#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 8:43 GMT TreeBASE (cc) 1994-2008 Study reference: Farruggia F.T., & Howard J.H. 2011. Examination of five nuclear markers for phylogenetic study of Hologalegina (Leguminosae). Brittonia, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S11118] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=50; TAXLABELS Alhagi_maurorum Astragalus_alpinus Astragalus_americanus Astragalus_canadensis Astragalus_nothoxys Caragana_arborescens Cicer_arietinum Cicer_pinnatifidum Colutea_arborescens Coursetia_glandulosa Galega_orientalis Glycine_max Glycyrrhiza_lepidota Lathyrus_sativus Lotus_grandiflorus_B Lotus_purshianus Medicago_arabica Medicago_lanigera Medicago_monantha Medicago_sativa Medicago_truncatula Olneya_tesota Oxytropis_deflexa Oxytropis_lambertii Oxytropis_parryi Oxytropis_pilosa Oxytropis_viscida Peteria_thompsonae Robinia_neomexicana Sesbania_bispinosa Sesbania_brachycarpa Sesbania_cinerascens Sesbania_formosa Sesbania_grandiflora Sesbania_herbacea Sesbania_microphylla Sesbania_punicea Sesbania_quadrata Sesbania_rostrata Sesbania_sesban Sesbania_tetraptera Sesbania_tomentosa Sesbania_vesicaria Sutherlandia_frutescens_WOJ266 Swainsona_pterostylis Trifolium_repens 'Trigonella foenum-graecum' Trigonella_kotschyi Vicia_faba Wisteria_floribunda ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=48; TAXLABELS Alhagi_maurorum Astragalus_alpinus Astragalus_americanus Astragalus_canadensis Astragalus_nothoxys Caragana_arborescens_B Colutea_arborescens Coursetia_glandulosa Galega_orientalis Glycine_max Glycyrrhiza_lepidota Lathyrus_sativus Lotus_grandiflorus Lotus_purshianus Medicago_arabica Medicago_lanigera Medicago_monantha Medicago_sativa Medicago_truncatula Olneya_tesota Oxytropis_deflexa Oxytropis_lambertii Oxytropis_parryi_B Oxytropis_pilosa Oxytropis_viscida Peteria_thompsonae Robinia_neomexicana Sesbania_bispinosa Sesbania_brachycarpa Sesbania_cinerascens Sesbania_formosa Sesbania_grandiflora Sesbania_herbacea Sesbania_microphylla Sesbania_punicea Sesbania_quadrata Sesbania_sesban Sesbania_tetraptera Sesbania_tomentosa Sesbania_vesicaria Sutherlandia_frutescens Swainsona_frutescens Trifolium_pratense Trifolium_repens 'Trigonella foenum-graecum B' Trigonella_kotschyi Vicia_faba Wisteria_floribunda ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7471] TITLE Triosephosphate_Translocator; LINK TAXA = Taxa1; DIMENSIONS NCHAR=343; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alhagi_maurorum ATA{CG}CGATCA{AG}TGGTTCTGA{CT}GTTGTTTTGCGCAATAGACATGCAACCCTAGTTCAG------CCACGGTCGTTT---TTACCTTCTCTGGCAAGAGAAAAAGGTCAAAGATCTCTTGTTTCAGTGCAAAAGCCTCTTCACCTTGCA---T{CG}TCTTGGTGTTGGA---AATTTTGGGGCAGTGAAGAATTTTGAG------TCAGA{AG}---AAGGGTTTTGGAAGG---GATGATTTGGTGAAGTGTGGAGCATATGAAGC{AT}GATA{CG}ATCAGAGGTTGAAG{CG}TGCAGG{CG}------ACACCAT{CG}TGAGGCTGC{AC}AAAAAAGTGAAAATTGGCATA{GT}ATTTTGCAA Astragalus_alpinus ATAACGATCAGTGGTTCCGAAATTGTTTTGGGGAAAAGACATGCAACTCCAATTCGG------CCACGGTCGTTT---TTACCTTCTCTGGGAAGAGAAAAAGCTCAGAGATCTCTTGTTTCAGTGCAAAAGCCTCTGCACCTTGCA---TGTCTTGGTGTTGGT---AAATTTGGATCAGTGAAGAATTTTGAG------TCAGAG---AAGAGTTTTGGAAGG---GATGATTTGGTGAAGTGTGGAGCCTATGAAGCTGATAAATCAGAGGTTGAAGGTGCAGGG------ACACCAACTGAGGCTGCC??????????????????????????????? Astragalus_americanus ATAACGATCAGTGGTTCCGAAATTGTTTTGGGGAAAAGACATGCAACCCCAATTCAG------CCACGGTCGTTT---TTACCTTCTCTGGGAAGAGAAAAAGCTCAGAGATCTCTTGTTTCAGTGCAAAAGCCTCTGCACCTTGCA---TGTCTTGGTGTTGGA---AAATTTGGGTCAGTGAAGAATTTTGAG------TCAGAG---AAGAGTTTTGGAAGG---GATGATTTGGTGAAGTGTGAAGCCTATGAAGCTGATAAATCAGATGTTGAAGCTGCAGGG------ACACCAACTGAGGCTGCCAAAAAGGTGAAAATTGGGTTATATTTTGCAA Astragalus_canadensis ATAACGATCAGTGGTTCCGAAATTGTTTTGGGGAAAAGACTTGCAACCCCAATTCAG------CCACGGTCGTTT---TTACCTTCTCTGGGAAGAGAAAAAGCTCAGAGATCTCTTGTTTCACTGCAAAAGCCTCTGCACCTTGCA---TGTCTTGGTGTTGGA---AACTTTGGATCAGTGAAGAATTTTGAG------TCAGAA---AAGAGTTTTGGAAGG---GATGATTTGGTGAAGTGTGGAGCCTATGAAGCTGATAAATCAGAGGTTGAAGGTGCAGGG------ACACCAAGTGAGGCTGCCAAAAAGGTGAAAATTGGGTTATATTTTGC?? Astragalus_nothoxys ATAACGATCAGTGGTTCCGATATTGTTTTGGGGAAAAGACATGCAACCCCAATTCAG------GCACTGTCGTTT---TTACCTTCTCTGGGAAGAGAAAAAGCTCAGAGATCTCTTGTTTCAGTGCAAAAGCCTCTGCACCTTGCA---TGTCTTGGTGT{CT}GGA---AAATTTGGA------------------------TCAGAG---AAGAGTTTTGGAAGG---GATGATTTGGTGAAGTGTGGAGCCTATGAAGCTGATAAATCAGAGGTTGAAGGTGCAGGG------ACACCAACTGAGGCTGCCAAAAAGGTCAAAATTGGGTTATATTTTGCAA Caragana_arborescens ATAACGATCAGTGGTTCTGATGTTGTTTTGAGGAATAGACATGCAACCCTAGTTCAG------CCAAGGTCGTTT---TTACCTTCTCTGGCAAGAGAAAAAACTCAGAGATCTCTTGTTTCTGTGAAAAAGCCTCTTCACCTTGCA---TCTCTTGGTGTTGGG---AATTTTGGGGCAGTGAAGAGTTTTGAG------ACAGAG---AAGAGTTTTGAAAGG---GATGATTTGGTGAAGTGTGGTGCATATGAAGCAGACAGATCAGAGGTTGAAGCTGCAGGG------ACACCATCTGAGGCTGCCAAAAAGGTTAAAATTGGGATATATTTTGCA{AG} Cicer_arietinum ATAGCGATCAGTGGTTCTGATGTTGTTTTAAGGAAAAGACATGGAACCCTAGTTCAA------CCACAGTCGTTT---TTACCTTCACTGGTAAGAGGAAAATCACAGAGATCTCTTGTTTCAGTGCAAAAGCCTCTTCACCTTGCA---TGTGTTGGTGTTGGA---AATTTTGGGTCAGTGAAGAGTTTTGAT------TCAGTG---AAGGGTTTTGGAAGT---GATGATTTGGTTAAGTGTGAAGCCTATGAAGCTGATAGATCGGAGGTTGAAGGTGCAGCA------ACACCATCAGAAGCTGCAAAAAAAGTGAAAATTGGGATATATTTTGCA? Cicer_pinnatifidum ????????????GGTTCTGATGGTGTTTTAAGGAAAAGACATGGAACCCTAGTTCAA------CCACAGTCGTTT---TTACCTTCATTGGTAAGAGGAAAATCCCAGAGATCTCTTGTTTCAGTGCAAAAGCCTCTTCACCTTGCA---TGTGTTGGTGTTGGA---AATTTTGGGTCAGCGAAGAGTTTTGAT------TCAGTG---AAGGGTTTTGGAAGT---GATGACTTGGTTAAGTGTGAAGCCTATGAAGCTGATAGATCAGAGGTTGAAGGTGCAGGA------ACACCATCAGAAGCTGCAAAAAAAGTGAAAATTGGG????????????? Colutea_arborescens ??AACGATCAGTGGTTCCGAAATTGTTTTGGGGAAAAGACATGCAACCCCAGTTCAG------GCACGGTCGTTT---TTACCTTCTCTGGGAAGAGAAAAAGCTCAGAGATCTCTTGTTTCGGTGCAAAAGCCTCTGCACCTTGCA---TGCCTTGGTGTTGGA---AATTTTGGGTCGGTGAAGAATTTTGAG------TCAGAC---TTGAGTTTTGGAAGA---GATGATTTGGTGAAGTGTGGGGCCTATGAAGCTGATAAATCAGAGATTGAAGCGGCAGGG------ACACCAACAGAGGCTGCCAAAAAGGTGAAAATTGGGTTATATTTTGCAA Coursetia_glandulosa GTAGGGATCAATGGTTCTGATGTTATTTTGAGGAAAAGACATGCAACCCCAGTGAAG---AAATTTGGGTTGTTT---TTACCTTCTTTCTCAAGAGAAAAAGCTCAGAGATCTCTTGTTTCAGTGCAAAAGCCTTTGCACCTTGCA---TGTCTTGGTGGTGGG---AATTTTGGGTCAGTGGAGAATTTTGAG------TCTGGG---AAGAATCTAGTAAGA---GATGATTTGGTGAAGTGTGGGGCTTATGAGGCAGATAGATCAGAAATTGAAGCTGCAGAG------ACACCATCAGAGGCTGCAAAGAAGGTGAAAATTGGGATATATT?????? Galega_orientalis ATTGCGATCAGTGGTTCTGATGTTGTTTTAGGGAAAAGACATGCAACCCTAGTTCAG------CCACAGTTGTTTTTTTTACCTTCATTGGTGAGAGAAAAAACACATAGATCTATTGTTTCAGTGCAAAAACCTCTTCATCTTGCA---TGTCTTGGTGTTGGA---AATTTAGGGTCAGTGAAGAATTTTGAG------TTAGGG---AAGAGTGTTGGAAAA---AATGATTTGGTGAAGTGTGAGGCTTATGAAGCTGATAGATCAGAGATTGAACCTGCAGGA------ACACCATCAGAAGCTGCAAAAAAAGTGAAAATTGGGATATATTTTGCA? Glycine_max GTAGGGATCAGTGGTTCTGATCTTCCTTTGAGGCAAAGACATGCAACTCCAATTAAG------GCAAGGTCGTTT---TTACCCTCTTTGTCAAGAGAAAAGGGTCAAGGATCTCTTGTTTCAGTTCAAAAGCCACTCCACATTGGTGCTTCTCTTGGTGTTGGA---AATTTTGCGTCAGTGAAGAG---TGA---------------------TGCTAAAAGG---GGTGATTTGGTGAAGTGTGAGGCCTATGAGGCAGACAGATCAGAGGTTGAGGGTGCAAGC------ACACCGTCAGAGGCTGCAAAGAAGGTAAAAATTGGGATATATTTTGCAA Glycyrrhiza_lepidota ATAGCGATCAGTGGTTCTGATATTGTTTTGAGGAACAGACATGCAACCCCAGTTCAG------CCACGATCGTTT---TTACCTTCTCTGCTGAGAGAAAAAGCTCAGAGATCTCTGGTTTCAGTGCAAAAGCCTCTGCACCTTGCA---TCCCTTGGTGTTGGG---AATTTTGGGCCGGTGAAGAATCTCGAT------TCAGAG---AAGATTTTTGGAAGAGGTGTTGATTTGGTGAAGTGTGGAGCGTATGAAGCAGACAGATCAGAGGTTGAAGCTGCTACG---------CCATCAGAGGCTGCCAAAAAGGTTAAAATTGGGATATATTTTGCAA Lathyrus_sativus ?TTTCGATCAGTGGTTCCGGTGTTGTTTTAAGGAAAAGACATGTAACCCTAATTCAGCCACAACCACAATCGTTT---TCACCTCTCTTGTCAAGAGAGAAATCACATAGATCTGTTGTTTCAATGAAGAAGCCTCTTCATCTTGCA---TGTGTTGGTGTTGGA---AATTTTGGGTCTGTGAAGAATTTTGAG------TCCGAG---GAGAGTTTTGGGAAA---AGTGATTTGGTGAAGTGTGGGGCTTATGAGGCTGATAGATCAGAGGTTGAAGGTGGTGGTGGTGGAGCCCCATCTGAGGCTGCTAAGAAGGTGAAAATTGGGATATATTTTGCG? Lotus_grandiflorus_B ATAGGGATCACTGGTTCTGATGTTGTTTTGAGGAGAACACATGCAACCACAGTGCAG------TCACGGTCGTTT---TTACCTTCTCTGTCAACAGAAAGACCTCAGAGATCTCTGGTTTCAGTGCAAAAGCCACTGCACCTTGCAGCATCTCTTGGTGTTGGAGGAAGTTTTGGGCCTCTGGAGAATTTCGAG------TCAGAGAAGAAGAATCTCGGAAGGGGTGATGATTTGGTGAAGTGTGGAGCTTATGAGGCAGACAGATCAGAGATTGAAGCTGCAGCAGCAGCAACGCCATCAGAGGCTGCGAAGAAGGTGAAAATTGGGATATATTTTGCAA Lotus_purshianus ???GGGATCACTGGTTCTGATGTTGTTTTGAGGAGAACACATGCAACCACAGTGCAG------TCACGGTCGTTT---TTACCTTCTCTGTCAAGAGAAAGAACTCAGAGATCTCTGGTCTCAGTGCAAAAGCCACTGCACCTTGCAGCATCTCTTGGTGTTGGAGGAAGTATTGGGCCTCTGAAGAATTTCGAG------TCAGAGATGAAGAATCTCGGAAGGGGTGATGATTTGCTTAAGTGTGGAGCTTATGAGGCAGACAGATCAGAGATTGAAGCTGCAGCA------ACGCCATCAGAGGCTGCGAAGAAGGTGAAAATTGGGATATATTTTGCA? Medicago_arabica ATTGTGATCACTGGTTCTGATGCTGGTTTAGGGAAAAGACATGCAACCCTAGTTCAA------CCACAATCTTTT---TTACCATCTTTGGTTGGTGGAAAATCACAAAGATCTGTGATTTCAATGAAGAAACCTCTTCATATTGCA---TGTGCTGGTGTTGGA---AATTTTGGGTCAGTGAAGAATTTTGAATTTGAATCAGAG---AAGAGTTTTGAAAAG---GGTGATTTGGTGAAGTGTGAAGCTTATGAAGCTGATAGATCAGAGATTGAAGGTGCAGAA------ACACCTTCAGAGGCTGCAAAGAAAGTGAAAATTGGGATATATTTTGCAA Medicago_lanigera ATTGTGATCACTGGTTCTGATGCTGTTTTAGGGAAAAGACATGCAACCCTAGTTCAA------CCACAATCTTTT---TTACCATCTTTGGTTGGTGGAAAATCACAAAGATCCGTGATTTCAATGAAAAAGCCTTTGCATCTTGCA---TGTGTTGGTGTTGGA---AATTTTGGGTCAGTAAAGAATTTTGAA------TCAGAG---AAGAGTTTTGAAAAG---GGTGATTTGGTGAAGTGTGAAGCTTATGAAGCTGATAGATCAGAGGTTGAAGGTGCAGGA------ACACCTTCAGAGGCTGCAAAAAAAGTGAAAATTGGGATATATTTTGCAA Medicago_monantha ATTGTGATCAATAGTTCTGATTCTGTTTTAGGGAAAAGACATGCAACCCTAGTTCAA------CCACAATCTTTT---TTACCATCTTTGGTTGGTGGAAAATCACAAAGATCTATGATTTCAATGAAAAAGCCTCTTCATATTGCA---TGTGTTGGTGTTGGA---AATTTTGGGTCAGTGAAGAATTTTGAA------TCAGAC---AAGAGTTTTGAAAAG---GGTGATTTGGTGAAGTGTGAAGCTTATGAAGCTGATAGATCAGAGGTTGAAGGTGCAGGA------ACACCTTCAGAGGCTGCAAA{AG}AAAGTGAAAATTGGGATATATTTTGCAA Medicago_sativa ?TTGTGATCACTGGTTCTGATGCTGGTTTAGGGAAAAGACATGCAACCCTAGTTCAA------CCACAATCTTTT---TTACCATCTTTGGTTGGTGGAAAATCACAAAGATCTGTTTTTTCATTGAAAAAGCCT{CT}TTCATATTGCA---TGTGTTGGTGTTGGA---AATTTTGGGTCAGTGAAGAATTTTGAA------TCAGAG---AAGAGTTTTGAAAAG---GGAGATTTGGTGAAGTGTGAAGCTTATGAAGCTGATAGATCAGAGATTGAAGGTGCAGGA------ACACCTTCAGAGGCTGCAAAGAAATTGAAAATTGG?????????????? Medicago_truncatula ?TTGTGATCACTGGTTCTGATGCCGGTTTAAGGAAAAGACATGCAACCCTAGTTCAA------CCACAATCTTTT---CTCCCATCTTTGGTTGGTGGAAAATCACAAAGATCTGTGATTTCAATGAAGAAGCCTCTTCATATTGCA---TGTGCTGGTGTTGGA---AATTTTGGGTCAGTGAAGAATTTTGAATTTGAATCAGAGAAGAAGAGTTTTGAAAAG---GGTGATTTGGTGAAGTGTGAAGCTTATGAAGCTGATAGATCAGAGGTTGAAGGAGCAGAA------ACACCTTCAGAGGCTGCAAAGAAAGTGAAAA?????????????????? Olneya_tesota GTAGGGATCAATGGTTCTGACGTTGTTTTGAGGA{GT}AAGACATGCAACCCCAGTGAAG---AATTTTGGGTTGTTT---TTACCTTCTCTGTCAAGAGAAAAAGCTCAGAGATCTCTTGTTTCAGTGCAAAAGCCTTTGCACCTTGCA---TGTCTTGGGGTTGGA---AATTTTGGGTCAGTGAAGAATTTTGAG------TCAGAG---AAGAATCTTGGAAGA---GATGATTTGGTGAAGTGTGGAGCTTATGAGGCAGATAGAACAGAAATTGAAGCTGCAGGG------ACACCATCAGAGGCTGCTAAGAGGGTGAAAATTGGGATATATTTTGCAA Oxytropis_deflexa ATAACGATCAGTGGTTATGAAATTGTTTTGGGGAAAAGACATGCAACCCTAATTCAG------CCACGGTCGTTT---TTACCTTCTCTGGGAAGAGAGAAAACTCAAAGATCTCTTGTTTCAGTGCAAAAGCCTCTGCACCTTGCA---TGTGTTGGTGTTGGA---AATTTTGGGTCAGTGAAGAATTTTGAA------TCAGAT---AAGAGTTTTGGAAGG---GATGATTTGGTGAAGTGTGGAGCCTATGAAGCTGATAAATCAGAGGTTGAAGGTGCAGAG------ACACCAACTGAGGCTGCAAAAAAAGTGAAAATTGGGTTATATTTTGCAA Oxytropis_lambertii ATAACGATCAGTGGTTCTGAAATTGTTTTGGGGAAAAGACATGCAACCCTAGTTCAG------CCACGGTCGTTT---TTACCTTCT{AG}TGGGAAGAGAAAAAACTGAAAGATCTCTTGTTTCAGTGCAAAAGCCTCT{CG}CACCTTGCA---TGTGTTGGTGTTGGG---AATTTTGGGTCAGTGAAGAATTTTGAA------TCAGAT---{CT}AGAGTTTTG{CT}AAGG---GATGATTTGGTGAAGTGTGGAGCATATGAAGCTGATAAATCAGAGGTTGAAGGTGCAGAG------ACACCAACTGAGGCTGCAAAAAAGGTGAAA??????????????????? Oxytropis_parryi ATAACGATCAGTGGTTCTGAAATTGTTTTGGGGAAAAGACATGCAACCCTAGTTCAG------CCACGGTCGTTT---TTACCTTCTCTGGGAAGAGAAAAAACTCAAAGATCTCTTGTTTCAGTGCAAAAGCCTCTCCACCTTGCA---TGTGTTGGTGTTGGG---AATTTTGGGTCAGTGAAGAATTTTGAA------TCAGAT---AAGAGTTTTGGAAGG---GATGATTTGGTGAAGTGTGGAGCATATGAAGCTGATAAATCAGAGGTTGAAGGTGCAGAG------ACACCAACTGAGGCTGCCAAAAAGGTGAAAATTGGGTTATATTTTGCAA Oxytropis_pilosa ATAACGATCAGTGGTTCTGAAATTGTTTTGGGGAAAAGACATGCAACCCTAATTCAG------CCACGGTCGTTT---TTACCTTCTCTAGGAAGAGA{CG}AAAACTCAAAGATCTCTTGTTTCAGTGCAAAAGCCTCTGCACCTTGCA---TGTGTTGGTGTTGGA---AATTTTGGGTCAGTGAAGAATTTTGAA------TCAGAT---AAGAGTTTTGGAAGG---GATGATTTGGTGAAGTGTGGAGCCTATGAAGCTGATAAATCAGAGGTTGAAGGTTCAGAG------ACACCAACTGAGGCTGCAAAAAA{AG}GTGAAAATTGGGTTATATTTTGCAA Oxytropis_viscida ATAACGATCAGTGGTTCTGAAATTGTTTTGGGGAAAAGACATGCAACCCTAGTTCAG------CCACGGTCGTTT---TTACCTTCTCTGGGAAGAGAAAAAACTCAAAGATCTCTTGTTTCAGTGCAAAAGCCTCTCCACCTTGCA---TGTGTTGGTGTTGGG---AATTTTGGGTCAGTGAAGAATTTTGAA------TCAGAT---AAGAGTTTTGAA{AC}GG---GATGATTTGGTGAAGTGTGGAGCATATGAAGCTGATAAATCAGAGGTTGAAGGTGCAGAG------ACACCAACTGAGGCTGCCAAAAAGGTGAAAATTGGGTTATATTTTGCAA Peteria_thompsonae GTAGGGATCAATGGTTCTGATGTTGTTTTGAGGAAAAGACATGCAACCCCAGTGAAG---AATTTTGGGGTGTTT---TTACCTTCTCTGTCAAGAGAAAAAGCTCAGAGATCTCTTGTTTCAGTGCAAAAGCCTTTGCACCTTGCA---TGTCTTGGTGTTGGA---AATTTTGGGTCAGTGGAGAATTTTGAG------ATAGAG---AAGAATCTTGGAAGA---GATGATTTGGTGAAGTGTGGGGCTTATGAGGCAGATAGATCAGAAATTGAAGCTGCAGGG------ACACCATCAGAGGCTGCTAAGAAGGTGAAAATTGGGATATATTTTGCTA Robinia_neomexicana GTAGGGATCAATGGTTCTGATGTTGTTTTGA{CG}GAAAAGACATGCAACCCCAGTGAAG---AATTTTGGGTTGTTT---TTACCTTCTCTTTCAAGAGAAAAAGCTCAGAGATCTCTTGTTTCAGTGCAAAAGCCTTTGCACCTTGCA---TGTCTTGGTGTTGGA---AATTTTGGGTCAGTGGAGAATTTTGAG------TCAGAG---AAGAATCTTGGAAGA---GATGATTTGGTGAAGTGTG{AG}AGCTTATGAGGCAGACAGATCAGAAATTGAAGCTGCAGGG------AC{AG}CCATCAGAGGCTGCAAAGAAGGTGAAAATTGGGATATATTTT???? Sesbania_bispinosa ???????????????TCTGGTGTTGTTCTGAGGAACAGACATGCAACCCCACTTCAA------CCACGGTCGTTT---TTACCTTCTCTGTCAAGAGAAAAAATTCAGAAACCCCTTGTTTCAGTGCAAAAGCCTCTGCACCTTGCA---TGTCTT---------------TTTGGGTCGGTGAAGAATTTTGAG------TCAGAG---AAGAATCCTAGGAGG---GATGATTTGGTGAAGTGTGGAGCGTATGAGGCAGATAGATCAGAGATTGAAGCTGCAGCC------ACGCCAACAGAGGCTGTCAATAAGGTGAAAATTGGGATATATTTTGCAA Sesbania_brachycarpa ATAGGGATCACCGGCTCTGGTGTTGTTCTGAGGAACAGACATGCAACCCCACTTCAA------CCACGGTCGTTT---TTACCTTCTCTGTCAAGAGAAAAAGTTCAGAAACCCCTTGTTTCAGTGCAAAAGCCTCTGCACCTTGCA---TGTCTT---------------TTTGGGTCGGTGAAGAATTTTGAG------TCAGAG---AAGAATCCTAGGAGG---GATGATTTGGTGAAGTGTGGAGCGTATGAGGCAGATAGATCAGAGATTGAAGCTGCAGCC------ACGCCAACAGAGGCTGTCAATAAGGTGAAAATTGGGATATATTTTGCAA Sesbania_cinerascens ATAGGGATCACCGGCTCTGGTGTTGTTCTGAGGAACAGACATGCAACCCCAGTTCAA------CCACGGTCGTTT---TTACCTTCTCTGTCAAGAGAAAAAGTTCAGAAACCCCTTGTTTCAGTGCAAAAGCCTCTGCACCTCGCA---TCTCTT---------------TTTGGGTCGGTGAAGAATTTTGAG------TCAGAG---AAGAATCCTAGGAGG---GATGATTTGGTGAAGTGTGGAGCGTATGAGGCAGATAGATCAGAGATTGAAGCTGCAGCC------ACGCCAACAGAGGCTGTCAATAAGGTGAAAATTGGGATATATTTTGCAA Sesbania_formosa ATAGGGATCACCGGCTCTGGTGTTGTTCCGATGAACAGGCATGCAACCCCACTTCAA------CCACGGTCGTTT---TTACCTTCTCTGTCAAGAGAAAAAGTTCAGAAACCCCTTGTTTCAGTGCAAAAGCCTCTGCACCTTGCA---TGTCTT---------------TTTGGGTCGGTGAAGAATTTTGAG------TCAGAG---AAGAATCCTAGGAGG---GATGATTTGGTGAAGTGTGGAGCGTATGAGGCAGATAGATCAGAGATTGAAGCTGCAGCC------ACGCCAACAGAGGCTGTCAATAAGGTGAAAATTGGGATATATTTTGCAA Sesbania_grandiflora ATAGGGATCACCGGCTCTGGTGTTGTTCCGATGAACAGACATGCAACCCCACTTCAA------CCACGGTCGTTT---TTACCTTCTCTGTCAAGAGAAAAAGTTCAGAAACCCCTTGTTTCAGTGCAAAAGCCTCTGCACCTTGCA---TGTCTT---------------TTTGGGTCGGTGAAGAATTTTGAG------TCAGAG---AAGAATCCTAGGAGG---GATGATTTGGTGAAGTGTGGAGCGTATGAGGCAGATAGATCAGAGATTGAAGCTGCAGCC------ACGCCAACAGAGGCTGTCAATAAGGTGAAAATTGGGATATATTTTGCAA Sesbania_herbacea GTAGGGATCACCGGCTCTGGTGTTGTTCTGAGGAACAGACCTGCAACCCCAGTTCAG------CCACGGTCATTT---TTACCTTCTCTGTCAAGAGAAAAAGTTCAGAAACCCCTTGTTTCAGTGCAAAAACCTCTGCACCTTGCA---TCTCTTGGTGTTGGA---AATTTTGGGTCGGTGAGGAATTTTGAG------TCAGAG---AAGAATCCTGGGAGG---GATGATTTGGTGAAGTGTGGAGCGTATGAGGCAGACAGATCAGAGATTGAAGCTGCAGCC------ACGCCAACAGAGGCTGTCAATAAGGTGAAAATTGGG????????????? Sesbania_microphylla ATAGGGATCACCGGCTCTGGTGTTGTTCTGAGGAACAGACATGCAACCCCAGTTCAA------CCACGGTCGTTT---TTACCTTCTCTGTCAAGAGAAAAAGTTCAGAAACCCCTTGTTTCAGTGCAAAAGCCTCTGCACCTTGCA---TCTCTT---------------TTTGGGTCGGTGAAGAATTTTGAG------TCAGAG---AAGAATCCTAGGAGG---GATGATTTGGTGAAGTGTGGAGCGTATGAGGCAGATAGATCAGAGATTGAAGCTGCAGCC------ACGCCAACAGAGGCTGTCAATAAGGTGAAAATTGGGATATATTTTGCAA Sesbania_punicea ATAGGGATCACCGGCTCTGGCGTTGTTCTGAGGAACAGACATGTAACCCCAGTTCAG------CCACGGTCGTTT---TTACCTTCTCTGTTAAGAGAAAAACCTCAGAGATCCCTGGTTTCAGTGCAAAAGCCTCTGCACCTTGCA---TCTCTTGGTGTTGGA---AATTTTGGTTCGGTGAAGAATTTTGAG------TCAGAG---AAGAATCCTGGGAGG---GATGATTTGGTGAAGTGTGGAGCGTATGAGGCAGATAGATCAGAGATTGAAGCTGCAAGC------ACGCCATCAGTGGCTGTCAATAAGGTGAAAATTGGGATATATTTTGCAA Sesbania_quadrata ATAGGGATCACCGGCTCTGGTGTTGTTCTGAGGAACAGACATGCAACCCCAGTTCAA------CCACGGTCGTTT---TTACCTTCTCTGTCAAGAGAAAAAGTTCAGAAACCCCTTGTTTCAGTGCAAAAGCCTCTGCACCTTGCA---TCTCTC---------------TTTGGGTCGGTGAAGAATTTTGAG------TCAGAG---AAGAATCCTGGGAGG---GATGATTTGGTGAAGTGTGGAGCGTATGAGGCAGACAGATCAGAGATTGAAGCTGCAGCC------ACGCCAACAGAGGCTGTCAATAAGGTGAAAATTGGGATATATTTTGCAA Sesbania_rostrata ATAGGGATCACCGGCTCTGGTGTTGTTCTGAGGAACAGGCATGCAACCCCAGTTCAA------CCACGGTCGTTT---TTACCTTCTCTGTCAAGAGAAAAAGTTCAGAAACCCCTTGTTTCAGTGCAAAAGCCTCTGCACCTTTTA---TCTCTTGGTGTTGGA---AATTTTGGGTCGGTGAAGAATTTTGAG------TCAGAG---AAGAATCCTGGGAGG---GATGATTTGGTGAAGTGTGGAGCCTATGAGGCTGATAGATCAGAGATTGAAGCTGCAGCC------ACGCCAACAGAGGCTGTCAATAAGGTGAAAATTGGGATATATTTTGCAA Sesbania_sesban ATAGGGATCACCGG{AC}T{CG}TGGTGTTGTTCTGAGGAACAGACATGCAACCCCACTTCAA------CCACGGTCGTTT---TTACCTTCTCTGTCAAGAGAAAAAGTTCAGAAACCCCTTGTTTCAGTGCAAAAGCCTCTGCACCTTGCA---TCTCTT---------------TTTGGGTCGGTGAGGAATTTTGAG------TCAGAG---AAGAATCCTGTGAGG---GATGATTTGGTGAAGTGTGGAGCGTATGAGGCAGATAGATCAGAGATTGAAGCTGCAGCC------ACGCCAGCAGAGGCTGTCAATAAGGTGAAAATTGGGATATATTTTGCAA Sesbania_tetraptera ATAGGGATCACCGGCTCTGGTGTTGTTCTGAGGAACAGACATGCAACCCCAGTTCAA------CCACGGTCGTTT---TTACCTTCTCTGTCAAGAGAAAAAGTTCAGAAACCCCTTGTTTCAGTGCAAAAGCCTCTGTACCTTGCA---TCTGTTGGTGTTGGA---AATTTTGGGTCGGTGAGGAATTTTGAG------TCAGAG---AAGAATCCTGGGAGG---GATGATTTGGTGAAGTGTAGAGCCTATGAGGCAGATAGATCAGAGATTGAAGCTGCAGCC------ACGCCAACAGAGGCTGTCAATAAGGTGAAAATTGGGATATATTTTGCAA Sesbania_tomentosa ATAGGGATCACCGGCTCTGGTGTTGTTCTGAGGAACAGACATGCAACCCCAGTTCAA------CCACGGTCGTTT---TTACCTTCTCTGTCAAGAGAAAAAGTTCAGAAACCCCTTGTTTCAGTGCAAAAGCCTCTGCACCTTGCA---TCTCTTGGTGTTGGA---AATTTTGGGTCGGTGAGGAATTTTGAG------TCAGAG---AAGAATCCTAGGAGG---GATGATTTGGTGAAGTGTGGAGCGTATGAGGCAGATAGATCAGAGATTGAAGCTGCAGCC------ACGCCAACAGAGGCTGTCAATAAGGTGAAAATTGGGATATATTTTGCAA Sesbania_vesicaria ATTGGGATCACCGGCTCTGGCGTTGTTCTGAGGAACAGACATGTAACCCCAGTTCAG------CCACGGTCGTTT---TTACCTTCTCTGTTAAGAGAAAAACCTCAGAGATCCCTGATTTCAGTGCAAAAGCCTCTGCACCTTGCA---TCTCTTGGTGTTGGA---AATTTTGGTTCGGTGAAGAATTTTGAG------TCAGAG---AAGAATCCTGGGAGG---GATGATTTGGTGAAGTGTGGTGCGTATGAGGCAGATAGATCAGAGATTGAAGCTGCAGGC------ACACCATCAGAGGCTGTCAATAAGGTGAAAATTGGGATATATT?????? Sutherlandia_frutescens_WOJ266 ATAACGATCAGTGGTTCCGAAATTGTTTTGGGGAAAAGACATGCAACCCCAGTTCAG------GCACGATCGTTT---TTACCTTCTCTGGGAAGAGAAAAAGCTCAGAGATCTCTTGTTTCGGTGCAAAAGCCTCTGCACCTTGCA---TGCCTTGGTGTTGGA---AATTTTGGGTCGGTGAAGAATTTTGAG------TCAGAC---TTGAGTTTTGGAAGG---GATGGTTTGGTGAAGTGTGGGGCCTATGAAGCTGATAAATCAGAGATTGAAGCGGCAGGG------AAACCAACAGAGGCTGCCAAAAAGGTGAAAA?????????????????? Swainsona_pterostylis ATAACGATCAGTGGTTCCGAAATTGTTTTGGGGAAAAGACATGCAACCCCAGTTCAG------GCACGGTCGTTT---TTACCTTCTCTGGGAAGAGAAAAAGCTCAGAGATTTCTTGTTTCGGTGCAAAAGCCTCTGCACCTTGCA---TGCCTTGGTGTTGGA---AATTTTGGGTTGGTGAAGAATTTTGAG------TCAGAC---TTGAGTTTTGGAAGG---GATGGTTTGGTGAAGTGTGGGGCCTATGAAGCTGATAAGTCAGAGATTGAAGCGACAGGG------ACACCAACAGAGGCTGCCAAAAAGGT{CT}AAAA?????????????????? Trifolium_repens ???GCGATCAGTGGTTCTGATGTTGTTTTTGGGAAAAGACATGCAACCCTAATTCAA------CCACGGTCTTTT---TTACCATCTTTGAT{AT}AGTGAAAAATCACATAGATCTGTTGTTTCATTGAAAAGGCCTCTTCATATTGCA---TGTCTTGGTGTTGGA---AATTTTGGGTCAGTGAAAAATTTTGAG------ACAGAG---AAGAGTTTTGAAAAG---GGTGATTTGGTTAAGTGTGGTGCTTATGAAGCTGATAGATCAGAGGTTGAAGATGCAGGA------ACACCATCAGAAGCTGCAAAAAAAGTGAAAATGGGAATATATTTTGCAA 'Trigonella foenum-graecum' ????????CAATGGTTGTGATGTTGTTTCAGGGAAAAGACATGCAACCCTAGTTCAA------CCACAATCTTTT---TTACCATCTTTGGTTGGTGGAAAATCACAAAGATCTGTGATTTCAGTGAAAAAGCCTTTGCATATTACA---TGTGTTGGTGTTGGA---AATTTTGGGTCAGTGAAGAATTTTGAA------TCAAAG------AGTTTTGAAAAG---GGTGATTTGGTGAAGTGTGAGGCTTATGAAGCCGATAGATCAGAGGTTGAAGGTGCAGAA------ACACCATCAGAGGCTGCTAAGGAAGTGAAAATTGGGATATATTTTGCAA Trigonella_kotschyi TTAGGGATCAATGGTTGTGATGTTGTTTTAGGGAAAAGACATGCAACCCTAGTTCAA------CCACAATCTTTT---TTACCATCTTTGGTTGGTAGAAAATCACAAAGATCTGTGATTTCAGTGAAAAAGCCTTTGCATATTACA---TGTATTGGTGTTGGA---AATTTTGGGTCAGTGAAGAATTTTGAA------TCAGAG---AAAGGTTTTGAAAAG---GGTGATTTGGTGAAGTGTGAGGCTTATGAAGCTGATAGATCAGAGGTTGAAGGTGCAGGA------ACACCTTCAGAGGCTGCTAAGAAAGTGAAAATTGGGATATATTTTGCAA Vicia_faba ATTTCGATCAGTGGTTCTGATGTTGTTTTAAGGAAAAGACATGCAACCCTAATTCAGCCACAACCACAATCGTTT---TTACCTTTACTGTCAAGAGGGAAATCACTGAGATCTGTTGTTTCGTTGAAGAAGCCTCTTCATCTTGCA---TGTATTGGTGTTGGA---AATTTTGGGTCAGTGGAGAAATTTGAA------TCAGAT---GAGAGTTTTGGGAAA---AGTGATTTGGTGAAGTGTGGAGCTTATGAAGGTGATAGATCAGAGGTTGAAGGTGGTGGT---GGAGCATCATCAGAGGCTGCTAAGAAGGTGAAAATCGGGATATACTTTG??? Wisteria_floribunda AT{GT}{AG}TGATCAGTGGTTCTGATGTTGTTTTGGGGAAAAGACATGCAACCCTAATTCAA------CCACAATCGTTT---TTACCTTCTTTGGGATGGAGGAAATC{AT}CAAAGATC{CT}ATGATTTCAGTGAAAAAGCCTTTGCATCTTGCA---TGTGTTGGTGTTGGA---AATTTTGGGTCAGTGAAGAATTTTGAA------TCAGAG---AAGAGTTTTGAAAAG---GGTGATTTGGTGAAGTGTGAAGCTTATGAAGCTGATAGATCAGAGGTTGAAGGTGCAGG{AG}------ACACCTTCAGAGGCTGCAAAAAAAGTGAAAATTGGGATATATTTTGCA? ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7472] TITLE Prostaglandin_Dehydrogenase; LINK TAXA = Taxa2; DIMENSIONS NCHAR=452; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alhagi_maurorum GGTCTTTAAATCAGGTGGCTTTGGGGATATCTTGACTGATCAACCTGTAGACAAGCAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCATCCAAGATATGTAGTTATGCACAGGGAATGAATCTGATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTAACGTTGGGTGAACTGGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTGGATAGAATCAAGCAGGCATATGACAGAAACCCTAATCTGGCAAACCTTCTTGTGGATCCAGAGTTTGCGAAGGAAATAATTGATCGCCAGTCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCAGCATCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Astragalus_alpinus GGTCTTTAAATCAGCTGGCGTTGGCGATTTCGTAACCGATCAACAAGTAGACAAGAAGCAGTTGATTGATGATGTGAGGAAGGCTCTTTATGCAGCCAAAATCTGTAGTTATGCACAGGGAATGAATTTGATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTGAAGTTAGGTGAACTGGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTAGACAGAATCAAGCAGGCGTATGACAGAAATCCTAATCTGGCAAACCTCCTCGTGGATCCAGAGTTTGCAAAGGAAATAATTGACCGCCAATCTGCTTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCGGGTATCACCGTCCCAGGTATGTCTGCAAGTCTTGCATATTTTGACACTTATAGAAGGGAAAGGTTGCCGGCTAATTTGGTGCAAGCTCAACGAGACT Astragalus_americanus GGTCTTTAAATCAGCTGGCGTTGGTGATTTCGTAACCGATCAACAGGTAGACAAGAAACAGTTGATTGATGATGTGAGGAAGGCTCTTTATGCAGCGAAAATCTGTAGTTATGCACAGGGAATGAATTTGATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTGGCCCGGATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTAGACAGAATCAAGCAGGCGTATGACAGAAACCCTAATCTGGCAAACCTCCTCGTGGATCCAGAGTTTGCAAAGGAAATAATTGACCGCCAGTCTGCTTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCACCATCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTATAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Astragalus_canadensis GGTCTTTAAATCAGCTGGCGTTGGTGATTTCGTGACCGATCAACAAGTAGACAAGAAACAGTTGATTGATGATGTGAGAAAGGCTCTTTATGCAGCCAAAATCTGTAGTTATGCACAGGGAATGAATTTGATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTGGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTAGACAGAATCAAGCAGGCATATGACAGAAACCCCAATCTGGCAAACCTCCTCGTGGATCCGGAGTTTGCAAAGGAAATAATTGACCGCCAGTCTGCTTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCACCATCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTATAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Astragalus_nothoxys GGTCTTTAAATCAGCTGG?GTTGGTGATTTCGTAACCGATCAA{AC}AAGTAGACAAGAAGCAGTTGATTGATGATGTGAGGAAGGCTCTTTATGCAGCCAAGATCTGTAGTTATGCACAGGGAATGAATTTGATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTGGCCCGTATTTGGAAAGG{AT}GGTTGCATCATTAGAGCTATATTCTTAGACAGAATCAAGCAGGCATATGACAGAAACCCTAATTTGGCAAACCTCCTCGTGGATCCAGAGTTTGCAAAGGAAATAATTGACCGCCAATCTGCTTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCACCATCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTATAGAAGGGAAAGGTTGCCGGCTAATTTGGTGCAAGCTCAACGAGACT Caragana_arborescens_B GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTGACCGATCAACCTGTAGACAAGAAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAGATTTGTAGTTATGCACAGGGAATGAATCTAATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTGGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTAGACAGAATCAAGCAGGCGTATGACAGAAACCCCAATCTGGCAAACCTTCTTGTGGATCCAGAGTTTGCAAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGTCTTGCTGTCAATTCTGGTATCACCATCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Colutea_arborescens GGTCTTTAAATCAGCTGGCGTTGGCGATTTCGTAACCGATCAACAAGTAGACAAGAAACAGTTGATTGATGATGTGAGGAAGGCTCTTTATGCAGCCAAGATCTGTAGTTATGCACAGGGAATGAATCTGATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTGGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTAGATAGAATCAAGCAGGCTTATGACAGAAACCCTAATCTGGCAAACCTTCTTGTAGATCCGGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCACCATCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTATAGAAGGGAAAGGTTGCCGGCTAATTTGGTGCAAGCTCAACGAGACT Coursetia_glandulosa GGTCTTTAAATCAGGTGGCTTTAGTGATATCATAACTGATCAACCTGTTGACAAGAAGAAGTTGGTTGATGATGTTAGAATGGCTCTATATGCTGCAAAAATCTGTAGTTATGCACAGGGAATGAATCTAATCCGCGCAAAGAGTATTGAAAAGGGTTGGGACTTGAAGTTAGGTGAACTTGCCAGGATTTGGAAAGGGGGTTGCATCATAAGGGCAATATTCTTGGACAGAATCAAGAAGGCATATGACAGAAATCCTAATCTGGCAAACCTTCTTGTAGATCCAGAGTTTGCCAAGGAAATAATCGATCGCCAATCTGCATGGAGGAGAGTGGTGTGCCTTGCTATCAATTCTGGTATCAGCACTCCAGGTATGTCTGCTAGTCTTGCTTATTTTGACACATATAGAAGGGAAAGATTGCCAGCTAATTTGGTTCAAGCTCAACGAGACT Galega_orientalis GGTCTTTAAATCAGGTGGCATTGGCGATATCGTAACTGACCAACCTGTAGACAAGAAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCTGCAAAGATCTGTAGTTACGCACAGGGAATGAATCTGATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTGGCTCGTATTTGGAAAGGTGGTTGCATCATTAGAGCTATATTCTTAGACAGAATCAAGCAGGCGTATGACAGAAACTCTAATCTCGCAAACCTTCTTGTGGATCCAGAGTTTGCAAAGGAAATAATTGATCGTCAAACTGCATGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCAGCATTCCAGGTATGTCTGCAAGTCTTGCATATTTCGACACTTATCGAAGGGCAAGCTTGCCGGCTAATTTGGTGCAAGCTCAACGAGACT Glycine_max GGTCTTTAAATCAGGTGGCATTGGTGATATTGTGACTGATCAACATGTAGACAAGCAGAAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAAATCTGTAGTTATGCACAGGGAATGAATTTGATCCGTGCAAAGAGTATTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTGGCCCGGATTTGGAAAGGGGGTTGCATTATTAGAGCAATATTCTTAGACAGAATCAAGCAGGCATATGAAAGAAACCCTAATCTGGCAAACCTTCTTGTGGATCCAGAGTTTGCAAAGGAAATAATTGATTACCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTATCAATTCTGGTATTAGCACTCCAGGTATGTCTGCTAGTCTTGCTTATTTTGACACTTACAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Glycyrrhiza_lepidota GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTGACTGATCAACCTGTAGACAAGAAGCAGCTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAGATTTGTAGTTATGCACAGGGAATGAATCTGATCCGTGCAAAGAGTGTTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTGGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTGGATAGAATCAAGCAGGCATACGACAGAAACCCTAATCTGGCAAACCTTCTTGTGGATCCAGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTCGCTATCAATTCTGGTATCAGTACCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAAAGGTTGCCGGCTAATTTGGTGCAAGCTCAACGAGACT Lathyrus_sativus GGTCTTTAAATCAGGCGGCTTTAGCGAAATCTCAACCGACCAACATGTAGACAAGAAGCAGTTGGTTGATGACGTTAGAAAGGCTCTTTACGCAGCCAAGATCTGTAGTTACGCACAAGGAATGAATCTGATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGGTTTAGAATTGGGTGAACTCGCCCGTATCTGGAAAGGAGGCTGCATCATTAGAGCTATATTCTTAGACCGAATCAAGCAAGCGTACGACAGAAACCCCAATTTGGCAAACCTTCTTGTCGATCCAGAGTTCGCAAAGGAAATAATCGATCGCCAACCCGCATGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCAGCATCCCAGGTATGTCTGCTAGTCTTGCTTATTTCGACACTTACAGAAGGGAAAGGTTGCCGGCTAATTTGGTGCAAGCTCAACGAGACT Lotus_grandiflorus ???????????????????????????????????????????????????????????AGTTGATTGATGATGTTAGGAAGGCTCTTTA{CT}GCATCCAA{AG}ATCTGCAGTTA{CT}GCACAGGGAATGAATCT{GT}ATCCGCGCAAAGAGTA{AT}{CT}GAAAAGGGTTGGGAT{CT}TGAA{AG}TTGGG{AT}GA{AG}CT{GT}GCCCGGATTTGGAAAGG{AG}GGTTGCATCAT{GT}AGAGCAATATTCTTGGACAGAATCAAG{GT}A{AT}GCATATGACAGAAACCCCGATCTGGCAAACCTTCTTGTGGATCCAGAATTCGCCAAGGAAATAATTGATCGCCAATCTGC{CT}TGGAG{AG}AGAGTTGT{GT}TGCCTTGCTATCAATTCTGGTATCAGCACCCC{AG}GGTATGTCTGCTAGTCTTGCTTATTTTGACACTTAC?????????????????????????????????????????????? Lotus_purshianus ???????????????????????????????????????????????????????AAG{AC}AGTTGATTGATGATGTTAGGAAGGCTCTTTA{CT}GCATCCAA{CT}ATCTGCAGTTATGCACAGGGAATGAATCTTATCCG{CT}GCAAAGAGTAA{CT}GAAAAGGGTTGGGATTTGAAGTTGGGAGAACT{GT}GC{CT}{AC}GGATTTGGAAAGGAGGTTGCATCAT{AC}{AC}GAGCAATATTCTTGGACAGAATCAAGCA{AG}GCATATGACAGAAACCCCAATCTGGCAAACCTTCTTGTGGATCCAGA{AG}TTCGCCAAGGAAATAATTGATCGCCAATCTGC{CT}TGGAG{AG}AGAGTTGT{GT}TGCCTTGCTATCAATTCTGGTATCAGCACCCCAGGTATGTCTGCTAGTCTTGCTTATTTT{AG}ACAC{AT}TAC{AC}GAAGGGA{AG}AG{AG}TTGCCAGCTAACTTGGT{GT}CAAGCTCAACGAGACT Medicago_arabica GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTGACCGACCAACAAGTAGACAAGAAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAGATTTGTAGTTACGCACAAGGGATGAATCTGATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTGGCATTGGGTGAACTTGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTGGACAGAATCAAGCAGGCGTACGACAGAAACCCTAATCTCGCAAACCTTCTTGTGGATCCAGAGTTCGCAAAGGAAATAATTGAACGCCAAACCGCATGGAGGAGAGTTGTTTCCCTTGCTGTCAATTCAGGTATCAGCCTCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACAGTTATAGAAGGGAAAGATTGCCGGCTAATTTGGTGCAAGCTCAACGAGACT Medicago_lanigera GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTGACCGACCAACAAGTAGACAAGAAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTACGCAGCCAAGATCTGTAGTTACGCACAAGGGATGAATCTGATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTGGCATTAGGTGAACTTGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTGGACAGAATCAAGCAGGCGTACGACAGAAACCCTAATCTCGCAAACCTTCTTGTGGATCCAGAGTTCGCAAAGGAAATAATTGAACGCCAAACCGCATGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCAGGTATCAGCATCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Medicago_monantha GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTGACCGACCAACAAGTAGACAAGAAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAGATTTGTAGTTACGCACAAGGGATGAATCTGATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTGGCATTGGGTGAACTTGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTGGACAGAATCAAGCAGGCGTACGACAGAAACCCTAATCTCGCAAACCTTCTTGTGGATCCAGAGTTCGCAAAGGAAATAATTGAACGCCAAACCGCATGGAGGAGAGTTGTTTCCCTTGCTGTCAATTCAGGTATCAGCCTTCCAGGTATGTCTGCTAGTCTTGCATATTTTGACAGTTATAGAAGGGAAAGGTTGCCGGCTAATTTGGTGCAAGCTCAACGAGACT Medicago_sativa GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTGACCGACCAACAAGTAGACAAGAAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTACGCAGCCAAGATCTGTAGTTACGCACAAGGGATGAATCTGATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTGGCATTGGGTGAACTTGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTGGACAGAATCAAGCAGGCGTACGACAGAAACCCTAATCTCGCAAACCTTCTTGTGGATCCAGAGTTCGCAAAGGAAATAATTGAACGCCAAACCGCATGGAGGAGAGTTGTTTCCCTTGCTGTCAATTCAGGTATCAGCCTCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACAGTTATAGAAGGGAAAGGTTGCCGGCTAATTTGGTGCAAGCTCAACGAGACT Medicago_truncatula GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTGACTGACCAACAAGTAGACAAGAAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAGATTTGTAGTTACGCACAAGGGATGAATCTGATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTGGAATTGGGTGAACTTGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTGGACAGAATCAAGCAGGCGTACGACAGAAACCCTAATCTCGCTAACCTTCTTGTGGATCCAGAGTTCGCAAAGGAAATAATTGAACGCCAAACCGCATGGAGGAGAGTTGTTTCCCTTGCTGTCAATTCAGGTATCAGCCTCCCGGGTATGTCTGCTAGTCTTGCATATTTTGACTCTTATAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Olneya_tesota GGTCTTTAAATCAGGTGGTTTTGGTGATATCATAACTGATCAACCTGTTGACAAGAAGAAGTTGATTGATGATGTTAGAAAGGCTCTATATGCAGCAAAAATATGCAGTTATGCACAAGGAATGAATCTGATCCGTGCAAAGAGTATTGAAAAGGGTTGGGACTTGAC{AG}TTAGGTGAACTTGCCAGGATTTGGAAAGGGGGTTGTATCATAAGAGCAATATTCTTGGACAGAATTAAGAAGGCATATGACAGGAATGCTAATCTGGCAAACCTTCTTGTGGATCCAGAGTTTGCTAAGGAAATAATCGATCGCCAATCCGCATGGAGAAGAGTTGTGTGCCTTGCTATCAATTCTGGCATCAGCACTCCAGGCATGTCTGCTAGTCTTGCTTATTTTGACACATATAGAAGGGAAAGATTGCCAGCTAATTTGGTTCAAGCTCAACGAGACT Oxytropis_deflexa GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTGACTGATCAACCTGTAGACAAGAAGCAGCTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAGATTTGTAGTTATGCACAGGGAATGAATCTGATCCGTGCAAAGAGTGTTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTGGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTGGATAGAATCAAGCAGGCATACGACAGAAACCCTAATCTGGCAAACCTTCTTGTGGATCCAGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTCGCTATCAATTCTGGTATCAGTACCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAAAGGTTGCCGGCTAATTTGGTGCAAGCTCAACGAGACT Oxytropis_lambertii GGTCTTTAAATCAGCTGGCTTTGGCGATATCTTAACCGATCAAAAAGTAGACAAGAAACATTTGATTGATGATGTGAGGAAGGCTCTTTATGCAGCCAAGATCTGTAGTTATGCACAGGGAATGAATCTAATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATCTGAAGTTGGGTGAATTGGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTAGACAGAATCAAGCAGGCGTATGACAGAAACGCTAATCTGGCAAACCTTCTTGTGGATCCGGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTG?CTTGCTGTCAATTCTGGTATCACCGTCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTATAGAAGGGAAAGATTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Oxytropis_parryi_B GGTCTTTAAATCAGCTGGCTTTGGCGATATCTTAACCGATCAAAAAGTAGACAAGAAACAGTTGATTGATGATGTGAGGAAGGCTCTTTATGCAGCCAAGATCTGTAGTTATGCACAGGGAATGAATCTAATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATCTGAAGTTGGGTGAATTGGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTAGACAGAATCAAGCAGGCGTATGACAGAAACGCTAATCTGGCAAACCTTCTTGTGGATCCGGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGTCTTGCTGTCAATTCTGGTATCACCGTCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTATAGAAGGGAAAGATTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Oxytropis_pilosa GGTCTTTAAATCAGCTGGCTTTGGCGATATCATAACCGATCAAAAAGTAGACAAGAAACAGTTGATTGATGATGTGAGGAAGGCTCTTTATGCAGCCAAGATCTGTAGTTATGCACAGGGAATGAATCTAATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTGAAGTTGGGTGAGTTGGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTAGACAGAATCAAGCAGGCATATGACAGAAACGCTAATCTGGCAAACCTTCTTGTGGATCCGGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCACCGTCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTATAGAAGGGAAAGATTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Oxytropis_viscida GGTCTTTAAATCAGCTGGCTTTGGCGATATCTTAACCGATCAAAAAGTAGACAAGAAACAGTTGATTGATGATGTGAGGAAGGCTCTTTATGCAGCCAAGATCTGTAGTTATGCACAGGGAATGAATCTAATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATCTGAAGTTGGGTGAATTGGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTAGACAGAATCAAGCAGGCGTATGACAGAAACGCTAATCTGGCAAACCTTCTTGTGGATCCGGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGTCTTGCTGTCAATTCTGGTATCACCGTCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTATAGAAGGGAAAGATTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Peteria_thompsonae GGTCTTTAAATCAGGTGGCTTTGGTGATATCATAAGTGATCAACCTGTTGACAAGAAGAAGTTGATTGATGATGTTAGAAAGGCTCTGTACGCCGCAAAAATATGCAGTTATGCACAAGGAATGAATCTGATCCGTGCAAAGAGTATTGAGAAGGGTTGGGATTTGAAGTTGGGTGAACTTGCCAGGATTTGGAAAGGGGGTTGCATCATAAGAGCAATATTCTTGGACAGAATTAAGAAGGCATATGATAGGAACCCTAATCTGGCAAACCTTCTTGTGGATCCAAAGTTTGCGAAGGAAATAATCGATCGCCAATCTGCATGGAGAAGAGTTGTGTGCCTCGCTATCAATTCTGGAATCAGCACTCCAGGTATGTCCGCTAGTCTTGCTTATTTCGACACATATAGAAGGGAAAGATTGCCAGCTAATTTGGTTCAAGCTCAACGAGACT Robinia_neomexicana GGTCTTTAAATCAGGTGGCTTTGGTGATATCATAACTGATCAACCAGTTGACAAGAAGAAGTTGATTGATGATGTTAGAAAGGCTCTTTATGCAGCAAAAATCTGCAGTTATGCACAAGGAATGAATCTGATCCGTGCAAAGAGTATTGAAAAGGGTTGGGATTTGAAGTTGGGAGAACTTGCCAGGATTTGGAAAGGGGGTTGCATCATAAGAGCAATATTCTTGGACAGAATTAAGAAGGCATATGATAGAAATCCTAATCTGGCAAACCTTCTTGTGGATCCAGAGTTTGCTAAGGAAATAATTGATCGCCAATCTGCATGGAGGAGAGTTGTGTGCCTTGCTATCAATTCTGGTGTCAGCACCCCAGGTATGTCTGCCAGTCTTGCTTATTTTGACACATACAGAAGGGAAAGATTGCCAGCTAATTTGGTTCAAGCTCAACGAGACT Sesbania_bispinosa GGTCTTTAAATCAGGTGGCTTTGGTGATATCTTGACTGATCAACCTGTAGACAAGCAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAAATCTGTAGTTATGCTCAGGGAATGAACCTGATCCGTGCAAAGAGTACTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTAGCCCGTATTTGGAAGGGAGGTTGCATCATTAGAGCAATATTCTTAGACAGAATCAAGCAGGCATATGACAGAAACCCTAATCTGGCAAACCTTCTTGTCGATCCAGAGTTCGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCAGCACCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Sesbania_brachycarpa GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTGACTGATCAACCTGTAGACAAGCAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCCGCCAAAATCTGTAGTTATGCTCAAGGAATGAATCTGATTCGTGCAAAGAGTACTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTAGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCAATATTCTTAGATAGAATCAAGCAGGCATACGACAGAAACCCTAATCTGGCAAACCTTCTTGTCGATCCAGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCAGCACCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Sesbania_cinerascens GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTGACTGATCAACCTGTAGACAAGCAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAAATCTGTAGTTATGCTCAAGGAATGAATCTGATCCGTGCAAAGAGTACTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTAGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCAATATTCTTAGACAGAATCAAGCAGGCATATGACAGAAACCCTAATCTGGCAAACCTTCTTGTCGATCCAGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCAGCACCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Sesbania_formosa GGTCTTTAAATCAGGTGG?TTTGGTGATATCTTGACTGATCAACCTGTAGACAAGCAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAAATCTGTAGTTATGCTCA{AG}GGAATGAATCTGATCCGTGCAAA{GT}AGTACTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTAGCCCGGATTTGGAAAGGAGGTTGCATCATTAGAGCAATATTCTTAGACAGAATCAA{AG}CAGGCATATGACAGAAACCCTAATCTGGCAAACCTTCTTGTCGATCCAGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCAGCACCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Sesbania_grandiflora GGTCTTTAAATCAGGTGGCTTTGGTGATATCTTGACTGATCAACCTGTAGACAAGCAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAAATCTGTAGTTATGCTCAGGGAATGAATCTGATCCGTGCAAAGAGTACTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTAGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCAATATTCTTAGACAGAATCAAGCAGGCATATGACAGAAACCCTAATCTGGCAAACCTTCTTGTCGATCCAGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCAGCACCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Sesbania_herbacea GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTGACTGATCAACCTGTAGACAAGCAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAAATCTGTAGTTATGCTCAAGGAATGAATCTGATCCGTGCAAAGAGTACTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTAGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCAATATTCTTAGACAGAATCAAGCAGGCATACGACAGAAACCCTAATCTGGCAAACCTTCTTGTCGATCCAGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCAGCACCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Sesbania_microphylla GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTAACTGATCAACCTGTAGACAAGCAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAAATCTGTAGTTATGCTCAAGGAATGAATCTGATCCGTGCAAAGAGTACTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTAGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCAATATTCTTAGACAGAATCAAGCAGGCATACGACAGAAACCCTAATCTGGCAAACCTTCTTGTCGATCCAGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCAGCACCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Sesbania_punicea GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTGACTGATCAACCTGTAGACAAACAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAAATCTGTAGTTATGCTCAGGGAATGAATCTGATCCGTGCAAAGAGTACTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTAGCCCGTATTTGGAAAGGAGGTTGCATTATTAGAGCAATATTCTTAGATAGAATCAAGCAGGCATACGACAGAAACCCTAATCTGGCAAACCTTCTTGTCGATCCAGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTGTGCCTTGCTATCAATTCTGGTATCAGCACCCCAGGTATGTCTGCTAGTCTTGCTTATTTTGACACATACAGAAGGGAAAGATTGCCAGCTAATTTGGTTCAAGCTCAACGAGACT Sesbania_quadrata ????????????????????????????????????TGATCAACCTGTAGACAAGCAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAAATCTGTAGTTATGCTCAAGGAATGAATCTGATCCGTGCAAAGAGTACCGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTAGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCAATATTCTTAGACAGAATCAAGCAGGCATACGACAGAAACCCTAATCTGGCAAACCTTCTTGTCGATCCGGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCAGCACCCCAGGTATGTCTGCTAGTCTTGCATATTTTGAC{AT}CTTACAGAAGGGA?????????????????????????????????????? Sesbania_sesban GGTCTTTAAATCAGGTGGCTTTGGTGATATCTTGACTGATCAACCTGTAGACAAGCAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAAATCTGTAGTTATGCTCAGGGAATGAATCTGATCAGTGCAAAGAGTACTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTAGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCAATATTCTTAGACAGAATCAAGCAGGCATACGACAGAAACCCTAATCTGGCAAACCTTCTTGTCGATCCAGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCAGCACCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Sesbania_tetraptera GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTGACTGATCAACCTGTAGACAAGCAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAAATCTGTAGTTATGCTCAGGGAATGAATCTGATCCGTGCAAAGAGTACTGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTAGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCAATATTCTTAGACAGAATCAAGCAGGCTTACGACAGAAACCCTAATCTGGCAAACCTTCTTGTCGATCCAGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCAGCACCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Sesbania_tomentosa GGTCTTTAAATCAAGTGGCTTTGGCGATATCTTGACTGATCAACCTGTAGACAAGCAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAAATCTGTAGTTATGCTCAGGGAATGAATCTGATCCGTGCAAAGAGTACCGAAAAGGGTTGGGATTTGAAGTTGGGTGAACTAGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCAATATTCTTAGACAGAATCAAGCAGGCATACGACAGAAACCCTAATCTGGCAAACCTTCTTGTCGATCCAGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCAGCACCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAAAGGTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Sesbania_vesicaria GGTCTTTAAATC?GGTGGCTTCGGCGATATCTTGACTGATCAACCTGTAGACAAACAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAAATCTGTAGTTATGCTCAGGGAATGAATCTGATCCGTGCAAAGAGTACTGAAAAGGATTGGGATTTGAAGTTGGGTGAACTAGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCAATATTCTTAGATAGAATCAAGCAGGCATATGACAGAAACCCTAATCTGGCAAACCTTCTTGTCGATCCAGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCAGCACCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAAAGTTTGCCAGCTAATTTGGTGCAAGCTCAACGAGACT Sutherlandia_frutescens GGTCTTTAAATCAGCTGGCGTTGGCGATTTCTTAACCGATCAACAAGTAGACAAGAAACAGTTGATTGATGATGTGAGGAAGGCTCTTTATGCAGCCAAGATCTGTAGTTATGCACAGGGAATGAATTTGATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTGAAATTGGGTGAACTGGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTAGATAGAATCAAGCAGGCTTATGACAGAAACCCTAATCTGGCAAACCTTCTTGTAGATCCAGAGTTTGCGAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCACCATCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTATAGAAGGGAAAGGTTGCCGGCTAATTTGGTGCAAGCTCAACGAGACT Swainsona_frutescens ???????????????????????????????????????????CAAGTAGACAAGAAACAGTTGATTGATGATGTGAGGAAGGCTCTTTATGCAGCCAAGATCTGTAGTTATGCACAGGGAATGAATCTGATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTGAAATTGGGTGAACTGGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTAGATAGAATCAAACAAGC{AT}TATGACAGAAACCCTAATCTGGCAAACCTTCTTGTAGATCC{AG}GAGTTTGCGAAGGAAATAATTGATCGTCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCACCATCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTATAGAAGGGAAAGGTTGCC{AG}GCTAATTTGGTGCAAGCTCAACGAGACT Trifolium_pratense GGTCTTTAAATCAGGAGGTTTTGGCGATATCTTGACCGATCAAACTGTAGACAA?AAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTACGCAGCCAAGATCTGTAGTTACGCACAGGGAATGAATCTGATCCGTGCAAAGAGCGCTGAAAAGGGTTGGGATTTGGCATTGGGTGAACTTGCCCGTATTTGGAAAGGTGGTTGCATCATTAGAGCTATATTCTTAGACAGAATCAAGCAGGCATACGACAGAAACCCCAATCTGGCTAACCTTCTTGTGGACCCAGACTTTGCAAAGGAAATAATTGACCGCCAAGGTGCATGGAGGAGAGTTGTGTGCCTTGCTGTCAATTCTGGTATCAGCATCCCAGGTATGTCTGCTAGTCTTGCATATTTCGACACTTATAGAAGGGACAGGCTGCCGGCTAATTTGGTGCAAGCTCAACGAGACT Trifolium_repens GGTCTTTAAATCAGGAGGCTTTGGCGATATCTTGACCGATCAAACTGTAGACAAGAAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTACGCAGCCAAGATCTGTAGTTACGCACAGGGAATGAATCTGATCCGTGCAAAGAGTGCTGAAAAGGGTTGGGATTTGGCATTGGGTGAACTTGCTCGTATTTGGAAAGGCGGTTGCATCATTAGAGCTATATTCTTAGACAGAATCAAGCAGGCGTACGACAGAAACCCTGATCTGGCTAACCTTCTTGTGGATCCAGAGTTTGCAAAGGAAATAATTGATCGCCAAGGTGCATGGAGGAGAGTTGTGTGCCTTGCTGTCAATTCCGGTATCAGCATCCCAGGTATGTCTGCTAGTCTTGCATATTTCGACACTTATAGAAGGGAAAGGTTGCCGGCTAATTTGGT{CG}CAAGCTCAACGAGACT 'Trigonella foenum-graecum B' GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTGACCGACCAACAGGTAGACAAGAAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTACGCAGCCAAGATCTGTAGTTACGCACAAGGAATGAATCTGATCCGTGCAAAGAGTGCTGAAAAGGGATGGGATTTGGAATTGGGTGAACTCGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTAGACAGAATCAAGCAGGCGTACGACAGAAACCCTAATCTCGCAAACCTTCTTGTAGATCCAGAGTTCGCAAAGGAAATAATTGAACGCCAAACTGCATGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCAGGTATCAGCATCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTATAGAAGGGAAAGGTTACCGGCTAATTTGGTGCAAGCTCAACGAGACT Trigonella_kotschyi GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTGACTGACCAACAGGTAGACAAGAAGCAGTTGATTGATGATGTTAGGAAGGCTCTTTACGCAGCCAAGATCTGTAGTTACGCACAAGGAATGAATCTGATCCGTGCAAAGAGTGCTGAAAAGGGCTGGGATTTGGAATTGGGTGAACTCGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTAGACAGAATCAAGCAGGCGTACGACAGAAACCCTAATCTCGCAAACCTTCTTGTGGATCCAGAGTTCGCAAAGGAAATAATTGAACGCCAAACCGCGTGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCAGGTATCAGCATCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTATAGAAGGGAAAGGTTGCCGGCTAATTTGGTGCAAGCTCAACGAGACT Vicia_faba GGTCTTTAAATCAGGCGGCTTTAGCGATATCTTGACCGACCAACACGTAGACAAGAAACAGTTGATTGATGATGTTAGAAAGGCTCTTTACGCAGCCAAGATCTGTAGTTACGCACAAGGAATGAATCTGATCCGTGCAAAGAGTGTTGAAAAGGGTTGGGGTTTGGAATTGGGTGAACTCGCCCGTATCTGGAAAGGAGGCTGCATCATTAGAGCTATATTCTTAGACAGAATCAAGCAAGCATATGACAGAAACGCCAATTTGGCAAACCTTCTTGTCGATCCAGAGTTTGCAAAGGAAATAATCGATCGCCAAAGTGCATGGAGGAGAGTTGTTTGCCTTGCTGTCAATTCTGGTATCAGCATCCCAGGTATGTCTGCTAGTCTTGCTTATTTTGACACTTACAGAAGGGAAAGGTTGCCGGCTAATTTGGTGCAAGCTCAACGAGACT Wisteria_floribunda GGTCTTTAAATCAGGTGGCTTTGGCGATATCTTGACTGATCAACCTGTAGACAAGAAGAAGTTGGTTGATGATGTTAGGAAGGCTCTTTATGCAGCCAAGATCTGTAGTTATGCACAGGGTATGAATCTGATCCGTGCAAAGAGTGCTGAAAAGGGCTGGGATTTGAAGTTGGGTGAACTGGCCCGTATTTGGAAAGGAGGTTGCATCATTAGAGCTATATTCTTAGACAGAATCAAGCAGGCATACGACAGAAACCCTAATCTGGCAAACCTTCTTGTGGATCCAGAGTTTGCAAAGGAAATAATTGATCGCCAATCTGCCTGGAGGAGAGTTGTTTGCCTTGCTATCAATTCTGGTATCAGCACCCCAGGTATGTCTGCTAGTCTTGCATATTTTGACACTTACAGAAGGGAGAGGTTGCCGGCTAATTTGGTGCAAGCTCAACGAGACT ; END; BEGIN TREES; TITLE Triosephosphate_Translocator_TB; LINK TAXA = Taxa1; TRANSLATE 1 Glycine_max, 2 Sesbania_vesicaria, 3 Sesbania_punicea, 4 Sesbania_herbacea, 5 Sesbania_tomentosa, 6 Sesbania_rostrata, 7 Sesbania_tetraptera, 8 Sesbania_sesban, 9 Sesbania_cinerascens, 10 Sesbania_brachycarpa, 11 Sesbania_formosa, 12 Sesbania_grandiflora, 13 Sesbania_bispinosa, 14 Sesbania_microphylla, 15 Sesbania_quadrata, 16 Lotus_grandiflorus_B, 17 Lotus_purshianus, 18 Peteria_thompsonae, 19 Robinia_neomexicana, 20 Olneya_tesota, 21 Coursetia_glandulosa, 22 Glycyrrhiza_lepidota, 23 Wisteria_floribunda, 24 Caragana_arborescens, 25 Alhagi_maurorum, 26 Astragalus_canadensis, 27 Astragalus_nothoxys, 28 Astragalus_alpinus, 29 Astragalus_americanus, 30 Oxytropis_deflexa, 31 Oxytropis_lambertii, 32 Oxytropis_parryi, 33 Oxytropis_viscida, 34 Oxytropis_pilosa, 35 Colutea_arborescens, 36 Sutherlandia_frutescens_WOJ266, 37 Swainsona_pterostylis, 38 Vicia_faba, 39 Lathyrus_sativus, 40 Medicago_truncatula, 41 Medicago_sativa, 42 Medicago_lanigera, 43 Medicago_monantha, 44 Medicago_arabica, 45 'Trigonella foenum-graecum', 46 Trigonella_kotschyi, 47 Trifolium_repens, 48 Cicer_pinnatifidum, 49 Cicer_arietinum, 50 Galega_orientalis; TREE PAUP_1 = [&R] (1,((2,3)99.330002,(4,5,6,7,8,9,(10,(11,12)82.000000,13)75.736664,14,15)94.823387),(16,17),(18,19,20,21)99.000000,22,(((((23,(((40,44)87.559998,41)69.346664,42,43,(45,46)98.180000)62.454323)94.870003,47)67.949997,(38,39))63.939999,50)68.309998,(48,49))96.820000,(24,25)59.160000,((((26,27,28)68.757690,29)56.515354,(35,(36,37)64.150002))55.679958,((30,34)93.356232,(31,(32,33)57.004581)67.732941)98.199997)93.610001); END; BEGIN TREES; TITLE Prostaglandin_Dehydrogenase_TB; LINK TAXA = Taxa2; TRANSLATE 1 Glycine_max, 2 Sesbania_vesicaria, 3 Sesbania_punicea, 4 Sesbania_herbacea, 5 Sesbania_sesban, 6 Sesbania_cinerascens, 7 Sesbania_brachycarpa, 8 Sesbania_formosa, 9 Sesbania_grandiflora, 10 Sesbania_tomentosa, 11 Sesbania_bispinosa, 12 Sesbania_microphylla, 13 Sesbania_tetraptera, 14 Sesbania_quadrata, 15 Lotus_grandiflorus, 16 Lotus_purshianus, 17 Peteria_thompsonae, 18 Robinia_neomexicana, 19 Olneya_tesota, 20 Coursetia_glandulosa, 21 Glycyrrhiza_lepidota, 22 Wisteria_floribunda, 23 Caragana_arborescens_B, 24 Alhagi_maurorum, 25 Astragalus_canadensis, 26 Astragalus_nothoxys, 27 Astragalus_alpinus, 28 Astragalus_americanus, 29 Oxytropis_deflexa, 30 Oxytropis_lambertii, 31 Oxytropis_parryi_B, 32 Oxytropis_viscida, 33 Oxytropis_pilosa, 34 Colutea_arborescens, 35 Sutherlandia_frutescens, 36 Swainsona_frutescens, 37 Vicia_faba, 38 Lathyrus_sativus, 39 Medicago_truncatula, 40 Medicago_sativa, 41 Medicago_lanigera, 42 Medicago_monantha, 43 Medicago_arabica, 44 'Trigonella foenum-graecum B', 45 Trigonella_kotschyi, 46 Trifolium_repens, 47 Trifolium_pratense, 48 Galega_orientalis; TREE PAUP_1 = [&R] (1,(((2,3)56.993332,4,5,6,7,8,9,10,11,12,13,14)66.400002,((21,29),22,(23,((((25,28)81.143333,26,27)97.750000,(34,(35,36)74.460884)84.469170)65.416649,((30,31,32)84.803337,33)99.000000)93.377892,((((37,38),(((((39,42,43)62.094761,40)79.558098,41)92.323334,45)52.634396,44)91.000511)88.342255,(46,47)98.894737)74.315559,48)82.627632)67.230003,24)67.986664)80.129997,((15,16)89.209999,(((17,19)64.290001,20)55.099998,18)99.000000)66.139999); END;