#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on October 23, 2019; 21:11 GMT TreeBASE (cc) 1994-2008 Study reference: Steiner U., Leibner S., Schardl C.L., Leuchtmann A., & Leistner E. 2011. Periglandula, a new fungal genus within the family Clavicipitaceae and its association with Convolvulaceae. Mycologia, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S11183] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=21; TAXLABELS Aschersonia_placenta_EF468998 Balansia_henningsiana_AY489576 Cordyceps_capitata_AY489581 Cordyceps_ophioglossoides_AY489583 Elaphocordyceps_subsessilis_EF469015 Epichloe_typhina_AY489584 Hypocrea_lutea_AY489592 Isaria_farinosa_EF469027 Lecanicillium_tenuipes_EF469019 Metacordyceps_taii_EF469016 Ochronectria_calami_AY489577 Penicillium_chrysogenum_L19866 Periglandula_ipomoeae_IasaF13_HQ702614 Periglandula_ipomoeae_IasaredF01_HQ702615 Periglandula_turbinae_TcorF01_HQ702613 Pseudonectria_rousseliana_AY489598 Simplicillium_lamellicola_EF469047 Stachybotrys_echinata_AY489599 Torrubiella_confragosa_EF469051 Verticillium_epiphytum_EF469053 Viridispora_diparietispora_EF469055 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=15; TAXLABELS Annulohypoxylon_elevatidiscus_AY951656 Beauveria_bassiana_AY366065 Chaetomidium_subfimeti_FJ666373 Claviceps_purpurea_FM987276 Claviceps_viridis_EF473865 Corallocytostroma_ornithocopreoides_FJ711475 Daldinia_clavata_AY951693 Epichloe_festucae_AY722412 Epichloe_typhina_X52616 Hypoxylon_duranii_AY951714 Isaria_farinosa_DQ079607 Periglandula_ipomoeae_IasaF13_HQ702605 Periglandula_ipomoeae_IasaredF01_HQ702606 Periglandula_turbinae_TcorF01_HQ702604 Xylaria_atrosphaerica_GQ495953 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=33; TAXLABELS Akanthomyces_novoguineensis_EU369051 Aschersonia_blumenaviensis_DQ000331 Balansia_epichloe_EF468851 Balansia_henningsiana_AY489643 Balansia_pilulaeformis_DQ522365 Cladobotryum_multiseptatum_FN868786 Claviceps_fusiformis_DQ522366 Claviceps_paspali_DQ522367 Cordyceps_unilateralis_DQ522385 Epichloe_elymi_DQ000352 Hypocrella_viridans_EU392706 Hypomyces_lactifluorum_FN868812 Lecanicillium_lecanii_AY555913 Metarhizium_globosum_EU248898 Moelleriella_zhongdongii_EU392741 Nectria_cucurbitula_GQ506028 Nectriopsis_exigua_GQ506014 Neoclaviceps_monostipa_DQ000353 Niesslia_exilis_AY489647 Nomuraea_rileyi_EF468893 Ophiocordyceps_rhizoidea_EF468873 Paecilomyces_marquandii_EF468899 Periglandula_ipomoeae_IasaF13_HQ702611 Periglandula_ipomoeae_IasaredF01_HQ702612 Periglandula_turbinae_TcorF01_HQ702610 Pochonia_bulbillosa_EF468902 Pochonia_rubescens_EF468903 Regiocrella_camerunensis_DQ127234 Regiocrella_sinensis_DQ127235 Samuelsia_sheikhii_EU392745 Torrubiella_tenuis_EU369069 Verticillium_catenulatum_AY555910 Viridispora_alata_GQ506019 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7793] TITLE Sordariomycetes_atp6; LINK TAXA = Taxa1; DIMENSIONS NCHAR=608; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aschersonia_placenta_EF468998 AATTTACATTTATCATTAACAAACATCGGGTTCTACTTAACACTTGGAGCTTTATTAACATTAGTACTAAGCTTAGTTGCAACTAATCAAAACAAATTAGTAAGTAATAACTGATCTATAGCTCAAGAATCTTTATATGTAACTATACACAATATAGTTACAGGACAAATAAATGCTAAAGGAGGACAAATATATTTCCCATTTATTTACACATTATTTATTTTTATATTAATAAATAATTTAATAGGGATGGTTCCTTATAGTTTTGCATCTACAGGGCACTTTGCATTAACATTTGCCTTAAGTTTTACTATAGTATTAGGAGCCACAATTTTAGGTTTTTCTAAACATGGATTAAAATTCTTTTCATTATTAGTGCCTGCAGGATGTCCTTTAGGTTTATTACCTTTATTAGTGATAATCGAATTTATCTCATACATTGCCCGTAATGTTTCATTAGGGTTGAGATTAGCCGCCAACATCACAGCGGGCCATATGCTATTAGCTATATTAAGTGGTTTTGTTTACAATATAATGAATTCAGGAATTATTTTCTTTATTTTGGGATTAATACCTTTAGCCTTTATAGTAGCGTTTTCAGGATTGGA Balansia_henningsiana_AY489576 AACTTACACTTATCCATAACAAACATAGGATTCTACTTAACATTAGGAGCATTATTAACATTAATATTAAGCTTAGTTGCAACTAATCAAAATAAATTAGTAAGTAACAACTGATCTATAGCCCAAGAATCTTTATACGTAACAATACACAATATAGTTACAGGACAAATAAATGCTAAAGGAGGTCAAATATACTTCCCATTTATTTATACTTTATTTGTATTTATCTTAATAAATAACTTAATAGGTATGGTTCCTTATAGCTTCGCATCTACAGGACACTTTGCATTAACATTTGCATTAAGTTTCACAATTGTATTAGGGGCTACAATCTTAGGATTCTCTAAACACGGTCTAAAATTCTTCTCATTATTGGTACCTGCAGGGTGTCCTTTAGGTTTATTACCTTTATTAGTAATAATAGAATTCATTTCATACTTAGCTAGAAATGTTTCATTAGGGTTAAGATTAGCAGCTAACATAACAGCTGGTCACATGTTATTAGCTATATTAAGTGGATTCGTTTACAACATAATGAATTCAGGAATAATATTCTTTATCTTAGGATTAATTCCATTAGCATTTATAATAGCATTCTCAGGATTAGA Cordyceps_capitata_AY489581 AACTTACACTTATCATTAACGAATATAGGATTTTACTTAGTATTAGGATTATTAATAATATTAATATTAAGCTTAGTTGCAACTAATTATAACAAATTAGTAAGTAATAATTGATCTGTAGCTCAAGAATCTTTATACGTAACAATACATAATATAGTTACAAATCAAATAAATGCTAAAAATGGACAAATTTATTTCCCATTTATATATACATTATTTGTATTTATATTAATTAATAATTTAATAGGAATGATACCCTATAGCTTTGCTTCTACAGGTCATTTTGCTTTAACATTTGCTCTTAGTTTTACAATAGTATTAGGAGCAACAATCTTAGGATTCCAAAAACATGGTTTAAATTTCTTCTCGTTATTAGTACCAGCTGGTTGTCCTCTAGGTCTTTTACCCTTATTAATAAGTATAGAATTCATTTCATATTTAGCAAGAAATATTTCATTAGGCCTTAGATTAGCTGCTAATATAACAGCAGGTCACATGTTATTAAGTATCTTAAGTGGATTTGTTTATAACATAATGAACTCTGGTATAATATTCTTTATATTAGGATTAATACCTTTATTATTTATTATAGCATTCTCAGGATTAGA Cordyceps_ophioglossoides_AY489583 AACTTACACCTATCATTAACAAATATAGGATTCTACTTAACATTAGGTTTCTTAATAACATTAATATTAAGCTTAGTTGCAACTAATTATAACAAATTAGTAAGTAACAACTGATCTATAGCTCAAGAATCTTTATACGTAACAATACATAACATAGTTACAAACCAAATAAATGCTAGAAATGGACAAGTCTATTTCCCATTTATATATACATTATTTGTATTTATATTAATTAATAATTTAATCGGAATGATACCTTATAGCTTTGCTTCAACAGGTCATTTTGCTTTAACATTCGCTCTTAGTTTCACAATAGTATTAGGAGCAACAATCTTAGGATTCCAAAAACATGGTTTAAAATTCTTCTCGTTATTAGTACCAGCTGGTTGTCCTTTAGGTCTTTTACCTTTATTAATAACTATAGAATTCATTTCATACTTAGCAAGAAATGTTTCATTAGGACTTAGATTAGCTGCTAATATAACAGCAGGTCACATGTTATTAAGTATATTAAGTGGATTTGTTTATAACATAATGAACTCAGGTATAATATTCTTCGTATTAGGATTAATACCTTTATTATTTATTATAGCATTCTCAGGATTAGA Elaphocordyceps_subsessilis_EF469015 AACTTACATCTATCTCTAACAAATATAGGATTCTACTTAACATTAGGTTTCTTAATAACATTAATATTAAGTTTAGTTGCAACTAATTATAACAAATTAGTAAGTAACAACTGATCTATAGCTCAAGAATCTTTATACGTAACAATACATAACATAGTTACAAACCAAATAAATGCTAGAAATGGACAAGTTTATTTCCCATTTATATATACATTATTTGTATTTATATTAATTAATAATTTAATCGGTATGATACCTTATAGCTTTGCTTCAACAGGTCATTTTGCTTTAACATTTGCTCTTAGTTTCACAATAGTATTAGGAGCAACAATCTTAGGATTCCAAAAACATGGTTTAAAATTCTTTTCATTATTAGTACCAGCTGGTTGTCCTTTAGGTCTTTTACCATTATTAATAACTATAGAATTTATTTCATATTTAGCAAGAAATGTTTCATTAGGACTTAGATTAGCTGCTAATATAACAGCGGGTCACATGTTGTTAAGTATCTTAAGTGGGTTTGTTTATAACATAATGAATTCAGGTATAATATTCTTCGTATTAGGATTAATACCTTTATTATTTATTGTAGCATTCTCAGGATTAGA Epichloe_typhina_AY489584 AACTTACACTTATCAATAACAAACATAGGATTCTACTTAACATTAGGAGCATTATTAACATTAATATTAAGCTTAGTTGCAACTAACCAAAACAAATTAGTAAGTAACAACTGATCTATAGCTCAAGAATCTTTATACGTAACAATACACAATATAGTTACAGGACAAATAAATGCTAAAGGAGGACAAATATACTTCCCATTTATTTACACATTATTTGTATTTATATTAATAAATAATTTAATCGGTATGGTACCTTATAGTTTCGCATCTACAGGACACTTTGCATTAACATTTGCATTAAGTTTCACAATAGTATTAGGAGCTACAATATTAGGATTCTCTAAACACGGTTTAAAATTATTCTCGTTATTAGTACCTGCTGGGTGTCCTTTAGGATTATTACCATTATTAGTAATAATAGAATTCATTTCATACTTAGCTAGAAATGTTTCATTAGGATTAAGATTAGCAGCTAACATAACAGCTGGTCACATGTTATTAGCAATATTAAGTGGATTTGTTTATAACATAATGAATTCAGGAATAATATTCTTTATCTTAGGATTAATCCCATTAGCATTTATAATAGCATTCTCAGGATTAGA Hypocrea_lutea_AY489592 AATTTACACTTATCTTTAACAAACATAGGGTTCTATTTAATAATAGGAGCCTTAATAACACTAATCTTAAGCTTAGTAGCTACAAACTATAACAAATTAGTTAGTAACAACTGATCTATAGCTCAAGAATCTTTATATGTAACTATACATAATATAGTTACAAATCAAATAAATGCTAGAAGTGGACAAATATACTTCCCATTTATTTACACTTTATTTGTATTTATATTAATAAATAATTTAATTGGAATGATACCTTATAGCTTTGCATCTACAGGTCATTTTGCTTTAACATTTGCTCTTAGTTTCACAATAGTATTAGGAGCAACAATTTTAGGATTCCAAAAACATGGATTAAAATTCTTCTCTTTACTAGTACCAGCTGGATGTCCTTTAGCTCTTTTACCTTTATTAGTTACTATTGAATTAATTTCTTACTTAGCAAGAAACGTTTCATTAGGACTTAGATTAGCAGCTAATATAACAGCTGGACACATGCTATTAAGTATTTTAAGCGGTTTCGTTTACAATATAATGAATTCAGGAATTATATTCTTTGTTTTAGGTTTATTACCTTTAGTATTTATTATAGCATTCTCAGGATTAGA Isaria_farinosa_EF469027 AATTTACATTTATCATTAACAAATATCGGTTTATACTTGACAATTGGATGTATATTAGTATTAGGCTTATCAATATTAAGTACTAATTATAATAAATTAGTAAGTAATAACTGATCAATAGCTCAAGAATCATTATATGTAACAATACATAATATAGTAACAAGCCAAATTAACACAGGAAGAGGTCAAATATATTTCCCTTTAATGTATACATTATTTGTATTTATTTTAATAAATAATTTAATCGGTATGGTTCCTTATAGTTTTGCATCAACAGGTCATTTCGCCTTAACATTTGCTTTAAGTTTCACAATCGTATTGGCAGCTACAATAATCGGATTTAAAGAACATGGATTAAAATTCTTTTCATTATTAGTACCAGCTGGTTGTCCATTAGTGTTATTACCTTTATTAGTAACAATAGAATTAATATCATATTTAGCTAAAAATGTATCATTAGGTTTAAGATTAGGAGCTAATATAACATCAGGTCATATGTTATTAAGTATATTAAGTGGATTTGTATATAATATAATGAATTCAGGAATAATCTTCTTTATAATAGGATTAATACCATTAACATTTATAATCATGTTCTCAGGATTAGA Lecanicillium_tenuipes_EF469019 AATTTACATTTATCATTAACAAACATAGGTTTATACTTAACAATAGGATGTGTAATAGTATTAATCTTAACAGTATTAGGAACTAATTATAATAAATTAGTAAGTAATAACTGATCAATAGCTCAAGAATCATTATATGTAACAATACATAATATAGTAACAAGTCAAATTAATCCAGGAAGAGGTCAAATTTACTTTCCATTAATGTATACATTATTTGTATTTATATTAATTAATAATTTAATAGGTATGGTTCCTTATAGCTTTGCATCAACAGGTCATTTTGCCTTAACATTTGCTTTAAGTTTCACAATAGTATTAGCAGCTACAATAATAGGATTTAAAGAACATGGATTAAAATTCTTTTCATTATTAGTACCAGCAGGTTGTCCTTTAGTATTATTACCTTTATTAGTAACAATAGAATTAATATCATATTTAGCTAAAAATGTATCATTAGGTTTAAGATTAGGAGCTAATATAACATCAGGTCATATGTTATTAAGTATATTAAGTGGATTTGTATATAATATAATGAATTCAGGTATAATCTTCTTTATAATAGGATTAATACCATTAACATTTATTATAGCCTTTTCAGGATTAGA Metacordyceps_taii_EF469016 AATTTACACTTATCATTAACAAACATAGGATTCTACTTAACATTAGGAGCATTAATAACATTAATATTAAGCTTAGTTGCAACTAACCAAAATAAATTAGTAAGTAACAACTGATCTATAGCTCAAGAATCTTTATACGTAACAATACACAATATTGTTACAGGACAAATAAATGCCAAAGGAGGACAAGTATACTTCCCATTTATTTATACATTATTTATATTTATATTAGTAAATAATTTAATAGGTATGATACCTTATAGCTTCGCATCTACAGGACACTTTGCATTAACATTTGCATTAAGTTTCACTATAGTATTAGGAGCTACAATATTAGGATTCTCTAAACACGGTCTAAAATTCTTCTCATTATTAGTACCAGCAGGATGTCCTTTAGGTTTATTACCATTATTAGTAATAATAGAATTCATTTCATACTTAGCTAGAAATGTTTCATTAGGATTAAGATTAGCAGCTAATATAACAGCTGGTCACATGTTATTAGCAATATTAAGTGGATTCGTTTATAACATAATGAATTCAGGAATAATCTTCTTTATCTTAGGATTAATCCCATTAACATTCATAATAGCATTCTCAGGATTAGA Ochronectria_calami_AY489577 AGTTTTCATCTATCTTTAACTAATATAGGTTTTTATTTATTAACAGGAACAACTATAATAATAATCTCTGGATTATTAGCTACTAATTATAATAAATTAGTAAGTAATAACTGATCAATAGCTCAAGAATCTTTATATGTAACTATACATAATATAGTTACAAATCAAATAAACCCGAAAAATGGTCAAATATATTTTCCATTTATGTATACTTTATTTATATTTATTTTAATAAATAATTTAATAGGAATGGTACCTTATAGTTTTGCTTCTACAGGGCATTTTGCTTTAACTTTTGCATTAAGTTTCACAATTGTTTTAGGTGCTACTATTTTAGGATTCCAAAAACATGGTTTAAAATTCTTTTCATTATTAGTGCCTGCTGGTTGTCCTTTACCTTTATTACCATTATTAGTATTAATTGAATTTATTTCTTATTTAGCTAGAAATGTGTCATTAGGATTAAGATTAGCTGCAAATATTACAGCTGGACATATGTTATTAAGTATTTTAAGTGGTTTTGTATATAATATAATGAACTCAGGTATTATATTCTTTGTTTTAGGATTAATACCTTTATTATTCATTATTGCATTTTCAGGTTTAGA Penicillium_chrysogenum_L19866 AATTTACACTTATCATTAACAAATATAGGTTTATACTTAACAATTAGTATCTTTTTAATTTTAACATATAGCTTATTAGCTACAAATAATAATAAAATAATACCTAATAACTGATCAATAAGTCAAGAAAGTATTTATGCAACAGTTCACGGTATAGTAGTAAATCAAATTAATCCTAATAAAGGACAAATGTTCTTCCCATTAATGTATGTATTATTCATATTTATTTTAGTAAATAATTTAATAGGATTAGTACCATACAGTTTTGCATCTACATCTCACTTTATATTAACATTCTCTATTAGTTTTACTGTTGTTTTAGGTGCAACAATATTAGGTTTCCAAAGACATGGGTTAAAATTCTTCTCATTATTTGTACCTTCAGGTTGTCCTTTAGCTTTATTACCTTTATTAGTTTTAATTGAATTTATTTCATACTTATCTAGAAATGTTTCATTAGGATTAAGATTAGCTGCTAATATTTTAAGTGGTCACATGCTTTTAAGTATTTTAAGTGGATTCACATATAATATTATGACTAGTGGTATAATATTCTTTATATTAGGTTTAATACCTTTAGCATTTATTATTGCATTCTCTGGTTTAGA Periglandula_ipomoeae_IasaF13_HQ702614 AACTTACACTTATCAATAACAAACATAGGATTCTACTTAACATTAGGAGCATTATTAACATTAATATTAAGCTTAGTTGCAACTAACCAAAACAAATTAGTAAGTAACAACTGATCTATAGCTCAAGAATCTTTATACGTAACAATACACAATATAGTTACAGGACAAATAAATGCTAAAGGAGGACAAATCTACTTCCCATTTATTTATACATTATTTGTATTTATCTTAATAAATAATTTAATAGGTATGGTTCCTTATAGCTTCGCATCTACAGGACACTTTGCATTAACATTTGCATTAAGTTTCACAATAGTATTAGGGGCTACAATCTTAGGATTCTCTAAACACGGTCTAAAATTCTTCTCATTATTAGTACCTGCTGGATGTCCTTTAGGTTTATTACCATTATTAGTAATAATTGAATTCATTTCATACTTAGCTAGAAATGTTTCATTAGGATTAAGATTAGCAGCTAACATAACAGCTGGTCACATGTTATTAGCAATATTAAGTGGATTCGTTTATAACATAATGAATTCAGGAATAATCTTCTTTATCTTAGGATTAATCCCATTAGCATTCATAATAGCATTCTCAGGATTAGA Periglandula_ipomoeae_IasaredF01_HQ702615 AACTTACACTTATCAATAACAAACATAGGATTCTACTTAACATTAGGAGCATTATTAACATTAATATTAAGCTTAGTTGCAACTAACCAAAACAAATTAGTAAGTAACAACTGATCTATAGCTCAAGAATCTTTATACGTAACAATACACAATATAGTTACAGGACAAATAAATGCTAAAGGAGGACAAATCTACTTCCCATTTATTTATACATTATTTGTATTTATCTTAATAAATAATTTAATAGGTATGGTTCCTTATAGCTTCGCATCTACAGGACACTTTGCATTAACATTTGCATTAAGTTTCACAATAGTATTAGGGGCTACAATCTTAGGATTCTCTAAACACGGTCTAAAATTCTTCTCATTATTAGTACCTGCTGGATGTCCTTTAGGTTTATTACCATTATTAGTAATAATTGAATTCATTTCATACTTAGCTAGAAATGTTTCATTAGGATTAAGATTAGCAGCTAACATAACAGCTGGTCACATGTTATTAGCAATATTAAGTGGATTCGTTTATAACATAATGAATTCAGGAATAATCTTCTTTATCTTAGGATTAATCCCATTAGCATTCATAATAGCATTCTCAGGATTAGA Periglandula_turbinae_TcorF01_HQ702613 AATTTACACTTATCAATAACAAACATAGGATTCTACTTAACATTGGGAGCATTATTAACATTAATATTAAGCTTAGTTGCAACTAACCAAAACAAGTTAGTAAGTAACAACTGATCTATAGCTCAAGAATCTTTATACGTAACAATACACAATATAGTTACAGGACAAATAGATGCTAAAGGAGGACAAATCTACTTCCCTTTTATTTATACATTATTTGTATTTATTTTAATAAATAATTTAATAGGTATGGTTCCTTATAGCTTCGCATCTACAGGACACTTTGCATTAACATTTGCACTAAGTTTCACAATAGTATTAGGGGCTACAATCTTAGGATTCTCTAAACACGGTCTAAAATTCTTCTCATTATTAGTACCTGCTGGATGTCCTTTAGGTTTATTACCATTATTAGTAATAATTGAATTCGTTTCATACTTAGCTAGAAATGTTTCATTAGGATTAAGATTAGCAGCTAACATAACAGCTGGTCACATGTTATTGGCAATATTAAGTGGATTCGTTTATAACATAATGAATTCAGGAATAATCTTCTTTATCTTAGGATTAATCCCATTAGCATTTATAATAGCATTCTCAGGATTAGA Pseudonectria_rousseliana_AY489598 AATTTACACTTATCTTTTACTAACATAGGATTCTATTTAATAATAGGAGCTTTATTAATATTAACATTAAGCATAGTTTCAACTAACTATAATAAATTAGTAAGTAATAACTGATCTATAGCTCAAGAATCTTTATACGTAACAATACATAATATAGTTACAAATCAAATAAACCCTAAAAATGGTCAAATCTATTTCCCATTCATATACACTTTATTTATTTTCATCTTAATGAATAATTTAATAGGAATGGTGCCTTACAGTTTTGCATCAACTAGTCATTTTGCATTAACATTTGCACTTAGTTTCACAATAGTATTAGGTGCTACTATTTTAGGATTCCAAAAACATGGTTTAAAATTCTTTTCTTTATTAGTACCTGCTGGTTGTCCTTTAGCATTATTACCTTTATTAGTTACTATAGAATTCATTTCATACTTAGCTAGAAATGTATCATTAGGATTAAGATTAGCCGCTAATATAACAGCAGGACACATGCTATTAAGTATTTTAAGTGGTTTTGTATATAATATAATGAATTCAGGATTTATATTCTTTATTTTAGGATTAATACCTTTATTATTTATTATAGCATTCTCAGGTTTAGA Simplicillium_lamellicola_EF469047 AATATACATTTATCATTAACTAATATTGGATTCTACTTAGTTGTAGGTGCTATAATAACTTTAGCATTAAGTTTATTAGCAACTAATTATAACAAATTAGTAAGTAATAACTGATCTATAGCTCAAGAATCTTTATACGTAACTATACATAATATAGTTACAAACCAAATAAATGCTGGAAACGGACAAATCTATTTCCCATTTATCTATACTTTATTTGTTTTCGTATTAATAAATAATTTAATAGGTATGGTACCTTATAGCTTTGCTTCTACAGGACACTTTGCCTTAACATTCGCCTTAAGTTTCACAATCGTGTTAGGTGCTACAATACTAGGATTCCAAAAACATGGATTAAAATTCTTCTCATTATTAGTACCAGCTGGTTGTCCATTAGGATTATTACCTTTATTAGTAATAATAGAATTTATTTCATACTTAGCTAGAAATGTTTCATTAGGTCTTAGATTAGCAGCTAATATTACAGCTGGTCATATGTTATTAAGTATATTAAGTGGTTTTGTTTATAATATAATGAATTCAGGAATAATCTTCTTCATATTAGGATTAATCCCATTATTATTCATTGTAGCATTCTCAGGATTAGA Stachybotrys_echinata_AY489599 AATTTACAAATATCTTTAACTAATATAGGATTTTATTTAACATTAGGTGCTATAATTATATTAGGTTTAAGTGTATTAGCAACTAATTATAACAAATTAGTAAGTAACAATTGATCTATAGCTCAAGAATCTTTATATATGACTATACATGGTATAGTAACAAATCAAATTAATGCAAAAAATGGTCAAATATACTTCCCATTTATTTATACTTTATTTGTATTTATTTTAATAAATAATTTAATAGGTATGATACCATATAGCTTTGCTTCTACTAGCCACTTTGCTTTAACATTTGCTCTTAGTTTCACTATAGTATTAGGTGCAACAATCTTAGGATTTTCTAGACACGGTTTGAAATTCTTTTCTTTATTAGTTCCGGCTGGTTGTCCTTTAGCTCTTTTACCTTTATTAGTTACAATAGAATTAATCTCATATTTAGCTAGAAATGTTTCATTAGGACTAAGATTAGCTGCTAATATAACAGCAGGACATATGTTATTAAGTATTTTAAGCGGTTTTGTTTATAATATTATGAATTCAGGTATTATATTCTTTATTGTAGGATTAATACCTTTATTATTTATAATAGCTTTTTCAGGTTTAGA Torrubiella_confragosa_EF469051 AACTTACACTTATCATTAACAAATATAGGTTTATACTTAACAATTGGATGTGTATTAGTATTAGGCTTATCAATATTAAGTACTAATTATAATAAATTAGTAAGTAATAACTGATCAATAGCTCAAGAATCATTATATGTAACAATACACAATATAGTAACAAGCCAAATTAACCCAGGAAGAGGTCAAATCTATTTTCCTTTAATGTATACATTATTTGTATTTATTTTAATAAATAATTTAATCGGGATGGTTCCATATAGCTTTGCATCAACAGGTCATTTCGCCTTAACATTTGCTTTAAGTTTCACAATCGTATTAGCAGCTACAATAATAGGATTTAAAGAACATGGATTAAAATTCTTTTCATTATTAGTGCCAGCGGGTTGTCCATTAGTTTTATTACCTTTATTAGTAACAATAGAATTAATATCATATTTAGCTAAAAATGTATCATTAGGTTTAAGATTAGGAGCTAATATAACATCAGGTCATATGTTATTAAGTATATTAAGTGGATTTGTATACAATATAATGAATTCAGGAATAATCTTCTTTATAATAGGATTAATACCATTAACATTTATAATAATGTTCTCAGGATTAGA Verticillium_epiphytum_EF469053 AACTTACACTTATCAATAACAAACATAGGATTCTACTTAACATTAGGAGCAGTATTAACATTAATATTAAGCTTAGTTGCAACTAATCAAAATAAATTAGTAAGTAACAACTGATCTATTGCTCAAGAATCTTTATATGTAACAATACACAACATAGTTATAGGACAAATAAATGCAAAAGGTGGACAAATCTACTTCCCATTTATTTATACATTATTTATATTTATAT?AATAAATAATTTAATAGGTATGGTTCCTTACAGCTTCGCATCTACAGGACACTTTGCATTAACATTTGCATTAAGTTTCACAATAGTATTAGGGGCTACAATCTTAGGATTTTCTAAACACGGTCTAAAATTCTTCTCATTATTAGTGCCTGCTGGGTGTCCTATAGGTTTATTACCATTATTAGTAATAATTGAATTCATTTCATATTTAGCTAGAAATGTTTCATTAGGATTAAGATTAGCAGCTAATATAACAGCTGGTCACATGTTATTAGCAATATTAAGCGGATTCGTTTACAACATAATGAACTCAGGAATAATCTTCTTCATTTTAGGATTAATCCCATTAGCATTTATAATAGCATTCTCAGGTTTAGA Viridispora_diparietispora_EF469055 AACTTACACTTATCTTTAACTAACATAGGATTCTATTTAACAATAGGAGCTTTAATTATATTAACTTTAAGTATAGTATCAACTAACTATAATAAATTAGTTAGCAACAACTGATCTATAGCTCAAGAATCTTTATACGTAACTATCCACGGTATAGTTACAAACCAAATAAACCCTAAAAACGGTCAAATTTATTTCCCATTCATATATACTTTATTTATATTTATATTAATAAATAATTTAATAGGAATGGTACCTTACAGTTTTGCTTCTACAAGCCATTTTGCATTAACATTTGCTCTTAGTTTCACAATTGTATTAGGTGCGACTATTTTAGGATTCCAAAAACACGGTTTAAAATTCTTTTCATTATTAGTACCAGCTGGTTGTCCTTTAGCCTTATTACCTTTATTAGTTACTATTGAATTTATTTCATATTTAGCTAGAAATGTATCATTAGGTTTAAGATTAGCTGCTAACATTACTGCAGGACATATGTTATTAAGCATATTAAGTGGTTTTGTTTATAATATAATGAATTCAGGATTTATATTCTTTATTTTAGGGTTAATACCTTTATTATTTATAATAGCATTCTCAGGATTAGA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7678] TITLE Hypocreales_rpbA; LINK TAXA = Taxa3; DIMENSIONS NCHAR=565; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Akanthomyces_novoguineensis_EU369051 CAAAGTGTTGGCCGATGAAGTTGGTCTAGAGTGATCCCGAGTTTGTTTCTGCCATTCACACCCGCGACCCCAAAGTACGATTCAAACGTGTCTGGGCGGCCTGCAAGAAGAAACGAAAGTGCGAGAATGAAGACAGACAGG---ACAAAAACAAAGACGAACCCTTCGCCCCTGGCGTCAAGA---GTGCCGTCCTCGAGGGTCACGGCGGATGTGGTAACATGCAGCCGCAAGTCAGGCAGGCTGCTCTGCAACTCAAGGCTGCTTTTGAAGTTGCCTCTGAAGAAGGT---CCCAAGAGAAAGGAAACTGTTAACATCACTGCCGAAATGGCTCACGGTATCCTTCGTCGCATCTCTGAGCGCGACCTGCACAACATGGGTCTTAACTCGGACTACGCACGTCCAGAATGGATGATCATCACCGTCTTGCCCGTGCCCCCTCCCCCCGTGCGTCCTAGTATCTCCATGGATGGTACCGGCACCGGAATGAGAAACGAAGACGATTTGACCTACAAGCTGGGCGATATCATCCGCGCCAACGGCAATGTGAAGCAAGCTATTCG Aschersonia_blumenaviensis_DQ000331 CAAGGTGTTGGTCGATACTGTTGGTTTAGAGTGATCCTGAGTTTGTCGCTGCTATCAGCACTCGAGACGCTAAGCTTCGCTTTAATCGTGTTTGGACAGTTTGTAAGAAGAAGCGGAGATGCGAAAACGAGGACCGTACCG---AGAAG---AATGACGAAGAATTCGCTCCGGGCATGAAGC------CCGTGGTGAACAATCACGGCGGCTGCGGTAACGTCCAACCACAGGTTCGACAAGCCGCCCTCCAGCTAAAGGCTGCTTTTGATGTGGCGTCAGAGGACGGC---CCTAAACGACGTGAGACTGTGCCAATTACGCCTGAAATGGCCCATGGCATCTTGAGGAGAATCCCAGAGGAAGATCTGCGCCATATGGGTCTCAATTCAGATTACGCTCGTCCAGAGTGGATGATCGTTACTGTTCTGCCCGTTCCCCCTCCCCCGGTTCGGCCTAGTATCTCCATGGACGGGACCGGGACAGGCATGAGAAACGAAGATGATTTGACGTATAAGCTTGGCGACATCATTCGTGCCAATGGTAATGTGAAGCAGGCGATACG Balansia_epichloe_EF468851 CAAGGTGCTGGCCGATACCGTTGGTCTAGAGCGATCCCGAGTTTGTCTCAGCTATCAGCACTCGAGACGCTAAGCTTCGCTTCAATCGGGTTTGGGCCGTCTGCAAGAAGAAGAGAAGATGTGAGAACGAAGACCGCAGCG---AGAAG---AATGAAGAGGAATTCTCACCGGGCATGAAGC------CGACGGTGAATAACCACGGCGGTTGCGGCAACGTGCAACCACAAGTCCGACAGGCCGCTCTCCAACTCAAGGCCGCCTTCGATGTTGTGCAAGAGGATGGT---CCAAAGCGCCGAGAGACGGTGCCCATTACTCCCGAGATGGCACATGGCATCCTCCGAAGAATTTCTGAAGAAGACCTCCGCCATATGGGTTTGAACTCGGATTATGCTCGACCTGAGTGGATGATCGTCACCGTCCTTCCCGTCCCTCCTCCTCCGGTGCGTCCAAGTATTTCTATGGATGGTACCAGTACTGGCATGCGAAATGAGGATGATTTGACGTACAAACTTGGCGACATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCG Balansia_henningsiana_AY489643 CAAGGTGCTGGCCGATACCGTTGGTCTAGAGCGATCCCGAGTTTGTCTCAGCTATCAGCACTCGAGACGCTAAGCTTCGCTTTAATCGGGTTTGGGCCGTCTGCAAGAAGAAAAGAAGATGTGAGAACGAAGACCGCAGTG---AGAAG---AATGATGAGGAATTCTCACCGGGCATGAAGC------CGGTGGTGAACAACCACGGCGGTTGCGGCAACGTGCAACCACAAGTCCGACAGGCCGCTCTCCAACTCAAGGCCGCTTTCGATGTTGTGCAAGAAGATGGT---CCAAAGCGCCGAGAGACGGTGCCCATCACTCCCGAGATGGCACATGGGATCCTCCGAAGAATTACTGAAGAAGACCTCCGCCACATGGGTTTGAACTCGGATTATGCTCGACCTGAGTGGATGATCATCACCGTCCTTCCCGTCCCTCCTCCTCCAGTGCGTCCAAGTATTTCCATGGATGGTACCAGTACTGGCATGCGAAATGAGGACGATTTGACGTCCATACTTGTCGACATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCG Balansia_pilulaeformis_DQ522365 CAAGGTGCTGGCCGATACTGTTGGTCTAGAGCGATCCCGAGTTTGTCTCAGCTATCAGCACTCGAGACGCTAAGCTTCGCTTCAATCGGGTTTGGGCCGTCTGCAAGAAGAAAAGAAGATGTGAGAATGAAGACCGTAGCG---AGAAG---AACGACGAAGAATTCTCACCGGGCATGAAAC------CGATGGTGAATAACCACGGTGGTTGTGGCAATGTGCAACCACAAGTCCGACAGGCCGCTCTCCAGCTTAAGGCTGCTTTCGATGTTATGCAAGAGGATGGT---CCAAAGCGCCGAGAGACGGTGCCCATCACTCCTGAGATGGCACATGGTATCCTCCGAAGAATTACGGAAGAGGACCTCTGTCATATGGGTTTGAACTCGGATTATGCTCGACCTGAGTGGATGATCATCACTGTCCTTCCCGTCCCTCCTCCTCCAGTGCGCCCGAGTATCTCTATGGACGGTACCAGTACTGGCATGCGAAATGAGGATGATTTGACGTACAAACTTGGCGACATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCG Cladobotryum_multiseptatum_FN868786 CAAAGTGTTGGCCGATGAAGTTGGTCTAGAGTGACCCCGAGTTTGTCGCTGCCATCAATACACGAGATGCCAAGACCCGCTTCAAACGTGTTTGGGCGGTCTGCAAGAAGAAGCGGAGGTGTGAGAACGAAGATCGAC------AGAAC---AAGGACGAAGAATTTGCGCCGGGCATGAAGC---CTGCTCCCGTCGAGAGCCACGGTGGCTGTGGTAACGTTCAACCTCAGGTACGACAAGTTGCTTTACAGCTTAAGGCGGCCTATGAAGTAGCTCAAGAAGAGGGC---CCCAAGCGAAAAGAATCGGCTCCCATTACCCCTGAAATGGCTCATGGTATCCTTCGCCGAATCTCTGAAAATGATCTTCGCAACATGGGCCTCAACTCCGACTATGCCCGTCCTGAATGGATGATCCTCACTGTCCTTCCTGTCCCCCCCCCTCCGGTTCGTCCTAGTATTTCCATGGATGGTACCGGTACCGGTATGCGGGGTGAAGATGATTTGACATACAAGCTCGGTGATATTATTCGTGCCAACGGAAACGTCAAGCAGGCTATCCG Claviceps_fusiformis_DQ522366 CAAGGTGCTGGCCGATACTGTTGGTCTAGAGCGATCCCGAGTTTGTCTCAGCGATCAATACTCGAGATGCTAAGCTCCGCTTCAATCGTGTCTGGACTGTCTGCAAAAAGAAGCGAAGATG{GT}GAAAATGAAGATCGCACTG---AAAAG---AACGATGAGGAGTTTGCCCCTGGCATGAAGC------CAGTGGTGAACAATCACGGTGGTTGTGGCAATGTACAACCACAGGTCCGACAGGCCGCGCTCCAGCTCAAGGCTGCCTTTGATGTTGCTCAAGAAGATGGA---CCCAAGCGCCGTGAGACTGTGCCCATCACTCCCGAAATGGCACATGGTATCCTCAAAAGAATTTCTGAGGAAGACCTGCGTCACATGGGCCTGAACTCGGACTACGCTCGACCTGAGTGGCTTATCATCACCGTCTTGCCTGTTCCCCCTCCTCCCGTGCGTCCCAGTATTTCCATGGATGGCACCAGTACCGGAATGCGAAACGAGGATGATTTGACATACAAGCTTGGTGACATCATTCGCGCCAACGGCAACGTGAAGCAGGCAATTCG Claviceps_paspali_DQ522367 CAAGGTGCTGGCCGATACTGTTGGTCTAGAGCGATCCCGAGTTTGTCTCAGCTATCAATACTCGAGATGCCAAGCTTCGCTTCAACCGTGTCTGGGCCGTCTGCAAGAAGAAGCGAAGATGTGAAAATGAAGACCGCACAG---AGAAG---AACGATGACGACTTTGCTCCTGGTATGAAGG------CAGTCGTGAACAATCACGGTGGTTGTGGCAATGTCCAACCACAGGTCCGCCAGGCTGCTCTTCAGCTCAAGGCAGCGTTTGATGTTGTTCAGGAAGATGGT---CCCAAGCGCAGAGAGACTGTACCCATCACGCCCGAAATGGCACATGGTATTCTCAAAAGAATCTCCGAGGAAGATCTGCGTCACATGGGATTGAACTCGGACTACGCTCGGCCTGAGTGGCTCATTATCACCGTCTTGCCTGTTCCCCCCCCACCCGTGCGTCCCAGTATTTCAATGGACGGCACCAGCACCGGAATGCGAAACGAAGATGATTTGACGTACAAGCTTGGTGACATCATTCGCGCCAACGGAAACGTGAAGCAGGCTATTCG Cordyceps_unilateralis_DQ522385 CAAGGTGCTGGCCGATACTGTTAGTCTAGAACGACCCCGAGTTCGTCGCCGCCATCAACACTAGAGACCCCAAGCTCCGCTTCAGCCGCGTCTGGACCGTCTGCAAGAAGAAGAAACGATGCGAAAACGAAGATCGTCAGA---ACAAGGACAAGGACGAAGAGTTCGCGCCGGGTCTGAAGCAGCCCCTCGCCGTCGAAAACCACGGCGGTTGCGGCAACGTCCAGCCTGCCGTGCGCCAGGCCGCCCTGCAACTCAAGGCCGGCTTCGAGGTCGCCCAGGAGGATGGT---CCGAAGAGGAAGGAGACGGTGCCCATCACGCCCGAGATGGCCCACAGCATTCTACGGCGGATATCCGAGGAAGACCTGCGCAACATGGGGCTCAACTCCGACTACGCCCGCCCCGAGTGGATGATCCTCACGGTCCTGCCGGTGCCTCCGCCGCCGGTGCGTCCCAGCATTTCCATGGACGGCACGGGAACCGGCATGCGGAACGAGGACGATTTGACGTACAAGCTCGGCGACATCATCCGGGCCAACGGCAACGTCAAGCAAGCCATCCG Epichloe_elymi_DQ000352 CAAGGTGCTGGCTGATACTGTTGGTCTAGAGCGATCCCGAGTTTGTCTCAGCTATCCAAACTCGAGACGCTAAGCTTCGCTTCAATCGTGTTTGGGCCGTGTGCAAGAAGAAGCGGAGATGTGAAAACGAAGACCGTACCG---AAAAG---AATGACGAAGAGTTTGCCCCAGGTATGAAGC------CAGTGGTAAACAACCATGGTGGTTGTGGCAATGTGCAACCGCAGGTTCGACAAGCCGCTCTCCAGCTCAAGGCTGCTTTCGATGTTGTTCAGGAAGACGGA---CCCAAGCGGCGAGAGACTGTGCCTATCACACCCGAAATGGCCCATGGTATCCTCAAGAGAATCTCCGAGGAAGACCTGCGCCAGATGGGTTTGAACTCGGATTATGCTCGACCTGAGTGGCTCATCATCACCGTTTTGCCTGTCCCCCCCCCTCCAGTACGTCCTAGTATTTCTATGGATGGCACCAGCACGGGAATGCGAAACGAAGACGATTTGACGTACAAGCTCGGTGACATCATTCGTGCCAACGGTAATGTGAAGCAGGCGATTCG Hypocrella_viridans_EU392706 CAAGGTGTTGGCCGATACTGTTGGTCTAGAGTGATCCTGAGTTCGTCGCTGCTATTGGCACTCGAGACGCTAAGCTTCGCTTTAATCGTGTTTGGACAGTTTGCAAGAAGAAGCGGAGATGCGAGAACGAGGACCGTACCG---AGAAG---AACGACGAGGAATTCGCTCCAGGCATGAAAC------CCGTGGTGAACAATCACGGCGGCTGCGGAAACGTCCAACCACAGGTTCGGCAAGCCGCCCTCCAGCTGAAGGCTGCCTTTGACGTTGCGTCTGAGGACGGC---CCGAAACGACGAGAGACTGTGCCAATCACGCCTGAGATGGCCCACGGCATCTTGAGGAGAATTCCAGAGGAAGATTTGCGCCATATGGGTCTCAATTCAGATTACGCTCGTCCGGAGTGGATGATCGTAACCGTCTTACCCGTTCCACCTCCCCCGGTTCGCCCTAGTATCTCTATGGACGGTACTGGAACAGGCATGAGAAACGAAGACGATTTGACGTATAAGCTTGGCGACATCATTCGTGCAAATGGTAACGTGAAGCAGGCGATACG Hypomyces_lactifluorum_FN868812 CAAGGTGTTGGCCGATGAAGTTGGTCTAGAGTGACCCCGAATTTGTCGCTGCCATCAACACCCGAGATGCCAAGCTTCGCTTCAAGCGTGTCTGGGCCGTCTGCAAGAAGAAGCGAAGATGCGAGAATGAAGATCGAC------AAAAC---AAAGACGAGGAATTTGCGCCAGGCATGAAAC---TTGCGCCGCTCGAGAGCCACGGCGGCTGTGGAAACGTCCAACCTCAAGTACGACAAGTGGCCTTGCAACTCAAGGCAGCTTACGAGGTGGCCCAAGAAGATGGC---CCCAAGCGAAAAGAATCGATGCCAATCACTCCCGAGATGGCTCAAGGTATTCTTCGTCGAATTTCCGAGTCAGACCTTCACAACATGGGCCTCAACTCCGACTACGCCCGACCTGAGTGGATGATTCTAACCGTCCTTCCTGTTCCTCCTCCTCCTGTTCGTCCTAGTATCTCTATGGATGGCACAGGCACAGGTATGCGAGGTGAAGATGATTTGACGTACAAGCTTGGTGATATCATTCGTGCCAACGGCAACGTCAAACAAGCTATTCG Lecanicillium_lecanii_AY555913 CAAAGTGTTGGCCGATGAAGTTGGTCTAGAGCGATCCCGAGTTTGTTCAAGCCGTCAACACCCGCGATCCGAAACTCCGATTCAAGCGCGTCTGGGCCGTGTGTAAGAAGAAGCGCAAGTGTGAGAACGAGGACAGGCAAG---ACAAGAACAAGGACGAAGAATTTGCTCCAGGTGCCAAGA---GCGTCGTTCTCGAAGGACACGGCGGATGCGGCAACATGCAGCCGCAGGTAAGACAAGCCGCGTTGCAGCTCAAGGCCGCTTTCGAGGTCACTTCGGAAGAGGGC---CCCAAGAGGAAGGAGACCGTGAACATTAGCGCCGAAATGGCGCACGGTATTCTTCGCCGCATCTCTGAACGCGATTTGCACAACATTGGTCTCAACTCGGACTATGCCCGTCCTGAGTGGATGATTATTACTGTTCTGCCTGTCCCACCCCCTCCCGTGCGTCCTAGTATTTCCATGGATGGTACTGGTACCGGCATGAGAAACGAAGACGATTTGACCTACAAGCTTGGCGACATTATTCGCGCCAACGGTAATGTCAAGCAGGCCATTCG Metarhizium_globosum_EU248898 CAAGGTGTTGGCCGATACTGTTGGTCTAGAGCGATCCCGAGTTTGTCACCGCAATCAACACGCGAGATGCTAAACTACGCTTCAATCGTGTCTGGGCAGTCTGCAAGAAGAAGCGGAGATGTGAAAACGAAGATCGTAACG---AGAAG---AACGACGATGAGTTTGCTCCGGGCATGAAGC------CAGTCGCACACAACCATGGTGGTTGCGGAAACGTGCAGCCGCAGGTCCGACAGGCGGCTTTGCAGCTCAAGGCTGCGTTCGATGTTGCGCAAGAGGACGGC---CCCAAGCGGCGAGAGACGGTGCCGATTACTCCAGAGATGGCTCATGGTATTCTGAGAAGAATCTCGGAGGAGGATCTTCGGCACATGGGCCTTAACTCGGACTATGCTCGCCCAGAGTGGATGATTCTCACTGTGCTTCCTGTTCCCCCACCACCTGTTCGTCCCAGTATTTCCATGGACGGTACTGGCACCGGCATGCGAAATGAAGACGATTTGACCTACAAGCTTGGTGATATTATCCGTGCCAACGGTAATGTGAAGCAGGCTATCCG Moelleriella_zhongdongii_EU392741 CAAGGTGTTGGCCGATACTGTTGGTCTAGAGTGATCCTGAGTTTGTCACTGCTATCAGCACTCGAGACGCCAAGCTTCGCTTTAATCGCGTCTGGGCAGTCTGCAAGAAGAAGCGGAGATGTGAAAACGAAGATCGCACCG---AGAAA---AATGATGACGAATTTGCTCCCGGAATGAAGC------CAGTGGCCAGTAACCATGGCGGTTGTGGCAACGTGCAGCCTCAGGTGCGGCAAGCTGCTCTTCAGCTCAAGGCGGCCTTCGATGTTGCGCAGGAGGATGGG---CCCAAGCGACGGGAGACCGTTCCCATCACACCCGAAATGGCCCACGGTATTTTGAGAAGAATATCCGAGGAGGATTTGCACCACATGGGCCTAAACTCCGATTACGCACGTCCCGAATGGATGATCATCACAGTTCTTCCTGTCCCGCCTCCGCCTGTCCGTCCTAGTATCTCCATGGATGGTACCGGCACCGGCATGCGAAACGAAGACGATCTCACGTACAAGCTGGGTGACATCATTCGAGCCAACGGCAACGTCAAGCAGGCTATCCG Nectria_cucurbitula_GQ506028 CAAGGTGTTGGCCGATAAAGTTGGTCTAGAGTGATCCCGAATTTGTCGCTGCGATAAATACCCGAGATCCTAAGCTTCGATTTAATCGAGTCTGGGCAGTCTGCAAGAAGAAGCGGAGATGTGAGAACGAGGATAGAAGCGACAAGAAGGAAAAGGATGAGGAGTACGCCCCGGGATTGAAAC---CCTTCGTTGTCGAGAACCACGGCGGATGTGGTAATGTCCAGCCTCAGGTTCGACAAGCTGCTCTGCAGTTGAAGGCTGCCTTCGAAGTCGCCCAGGAAGATGGA---CCGAAAAAGAAGGAGTCCATGCCTATCACCCCGGAGATGGCTCATGGTATCCTTCGTCGCATATCTGAGGAGGATATTCGCAACATGGGGCTGAATTCGGACTACGCCCGGCCCGAGTGGATGATCATCACGGTTCTCCCAGTTCCACCTCCTCCCGTCCGTCCCAGTATCTCCATGGATGGAACAGGAACAGGAATGCGAAACGAAGATGATCTGACCTACAAGCTTGGTGATATCATTCGCGCCAACGGTAACGTCAAGCAGGCTATCCG Nectriopsis_exigua_GQ506014 CAAAGTGTTAGCCGATGAAGTTGGTCTAGAGCGATCCCGAGTTCGCTGCTGCAATCCGCACCAGAGACCCCAAGGTCCGCTTCCAGAGAGTATGGACTGTCTGCAAGAAGAAGCGCCGCTGTGAGAACGAGGATCGTTCCG---ACAAG---AAGGACGAGGAGTTCGCCCCAGGTATGAAGC---CCACTGCCATCGCCAACCACGGTGGCTGCGGCAATCTCCAGCCCCAGGTTCGCCACGCCGCCCTCCAGCTCAAGGCGGCTCAGGAGGTCGTCGTAGAGGATGGC---CCCAAGCGTAAGGAGTCGACGCCAATCAGCCCCGAGACCGCTCACAGCATTCTGCGTCGCATCTCGGAGCAGGACCTCCGTAACATGGGTCTCAACTCTGATTATGCTCGTCCCGAGTGGATGATTCTCACAGTCTTGCCCGTGCCCCCTCCCCCGGTTCGCCCCAGTATTTCCATGGACGGTACCGGTACTGGCATGCGCAACGAGGACGATTTGACCTACAAGCTTGGTGATATCATTCGTGCCAACGGTAACGTCAAGCAGGCGATTCG Neoclaviceps_monostipa_DQ000353 CAAGGTGCTGGCCGATACTGTTGGTCTAGAGCGATCCCGAGTTTGCATTAGCTATCGGCACTCGAGACGCGAAGCTTCGCTTTAATCGTGTCTGGTCCGTCTGCAAGAAGAAACGAAGATGTGAAAATGAAGATCGCACTG---AAAAA---AACGATGAGGAATTTACTCCTGGTATGAAGC------CAGTGGTGAACAATCACGGTGGTTGTGGCAATGTACAACCTCAGGTCCGGCAGACCGCTCTACAGCTCAAGGCTGCTTTTGATGTTGCCCAGGAAGACGGC---CCCAAGCGCCGAGAGACTGTGCCCATCACACCCGAAATGGCACATGGTATCCTCAAAAGAATCTCGGAAGAAGATCTGCGCAACATGGGGTTGAACTCGGACTATGCTCGACCTGAGTGGCTCATTATCACGGTCTTGCCTGTTCCCCCTCCTCCCGTGCGTCCCAGTATTTCGATGGACGGCACCAGCGCCGGAATGCGAAACGAGGACGATTTGACATATAAGCTTGGCGACATCATCCGTGCCAATGGCAATGTGAAGCAGGCAATTGG Niesslia_exilis_AY489647 CAAGGTGCTGGCTGATAAAGTTGGTCTAGAGCGACCCGGAGTTTGTCACTGCGATTAACACTCGTGACGCCAAGGTCCGCTTCCAGCGCGTCTGGGCCGTCTGCAAGAAGAAGACTCGATGTGAGAACGAGGATCGTA------AGAAGGACAAGGATGAGGAGTTTGCGCCAGGCCTGAAGC---CTGACCAACCCGACAACCACGGCGGCTGCGGCAACACCCAGCCTCGCGTCCGTCAGGCTGCTCTCCAGCTCAAGGCTGCGTTTGAAGTCGTCGAGGATGATGGCGGTGCGAAGCGAAAGGAGACGACCAACATCAGCCCGGAGATGGCTCACGGCATTTTGCGACGAATTTCCGAGGCTGACCTACGCAACATGGGTCTCAACTCCGACTACGCACGCCCCGAATGGATGATCCTGACCGTGCTGCCTGTGCCCCCGCCACCCGTGCGACCCAGTATTTCCATGGACGGTACCGGTACCGGTACGCGCAACGAGGATGATTTGACCTACAAGCTAGGCGATATCATCCGCGCCAACGGCAATGTGAAGCAGGCTATCCG Nomuraea_rileyi_EF468893 CAAGGTGTTGGCCGATACTGTTGGTCTAGAGCGATCCAGAGTTTGTCACCGCGATCAACACGCGAGACGCCAAACTGCGCTTTAATCGCGTTTGGACGGTTTGCAAGAAAAAGCACAGGTGTGAAAACGAAGATCGTAGCG---AGAAA---AATGATGATGAATTTGCTCCTGGCATGAAAG------CCGTTGCGCATAACCACGGCGGTTGTGGAAACGTGCAGCCGCAGGTCCGACAAGCGGCTTTGCAACTCAAAGCTGCCTTTGACGTTGTGCAAGAGGACGGG---CCTAAAAGGCGAGAGACGGTGCCAATTACTCCAGAGATGGCGCACGGCATCCTCAGGAGAATCTCCGAGGAAGATCTTCGCCACATGGGCCTCAACTCGGACTATGCCCGCCCAGAGTGGATGATCCTGACTGTGCTTCCCGTTCCACCACCTCCTGTTCGTCCTAGTATTTCCATGGACGGCACCGGCACCGGCATGCGAAATGAAGATGATTTGACATACAAGCTTGGTGACATAATCCGTGCCAACGGTAATGTGAAGCAGGCTATCCG Ophiocordyceps_rhizoidea_EF468873 CAAGGTGCTGGCCGATACTGTTAGTCTAGAGTGACCCCGAGTTTGTCGCCGCCATCAACACCAGAGACCCCAAGCTTCGCTTCAACCGGGTCTGGACCGTGTGCAAGAAGAAGCGGAAGTGCGAGAACGAGGATCGCCAGA---ACAAGGACAAGGATGACGAGTTTGCGCCCGGGATGAAGCCGGCGCAAGGCGTCGACAATCATGGCGGATGCGGCAACGTACAGCCCGCCGTGCGGCAGGCCGCCCTGCAGCTCAAGGCCGCATACGAGGTTGCCCAGGAAGACGGC---CCCAAGAGGAAGGAGACGACTCCCATCACGCCCGAGACGGCACACAACATCCTGCGGCGAATCTCCGAGGAGGACCTGCGCAACATGGGGCTCAACTCCGACTACGCTCGCCCGGAGTGGATGATCATCACCGTCTTGCCGGTGCCCCCGCCGCCCGTTCGCCCCAGCATCTCCATGGACGGCACCGGAACCGGCATGCGAAACGAAGACGACTTGACGTACAAGCTCGGCGACATCATCCGCGCCAACGGCAACGTCAAGCAGGCCATCCG Paecilomyces_marquandii_EF468899 CAAGGTGCTGGCCGATACTGTTGGTCTAGAGCGATCCCGAGTTTGTCACCGCAATTAACACTCGAGATGCTAAGCTTCGCTTCAACCGTGTTTGGGCAGTCTGCAAGAAAAAGCGGAGATGTGAGAACGAAGATCGTAGCG---AGAAG---AACGAAGAGGAGTTTGCGCCTGGCATGAAGC------CTGTCGTAAACAACCACGGCGGTTGCGGAAATGTGCAACCCCAAGTCCGACAAGCTGCCCTGCAACTGAAAGCTGCTTTTGATGTTGCCCAAGAGGATGGC---CCCAAAAGGCGAGAAACGGTGCCAATCACACCAGAGATGGCTCACGGAATACTGAGACGAATCTCCGAGGAAGACCTTCGTCACATGGGTCTCAACTCAGATTACGCTCGCCCAGAGTGGATGATTCTCACCGTGCTTCCTGTTCCCCCGCCTCCTGTTCGACCCAGTATCTCCATGGATGGAACCAGTACAGGCATGCGAAATGAAGACGATTTGACTTACAAGCTCGGCGATATCATCCGTGCCAACGGTAATGTGAAGCAGGCCATTCG Periglandula_ipomoeae_IasaF13_HQ702611 CAAGGTGCTGGCCGATACTGTTGGTCTAGAGCGATCCCGAGTTTGTTGCAGCTATCAGTACTCGAGACGCTAAGCTTCGCTTTAATCGTGTTTGGGCCGTCTGTAAGAAGAAGCAGAGATGTGAAAACGAAGATCGTACCG---AGAAG---AACGACGAAGAGTTCGCACCAGGCATGAAAC------CGATGTTAAACAACCACGGCGGTTGTGGCAATGTACAACCACAGGTTCGACAAGCTGCTCTCCAGCTCAAGGCTGCCTTTGATGTTGTTCAAGAGGATGGC---CCCAAGCGCCGAGAGACGGTACCTATCACTCCTGAGATGGCACATGGTATTCTTCGAAGAATTTCTGAGGAAGATCTGCGCCACATGGGTCTGAATTCGGATTATGCACGACCTGAATGGATGATCATCACTGTCTTGCCTGTTCCTCCCCCTCTAGTACGTCCTAGTATCTCTATGGACGGCACCAGCACCGGTATGCGAAACGAAGACGATTTGACGTACAAGCTCGGCGATATCATCCGTGCGAACGGTAATGTGAAGCAGGCAATCCG Periglandula_ipomoeae_IasaredF01_HQ702612 CAAGGTGCTGGCCGATACTGTTGGTCTAGAGCGATCCCGAGTTTGTCGCAGCTATCAGTACTCGAGACGCTAAGCTTCGCTTTAATCGTGTTTGGGCCGTCTGTAAGAAGAAGCAGAGATGTGAAAACGAAGATCGTACCG---AGAAG---AACGACGAAGAGTTCGCACCAGGCATGAAAC------CGATGTTAAACAACCACGGCGGTTGTGGCAATGTACAACCACAGGTTCGACAAGCTGCTCTCCAGCTCAAGGCTGCCTTTGATGTTGTTCAAGAGGATGGC---CCCAAGCGCCGAGAGACGGTACCTATCACTCCTGAGATGGCACATGGTATTCTTCGAAGAATTTCTGAGGAAGATCTGCGCCACATGGGTCTGAATTCGGATTATGCACGACCTGAATGGATGATCATCACTGTCTTGCCTGTTCCTCCCCCTCTAGTACGTCCTAGTATCTCTATGGACGGCACCAGCACCGGTATGCGAAACGAAGACGATTTGACGTACAAGCTCGGCGATATCATCCGTGCGAACGGTAATGTGAAGCAGGCAATCCG Periglandula_turbinae_TcorF01_HQ702610 CAAGGTGCTGGCCGATACTGTTGGTCTAGAGCGATCCTGAGTTTGTCGCAGCTATCAGCACTCGAGACGCTAAGCTTCGCTTCAATCGTGTTTGGGCCGTCTGTAAGAAGAAGCGAAGATGTGAAAACGAAGATCGTACCG---AGAAA---AACGACGAAGAATTCGCACCAGGCATGAAAC------CGATGGTCAACAACCACGGCGGTTGTGGCAATGTTCAACCACAGGTTCGACAAGCTGCTCTTCAGCTCAAGGCAGCCTTTGATGTTGTCCAAGAGGATGGC---CCCAAGCGCCGAGAGACGGTACCTATCACTCCTGAGATGGCACATGGTATTCTTCGAAGAATTTCTGAGGAAGATCTGCGCCACATGGGTTTGAACTCGGATTATGCACGACCTGAGTGGATGATCATTACCGTCTTGCCTGTTCCTCCCCCTCCAGTGCGTCCAAGTATCTCTATGGATGGCACCAGCACCGGCATGAGAAACGAAGACGATTTGACGTACAAGCTTGGTGATATCATCCGTGCCAACGGTAATGTGAAGCAGGCGATCCG Pochonia_bulbillosa_EF468902 CAAGGTGTTGGCCGATACTGTTGGTCTAGAGCGATCCCGAGTTTGTCACCGCAATTAACACACGAGATGCTAAGCTTCGTTTCAACCGTGTTTGGGCAGTCTGCAAGAAGAAGCGGAGATGTGAAAACGAAGATCGTAGCG---AGAAAAACAACGATGATGAATTTGCCCCTGGCATGAAGC------CGGTGGTAAACAACCACGGTGGTTGCGGTAACGTGCAGCCGCAAGTCCGACAAGCCGCTTTGCAACTCAAGGCTGCTTTCGACGTTGCGCAAGAGGACGGT---CCCAAGAGGAGAGAGACGGTACCAATCACCCCAGAGATGGCTCACGGTATTCTCAGGAGAATCTCCGAGGAAGATCTGCGCCATATGGGTCTCAACTCGGATTACGCCCGCCCGGAGTGGATGATTCTCACTGTTCTGCCTGTTCCCCCGCCTCCTGTTCGTCCCAGTATTTCCATGGACGGTACTGGTACCGGCATGAGAAACGAAGACGATTTGACCTACAAGCTTGGTGATATCATCCGTGCCAACGGCAATGTGAAGCAGGCTATCCG Pochonia_rubescens_EF468903 CAAGGTGCTGGCCGATACTGTTGGTCTAGAGCGATCCCGAGTTTGTCACCGCAATTAACACACGAGATGCTAAGCTTCGCTTCAACCGTGTTTGGGCAGTCTGCAAGAAGAAGCGGAGATGTGAAAACGAAGATCGTAGCG---AGAAAAACAACGACGATGAATTTGCTCCTGGCATGAAGC------CAGTGGTAAACAACCACGGTGGTTGCGGTAACGTGCAGCCACAAGTCCGACAAGCCGCTTTGCAACTCAAGGCTGCTTTCGACGTCGCGCAAGAGGACGGC---CCCAAGAGACGAGAGACGGTACCAATCACCCCAGAGATGGCTCACGGTATTCTGAGGAGAATCTCCGAGGAAGATCTGCGCCATATGGGTCTCAACTCGGATTACGCCCGCCCAGAGTGGATGATTCTCACTGTGTTGCCTGTTCCCCCGCCTCCTGTTCGCCCCAGTATTTCCATGGACGGTACTGGTACCGGCATGAGAAACGAAGATGATTTGACCTACAAGCTTGGTGATATCATCCGTGCCAACGGCAATGTGAAGCAGGCAATTCG Regiocrella_camerunensis_DQ127234 CAAGGTGTTGGCCGATACTGTTGGTCTAGAGCGATCCCGAGTTTGTAGCCGCTATCAGTACTCGAGACGCCAAGGTCCGCTTTAACCGTGTCTGGGCCGTCTGCAAGAAGAAGCGGAGATGCGAGAACGAAGACCGCACCG---AGAAG---AATGACGAGGAGTTTGCACCCGGAATGAAGC------CGATGGTGAATAACCACGGTGGATGCGGCAACGTGCAGCCCCAAGTACGACAGGCGGCTCTTCAGCTCAAGGCTGCTTTTGATGTTGCGCAAGAGGACGGT---CCTAAGCGACGCGAGACGGTACCCATCACTCCAGAGATGGCTCACGGCATCTTGAGAAGGATTTCTGAGCAAGATTTGAGCCACATTGGCCTCAACTCGGATTATGCTCGCCCAGAGTGGATGATCATCACGGTACTGCCCGTTCCCCCGCCTCCTGTTCGTCCCAGCATTTCCATGGACGGAACTGGCACCGGCATGCGAAACGAGGATGACTTGACGTACAAACTTGGCGACATTATCCGCGCAAATGGCAATGTAAAGCAGGCTATTCG Regiocrella_sinensis_DQ127235 CAAGGTGTTGGCCGATACTGTTGGTCTAGAGCGATCCCGAGTTTGTCGCCGCTATCAGTACTCGAGACGCTAAGCTTCGCTTTAATCGTGTATGGGCAGTCTGCAAGAAGAAGCGCAGATGCGAAAACGAAGATCGCACTG---AGAAG---AATGACGAGGAGTTTGCACCGGGAATGAAGC------CCATGGTGAATAACCACGGTGGCTGCGGTAATGTTCAGCCTCAAGTACGACAAGCGGCTCTCCAGCTCAAAGCTGCTTTCGATGTTGCGCAAGAGGACGGT---CCGAAGCGACGTGAGACGGTGCCCATCACCCCGGAGATGGCCCACGGCATCTTGAGAAGGATCTCCGAGGAAGATTTGCGTCACATAGGTCTCAATTCGGATTATGCTCGTCCAGAGTGGATGATTATCACTGTCTTGCCGGTTCCTCCACCCCCTGTGCGTCCTAGTATTTCTATGGACGGTACAGGCACTGGCATGCGAAACGAGGACGATTTGACATACAAGCTTGGTGATATCATCCGCGCTAATGGGAATGTGAAGCAGGCTATCCG Samuelsia_sheikhii_EU392745 CAAGGTGTTGGCCGATACTGTTGGTCTAGAGCGATCCTGAGTTTGTCGCCGCTATCAGCACCCGAGACGCTAAGCTTCGCTTTAATCGCGTTTGGGCTGTTTGCAAGAAGAAGCGGAGATGCGAAAACGAGGATCGTACTG---AAAAG---AACGATGAGGAGTTCGCTCCAGGCATGAAGC------CAGTGATGAACAACCACGGCGGATGCGGTAATGTCCAGCCACAGGTTCGACAAGCTGCTCTTCAGCTGAAGGCCGCGTTCGATGTTGCGCAAGAGGATGGG---CCCAAACGACGGGAAACTGTGCCAATCACTCCTGAAATGGCGCACGGCATTCTTAGGAGAATATCCGAAGACGACTTGCGTCATATGGGTCTCAATTCAGATTACGCTCGTCCAGAATGGATGATCGTTACCGTCCTGCCTGTTCCCCCTCCGCCCGTTCGTCCCAGTATCTCCATGGACGGTACTGGCACTGGCATGAGAAACGAAGACGATCTGACTTACAAACTCGGCGATATCATTCGTGCCAATGGTAATGTGAAGCAAGCGATTCG Torrubiella_tenuis_EU369069 CAAGGTGTTGGCCGATACTGTTGGTCTAGAGTGATCCTGAGTTTGTCTCCGCTATCGGTACTCGAGACGCTAAACTTCGTTTCAACCGCGTGTGGGCTGTTTGCAAGAAGAAGCGGAGATGCGAAAATGAGGATCGTACCG---AGAAG---AACGATGAAGAATTTGCCCCAGGCATGAAAC------CGGCGGTGAACAACCATGGTGGTTGCGGCAACGTGCAACCCCAGGTCCGACAAGCTGCTCTCCAACTCAAAGCTGCCTTCGATGTTGTGCAGGAGGAGGGC---CCTAAACGACGAGAGACGGTGCCCATCACACCGGAAATGGCTCACGGCATTCTCAGGAGAATCTCGGAAGAAGACCTGCAGCACATGGGCCTCAACTCGGACTATGCTCGCCCAGAGTGGATGATTCTCACTGTTCTGCCTGTTCCTCCACCTCCTGTTCGCCCTAGTATATCCATGGACGGTACTGGTACCGGCATGAGAAACGAGGACGATTTGACATACAAGCTGGGTGACATTATCCGTGCCAACGGTAATGTGAAACAAGCTATCCG Verticillium_catenulatum_AY555910 CAAGGTGTTGGCCGATACTGTTGGTCTAGAGCGATCCCGAGTTTGTCACCGCAATCAACACAAGAGATGCTAAGCTTCGCTTTAACCGTGTTTGGGCAGTCTGTAAGAAGAAGCGGAGATGTGAAAACGAAGATCGTAGCG---AGAAAAACAACGACGATGAATTTGCTCCTGGCATGAAGC------CAGTGGTAAACAACCACGGTGGTTGCGGTAACGTACAGCCGCAAGTCCGACAAGCCGCTTTGCAACTCAAGGCTGCCTTCGACGTTGCGCAAGAGGAGGGC---CCCAAGAGGCGAGAGACGGTGCCAATCACCCCAGAGATGGCTCACGGTATTCTGAGGAGAATTTCCGATGAAGATTTGCAACATATGGGTCTCAACGCGGATTACGCTCGCCCAGAATGGCTGATTCTCACTGTGCTGCCTGTTCCCCCGCCTCCTGTTCGCCCTAGTATTTCCATGGACGGTACTAGTACCGGCATGCGAAACGAGGATGATTTGACATACAAGCTGGGCGACATTATCCGTGCCAACGGCAATGTGAAGCAGGCAATTCG Viridispora_alata_GQ506019 CAAGGTGCTGGCCGATAAAGTTGGTCTAGAGCGACCCTGAATTCGCGGCGGCCGTCGCTACGCGCGACCCAAAGGTTCGCTTTAGCCGAGTCTGGGAAGTCTGTAAGAAGAAGCGCCGATGTGAGAACGAAGACAGGAACG---AGAAGAATAAGGACGAGGAGTACGCGCCCGGCATGAAAC---CCAACCCAGTGGAGAACCATGGTGGCTGTGGCAACGTCCAACCCAACGTCCGACAGGCAGCTCTGCTACTGAAGGCTGCCTTTGACGTGGCTCAAGAGGATGGT---GGCAAGCGACGAGAGACGACTCCCATTACTCCTGAAATGGCACACAACATTCTTCGAAGAATTACCGAGGAAGATCTGGTCAATATGGGCCTGAACTCCGACTACGCTCGCCCAGAGTGGATGGTTCTCACCGTTCTCCCAGTACCACCGCCTCCTGTCCGACCCAGTATTTCCATGGACGGTACTGGTACTGGCATGCGTAACGAGGATGATTTGACCTACAAGCTCGGCGATATAATCCGTGCCAACGGAAACGTCAAGCAGGCCATTCG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M7679] TITLE Sordariomycete_tubB; LINK TAXA = Taxa2; DIMENSIONS NCHAR=686; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Annulohypoxylon_elevatidiscus_AY951656 --------TACACCGAGGGTGCCGAGCTTGTCGACAACGTCCTTGATGTC-GTCCGTCGTGAGGCTGAAGGCTGCGACTGCCTCCAGGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGTATGGGTACTCTGCTGATCTCCAAGATCCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTCGTTCCCTCCCCCAAGGTTTCCGACACTGTTGTCGAGCCTTACAACGCCACTCTCTCCGTTCACCAGCTGGTTGAGAACTCCGACGAGACCTTCTGCATCGACAACGAAGCTCTGTACGACATTTGCATGCGTACCCTCAAGCTGTCGAACCCCTCTTATGGTGACTTGAACCACCTGGTCTCCGCCGTCATGTCCGGTGTCACTACTTGCTTGCGTTTCCCCGGTCAGCTGAACTCTGACCTACGCAAGCTCGCCGTGAACATGGTTCCTTTCCCTCGTCTCCACTTCTTCATGGTCGGCTTTGCTCCTTTGACTAGCCGTGGCGCCTACTCTTTCCGTGCCGTTACCGTTCCTGAGCTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCCGCAACGGTCGCTACCTGACGTGCTCCGCCATCTTCCGCGGCAAGATCTCCATGAAGGAGGTTGAGGACCAGATGCG Beauveria_bassiana_AY366065 --------TACACTGAGGGTGCCGAGCTCGTTGACCAGGTCCTCGATGTT-GTTCGTCGTGAGGCCGAAGGCTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCTCTCGGTGGTGGTACTGGTGCTGGTATGGGTACTCTGCTCATCTCCAAGATCCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTTTCCGTGGTTCCCTCTCCCGGCAACTCCGACACCGTTGTCGAGCCCTATAACGCCACTCTCTCCGTTCATCAGCTCGTCGAGAACTCCGACGAGACCTTCTGTATCGACAACCAGGCTCTGTACGATATCTGCATGCGTACCCTGAAGCTATCCAACCCTTCGTACGGTGACCTGAACCACCTCGTTTCCGTCGTCATGTCCGGCATCACCACCTGCCTGCGTTTCCCTGGTCAGCTCAACTCTGATCTTCGCAAGCTCGCCGTTAACATGGTTCCTTTCCCTCGTCTTCACTTCTTCATGGTTGGCTTTGCTCCCCTGACCAGCCGTGGTGCCCACTCCTTCCGCGCCGTCTCTGTTCCTGAGCTCACTCAGCAGATGTTCGACCCTAAGAACATGATGGCTGCTTCTGACTTCCGCAATGGTCGCTACCTGACCTGCTCTGCCATTTTCCGTGGTAAGGTTGCCATGAAGGAGGTTGAGGACCAGATGCG Chaetomidium_subfimeti_FJ666373 --------TACACCGAGGGTGCCGAGCTCGTTGACCAGGTCCTCGACGTC-GTCCGTCGCGAGGCCGAGGGCTGCGACTGCCTCCAGGGCTTCCAGATCACCCACTCCCTCGGTGGTGGTACCGGTGCCGGTATGGGTACCCTCCTGATCTCCAAGATCCGCGAGGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTCGTGCCCTCCCCCAAGGTCTCGGATACCGTCGTCGAGCCTTACAACGCCACCCTCTCGGTCCACCAGCTGGTCGAGAACTCGGACGAGACCTTCTGCATTGACAACGAGGCTCTCTACGACATCTGCATGCGCACCCTGAAGCTGTCCAACCCCTCGTACGGCGACCTCAACTACCTGGTCTCCGCCGTCATGTCGGGTGTCACCGTCTCGCTGCGTTTCCCCGGCCAGCTCAACTCGGATCTTCGCAAGCTGGCTGTCAACATGGTTCCTTTCCCGCGTCTCCACTTCTTCATGGTCGGCTTCGCTCCCCTGACCAGCCGTGGCGCCCACTCCTTCCGCGCCGTCTCCGTTCCGGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCCGCTTCTGACTTCCGCAACGGTCGCTACCTGACCTGCTCTGCCATCTTCCGTGGCAAGGTCTCCATGAAGGAGGTTGAGGACCAGATGCG Claviceps_purpurea_FM987276 --------TACACTGAAGGTGCCGAGCTGGTAGACCAGGTCCTTGACGTT-GTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATTACCCACTCTCTTGGTGGTGGTACCGGTGCTGGTATGGGAACCTTGTTGATCTCCAAGATCCGTGAGGAGTTCCCCGACCGAATGATGGCCACCTTCTCCGTCGTTCCCTCCCCCAAGGTCTCCGACACCGTCGTGGAGCCCTACAATGCCACACTCTCTATCCATCAGCTCGTTGAGAACTCGGACGAGACTTTCTGTATCGATAACGAGGCTCTGTACGATATCTGCATGCGCACCCTCAAGCTGTCCAACCCCTCATACGGTGACCTGAACTACCTGGTCTCTGCCGTCATGTCCGGCGTCACCACCTGCCTGCGTTTCCCCGGTCAGCTGAACTCTGACCTGCGCAAGCTGGCCGTCAACATGGTTCCCTT{CT}CCTCGTCTGCACTTCTTCATGGTCGGATTCGCTCCCCTGACCAGCCGTGGTGCTCACTCCTTCCGCGCTGTCAGCGTTCCTGAGCTCACTCAGCAAATGTTTGACCCTAAGAACATGATGGCTGCTTCCGATTTCCGAAACGGTCGCTACCTGACATGCTCTGCCATCTTCCGTGGCAAGGTCGCTATGAAGGAGGTTGAGGACCAGATGCT Claviceps_viridis_EF473865 --------TACACTGAAGGTGCTGAGCTGGTTGACAATGTCCTTGACGTT-GTCCGTCGCGAGGCGGAGGGATGTGACTGCCTTCAGGGTTTCCAGATTACCCACTCTCTTGGTGGTGGTACCGGTGCTGGTATGGGTACCTTGTTGATCTCCAAGATCCGCGAGGAGTTCCCCGACCGAATGATGGCCACCTTCTCCGTCGTCCCCTCCCCCAAGGTCTCGGACACCGTCGTCGAGCCCTACAATGCCACTCTCTCCGTGCATCAGCTCGTCGAGAACTCGGACGAGACCTTCTGCATCGATAACGAGGCTCTGTACGATATTTGCATGCGCACTCTGAAGCTGTCCAACCCCTCTTACGGTGACCTGAACTACCTGGTCTCCGCCGTCATGTCTGGCGTCACCACCTGCCTGCGTTTCCCCGGTCAGCTGAACTCTGACCTGCGTAAGCTGGCCGTCAACATGGTTCCCTTCCCCCGTCTGCACTTCTTCATGGTCGGCTTCGCTCCCCTGACCAGCCGTGGTGCCCACTCCTTCCGCGCTGTCAGCGTCCCTGAGCTCACTCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTTCCGATTTCCGAAACGGACGCTACCTGACATGCTCCGCCATCTTCCGTGGCAAGGTCGCCATGAAGGAGGTCGAGGACCAGATGCT Corallocytostroma_ornithocopreoides_FJ711475 --------TACACCGAAGGTGCTGAGCTGGTTGACAATGTCCTTGATGTT-GTCCGTCGCGAGGCTGAAGGGTGTGACTGCCTACAGGGTTTCCAGATCACCCACTCTCTTGGTGGTGGTACGGGTGCTGGTATGGGCACCTTGTTGATCTCGAAGATCCGCGAGGAGTTTCCCGACCGAATGATGGCCACCTTCTCCGTCGTTCCCTCCCCCAAGGTCTCTGACACCGTCGTCGAGCCCTACAACGCCACTCTTTCTGTCCACCAGCTTGTGGAGAACTCTGACGAGACCTTCTGTATCGATAACGAGGCTCTGTACGATATTTGCATGCGCACTCTTAAGCTGTCCAACCCCTCTTACGGTGACCTGAACTACCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGCCTGCGTTTCCCCGGTCAGCTGAACTCTGACCTGCGTAAGCTGGCCGTCAACATGGTCCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTCGCTCCCTTGACCAGCCGTGGTGCCCACTCATTCCGCGCTGTTAGCGTTCCTGAGCTCACTCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCTTCTGATTTCCGAAACGGTCGATACCTGACATGCTCTGCCATCTTCCGTGGCAAGGTCGCTATGAAGGAGGTCGAGGACCAGATGCT Daldinia_clavata_AY951693 --------TACACTGAGGGTGCTGAGTTGGTTGACAACGTTCTCGATGTC-GTTCGTCGTGAGGCTGAAGGCTGTGACTGCCTCCAGGGTTTCCAGATCACCCACTCTCTCGGTGGTGGTACCGGTGCCGGTATGGGTACTCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCCGACCGCATGATGGCTACCTTCTCCGTTATGCCCTCCCCCAAGGTCTCCGACACCGTCGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGTATCGACAACGAGGCTCTGTACGACATCTGCATGCGTACTCTGAAGCTGTCCAACCCTTCTTACGGTGACCTGAACCACCTAGTTTCCGCAGTCATGTCCGGTGTTACCACTTGCTTGCGTTTCCCCGGTCAGCTGAACTCTGACCTGCGCAAGCTGGCCGTGAACATGGTTCCTTTCCCTCGTCTCCACTTCTTCATGGTCGGCTTCGCTCCCCTGACCAGCCGTGGCGCTCACTCTTTCCGTGCCGTCACCGTTCCTGAGTTGACTCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCCGACTTCCGCAACGGTCGTTACCTGACGTGCTCTGCCATCTTCCGTGGCAAGGTCTCCATGAAGGAAGTTGAAGACCAGATGCG Epichloe_festucae_AY722412 ATACGAACTACACTGAGGGTGCTGAGCTGGTTGACCAGGTCCTCGACGTT-GTGCGTCGCGAGGCCGAAGGCTGTGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTTGGTGGTGGTACCGGTGCCGGTATGGGTACATTGTTGATCTCCAAGATCCGTGAAGAGTTCCCCGACCGGATGATGGCCACTTTTTCCGTCGTCCCCTCTCCCAAGGTCTCTGACACCGTTGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTTGTCGAGAACTCGGACGAAACGTTCTGTATCGATAATGAGGCCTTGTACGATATCTGCATGCGTACTCTTAAGCTGTCTAACCCGTCATACGGTGATCTGAACTACCTGGTCTCCGCTGTCATGTCTGGCGTCACCACCTGCCTGCGTTTCCCTGGTCAGCTGAACTCTGACCTGCGGAAGCTGGCCGTCAACATGGTTCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTCGCTCCCCTGACCAGCCGTGGCGCCCACTCTTTCCGCGCTGTTAGCGTTCCTGAGCTTACTCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTTCTGATTTCAGAAATGGTCGCTACCTGACCTGCTCCGCCATTTTCCGTGGCAAGGTCGCTATGAAGGAGGTCGAGGACCAGATGCG Epichloe_typhina_X52616 --------TACACTGAGGGTGCTGAGCTGGTTGACCAGGTCCTCGATGTT-GTGCGTCGCGAGGCCGAAGGCTGTGACTGCCTCCAGGGTTTCCAGATCACCCACTCTCTTGGTGGTGGTACCGGTGCCGGTATGGGTACATTGTTGATCTCCAAGATCCGTGAGGAGTTCCCCGACCGGATGATGGCTACTTTTTCCGTCGTTCCCTCTCCCAAGGTCTCTGACACCGTTGTCGAGCCCTACAACGCCACTCTCTCTGTCCATCAGCTTGTCGAGAACTCGGACGAAACGTTCTGTATCGATAATGAGGCCTTGTACGATATCTGCATGCGTACTCTTAAGCTGTCCAACCCCTCGTACGGCGATTTGAACTACCTGGTCTCCGCTGTCATGTCTGGCGTCACCACCTGCCTGCGTTTCCCTGGTCAGCTGAACTCTGACCTGCGCAAGTTGGCCGTCAACATGGTTCCTTTCCCCCGTCTGCACTTCTTCATGGTCGGCTTCGCCCCCCTGACCAGCCGTGGCGCCCACTCTTTCCGCGCTGTCAGCGTCCCTGAGCTTACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTTCTGATTTCAGAAATGGTCGCTACCTGACCTGCTCTGCCATTTTCCGTGGCAAGGTCGCTATGAAGGAGGTCGAGGACCAGATGCG Hypoxylon_duranii_AY951714 --------TACACTGAAGGTGCTGAGCTGGTCGACAACGTCCTCGATGTC-GTTCGTCGTGAGGCTGAAGGCTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCTCTCGGTGGTGGTACCGGTGCCGGTATGGGTACCTTGTTGATCTCCAAGATCCGCGAGGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTCGTGCCCTCTCCCAAGGTCTCCGACACTGTCGTTGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATCGACAACGAGGCTCTGTACGACATCTGCATGCGTACGCTGAAGTTGTCCAACCCCTCGTACGGTGACCTGAACCACCTGGTCTCCGCCGTCATGTCTGGCGTCACCACTTGCTTGCGATTCCCCGGTCAGCTCAACTCTGACCTACGCAAGCTCGCCGTCAACATGGTTCCCTTCCCCCGTCTACACTTCTTCATGGTCGGCTTTGCTCCCCTGACCAGCCGCGGTGCTCACTCTTTCCGAGCCGTCACCGTTCCCGAGTTGACTCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCCGACTTCCGCAACGGTCGTTACCTGACGTGCTCTGCCATCTTCCGTGGCAAGGTCTCCATGAAGGAGGTTGAGGACCAGATGCG Isaria_farinosa_DQ079607 ----------------------------------------CCTCGACGTTTGTTCGTCGTGAGGCCGAAAGCTGCGACTGCCTTCAGGGTTTCCAGATCACCTACTCTCTTGGTGGTGGTACTGGTGCTGGTATGGGTACTCTGCTCATCTCCAAGATCCGCGAGGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTGTTCCCTCCCCCGGCAACTCCGACACCGTTGTCGAGCCTTACAACGCCACTCTCTCCGTGCATCAGCTCGTTGAGAACTCCGACGAGACCTTCTGTATCGACAACCAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCTTCATACGGTGACCTCAACCACCTTGTCTCCGTCGTCATGTCCGGCATCACTACCTGCCTGCGTTTCCCTGGTCAGCTCAACTCTGACCTTCGCAAGCTTGCCGTCAACATGGTTCCTTTCCCTCGTCTTCACTTCTTCATGGTCGGCTTCGCTCCCCTGACCAGCCGTGGTGCTCACTCCTTCCGCGCCGTCTCTGTCCCTGAGCTCACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCTGACTTCCGTAACGGTCGTTACCTGACCTGCTCTGCCATTTTCCGTGGTAAGGTTGCCATGAAGGAGGTTGAGGACCAGATGCG Periglandula_ipomoeae_IasaF13_HQ702605 --------TACACTGAAGGTGCCGAGCTGGTTGACAACGTCCTTGATGTT-GTCCGTCGTGAGGCCGAAGGCTGTGACTGCCTCCAGGGTTTCCAGATCACCCACTCTCTGGGAGGTGGTACCGGTGCTGGTATGGGTACCTTGCTGATCTCCAAGATCCGTGAGGAGTTCCCCGACCGAATGATGGCTACCTTCTCCGTCGTTCCCTCCCCCAAGGTCTCGGACACCGTCGTCGAGCCCTACAATGCCACTCTCTCCGTCCACCAGCTCGTTGAGAACTCCGACGAGACTTTCTGTATCGACAACGAGGCTCTGTACGATATCTGCATGCGTACTCTTAAGCTGTCGAACCCCTCATATGGTGACCTGAACTACCTGGTTTCCGCCGTCATGTCTGGCGTTACCACCTGCTTGCGTTTCCCCGGTCAGTTGAACTCTGACCTGCGCAAGCTTGCCGTCAACATGGTTCCTTTCCCCCGTCTTCACTTCTTCATGGTCGGCTTCGCTCCCCTGACCAGCCGTGGTGCCCACTCTTTCCGCGCCGTCAGCGTTCCTGAGCTCACCCAGCAGATGTTCGACCCGAAGAACATGATGGCTGCTTCTGACTTCCGAAACGGTCGTTACCTGACCTGCTCTGCCATTTTCCGTGGCAAGGTTGCTATGAAGGAGGTTGAGGACCAGATGCG Periglandula_ipomoeae_IasaredF01_HQ702606 --------TACACTGAAGGTGCCGAGCTGGTTGACAACGTCCTTGATGTT-GTCCGTCGTGAGGCCGAAGGCTGTGACTGCCTCCAGGGTTTCCAGATCACCCACTCTCTGGGAGGTGGTACCGGTGCTGGTATGGGTACCTTGCTGATCTCCAAGATCCGTGAGGAGTTCCCCGACCGAATGATGGCTACCTTCTCCGTCGTTCCCTCCCCCAAGGTCTCGGACACCGTCGTCGAGCCCTACAATGCCACTCTCTCCGTCCACCAGCTCGTTGAGAACTCCGACGAGACTTTCTGTATCGACAACGAGGCTCTGTACGATATCTGCATGCGTACTCTTAAGCTGTCGAACCCCTCATATGGTGACCTGAACTACCTGGTTTCCGCCGTCATGTCTGGCGTTACCACCTGCTTGCGTTTCCCCGGTCAGTTGAACTCTGACCTGCGCAAGCTTGCCGTCAACATGGTTCCTTTCCCCCGTCTTCACTTCTTCATGGTCGGCTTCGCTCCCCTGACCAGCCGTGGTGCCCACTCTTTCCGCGCCGTCAGCGTTCCTGAGCTCACCCAGCAGATGTTCGACCCGAAGAACATGATGGCTGCTTCTGACTTCCGAAACGGTCGTTACCTGACCTGCTCTGCCATTTTCCGTGGCAAGGTTGCTATGAAGGAGGTTGAGGACCAGATGCG Periglandula_turbinae_TcorF01_HQ702604 --------TACACTGAAGGTGCCGAGCTGGTTGACAACGTCCTTGATGTT-GTCCGTCGTGAGGCCGAAGGCTGTGACTGCCTCCAGGGTTTCCAGATCACCCACTCTCTGGGAGGTGGTACCGGTGCTGGTATGGGTACCTTGCTGATCTCCAAGATCCGTGAGGAGTTCCCCGACCGAATGATGGCTACCTTCTCCGTCGTTCCCTCCCCCAAGGTCTCGGACACCGTCGTCGAGCCCTACAATGCCACTCTCTCCGTCCACCAGCTCGTTGAGAACTCCGACGAGACTTTCTGTATCGACAACGAGGCTCTGTACGATATCTGCATGCGTACTCTTAAGCTGTCGAACCCCTCATATGGTGACCTGAACTACCTGGTTTCCGCCGTCATGTCTGGCGTTACCACCTGCTTGCGTTTCCCCGGTCAGTTGAACTCTGACCTGCGCAAGCTTGCCGTCAACATGGTTCCTTTCCCCCGTCTTCACTTCTTCATGGTCGGCTTCGCTCCCCTGACCAGCCGTGGTGCCCACTCTTTCCGCGCCGTCAGCGTTCCTGAGCTCACCCAGCAGATGTTCGACCCGAAGAACATGATGGCTGCTTCTGACTTCCGAAACGGTCGTTACCTGACCTGCTCTGCCATTTTCCGTGGCAAGGTTGCTATGAAGGAGGTTGAGGACCAGATGCG Xylaria_atrosphaerica_GQ495953 --------TACACTGAGGGTGCTGAGCTGGTCGACAACGTTCTCGATGTC-GTCCGTCGCGAGGCTGAGGGCTGCGACTGCCTCCAGGGCTTCCAGATCACCCACTCTCTCGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCCGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAGAACTCGGACGAGACCTTCTGCATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACCACCTGCCTGCGTTTCCCTGGTCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCCGAGCTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCCGCTGACTTCCGCAACGGTCGTTACCTGACATGCTCTGCTATCTTCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCG ; END; BEGIN TREES; TITLE rpbA_exon; LINK TAXA = Taxa3; TRANSLATE 1 Nectriopsis_exigua_GQ506014, 2 Viridispora_alata_GQ506019, 3 Niesslia_exilis_AY489647, 4 Cordyceps_unilateralis_DQ522385, 5 Ophiocordyceps_rhizoidea_EF468873, 6 Akanthomyces_novoguineensis_EU369051, 7 Lecanicillium_lecanii_AY555913, 8 Hypomyces_lactifluorum_FN868812, 9 Cladobotryum_multiseptatum_FN868786, 10 Nectria_cucurbitula_GQ506028, 11 Moelleriella_zhongdongii_EU392741, 12 Balansia_pilulaeformis_DQ522365, 13 Balansia_epichloe_EF468851, 14 Balansia_henningsiana_AY489643, 15 Neoclaviceps_monostipa_DQ000353, 16 Claviceps_paspali_DQ522367, 17 Claviceps_fusiformis_DQ522366, 18 Epichloe_elymi_DQ000352, 19 Periglandula_turbinae_TcorF01_HQ702610, 20 Periglandula_ipomoeae_IasaF13_HQ702611, 21 Periglandula_ipomoeae_IasaredF01_HQ702612, 22 Hypocrella_viridans_EU392706, 23 Aschersonia_blumenaviensis_DQ000331, 24 Samuelsia_sheikhii_EU392745, 25 Regiocrella_sinensis_DQ127235, 26 Regiocrella_camerunensis_DQ127234, 27 Torrubiella_tenuis_EU369069, 28 Nomuraea_rileyi_EF468893, 29 Paecilomyces_marquandii_EF468899, 30 Metarhizium_globosum_EU248898, 31 Verticillium_catenulatum_AY555910, 32 Pochonia_bulbillosa_EF468902, 33 Pochonia_rubescens_EF468903; TREE tree_1 = [&R] ((((((((27:0.1284,((22:0.05105,23:0.03622)0.99:0.0745,24:0.08344)0.96:0.06827)0.66:0.02289,(25:0.0643,26:0.0961)0.98:0.06612)0.46:0.00577,(((33:0.01208,32:0.02165)0.41:0.00759,31:0.04853)0.77:0.01533,((30:0.03893,28:0.1178)0.93:0.03106,29:0.1046)0.77:0.01486)0.99:0.0671)0.71:0.0088,((((14:0.02294,13:0.01467)0.51:0.02325,12:0.02678)1:0.0976,((20:0.00172,21:0.0)0.99:0.03488,19:0.02158)0.81:0.02152)0.85:0.02334,(18:0.06157,((17:0.04628,16:0.06545)0.53:0.00632,15:0.08633)0.93:0.04437)0.97:0.04643)0.99:0.08043)0.79:0.02308,11:0.1585)0.99:0.1039,(5:0.1056,4:0.1027)1:0.1364)0.29:0.0191,(2:0.3583,(3:0.2275,1:0.2431)0.41:0.03736)0.76:0.03527)0.82:0.02065,((8:0.1157,9:0.09691)0.99:0.109,(10:0.1894,(7:0.127,6:0.1546)1:0.2023)0.72:0.05108)0.82:0.01623); END; BEGIN TREES; TITLE atp6; LINK TAXA = Taxa1; TRANSLATE 1 Penicillium_chrysogenum_L19866, 2 Lecanicillium_tenuipes_EF469019, 3 Isaria_farinosa_EF469027, 4 Torrubiella_confragosa_EF469051, 5 Stachybotrys_echinata_AY489599, 6 Ochronectria_calami_AY489577, 7 Aschersonia_placenta_EF468998, 8 Verticillium_epiphytum_EF469053, 9 Metacordyceps_taii_EF469016, 10 Balansia_henningsiana_AY489576, 11 Epichloe_typhina_AY489584, 12 Periglandula_ipomoeae_IasaF13_HQ702614, 13 Periglandula_ipomoeae_IasaredF01_HQ702615, 14 Periglandula_turbinae_TcorF01_HQ702613, 15 Simplicillium_lamellicola_EF469047, 16 Pseudonectria_rousseliana_AY489598, 17 Viridispora_diparietispora_EF469055, 18 Hypocrea_lutea_AY489592, 19 Cordyceps_capitata_AY489581, 20 Elaphocordyceps_subsessilis_EF469015, 21 Cordyceps_ophioglossoides_AY489583; TREE tree_1 = [&R] (1:0.4724,(((5:0.1469,(18:0.06953,((15:0.1066,((2:0.00105,(3:0.0272,4:0.01412)0.99:0.0615)1:0.1864,((11:0.0175,((((13:0.0,12:0.0)0.69:0.00128,14:0.0159)0.63:0.00175,8:0.04303)0.53:0.00336,(7:0.1642,10:0.02233)0.19:0.00869)0.87:0.00719)0.82:0.00953,9:0.02047)0.99:0.08139)0.099:0.01357)0.94:0.0429,((21:0.0026,20:0.02999)0.88:0.01442,19:0.04671)0.92:0.03665)0.9:0.03356)0.82:0.02513)0.93:0.03853,(16:0.05616,17:0.05708)0.77:0.01592)0.68:0.0426,6:0.1328):9.6E-4):0.0; END; BEGIN TREES; TITLE tubB; LINK TAXA = Taxa2; TRANSLATE 1 Xylaria_atrosphaerica_GQ495953, 2 Isaria_farinosa_DQ079607, 3 Beauveria_bassiana_AY366065, 4 Chaetomidium_subfimeti_FJ666373, 5 Annulohypoxylon_elevatidiscus_AY951656, 6 Daldinia_clavata_AY951693, 7 Hypoxylon_duranii_AY951714, 8 Epichloe_typhina_X52616, 9 Epichloe_festucae_AY722412, 10 Periglandula_turbinae_TcorF01_HQ702604, 11 Periglandula_ipomoeae_IasaF13_HQ702605, 12 Periglandula_ipomoeae_IasaredF01_HQ702606, 13 Corallocytostroma_ornithocopreoides_FJ711475, 14 Claviceps_viridis_EF473865, 15 Claviceps_purpurea_FM987276; TREE tree_1 = [&R] ((((6:0.03109,5:0.06483)0.53:0.00897,7:0.03702)0.12:0.00341,(4:0.08306,1:0.0722)0.77:0.01176)0.95:0.03694,((3:0.03183,2:0.0249)1:0.06373,((10:0.0,(11:0.0,12:0.0)0:0.0)0.97:0.02999,(((15:0.02918,14:0.03127)0.27:0.01186,13:0.04053)0.86:0.01359,(8:0.01524,9:0.01833)1:0.05378)0.93:0.02575)0.94:0.03367)0.95:2.3E-4); END;