTCAAATTCTACAGATATGTTAATCTTGTTTAAGACACTAATTGGATAA-CCTTAAGAGTGATAGTTTGGAGTCTCATCGCCTTTAATCCCCAAGTATAGTGGAATGCAGTGATGCCTGTAACCCAAATTTGGGAGACCTTTGACCTCAGTGATTTATTTGTTCATTTTATTTGTATGATTGCTCAAGTAAAA-GTATCTTTTTTTGACCTGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum limoncochaense Tepe-LB2391' TGTGGATAAATTTGGTAACAAATATTATGAGAAGCTAGGCGATACGCAATATGGTTGGTACATCTGCTTCATGCTTTCATGTGTATTAATCAGTTTGCATTGCACATCTCACTTGTCGTT-ATCTTGTTTAATACGAGTGCCACAGAATGTATTTTCAAGGTTGTGGGTTCCCTCGAGTATCGCCTAAA-GTTGAGGGTTCTATCATTTGGTTGT--AGTCTTATGCTCTGA-TATTTTTCCCTTAAGGTGATCAGAGGAAAGGCTTTATGTAGCCACATATAAGAAT-GGTTATATTCCCCTTGTTCTAGGTAAAAGAGCAAAGATCTCTTG---------------------------------CTCTTTATTCTCTGAGTAGGTTATATTTCCCTTGTTCTAGGTAAAAGAGCAAAGGTTTCTTGCTCCTTATTCACTGAGTAGTTGTTGCAGTTGTTACTTTGTCAAGACTTGTACTTTATGGTGACAGGACTTAGTGTGGTTCAATTGATCTGCTTCAGTATGTGTACTCTACTAATCTCTCTTGGTAGATGATGTTTAACTTTACTGGAGGCT-ATTTGTTTCACTGTGTGAAATAATAGTTTTCGCCTAGGTAAACATGCTTTCTAGGTCGTATTGGGAAGCTTGACTACATTTTCAAATTCTAGAGATATGGTAATCTTGTTTAAGACACTAACTGGATAA-CCTTAAGAGTGATAGTTTGGAGTCTCATTGCCTTTAATCCCCAAGTATAGTGGAATGCAGTGATGCCTGTAACCCAAATTTGGGAGACCTTTGACCTCAGTGATTTATTTGTTCATTTTATTTTTATGATTGCTCAAGTAAAA-GTATCTTTTTTTGACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum limoncochaense Tepe-LB2466' TG{CG}GGATAAATTTGGTAACAAATATTATGAGAAGCTAGGCGATACGCAATATGGTTGGTACATCTGCTTCATGCTTTCATGTGTATTAATCAGTTTGCATTGCACATCTCACTTGTCGTT-ATCTTGTTTAATACGAGTGCCACAGAATGTATTTTCAAGGTTGTGGGTTCCCTCGAGTATCGCCTAAA-GTTGAGGGTTCTATCATTTGGTTGT--AGTCTTATGCTCTGA-TATTTTTCCCTTAAGGTGATCAGAGGAAAGGCTTTATGTAGCCACATATAAGAAT-GGTTATATTCCCCTTGTTCTAGGTAAAAGAGCAAAGATCTCTTG---------------------------------CTCTTTATTCTCTGAGTAGGTTATATTTCCCTTGTTCTAGGTAAAAGAGCAAAGGTTTCTTGCTCCTTATTCACTGAGTAGTTGTTGCAGTTGTTACTTTGTCAAGACTTGTACTTTATGGTGACAGGACTTAGTGTGGTTCAATTGATCTGCTTCAGTATGTGTACTCTACTAATCTCTCTTGGTAGATGATGTTTAACTTTACTGGAGGCT-ATTTGTTTCACTGTGTGAAATAATAGTTTTCGCCTAGGTAAACATGCTTTCTAGGTCGTATTGGGAAGCTTGACTACATTTTCAAATTCTAGAGATATGGTAATCTTGTTTAAGACACTAACTGGATAA-CCTTAAGAGTGATAGTTTGGAGTCTCATTGCCTTTAATCCCCAAGTATAGTGGAATGCAGTGATGCCTGTAACCCAAATTTGGGAGACCTTTGACCTCAGTGATTTATTTGTTCATTTTATTTTTATGATTGCTCAAGTAAAA-GTATCTTTTTTTGACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum loxophyllum Bitter-LB2396' ----------------AACAAATTATGAGAG---CTAGGCGATACGCAATATGGTTGGTACATCTGCTTCATGCTTTCATGTGTCTTAATCAGTTTGCATTGCACATCTCACTTGTCGTT-ATCTTGTTTAATACGAGTGCCACAGAATGTATTTTCAAGGTTGTGGGTTCCCTCGAGTATCGCCTAAAAGCTGAGGGTTCTATCATTTGGTTGT{CT}TAATCTTATGCTCTGA-TATTTTCCCCTTAAGGTGATCAGAGGAAAGGCTTTATGTAGCCACATA{GT}AAGAAT-GGTTATATTCCCCTTGTTCTAGGTAAAAGAGCAAAGAT{CT}TCTTG---------------------------------CTCTATATTTACTGAG----TTATATTTCCCTTGTTCTAGGTAAAAGAGCTAAGGTTTCTTGCTCCTTATTCACTGAGTAGTTGTTGCTGTTGCTACTTTGTCAAGACTT-TACTTTATGGTGACAGAACTTAGTGTGGTTCAATTGATTTG{CT}TTCAGTATGTGTACTCTACTAATCTCTCTTGGTAGATGATGTTTAACTTTACTGGAGGCT-ATTTGTTTCACTGTGTGAAATAATAGTTTTTGCCTAGGTAAACATGCTTTCTAGGTCGTATTGGGAAGCTTGACTACATTTTCAAATTCTACAGATATGTTAATCTTGTTTAAGACACTAACTGGATAA-CCTTAAGAGTGATAGTTTGGAGTCTCATCGCCTTTAATCCCCAAGTATAGTGGAATGCAGTGATG{CT}CTGTAACCCAAATTTGGGAG{AT}CCTTTGACCTCAGTGATTTATTTGTTCATTTTATTTTTATGATTGCTCAAGTAAAA-GTATCTTTTTTTGACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum loxophyllum Bitter-LB2521' -------------------------------------------------------TGGTACATCTGCTTCATGCTTTCATGTGTCTTAATCAGTTTGCATTGCACATCTCACTTGTCGTT-ATCTTGTTTAATACGAGTGCCACAGAATGTATTTTCAAGGTTGTGGGTTCCCTCGAGTATCGCCTAAAAGTTGAGGGTTCTATCATTTGGTTGTATAGTCTTATGCTCTGA-TATTTTCCCCTTAAGGTGATCAGAGGAAAGGCTTTATGTAGCCACATATAAGAAT-GGTTATATTCCCCTTGTTCTAGGTAAAAGAGCAAAGATGTCTTG---------------------------------CTCTATATTTACTGAG----TTATATTTCCCTTGTTCTAGGTAAAAGAGCTAAGGTTTCTTGCTCCTTATTCACTGAGTAGTTGTTGCTGTTGCTACTTTGTCAAGACTT-TACTTTATGGTGACAGAACTTAGTGTGGTTCAATTGATTTG{CT}TTCAGTATGTGTACTCTACTAATCTCTCTTGGTAGATGATGTTTAACTTTACTGGAGGCT-ATTTGTTTCACTGTGTGAAATAATAGTTTTTGCCTAGGTAAACATGCTTTCTAGGTCGTATTGGGAAGCTTGACTACATTTTCAAATTCTACAGATATGTTAATCTTGTTTAAGACACTAACTGGATAA-CCTTAAGAGTGATAGTTTGGAGTCTCATCGCCTTTAATCCCCAAGTATAGTGGAATGCAGTGATGCCTGTAACCCAAATTTGGGAGTCCTTTGACCTCAGTGATTTATTTGTTCATTTTATTTTTATGATTGCTCAAGTAAAA-GTATCTTTTTTTGACATGATTATGTAGGAAGACACCGGTGGGTGGAGTA-GCACAGAAGAATCG 'Solanum lycopersicon L.-RGO340' TGTGGATAAATTTGGTAACAAATATTATGAGAAGCTAGGCGATACACAATATGGTTGGTACAGCTGCTTCATGCTTTTGTGTGTCTTAATCAGTTTCCCTTGTACATATCACTTCTCGTT-ATCTTGTTTGATACTAGTGCCACAAAATGTATCTTCAAGGTTGTGGGTTCCTTCATGTATCGCCTAAAAGTTGAGGGTTCTATCATTTGGTTGTATTATCTTATGCTCTGAATATTTTCCCCT-AAGGTGATCAAAGGAAAGGCTTTATGTAGCCACATATAAGAAAAGGTTATATTTCCCTTGTTCTAGGTAAAAGAG-AAGGATTTCTTG---------------------------------TTCTTTATTCACGGAGTAGGTTATATTTTTCTTGTTCTATGTAAAAGAGTAAAGGTCTCTTGCTCTTTATTCAC----------------------------------------------------------AGTGTGGTTCAATTGATCTGCTTCAGTCTGTG-ACTCTACTAATCTCTCTTGGTAGAGGATATT-AACTTTACTGGTGGCTTATTTGTTTCATTGTGTGAAATAATAGTTTTGGCCTAGTTAAACATGCTTTCTAGGTCGTATTGTGAAGCTTGACTACATTTTCAACTTCTAGAGATATGTTAATATTCTTTAAGACATTAAATGGATAA-CCTTAAGGTTAATAGTTTGGAGTCTCATCGCCCTTAATCTCCAAGTATAGTGGAATGAAGTAATGCCTGTAACCCAAATTTGGGAGACCTTAGACCTCAGTGATTTATTTGCTTATTTTGTTTTGATGATTGCTCAAGTAAAA-GCCTCTTTTTTTGACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum pacificum Tepe-LB2395' TGTGGATAAATTTGGTAACAAATATTATGAGAAGCTAGGCGATACGCAATATGGTTGGTACATCTGCTTCATGCTTTCATGTGTCTTAATCAGTTTGCATTGCACATCTTACTTGTCGTT-ATCTTGTTTAATACGAGTGCCACAGAATGTATTTTCAAGGTTGTGGGTTCCCTCAAGTATCGCCTAAAAGTTGAGGGTGCTATCATTTGGTTGTATAGTCTTATGCTCTGA-TATTTTCCCCTTAAGGTGATCAGAGGAAAGGCTTTATGTAGCCACATATAAGAAT-GGTTATATTCCCCATGTTCTAGGTAAAAGAGAAAAGATCTCTTG---------------------------------CTCTATATTTACTGAGTAGGTTATATTTCCCTTGTTCTAGGTAAAAGAGCTAAGGTTTCTTGCTCCTTGTTCACTGAATAGTTGTTGCTGTTGCTACTTTGTCAAGACTTGTACTTTATGGTGACAGAACTTAGTGTGGTTCAATTGATTTGCTTAAGTATGTGTACTCTACTAATCTCTCTTGGTAGATGATGTTTAACTTTACTGGAGGCT-ATTTGTTTCACTGTGTGAAATAATAGTTTTTGCCTAGGTAAACATGCTTTCTAGGTCGCATTGGGAAGCTTGACTACATTTTCAAATTCTACAGATATGTTAATCTTGTTTAAGACACTAACTGGATAA-CCTTAAGAGTGATAGTTTGGAGTCTCATCGCCTTTAATCCCCAAGTATAGTGGAATGCAGTGATGCCTGTAACCCAAATTTGGGAGACCTTTGACCTCAGTGATTTATTTGTTCATTTTATTTTTATGATTGCTCAAGTAAAA-GTATCTTTTTTTGACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum phaseoloides Pol.-LB1727' TGTGGATAAATTTGGTAACAAATATTATGAGAAGCTAGGCGATACGCAATATGGTTAGTACATCTGCTTCATGCTTTCATGTGTCTTAATCAGTTTGCATTGCACATCTCACTTGTCGTT-ATCTTGTTTAATACGAGTGCCACAGAATGTATTTTCAAGGTTGTGGGTTCCCTCGAGTATCGCCTAAAAGTTGAGGGTTCTATCATTTGGTTGTATAGTCTTATGCTCTGA-TATTTTCCCCTTAAGGTGATCAGAGGAAAGGCTTTATGTAGCCACATATAA-ATT-GGTTATATTCTTCTTGTTCTAGGTAAAAGAGCAAAGATCTCTTG---------------------------------CTCTTTATTCACTGAGTAGGTTATATTTCCCTTGTTCTAGGTGAAAGAGCCAAGGTTTCTTGCTCCTTATTCACTGAGTAGTTGTTGCTGTTGCTACTTTGTCAAGACTTGTGCTTTATGGTGACAGAACTTAGTGTGGTTCAATTGATCTGCTTCAGTATGTGTACTCTACTAATCTCTCTTGGTAGATGATGTTTAACTTTACTAGAGGCT-ATTTGTTTCACTGTGTGAAATAATAGTTTTTGCCTAGGTAAACATGCTTTCTAGGTCGTATTGGGAAGCTTGACTACATTTTCAAATTCTACAGATATGTTAATCTTGTTTAAGACACTAACTGGATAA-CCTTAAGAGTGATAGTTTGGAGTCTCGTCGCCTTTAATCCCCAAGTATAGTGGAATGCAGTGATGCCTGTAACCCAAATTTGGGAGACCTTTGACCTCAGTAATTTATTTGTTCATTTTGTTTTTATGATTGCTCAAGTAAAA-GTATCTTTTTTTGACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum phaseoloides Pol.-LB693' TGTGGATAAATTTGGTAACAAATATTATGAGAAGCTAGGCGATACGCAATATGGTTAGTACATCTGCTTCATGCTTTCATGTGTCTTAATCAGTTTGCATTGCACATCTCACTTGTCGTT-ATCTTGTTTAATACGAGTGCCACAGAATGTATTTTCAAGGTTGTGGGTTCCCTCGAGTATCGCCTAAAAGTTGAGGGTTCTATCATTTGGTTGTATAGTCTTATGCTCTGA-TATTTTCCCCTTAAGGTGATCAGAGGAAAGGCTTTATGTAGCCACATATAA-ATT-GGTTATATTCTTCTTGTTCTAGGTAAAAGAGCAAAGATCTCTTG---------------------------------CTCTTTATTCACTGAGTAGGTTATATTTCCCTTGTTCTAGGTGAAAGAGCCAAGGTTTCTTGCTCCTTATTCACTGAGTAGTTGTTGCTGTTGCTACTTTGTCAAGACTTGTGCTTTATGGTGACAGAACTTAGTGTGGTTCAATTGATCTGCTTCAGTATGTGTACTCTACTAATCTCTCTTGGTAGATGATGTTTAACTTTACTAGAGGCT-ATTTGTTTCACTGTGTGAAATAATAGTTTTTGCCTAGGTAAACATGCTTTCTAGGTCGTATTGGGAAGCTTGACTACATTTTCAAATTCTACAGATATGTTAATCTTGTTTAAGACACTAACTGGATAA-CCTTAAGAGTGATAGTTTGGAGTCTCGTCGCCTTTAATCCCCAAGTATAGTGGAATGCAGTGATGCCTGTAACCCAAATTTGGGAGACCTTTGACCTCAGTAATTTATTTGTTCATTTTGTTTTTATGATTGCTCAAGTAAAA-GTATCTTTTTTTGACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG 'Solanum trifolium Dunal-LB2368' TGTGGATAAATTTGGTAACAAATATTATGAGAAGCTCGGCGATACGCAATATGGTTGGTACATCTGCTTCATGCTTCCATGTGTCTTAATCAGTTTGCATTGCACATCTCACTTGTCGTT-ATCTTGTTTAATACGAGTGCCACAGAATGTATTTTCAAGGTTGTGGGTTCCCTCGAGTATCGCCTAAAAGTTGAGGGTTCTATCATTTGGTTGTATAGTCTTATGCGGTGA--------------------TCAGAGGAAAGGCTTTATGTAGCCACATATAAGAAT-GGTTATATTCCCCTTGTTCTAGGTAAAAGAGCAAAGATCTCTTG---------------------------------CTCTTTATTCACTGAGTAGGTTATATTTCCCTTGTTCTAGGTAAAAGAGCTAAGGTTTCTTGCTCCTTATTCACCGAGTAGTTGTTGCTGTTGCTACTTTGTCAAGACTTGTACTTTATGGTGACAGAACTTAGTGTGGTTCAATTGATCTCCTTCAGTATGTGTACTCTACTAATCTCTCTTGGTAGATGATGTTTAACTTTACTGGAGGCT-ATTTGTTTCACGGTGTGAAATAATAGTTTTCACCTAGGTAAACATGCTTTCTAGGTCGTATTGGGAAGCTTGACGACATTTTCAAATTCTAGAGATAGGTTAATCTTGTTTAAGACACTAACTGGATAA-CCTTAAGAGTGGTAGTTTGGAGTCTCATCGCCTTTAATCCCCAAGTATAGTGGAATGCAGTGATGCCTGTAACCCAAATTTGGGAGACCTTTGACCTCAGTGATTTATTT--TCATTTTATTTTTGTGATTGCTCAAGTAAAA-GTATGTTTTTTTGACATGATTATGTAGGAAGACACCGGTGGGTGGAGTATGCACAGAAGAATCG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7415] TITLE 'Herpystichum-trnStrnG'; LINK TAXA = Taxa5; DIMENSIONS NCHAR=687; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Solanum anceps Ruiz & Pav.-LB2408' TCCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTT-ATCATCAATTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCGTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTACAACGAATTTG------AAAATAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------ATA-------AAAGTAAAATAAAA-TATATGAAATAGAAAATTAGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGGTTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum anceps Ruiz & Pav.-LB654' TCCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTT-ATCATCAATTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCGTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTACAACGAATTTG------AAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------CTA-------AAAGTCAAATAAAA-TATATGAAATAGAAAATTAGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGGTTTTATGTTTAACAACTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum brevifolium Dunal-LB1029' TCCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTAATACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAATTTCCTTTATCTCTTTATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTTCCAACAAATTTTAATTTGAAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTTCCATTTTTT--------ATAT------AAAGTCAAATAAAA-TATATGAAATAGAAAATTCGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTA---------------------------------------CCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum bulbocastanum Dunal-Spooner4' TCCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTAATACATGAGATAGCACATTAAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAATTTCCTTTATCTCTTTATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATCTCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTTCCAATGAATTTGAATTTGAAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------ATAT------AAAGTCAAATAAAA-TATATGAAATAGAAAATTCGATCAAAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTACCATCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAA----TTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum caripense Dunal-LB1026' -CCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTAATACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATTGATATGTACAACTTTTATCATCAATTTCCTTTATCTCTTTATCT-AAAGTAAAGAAAGGGCTCAGAAGAGCCAAGAATAGCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTTGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTTCCAACGAATTTGAATTTGAAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------ATAT------AAAGTCAAATAAAA-TATATGAAATAGAAAATTAGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTACCATCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum crassinervium Tepe-LB2397' TCCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAATTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTCCAACGAATTTG------AAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------AGA-------AAAGTAAAATAAAA-TATATGAAATCGAAAATTCGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum dalibardiforme Bitter-LB2454' TCCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAATTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTCCAACGAATTTG------AAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------ATA-------AAAGTAAAATAAAA-TATATGAAATAGAAAATTCGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTTTGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum dolichorhachis Bitter-LB2512' TCCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAATTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAAGAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTCCAACGAATTTG------AAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------AGA-------AAAGTAAAAAAAAA-TATATGAAATAGAAAATTCGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTTGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum evolvulifolium Greenm.-LB183' -CCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAATTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTCCAACGAATTTG------AAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------AGA-------AAAGTAAAATAAAA-TATATGAAATCGAAAATTCGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum evolvulifolium Greenm.-LB2253' -CCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAATTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTCCAACGAATTTG------AAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------AGA-------AAAGTAAAATAAAA-TATATGAAATCGAAAATTCGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTTGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum evolvulifolium Greenm.-LB2415' TCCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAATTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTCCAACGAATTTG------AAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------AGA-------AAAGTAAAATAAAA-TATATGAAATCGAAAATTCGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum evolvulifolium Greenm.-LB2520' TCCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAATTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTCCAACGAATTTG------AAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------AGA-------AAAGTAAAATAAAA-TATATGAAATCGAAAATTCGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum evolvulifolium Greenm.-LB709' TCCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAATTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTCCAACGAATTTG------AAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------AGA-------AAAGTAAAATAAAA-TATATGAAATCGAAAATTCGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum limoncochaense Tepe-LB2391' TCCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAACTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTCCAACGAATT---------AAAAAAAAATGTCTGTTATAGTTTTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATT-----------------------------------------------------------------------------------------------------------------GCTGGACTAAAAAAAAGAAACTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum limoncochaense Tepe-LB2466' TCCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAACTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTCCAACGAATT---------AAAAAAAAATGTCTGTTATAGTTTTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATT-----------------------------------------------------------------------------------------------------------------GCTGGACTAAAAAAAAGAAACTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum loxophyllum Bitter-LB2396' -----------------------------------TTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAATTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTCCAACGAATTTG------AAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------AGA-------AAAGTAAAATAAAA-TATATGAAATCGAAAATTCGATCAAAATAAAAGCCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATA------------------------------------------ 'Solanum loxophyllum Bitter-LB2521' --CACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAATTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTCCAACGAATTTG------AAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------AGA-------AAAGTAAAATAAAA-TATATGAAATCGAAAATTCGATCAAAATAAAAGCCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum lycopersicum L.-RGO340' -CCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTAATACATGAGATAGCACATTAAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAATTTCCTTTATCTCTTTATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATCTCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTTCCAATTAATTTG------AAAACAAAAATGTTTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTTATATTTTTATAT------AAAGTAAAATAAAA-TATATGAAATAGAAAATTCGATCAAAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTACCATCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGTATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum pacificum Tepe-LB2395' TCCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATTAATTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTCCAACGAATTTG------AAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------AGA-------AAAGTAAAATAAAA-TATATGAAATAGAAAATTCGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum pentaphyllum Bitter-LB2515' TCCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAACTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTCCAACGAATTTG------AAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTACCATTTTTT--------ATATTTTATAAAAGTAAAATAAAA-TATATGAAATAGAAAATTCGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAACTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGT- 'Solanum phaseoloides Pol.-LB1727' -CCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAATTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCGTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTCCAACGAATTTT------AAAACAAAAATGTCTGTTATAATTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------ATA-------AAAGTAAAATAAAA-TATATGAAATAGAAAATTCGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG 'Solanum phaseoloides Pol.-LB693' TCCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAACTTCCTTTA-CTTTAGATCA-AGAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGCAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCCTTTGTTCCAACGAATTTG------AAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTTATATTTT-ATA-------AAAGTAAAATAAAA-TATATGAAATAGAAAATTCGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAACTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGAT------------------------------ 'Solanum trifolium Dunal-LB2209' -CCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAACTTCCTTTA-CTTTAGATCAAGAGATAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCCTTTGTTCCAACGAATTTG------AAAACAAAAATGTCTGTTATAGTTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------ATATTTTATAAAAGTAAAATAAAA-TATATGAAATAGAAAATTCGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAACTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGT- 'Solanum trifolium Dunal-LB2368' TCCACTCAGCCATCTCTCCCAATTGAAAAAGATAATTACTACATGAGATAGCACAT-AAGATAAAGGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTATATAGATATGTACAACTTTTATCATCAATTTCCTTTATCTCTTGATCT-AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAGAAGACCTCGTTTCTTTGTCTTGATTTTGTTCGAAAGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTTCCAACGAATTTT------AAAACAAAAATGTCTGTTATAATTGTAATATTTCATTTTAATTGAATAGTTAATATTCAAGCAACAAGAAAAAATTCCCATTTTTT--------ATA-------AAAGTAAAATAAAA-TATATGAAATAGAAAATTCGATCAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTAACACCTTGCTGGACTAAAAAAAAGAAGCTTTCGAGTATTCCACAATGCATTTTTATGTTATGATTTTAGTCGTTTTGACGACCCTATCTTATCCTATCTTAATTACCACAATTCCCCTGTTCGACAAAAGTTGCATTTGTATACAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAAAGTG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7411] TITLE 'Herpystichum-GBSSI'; LINK TAXA = Taxa6; DIMENSIONS NCHAR=2233; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Solanum anceps Ruiz & Pav.-LB2408' -CCCCTCGTTATGACCAATACAAAGATGCGTGGGATACTAGTGTTGCGGTTGAGGTACTCCTATCTTATTA--------TAAAATATA---TCTCTTCCATTCCCTCATTCAAGCATATTCTGATCC-CTACTTTATTTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCACATTCTCAACCCTTAGGGATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTACAATGTGAATA----------------TTGAATTTCTTTTGACTCTACCGCTGCTTTTACCCTTTTAAGGTCTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAATCTGGACAAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTGTACTGTTGTCTTGA--CTTTATGTGGCATTTTACT-TTTGTCTTTAATCGTTTTTT-AACCTTGTTTTCTTTGTCACTCTCAGGCAGCGCTCGAGGTACCTAGAGTTCTGAGTTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-C{AT}CATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTATATGTAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAATCTTTTTGTATTCACTTGATTGCACTTTTACCCTGCAAATCAACAAGGTTGTATTAATATAT--GATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCGTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACTTTAGAAGCTCTTTTGATGCTAGTAAATTGAGTTTTTTAAATGTTGCAGATATGAAAAGCCTATTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCTGGTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTTCTG-ACTTCAGTATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTCATGGACGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATTGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATTGTAGTCCTTGTATGTACCAAATGGACTCATGGTATCTT-------TCTTGTTGTGTTTACTTGTGCCAAGACTGGA-TTGACCTGCTACTCGTCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATC---------------------------------- 'Solanum anceps Ruiz & Pav.-LB654' --CCCTCGTTATGACCAATACAAAGATGCGTGGGATACTAGTGTTGCGGTTGAGGTACTCCTATCTTATTA--------TAAAATATA---TCTCTTCCATTCCCTCATTCAAGCATATTCTGATCC-CTACTTTATTTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCACATTCTCAACCCTTAGGGATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTACAATGTGAATA----------------TTGAATTTCTTTTGACTCTACCGCTGCTTTTACCCTTTTAAGGTCTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAATCTGGACAAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTGTACTGTTGTCTTGA--CTTTATGTGGCATTTTACT-TTTGTCTTTAATCGTTTTTT-AACCTTGTTTTCTTTTTCACTCTCAGGCAGCGCTCGAGGTACCTAGAGTTCTGAGTTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-CACATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTATATGTAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAATCTTTTTGTATTCACTTGATTGCACTTTTACCCTGCAAATCAACAAGGTTGTATTAATATAT--GATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACTTTAGAAGCTCTTTTGATGCTAGTAAATTGAGTTTTTTAAATTTTGCAGATATGAAAAGCCTATTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCTGGTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTTCTG-ACTTCAGTATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTCATGGACGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATTGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATTGTAGTCCTTGTATGTACCAAATGGACTCATGGTATCTT-------TCTTGTTGTGTTTACTTGTGCCAAGACTGGA-TTGACCTGCTACTCGTCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCA 'Solanum brevifolium Dunal-LB1029' -------------------------------GGGATACTACCGTTGCGGTTGAGGTACTCCTATCTTAACTGCATATGATACAATATA---TCTCTTCCATTTCCTGATTCAAGAATGT---GATCC-CTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTATGAATCCTTAGAGAGGTCCTGAGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATACTACAACGTGAATATGCACAACACGTCATTTTGAATTTCTTTTAACTCTACTGGTGCTTTTACCCTTT-AAGGTTTGGGGCAAAACTAGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGCTACTT----GTTGTACTGTTGTCTTGA--TTTTATGTGGCATTTTGCT-TTTGTGTTTAATCATTTTTT-AACCTTGTTTTCTT-GTCACTCTCAGGCAGCCTTAGAGGCACCTAGAGTTCTGAATTTGAACTGTAGCAACTACTTCTCTGGACCATATGGTAAACACATCCTAGTTTCAGAAAAACTCCTTAGCAATCATAGTTTATCATTTTAGGTAATTATCTTTATTTTGCCTATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGACTGGCACACAGCTCTCATTCCCTGCTACCTCAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAATCTCTTTGTATTCACTTGATTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATATAT--GACAAATTTCGCATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTTCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACTTTTGAAGCTCTTTCGATGCTAGTAAATCTAGTTTTTAAAATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCCGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATATGTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCTACTGACAAATACACCGATGTCAAATACGATATAACCACTGTAAGATAAGACTTTTCTGAACTTCAGTATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTCATGGACGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAAGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATTGTAGTCCTTGTAAGTACCAAATGGACTCATGGTATCTTTGATCTTTCTTGTTGTATTTACTTGTGCCAAAACTGAAATTGACCTGCTACTCGTCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTG---------- 'Solanum bulbocastanum Dunal-Spooner4' -------GTTATGACCAATACAAAGATGCTTGGGATACTAGCGTTGCGGTTGAGGTACATCT-TCCTATATTGATACA--ACAACAT-TGTTCTCTTCCATTTCCTGATTCAAGAATGT---GATCCGCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTACAAACGTGGGGTTGATCG{GT}GTTTTTGTTGACCACCCAATGTTCTTGGAGAGAGTAAGCATATTATGAT--TATGAATCCGTCCTGAGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTACAATGTGAATACGCA-------------------TCCTTTAACTCTACTGGTGCTTTTACTCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACTAGATTATCTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTAGTTACTTGTTATACTGTTGTCTTGA--TTT---GTGGCATTTTACTTTTTGTCTTTAATCGTTTTTTTAACCTTGTTTTCT----------CAGGCAGCCCTAGAGGCACCTAGAGTTTTGAATTTGAACAGTAGCAACTACTTCTCAGGACCATATGGTAA-CACATCCTAGTTTCAGAAAA-CTCC---------TTAGTATATCATTGTAGGTAATCATCTTTAGTTTGCCTATTCCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCTAGAGGAATCTATTTGAATGCCAAGGTAAAATCTCTTTGTATTCACTTGATAGCACTTT-ACCCTGCAAATCAATCAGGTTGTATTAATATAT--GATAAATTTCACATTGTCTCTAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTTCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGA{CT}GGGTATGTATTTAATGCTTCAAATCAGACCACCAACTTTTGAAGCTCTTTTGATACTAGAAAATTGAGTTTTTAAAATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCTGCTGTTGACAAGGGTGTTGAATTGGACAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCGACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTTCTG-ACTTCAGTATATACTAAATTATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTCATGGACGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAAGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATTGTAGTCCTTGTAAGTACCAAATGGACTCATGGTATCTT-------TCTTGTTGAGTTTACTTGTGCCGAAACTGAAATTGACCTGCTACTCATCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTC------ 'Solanum caripense Dunal-LB1026' ------------------------------TGGGATACTAGCGTTGCGGTTGAGGTACTCCTATCTTAACTACTTATGATACAGTATA---TCTCTTCCATTTCCTGATTCAAGAATGT---GATCT-CTACTTTATCTGCAGGTCAAAATTGGAGATAGCATTGAAATTGTTCGTTTCTTTCACTGTTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATCTTCTTGGAGAAAGTAAGCATATTATGAATCCTTAGAGAGATCCTGAGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATACTACAATGTGCATACGCAGAAAACATCATTTTAAATTTCTTTTAACTCTACTGCTGCTTT-ACCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----ATTGT--------CTTGA--TTTTATGTGGCATTTTACT-TTTGTCTTTAATCGTTTTTTTAACCTTGTTTTCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGTAGCAAATACTTCTCAGGACCATATGGTAA-CACATCCCAGTTTCAGAAAA-CTCCTTAGCAATTATAGTATATCATTGTAGGTAATCATCTTTATTTTGCTTATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAAAGGAATCTATTTGAATGCCAAGGTAAAATCTCTTTGTATTCACTTGATTGCACTTT-AGCCTGCAAATCAACAAGGTTGTATTAATATAT--GATAAATTTCACATTGCCTCCAGGTTGCTTTCTGCATCCACAACATTGCCTACCAAGGACGATTTTCTTTCTCCGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAA-TCAGACCACCAACTTTTGAAGCTCTTTTGATGCTAGTAAATTGAGTTTTCTAAATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATGTTGGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCCGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTGGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACGGTAAGATAAGATTTTTCTG-ACTTCAGTATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGATAATCAAAATCTCTATACAGGTCATGGATGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAAGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATTGTAGTCCTTGTAAGTACCAAAT-AACTCATGGTATCTT-------TCTTGTTGTGTTTACTTGTGCCAAAACTGAAATTGACCTGCTAATCGTCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTAGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCA 'Solanum crassinervium Tepe-LB2397' -CCCCTCGTTATGACCAATACAAAGATGCTTGGGATACTAGTGTTGCGGTTGAGGTACTCCTATCTTATCA--------TACAATATA---TCTCTTCTATTCCCTCATTCAAGCATATTCTGATCC-CTACTTTTTCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTCCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTCAACCCTTAGGGATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTACAATGTGAATA----------------TTGAATTTCTTTTGACTCTACTGCTGCTTTTACCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTGTACTGTTGTCTTGA--CTTTATGTGGCAGTTTACT-TTTGTCTTTAATCCTTTTTT-AACCTTGTTTTCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-TACATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTGTAGGTAATCATCTTTATTTTGCCAATTACTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATACCCTGCTACTTGAAGTCAATGTACCAGTCAAGGGGAATCTATTTGAATGCGAAGGTAAAATCTTTTTGTATTCACTTGATTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATATAT--GATAAATTCCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCC{GT}CTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAAATCAGACCTCCAACTTTAGAAGCTCTTTTGATGCTAGTAAATTGAGTTTTTTAAATTTTGCAGATATGAAAAGCCTATTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCTGGTATTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGC???GATACCCAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTTCTG-ACTTCAGTATGTACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTAATGGATGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATTGTAGTCCTTGTATGTACCAAATGGACTCATGGTATCTT-------TCTTGTTGTGTTTACTTGTGCCAAGATTGAA-TTGACCTGCTACTCATCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAATTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTTAATGTCCCTTTGGCTCACATGATCACTGCCGGTGCTGATTTTATGTTGGTTCCCAGTA 'Solanum dalibardiforme Bitter-LB2454' -------------------------------------------TTGCGGTTGAGGTACTCCTATCTTATCA--------TACAATATA---TCTCTTCCATTCCCTCATTCAAGCATATTCTGATCC-CTACTTTATCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTCAACCCTTAGGGATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTACAATGTGAATA----------------TTGAATTTCTTTTGACTCTACTGCTGCTTTTACCCTTTTCAGGTTTGGGGCAAAACTGCTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTGTACTGTTGTCTTAA--CTTTATGTGGCATTTTACT-TTTGTCTTTAATCCTTTTTT-AATCTTGTTTTCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-CACATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTGTAGGTAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAATCTTTTTGTATTCACTTGATTGCACTTT-ACCCTGCAAATCAACAAGGCTGTATTAATATAT--GATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACTTTAGAAGCTCTTTTGATGCTAGTAAATTGAGTTTTTTAAATTTTGCAGATATGAAAAGCCTATTAAGGGCAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTGTCTGGTGTTGACAAGGGTGTTGAATTGGATAATGCCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGC???GATACCCAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAAAATTTTCTG-ACTTCAGTATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTAATGGACGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATTGTAGTCCTTGTACGTACCAAATGGACTCATGGTATCTT-------TCTTGTTCTGTTTACTTGTGCCAAGACTGAA-TTGACCTGCTACTCATCCTATGCATCAGGGAACCGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTTAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGTA 'Solanum dolichorhachis Bitter-LB2512' ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTGTCTTTAATCCTTTTTT-AACCTTGTTTTCTTTATCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-CACATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTGTAGGTAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTTCCAGTCAAGGGGAATCTATTTGAATGCCAAGGTAAAATCTTTTTGTATTCACTTGATTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATATAT--GATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAAATCAGACCATCAACTTTAGAAGCTCTTTTGATGCTAATAAATTGAGGTTTTTAAATTTTGCAGATATGAAAAGCCTATTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Solanum evolvulifolium Greenm.-LB183' -CCCCTCGTTATGACCAATACAAAGATGCTTGGGATACTAGTGTTGCGGTTGAGGTACTCCTATCTTATCA--------TACAATATA---TCTCTTCCATTCCCTCATTCAAGCATATTCTGATCC-CTACTTTTTCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTCAACCCTTAGGGATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTACAATGTGAATA----------------TTGAATTTCTTTTGACTCTACTGTTGCTTTTACCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACGAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTGTACTGTGGTCTTGA--CTTTATGTGGCATTTTACT-TTTGTCTTTAATCCTTTTTT-AACCTTGTTTTCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-CACATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTGTAGGTAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGGGGAATCTATTTGAATGCCAAGGTAAAATCTTTTTGTATTCACTTGATTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATATAT--GATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACTTTAGAAGCTCTTTTGATGCTAGTAAATTGAGTTTTTAAAATTTTGCAGATATGAAAAGCCTATTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCTGGTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTTCTG-ACTTCAGTATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTAATGGACGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATTGTAGTCCTTGTATGTACCAAATGGACTCATGGTATCTT-------TCTTGTTGTGTTTACTTGTGCCAAGATTGAA-TTGACCTGCTACTCATCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAATTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTTAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGTA 'Solanum evolvulifolium Greenm.-LB2253' -CCCCTCGTTATGACCAATACAAAGATGCTTGGGATACTAGTGT{GT}GCGGTTGAGGTACTCCTATCTTATCA--------TACAATATA---TCTCTTCCATTCCCCCATTCAAGCATATTCTGATCC-CTACTTTTTCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTCAACCCTTAGGGATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTACAATGTGAATA----------------TTGAATTTCTTTTGACTCTACTGCTGCTTTTACCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTGTACTGTTGTCTTGA--CTTTATGTGGCATTTTACT-TTTGTCTTTAATCCTTTTTT-AACCTTGTTTTCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-CACATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTGTAGGTAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAAGGGAATCTATTTGAATGCCAAGGTAAAATCTTTTTGTATTCACTTGATTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATATAT--GATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACTTTAGAAGCTCTTTTGATGCTAGTAAATTGAGTTTTTTAAATTTTGCAGATATGAAAAGCCTATTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCTGGTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGC????ATACCCAAGAGTGGAA{CT}CCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTTCTG-ACTTCAGTATGTACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTAATGGACGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATTGTAGTCCTTGTATGTACCAAATGGACTCATGGTATCTT-------TCTTGTTGTGTTTACTTGTGCCAAGATTGAA-TTGACCTGCTACTCATCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAATTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTTAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTACTAGTA 'Solanum evolvulifolium Greenm.-LB2415' -CCCCTCGTTATGACCAATACAAAGATGCTTGGGATACTAGTGTTGCGGTTGAGGTACTCCTATCTTATCA--------TACAATATA---TCTCTTCCATTCCCTCATTCAAGCATATTCTGATCC-CTACTTTATCTGCAGGTCAAAGTTGGAGACACCGTTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGAATATTCTCAACCCTTAGGGATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTACAATGTGAATA----------------TTGAATTTCTTTTGACTCTACTGCTGCTTTTACCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTGTACTGTTGTCTTGA--CTTTATGTGGCGTTTTACT---TGTCTTTAATCCTTTTTT-AACCTTGTTTTCTTTATCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-CACATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTGTAGGTAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCT{CT}TTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTTCCAGTCAAGGGGAATCTATTTGAATGCCAAGGTAAAATCTTTTTGTATTCACTTGATTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATATAT--GATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCA{GT}TGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACTTTAGAAGCTCTTTTAATGCTAGTAAATTGAGTTTTTTAAATTTTGCAGATATGAAAAGCCTATTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCTGGTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATG??????????????????????AGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTTCTG-GCTTCAGTATGTACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTAATGGA{CT}GCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATTGTAGTCCTTGTATGTACCAAATGGACTCATGGTATCTT-------TCTTGTTGTGTTTACTTGTGCCAAGATTGAA-TTGACCTGCTACTCATCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAATTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTTAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGG{CT}TCCAAGTA 'Solanum evolvulifolium Greenm.-LB2520' -CCCCTCGTTATGACCAATACAAAGATGCTTGGGATACTAGTGTTGCGGTTGAGGTACTCCTATCTTATCA--------TACAATATA---TCTCTTCCATTCCCTCATTCAAGCATATTCTGATCC-CTACTTTATCTGCAGGTCAAAGTTGGAGACACCGTTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGAATATTCTCAACCCTTAGGGATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTACAATGTGAATA----------------TTGAATTTCTATTGACTCTACTGCTGCTTTTACCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTGTACTGTTGTCTTGA--CTTTATGTGGCGTTTTACT---TGTCTTTAATCCTTTTTT-AACCTTGTTTTCTTTATCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-CACATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTGTAG{AG}TAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTTCCAGTCAAGGGGAATCTATTTGAATGCCAAGGTAAAATCTTTTTGTATTCACTTGATTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATATAT--GATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACTTTAGAAGCTCTTTTAATGCTAGTAAATTGAGTTTTTTAAATTTTGCAGATATGAAAAGCCTATTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCTGGTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGTATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTTCTG-GCTTCAGTATGTACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTAATGGACGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATTGTAGTCCTTGTATGTACCAAATGGACTCATGGTATCTT-------TCTTGTTGTGTTTACTTGT{AG}CCAAGATTGAA-TTGACCTGCTACTCATCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAATTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAA------------------------------------------------------------- 'Solanum evolvulifolium Greenm.-LB709' -CCCCTCGTTATGACCAATACAAAGATGCTTGGGATACTAGTGTTGCGGTTGAGGTACTCCTATCTTATCA--------TACAATATA---TCTCTTCCATTCCCTCATTCAAGCATATTCTGATCC-CTACTTTTTCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTCAACCCTTAGGGATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTACAATGTGAATA----------------TTGAATTTCTTTTGACTCTACTGTTGCTTTTACCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACGAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTGTACTGTGGTCTTGA--CTTTATGTGGCATTTTACT-TTTGTCTTTAATCCTTTTTT-AACCTTGTTTTCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-CACATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTGTAGGTAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGGGGAATCTATTTGAATGCCAAGGTAAAATCTTTTTGTATTCACTTGATTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATATAT--GATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACTTTAGAAGCTCTTTTGATGCTAGTAAATTGAGTTTTTAAAATTTTGCAGATATGAAAAGCCTATTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCTGGTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTTCTG-ACTTCAGTATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTAATGGACGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATTGTAGTCCTTGTATGTACCAAATGGACTCATGGTATCTT-------TCTTGTTGTGTTTACTTGTGCCAAGATTGAA-TTGACCTGCTACTCATCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAATTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTTAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGTA 'Solanum limoncochaense Tepe-LB2391' ---------------------------GCTTGGGATACTAGTATTGCGGTTGAGGTACTCCTACCTTATCA--------TTCAATATA---TCTCTTCCATTCCCTCATTCAAGCATATTCTGATCC-CTACTTCATCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAGGCATATTCTCAACCCTTAGGGATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTACAATGTGAATA----------------TTGAATTTCTTTTGACTCTACTGCTGCTTTTACCCTTTAAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGCCAAGTAAGTCACTT----GTTGTACTGTTGTCTTGA--CTCTATGTGGCATTTTACT-TTTGTCTTTAATCCTTTTTT-AACCTTGTTTTCTTTGTCACTCTCAGGCAGCCCTCGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-AACATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTGTAGGTAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAATCTTTTTGTATTCACTTGCTTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATATAT--GATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGCTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACTTTAGAAGCTCTTTTGATGCTAGTAAATTGAGTTTTTTAAATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCTGGTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGC???GATACCCAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTTCTG-ACTTCAGTATGTACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTTTACAGGTCATGGACGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCAGATTGGATGTTCAAATTGTAGTCCTTGTATGTACCAAATGGACTCATGGTATCTT-------TCTTATTGTGTTTACTTGTGCCAAGACTGAA-TTGACCTGCTACTCGTCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCA 'Solanum limoncochaense Tepe-LB2466' --------------------------------GGATACTAGTATTGCGGTTGAGGTACTCCTACCTTATCA--------TTCAATATA---TCTCTTCCATTCCCTCATTCAAGCATATTCTGATCC-CTACTTCATCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAGGCATATTCTCAACCCTTAGGGATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTACAATGTGAATA----------------TTGAATTTCTTTTGACTCTACTGCTGCTTTTACCCTTTAAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGCCAAGTAAGTCACTT----GTTGTACTGTTGTCTTGA--CTCTATGTGGCATTTTACT-TTTGTCTTTAATCCTTTTTT-AACCTTGTTTTCTTTGTCACTCTCAGGCAGCCCTCGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-AACATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTGTAGGTAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAATCTTTTTGTATTCACTTGCTTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATATAT--GATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGCTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACTTTAGAAGCTCTTTTGATGCTAGTAAATTGAGTTTTTTAAATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCTGGTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGC???GATACCCAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTTCTG-GCTTCAGTATGTACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTAATGGA{GT}GCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATTGTAGTCCTTGTATGTACCAAATGGACTCATGGTATCTT-------TCTTGTTGTGTTTACTTGTGCCAAGATTGAA-TTGACCTGCTACTCATCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAATTGTTGTACCCTAACAAAGCTAAAGGAGTGGC{AC}AAATT{CT}AATGTCCCTTTGGCTCACATGATCACTGCTGG{CT}GCTGATTTTATGTTGGTTCCAAGTA 'Solanum loxophyllum Bitter-LB2396' -CCCCTCGTTATGACCAATACAAAGATGCTTGGGATACTAGTGTTGCGGTTGAGGTACTCCTATCTTATCA--------TACAATATA---TCTCTTCCATTCCCTCATTCAAGCATATTCTGATCC-CTACTTTTTCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCC{AT}ATGTTCTTGGAGAAAGTAAGCATATTCTCAACCCTTAGGGATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTACAATGTGAATA----------------TTGAATTTCTTTTG{AC}CTCTACTGCTGCTTTGACCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTGTACTGTTGTCTTGA--CTTTATGTGGCATTTTACT-TTTGTCTTTAATCCTTTTTT-AACCTTGTTTTCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-TACATCCCAGTTTCAGAAAA-CTCCTTAGAAGTCATAGTATATCCTTGTAGGTAATCATCCTTATTTTGCCAATTGCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATACCCTGCTACTTGAAGTCAATGTACCAGTCAAGGGGAATCTATTTGAATGCGAAGGTAAAATCTTTTTGTATTCACTTGATTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATAGAT--GATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAATTTAATGCT------------ACCAACTTTAGAAGCTCTTTTGATGCTAGTAAATTGAGTTTTTTAAATTTTGCAGATATGAAAAGCCTATTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGTCCATACTATGCCCAAGAACTTGTCTCTGGTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCATAA{GT}ACTTGC{AC}TAACTGG{GT}ATTGTGAATGGC???GATACCCAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTTCTG-ACTTCAGTATGTACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTAATGGACGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATTGTAGTCCTTGTATGTACCAAATGGACTCATGGTATCTT-------TCTTGTTGTGTTTACTTGTGCCAAGATTGAA-TTGACCTGCTACTCATCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAATTGTTGTACCCTAACAAAGCTAACGGAGTGGCAAAATTTAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCCAGTA 'Solanum loxophyllum Bitter-LB2521' -------------------------------------CTAGTGTTGCGGTTGAGGTACTCCTATCTTATCA--------TACAATATA---TCTCTTCCATTCCCTCATTCAAGCATATTCTGATCC-CTACTTTTTCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTCAACCCTTAGGGATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTACAATGTGAATA----------------TTGAATTTCTTTTGACTCTACTGCTGCTTTTACCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTGTACTGTTGTCTTGA--CTTTATGTGGCATTTTACT-TTTGTCTTTAATCCTTTTTT-AACCTTGCTTTCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-TACATCCCAGTTTCAGAAAA-CTCCTTAGAAGTCATAGTATATCCTTGTAGGTAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATACCCTGCTACTTGAAGTCAATGTACCAGTCAAGGGGAATCTATTTGAATGCGAAGGTAAAATCTTTTTGTATTCACTTGATTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATATAT--GATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACTTTAGAAGCTCTTTTGATGCTAGTAAATTGAGTTTTTTAAATTTTGCAGATATGAAAAGCCTATTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGTCCATACTATGCCCAAGAACTTGTCTCTGGTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTTCTG-ACTTCAGTATGTACTAAAATATTTTGTATGTT-ATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTAATGGACGCAAAACCTTTATTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATTGTAGTCCTTGTATGTACCAAATGGACTCATGGTATCTT-------TCTTGTTGTGTTTACTTGTGCCAAGATTGAA-TTGACCTGCTACTCATCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAATTGTTGTACCCTAACAAAGCTAAAGGA---------------------------------------------------------------------- 'Solanum lycopersicum L.-RGO340' --CCCCCGTTATGACCAATACAAAGATGCTTGGGATACTAGCGTTGCCCTTGAGGTACTCCT-TCCTATATATACTTTTCA---TAC-----ATACAACAATATAT-ATTCAACAATGT--------------TTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGCTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCAAGC-AT-AT--TATGATTATG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATA--CATTTTGAACA-----------------------TCTTTTAACTCTACTGGTGCTTTTA--------AGGTTTGGGGCAAAACTGGTTCAAAAATCTACGGCCCCAAAGCTGGACTGGATTATCTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTATACTGTTGTCTTGGAATTTTATGTGGCATTTTACTTTTTGTCTTTAATCGTTTTCTCAACCTTATTTTCT----------CAGGCAGCCCTAGAGGCACCTAGAGTTTTGAATTTGAACAGTAGCAACTACTTCTCAGGACCATATGGTAA-CACATCCTAGTTTCACTAGC-AACC---------ATAGTATATCATTGTAGGTAATCAAC--------GCCTATTCCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTAATTCCCTGCTACTTAAAGTCAATGTACCAGTCCAGAGGAATCTATTTGAATGCCAAGGTAAAATTTATTTGTATACACTTGATTGCACTTT-ACCCTTCATATCAGTAAGGTTGTATTAATATAT--GATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCAGATTTTCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGTATTTAATGCTTGAAATCAGACCACCAACTTTTGA-----------TGCTAGTAAATTCAGTTCTTAAAATTTTGCAGATATGAGAAACCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTAAGCCCATACTATGCCCAAGAACTTGTCTCTGCTGTTGACAAGGGTGTTGAATTGGACAGTGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCGACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTTCCCCACTCCAGTATATACTAAATTATTTTGTATGTTTATGAAATTAAAGAGTTTCTTGCTGATCAAAATCTCCATACAGGTCATGGACGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAAGAAGATCCCCTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTTATCGAATTGGATGTTCAAATTGTAGTCCTTGTAAGTACCAAATGGAATCATTCTATCTT-------TCTTGTTGAGTTTACTTGTGCTGAAACTGAAATTGACCTGCTGCTCATCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAATAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTCCCAAGCA 'Solanum pacificum Tepe-LB2395' -CCCCTCGTTATGACCAATACAAAGATGCTTGGGATACTAGTGTTGCGGTTGAGGTACTCCTATCTTATCA--------TACAATATA---TCTCTTCCATTCCCTCATTCAAGCATATTCTGATCC-CTACTTTATCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTCAACCCTTAGGGATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTACAACGTGAATA----------------TTGAATTTCTTTTGACTCTACTGCTGCTTTTACCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTGTACTGTTGTCTTGA--CTTTATGTGGCATTTTACT-TTTGTCTTTAATCCTTTTTT-AACCTTGTTTTCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-CACATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTGTAAGTAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAATCTTTTTGTATTCACTTGATTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATATAT--GATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACCTTAGAAGCTCTTTTGATGCTAATAAATTGAGGTTTTTAAATTTTGCAGATATGAAAAGCCTATTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATGCTATGCCCAAGAACTTGTCTCTGGTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGC???GATACCCAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTTCTA-ACTTCAGTATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTAATGGACGCAAAACGTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATTGTAGTCCTTGTATGTACCAAATGGACTCATGGTATCTT-------TCTTGTTGTGTTTACTTGTGCCAAGATTGAA-TTGACCTGCTACTCATCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAATTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTTAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGTA 'Solanum pentaphyllum Bitter-LB2515' ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TATGGCCCCAAAGCTGGACAAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTGTACTGTTGTCTTGA--CTTTATGTGGCATTTTACT-TTTGTCTTTAATCCTTTTTT-AACCTTGTTTTCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-CACATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTGTAGGTAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAGTCTTTTTGTATTCACTTGATTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATCGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACTTTAGAAGCT-TTTTGATGCTAATAAATTGAGTTTTTAAAATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCTGGTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGAT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Solanum phaseoloides Pol.-LB1727' -CCCCTCGTTATGATCAATACAAAGATGCTTGGGATACTAGTGTTGCGGTTGAGGTACTCCTATCTTATCA--------TACAATATA---TCTCTTCCATTCCCTCATTCAAGCATATTCTGATCC-CTACTTTATCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTACAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTCAACTCTTAGGG------------TCGTTTGGTGCGAAGGATAAACACAACTAGTCCTCGGATAATATTTTAGTGGCACTTAATTTATTGTTTGGTTGGGAAGCTTGGTATAACTTATCCCGGGATTAATAATTAGTACCGGGATAAGTTATTCCTCCCAAGGGGTGGTATAGTAATCCCGGGATAA---------------AATATGTAAATGACAAAGATATCGCTTTTAACCCTTTTTATACATCACTTTTCACATTTATGAAGGATATTTTTGTAAACAAACAACTTATTCTTAAAATTTATCCAATGCATATTATTTTGAATACAACAAACCAAACACTCAATAAAAAATAATCTAAGCATAACTTATCCCATCATAACTTGTATTCAAACCAAACGACACCTTAGGGATAT--ATACTACAATGTGAATA----------------TTGAATTTCTTTTGACTCTACTGCTGCTTTTACCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTGTACTGTTGTCTTGA--CTTTATGTGGCATTTTACT-TTTGTCTTTAATCCTTTTTT-AACCTTGTTTTCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-CACATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTGTAGGTAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAGTCTTTTTGTATTCACTTGATTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACTTTGGAAGCT-TTTTGATGCTAATAAATTGAGTTTTTTAAATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCTGGTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTTCTG-ACTTCAGTATATACTAAAATATTTTGGATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTCATGGACGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATTCCTTTGATTGGCTTCATTGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATTGTAGTCCTTGTATGTACCAAATGGGCTCATGGTATCTT-------TCTTGTTGTGTTTACTTGTGCCAAGACTGAA-TTGACCTGCTACTCGTCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGT-CCAAGCA 'Solanum phaseoloides Pol.-LB693' ---------------------------GCTTGGGATACTAGTGTTGCGGTTGAGGTACTCCTATCTTATCA--------TACAATATA---TCTCTTCCATTCCCTCATTCAAGCATATTCTGATCC-CTACTTTATCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTACAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTCAACTCTTAGGG------------TCGTTTGGTGCGAAGGATAAACACAAATAGTCCTCGGATAATATTTTAGTGGCACTTAATTTATTGTTTGGTTGGGAAGCTTGGTATAACTTATCCCGGGATTAATAATTAGTACCGGGATAAGTTATTCCTCCCAAGGGGTGGTATAGTGATCCCGGGATAAGTTATCCCGGGATAAAATATGTAAATGACAAAGATATCGCTTTTAACCCTTTTTATACATCACTTTTCACATTTATGAAGGATATTTTTGTAAACAAACAACTTATTCTTAAAATTTATCCAATGCATATTATTTTGAATACAACAAACCAAACACTCAATAAAAAATAATCTAAGCATAACTTATCCCATCATAACTTGTATTCAAACCAAACGACACCTTAGGGATAT--ATACTACAATGTGAATA----------------TTGAATTTCTTTTGACTCTACTGCTGCTTTTACCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTGTACTGTTGTCTTGA--CTTTATGTGGCATTTTACT-TTTGTCTTTAATCCTTTTTT-AACCTTGTTTTCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAA-CACATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTGTAGGTAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAGTCTTTTTGTATTCACTTGATTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATCGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACTTTGGAAGCT-TTTTGATGCTAATAAATTGAGTTTTTTAAATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCTGGTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTTCTG-ACTTCAGTATATACTAAAATATTTTGGATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTCATGGACGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATTCCTTTGATTGGCTTCATTGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATTGTAGTCCTTGTATGTACCAAATGGGCTCATGGTATCTT-------TCTTGTTGTGTTTACTTGTGCCAAGACTGAA-TTGACCTGCTACTCGTCGTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCA 'Solanum trifolium Dunal-LB2368' -CCCCTCGTTATGACCAATACAAAGATGCTTGGGATACTAGTGTTGCGGTTGAGGTACTCCTATCTTATCA--------TACAATATA---TCTCTTCCATTCCCTCATTCAAGCATATTCTGATCC-CTACTTTATCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTCAACCCTTAGGGATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTACAATGTGAATA----------------TTGAATTTCTTTTGACTCTACTGCTGCTTTTACCCTTTTAAGGTTTGGGGCAAAACGGGTTCAAAAATATATGGCCCCAAAGCTGGACAAGATTATTTAGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTT----GTTGTACTGTTGTCTTGA--CTTTATGTGGCATTTTACTTTTTGTCTTTAATCCTTTTTT-AACCTTGTTTTCTTTGTTACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTACTCAGGACCATATGGTAA-CACATCCCAGTTTCAGAAAA-CTCCTTAGAAATCATAGTATATCCTTGTAGGTAATCATCTTTATTTTGCCAATTTCTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAGTCTTTTTGTATTCACTTGATTGCACTTT-ACCCTGCAAATCAACAAGGTTGTATTAATATAT--GATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATCGCCTATCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAATTTAATGCTTGAAATCAGACCACCAACTTTAGAAGCTCTTTTGATGCTAGTAAATTGAGTTTTTTAAATTTTGCAGATATGAAAAGCCTATTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCTGGTGTTGACATGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAGCCACTGTAAGATAAGATTTTTCTG-ACT-CAGTATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTT-CTTGCTAATCAAAATCTCTATACAGGTAATGGACGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCGTCGGATTGGATGTTCAAATTGTAGTCCTTGTATGTACCAAATGGACTCATGGTATCTT-------TCTTCTTGTGTTTACTTGTGCCAAGACTGAA-TTGACCTGCTACTCGTCCTATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTTAATGTCCCTTTGGCTCACATGATC?CTGCTGGTGCTGA-------------------- ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M8568] TITLE 'Herpystichum-ITS'; LINK TAXA = Taxa8; DIMENSIONS NCHAR=686; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Solanum_anceps_LB2408 GGATCATTGTCGAAACCTGCAGT-GCAGAACGACCCGCGGACCTGTTT-GAACACTCGGGGG-AG-CCGCGCG-TCCGGGGGTGCT-----CAGGC-CCCCCCGCCCGCGCGTCTCCCTCCCGTCCCCGGCGCGCGCGCCCGCGCGCACGCCGGGCGACTAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACA-AAATTGACAGCC-CGCCACCCGCGCCCCGTCTGCGGAGCGCGCGGGGGGACGCGTGCTTCTTTCGA----AACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCTCC-----GCACGCCGCGAGGCGT--CGCGCGGGGG--CGGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCT-CTGTTGTCGCGGCTACAGCCCGTCGCGCGTCGGCACTCCCGGACCCTGTTCGCG-CCT---------TGGGCGCTCCGACCGCGACCCCAGGTCA Solanum_anceps_LB654 GGATCATTGTCGAAACCTGCAGT-GCAGAACGACCCGCGGACTTGTTT-GAACACTCGGGGG-AG-CCGCGCTAC?-GT?TGT???-----?????-??????G{CT}{AC}{CT}GCGCGTCTCCCTCCCGTCCCCGGCGCGCGCGCCCGCGTGCACGCCGGGCGACTAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACT-AAATTGACAGCC-CGCCACCCGCGCCCCGTCTGCGGAGCGCGCGGGGGGACGCGTGCTTCTTTCGA----AACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCTCC-----GCACGCCGCGAGGCGT--CGCGCGGGGG--CGGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATACGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCT-CTGTTGTCGCGGCTACAGCCCGTCGCGCGTCGGCACTCCCGGACCCTGTTCGCG-CCT---------TGGGCGCTCCGACCGCGACCCCAGGTCA Solanum_brevifolium_LB1029 GGATCATTGTCGAAACCTGCACA-GCAGAACGACCCGCGAACACGTTT-CAACACTCGGGGG-CG-ACGCGCGTTC-GGGGGTGCT-----CCGGC-CTCCCCGCCCGCGCGCCTCCCTCCCGTCCCCGGCGCGCGCGCCCGCGCGCTCGTCGGGCGACCAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACTAAAATTGACGGCC-C-----TCGCGCCCCGTCCGCGGAGTGCGT---GGG----GTGCTGCTCTTGA----AACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC------GCACGCCGCAAGGCGTCGCGCGGGG-----CGGAATCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCT-TTGCTGTCGCGGCCACGTACCGTCGTGCGTCCGGACTCCCAGACCCTCTCTGCG-CCG------ACTAAGGCGCTCCGACCGCGACCCCAGGTCA Solanum_bulbocastanum_S4 ----CATTGTCGAAACCTGCACA-GCAGAACGACCCGCGAACGCGTTTTAAACACTTGGGGG-CG-GCGCGCGCTC--GCCGCGC---------GC-C{CT}CCC----CTCCCGTCCCC-GGCGTGCGCGCCC--GCGCGCTCG-------TTCGGGCGACCAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACTGAAATCGACGGCCCTCCCC-TCGCGCCCCGTTCGCGGAGCGCGCGGGGGGACGCGTGCTGCTCTTTA----AACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-----GCACGCCGCGAGGCGC--TGCGCGGGGG--CGGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAGGTGGTGGTTGAA{AG}CTCAACTCTCTCTTGCTGTCGCGGCTACGGCCCGTCGTGCGTCCGGACTCCCAGACCCTGACCGCG-CCAGCCGA--AAGCGGCGCTCCGACC-------------- Solanum_caripense_LB1026 GGATCATTGTCGAAACCTGCAAA-GCAGAACGACCCGCGAACGCGTTT-CAACACTTGAGGG-AG-CCGCGCGGCT-GGGGG-GCCGAAGCTTCGT-CCCCCCGCCCGTGCGTCCCCCTCCCGTCCCCGCCGCGCGCGCCCGCGTGCGCGTCGGGCGACAAACGAA----CCCCGGCGCGGAAAGCGCCAAGGACTACT-AAACTAGCAGCCCTCCCC-TCGCGCCCCGTCCGCGGAGCGTGCGTGGGGATGCGTGCTTCTTTTAA----AACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC------GCACGCCGCTAGGCGT--CGTGGGG-----CGGAAGCTGGCCTCCCGTGCGCCTC-CAGCGCGCGGCTGGCCTAAATGCGAGTCCACGCCGACGGACGTCGCGGCAATCGGTGGTTGAAACTCAACTCTCT-TTGTCGTCGCGGCTACAGCCCGTCGCGCGTTCGGACTCCCAGACCCTCCGTGCG-CCTCCTAAATCGAAGGCGCTCCGACCGCGACCCCAGGTCA Solanum_crassinervium_LB2397 ----CATTGTCGAAGCCTGCGAA-GCGGAACGACCCGTGAACTAGTTT-GAACACTCGGGGG-AG-CGGCGCGGCC-GGGGGTGCTCAGG-CCCCC-CCGCCCGGCCGCGCGTCTCCCTCGCGTCCCCGGCGCGCGCGCCCGCGCGCGCGTCGGGCGAC{AT}AACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACT-GAATCGGCAGCCC------TCCCCCCC------------GCGCGGGGGGACGCG{CT}GCTGCTTTCGA----AACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCAC----GCACGCCGCGAGGCGTCGCGCGCGGGGG--CGGAAGCTGGCCTCCCGTGCGCCCCCGAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCGAGTGGTGGTTGGAACTCAACTCTCT-CTGTCGTCGCTGT----GGCCGTCGCGCGTGCGGACTCCCCGGCCCTCTTCGCG-CCT---------CGCGCGCTCCGACCGCGACCCCAGGTCA Solanum_dalibardiforme_LB2454 GGATCATTGTCGAAACCTGCGAA-GCGGAACGACCCGTGAACGTGTTT-GAACACTCGGGGG-AG-CCGCGCCTTAGCCGGCGCGTCTCCCTCTACGTCCCCGGCGGGCGGG------------------CGCGCCCGCGCGCGCGCACGTCGGGCGACTAACTAACGAACCCCGGCGCGGAAAGCGCCAAGGAATACT-AAATTGGCAGCCCTCCCC-CCGCGCGC--TCC-----GCGCGCGGAGGGACGTGTGCTTCTTTTGA----AACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCTC----GCACGCCGCAGGGCGT--GGCGCGGGGGG-CGGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAACGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCT-TTGCTGCCGCGGCCACAGCCCGTCGCGCGTCCGGACTCCCGGGCCCTATCTGCG-CCG-----CGTGCGCGCGCTCCGACCGCGACCCCAGGTCA Solanum_evolvulifolium_LB183 GGATCATTGTCGAAGCCTGCGAA-GCGGAACGACCCGTGAACTAGTTC-GAACACTCGGGGG-AG-CCGCGCGGCC-GGGGGTGCTCAGG-CCCCC-CCGGCCGGGCG{CG}GCGCCCCCCT{CG}GCGTCCCCGGCGCGCGCTTCCG{CT}GCGCGCGT{CT}GGGCGACCAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACT-{GT}AAT{CT}GGCAGCCC------T{CT}CCCCCCC-----------GCGCGGGGGGACGCGTGCTGCTTTCGA----AACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTC{GT}CCCCCCCAC---GCGCGCCGCGAGGCGTCGCGCGCGGGGG--CGGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCGAGTGGTGGTTGGAACTCAACTCTCT-CTGTCGTCGCTGT----GTCCGTCGCGCGTGCGGGCTCCAAGGCCCTCTTCGCG-CCT---------GGCGCGCTCCGACCGCGACCCCAGGTCA Solanum_evolvulifolium_LB2253 GGATCATTGTCGAAGCCTGCGAA-GCGGAACGACCCGTGAACTAGTTT-GAACACTCGGGGG-AG-CCGCGCGGCC-GGGGGTGCTCAGG-CCCCC-CCGCCCGGCCGCGCGTCCCCCTCGCGTCCCCGGCGCGCGCGCCCGCGCGCGCGTCGGGCGACCAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACT-GAATCGGCAGCCC------TCCCCCCC------------GCGCGGGGGGACGCGTGCTGCTTTCGA----AACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCGC---GCACGCCGCGAGGCGTCGCGCGCGGGGG--CGGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCGAGTGGTGGTTGGAACTCAACTCTCT-CCGTCGTCGCTGT----GTCCGTCGCGCGTGCGGGCTCCCCGGCCCTCTTCGCG-CAT---------GGCGCGCTCCGACCGCGACCCCAGGTCA Solanum_evolvulifolium_LB2415 GGATCATTGTCGAAGCCAGCAAA-GCGGAACGACCCATGAACGTGTTT-GAACACTCGGGGG-AG-CCGCGCGGCC-GGGGGTGCTTAGG-CCCCC-CCTCCCAGCCGCGC-----------ATCCTTAATAAGAGCACCCGTGCGCGCGTCGGGCGAGTAACAAA----TCCCAGCGCGAAAAGCGCACAGGAATACT-GAATCGATAGCCC------TCCCCC----TGCGCCGCGTGCGCGGGGGGACGTGTGCTACTTTTGA----AACACAAACGACTCTCGGTAACGGATATCTCGGCTCTCGCATCGATGAAGAATGTAGAGAAATGCGATACTTGGTGTGAATTGCAGAATATCGTGAACCATCGAGTTTTTGAATGCAAGTTACGCCAGAAGCCATTAGGCCGAGGGCATGACTGCTTGGGCGTCACGCATCACGTCGCCCCCCA-----GCACGCCGTGACGCGTCGCACACGGGGG--CGAAAGTTGGCCTCCTGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATACGAGTCCATGTCGACGGACGTCGTGGCGAGTAGTGGTTGAAACTCAACTCTCT-TTGTCATCGCG{AG}CCACTGGCCGTCGCGCGTCCAAACTGCCCGGCCCTTTTTGTG-CCT---------CGCGCGTTTCGA{CT}CGCCACCCCAGGTCA Solanum_evolvulifolium_LB2520 GGATCATTGTCGAAGCCTGCGAA-GCGGAACGACCCGTGAACTTGTTT-GAACAACTCGGGGGAG-CGGCGCGGCC-GGGGGTGCTCAGG-CCCCC-CCGCCCGGCCGCGCGTCTCCCTCGCGTCCCCGGCGCGCGCGCCCGCGCGCGCGCCGGGCGACTAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACT-GAATGGGCAGCCC------TCCCCCCC------------GCGCGGGGGGACGCGCGCTGCTTTCGATCGAAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCAAGCATCGCGTCGCCCCCCCC----GCACGCCGCGAGGCGTCGCGCGCGGGGG--CGGAAGCTGGCCTCCCGCGCGGCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCGAGTGGTGGTTGGAACTCAACTCTCT-CTGTCGTCGCTGC----GGCCGTCGCGCGTGCGGACTCCCCGGCCCTCTTCGCG-CCT---------CGCGCGCTCCGACTGCGACCCCAGGTCA Solanum_evolvulifolium_LB709 GGATCATTGTCGAAGCCTGCGAA-GCGGAACGACCCGTGAACTAGTTC-GAACACTCGGGGG-AG-CCGCGCGGCC-GGGGGTGCTCAGG-CCCCC-CCGGCCGGGCG{CG}GCGCCCCCCT{CG}GCGTCCCCGGCGCGCGCTTCCG{CT}GCGCGCGT{CT}GGGCGACCAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACT-{GT}AAT{CT}GGCAGCCC------T{CT}CCCCCCC-----------GCGCGGGGGGACGCGTGCTGCTTTCGA----AACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTC{GT}CCCCCCCAC---GCGCGCCGCGAGGCGTCGCGCGCGGGGG--CGGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCGAGTGGTGGTTGGAACTCAACTCTCT-CTGTCGTCGCTGT----GTCCGTCGCGCGTGCGGGCTCCAAGGCCCTCTTCGCG-CCT---------GGCGCGCTCCGACCGCGACCCCAGGTCA Solanum_limoncochaense_LB2391 GGATCATTGTCGAAACCTGCAAA-GCAGCACGACCCGCGAACGCGTTT-GAACACTCGGGGG-AG-CCGCGCGGCC-GGGGGTGCTCGGG-CGCCC-----CCGCCCGCGCGTCTCCCTCCCGTCCCCGGCGCGCGCGCCCGCGCGCACGTCGGGCGACTAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACT-AAATTGACAGCCCGCCCC-CCGCGCCCCGTCCGCGGAGCGCGCGGGGGGACGTGTGCTTCTTTTGA----AACGCAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCC----GCACGCCGCGAGGCGT--CGCGCGGGG---CGGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCT-TTGCTGTCGCGGCTACGGCCCGTCGCGCGTCCGGACTCCCAGACCCTATTCGCG-CCT---------CAGGCGCTCCGACCGCGACCCCAGGTCA Solanum_limoncochaense_LB2466 GGATCATTGTCGAAACCTGCAAA-GCAGCACGACCCGCGAACGCGTTT-GAACACTCGGGGG-AG-CCGCGCGGCC-GGGGGTGCTCGGG-CGCCC-----CCGCCCGCGCGTCTCCCTCCCGTCCCCGGCGCGCGCGCCCGCGCGCACGTCGGGCGACTAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACT-AAATTGACAGCCCGCCCC-CCGCGCCCCGTCCGCGGAGCGCGCGGGGGGACGTGTGCTTCTTTTGA----AACGCAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCC----GCACGCCGCGAGGCGT--CGCGCGGGG---CGGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCT-TTGCTGTCGCGGCTACGGCCCGTCGCGCGTCCGGACTCCCAGACCCTATTCGCG-CCT---------CAGGCGCTCCGACCGCGACCCCAGGTCA Solanum_loxophyllum_LB2396 GGATCATTGTCGAAGCCTGCGAA-GCGGAACGACCCGTGAACCAGTTT-GAACACACGGGGG-AG-CGGCGCGGCC-GGGGGTGCTCAGG-CCCCC-CCGCCCGGCCGCGCGTCTCCCTCGCGTCCCCGGCGCGCGCGCCCGCGCGCGCGCCGGGCGACCAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACT-GAATGGGCGGCCC------TCCCCCC---------GCGCGCGCGGGGGGACGCGTGCTGCTTTCGA----AACGCGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCCACCCGCACGCCGCGAGGCGTCGCGCGCGGGGGGGCGGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCGAGTGGTGGTTGGAACTCAACTCTCT-CTGTCGTCGCTGT----GGCCGTCGCGCGTGCGGACTCCCCGGCCCTCTTCGCG-CCT---------CGCGCGCTCCGACCGCGACCCCAGGTCA Solanum_loxophyllum_LB2521 GGATCATTGTCGAAGCCTGCGAA-GCGGAACGACCCGTGAACCCGTTT-TAACACACGGGGG-AG-CGGCGCGGCC-GGGGGTGCTCAGG-CCCCC-CCGCCCGGCCGCGCGTCTCCCTCGCGTCCCCGGCGCGCGCGCCCGCGCGCGCGCCGGGCGACCAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACT-GAATGGGCGGCCC------TCCCCCC---------GCGCGCGCGGGGGGACGCGTGCTGCTTTCGA----AACGCGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-ACCCGCACGCCGCGAGGCGTCGCGCGCGGGGGGGCGGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCGAGTGGTGGTTGGAACTCAACTCTCT-CTGTCGTCGCTGT----GGCCGTCGCGCGTGCGGACTCCCCGGCCCTCTTCGCG-CCT---------CGCGCGCTCCGACCGCGACCCCAGGTCA Solanum_lycopersicum_RGO340 GGATCATTGTCGAAACCTGCACA-GCAGAACGACCCGCGAACTCGTTTTAAACAC-CGGGGG-CG-GCGCTCGCTC--GTCGCGC---------GC-CTCCC------CCCGTCGCCCGAGGCGC--------GCAAGCTCT--------TCGGGCGACCAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACTACAATCGACAGCCCTCCCCCTCGCGCCCCGTTCGCGGATCGTGCGGGGGGAAGCGCGCTGCTCTGTT----AACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTC-----GCACGCCGCAAGGCTTT-AGCGCGGGGG--CGGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACAGCCCGTCGCGCGTCCGGACTCCCCGACCCTCACCGCG-CC------TCACCAGGCGCTCCGACCGCGACCCCAGGTCA Solanum_pacificum_LB2395 GGATCATTGTCGAAACCTGCGAA-GCGGAACGACCCGTGAACGTGTTT-GAACACTCGGGGG-CG-CCGCGCGGCC-GGGGGTGCTTAGG-CCCCC-CCGCCCGGCCGCGCGTCTCCCTCGCGTCCCCGGCGCGCGC----GTGCGCGCGTCGGGCGACTAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACC-GAATCGGCAGCCC------TCCTG----------------CGC-GGGGGGCTAGTGCTGCTTTTGA----AACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCTGC--GCACGCCGCGAGGCGTCGCGCGCGGGGG--CGGAATCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCGAGTGGTGGTTGAAACTCAACTCTCT-CCGTCGTCGCGGCCTCAGGCCGTCGCGCGTCCGGACCCCCCGACCCTTTCCGCG-CCT---------CGTGCGCTCCGACCGCGACCCCAGGTCA Solanum_phaseoloides_LB693 GGATCATTGTCGAGAAC--------CCGAACGACCCGCGAACGTGTTT-GAACACTCGGGGG-GG-GCGCGGGGGC-GGGGG-------------------CCGCCCGCGCGCCTCCCTCCCGTCCCCGGCGCGCGC----GCGCGCGAGTCGGGCGACGAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACT-AAATTGACGG----------CGCGCCCC-TC---------CGCGGAGGGACGCG--CTTCTCTGGA----AACGCAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCTCC-----GCACGCCGCGAGGCGT--CGCGCGGGGGGGCGGGAGGTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGGCGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCT-TTGCTGTCGCGGCCGCAGGCCGTCGCGCGTCCGGACTCCCGGACCCTATTCGCG-CCG---------CAGGCGCTCCGACCGCGACCCCAGGTCA Solanum_trifolium_LB2209 GGATCATTGTCGAGACCTGCAAG-GCAGAACCACCCGCGAACGTGTTT-GAACACT-GGGGG-AG-CC-------------------------------------------TTCTCCCTCCCGTCCCCGGCGCGCGCGCCCGCGCTTGCGTCGGGCGACCAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACC-GAATCGACAGCTCGCCCC-CCGCGCCCCGTCCGCGGAGCGCGCGGGGGGACGCGTTG-AAACACGA----AA--CAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCTAC-----GCACGCCGCGAGGCGT--CGCGCGGGGG--CGGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAGGTGGTGGTTGAAGCTCAACTCTCT-CTGCTGTCGCGGCCACAGCCCGTCGCGCGTGCGGACTCCCCGACCCTGTTCGCG-CCT---------CAGGCGCTCCGACCGCGACCCCAGGTCA Solanum_trifolium_LB2368 GGATCATTGTCGAGACCTGCAAG-GCAGAACCACCCGCGAACGTGTTT-GAACACT-GGGGG-AG-CC-------------------------------------------TTCTCCCTCCCGTCCCCGGCGCGCGCGCCCGCGCTTGCGTCGGGCGACCAACGAA----CCCCGGCGCGGAAAGCGCCAAGGAATACC-GAATCGACAGCTCGCCCC-CCGCGCCCCGTCCGCGGAGCGCGCGGGGGGACGCGTTG-AAACACGA----AA--CAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCTAC-----GCACGCCGCGAGGCGT--CGCGCGGGGG--CGGAAGCTGGCCTCCCGTGCGCCCC-GAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAGGTGGTGGTTGAAGCTCAACTCTCT-CTGCTGTCGCGGCCACAGCCCGTCGCGCGTGCGGACTCCCCGACCCTGTTCGCG-CCT-----------GGCGCTCCGACCGCGACCCCAGGTCA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7409] TITLE 'Herpystichum-psbAtrnH'; LINK TAXA = Taxa3; DIMENSIONS NCHAR=584; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Solanum anceps Ruiz & Pav.-LB2408' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCTAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATAATTTTCTTGTTCTATCAAGAGGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTACTAGTATTTTACTGACATAGACTTTTTTTTTTACATTATCGAAAAAGAA---GGAAAGGGTATTTGCCTGCATTTATTCATGAT-------------TGAGTATTCGAT-TTTTATTTTCTATTTATTTAAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTAAAAAAAAA--TATAATTTTGACTTCATATTCTTATCTTTGAAATAA-TAAT---CGAAATAATAATATCATTGAAATAAGAAAGAAGAGAAATATTAGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAATCC 'Solanum anceps Ruiz & Pav.-LB654' ---GTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCTAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATAATTTTCTTGTTCTATCAAGAGGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTACTAGTATTTTACTGACATAGACTTTTTTTTTTACATTATCGAAAAAGAA---GGAAAGGGTATTTGCCTGCATTTATTCATGAT-------------TGAGTATTCGAT-TTTTATTTTCTATTTATTTAAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCAAAAAAAAAATATAATTTTGACTTCATATTCTTATCTTTGAAATAA-TAAT---CGAAATAATAATATCATTGAAATAAGAAAGAAGAGAAATATTAGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAA--- 'Solanum brevifolium Dunal-LB1029' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTATCAAGAAGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---GGAGAGGGTATTTTCCTGCATTTATTCATGAT-------------TGAGTATTCTAT-TTTTATTTTCTATTTATTTAAAATTGTAGAAATAGAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--GATAATTTTGACTTCATATTCTTATCTTTGAAATAA-TAAT---CGAAATAATAATATCATTGAAATAAGAAAGAAGAGAAATATTCGAATTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAATCC 'Solanum bulbocastanum Dunal -Spooner4' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGGAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTT-----------TTTTTCTTTATTAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---AGAGAGGGTATTTGCTTGCATTTATTCATGAT-------------TGAGTATTCGAT-TTTTATTTTCTATTTATTTAAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TACAATTTTTACTTCATATTCTTATCTTTGAAATAA-TAAT---CAAAATAATAATATCATTGAAATAAGAAAGAAGATAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGT-AAGTAGGCGGGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAATCC 'Solanum caripense Dunal-LB1026' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTTTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTTTTTTTTATTTTTCTTTATTAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAATAAAAAGGAAAGGGTATTTGCCTGCATTTATTCATGAT-------------TGAGTATTCGAT-TTTTATTTTCTATTTATTTAAAATTGTAGAAATAGAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TACAATTTTTACTTCATATTCTTATCTTTGAAAGAAATAATAATCAAAATAATAATCTCATTGAAATAAGAAAGAAGAGAAATATTAGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTAAATCC 'Solanum crassinervium Tepe-LB2397' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTATCAAGAAGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTACTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---GTAAAGGGTATTTGCCTGCATTTATTCATGAT-------------TGAGTATTCGAT-TTTTATTTTCTATTTATTGAAAATTGTCGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TAGAATTTTGACTTCATATTCTTATCTTTGAAATAA-TAAT---CGAAATAATAATATCATTGAAATAAGAAAGAATCGAAATATTCGAACTTGAATCTTTTGTTTTTGAATTTAAATAATGTAAAAATGGAATAT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAATCC 'Solanum dalibardiforme Bitter-LB2454' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTATCAAGAAGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTACTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---GGAAAGGGTATTTGCCTGCATCTATTCATGAT-------------TGAGTATTCGAT-TTTGATTTTCTATTTATTTAAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TATAATTTTTACTTCATATTCTTATCTTTGAAATAA-TAAT---CGAAATAATAATATCATTGAAATAAGAAAGAATAGAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATAT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAATCC 'Solanum evolvulifolium Greenm.-LB183' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTATCAAGAAGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTACTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---GTAAAGGGTATTTGCCTGCATTTATTCATGAT-------------TGAGTATTCGAT-TTTGATTTTCTATTTATTGAAAATTGTCGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TCGAATTTTGACTTCATATTCTTATCTTTGAAATAA-TAAT---CGAAATAATAATATCATTGAAATAAGAAAGAATAGAAATATTCGAACTTGAATCTTTTGTTTTTGAATTTAAATAATGTAAAAATGGAATAT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAATCC 'Solanum evolvulifolium Greenm.-LB2415' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTATCAAGAAGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTACTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---GTAAAGGGTATTTGCCTGCATTTATTCATGAT-------------TGAGTATTCGAT-TTTTATTTTCTATTTATTGAAAATTGTCGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TCGAATTTTGACTTCATATTCTTATCTTTGAAATAA-TAAT---CGAAATAATAATATCATTGAAATAAGAAAGAATCGAAATATTCGAACTTGAATCTTTTGTTTTTGAATTTAAATAATGTAAAAATGGAATAT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAATCC 'Solanum evolvulifolium Greenm.-LB2520' ---------------------------------CTGCTATCGGAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTATCAAGAAGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTACTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---GTAAAGGGTATTTGCCTGCATTTATTCATGAT-------------TGAGTATTCGAT-TTTTATTTTCTATTTATTGAAAATTGTCGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TAGAATTTTGACTTCATATTCTTATCTTTGAAATAA-TAAT---CGAAATAATAATATCATTGAAATAAGAAAGAATCGAAATATTCGAACTTGAATCTTTTGTTTTTGAATTTAAATAATGTAAAAATGGAATAT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTG------------- 'Solanum evolvulifolium Greenm.-LB709' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTATCAAGAAGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTACTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---GTAAAGGGTATTTGCCTGCATTTATTCATGAT-------------TGAGTATTCGAT-TTTGATTTTCTATTTATTGAAAATTGTCGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TCGAATTTTGACTTCATATTCTTATCTTTGAAATAA-TAAT---CGAAATAATAATATCATTGAAATAAGAAAGAATAGAAATATTCGAACTTGAATCTTTTGTTTTTGAATTTAAATAATGTAAAAATGGAATAT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAATCC 'Solanum limoncochaense Tepe-LB2391' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTATCAAGAGGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTACTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---GGAAAGGTTATTTGCCTGCATTTATTCATGAT-------------TGAGTATTCGAT-TTTTATTTTCTATTTATTTAAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TATAATTTTGACCTCATATTCTTATCTTTGAAATAA-TAAT---CGAAATAATAATATCATTGAAATAAGAAAGAAGAGAAATATTCGAACTTGAACCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAATCC 'Solanum limoncochaense Tepe-LB2466' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTATCAAGAGGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTACTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---GGAAAGGTTATTTGCCTGCATTTATTCATGAT-------------TGAGTATTCGAT-TTTTATTTTCTATTTATTTAAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TATAATTTTGACCTCATATTCTTATCTTTGAAATAA-TAAT---CGAAATAATAATATCATTGAAATAAGAAAGAAGAGAAATATTCGAACTTGAACCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAATCC 'Solanum loxophyllum Bitter-LB2396' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTATCAAGAAGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTACTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---GTAAAGGGTATTTGCCTTCATTTATTCATGAT-------------TGAGTATTCGAT-TTTGATTTTCTATTTATTGAAAATTGTCGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TCGAATTTTGACTTCATATTCTTATCTTTGAAATAA-TAAT---CGAAATAATAATATCATTGAAATAAGAAAGAATCGAAATATTCGAACTTGAATCTTTTGTTTTTGAATTTAAATAATGTAAAAATGGAATAT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAATCC 'Solanum loxophyllum Bitter-LB2521' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTATCAAGAAGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTACTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---GTAAAGGGTATTTGCCTTCATTTATTCATGAT-------------TGAGTATTCGAT-TTTGATTTTCTATTTATTGAAAATTGTCGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TCGAATTTTGACTTCATATTCTTATCTTTGAAATAA-TAAT---CGAAATAATAATATCATTGAAATAAGAAAGAATCGAAATATTCGAACTTGAATCTTTTGTTTTTGAATTTAAATAATGTAAAAATGGAATAT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAATCC 'Solanum lycopersicum L.-RGO340' --------------------------------------------GCTCCATCTACAAATGGATAAGATCCTAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTGTCAAGAGGGTGCTATTGCTCCTTTCTTTTTTT------TTTTTTCTTTACTAATTTCCTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---AGAGAGGGTATTTGCTTGCATTTATTCATGATATTTATTCATGATTGAGTATTCTATGTTTTATTTTCTATTTATTGAAAATTGTAGAAATATAACGTGTTCCTCTTGTTACTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TAAAATTTTGACTTCATATTCTTATTTTTGAAATAA-TAAT---CAAAATAATAATATCATTGAACTAAGAAAGAAGAGAAATATTCGAACTTGAATCTTTTGTTTTCTAATTTAAATAATGTAAAAATGGAATGT-AAGTAGGCGAGGGG------------------------------------------- 'Solanum pacificum Tepe-LB2395' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGGAAAGAAAGGAGCAATAATCATTTTCTTGTTCTATCAAGAAGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTACTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---GGAAAGGGTATTTGCCTGCATTTATTCATGAT-------------TGAGTATTCGAT-TTTGATTTTCTATTTATTTCAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAGTGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TATAATTTTGACTTCATATTCTTATCTTTGAAATAA-TAAT---CGAAATAATAATATCATTGAAATAAGAAAGAATAGAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATATTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAATCC 'Solanum phaseoloides Pol.-LB1727' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTATCAAGAGGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTACTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---GGAAAGGGTATTTGCCTGCATTTATTCATGAT-------------TGAGTATTCGAT-TTTGATTTTCTATTTATTTCAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TAGAATTTTGACTTCATATTCTTATCTTTGAAATAA-TAAT---CGAAATAATAATATCATTGAAATAAGAAAGAAGAGAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAATCC 'Solanum phaseoloides Pol.-LB693' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTATCAAGAGGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTACTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---GGAAAGGGTATTTGCCTGCATTTATTCATGAT-------------TGAGTATTCGAT-TTTGATTTTCTATTTATTTCAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TAGAATTTTGACTTCATATTCTTATCTTTGAAATAA-TAAT---CGAAATAATAATATCATTGAAATAAGAAAGAAGAGAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAATCC 'Solanum trifolium Dunal-LB2368' AACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATCCCAGCCTAGTCTATAGGAGGTTTTGAAAAGAAAGGAGCAATAATCATTTTCTTGTTCTATCAAGAGGGTGCTATTGCTCCTTTCTTTTTTT------CTTTTTCTTTATTAATTTACTAGTATTTTACTGACATAGACTTTTTTGTTTACATTATCGAAAAAGAA---GGAAAGGGTATTTGCCTGCATTTATTCATGAT-------------TGAGTATTCGAT-TTTTATTTTCTATTTATTTCAAATTGTAGAAATATAACTTGTTCCTCTTGTTGCTAATGTTACTATATCTTTTTTATTTCATTTCACAAAAAA--TATAATTTTTATTTCATATTCTTATCTTTTAAATAA-TAAT---------------ATCATTGAAATAAGAAAGAAGAGAAATATTCGAACTTGAATCTTTTGTTTTCGAATTTAAATAATGTAAAAATGGAATGT-AAGTAGGCGAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTTGTGAATCC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7416] TITLE 'Herpystichum-cos10B'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=716; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Solanum anceps Ruiz & Pav.-LB2408' GGACAAAGAGCTTAAGCGTCTGGTGGTTGAAACCACTGCAAATCAGGTGATTGATGCATGTTCTATTTATCCTATATTAATAGATAGATATGTTCTATTTATCCTAAATTAATAGATTGCTGATCGTCATCGTCAACAAGTGAAGTTGATTTCTCCACTTTGTTGCCTTAACTCAGAGGTTATTAT---CCAATAAAGCGCAAAAAGAAAATGTGGAAGACTGCTAATTT-CTTGATCGCCTAGAAGTCTTAAAGCTGTAGACTAAATAATCTGACCTTTCATTCATTATTAGCTGCCACAATTGAGAGATGCATTTTTTATGTTAATTGATGTTGTCTTTGCACCAGCTGAG--------TTCTCCCCTT-AGGTTAATGAACTTCTTTGACCGATCCTTTAGGATTATTT-GCATTTCCCCACCTCCTTCGTCAGTCAGCATTCTGTAGTCTACACCATACCGCGCAGGCTTCAATCATAGATAGGTCTTTATTTTTGTCTTTTTTGGCAATCCTTTTTT------ATATA--GGGGATTGCAATTTGCATAA-GAAAGTTGGCATATGTTTCTATAATTGTTGCTTGTCAGGTTGCCTAATGAATTATGAAAGGGATCATTTTTGCGATTATTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCAT 'Solanum anceps Ruiz & Pav.-LB654' GGACAAAGAGCTTAAGCGTCTGGTGGTTGAAACCACTGCAAATCAGGTGATTGATGCATGTTCTATTTATCCTATATTAATAGATAGATATGTTCTATTTATCCTAAATTAATAGATAGCTGAGCGTCATCTTCAACAAGTGAAGTTGATTTCTCCACTTTGTTGCCTTAACTCAGAGGTTATTAT---CCAATAAAGCGCAAAAAGAAAATGTGGAAGACTGCTAATTT-CTTGATCGCCTAGAAGTCTTAAAGCTGTAGACTAAATAATCTGACCTTTCATTCATTATTAGCTGCCACAATTGAGAGATGCATTTTTTATGTTAATTGATGTTGTCTTTGCACCAGCTGAG--------TTTTCCCCTT-AGGTTAATGAACTTCTTTGACCGGTCTTTTTGGATTATTT-GCATTTCCCCACCTTCTTGGTCAGTCAGCATTCTGTAGTCTACACCATACCGCGCAGGCTTCAACCGTAGATAGGTTTTTATTTTTTTATTTTTTGGCAATCCTTTTTT------ATATA--GGGGATTGCAATTTGCATAA-GAAAGTTGGCATATGTTTCTATAATTGTTGCTTGTCAGGTTGCCTTATGAATTATGAAAGGGATCATTTTTGCGATTATTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCAT 'Solanum brevifolium Dunal-LB1029' GGACAAAGAGCTTAAGCGCCTGGTGGTTGAAACCACTGCAAATCAGGTGATTGATGCATGTTCTATTTATCCCGTATTAGTAGATAGATATGTTCTATTTATCCTAAATTAATAG----CTGAGCGTCATCTTCAACAAGTGAAGTTGATTCCTCCACTTTGTTGCCTTAACTTAGAGGTTATTAT---CCAAGAAAACACAAAAAGAAAATGTGAAAGACTGCTAATTT-CTTGATCGCTTAGAAGTCTTAAAGCTGTAGACTAAATAATCTGACCTTCCATTCATTATTAGCTGCCATAATTGAGAGATGTATCTTTTATGTTAATTGAT-----------ACCATCTGAG--------TTTTCCTCTTT-GGTTAATGAACTTCTCTGACCGGTCCTTTAGGATTATTT-GCATTTCCCCACCTCCTTGGTCTGTCAGCATTCTGCAGTCTACACCATACGGCCCAGGTTTCAACTGTAGATAGGTCTTAGTTTTTGTCTTTTTTGGCAATCCTTTTTAGTTTTTATATA--GGGGAGTGC-------ATAA-GAAAGTAGGCATATGTTTCCGTAATTGTTGCTTGTCAGTTTGCCTAATGAATTATGATAGGGATCATTTTTGGGATTATTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCAT 'Solanum bulbocastanum Dunal -Spooner4' GGACAAAGAGCTTAAGCGCCTGGTGGTTGAAACCACTGCAAATCAGGTGATTGATGCATGTTCTATTTATCCTAGATGAATAGATAGATATGTTCTATTTATCCTAAATTAATAGATAGCTGAGCATCATCTTCAACAAGTGAAGTTGATTCCTCCACTTTGTTGCCTTGACTTAGAGGTTAATACTATCCAAGAAAGCGTGAAAAGAAAATGCATAAGACTGCTAATTT-CTTGATTGCTTAGAAGTCTTTAAGTTGTAGACTAAATAATTTGAC-TTCCATTTCTTATTAGCTGCCATGATTGAGAGATGTATTTTTTATGTTAATTGATGCTGTCTTTGCACGGTCTGAG--------TTTTCCTCTTT-GGTTAATGAACTTCTCTAACCGGTCCTTTAGAATTATTT-GCATTTCCCCACCTCCTTGGTCTGTCAGCATTCTGCAGTCTACATCATA{CT}GGCCCAGGCTTCAACTGTAGATAGGTCTT-ATTTTTGTCTATTTTGACAATCCTTTTT-------ATATGT--GGGATTGC-------ATAA-GAACGTTGGCATATGCTTTTGCAATAGTTGCTTGTCAGGTTGTCTTATGAATTATGGTAGGGATCATTTTTGGGATTATTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTATGGGTATAGACGTTTGGGAACACGCAT 'Solanum caripense Dunal-LB1026' ------------------------------------------------TATTGATGCATGTTCTGTTTATCCTATATTCGTAGATAGATATGTTTTATTTATCCTAGATTAGTAGAAAGCTGAGTGTCATCTTCAACAAGTG---------------------TGCCTTAACTTAAAGGTTATTAT---CCAAGGAAGCGCGAAAACAAAATGCGTAAGACTGCTAATTT-CTTGATCAGTTAGAAGC?TTAAAGCTATTGACTAAATAATCTGACCTTCCATTCATTATTAGCTGCCATAATTGAGAGATGTATTTTTTATGTTAATTGATCTTGTCTTTGCACCATCTGAG--------TTTTCCTCTTT-GGTTAATGAACTTCTCTGACCGGTCCTTTAGGATTATTT-GCGTTTCCCCACCTCCTTGGTCTGTCAGCATTCTGCAGTCTACACCATACGGCTCAGGCTTCAACTGTAGATAGGTCTTTATTTTTGTCTTCTTTGGCAATCCTTTTT-------ATATA--GGGGATTGC-------ATAA-GAAAGTTGGCATATGTTTCCGTAGTTGTTGCTTGTCAGGTTGCCTTATGAATAATGATAGGGATCATTTTTGGGATTATTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATCTGGTACCTCT----------------------------- 'Solanum crassinervium Tepe-LB2397' GGACAAAGAGCTTAAGCGCCTGGTGGTTGAAACCACTTCAAATCAGGTGATTGATGCATGTTCTATTTATCCTATATTAATATATAGATATGTTCTATTTATCCTAAATTAATAGATAGCTGAGCATCATCTTCAACAAGTGAAGTTGATTCCTCCACTTTGTTGTCTTAACTCAGAGGTTATTAT---CCAATAAAGCGCAAAAAGAAAATGTGGAAGACTGCTAATTT-CTTGATCGCCTAGAAGTCTTAAAGCTGTAGATTAAATAATCTGACCTTTCATTCATTATTAGCTGCCACAATTGAGAGATGCGTTTTTTATGTTAATTGATGTTGTCTTTGCACCAGTTGAG--------TTTTCCCCTT-AGGTTAATGAACTTCTTTGACCA{AG}TCCTTTAGGATTATTT-GCATTTCCCCACCTCCTTGGTCAGTCAGCATTCTGTAGTCTACACCATACCGTGCAGGCTTCAACTGTAGATAGGTCTTTATTTTTGTCTTTTTTGGCAATCCTTTTTT------ATCTA--GGGGATTGC-------ATAA-GAAAGTTGGCATATGTTTCTGTAATTGTTGCTTGTCAGGTTGCCTTATGAATTATGAGAGGGATCATTTTTCGAATTATTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCAT 'Solanum dalibardiforme Bitter-LB2454' GGACAAAGAGCTTAAGCGCCTGGTGGTTGAAACCACTGCAAATCAGGTGATTGATGCATGTTCTATTTATCCTATATTAATTGATGGATATGTTCTATTTATCCTAAATTAATAGATAGCTGAGCGTCATCTTCAACAAGTGAAGTTGATTACTGCACTTTGTTGCCTTAACTTAGAGGTTATTAT---CCAAGAAAGCGCGAAAAGAAAATGTGGAAGACTGCTAATTT-CTTGATCGCCTAGAAATCTTAAAGCTGTAGACTAAATAATCTGACCTTTCATTCATTATCGGTAGCCATAATTGAGAGATGTATTTTTTATGTTAATTGATGCTGTCTCTACACCAGCTGAG--------TTTTCCTCTT-AGGTTAATGAACTACTCTGACCGGTCCTTTAGGATTATTT-GCATTTCCCCACCTCCTTGGTCTGTCAGCATTCTGCAGTCTACACCATATGGACCAGGCTTCAACTGTAGATAGGTCTTTATTTTTGTCTTTTTTGGCAATCC-TTTTT------ATATAGAGGGGATTGC-------ATAA-GAAAGTTGGCATATGTTCCCGTAATTGTTGTTTGTCAGGTTGCCTTGTGAATTATGGTGGGGATCATTTTTGGGATTATTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGATGTTTGGGAACACGCAT 'Solanum evolvulifolium Greenm.-LB183' GGACAAAGAGCTTAAGCGCCTGGTGGTTGAAACCACTTCAAATCAGGTGATTGATGCATGTTCTATTTATCCTATATTAATATATAGATATGTTCTATTTATCCTAAATTAATAGATAGCTGAGCATCATCTTCAACAAGTGAAGTTGATTCCTCCACTTTGTTGTCTTAACTCAGAGGTTATTAT---CCAATAAAGCGCAAAAAGAAAATGTGGAAGACTGCTAATTT-CTTGATCGCCTAGAAGTCTTAAAGCTGTAGATTAAATAATCTGACCTTTCATTCATTATTAGCTGCCACAATTGAGAGATGCATTTTTTATGTTAATTGATGTTGTCTTTGCACCAGCTGAG--------TTTTCCCCTT-AGGTTAATGAACTTCTTTGACCGGTCCTTTAGGATTATTT-GCATTTCCCCACCTACTTGGTCAGTCAGCATTCTGTAGTCTACACCATACCGTGCAGGCTTCAACTGTAGATAGGTCTTTATTTTTGTCTTTTTTGGCAATCCTTTTTT------ATATA--GGGGATTGC-------ATAA-GAAAGTTGGCATATGTTTCTGTAATTCTTGCTTGTCAGGTTGCCTTATGAATTATGAGAGGGATCATTTTTCGGATTATATTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCAT 'Solanum evolvulifolium Greenm.-LB2253' -----------TTAAGCGCCTGGTGGTTGAAACCACTTCA{AG}ATCAGGTGATTGATGCATGTTCTATTTATCCTATATTAATATATAGATATG{CT}TCTATTTATCCTA{AT}ATTAATAGATAGCTGAGCATCAT{CT}TTC{AC}ACAAGTGAAG{GT}TGATTCCTCCACTTTGTTGTCTTAACTCAGAGGTTATTAT---CCAATAAAGCGCAAAAAGAAAATG{GT}GGAAGACTGCTAATTT-CT?GATCGCCTA{AG}AAGTCTT{AT}AAGCTG{GT}AGATTAAA{AT}AAT{CG}TG{AC}CCTT-CATTCATTATTAGCTGCCACAATTGAGAGATGCATTTTTTATGTTAATTGATGTTGTCTTTGCACCAGTTGAG--------TTTTCCCCTT-A{AG}GTTAATGAACTTCTTTGACC{AG}GTCCTTTAGGATTATTT-GCATTTCCCCACCTCCTTGGTCAGTCAGCATTCTGTAGTCTACACCATACCGTGCAGGCTTCAACTGTAGATAGGTCTTTATTTTTGTCTTTTTTGGCAATCCTTTTTT------ATATA--GGGGATTGC-------ATAA-GAAAGTTGGCATATGTTTCTGTAATTGTTGCTTGTCAGGTTGCCTTATGAATTATGAGAGGGATCATTTTTCGGATTATTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGC-- 'Solanum evolvulifolium Greenm.-LB2415' ---------------------------------CACTTCAAATCAGGTGATTGATGCATGCTCTATTTATCCTATATTAATAGATAG--------------------------------CTGAGCATCATCTTCAACAAGTGAAGTTGATTCCTCCACTTTGTTGTCTTAACTCAGAGGTTATTAT---CCAATAAAACGCAAAAAGAAAATGTGGAAGACTGCTAATTT-CTTGATCGCCTAGAAGTCTTAAAGCTGTAGATTAAATAATCTGACCTT-CATTCATTATTAGCTGCCACAATTGAGAGATGCATTTTTTATGTTAATTGATGTTGTCTTTGCACCAGTTGAG--------TTTTCCCCTT-AGGTTAATGAACTTCTTTGACCAGTCCTTTAGGATTATTT-GCATTTCCC-ACCTCCTTGGTCAGTCAGCATTCTGTAGTCTACACCATACCGTGCAGGCTTCAACTGTAGATAGGTCTTTATTTTTGTCTTTTTTGGCAATCCTTTTTT------ATATA--GGGGATTGC-------ATAA-GAAAGTTGGCATATGTTTCTGTAATTGTTGCTTGTCAGGTTGCCTTATGAATTATGAGAGGGATCATTTTTCGGATTATTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGT---------------------- 'Solanum evolvulifolium Greenm.-LB2520' ----------------------------------------AATCAGGTGATTGATGCATGCTCTATTTATCCTATATTAATATATAGATATGTTCTATTTATCCTAAATTAATAGATAGCTGAGCATCATCTTCAACAAGTGAAGTTGATTCCTCCACTTTGTTGTCTTAACTCAGAGGTTATTAT---CCAATAAAGCGCAAAAAGAAAATGTGGAAGACTGCTAATTT-CTTGATCGCCTAGAAGTCTTAAAGCTGTAGATTAAATAATCTGACCTT-CATTCATTA{CT}TAGCTGCCACAATTGAGAGATGCATTTTTTATGTTAATTGATGTTGTCTTTGCACCAGTTGAG--------TTTTCCCCTT-AGGTTAATGAACTTCTTTGACCAGTCCTTTAGGATTATTT-GCATTTCCC-ACCTCCTTGGTCAGTCAGCATTCTGTAGTCTACACCATACCGTGCAGGCTTCAACTGTAGATAGGTCTTTATTTTTGTCTTTTTTGGCAATCCTTTTTT------ATATA--GGGGATTGC-------ATAA-GAAAGTTGGCATATGTTTCTGTAATTGTTGCTTGTCAGGTTGCCTTATGAATTATGAGAGGGATCATTTTTCGGATTATTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCAT 'Solanum evolvulifolium Greenm.-LB709' GGACAAAGAGCTTAAGCGCCTGGTGGTTGAAACCACTTCAAATCAGGTGATTGATGCATGTTCTATTTATCCTATATTAATATATAGATATGTTCTATTTATCCTAAATTAATAGATAGCTGAGCATCATCTTCAACAAGTGAAGTTGATTCCTCCACTTTGTTGTCTTAACTCAGAGGTTATTAT---CCAATAAAGCGCAAAAAGAAAATGTGGAAGACTGCTAATTT-CTTGATCGCCTAGAAGTCTTAAAGCTGTAGATTAAATAATCTGACCTTTCATTCATTATTAGCTGCCACAATTGAGAGATGCATTTTTTATGTTAATTGATGTTGTCTTTGCACCAGCTGAG--------TTTTCCCCTT-AGGTTAATGAACTTCTTTGACCGGTCCTTTAGGATTATTT-GCATTTCCCCACCTACTTGGTCAGTCAGCATTCTGTAGTCTACACCATACCGTGCAGGCTTCAACTGTAGATAGGTCTTTATTTTTGTCTTTTTTGGCAATCCTTTTTT------ATATA--GGGGATTGC-------ATAA-GAAAGTTGGCATATGTTTCTGTAATTCTTGCTTGTCAGGTTGCCTTATGAATTATGAGAGGGATCATTTTTCGGATTATATTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCAT 'Solanum limoncochaense Tepe-LB2391' GGACAAAGAGCTTAAGCGCCTGGTGGTTGAAACCACTGCAAATCAGGTGATTGATGC--------------------------------ATGTTCTATTTATCCTAAATTAATAGATAGCTGAGCATCATCTTCAACAAGTGAAGTTGATTCCTACACTTTGTTGCCTTTACTCGGGGGTTATTAT---CCAATAAAGCGCGAAAAGAAAATGTGGAAGACTACTAATTT-CTTGATTGCCTAGAAGTCTTAAAGCTGTAGACTAGATAATCTGACCTTT-ATTCATTATTAGCTGCCATAATTGAGAGATGTATTTTTTATGTTAATTGATGTTTTCTTAGCACCAGCTGAG--------TTATCCTCTTTAGGTTAATGAACTTCTTTGACCGGTCCTT-AGGATTATTT-GCATTTTCCCACCTCCTTGGTCTGGCAGCATTCTGCAGTCTACACCATACGGCCCAGGCTTCAACTGTAGATAGGTCTTTATGTTTGTCTTTTTTGGCAATCCTTTTTT------ATATA--GGGGATTGC-------ATAA-GAAAGTTGGCATATGTTTCTGTAATTGTTGCTTGTCAGGT------ATGAATTATGAGAGGGATCATTTTTGGGATTATTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCAT 'Solanum limoncochaense Tepe-LB2466' GGACAAAGAGCTTAAGCGCCTGGTGGTTGAAACCACTGCAAATCAGGTGATTGATGC--------------------------------ATGTTCTATTTATCCTAAATTAATAGATAGCTGAGCATCATCTTCAACAAGTGAAGTTGATTCCTACACTTTGTTGCCTTTACTCGGGGGTTATTAT---CCAATAAAGCGCGAAAAGAAAATGTGGAAGACTACTAATTT-CTTGATTGCCTAGAAGTCTTAAAGCTGTAGACTAGATAATCTGACCTTT-ATTCATTATTAGCTGCCATAATTGAGAGATGTATTTTTTATGTTAATTGATGTTTTCTTAGCACCAGCTGAG--------TTATCCTCTTTAGGTTAATGAACTTCTTTGACCGGTCCTT-AGGATTATTT-GCATTTTCCCACCTCCTTGGTCTGGCAGCATTCTGCAGTCTACACCATACGGCCCAGGCTTCAACTGTAGATAGGTCTTTATGTTTGTCTTTTTTGGCAATCCTTTTTT------ATATA--GGGGATTGC-------ATAA-GAAAGTTGGCATATGTTTCTGTAATTGTTGCTTGTCAGGT------ATGAATTATGAGAGGGATCATTTTTGGGATTATTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCAT 'Solanum loxophyllum Bitter-LB2396' GGACAAAGAGCTTAAGCGCCTGGTGGTTGAAACCACTTCAAATCAGGTGATTGATGCATGTTCTATTTATCCTATATTAATATATAGATATGTTCTATTTATCCTAAATTAATAGATAGCTGAGCATCATCTTCAACAAGTGAAGTTGATTCCTCCACTTTGTTGTCTTAACTCAGAGGTTATTAT---CCAATAAAGCGCAAAAAGAAAATGTGGAAGACTGCTAATTT-CTTGATCGGCTAGAAGTCTTAAAGCTGTAGATTAAATAATCTGACCTTTCATTCATTATTAGCTGCCACAATTGAGAGATGCATTTTTTATGTTGATTGATGTTGTCTTTGCACCAGTTGAG--------TTTTCCCCTT-AGGTTAATGAACTTCTTTAACCAGTCCTTTAGGATTATTT-GCATTTCCCCACCTCCTTGGTCAGTCAGCAT-CTGTAGTCTACACCATACCGTGCAGGCTTCAACTGTAGATAGGTCTTTATTTTTGTCTTTTTTGGCAATCCTTTTTT------ATATA--GGGGATTGC-------ATAA-GAAAGTTGGCATATGTTTCTGTAATTGTTGCTTGTCAGGTTGCCTTATGAATTATGAGAGGGATCATTTTTCGGATTATTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCAT 'Solanum loxophyllum Bitter-LB2521' GGACAAAGAGCTTAAGCGCCTGGTGGTTGAAACCACTTCAAATCAGGTGATTGATGCATGTTCTATTTATCCTATATTAATATATAGATATGTTCTATTTATCCTAAATTAATAGATAGCTGAGCATCATCTTCAACAAGTGAAGTTGATTCCTCCACTTTGTTGTCTTAACTCAGAGGTTATTAT---CCAATAAAGCGCAAAAAGAAAATGTGGAAGACTGCTAATTT-CTTGATCGGCTAGAAGTCTTAAAGCTGTAGATTAAATAATCTGACCTTTCATTCATTATTAGCTGCCACAATTGAGAGATGCATTTTTTATGTTGATTGATGTTGTCTTTGCACCAG-TGAG--------TTTTCCCCTT-AGGTTAATGAACTTCTTTAACCAGTCCTTTAGGATTATTT-GCATTTCCCCACCTCCTTGGTCAGTCAGCAT-CTGTAGTCTACACCATACCGTGCAGGCTTCAACTGTAGATAGGTCTTTATTTTTGTCTTTTTTGGCAATCCTTTTTT------ATATA--GGGGATTGC-------ATAA-GAAAGTTGGCATATGTTTCTGTAATTGTTGCTTGTCAGGTTGCCTTATGAATTATGAGAGGGATCATTTTTCGGATTATTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCAT 'Solanum lycopersicum L.-RGO340' GGACAAAGAGCTTAAGCGCCTGGTGGTTGAAACCACTGCAAATCAGGTGATTGATGC--------------------------------ATGTTCTGTTTATCCTAAATTAATAGATAGCTGAGCATCATCTTCAACAAGTGAAGCTGATGCCTCCACTTTGTTGCCTTGACTTAGAGGTTAATATTACCCAAGAAAGTGTGAAAACAAAATACATAAAACTGCTAAATT-CTTGATTGCTTACAAGTCTTAGAGCTGTAGACTAAATAATCTGAC-TTCCATTTATTATTAGCTGCCATAATTGATAGATGTATTTTTTATGTTAATTGATGCTGTCTTTGCTCGGTCTGAGACTCTGAGTTTTCCTCTTT-GGTTAATGAACTTCTCTAACCGGTCCTTTAGGATTATTT-GCATTTCCCGACCTCCTTGGTCTGTCAGTATTCTGCAGTCTACATCATACTGTCC-GGCTTTAACTGTAGATGGGTCTTATTTTTTATCTTTTTTGACAATCCTTTTT-------ATAC--AGAGGAATGT-------ATAA-GAATGTTGGCATATGCTTTCGCAATAGTTGCTTGTCAGGTTGTCTTATGAATTATGATAGGGCTCATTTTTGGGATTATTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCAT 'Solanum pacificum Tepe-LB2395' GGACAAAGAGCTTAAGCGCCTGGTGGTTGAAACCACTTCAAATCAGGTGATTGATGCATGCTCTATTTATCCTATATTAATATACAGATATGTTCTATTTATCCTAAATTAATAGATAGCTGAGCATCATCTTCAACAAGTGAAGTTGATTCCTCCACTTTGTTGTCTTAACTCAGAGGTTATTAT---CCAATAAAGCGCAAAAAGAAAATGTGGAAGACTGCTAATTT-CTTGATCGCCTAGAAGTCTTAAAGCTGTAGATTAAATAATCTGACCTTTCATTCATTATTAGCTGCCACAATTGAGAGATGCATTTTTTATGTTAATTGATGTTGTCTTTGCACCAGCTGAG--------TTTTCCCCTT-AGGTTAATGAACTTCTTTGACCAGTCCTTTAGGATTATTTTGCATTTCCCCACCTCCTTGGTCAGTCAGCATTCTGTAGTCTACACCATACCGTGCAGGCTTCAACTGTAGATAGGTCTTTATTTTTGTCTTTTTTGGCAATCTTTTTTT------ATATA--GGGGATTGC-------ATAA-GAAAGTTGGCATATGTTTCTGTAATTGTTGCTTGTCAGGTTGCCTTATGAATTATGAGAGGGATCATTTTTGGGATTGTTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCAT 'Solanum pentaphyllum Bitter-LB2515' GGACAAAGAGCTTAAGCGCCTGGTGGTTGAAACCACTTCAAATCAGGTGATTGATGCATGTTTTATTTATCCTATATTAATAAATAGATATGTTCTATTTATCCTAAATTAATAGATAGCTGAGCATCATCTTCAACAAGTGAAGTTGATTCCTCCACTTTGTTGCCTTAACTCAGAGGTTATTAT---CCAATACAGCGCTAAAAGAAAATGTGGAAGACTGCTAATTT-CTTGATCGCCTAGAAGTCTTAAAGCTGTAGATTAAATAATCTGACCTTTCATTCATTATTA---------------------------------------------------------------------------------GGTTAATGAACTTCTTTGACCGGTCCTTTAGGATTATTT-GCATTTCCCCACCTCCTTGGTCAGTCAGCATTCTGTAGTCTACACCATACCGTGCAGGCTTCAACTGTAGATAGGTCTTTATTTTTGTCTTTTTTGGCAATCCTTTTTT------ATATA--GGGGATTGC-------ATAA-GAAAGTTGGCATATGTTTCTGTAATTGTTGCTTGTCAGGTTGCCTTATGAATTATGAGAGGGATCATTTTTGGGATTATTTTGTTCTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCAT 'Solanum phaseoloides Pol.-LB1727' GGACAAAGAGCTTAAGCGCCTGATGGTTGAAACCACTTCAAATCAGGTGATTGATGCATGTTTTATTTATCCTATATTAATAAATAGATATGTTCTATTTATCCTAAATTAATAGATAGCTGAGCATCATCTTCAACAAGTGAAGTTGATTCCTCCACTTTGTTGCGTTAACTCAGAGGTTATTAT---CCAATACAGCGCAAAAAGAAAATGTGGAAGACTGCTAATTT-CTTGATCGCCTAGAAGTCTTAAAGCTGTAGATTAAATAATCTGACCTTTCATTCATTATTAGCTGCCACAATTGAGAGATGCATTTTTTATGTTAATTGATGTTGTCTTTGCACCAGCTGAG--------TTTTCCCCTT-AGGTTAATGAACTTCTTTGACCGGTCCTTTAGGATTATTT-GCATTTCCCCACCTCCTTGGTCAGTCAGCATTCTGTAGTCTACACCATACCGTGCAGGCTTCAACTGTAGATAGGTCTT-ATTTTTGTCTTTTTTGGCAATCCTTTTTT------ATATA--GGGGATTGC-------ATAA-GAAAGTTGGCATATGTTTCTGTAATTGTTGCTTGTCAGGTTGCCTTATGAATTATGAGAGGGATCATTTTTGAGATTATTTTGTTCTTGCCAGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCAT 'Solanum phaseoloides Pol.-LB693' ----------------------------------ACTGCAAATCAGGTGATTGATGCATGTTTTATTTATCCTAAATTAATAGATAGAT--------------------------------GGGTGTCATCTTCAACAAGTGAAGTTGATTCCTACACTATTTTGCCTCAACTTGGAGGCTATTATTATCCAATAAATTGCAAAAAGAAAGTGTGGAAGATTGCTAATTT-CTTGATTGCCTAGAAATCT--------------AAATAATCCAACCTTTCTTTCATTTTTAGCTGCTACAATTGAGCGATC--TTTTTTATCTTAATTGATTTTGTCTTTGCACCAGCTGAG--------TTTTCCTCTT-AGGTTAAGGAACTTGTTTGACCTGTCCTT-GGGATTATTT-GCATTTCCCCACCTCCCCGGTCTGTCAGCATTCTGCCATCTACACCATATGGCCCAGGCTTCATCTGTAGATAGGTCCTTATTTTTGTCTCTTTTGGCAATC---TTTT------ATATA--AAGGATTGC-------ATAAAGAAAGTTGATGTGTATTTCCGTAATTGTTGCTTGTCAGGTTGCCTAATGAATTATGATAGGGATCATTTTTGGGATTATTTTGTTTTTGC-AGGACCCTTTGGTTTCTAAAGGAGCAAATT--------------------------------------- 'Solanum trifolium Dunal-LB2368' GGACAAAGAGCTTAAGCGTCTGGTGGTTGAAACCACTGCAAATCAGGTGATTGATGCATGTTCTATTTATCCTATATTACTAGATAGATATGTTCTGTTTATCCTAAATTAATAGATAGCTGAGCGTCATCTTCAACGAGTGAAGTTGATTCCTACACTTTGCTGCCTTAACTCGGAGGTTATTAT---CCAATAAAGCGCGAAAAGAAAATGTGGAAGACCGCTAATTTTCTTGAT-GCCTAGAAGTCTTAAAGCTGTAGGCTAAATAATCTGACCTTTCATTCATTATTAGCTGCCACAATAGAGAGA----TTTTTTATGTTAGTTGATGTTGTCTTTGCACCAGTTGAG--------TTTTCCTCTT-AGGTTAATGAACTTCTTTGACTGGTCCTT-CGGATTATAT-GCATT-CCCAACCTCCTTCGTGTGTCAGCATTCTGCAGTCTACACCATACGGCCCAGGCTTCAACTGTAGATAGGTCTTTATTTTTGTC---TTTGGGAATCC-TTTTT------ATATA--GGGGGTTGC-------ATAA-GAAAGTTGGCATATGTTTCCGTAATTGTTGCTTGTCAGCTGGCCTTATGAATTATGATAGGGATCATTTTTGGGATT-TTTTTTTCTTGC-AGGACCCTTTGGTTTCTAGAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCAT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7414] TITLE 'Herpystichum-cos11'; LINK TAXA = Taxa9; DIMENSIONS NCHAR=697; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Solanum anceps Ruiz & Pav.-LB2408' CCCTTATCTGCAACACATCTTCAATCTCCAAGAACAATTCCCTCTCTTTTCCCA{CT}TTCAACATCTTTTCCAAAGGTACACTGAACTCCCTTTTCTTTTCTTGAAA-TTTTTCTGTAACCAAACATGGGGTTTCCTGAAGTTTACATTTTT-GGTCTTTTTAGAGTAGGAATTGGAATGGGTTTTGTTTCTTTCCCCACCCCTGCATCTTTTCTTGAAATTTT---CTTAGTAGCCAAACATGGGGTTT--------------------------------------------------------------------------------------------------TGCTGAAGTTTTCTCCTTTT-GAGCTGGAATTGAATT{GT}GGG-TTGCTGAATTTTCAATTTTTCTGAGTTTTTTGAGTTGGGGTTGCTGAATTTTCAATTTTTTGGACTTTCTT-GAGTTGGAATTAAATTGG{AG}TTTTGCTGAATTTTCCATTTTTTCTGAC------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTGAACTGAAATGAGTTTTGTGTAGAATGGAGGTTTGATTATAAAGTGTGTGCGTGTGGGAGGAGTGGAAGTTCCAA 'Solanum anceps Ruiz & Pav.-LB654' CCCTTATCTGCAACACATCTTCAATCTCCAAGAACAATTCCCTCTCTTTTCCCACTTCAACATCTTTTCCAAAGGTACACTGAACTCCCTTTTCTTTTCTTGAAA-TTTTTCTGT{AT}ACCAAACATGGGGTTTCCTGAAGTTTACATTTTT-GGTCTTTTTAGAGTAGGAAT{CT}GGAATGGGTTTTGTTTCTTTCCCCACCCCTGCATCTTTTCTTGAAATTTT---CT{CT}AGTA{AG}CCAAACATGG{GT}GTTT--------------------------------------------------------------------------------------------------T{AG}CTGAAGTTTTCTCCTTTT-GAGCTGGAATTGAATTGGGG-TTGCTGAATTTTCAATTTTTCTGAGTTTTTTGAGTTGGGGTTGCTGAATTTTCAA{AT}TTTTTGGACTTTCTT-GAGTTGGAATTAAATTGGGTTTTGCTGAATTTTCCATTTTTTCTGAC------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTGAACTGAAATGAGTTTTGTGTAGAATGGAGGTTTGATTATAAAGTGTGTGCGTGTGGGAGGAGTGGAAGTTCCAA 'Solanum brevifolium Dunal-LB1029' CCCTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCCCTCTCTTTTCCCACTTCTACATCTTTTCCAAAGGTACACTGAACTCCCTTCTCTTTTCTTGTAA-TTTTGCAGTAATTAAACATGGGGTTTGCTAAAGTTTATTTTTTTTGAGCTTTTTAGAGTAGGAATTGGAATGGGTTTTGTTTCTTTCCTCACCCCTGCATCTTTTCTTGAAATTTT---GTCAGTTACCAAACATGGGGTTT-------------------------------------------------------------------------------------------------TTGCTAAAGTTTTCTCTTTTT-GAGCTGGTATTGAAATGGGG-TTGCTGAATTTTCA---------------------------------------CAAAAAAATGACTTTTTTTGAGATGGAATTGAATTGGGGTT-GCTGAATTTTCAGTTTTT-TGGACTTTGTTGAGTTGGAACTGAATTGGGGTTGCTAAATTTTCAATTTTT-GGACTTTGTTGAGTTGGAATTGAATTGGGTTTACTG-AATTTTCATTTCTCTGATTG-TTTTGAGTTTGAACTGAAATGAGTTTTGTGTAGATTGGAGGTTTGATTATAAAGTGTGTGCGTGTGGGAGGAGTGGAAGTTCCAA 'Solanum bulbocastanum Dunal-Spooner4' CCCTTATCTGCAACACATCTTCCATCTCCAAGCACAGTTCCCTCTCTTTTTCCACTCCCACATCTTATCCAAAGGTACACTTCACTCTCTTCTCTTTTCTTGAAATTTTTGCAGTAACCAAACATGGAGTTTACTGAAGTTTACATTTTTTGACCTTTTTCGAGTAGGAATTGGAATGGGGTTTG--------------------TCTTTTCTTGCAATTTT---CTCAGTAACCAAACATGGGATTTGCTAAAGATTACATTTTTTTTAACCTTTTTCGAGTAGGAATTGGAATGAGTTTTGTCTTTTCTTGAAGTTCTCTCAGTAACCCAACATGGGG--TTTTTGCTAAAATTTTCGCTTTTT-GAGCGGAAATTGAATTGGGG-TAGCTTAATTTTC----------------------------------------ATATTTTTGGACTTTCTT-GAGTTGTCATTGAATTTAGTTT-GCTGAATTTTCCATTTTT-CCGATTG---------------------------------------------------------------------------------------------------------TTGAGTTTGAACTGAAATGAGTTTAGTGTAGACTGGAGGTTTGGTTATAAAGTGTGTGCGTGTGGGAGGAGTGGAAGTTCCAA 'Solanum caripense Dunal-LB1026' CCCTTATCTGCAACACATCTTCCATCTCCAAGCACAATTCCCTTTCTTTTCCCACTTCCACATCTTTGCCAAAGGTACACTGAACTCCCTTCTGTTTTCTTGAAA-TTTTGCAGTAACCAAACATGGAGTTTGCTAAAGTTTACATTTTTTGGTCTTTTTAGAGTAGGAATTAGAATGGGTATTTTTTCTTTCCCCACCCCTGCATCTTTTCTTGAAATTATTTTCTCAGTAACCAAACATGGGGTTT-------------------------------------------------------------------------------------------------TTGCTAAAGTTCTCTCTTTTT-GAGCTGGTATTGAAATGGAG-TTGCTGAATTTTTT---------------------------------------TAAAAAAATGACTTTTTT-GAGTTGGAATTGAATTGGGGTT-GCTTAATTTTCATATTTT-TGGACTTTCTTGAGTTGGAATTGAATTTGGTTTGCTGAATTTTCCATTT----------------------------------------------------TCTGATTG-TTTTGTGTTTGAACTGAAATGAGTTTTGTGTAGATTGGAGGTTTGGTTATAAAGTGTGTGCGTGTGGGAGGAGTGGAAGTTCCAA 'Solanum crassinervium Tepe-LB2397' CCCTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCCCTCTCTTTTCCCACTTCCACATCTTTTCCAAAGGTACACTTCGTTCCCTTCTCTTTTCTTGAAA-CTTCGCAGTAAACAAACATGGGGTTTGCTAAATTTCACATTTTATGACCTTTTCAGAGTAGGGATTGGAATGGGTTTTGTTTCTTTCCCCACCCC-GCATCTTTTCTTGAAATTTT---CTTAGTAGCCAAACATGGGGTTT--------------------------------------------------------------------------------------------------TGCTGAAGTTTTCTATTTTT-GAGCTGGAATTGAAATGGGG-TTGCTGAATTTTCAATTTCTCTGAGTTTTTTCAGTTTGGGTTGCTGAATTTTCAAATTTTTGGATTTTCTT-GAGTTGGAATTGAATTGGGTTT-GCTGAATTTTCCATTTTT-CTGAT------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTGAACTGAAATGAGTTTTGTGTAGACTGGAGGTTTGATTATAAAGTGTGTTCGTGTGGGAGGAGTGGAAGTTCCAA 'Solanum dalibardiforme Bitter-LB2454' -CCTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCCCTCTCTTTTCCAACTTCCACATCTTTTCCAAAGGTACACTTCGTTCCCTT{AC}TCTTTTCTTAAAA-TTTCGCAGTAAACAAACATGGGGTTTGCTAAAGATTACATTTTTTGACCTTTTTCGAGTAGGAATTGGAATGGGTTTTGTTTCTTTCCCCACCCC-GCATCTTTTCTTGAAATTTT---CTCAGTAGCCAAACATGGGGTTT--------------------------------------------------------------------------------------------------TGCTGAAGTTTTCTATTTTT-GAGCTGGAATTGAAATGGAG-TTACTGAATTTTCAATGTCTCTGAGTTTTTTGAGTTGGGGTTGCTGAATTTTCAAATTTTTGGATTTTCTT-GAGTTGGAATTGAACTGGGTTT-GCTGAATTTTCCATTTTT-CCGAC------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTGAACTGAAATGAGTTTTGTGTAGACTGGAGGTTTGATTATAAAGTGTGTTCGTGTGGGAGGAGTGGAA------- 'Solanum evolvulifolium Greenm.-LB183' CCCTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCCCTCTCTTTTCCCACTTCCACATCTTTTCCAAAGGTACACTTCGTTCCCTTCTCTTTTCTTGAAA-CTTCGCAGTAAACAAACATGGGGTTTGCTAAAGTTCACATTTTTTGACCTTTTCAGAGTAGGGATTGGAATGGGTTTTGTTTCTTTCCCCACCCC-GCATCTTTTCTTGAAATTTT---CTCAGTAGCCAAACATGGGGTTT--------------------------------------------------------------------------------------------------TGCTGAAGTTTTCTATTTTT-GAGCTGGAATTGAAATGGGG-{CT}TGCTGAATTTTCAATTTCTCTGAGTTTTTTGAGTTTGGGTTGCTGAATTTTCAA{AT}TTTTTGGATTTTCTT-GAGTTGGAATTGAATTGGGTTT-GCTGAATTTTCCATTTTT-CTGAC------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTGAACTGAAATGA{AG}TTTTGTGTAGACTGGAGGTTTGATTATAAAGTGTGTTCGTGTGGGAGGAGTGGAAGTTCCAA 'Solanum evolvulifolium Greenm.-LB2253' CCCTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCCCTCTCTTTTCCCACTTCCACATCTTTTCCAAAGGTACACTTCGTTCCCTTCTCTTTTCTTGAAA-CTTCACAGTAAACAAACATGGGGTTTGCTAAAGTTCACATTTTTTGACCTTTTCAGAGTAGGGATTGGAATGGGTTTTGTTTCTTTCCCCACCCC-GCATCTTTTCTTGAAATTTT---CTCAGTAGCCAAACATGGGGTTT--------------------------------------------------------------------------------------------------TGCTGAAGTTTTCTATTTTT-GAGCTGGAATTGAAATGGGG-TTGCTGAATTTTCAATTTCTCTGAGTTTTTTGAGTTGGGGTTGCTGAATTTTCAAATTTTTGGATTTTCTT-GAGTTGGAATTGAATTGGGTTT-GCTGAATTTTCCATTTTT-CTGAC------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTGAACTGAAATGAGTTTTGTGTAGACTGGAGGTTTGATTATAAAGTGTGTTCGTGTGGGAGGAGTGGAAGTTCCAA 'Solanum evolvulifolium Greenm.-LB2415' CCCTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCCCTCTCTTTTCCCACTTCCACATCTTTTCCAAAGGTACACTTCGTTCCCTTCTCTTTTCTTGAAA-TTTCGCAGTAAACAAACATGGGGTTTGCTAAAGTTTACTTTTTTTGACCTTTTCA{CG}AGTAGGGATTGAAATGGGTTTTGTTTCTTTCCCCACGCC-GCATCTTTTCTTGAAATTTT---CTCAGTAACCAAACATGGGGTTT--------------------------------------------------------------------------------------------------TGCTGAAGTTTTCTATTTTT-GAGCTGTAATTGAAATGGGG-TTGCTGAATTTTCAATTTCTCTGAGTTTTTTGAGTTGGGGTTGCTGATTATTCAAATTTTTGGATTTTCTT-GAGTTGGAATTGAATTGGGTTT-GCTGAATTTTCCATTTTT-CTGAC------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTGAACTGAAATGATTTTTGTGTAGACTGGAGGTTTGATTATAAAGTGTGTTCGTGTGGGAGGAGTGGAAGTTCCAA 'Solanum evolvulifolium Greenm.-LB2520' CCCTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCCCTCTCTTTTCCCACTTCCACATCTTTTCCAAAGGTACACTTCGTTCCCTTCTCTTTTCTTGAAA-TTTCGCAGTAAACAAACATGGGGTTTGCTAAAGTTTACTTTTTTTGACCTTTTCAGAGTAGGGATTGAAATGGGTTTTGTTTCTTTCCCCACGC{CT}-GCATCTTTTCTTGAAATTTT---CTCAGTAACCAAACATGGGGTTT--------------------------------------------------------------------------------------------------TGCTGAAGTTTTCTATTTTT-GAGCTGTAATTGAAATGGGG-TTGCTGAATTTTCAATTTCTCTGAGTTTTTTGAGTTGGGGTTGCTGATTATTCAAATTTTTGGATTTTCTT-GAGTTGGAATTGAATTGGGTTT-GCTGAATTTTCCATTTTT-CTGAC------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTGAACTGAAATGATTTTTGTGTAGACTGGAGGTTTGATTATAAAGTGTGTTCGTGTGGGAGGAGTGGAA------- 'Solanum evolvulifolium Greenm.-LB709' CCCTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCCCTCTCTTTTCCCACTTCCACATCTTTTCCAAAGGTACACTTCGTTCCCTTCTCTTTTCTTGAAA-CTTCGCAGTAAACAAACATGGGGTTTGCTAAAGTTCACATTTTTTGACCTTTTCAGAGTAGGGATTGGAATGGGTTTTGTTTCTTTCCCCACCCC-GCATCTTTTCTTGAAATTTT---CTCAGTAGCCAAACATGGGGTTT--------------------------------------------------------------------------------------------------TGCTGAAGTTTTCTATTTTT-GAGCTGGAATTGAAATGGGG-TTGCTGAATTTTCAATTTCTCTGAGTTTTTTGAGTTTGGGTTGCTGAATTTTCAAATTTTTGGATTTTCTT-GAGTTGGAATTGAATTGGGTTT-GCTGAATTTTCCATTTTT-CTGAC------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTGAACTGAAATGAGTTTTGTGTAGACTGGAGGTTTGATTATAAAGTGTGTTCGTGTGGGAGGAGTGGAAGTTCCAA 'Solanum limoncochaense Tepe-LB2391' CCCTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCCCTCTCTTTTCCAACTCCCACATCTTTTCCAAAGGTACACTTCGTTCCCTTCTCTTTTGTTGAAA-TTTCCCAGTAAACAAACATGGGGTTTGCTAAATATTACATTTT--GACCTTTTTATAGTAGGAATTGGAATGGGTTTTGTTTCTTTCCCCACCCCTGCATCTTTTCTTGAAATTTT---CTCAGTAACCAAACATGGGGTTT--------------------------------------------------------------------------------------------------TGCTGAAGTTTTCTCTTTTT-GAGCTGGTATTGAAATGGGG-TTGCTGAATTTT--------------------------------------TTTTTAAAAATTGACTTTTTT-GAGTTGGAATTGAATTGGGGTT-GCTGAAATTTCAATTTT--CTGA-----------GTTTTTTGAGTTGGGGTTGCTGAATTTTCAATTTACTGGACTTTCTTGAGTTGGAATTGAATTGAGGTTGCTGCATTTTCCATTTTTCTGACTG-TTTTGAGTTTGAACTGAAATGAGTTTTGTGTAGACTGGAGGTTTGACTATAAAGTGTGTGCGTGTGGGAGGAGTGGAAGTTCCAA 'Solanum limoncochaense Tepe-LB2466' CCCTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCCCTCTCTTTTCCAACTCCCACATCTTTTCCAAAGGTACACTTCGTTCCCTTCTCTTTTGTTGAAA-TTTCCCAGTAAACAAACATGGGGTTTGCTAAATATTACATTTT--GACCTTTTTATAGTAGGAATTGGAATGGGTTTTGTTTCTTTCCCCACCCCTGCATCTTTTCTTGAAATTTT---CTCAGTAACCAAACATGGGGTTT--------------------------------------------------------------------------------------------------TGCTGAAGTTTTCTCTTTTT-GAGCTGGTATTGAAATGGGG-TTGCTGAATTTT--------------------------------------TTTTTAAAAATTGACTTTTTT-GAGTTGGAATTGAATTGGGGTT-GCTGAAATTTCAATTTT--CTGA-----------GTTTTTTGAGTTGGGGTTGCTGAATTTTCAATTTACTGGACTTTCTTGAGTTGGAATTGAATTGAGGTTGCTGCATTTTCCATTTTTCTGACTG-TTTTGAGTTTGAACTGAAATGAGTTTTGTGTAGACTGGAGGTTTGACTATAAAGTGTGTGCGTGTGGGAGGAGTGGAAGTTCCAA 'Solanum loxophyllum Bitter-LB2396' CCCTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCCCTCTCTTTTCCCACTTCCACATCTTTTCCAAAGGTACACTTCGTTCCCTTCTCTTTTCTTGAAA-TTTCGCAGTAAACAAACATGGGGTTTGCTAAAGTTTAATTTTTTTGACCTTTTCAGAGTAGGGATTGGAATGGGTTTTGTTTCTTTCCCCACGCC-GCATCTTTTCTTGAAATTTT---CTCAGTAGCCAAACATGGGGTTT--------------------------------------------------------------------------------------------------TGCTGAAGTTTTCTATTTTT-GAGCTGGAATTGAAATGGGG-TTGCTGAATTTTCAATTTCTCTGAGTTTTTTGAGTTGGGGTTGCTGAATATTCAAATTTTTGGATTTTCTT-GAGTTGGAATTGAATTGGGTTT-GCTGAATTTTCCATTTT--CTGAC------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTG-----AAATGAGTTTTGTGTAGACTGGAGGTTTGATTATAAAGTGTGTTCGTGTGGGAGGAGTGGAAGTTCCAA 'Solanum loxophyllum Bitter-LB2521' CCCTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCCCTCTCTTTTCCCACTTCCACATCTTTTCCAAAGGTACACTTCGTTCCCTTCTCTTTTCTTGAAA-TTTCGCAGTAAACAAACATGAGGTTTGCTAAAGTTCACATTTTTTGACCTTTTCAGAGTAGGGATTGGAATGGGTTTTGTTTCTTTCCCCACGCC-GCATCTTGTCTTGAAATTTT---CTCAGTAGCCAAACATGGGGTTT--------------------------------------------------------------------------------------------------TGCTGAAGTTTTCTATTTTT-GAGCTGGAATTGAAATGGGG-TTGCTGAATTTTCAATTTCTCTGAGTTTTTTGAGTTGGGGTTGCTGAATTTTCAAATTTTTGGATTTTCTT-GAGATGGAATTGAATTGGGTTT-GCTGAATTTTCCATTTTT-CTGAC------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTGAACTGAAATGAGTTTTGTGTAGACTGGAGGTTTGATTATAAAGTGTGTTCGTGTGGGAGGAGTGGAAGTTCCA- 'Solanum lycopersicon L.-RGO340' CCCTTATTTGCAACACATTTTCCAT{CT}TCCAAGCACAGTTCCCTCTCTTTTTCTACTCCCACATCTTTTCCAAAGGTACACTTCACTCCCTTCTCTT-----GAAA--TTTGCAGTAATCAAACATGGAGTTTGCTGAAGTTTACATTTTTTGACCTTTTTCGTGTAGGAATTGGAATGGGGTTTGTCTTT---------------TTTTTTCTCGCAATTTT---CTCAGTAACCAAACATGGGTTTTGCTAAAGATTACTTTTTTTTTTACCT-----GAGTAGGAATTGGAATGAGTTTTTGGATTTTTCGAAATTTTCTCAGTAACCCAACATGAGTTTTTTTTGCTAAAGTTTCCGTTTTTTTGAGGTGGGATTGAATTGAGGTTTGCTTATTTTTC----------------------------------------ATATTTTTGGACTTTTTT-GAGTTGGAATTAAATTGGGTTTTGCTAAATTTTCCAT-------GATT----------------------------------------------------------------------------------------------------------TTGAGTTTGAACTGAAATGAGTTTTGTGTAGACTGCAGGTTTG---------------------------------------- 'Solanum pacificum Tepe-LB2395' CCCTTATCTGCAACACATCTTCAATCTCCAAGAACAATTCCCTCTCTTTTCCCACTTCCACATCTTTTCCAAAGGTACACTTCGTTCCCTTCTCTTTTCTTGAAA-TTTCGCAGTAAACAAACATGGGGTTTGCTAAAGTTCACATTTTTTGACCTTTTCAGAGTAGGGATTGGAATGGGTTTTGTTTCTTTCCCCACCCT-GGATCTTTTCTTGAAATTTT---CTCAGTAGCCAAACATGGGATTT--------------------------------------------------------------------------------------------------TGCTGAAGTTTTCTATTTTT-GAGCTGGAATTGAAATGGGG-TTGCTGAATTTTCAATTTCTCTGAGTTTTTTGAGTTGGGGTTGCTGAATTTTCAAATTTTTGGATTTTCTT-GTGTTGGAATTGAATTGGGTTT-GCTGAATTTTCCATTTTG-CTGAC------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTGAACTGAAATGAGTTTTGTGTAGACTGGAGGTTTGATTATAAAGTGTGTTCGTGTGGGAGGAGTGGAAGTTCCAA 'Solanum pentaphyllum Bitter-LB2515' CCCTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCCCTCTCTTTTCCCACTTCCACATCTTTTCCAAAGGTACACTTCTTTCCCTTCTCTTTTCTTGAAA-TTTCGCAGTAAACAAACACGGGGTTTGCTAAATTTCACATTTTTTGACCTTTTCAGAGTAGGGATTGGAATGGGTTTTGTTTCTTTCCCCACCCC-GCGTCTTTTCTTGAAATTTT---CTCAGTAG-------------------------------------------------------------------------------------------------------------------------TTTTCTATTTTT-GAGCTGGAATTGAAATGGGG-TTGCTGAATTTTCAATGTCTCTGAGTTTTTTGAGTTGGGGTTGCTGAATTTTCAAATTTTTGGATTTTCTT-GAGTTGGAATTGAATTGGGTTT-GCTGAATTTTCCATTTTT-CTGAC------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTGAACTGAAATGAGTTTTGTGTAGACTGGAGGTTTGATTATAAAGTGTGTTCGTGTGGGAGGAGTGGAA------- 'Solanum phaseoloides Pol.-LB1727' --CTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCCCTCTCTTTTCCCACTTCCACATCTTTTCCAAAGGTACACTTCTTTCCTTTCTCTTTTCTTGAAA-TTTCGCAGTAAACAAATATGGGGTTTGCTATAGTTCACATTTTTTGACCTTTTCAGAGTAGGGATTGGAATGGGTTTTGTTTCTTTCCCCACCCC-GCATCTTTTCTTGAAATTTT---CTCAGTAGCCAAACATGGGGTTT--------------------------------------------------------------------------------------------------TGCTGAAGTTTTCTATTTTT-GAGCTGGAATTGAAATGGGG-TTCCTGAATTTTCAATGTCTCTGAGTTTTTTGAGTTGGGGTTGCTGAATTTTCTAATTTTTGGATTTTCTT-GAGTTGGAATTGAATTGGGTTT-GCTGAATTTTCCATTTTT-CTGAC------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTGAACTGAAATGAGTTTTGTGTAGACTGGAGGTTTGATTATAAAGTGTGTTCGTGTGGGAGGAGTGGAAGTTCCA- 'Solanum phaseoloides Pol.-LB693' CCCTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCCCTCTCTTTTCCCACTTCCACATCTTTTCCAAAGGTACACTTCTTTCCTTTCTCTTTTCTTGAAA-TTTCGCAGTAAACAAATATGGGGTTTGCTAAAGTTCACATTTTTTGACCTTTTCAGAGTAGGGATTGGAATGGGTTTTGTTTCTTTCCCCACCCC-GCATCTTTTCTTGAAATTTT---CTCAGTAGCCAAACATGGGGTTT--------------------------------------------------------------------------------------------------TGCTGAAGTTTTCTATTTTT-GAGCTGGAATTGAAATGGGG-TTCCTGAATTTTCAATGTCTCTGAGTTTTTTGAGTTGGGGTTGCTGAATTTTCAAATTTTTGGATTTTCTT-GAGTTGGAATTGAATTGGGTTT-GCTGAATTTTCCATTTTT-CTGAC------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTGAACTGAAATGAGTTTTGTGTAGACTGGAGGTTTGATTATAAAGTGTGTTCGTGTGGGAGGAGTGGAAGTTCCAA 'Solanum trifolium Dunal-LB2209' CCCTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCTCTCTCTTTTCCCACTTCCACATCTTTTCCAAAGGTACACTTCGTTCCCTTCTCTTTTCTTGAAA-TTTCGCAGTAAACAAACATGGGGTTTGCTAAAGATTACATTTTTTGACCTTTTTCGAGTAGGAATTGGAATGGGTTTTG--------------------TCTTTTTTTGAAATTTT---CTCAGTAACCAAACATGGGGGTT-------------------------------------------------------------------------------------------------TTGCTAAAGTTTTCGCTTTTT-GAGCTGGAATTGAATTGGGG-TTGCTTAATTTTCAATTTTTTGGACTTTCTTG-----------------------------------------AGTTGGAATTGAATTGGGTTT-GCTGAATTTTCCATTTTT-CTGTC------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTGAACTGAAATGAGTTTTGTGTAGAATGGAGGTTTGATTATAAAGTGTGTGCGTGTGGGAGGAGTGGAAGTTCCAA 'Solanum trifolium Dunal-LB2368' CCCTTATCTGCAACACATCTTCAATCTCCAAGCACAATTCTCTCTCTTTTCCCACTTCCACATCTTTTCCAAAGGTACACTTCGTTCCCTTCTCTTTTCTTGAAA-TTTCGCAGTAAACAAACATGGGGTTTGCTAAAGATTACATTTTTTGACCTTTTTCGAGTAGGAATTGGAATGGGTTTTG--------------------TCTTTTTTTGAAATTTT---CTCAGTAACCAAACATGGGGGTT-------------------------------------------------------------------------------------------------TTGCTAAAGTTTTCGCTTTTT-GAGCTGGAATTGAATTGGGG-TTGCTTAATTTTCAATTTTTTGGACTTTCTTG-----------------------------------------AGTTGGAATTGAATTGGGTTT-GCTGAATTTTCCATTTTT-CTGTC------------------------------------------------------------------------------------------------------TGTTTTTGAGTTTGAACTGAAATGAGTTTTGTGTAGAATGGAGGTTTGATTATAAAGTGTGTGCGTGTGGGAGGAGTGGAAGTTCCAA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7408] TITLE 'Herpystichum-cos5'; LINK TAXA = Taxa7; DIMENSIONS NCHAR=1030; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Solanum anceps Ruiz & Pav.-LB2408' GTAAGTTCTTTATCAGTACACGTTCATAGGTTCTTGAAATAAAGTT-CTGCAACATTCTTATTTGCCTGCGACATGCTACTGTGTTTATTAT---GTGTTTGTTAGATTATAGGCTCTTCCAGTTCCAGACCTCACTTCTGAGATT-CACTGGGTATGTTG---------------TTGTAGATAATAGGCTCTTGTTTCAACAAATTAATTAA-CTCCTGTCCAGAGACTTGGTTCTTGGGGTAAAATTTGCATTAGTTGTCAACTTAACCCGATGGTGTAAAATCTTTAGACGTTATTAGTACACAAAACTTAAA-CTTGAGGTTCAATATTTCCGAAGAACTATGAGGTAAAAGTTGATGAAAAAGAGCCAACAAAAATGTGTTTTCATTTTGTGTGTGTATATGATT-------ACCACATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTCCATCTGAATTGGATTCTTAAGTTAGAAATGTCCATATAAACAATAACACTAGGTGATTTCTTCTTTTCTGCCCAAGTCTGGGTGAACATAGTTACTCGGAAGCTGTGC-TGAGGAATTACAAATTGACCCGAACATCACGGCTATTTAAAAAAAA--G-TCCATCAAGCCAATTACTTATT-GATTTTTT-GTAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGCTATGTAATGTGTGGCACCTTCCAACTCTGTTATTGAATGTGATTTTGATTCACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGCGGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGCCAAAAAGGAAATCAAAGAATCTGCCAAAGCTGTTAGTCTTGATGCAAAACAGACTAGAGGACCTTGTCCTATACCAG 'Solanum anceps Ruiz & Pav.-LB654' GTAAGTTCTTTATCAGTACACGTTCATAGGTTCTTGAAATAAAGTT-CTGCGACATTCTTATTTGCCTGCGACATGCTACTGTGTTTATTAT---GTGTTTGTTAGATTATAGGCTCTTCCAGTTCCAGACCTCACTTCTGAGATT-CACTGGGTATGTTG---------------CTGTAGATAATAGGCTCTTGTTTCAACAAATTAATTAA-CTCCTGTCCAGAGACTTGGTTCTTGGGGTAAAATTTGCATTAGTTGTCAACTTAACCCGATGGTGTAAAATCTTTAGACGTTATTAGTACACAAAACTTAAA-CTCGAGGTTCAATATTTCCGAAGAACTATGAGGTAAAAGTTGATGAAAAAGAGCCAACAAAAATGTGTTTTCATTTTGTGTGTGTATATGATT-------ACCACATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTCCATCTGAATTGGATTCTTAAGTTAGAAATGTCCATATAAACAATAACACTAGGTGATTTCTTCTTTTCTGCCCAAGTCTGGGTGAACATAGTTACTCGGAAGCTGTGC-TGAGGAATTACAAATTGACCCGAACTTCACGGCTATTTAAGAAAAA--G-TCCATCAAGCCAATTACTTATT-GATTTTTT-GTAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGCTATGTAATGTGTGGTACCTTCCAACTCTGTTATTGAATGTGATTTTGATTCACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGCGGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGCCAAAAAGGAAATCAAAGAATCTGCCAAAGCTGTTAGTCTTGATGCAAAACAGACTAGAGGACCTTGTCCTATACCAG 'Solanum bulbocastanum Dunal-Spooner4' GTAAGTTCTTTATCAGCACACAGTCATAGGTTCTTCAAATAAAATT-CTGCAACAATCTTATTTGCCTGCAACATGCTATTGTATTTATTAT---GTGTT-GTTAGATAATAGGTTTTTCCACTT-GTGA----------GCTT--ACACTGGATATGTTGTTGT----------------------------------CAACAAATTAGCTGATCCCCTGTCCAGAGACTGGGTTATTGCGGTAAAATTTGCATTAGTTGTCAACTTAATCTGATGGTGTAAAACATCTAGACGTTATTAGTGCACACAAGTTAAA-CTCGAGGTTCAATATTTCCTAGGAACTATGAGGTAAAAGTTGATGAAAAAGAGCTAACAAAAATGTGTTTTCATT--GTGTGTGTATGACG---------ACCACATAAAATAAGCTGACTTTGTTTGCAAGCTATTGCACAGGAGTGGGATTTTACCCCGTGCGCACCCAAAGGGTAGCGACTGCTGGTTTCCCTTGTCATCAAAAAACAAAAGTAAGCTGACAATTCATCTGAATTGTATTCTTAAGCTAGAAATTTCCATATAAACAATAACACTAGGTGATTTCTTCTTGTCTATCCAAGTCTGAGTGGAAATAGGTGCTCGGCAGCTATGC-TGAGGAATTACAAATTGACTTGGACATCATGGTTATTTAAGAAAAA--G-TTTATCAAGCCAATTACTTATT-GATTTTTT-GTAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGCTATGTTATGTGTAGCACCTTCCTACTCTGTTATTGAAAGGGATTTTGATTTTCTTT----CCAGAAAGAATCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGGGGAGTGAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGCCAAAAAGGAAAGCAAAGAATCAGCCAAAGCTGTTAATCTTGATGCACAACGGGCAAGAGGACCTTGTCCTATACCAG 'Solanum caripense Dunal-LB1026' GTAAGTTCTTTATCAGTA-AC----------------AATAAAATT-CTGCAACATTCTTATTTGCCTGCGACATGCTACTGTATTTATTAT---GTGTT-GTTAGATAATAGGTTTTTCCAGTTTCAGAC---------GAGT--ACACTGGATATGTTGTTGT----------------------------------CAACAAATTAACCAA-CCCTTGTCCAGAGACTGGGTTCTTGGGGTAAAATTTGCATTAGTTGTCAGCTTAACCCAATTGTGTAAAATATCTAGACGTTATTAGTACAGAAAACTTAAAACTCGAGGTTCAATATTTCCTAGGAACTATGAGGTAAAAGTTGATGAAAAAGAGCTAACAAGAATGTGTTTTCATT--GTGTGTGTATATGATG-------CCCACATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AA----GTTAGAAATGTATTCTTAAGTTAGAAATGTCCATGTAAACAATAACACTAGGTGATTTCTTCTTGTCTACCCAAGTCTGGGTGGACATAGTTAATCAGCAGCTCTGC-TGAGGAATTACAAATTGACCTGGACATCACGGTTATTAAAGAGAAA--G-TTCATTAAGCCAATTACTTATT-GATTTTTT-TCAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGTTATGTAATATGTGGCACCTTCCAACTCTGTTATTGAATGTGATTTTGATTCACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGGGGTGTAAGAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGCCAAAAAGGAAAGCAAAGAATCAGCCAAAGCTGTTAATCTTGATGCACAACGGGCAAGAGGACCTTGTCCTGTACCAG 'Solanum crassinervium Tepe-LB2397' GTAAGTTCTTTATCACTTCACATTCATAGGTTCTTGAAATAGAGTT-CTGCAACATTCTTATTTGCCTGCGACATGCTACTGTGTTTATTAT---GTGTTTGTTAGATTATAGGCTCTTCCAGTTCCAGACCTCACTTCTGAGATT-CACTGGTTATGTTGTTGTAG---------------ATAATAGGCTCTTGTTTCAACAAATTAATTAA-CTCCTGTCCAGAGACTTGGTTCTTGGGGTAAAATTTGCATTAGTTGTCAGCTTAACCCGATGGTGTAAAATCTTTAGACGTTATTAGTACACAAAACTTAAA-CTCGAGGTTCAATATTTCCGAAGAACTATGAGGTAAAAGTTGATGAAAAAGAGCTAACAAAAATGTGTTTTCATTTTGTGTGTGTATATGATTGCCATTTACCACATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTCCATCTGAATTGGATTCTTAAGTTAGAAATGTCCATATAAACAATAACACTGGGTGATTTCTTCCTGTCTGCCCAAGTCTGGGTGGACATAGTTACTCGGCAGCTGTGC-TGAGGAATTACAAATTGACCCGAACATCACAGCTATTTGAAAAAAA--G-TCCATCAAGCCAATTACTTATT-GATTTTTTTGTAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGCTATGTAATGTGTGGCACCTTCCAATTTTGTTATTGAATGTGATTTTGATTCACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGCGGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGCCAAAAAGGAAATCAAAGAATCTGCCAAAGCTGTTAATCTTGATGCAAAAGAGGCAAGAGGACCTTTTTCTATACCAG 'Solanum dalibardiforme Bitter-LB2454' ----------------------------GTTCCTTGAAATAAAGTT-CTGCAACATTCTTATTTGCCTGCGACATGCTACTGTGTTTATTAT---GTGTTTGTTAGATTATAGGCTCTTCCAGTTCCAGACCTCACTTTTGAGATT-CACTGGGTATGTTGTTATAGGGTATGTTGTTGTAGATAATAGGCTCTTGTTTCAACAAATTAATTAA-CTCCTGTCCAGAGACTTGGTTCTTGGGGTAAAATTTGCATTAGATGTCAACTTAACCCGATGGTGTAAAATCTTTAGATGTTATTAGTACACAAAACTTAAA-CTCGAGGTTCAATATTTCTGAAGAACTATGAGGTAAAAGTTGATGAAAAAGAGCTAACAAAAATGTGTTTTCATTTTGTGTGT--ATATGATT-------ACCACATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTCCATCTGAATTGGATTCTTAAGTTAGAAATGTCCATATAAACAATAACCCTAGGTGATTTCTTCTTGTCTGCCCAAGTCTGGGTGGACATAGTTACTCGGCAGCTGTGC-TGAGGAATTACAAATTGACCTGAACATCACGGCTATTTAAAAAAAAA-GGTCCATCAAGCCAATTACTTACT-GATTTTTT-GTAAATTCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTGAGCTATGTAATGTGTGGCACCTTCCAACTCTGTTATTGAATGTGATTTTGAT-CACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTGGAGAGGCTAATACTTCAAGCAGGCGGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGATATGCACAAAGTCAAAAAGGAAATTAAAGAATCTGCCAAAGCTGTTAATCT-------------------------------------- 'Solanum evolvulifolium Greenm.-LB183' ---------------------------------------TAAAGTT-CTGCAACATTCTTATTTGCCTGCGACATGCTACTGTGTTTATTAT---GTGTTTGTTAGATTATAGGCTCTTCCAGTTCCAGCCCTCACTTCTGAGATT-CACTGGTTATGTTGTTGTAGGGTATGTTGTTGTAGATAATAGGCTCTTGTTTCAACAAATTAATTAA-CTCCTGTCCAGAGACTTGGTTCTTGGGGTAAAATTTGCATTAGTTGTCAGCTTAACCCGATGGTGTAAAATCTTTAGACGTTTTTAGTACACAAAACTTAAA-CTCGAGGTTCAATATTTCCGAAGAACTATGAGGTAAAAGTTGATGAAAAAGAGCTAACAAAAATGTGTTTTCATTTTGTGTGTGTAAATGATTGCCATTTACCACATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTCCATCTGAATTGGATTCTTAAGTTAGAAATGTCCATATAAACAATAACACTAGGTGATTTCTTCCTGTCTGCCCAAGTTTGGGTGGACATAGTTACTCGGCAGCTGTGC-TGAGGAATTACAAATTGACTCGAACATCACAACTATTTAAAAAAAA--G-TCCATCAAGCCAATTACTTATT-GATTTTTTTAAAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGCTATGTAATGTGTGGCTCCTTCCAATTTTGTTATTGAATGTGATTTTGATTCACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGCGGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTTAGACATGCACAAAGGCAAAAAGGAAATCAAAGAATCTGCCAAAGCTGTTAATC--------------------------------------- 'Solanum evolvulifolium Greenm.-LB2415' GTAAGTTCTTTATCACTTCACATTCAAAGGTTCTTGAAATAAAGTT-CTGCAACATTCTTATTTGCCTGCGACATGCTACTGTGTTTATTAT---GTGTTTGTTAGATTATAGGCTCTTCCAGTTCCAGACCTCACTTCTGAGATT-CACTGGTTATGTTGTTGTAG---------------ATAATAGGCTCTTGTTTCAACAAATTAATTAA-CTCCTGTCCAGAGACTTGGTTCTTGGGGTAAAATTTGCATTAGTTGTCAGCTTAACCCGATGGTGTAAAATCTTTAGACGTTATTAGTACACAAAACTTAAA-CTCGAGGTTCAATATTTCCGAAGAACTATGAGGTAAAAGTTGATGAAAAAGAGCTAACAAAAATGTGTTTTCATTTTGTGTGTGTATATGATTGCCATTTACCACATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTCCATCTGAATTGGATTCTTAAGTTAGAAATGTCCATATAAACAATAACACTAGGTGATTTCTTTCCGTCTGCCCAAGTCTGGGTGGACAGAGTTACTCGGCAGCTGTGC-TGAGGAATTACAAATTGACCCGAACATCACAACTATTTT{AT}AAAAAA--G-TCCATCAAGCCAATTACTTTTT-GATTTTTTTGTAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGCTATGTAATGTGTGGCACCTTCCAATTTTGTTATTGAATGTGATTTTGATTCACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGCGGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGCCAAAAAGGAAATCAAAGAATCTGCCAAAGCTGTTAATCTTGATGCAAAAGAGGCAAGAGGACCTTGTTCTATACCAG 'Solanum evolvulifolium Greenm.-LB2520' ---------------------------AGGTTCTTGAAATAAAGTT-CTGCAACATTCTTATTTGCCTGCGACATGCTACTGTGTTTATTAT---GTGTTTGTTAGATTATAGGCTCTTCCAGTTCCAGACCTCACTTCTGAGATT-CACTGGTTATGTTGTTGTAG---------------ATAATAGGCTCTTGTTTCAACAAATTAATTAA-CTCCTGTCCAGAGACTTGGTTCTTGGGGTAAAATTTGCATTAGTTGTCAGCTTAACCCGATGGTGTAAAATCTTTAGACGTTATTAGTACACAAAACTTAAA-CTCGAGGTTCAATATTTCCGAAGAACTATGAGGTAAAAGTTGATGAAAAAGAGCTAACAAAACTGTGTTTTCATTTTGTGTGTGTATATGATTGCCATTTACCACATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTCCATCTGAATTGGATTCTTAAGTTAGAAATGTCCATA--AACAATAACACTAGGTGATTTCTTTCCGTCTGCCCAAGTCTGGGTGGACAGAGTTACTCGGCAGCTGTGC-TGAGGAATTACAAATTGACCCGAACATCACAACTATTTTAAAAAAA--G-TCCATCAAGCCAATTACTTTTT-GATTTTTTTGTAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGCTATGTAATGTGTGGCACCTTCCAATTTTGTTATTGAATGTGATTTTGATTCACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGG{CT}GGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGCCAAAAAGGAAATCAAAGAATCTGCCAAAGCTGTTAATC--------------------------------------- 'Solanum evolvulifolium Greenm.-LB709' GTAAGTTCTTTATCACTTCACATTCATAGGTTCTTGAAATAAAGTT-CTGCAACATTCTTATTTGCCTGCGACATGCTACTGTGTTTATTAT---GTGTTTGTTAGATTATAGGCTCTTCCAGTTCCAGACCTCACTTCTGAGATT-CACTGGTTATGTTGTTGTAGGGTATGTTGTTGTAGATAATAGGCTCTTGTTTCAACAAATTAATTAA-CTCCTGTCCAGAGACTTGGTTCTTGGGGTAAAATTTGCATTAGTTGTCAGCTTAACCCGATGGTGTAAAATCTTTAGACGTTTTTAGTACACAAAACTTAAA-CTCGAGGTTCAATATTTCCGAAGAACTATGAGGTAAAAGTTGATGAAAAAGAGCTAACAAAAATGTGTTTTCATTTTGTGTGTGTAAATGATTGCCATTTACCACATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTCCATCTGAATTGGATTCTTAAGTTAGAAATGTCCATATAAACAATAACACTAGGTGATTTCTTCCTGTCTGCCCAAGTCTGGGTGGACATAGTTACTCGGCAGCTGTGC-TGAGGAATTACAAATTGACTCGAACATCACAACTATTTAAAAAAAA--G-TCCATCAAGCCAATTA{CT}TTATT-GATTTTTTTAAAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGCTATGTAATGTGTGGCACCTTCCAATTTTGTTATTGAATGTGATTTTGATTCACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGCGGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTTAGACATGCACAAAGGCAAAAAGGAAATCAAAGAATCTGCCAAAGCTGTTAATCTTGATGCAAAAGAGGCAACAGGACCTTGTTCTATACCAG 'Solanum limoncochaense Tepe-LB2391' GTAAGTTCTTTATCAGTACTCATTCATAGGTTCTTGAAATAAAGTT-CTGCAACATTCTTATTTGCCTGCGACATGCTACTGTGTTTATTACTACGTGTTTGTTAGATTATAGGCTCTTCCAGTTCCAGACATCACTTCTGCGATT-CACTGGGTATGTTGTTGTAGGGTATGCTGTTGTAGATAATAGGCTCTTGTTTCAACAGATTAATTAA-CTCCTGTCCATAGACTTGGTTCTTGGGGTAAAATTTGCCTTAGTTGTCAACTTAACCCGATGGTGTAAAATCTTTAGATGTTATTAGTACACAAAACTTAAA-CTGGAGGTTCAATATTTCCAAAGAACTATGAGGTAAAAGTTGATGAAAAAGAGCTAACAAAAATGTGTTTTCATTGTGTGTGTGTATATGATT-------ACCACATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTCCATCTGAATTGGATTCTTAAGTTAGAAATGTCCATATAAACAATAACACTAGGTGATTTCTTCTTGTCTGCCCAAGTCTGGGTGGACATAGTTACTCGGCAGCTGTGC-TGAGAAATTACAAATTGACCCGAACATCACGGCTATTTTAAAAAAA--G-TCCATCAAGCCAATTACTTATT-GATTTTTT-GTAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGCTATGTAATGTGTGGCACCTTCCAACTCTGTTATTGAATGTGATTTTGGTTCACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGCGGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCATAAAGCCAAAAAGGAAATCAAAGCGTCTGCCAAAGCTGTTAATCTTGATGCAAAACAGGC----------------------- 'Solanum limoncochaense Tepe-LB2466' GTAAGTTCTTTATCAGTACTCATTCATAGGTTCTTGAAATAAAGTT-CTGCAACATTCTTATTTGCCTGCGACATGCTACTGTGTTTATTACTACGTGTTTGTTAGATTATAGGCTCTTCCAGTTCCAGACATCACTTCTGCGATT-CACTGGGTATGTTGTTGTAGGGTATGCTGTTGTAGATAATAGGCTCTTGTTTCAACAGATTAATTAA-CTCCTGTCCATAGACTTGGTTCTTGGGGTAAAATTTGCCTTAGTTGTCAACTTAACCCGATGGTGTAAAATCTTTAGATGTTATTAGTACACAAAACTTAAA-CTGGAGGTTCAATATTTCCAAAGAACTATGAGGTAAAAGTTGATGAAAAAGAGCTAACAAAAATGTGTTTTCATTGTGTGTGTGTATATGATT-------ACCACATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTCCATCTGAATTGGATTCTTAAGTTAGAAATGTCCATATAAACAATAACACTAGGTGATTTCTTCTTGTCTGCCCAAGTCTGGGTGGACATAGTTACTCGGCAGCTGTGC-TGAGAAATTACAAATTGACCCGAACATCACGGCTATTTTAAAAAAA--G-TCCATCAAGCCAATTACTTATT-GATTTTTT-GTAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGCTATGTAATGTGTGGCACCTTCCAACTCTGTTATTGAATGTGATTTTGGTTCACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGCGGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCATAAAGCCAAAAAGGAAATCAAAGCGTCTGCCAAAGCTGTTAATCTTGATGCAAAACAGGCAAGAGGACCTTGTCCTATACCAG 'Solanum loxophyllum Bitter-LB2396' GTAAGTTCTTTATCACTTCACATTCATAGGTTCTTGAAATAGAGTT-CTGCAACATTCTTATTTGCCTGCGACATGCTACTGTGTTTATTAT---GTGTTTGTTAGATTATAGGCTCTTCCAGTTCCAGACCTCACTTCTGAGATT-CACTGGTTATGTTGTTGTAGGGTATGTTGTTGTAGATAATAGGCTCTTGTTTCAACAAATTAATTAA-CTCCTGTCCAGAGACTTGGTTCTTGGGGTAAAATTTGCATTAGTTGTCAGCTTAACCCGATGGTGTAAAATCTTTAGACGTTATTAGTACACAAAACTTAAA-CTCGAGGTTCAATATTTCCGAAGAACTATGAGGTAAAAGTTGATGAAAAAGAGCTAACAAAAATGTGTTTTCATTTTGTGTGTGTATATGATTGCCATTTACCACATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTCCATCTGAATTGGATTCTTAAGTTAGAAATGTCCATATAAACAATAACACTGGGTGATTTCTTCCTGTCTGCCCAAGTCTGGGTGGACATAGTTACTCGGCAGCTGTGC-TGAGGAATTACAAATTGACCCGAACATCACAGCTATTTAAAAAAAA--G-TCCATCAAGCCAATTACTTATT-GATTTTTTTGTAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGCTATGTAATGTGTGGCACCTTCCAATTTTGTTATTGAATGTGATTTTGATTCACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGCGGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGCCAAAAAGGAAATCAAAGAATCTGCCAAAGCTGTTAATCTTGATGCAAAAGAGGCAAGAGGACCTTTTTCTATACCAG 'Solanum loxophyllum Bitter-LB2521' ----------------------------------------------------ACATTCTTATTTGCCTGCGACATGCTACTGTGTTTATTAT---GTGTTTGTTAGATTATAGGCTCTTCCAGTTCCAGACCTCACTTCTGAGATT-CACTGGTTATGTTGTTGTAGGGTATGTTGTTGTAGATAATAGGCTCTTGTTTCAACAAATTAATTAA-CTCCTGTCCAGAGACTTGGTTCTTGGGGTAAAATTTGCATTAGTTGTCAGCTTAACCCGATGGTGTAAAATCTTTAGACGTTATTAGTACACAAAACTTAAA-CTCGAGGTTCAATATTTCCGAAGAACTATGAGGTAAAAGTTGATGAAAAAGAGCTAACAAAAATGTGTTTTCATTTTGTGTGTGTATATGATTGCCATTTACC{AG}CATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTCCATCTGAATTGGATTCTTAAGTTAGAAATGTCCATATAAACAATAACACTGGGTGATTTCTTCCTGTCTGCCCAAGTCTGGGTGGACATAGTTACTCGGCAGCTGTGC-TGAGGAATTACAAATTGACCCGAACATCACAGCTATTTAAAAAAAA--G-TCCATCAAGCCAATTACTTAGT-GATTTTTTTGTAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGCTATGTAATGTGTGGCACCTTCCAATTTTGTTATTGAATGTGATTTTGATTCACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGCGGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGCCAAAAAGGAAATCAAAGAATCTGCCAAAGCTGTTAATCT-------------------------------------- 'Solanum lycopersicum L.-RGO340' GTAAGTTCTTTATCAGCAC----------GTTCTTCAAATAAAAATTATGTAGCATTCTTATTTGGCCGTGACATGCTACTGTATT-ATTAT---GTGTT-GTTAGATAATAGGGTTTTCCAGTTTCAGACCTCACTTGCGAGATTACACTGAATATGTTGTTGTAGATG----------------------------------AATTAATTAA-----------------------------------------------------------------------CCTTTGGACGTTATTAGTACAGAAAACTTAAAACTCGAGGTTCAATATTTCCTTGGAACTATGAGGTAGAAGTTGATGAAAAAGAGCTAACAAAAATGTGTTTTCATT--GTGTGTGTATGACA---------ACCACATATAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTACATCTGAATTGTATACTTAAGTTAGAAATGTCCATATAAACAATAGCACTAGGTGATTTCTTCTTGTCTACCCAAGTCTTGGTTAACATAGTTACTTGACAGCTGCGCCTGAGGAATTTCAAATTGACCTGGACATCACAGTTATTAAAGAAAAA--G-TTCATCAAGCCAATTATTTGTT-GTATTTTTTGTAAATCCAGTTTAAGTGATCTATTGTCCAGATATTGTAATGATCTTAAGCTATATTATGCGTAGCACCTTCCTACTGTGTTATTGAAAGGGATTTTGATTTTCTTTCTTTCCAGAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGGGGAGTGAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGCCAAAAAGGAAAGCAAAGAATCAGCCAAACCTGTCAATCTTGATGCACAACGGGCAGAGGGACTGTGTTCTATACCAG 'Solanum pacificum Tepe-LB2395' GTAAGTTCTTTATCAGTACACATTCATAGGTTCTTGAAATAAAGTT-CTGCAGCATTCTTATTTGCCGGCGACATGCTACTGTGTTTATTAT---GTGTTTGTTAGCTTATAGGCTCTTCCAGTTCTAGACCTCACTTTTGAGATT-CACTGGGTATGTTGTTGTAGGGTATGTTCTTGGAGATAATAGGCTCTTGTTTCAACAAATTAATCAA-CTCCTGTCCAGAGACTTGGTTCTTGGGGTAAAATTTGCATTAGTTGTCAACTTAACCCGATGGTGTAAAATCTTTAGACGATATTAGTACCGAAAACTTAAA-CTCGAGGTTCAATATTTCTGAAGAACTATGAGGTAAAAGTTGATCAAAAAGAGCTAACAAAAATGTGTTTTCATTTTGTGTGTGTATATGATT-------ACCACATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTCCATCTGAATTGGATTCTTAAGTTAGAAATGTCCATATAAACAATAACAGTGGGTGATTTCTTCCTGTCTGCCCAAGTCTGGGTGGACATAGTTACTCGGCAGCTGTGC-TGAGGAATTACAAATTGACCCGAACAGCACAACTATTTAAAAAAAA--G-TCCATCAAGCCAATTACTTATT-GATTTTTTCGTAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGCTATGTAATGTGTGGCACCTTCCAACTCTGTTATTGAATGTGATTTTGATTCACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGCGGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGCCAAAAAGGAAATCAAAGAATCTGCCAAAGCTGTTAATCTTGATGCAAAAGAGGCAAGAGGACCTTGTCCTATACCAG 'Solanum phaseoloides Pol.-LB1727' -------------------------------------AATAAAGTT-CTGCAACATTCTTATTTGCCTGCGACATGCTACTGTGTTTATTAT---GTGTTTGTTAGATTATAGGCTCTTCCAGTTCCAGACCTCACTTTTGAGATT-CACTGGGTATGTTGTTATAGGGTATGTTGTTGTAGATAATAGGCTCTTGTTTCAACAAATTAATTAA-CTCCTGTCCAGAGACTAGGTTCTTGGGGTAAAATTTGCATTAGTTGTCAACTTAACCCGATGGTGTAAAATCTTTAGACGTTATTAGTACACAAAACTTAAA-CTCGAGGTTCAATATTTCTGAAGAACTGTGAGGTAAAAGTTGATGAAAAAGAGCTAACAAAAATGTGTTTTCATTTTGTGTGTGTATATCATT-------ACCACATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTCCATCTGAATTGGATTCTTAAGTTAGAAATGTCCATATAAACAATAACACTAGGTGATTTCTTCTTGTCTGCCCAGGTCTGGGTGGACATAGTTACTTGGCAGCTGTGC-TGAGGAATTACAAATTGACCCGAACATCACGGCTATTTAAAAAAAAAAGATCCATCAAGCCAATTACTTATTTGATTTTTT-GTAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGCTATGTAATGTGTGGCACCTTCCAACTCTGTTATTGAATGTGATTTTGATTCACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTGGAGAGGCTAATACTTCAAGCAGGCGGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGTCAAAAAGGAAATCAAAGAATCTGCCAAAGCTGTTAATC--------------------------------------- 'Solanum phaseoloides Pol.-LB693' GTAAGTTCTTTATCAGTACACATTCATAGGTTCTTGAAATAAAGTT-CTGCAACATTCTTATTTGCCTGCGACATGCTACTGTGTTTATTAT---GTGTTTGTTAGATTATAGGCTCTTCCAGTTCCAGACCTCACTTTTGAGATT-CACTGGGTATGTTGTTATAGGGTATGTTGTTGTAGATAATAGGCTC--GTTTCAACAAATTAATTAA-CTCCTGTCCAGAGACTAGGTTCTTGGGGTAAAATTTGCATTAGTTGTCAACTTAACCCGATGGTGTAAAATCTTTAGACGTTATTAGTACACAAAACTTAAA-CTCGAGGTTCAATATTTCTGAAGAACTGTGAGGTAAAAGTTGATGAAAAAGAGCTAACAAAAATGTGTTTTCATTTTGTGTGTGTATATCATT-------ACCACATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTCCATCTGAATTGGATTCTTAAGTTAGAAATGTCCATATAAACAATAACACTAGGTGATTTCTTCTTGTCTGCCCAGGTCTGGGTGGACATAGTTACTTGGCAGCTGTGC-TGAGGAATTACAAATTGACCCGAACATCACGGCTATTTAAAAAAAAAAGATCCATCAAGCCAATTACTTATTTGATTTTT-TGTAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGCTATGTAATGTGTGGCACCTTCCAACTCTGTTATTGAATGTGATTTTGATTCACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTGGAGAGGCTAATACTTCAAGCAGGCGGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGTCAAAAAGGAAATCAAAGAATCTGCCAAAGCTGTTAATCTTGATGCAAAACAGGC----------------------- 'Solanum trifolium Dunal-LB2368' GTAAGTTCTTTATCAGTACACATTCATAGGTTCTTGAAATAAAGTT-CTACAACATTCTTATTTGCCTGCGACATGCTACTGTGTTTATTAT---ATGTGTGTTAAATTATAGGCTCTTCCAGTTTCAGACCTCACTTCTGAGATT-CACTGGGTGTGTTATTGTAGGGTATGTTGTTGTAGATAATAGGCTCTTGTTTCAACAAATTAATTAA-CTCCTGTCCAGAGACTTGGTTCTTGGGTTAAAATTTGCATTAGTTGTCAACTTAACCCGATGGTGTAAAATCTTTAGACGTTATTAGTACACAAAACTTAAA-CTCGAGGTTCAATATTTCCGAAGAACTATGAGGTAAAAGTTGATGAAAAAGAGCTAACAAAAATGTGTTTTCATTTTGTGTGTGTATATGATT-------ACCGCATAAAGTAAGCTAAC-------------------------------------------------------------------------------------------------------AATTCCATCTGAATTGGATTCTTAAGTTAGAAATGTCCATATAAACAATAACACTAGGTGATTTCTTCTTGTCTGCCCAAGTCTGGGTGGACATAGTTACTCGGCAGCTGTGC-TGAGGAATTACAAATTGACCCGAACATCACGGCTATTTTAAAAAAA--G-TCCATCAAGCCAATTACTTATT-GATTTTT-GGTAAATCCAGTTTAAGTGATCTATTGTCCAAATATTGTAATGATCTTAAGCTATGTAATGTGTAGCACCTTCCAACTCTGTTATTGAATGTGATTTTGATTCACTTT----CCAGAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGCGGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGCCAAAAAGGAAATCAAAGAATCTGCCAAAGCTGTTAATCTTGATGCAAAACAGGCAAGAGGACCTTGTCCTATACCAG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7407] TITLE 'Herpystichum-cos1C'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=731; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Solanum anceps Ruiz & Pav.-LB2408' TTGTTTCTTCTTTCAGGCGAGGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTCGGAAGACCTTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTTCTTTACCACATTTATTGATTTATGTAGAAGTAAAAGTCCCTTATGAACTACATTATTAT--GGTAATCCGGTCAACAATCAGCATCAAACTATCTTCTGCTGG-CATATATAGATATGCATGGTTCTGTCCACAGAC-ATGTTAATATATTTTGAAAAGCAAATCAGATCACATGTTTGTTATTCTGGAAAAGAAGTTCCATTTATCTAAACGCTTGTCTCAATTTAGAATGCTCGATGGTGTATAATCATTAAACATTTGCACTCTTCACATTCTCTTTGCTCCTTGTACACTAATTTGTTATCAAGTTATTGCAATCACCAGC----AAATCATTTCTTAATATTAATGCTTAGATACCTTTCGAA------CTTCATTTTGGGGGT---GATCCACATGATCTATAAGCAGTATCCTAAGATTTTACTTTTTTTTT----------CTGT{AG}ACGACACGCGAAGACATCTTTAAAGGATTCATCCTACGATATACTAAACATTTATATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATC- 'Solanum anceps Ruiz & Pav.-LB654' --GTTTCTTCTTTCAGGCGAGGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTCGGAAGACCTTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTTCTTTACCACATTTATTGATTTATGTAGAAGTAAAAGTCCCATATGAACTACATTATTAT--GGTAATCCAGTCAACAATTAACATCAAACTATCTTCTGCTGG-CATATATAGATATGCATGGTTCTGTCCAGAGAC-ATGTTATTATATTTTGAAAAGCAAATCAGATCACATGTTTGTTATTCTGGAAAAGAAGTTCCATTTATCTAAACGCTTGTCTCAATTTAGAATGCTCGATGTTGTATAATCATTAAACATTTGCACTCTTCACATTCTCTTTGCTCCTTGTACACTAATTTGTTATCAAGTTATTGCAATCACCAGC----AAATCATTTGTTAATATTAATGCTTAGATACCTTTCGAA------CTTCATTTTGGTGGT---GATCCACATGATCTTTAAGCAGTATCCTGAGATTTTACTTTTTGTTT----------CTGTGACTACACGCGAAGACATCTTTAAAGGATTCATCCTACGATATACTAAACATTTATATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATC- 'Solanum brevifolium Dunal-LB1029' TTGTTTCTTCTTTCAGGTGAGGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTCGGAAGACCTTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTTCTTTACTACATTTATTTA----TGTAGAAGTAAAAGTTCCATATGAACGACATTATTAT--GGTAATCCAGTCAACAATCAGCATCAAACTATCTTCTGCTGG-CATATACAGATATGCATGGTTCTGTCCACAGAC-ATGTTATTATATTTTGAAAAGAAAATCAGATCACATGTTTGTTATTCTGGAAAAGAAGTTCCATTTGTCTAAACGCATGCCTCAATTTAGAATGCTCGATGGTGTATAATCATTAAACATTTGCACTCTTCACATTGTCTTT--------------------------------TGCAGTCACCATCTTGCAAATCATTTCTTAAAATTAATGCTTAGATACCTTTCGAA------CTTCATTTTAGGGGT---GATCCACATGATCTATAAGCAGTATCCTGAGATTTTACTTCTTTTTTTT--------CTGTTACTACATGCGAAGGCATCTTAAAAGGATTCGTCCTACGATATACTAAACATTTATATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGCAAAATGCGTACCACACCAAGTATCG 'Solanum bulbocastanum Dunal-Spooner4' TTGTTTCTTCTTTCAGGCGAGGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTCGGAAGACCTTTATCTCCTGGTTCAAATCGTGCATGGACCATTATATACTTCGTATCATCATGGTGCGAGTCTCATCATTACACTTCTTTACCACATTTATTTACATA-----AAGTAAAAGTCCCATATGAACTACATTATTAT--GGTAATCCATTTAACAACCAGCATCAAACTATCTTCTGCTGGGCATATATAGATGTGCATGGTTCTGTCCTCAGAC-ATGTTATTATATTTTGAAAAGAAAATCAGATCACATG-TTATTATTCTGGAAAAGAGGTTCCATTTATCCAAATGCTTGTCTCAATTTAGAATGCTCCATGGTGTATGATCATTAAACATTTGCACTCTTCACATTGTCTTTGCTCCTTGTACACTAATTTGTTATCAAGTTATTGCAATCACCATCTTGCAAATCATTTCTTAATATTAATGCTAAGATACCTTTTGAA------CTTCATTTTGGGGGT---GATCCACATGATCTATAAGCAGTATCCTGAGATTTT{AG}CTTTTTTTTT----------CTGTTACTACACGCAAAGACATCTTACAAGGATTCATCCTACGATACACTAAACATTTATATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGCAAAATGCTTACCACACCAAGTATCG 'Solanum caripense Dunal-LB1026' -------------------------------------------AATGCATGTGCTTCGGAAGACCTTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCGTCATTACACTTCTTTACCGCA---TTTTATTTTCGTAGAAGTAAAAGTCCCATATGAACTACATTGTTAT--GGTAATCCAGTTAACAATCAGCATCAAACTATCTTCTGGTGG-CATATATAGATATGCATGGTTCTG-CCACAGAC-ATGTTATTATATTTTGAAAATAAAATCAGATCACATGCTTGTTATTCTGGAAAAGAAGTTCCATTTATCGAAACGCTTATCTCAATTTAGAATGCTCGATGGTGTATAATCATTAAGCATTTGCACTCTTCACATTGTCTTT--------------------------------TGCAGTCACCATCTTTCAAATCATTTCTCAAAACTAATGCTTAGATACCTTTC{CG}AA------CTTCATTTTAGGGGT---GATCCCCATGATCTATAAGCAGTATCCTAAGATTTTACTTTCTTTTTTTTC------CTGTCACGACATGCAAAGATATCTTAAAAGGATTCATCCTACGATATACTAAACATTGATATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGT{GT}GT--------------------------------------- 'Solanum crassinervium Tepe-LB2397' TTGTTTCTTCTTTCAGGCGAAGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTCGGAAGACCTTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTTCTTTACCACATTTATTTATTTATGTAGAAGTAAAAGTTCCATATGAACTACATTATTAT--GGTAATCCAGTCAACAATCAGCATCAAACTATCTTCTGCTGG-CATATATAGATATGCATGGTTCTGTCCACAGAC-ATGTTATTATATTTTGAAAAGAAAATCAGATCATCTGCTTGTTATTCTGGAAAAGAAGTTCCATTTATCTAAACTCTTGTCTCAATTTAGAATGCTTGATGGTGTATTAGCATTAAACATTTGCACTCTTCACATTGTCTTTGCTCCTTGTACACTAATTTGTTATCAAGTTATTGCAATCACCAGC----AAATCATTTCTTAATATTAATGCTTAGATACCTTTCGAA------CTTCATTTTGGGGGTGGTGATCCACATGATCTATAAGCAGTATCCTGAGATTTTACTTTTTTTTT----------CTGTGACTACATGCGAAGACATCTTTAAGGGATTCATCCTTCGATATACAAAACATTTATATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATCG 'Solanum dalibardiforme Bitter-LB2454' TTGTTTCTTCTTTCAGGCGAAGCATTGCTTATGGGAGTGACAAAATGTATGTGCTTCGGAAGACCTTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCGTTACACTACTTTACCACATTTATTTATTTATGTAGAAGTAAAAGTCCCATATGAACTACATTATTAT--GGTAATCCAGTCAACAAT{AC}AGCATCAAACTATCTTCTGCTGG-CATATATAGATATGCATGGTTCTGTCCACAGAC-ATGTTATTATATTTTGGAAAGAAAATCAGATCACATGTTTATTATTCTGGAAAAGAAGTTCCATTTATCAAAACGCTTGTCTCAATTTAGAATGCTCGATGGTGTATAATCATTAAACATTTGCACTCTTCACATTGTCTTTTCTCCTTGTACACTAATTTGTTATCAAGTTATTGCAATCACCATCTTGCAAATCATTTCTTAATATTAATGCTTAGATACCTTTCGAA------CTTCATTTTGGGGGT---GATCCACATGATCTATAAGCAGTATCCTGAGATTTTACCTTTTTT------------CTGTTACTAGACGTGAAGACATCTTAAAAGGATTCATCCTA{CT}GATATACTAAACATTTATATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATCG 'Solanum evolvulifolium Greenm.-LB183' TTGTTTCTTCTTTCAGGCGAAGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTTGGAAGACCTTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTTCTTTACCACATTTATTTATTTATGTAGAAGTAAAAGTTCCATATGAACTACATTATTAT--GGTAATCCAGTCAACAATCAGCATCAAACTATCTTCTGCTGG-CATATATAGATATGCATGGTTCTGCCCACAGAC-A{CT}GTTATTATATTTTGAAAAGAAAATCAGATCACATGTTTGTTATTCTAGAAAAGAAGTTCCATTTATCTAAATGCTTGTCTCAATTTAGAATGCTTGGTGGTGTATAATCATTAAACATTTGCACTCTTCACATTGTCTTTGCTCCTTGTACACTAATTTGTTATCAAGTTATTGCAATCACCAGC----AAATCATTTCTTAATATTAATGCTTATATACCTTTCGAA------CTGCATTTTGGGGGT---GATCCACATGATCTATAAGCAGTATCCTGAGATATTACTTTTTTTTT----------CTGTGACTACATGAGAAGACATCTTTAAAGGATTCATCCTACGATATACAAAACATTTATATCTGCAGGCTGACATTTCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATCG 'Solanum evolvulifolium Greenm.-LB2253' TTGTTTCTTCTTTCAGGCGAAGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTTGGAAGACCTTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTTCTTTACCACATTTATTTATTTATGTAGAAGTAAAAGTTCCATATGAACTACATTATTAT--GGTAATCCAGTCAACAATCAGCATCAAACTATCTTCTGCTGG-CATATATAGATATGCATGGTTCTGCCCACAGAC-ATGTTATTATATTTTGAAAAGAAAATCAGATCACATGTTTGTTGTTCTAGAAAAGAAGTTCCATTTATCTAAATGCTTGTCTCAATTTAGAATGCTTGGTGGTGTATAATCATTAAACATTTGCACTCTTCACATTGTCTTTGCTCCTTGTACACTAATTTGTTATCAAGTTATTGCAATCACCAGC----AAATCATTTCTTAATATTAATGCTTATATACCTTTCGAA------CTGCATTTTGGGGGT---GATCCACATGATCTATAAGCAGTGTCCTGAGATATTACTTTTTTTTT----------CTGTGACTACATGAGAAGACATCTTTAAAGGATTCATCCTACGATATACAAAACATTTATATCTGCAGGCTGACATTTCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATCG 'Solanum evolvulifolium Greenm.-LB2415' TTGTTTCTTCTTTCAGGCGAAGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTCGGAAGACCTTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTTCTTTACCACATTTATTTATATATGTAGAAGTAAAAGTTCCATATGAACTACATTATTCT--GGTAATCCAGTCAACAATCAGCATCAAAATATCTTCTGCTGG-CATATATAGATATGCATGGTTCTGTCCACAGAC-ATGTTATTATATTTTG{AG}AAAGAAAATCAGATCATCTGCTTGTTATTCTGGAAAAGAAGTTCCATTTATCTAAACGCTTGTCTCAATTTAGAATGCTTGATGGTGTATTAGCATTAAACATTTGCACTCTTCACATTGTCTTTGCTCCTTGTACACTAATTTGTTATCAAGTTATTGCAATCACCAGC----AAATCATATCTTAATATTAATGCTTAGA{CT}ACCTTTCGAA------CTTCATTTTGGGGGT---GATCCACATGATCAATAAGCAGTATCCTGAGATTTTACTTTTTTTTT----------CTGTGACTACATGCGAAGACATCTTAAAAGGATTCATCCTACGATATACAAAACATTTATATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATCG 'Solanum evolvulifolium Greenm.-LB2520' TTGTTTCTTCTTTCAGGCGAAGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTCGGAAGACCTTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTTCTTTACCACATTTATTTATATATGTAGAAGTAAAAGTTCCATATGAACTACATTATTCT--GGTAATCCAGTCAACAATCAGCATCAAAATATCTTCTGCTGG-CATATATAGATATGCATGGTTCTGTCCACAGAC-ATGTTATTATATTTTGAAAAGAAAATCAGATCATCTGCTTGTTATTCTGGAAAAGAAGTTCCATTTATCTAAACGCTTGTCTCAATTTAGAATGCTTGATGGTGTATTAGCATTAAACATTTGCACTCTTCACATTGTCTTTGCTCCTTGTACACTAATTTGTTATCAAGTTATTGCAATCACCAGC----AAATCATATCTTAGTATTAATGCTTAGATACCTTTCGAA------CTTCATTTTGGGGGT---GATCCACATGATCAATAAGCAGTATCCTGAGATTTTACTTTTTTTTT----------CTGTGACTACATGCGAAGACATCTGAAAAAGATTCATCCTACGATATACAAAACATTTATATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATCG 'Solanum evolvulifolium Greenm.-LB709' -TGTTTCTTCTTTCAGGCGAAGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTTGGAAGACCTTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTTCTTTACCACATTTATTTATTTATGTAGAAGTAAAAGTTCCATATGA{AT}{CT}TACATTATTAT--GGTAATCCAGTCAACAATCAGCATCAAACTATCTTCTGCTGG-CATATATAGATATGCATGGTTCTGCCCACAGAC-ATGTTATTATATTTTGAAAAGAAAATCAGATCACATGTTTGTTATTCTAGAAAAGAAGTTCCATTTATCTAAATGCTTGTCTCAATTTAGAATGCTTGGTGGTGTATAATCATTAAACATTTGCACTCTTCACATTGTCTTTGCTCCTTGTACACTAATTTGTTATCAAGTTATTGCAATCACCAGC----AAATCATTTCTTAATATTAATGCTTATATACCTTTCGAA------CTGCATTTTGGGGGT---GATCCACATGATCTATAAGCAGTATCCTGAGATATTACTTTTTTTTT----------CTGTGACTACATGAGAAGACATCTTTAAAGGATTCATCCTACGATATACAAAACATTTATATCTGCAGGCTGACATTTCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATCG 'Solanum limoncochaense Tepe-LB2391' TTGTTTCTTCTTTCAGGCGAGGCTTTGCTTATGGGAGTGACAAAATGCATGTGCTTCGGAAGACCTTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTGCTTTACCACATTTATTTA----TATAGATGTAAAAGTCCCATATGAACTACATTATTAT--GGTAATCCAGTCAACAATCAGCATCAAACTATCTTCTGCTGG-CATATATAGATATGCATGGTT--GTCCACAGACTATGTTATTATGTTTTGAAAAGAAATTCAGATCACATGTTTGTTATTCTGGAAAAGAATTTCCATTTATCCAAATGCTTGTCTCAATTTAGAATGCTCGATGGTGGATAATCATTAAACATTTGCACTCTTCACCTTGACTTTGT-------GCACTAATTTTTTATCAAGTTATTGCAATCACTATCTTGCAAATCATTTCTTAATATTAATGCTTAGATACCTTTCGAG------CTTCATTTTGCAGGT---GATTCACATGATCTGTAAGCAGTATCCTGAAATTTTACTTTTTTTA-----------CTGT----ACACGCGAAGACATCTTAAAAGGATTAATCCTACGATATACTAAACATTTATATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATCG 'Solanum limoncochaense Tepe-LB2466' TTGTTTCTTCTTTCAGGCGAGGCTTTGCTTATGGGAGTGACAAAATGCATGTGCTTCGGAAGACCTTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTGCTTTACCACATTTATTTA----TATAGATGTAAAAGTCCCATATGAACTACATTATTAT--GGTAATCCAGTCAACAATCAGCATCAAACTATCTTCTGCTGG-CATATATAGATATGCATGGTT--GTCCACAGACTATGTTATTATGTTTTGAAAAGAAATTCAGATCACATGTTTGTTATTCTGGAAAAGAATTTCCATTTATCCAAATGCTTGTCTCAATTTAGAATGCTCGATGGTGGATAATCATTAAACATTTGCACTCTTCACCTTGACTTTGT-------GCACTAATTTTTTATCAAGTTATTGCAATCACTATCTTGCAAATCATTTCTTAATATTAATGCTTAGATACCTTTCGAG------CTTCATTTTGCAGGT---GATTCACATGATCTGTAAGCAGTATCCTGAAATTTTACTTTTTTTA-----------CTGT----ACACGCGAAGACATCTTAAAAGGATTAATCCTACGATATACTAAACATTTATATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATCG 'Solanum loxophyllum Bitter-LB2396' TTGTTTCTTCTTTCAGGCGAAGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTCGGAAGACCTTTATCTCCTGGTTCAAATCG{CT}GCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTTCTTTACCACATTTATTTATTTATGTAGAAGTAAAAGTTCCATATGAACTACATTATTCT--GGTAATCCAGTCAACAATCAGCATCAAAATATCTTCTGCTGG-CATATATAGATATGCATGGTTCTGTCCATAGAC-ATGTTATTATATTTTGAAAAGAAAATCAGATCATCTGCTTGTTATTCTGGAAAAGAAGTTCCATTTATCTAAACGCTTGTCTCAATTTAGAATGCGTGATGGTGTATTAGCATTAAACATTTGCACTCTTCACATTGTCTTTGCTCCTTGTACACTAATTTGTTATCAAGTTATTGCAATCACCAGC----AAATCATTTCTTAATATTAGTGCTTAGATACCTTTCGAA------CTTCATTTGGGGGGT---GATCCACATGATCTATAAGCAGTATCCTGAGATTTTACTGTTTTTTT----------CTGTGACTACATGCGAAGACATCTTTAAAGGATTCATCCTACGATATACAAAACATTTATATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATCG 'Solanum loxophyllum Bitter-LB2521' TTGTTTCTTCTTTCAGGCGAAGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTCGGAAGACCTTTGTCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTTCTTTACCACATTTATTTATTTATGTAGAAGTAAAAGTCCCATATGAACTACATTATTAT--GGTAATCCAGTCACCAATCAGCATCAAACTATCTTCTGCTGG-CATATATAGATATGGATGGTTCTGTCCACAGAC-ATGTTATTATATTTTGAAAAGAAAATCAGATCACATGTTTGTTATTCTGGAAAAGAAGTTCCATTTATCTAAACGCTTGTCTCAATTTAGAATGCTTGATGGTGTATTAGCATTAAACATTTGCACTCTTCACATTGTCTTTGCTCCTTGTACACTAATTTGTTATCAAATTATTGCAATCACCAGC----AAATCATTTCTTAATATTGATGCTTAGATACCTTTCGAA------CTTCATTTTGGGGGT---GATCCACATGATCTATAAGCAGTATCCTGAGATTTTACTTTTTTTTT----------CTGTGACTACATGCGAAGACATCTTAAAAGGATTCATCCTACGATATACAAAACATTTGTATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATCG 'Solanum lycopersicon L.-RGO340' TTGTTTCTTCTTTCAGGTGAGGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTCGGAAGACCTTTATCTCCTGGTTCAAATCGTGCATGGACCATTATATACTTCGTATCATCATGGTGCGAGTCTCATCATTAAACTTCTTTACCACATTTACATAT----GTAGAAGTAAAAGTCCCATATGAACTACATTATTAT--GTTAATCCAATCAACAATCTGCATCAAACTATCTTCTGCTGG-CATATACAGATGTGCATGATTCTGTCCTCTGAC-ATATTATTATATTTTGAAAAGAAAATCAGATCACATGTTTGTTATTGTGGAAAAGAAATTCCATTAATCTAAACCCTTGTCTCAACTTAGAATGCTCCATGGTGTATGATCATTAAATATTTACACTCTTCACATTGTCTTTGCTCTTTGTACACTAATTTGTTATCGAGTTATTGCAATCACCATCTTGCAAATCATTTCTTAATAGTAATGCTAAGATACCTTTTGAATGAAAACTTCATTTTGGGGAT---GATGCAGATGATCTATAAGCAGTATCCTGAGATTTAACTTTTTTATTTTATTTTTTTCTGTTACTACACACGAAGACATCTTAAAAGGATTCATCGTACGATATACTAAACATTGATATCTGCAGGTTGACATTCCTGGTTGCTGAGGCATGTGTTATTGCTGGAGCAAAGCAAAATGCGTACCACACCAAGTATC- 'Solanum pacificum Tepe-LB2395' -TGTTTC{AT}TCT{GT}TCAGGCGAAGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTCGGAAGACCTTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTTCTTTACCACATTTATTTATTTATGTAGA--------------------------------------------------------------------------------------{AT}ATGCA{AT}GGTTCTGTCCACGGAC-ATGTTATTATATTTTGAAAAGAAAATCAGATCACATGTTTGTTATTCTGGAAAAGAAGTTCCATTTATCTAAACGCTTGTCTCAATTTAGAATGCTTGATGGTGTATAGCCATTAAACATTTGCACTCTTCACATTATCTTTGCTCCTTGTACACTAATTTGTTATCAAGTTATTGCAATCACCAGC----AAATCATTTCTTAATATTAATGCTTAGATACCTTTCGAA------CTTCATTTTGGGGGT---GATCCACATGATCTATAAGCAGTATGCTGAGATTTTACTCTTTTTTT----------CTGTGACTACATGCGAAGACATCTTTAAAGGATTGATCCTACGATATACAAAACATTTATATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATC- 'Solanum phaseoloides Pol.-LB1727' -TGTTTCTTCTTTCAGGCGAGGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTCGGTAGACCTTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTTCTTTACCACATTTATTTA----TGTAGAAGTAAAAATCCCATATGAACTACATTATTATATGGTAATCCAGTCAACAATCAGCATCAAACTATCCTCTGCTGG-CATATATAGATATGCATGGTTCTGTCCACAGAC-ATGTTATTATATTTTGAAAAGAAAATCAGATCACATGTTTGTTATTCTGGAAAAGAATTTCCATTTATCCAAACGCTTGTCTCAATTTAGAATGCTCGATGGTGGATAATCATTAAACATTTGCACTCTTCATCTTGTCTTTG-------TACACTAATTTTTTATCAAGTTATTGCAATCACAATCTTGTAAATCATTTCTTAATATTAATGCTTAGATACCTTTCGAG------CTTCATTTTGCAGGT---GATCCACATGATCTGTAAGCAGTATCCTGAGATTTTACTTTTTTTTT----------CTGTGATTACACGCGAAGACATCTTAAAAGGATTCATCCTACGATATACTAAACATTTATATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATC- 'Solanum phaseoloides Pol.-LB693' -TGTTTCTTCTTTCAGGCGAGGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTTGGTAGACCTTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTTCTTTACCACATTTATTTA----TGTAGAAGTAAAAATCCCATATGAACTACATTATTATATGGTAATCCAGTCAACAATCAGCATCAAACTATCTTCTGCTGG-CATATATAGATATGCATGGTTCTGTCCACAGAC-ATGTTATTATATTTTGAAAAGAAAATCAGATCACATGTTTGTTATTCTGGAAAAGAATTTCCATTTATCCAAACGCTTGTCTCAATTTAGAATGCTCGATGGTGGATAATCATTAAACATTTGCACTCTTCATCTTGTCTTTG-------TACACTAATTTTTTATCAAGTTATTGCAATCACAATCTTGTAAATCATTTCTTAATATTAATGCTTAGATACCTTTCGAG------CTTCATTTTGCAGGT---GATCCACATGATCTGTAAGCAGTATCCTGAGATTTTACTTTTTTTTT----------CTGTGATTACACGCGAAGACATCTTAAAAGGATTCATCCTACGATATACTAAACATTTATATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATCG 'Solanum trifolium Dunal-LB2209' TTGTTTCTTCTATCAGGCGAGGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTCGGAAGACCCTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTTTTTTACCACATTTATTAA----TGTAGAAGTAAAAATCCCATATGGACTACATTATTAT--GGTAATCCAGTCAACAATCAGCATCAAACTATCTTCTGCTGG-CATATATAGATATGCATGGTTCTGTACACAGAC-ATGTTATTATATTTTGAAAAGAAAATCAGATCACATGTTTGTTATTCTGGAAAAGAATTTCCATTTATCCGAACGCTTGTCTCAATTTAGAATGCTCGATGGTGGATAATCATTAAACATTTGCACTCTTCGCCTTGTCTTTG-------TACACTAATTTTTTATCAAGTTATTGCAATCACCATCTTGCAAATCATTTCTTAATATTAATGCTTA{AG}ATACCTTTCGAG------CTTCATTTTGCAGGT---GATCCACGTGATCTGTAAGCAGTATCCTGAGATTTTACTTTTTTTC-----------CTGTGATTACACGCGAAGACATCTTAAAAGGATTCATCCTAC{AG}ATATACTAAACATTTATATCTGCAGGCTGACATTCCTGGTTGCTGAGGC{AG}TGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATCG 'Solanum trifolium Dunal-LB2368' TTGTTTCTTCTTTCAGGCGAGGCATTGCTTATGGGAGTGACAAAATGCATGTGCTTCGGAAGACCCTTATCTCCTGGTTCAAATCGTGCATGGGCCATTATATACTTCATATCATCATGGTGCGAGTCTCATCATTACACTTTTTTACCACATTTATTAA----TGTAGAAGTAAAAATCCCATATGGACTACATTATTAT--GGTAATCCAGTCAACAATCAGCATCAAACTATCTTCTGCTGG-CATATATAGATATGCATGGTTCTGTACACAGAC-ATGTTATTATATTTTGAAAAGAAAATCAGATCACATGTTTGTTATTCTGGAAAAGAATTTCCATTTATCCGAACGCTTGTCTCAATTTAGAATGCTCGATGGTGGATAATCATTAAACATTTGCACTCTTCGCCTTGTCTTTGT-------ACACTAATTTTTTATCAAGTTATTGCAATCACCATCTTGCAAATCATTTCTTAATATTAATGCTTAGATACCTTTCGAG------CTTCATTTTGCAGGT---GATCCACGTGATCTGTAAGCAGTATCCTGAGATTTTACTTTTTTTC-----------CTGTGATTACACGCGAAGACATCTTAAAAGGATTCATCCTACGATATACTAAACATTTATATCTGCAGGCTGACATTCCTGGTTGCTGAGGCATGTGTTGTTGCTGGAGCAAAGAAAAATGCTTACCACACCAAGTATCG ; END; BEGIN TREES; TITLE 'Herpystichum-trnStrnG'; LINK TAXA = Taxa5; TRANSLATE 1 'Solanum evolvulifolium Greenm.-LB183', 2 'Solanum evolvulifolium Greenm.-LB709', 3 'Solanum evolvulifolium Greenm.-LB2253', 4 'Solanum evolvulifolium Greenm.-LB2415', 5 'Solanum evolvulifolium Greenm.-LB2520', 6 'Solanum dolichorhachis Bitter-LB2512', 7 'Solanum loxophyllum Bitter-LB2396', 8 'Solanum loxophyllum Bitter-LB2521', 9 'Solanum phaseoloides Pol.-LB693', 10 'Solanum phaseoloides Pol.-LB1727', 11 'Solanum pentaphyllum Bitter-LB2515', 12 'Solanum crassinervium Tepe-LB2397', 13 'Solanum limoncochaense Tepe-LB2391', 14 'Solanum limoncochaense Tepe-LB2466', 15 'Solanum pacificum Tepe-LB2395', 16 'Solanum dalibardiforme Bitter-LB2454', 17 'Solanum trifolium Dunal-LB2209', 18 'Solanum trifolium Dunal-LB2368', 19 'Solanum anceps Ruiz & Pav.-LB654', 20 'Solanum anceps Ruiz & Pav.-LB2408', 21 'Solanum brevifolium Dunal-LB1029', 22 'Solanum caripense Dunal-LB1026', 23 'Solanum bulbocastanum Dunal-Spooner4', 24 'Solanum lycopersicum L.-RGO340'; TREE 'FigS1-trnStrnG' = [&R] ((((1:0.0,2:0.0,(3:0.0,6:3.0):1.0,4:0.0,5:0.0,(7:0.0,8:0.0):1.0,12:0.0):1.0,15:1.0):1.0,((9:2.0,17:3.0):4.0,11:1.0,(13:0.0,14:0.0):2.0):2.0,((10:0.0,18:0.0):2.0,(19:3.0,20:1.0):3.0):1.0,16:1.0):6.0,21:3.0,22:5.0,(23:0.0,24:4.0):3.0); END; BEGIN TREES; TITLE 'Herpystichum-cos10B'; LINK TAXA = Taxa1; TRANSLATE 1 'Solanum evolvulifolium Greenm.-LB183', 2 'Solanum evolvulifolium Greenm.-LB709', 3 'Solanum evolvulifolium Greenm.-LB2253', 4 'Solanum evolvulifolium Greenm.-LB2415', 5 'Solanum evolvulifolium Greenm.-LB2520', 6 'Solanum phaseoloides Pol.-LB693', 7 'Solanum phaseoloides Pol.-LB1727', 8 'Solanum pentaphyllum Bitter-LB2515', 9 'Solanum loxophyllum Bitter-LB2396', 10 'Solanum loxophyllum Bitter-LB2521', 11 'Solanum crassinervium Tepe-LB2397', 12 'Solanum limoncochaense Tepe-LB2391', 13 'Solanum limoncochaense Tepe-LB2466', 14 'Solanum pacificum Tepe-LB2395', 15 'Solanum dalibardiforme Bitter-LB2454', 16 'Solanum trifolium Dunal-LB2368', 17 'Solanum anceps Ruiz & Pav.-LB654', 18 'Solanum anceps Ruiz & Pav.-LB2408', 19 'Solanum brevifolium Dunal-LB1029', 20 'Solanum caripense Dunal-LB1026', 21 'Solanum bulbocastanum Dunal -Spooner4', 22 'Solanum lycopersicum L.-RGO340'; TREE 'Fig. S1-cos10B' = [&R] (((((((1:0.0,2:0.0):3.0,((3:0.0,(4:2.0,5:0.0):1.0,(9:0.0,10:0.0):3.0,11:3.0):1.0,14:5.0):1.0):3.0,(7:3.0,8:1.0):2.0):6.0,(17:6.0,18:9.0):5.0):9.0,(6:45.0,(12:0.0,13:0.0):14.0,16:22.0):3.0):5.0,15:20.0):7.0,19:15.0,20:26.0,(21:11.0,22:27.0):22.0); END; BEGIN TREES; TITLE 'Herpystichum-ITS'; LINK TAXA = Taxa8; TRANSLATE 1 Solanum_evolvulifolium_LB183, 2 Solanum_evolvulifolium_LB709, 3 Solanum_evolvulifolium_LB2253, 4 Solanum_evolvulifolium_LB2415, 5 Solanum_evolvulifolium_LB2520, 6 Solanum_loxophyllum_LB2396, 7 Solanum_loxophyllum_LB2521, 8 Solanum_phaseoloides_LB693, 9 Solanum_crassinervium_LB2397, 10 Solanum_limoncochaense_LB2391, 11 Solanum_limoncochaense_LB2466, 12 Solanum_pacificum_LB2395, 13 Solanum_dalibardiforme_LB2454, 14 Solanum_trifolium_LB2209, 15 Solanum_trifolium_LB2368, 16 Solanum_anceps_LB654, 17 Solanum_anceps_LB2408, 18 Solanum_brevifolium_LB1029, 19 Solanum_caripense_LB1026, 20 Solanum_bulbocastanum_S4, 21 Solanum_lycopersicum_RGO340; TREE 'FigS1-ITS' = [&R] ((((((((1:0.0,2:0.0):9.0,3:5.0):8.0,((5:11.0,(6:1.0,7:2.0):5.0):4.0,9:1.0):1.0):12.0,4:60.0):4.0,12:15.0):18.0,13:34.0):15.0,(8:16.0,(14:1.0,15:0.0):19.0):13.0,(10:0.0,11:0.0):8.0,(16:6.0,17:3.0):22.0):18.0,(18:16.0,(20:12.0,21:25.0):26.0):19.0,19:36.0):0.0; END; BEGIN TREES; TITLE 'Herpystichum-cos5'; LINK TAXA = Taxa7; TRANSLATE 1 'Solanum evolvulifolium Greenm.-LB183', 2 'Solanum evolvulifolium Greenm.-LB709', 3 'Solanum evolvulifolium Greenm.-LB2415', 4 'Solanum evolvulifolium Greenm.-LB2520', 5 'Solanum phaseoloides Pol.-LB693', 6 'Solanum phaseoloides Pol.-LB1727', 7 'Solanum loxophyllum Bitter-LB2396', 8 'Solanum loxophyllum Bitter-LB2521', 9 'Solanum crassinervium Tepe-LB2397', 10 'Solanum limoncochaense Tepe-LB2391', 11 'Solanum limoncochaense Tepe-LB2466', 12 'Solanum pacificum Tepe-LB2395', 13 'Solanum dalibardiforme Bitter-LB2454', 14 'Solanum trifolium Dunal-LB2368', 15 'Solanum anceps Ruiz & Pav.-LB654', 16 'Solanum anceps Ruiz & Pav.-LB2408', 17 'Solanum caripense Dunal-LB1026', 18 'Solanum bulbocastanum Dunal-Spooner4', 19 'Solanum lycopersicum L.-RGO340'; TREE 'Fig. S1-cos5' = [&R] ((((((1:3.0,2:0.0):8.0,(3:0.0,4:1.0):6.0):1.0,((7:0.0,9:1.0):0.0,8:1.0):3.0):7.0,12:16.0):5.0,((5:0.0,6:0.0):5.0,13:12.0):5.0,((10:0.0,11:0.0):17.0,14:10.0):2.0,(15:5.0,16:1.0):8.0):34.0,17:26.0,(18:33.0,19:43.0):19.0); END; BEGIN TREES; TITLE 'Herpystichum-cos1C'; LINK TAXA = Taxa2; TRANSLATE 1 'Solanum evolvulifolium Greenm.-LB183', 2 'Solanum evolvulifolium Greenm.-LB709', 3 'Solanum evolvulifolium Greenm.-LB2253', 4 'Solanum evolvulifolium Greenm.-LB2415', 5 'Solanum evolvulifolium Greenm.-LB2520', 6 'Solanum loxophyllum Bitter-LB2396', 7 'Solanum loxophyllum Bitter-LB2521', 8 'Solanum phaseoloides Pol.-LB693', 9 'Solanum phaseoloides Pol.-LB1727', 10 'Solanum crassinervium Tepe-LB2397', 11 'Solanum limoncochaense Tepe-LB2391', 12 'Solanum limoncochaense Tepe-LB2466', 13 'Solanum pacificum Tepe-LB2395', 14 'Solanum dalibardiforme Bitter-LB2454', 15 'Solanum trifolium Dunal-LB2209', 16 'Solanum trifolium Dunal-LB2368', 17 'Solanum anceps Ruiz & Pav.-LB654', 18 'Solanum anceps Ruiz & Pav.-LB2408', 19 'Solanum brevifolium Dunal-LB1029', 20 'Solanum caripense Dunal-LB1026', 21 'Solanum bulbocastanum Dunal-Spooner4', 22 'Solanum lycopersicon L.-RGO340'; TREE 'Fig. S1-cos1C' = [&R] (((((((1:0.0,2:0.0,3:2.0):10.0,((((4:0.0,5:3.0):4.0,6:5.0):2.0,10:3.0):3.0,7:8.0):2.0,13:7.0):5.0,(17:8.0,18:5.0):3.0):2.0,(((8:1.0,9:1.0):4.0,(15:1.0,16:0.0):9.0):1.0,(11:0.0,12:0.0):14.0):11.0):1.0,14:11.0):1.0,(21:11.0,22:31.0):10.0):6.0,19:11.0,20:25.0); END; BEGIN TREES; TITLE 'Herpystichum-cos9B'; LINK TAXA = Taxa10; TRANSLATE 1 'Solanum evolvulifolium Greenm.-LB183', 2 'Solanum evolvulifolium Greenm.-LB709', 3 'Solanum evolvulifolium Greenm.-LB2253', 4 'Solanum evolvulifolium Greenm.-LB2415', 5 'Solanum evolvulifolium Greenm.-LB2520', 6 'Solanum phaseoloides Pol.-LB693', 7 'Solanum phaseoloides Pol.-LB1727', 8 'Solanum loxophyllum Bitter-LB2396', 9 'Solanum loxophyllum Bitter-LB2521', 10 'Solanum crassinervium Tepe-LB2397', 11 'Solanum limoncochaense Tepe-LB2391', 12 'Solanum limoncochaense Tepe-LB2466', 13 'Solanum pacificum Tepe-LB2395', 14 'Solanum dalibardiforme Bitter-LB2454', 15 'Solanum trifolium Dunal-LB2368', 16 'Solanum anceps Ruiz & Pav.-LB654', 17 'Solanum anceps Ruiz & Pav.-LB2408', 18 'Solanum brevifolium Dunal-LB1029', 19 'Solanum caripense Dunal-LB1026', 20 'Solanum bulbocastanum Dunal-Spooner4', 21 'Solanum lycopersicon L.-RGO340'; TREE 'FigS1-cos9B' = [&R] ((((((((1:0.0,2:3.0):7.0,10:3.0):1.0,(4:0.0,5:0.0):7.0):1.0,8:6.0):3.0,3:9.0,9:2.0,13:9.0):3.0,(6:0.0,7:0.0):11.0,(14:6.0,15:12.0):4.0):4.0,(11:0.0,12:1.0):7.0):11.0,((16:1.0,17:1.0):20.0,(18:27.0,(20:12.0,21:22.0):18.0):7.0):6.0,19:27.0); END; BEGIN TREES; TITLE 'Herpystichum-trnTtrnF'; LINK TAXA = Taxa4; TRANSLATE 1 Solanum_evolvulifolium_LB183, 2 Solanum_evolvulifolium_LB709, 3 Solanum_evolvulifolium_LB2253, 4 Solanum_evolvulifolium_LB2415, 5 Solanum_evolvulifolium_LB2520, 6 Solanum_dolichorhachis_LB2512, 7 Solanum_loxophyllum_LB2396, 8 Solanum_loxophyllum_LB2521, 9 Solanum_phaseoloides_LB693, 10 Solanum_phaseoloides_LB1727, 11 Solanum_pentaphyllum_LB2515, 12 Solanum_crassinervium_LB2397, 13 Solanum_limoncochaense_LB2391, 14 Solanum_limoncochaense_LB2466, 15 Solanum_pacificum_LB2395, 16 Solanum_dalibardiforme_LB2454, 17 Solanum_trifolium_LB2209, 18 Solanum_trifolium_LB2368, 19 Solanum_anceps_LB654, 20 Solanum_anceps_LB2408, 21 Solanum_brevifolium_LB1029, 22 Solanum_caripense_LB1026, 23 Solanum_bulbocastanum_S4, 24 Solanum_lycopersicum_RGO340; TREE FigS1trnTtrnF = [&R] ((((1:0.0,2:1.0,(3:1.0,(4:0.0,5:0.0):1.0,(7:0.0,8:0.0):1.0,12:0.0):1.0):2.0,(6:2.0,15:1.0):1.0):3.0,((9:1.0,10:1.0):4.0,11:4.0):2.0,13:0.0,14:2.0,16:2.0,((17:0.0,18:2.0):7.0,(19:1.0,20:1.0):8.0):2.0):6.0,(21:8.0,(23:4.0,24:6.0):3.0):2.0,22:19.0):0.0; END; BEGIN TREES; TITLE 'Herpystichum-psbAtrnH'; LINK TAXA = Taxa3; TRANSLATE 1 'Solanum evolvulifolium Greenm.-LB183', 2 'Solanum evolvulifolium Greenm.-LB709', 3 'Solanum evolvulifolium Greenm.-LB2415', 4 'Solanum evolvulifolium Greenm.-LB2520', 5 'Solanum phaseoloides Pol.-LB693', 6 'Solanum phaseoloides Pol.-LB1727', 7 'Solanum loxophyllum Bitter-LB2396', 8 'Solanum loxophyllum Bitter-LB2521', 9 'Solanum crassinervium Tepe-LB2397', 10 'Solanum limoncochaense Tepe-LB2391', 11 'Solanum limoncochaense Tepe-LB2466', 12 'Solanum pacificum Tepe-LB2395', 13 'Solanum dalibardiforme Bitter-LB2454', 14 'Solanum trifolium Dunal-LB2368', 15 'Solanum anceps Ruiz & Pav.-LB654', 16 'Solanum anceps Ruiz & Pav.-LB2408', 17 'Solanum brevifolium Dunal-LB1029', 18 'Solanum caripense Dunal-LB1026', 19 'Solanum bulbocastanum Dunal -Spooner4', 20 'Solanum lycopersicum L.-RGO340'; TREE 'Fig. S1-psbAtrnH' = [&R] ((((((((1:0.0,2:0.0,((3:0.0,(4:1.0,9:0.0):1.0):1.0,(7:0.0,8:0.0):1.0):1.0):6.0,13:2.0):1.0,12:2.0):3.0,(5:0.0,6:0.0):1.0):1.0,14:3.0):1.0,(10:0.0,11:0.0):3.0,(15:0.0,16:1.0):5.0):2.0,17:6.0):4.0,18:7.0,(19:3.0,20:10.0):6.0); END; BEGIN TREES; TITLE 'Herpystichum-GBSSI'; LINK TAXA = Taxa6; TRANSLATE 1 'Solanum evolvulifolium Greenm.-LB183', 2 'Solanum evolvulifolium Greenm.-LB709', 3 'Solanum evolvulifolium Greenm.-LB2253', 4 'Solanum evolvulifolium Greenm.-LB2415', 5 'Solanum evolvulifolium Greenm.-LB2520', 6 'Solanum dolichorhachis Bitter-LB2512', 7 'Solanum loxophyllum Bitter-LB2396', 8 'Solanum loxophyllum Bitter-LB2521', 9 'Solanum phaseoloides Pol.-LB693', 10 'Solanum phaseoloides Pol.-LB1727', 11 'Solanum pentaphyllum Bitter-LB2515', 12 'Solanum crassinervium Tepe-LB2397', 13 'Solanum limoncochaense Tepe-LB2391', 14 'Solanum limoncochaense Tepe-LB2466', 15 'Solanum pacificum Tepe-LB2395', 16 'Solanum dalibardiforme Bitter-LB2454', 17 'Solanum trifolium Dunal-LB2368', 18 'Solanum anceps Ruiz & Pav.-LB654', 19 'Solanum anceps Ruiz & Pav.-LB2408', 20 'Solanum brevifolium Dunal-LB1029', 21 'Solanum caripense Dunal-LB1026', 22 'Solanum bulbocastanum Dunal-Spooner4', 23 'Solanum lycopersicum L.-RGO340'; TREE 'Fig. S1-GBSSI' = [&R] ((((((((1:0.0,2:0.0):5.0,(3:4.0,((7:6.0,8:3.0):2.0,12:10.0):3.0):2.0):1.0,((4:1.0,5:1.0):1.0,6:3.0):7.0):3.0,15:9.0):2.0,16:13.0):2.0,17:10.0):4.0,((9:0.0,11:2.0):3.0,10:1.0):10.0,(13:3.0,14:7.0):15.0,(18:1.0,19:2.0):18.0):32.0,(20:29.0,(22:19.0,23:72.0):32.0):8.0,21:30.0); END; BEGIN TREES; TITLE 'Herpystichum-cos11'; LINK TAXA = Taxa9; TRANSLATE 1 'Solanum evolvulifolium Greenm.-LB183', 2 'Solanum evolvulifolium Greenm.-LB709', 3 'Solanum evolvulifolium Greenm.-LB2253', 4 'Solanum evolvulifolium Greenm.-LB2415', 5 'Solanum evolvulifolium Greenm.-LB2520', 6 'Solanum phaseoloides Pol.-LB693', 7 'Solanum phaseoloides Pol.-LB1727', 8 'Solanum pentaphyllum Bitter-LB2515', 9 'Solanum loxophyllum Bitter-LB2396', 10 'Solanum loxophyllum Bitter-LB2521', 11 'Solanum crassinervium Tepe-LB2397', 12 'Solanum limoncochaense Tepe-LB2391', 13 'Solanum limoncochaense Tepe-LB2466', 14 'Solanum pacificum Tepe-LB2395', 15 'Solanum dalibardiforme Bitter-LB2454', 16 'Solanum trifolium Dunal-LB2209', 17 'Solanum trifolium Dunal-LB2368', 18 'Solanum anceps Ruiz & Pav.-LB654', 19 'Solanum anceps Ruiz & Pav.-LB2408', 20 'Solanum brevifolium Dunal-LB1029', 21 'Solanum caripense Dunal-LB1026', 22 'Solanum bulbocastanum Dunal-Spooner4', 23 'Solanum lycopersicon L.-RGO340'; TREE 'Fig. S1-cos11' = [&R] (((((((1:0.0,2:0.0,11:5.0):1.0,3:1.0):1.0,(((4:0.0,5:0.0):5.0,9:1.0):3.0,10:3.0):1.0,((6:0.0,7:2.0):3.0,8:3.0):2.0,14:6.0):3.0,15:9.0):5.0,((16:0.0,17:0.0):6.0,(22:17.0,23:25.0):16.0):12.0,(18:0.0,19:0.0):20.0):12.0,(12:0.0,13:0.0):11.0):21.0,20:22.0,21:24.0); END;