#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 19:09 GMT TreeBASE (cc) 1994-2008 Study reference: Girlanda M., Segreto R., Cafasso D., Liebel H.T., Rodda M., Ercole E., Cozzolino S., Gebauer G., & Perotto S. 2011. Mediterranean meadow photosynthetic orchids feature partial myco-eterotrophy and specific mycorrhizal associations. American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S11307] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=166; TAXLABELS Ceratobasidium_sp._UAMH_9844_DQ068772 Ceratobasidium_sp._UAMH_9845_DQ068773 Ceratobasidium_sp._UAMH_9846_DQ068770 Epulorhiza_anaticula_EU218891 'Epulorhiza sp. 3-4Ll13-1p AM040890' Epulorhiza_sp._Ag3b_AJ313436 Epulorhiza_sp._Am9_AJ313444 Epulorhiza_sp._B1_AJ313445 Epulorhiza_sp._B4_AJ313441 'Epulorhiza sp. C6 CH06X1-1 EF393629' Epulorhiza_sp._CBS_189.90_DQ278944 Epulorhiza_sp._Ec1B_AJ313456 Epulorhiza_sp._Ep_Sst_07_EU418851 Epulorhiza_sp._Nq_AJ313446 Epulorhiza_sp._Onv4.3_AJ313449 Epulorhiza_sp._RO_02_AB369933 Epulorhiza_sp._Ss_AJ313438 Epulorhiza_sp._UAMH_5430_EU218890 Epulorhiza_sp._Van44_AJ313443 Tulasnella_albida_AY373294 Tulasnella_asymmetrica_DQ388047 Tulasnella_bifrons_AY373290 Tulasnella_calospora_AY373298 Tulasnella_calospora_AY643804 Tulasnella_calospora_DQ388041 Tulasnella_calospora_DQ388042 Tulasnella_calospora_DQ388045 Tulasnella_calospora_EF393631 Tulasnella_danica_AY373297 Tulasnella_deliquescens_AY373291 Tulasnella_eichleriana_AY373292 Tulasnella_irregularis_EU218889 Tulasnella_pruinosa_DQ457642 'Tulasnella sp. 07033-45.II.2 HM196800' Tulasnella_sp._169_AY373301 Tulasnella_sp._233_AY373287 Tulasnella_sp._238_AY373288 Tulasnella_sp._245_AY373282 Tulasnella_sp._AL1_Tul_1 Tulasnella_sp._AL1_Tul_2 Tulasnella_sp._AL10_isolated_Tul_1 Tulasnella_sp._AL10_isolated_Tul_2 Tulasnella_sp._AL11_Tul Tulasnella_sp._AL12_Tul Tulasnella_sp._AL13_Tul Tulasnella_sp._AL13_isolated_Tul Tulasnella_sp._AL14_Tul Tulasnella_sp._AL2_Tul Tulasnella_sp._AL4_Tul Tulasnella_sp._AL6_Tul Tulasnella_sp._AL7_Tul Tulasnella_sp._BOP8_isolated_Tul Tulasnella_sp._CP0835.VIII.2_HM196783 'Tulasnella sp. GV-69 DQ834405' Tulasnella_sp._MCU66440 Tulasnella_sp._OF1_Tul_1 Tulasnella_sp._OF1_Tul_2 Tulasnella_sp._OF10_Tul Tulasnella_sp._OF2_Tul Tulasnella_sp._OF3_Tul Tulasnella_sp._OF4_Tul Tulasnella_sp._OF5_Tul Tulasnella_sp._OF6_Tul Tulasnella_sp._OF7_Tul_1 Tulasnella_sp._OF7_Tul_2 Tulasnella_sp._OF8_Tul Tulasnella_sp._OF9_Tul Tulasnella_sp._OF9_isolated_Tul Tulasnella_sp._OP1_Tul Tulasnella_sp._OP2_Tul Tulasnella_sp._OP3_Tul Tulasnella_sp._OP4_Tul_1 Tulasnella_sp._OP4_Tul_2 Tulasnella_sp._OP5_Tul_1 Tulasnella_sp._OP5_Tul_2 Tulasnella_sp._OP6_Tul Tulasnella_sp._OP9_Tul_1 Tulasnella_sp._OP9_Tul_2 'Tulasnella sp. PB-01 DQ834406' Tulasnella_sp._SV1_Tul Tulasnella_sp._SV1_isolated_Tul Tulasnella_sp._SV10_Tul Tulasnella_sp._SV11_Tul Tulasnella_sp._SV12_Tul Tulasnella_sp._SV13_Tul Tulasnella_sp._SV14__Tul Tulasnella_sp._SV14_Tul Tulasnella_sp._SV15_isolated_Tul Tulasnella_sp._SV16_Tul_1 Tulasnella_sp._SV16_Tul_2 Tulasnella_sp._SV17_isolated_Tul Tulasnella_sp._SV18_Tul Tulasnella_sp._SV18_isolated_Tul Tulasnella_sp._SV2_Tul Tulasnella_sp._SV20_Tul Tulasnella_sp._SV21_Tul Tulasnella_sp._SV3_Tul Tulasnella_sp._SV4_Tul Tulasnella_sp._SV5_Tul Tulasnella_sp._SV6_Tul Tulasnella_sp._SV6_isolated_Tul Tulasnella_sp._SV7_Tul Tulasnella_sp._SV8_Tul_1 Tulasnella_sp._SV8_Tul_2 Tulasnella_sp._SV8_isolated_Tul Tulasnella_sp._SV9_Tul Tulasnella_sp._SV9_isolated_Tul Tulasnella_tomaculum_AY373296 Tulasnella_violea_DQ457643 'fungal sp. 5OL1-9B1 AM697921' fungal_sp._AP2_AY643806 'mycorrhizal fungus O-19 ex Dactylorhiza incarnata AJ549130' 'mycorrhizal fungus O-2 ex Orchis laxiflora ssp. palustris AJ549133' mycorrhizal_fungus_VIIf5_ex_Orchis_laxiflora_ssp._palustris_AJ549126 'mycorrhizal fungus XII-1 ex Orchis morio AJ549127' uncultured_Scleroderma_HM196776 uncultured_Tulasnella_AY192460 uncultured_Tulasnella_AY192485 uncultured_Tulasnella_DQ178069 uncultured_Tulasnella_DQ178074 uncultured_Tulasnella_DQ178085 uncultured_Tulasnella_DQ178086 uncultured_Tulasnella_DQ178115 uncultured_Tulasnella_HM196813 uncultured_Tulasnellaceae_AY634122 uncultured_Tulasnellaceae_AY634123 uncultured_Tulasnellaceae_AY634130 uncultured_Tulasnellaceae_AY634131 uncultured_Tulasnellaceae_DQ925497 uncultured_Tulasnellaceae_DQ925503 uncultured_Tulasnellaceae_DQ925536 uncultured_Tulasnellaceae_DQ925537 uncultured_Tulasnellaceae_DQ925552 uncultured_Tulasnellaceae_DQ925554 uncultured_Tulasnellaceae_DQ925555 uncultured_Tulasnellaceae_DQ925557 uncultured_Tulasnellaceae_DQ925564 uncultured_Tulasnellaceae_DQ925576 uncultured_Tulasnellaceae_DQ925593 uncultured_Tulasnellaceae_DQ925595 uncultured_Tulasnellaceae_DQ925597 uncultured_Tulasnellaceae_DQ925599 uncultured_Tulasnellaceae_DQ925600 uncultured_Tulasnellaceae_DQ925629 uncultured_Tulasnellaceae_DQ925633 uncultured_Tulasnellaceae_DQ925644 uncultured_Tulasnellaceae_DQ925658 uncultured_Tulasnellaceae_DQ925661 uncultured_Tulasnellaceae_DQ925664 uncultured_Tulasnellaceae_EF433954 uncultured_Tulasnellaceae_EU195344 uncultured_Tulasnellaceae_EU583690 uncultured_Tulasnellaceae_EU583696 uncultured_Tulasnellaceae_EU583697 uncultured_Tulasnellaceae_EU583698 uncultured_Tulasnellaceae_EU583702 uncultured_Tulasnellaceae_EU583718 uncultured_Tulasnellaceae_EU909163 uncultured_Tulasnellaceae_GQ907254 uncultured_Tulasnellaceae_GQ907258 uncultured_Tulasnellaceae_GQ907263 uncultured_Tulasnellaceae_GQ907266 uncultured_Tulasnellaceae_GQ907271 uncultured_Tulasnellaceae_GQ907278 uncultured_Tulasnellaceae_GQ907279 uncultured_mycorrhizal_fungus_ex_Ophrys_sphegodes_AJ549122 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=45; TAXLABELS Geastrum_schmidelii_EU784247 Sebacina_epigaea_AJ966754 Sebacina_helvelloides_AJ966750 Sebacina_incrustans_AJ966753 Sebacina_sp._AL7 Sebacina_sp._SV1 Sebacina_sp._SV3 Sebacina_sp._SV6 Sebacina_sp._SV7 Sebacina_sp._SV9 Sebacina_sp._src835_DQ974770 Sebacina_vermifera_AF202728 Sebacina_vermifera_DQ983815 Sebacinaceae_sp._B18_AJ549198 Sebacinaceae_sp._F_JLP_1380_AY296259 Sebacinaceae_sp._kz24_EF372401 fungal_sp._CC2_AY643802 uncultured_Basidiomycota_HM241745 uncultured_Basidiomycota_HM241756 uncultured_Basidiomycota_HM241758 uncultured_Basidiomycota_HM241759 uncultured_Basidiomycota_HM241760 uncultured_Sebacinaceae_AJ879655 uncultured_Sebacinaceae_AY286193 uncultured_Sebacinaceae_AY452678 uncultured_Sebacinaceae_AY452680 uncultured_Sebacinaceae_AY634132 uncultured_Sebacinaceae_DQ273405 uncultured_Sebacinaceae_EF077512 uncultured_Sebacinaceae_EF218817 uncultured_Sebacinales_AM181396 uncultured_Sebacinales_DQ182435 uncultured_Sebacinales_EF030946 uncultured_Sebacinales_EF417824 uncultured_ectomycorrhizal_fungus_AY277943 'uncultured endomycorrhiza ex Neottia nidus-avis AF440647' 'uncultured endomycorrhiza ex Neottia nidus-avis AF440648' 'uncultured endomycorrhiza ex Neottia nidus-avis AF440651' 'uncultured endomycorrhiza ex Neottia nidus-avis AF440652' 'uncultured endomycorrhiza ex Neottia nidus-avis AF440656' uncultured_fungus_AJ875396 uncultured_mycorrhiza_ex_Hexalectris_revoluta_sp._F_AY243532 uncultured_mycorrhiza_ex_Hexalectris_spicata_sp._E_AY243531 uncultured_mycorrhizal_fungus_ex_Dactylorhiza_incarnata_AJ549120 uncultured_sebacinaceous_ectomycorrhiza_ERF3_AY093438 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=104; TAXLABELS Cantharellales_sp._UAMH_5437_EU218893 Ceratobasidium_albasitensis_AJ427399 Ceratobasidium_anceps_AJ427402 Ceratobasidium_angustisporum_AJ427403 Ceratobasidium_bicorne_AF200514 Ceratobasidium_cereale_AJ302009 Ceratobasidium_cornigerum_AJ301902 Ceratobasidium_papillatum_AJ427401 Ceratobasidium_ramicola_AJ427404 'Ceratobasidium sp. AG-A EU152858' 'Ceratobasidium sp. AG-B(o) DQ279057' 'Ceratobasidium sp. AG-Ba DQ279059' 'Ceratobasidium sp. AG-Bb DQ279058' 'Ceratobasidium sp. AG-C DQ279046' 'Ceratobasidium sp. AG-D DQ279060' 'Ceratobasidium sp. AG-E DQ279013' 'Ceratobasidium sp. AG-F DQ279014' 'Ceratobasidium sp. AG-G DQ102402' 'Ceratobasidium sp. AG-H DQ279065' 'Ceratobasidium sp. AG-I DQ102444' 'Ceratobasidium sp. AG-K DQ279056' 'Ceratobasidium sp. AG-L AF354093' 'Ceratobasidium sp. AG-O DQ279045' 'Ceratobasidium sp. AG-P DQ279015' 'Ceratobasidium sp. AG-Q DQ279061' Ceratobasidium_sp._AL1_Cer Ceratobasidium_sp._AL10_Cer Ceratobasidium_sp._AL11_Cer Ceratobasidium_sp._AL3_Cer_1 Ceratobasidium_sp._AL3_Cer_2 Ceratobasidium_sp._AL4_Cer_1 Ceratobasidium_sp._AL4_Cer_2 Ceratobasidium_sp._AL5_Cer_1 Ceratobasidium_sp._AL5_Cer_2 Ceratobasidium_sp._AL8_Cer Ceratobasidium_sp._AL8_isolated_Cer Ceratobasidium_sp._AL9_Cer_1 Ceratobasidium_sp._AL9_Cer2 Ceratobasidium_sp._BRAL9_Cer_1 Ceratobasidium_sp._BRAL9_Cer_2 Ceratobasidium_sp._CAAL8_Cer Ceratobasidium_sp._FPUB_168_EF536969 Ceratobasidium_sp._JTO048_AF472285 Ceratobasidium_sp._JTO116_AF472299 Ceratobasidium_sp._JTO124_AF472301 Ceratobasidium_sp._JTO162_AF472302 Ceratobasidium_sp._JTO163_AF472303 Ceratobasidium_sp._OF10_isolated_Cer Ceratobasidium_sp._OF2_Cer_1 Ceratobasidium_sp._OF2_Cer2 Ceratobasidium_sp._OF2_isolated_Cer Ceratobasidium_sp._OF3_Cer_2 Ceratobasidium_sp._OF8_isolated_Cer Ceratobasidium_sp._OP1_Cer Ceratobasidium_sp._OP2_Cer Ceratobasidium_sp._OP7_isolated_Cer Ceratobasidium_sp._OP8_isolated_Cer Ceratobasidium_sp._SV11_Cer Ceratobasidium_sp._SV11_isolated_Cer Ceratobasidium_sp._SV19_isolated_Cer Ceratobasidium_sp._SV21_Cer Ceratobasidium_sp._SV3_Cer Ceratobasidium_sp._SV6_Cer Ceratobasidium_sp._SV8_Cer_1 Ceratobasidium_sp._SV8_Cer_2 Ceratobasidium_sp._UAMH_5443_EU218894 Ceratobasidium_sp._aurim1217_DQ093646 Ceratobasidium_sp._olrim908_AY787667 'Ceratorhiza oryzae-sativae EF429314' Ceratorhiza_sp._UAMH_6440_EU218895 Rhizoctonia_sp._162a_AY586182 Rhizoctonia_sp._269_AJ419931 'Rhizoctonia sp. 3-4Ll20-5p AM040889' 'Rhizoctonia sp. 85-387/Na AF200519' Rhizoctonia_sp._Oss2_AJ318425 Rhizoctonia_sp._Pha1_AJ318423 Thanatephorus_cucumeris_AF354059 fungal_sp._PN1_AY643803 fungal_sp._PO1_AY643805 'mycorrhizal fungus VII-17d ex Dactylorhiza incarnata AJ549123' uncultured_Basidiomycota_AY833047 uncultured_Basidiomycota_AY970109 uncultured_Ceratobasidiaceae_AY634119 uncultured_Ceratobasidiaceae_AY634120 uncultured_Ceratobasidiaceae_AY634126 uncultured_Ceratobasidiaceae_AY634127 uncultured_Ceratobasidiaceae_AY634128 uncultured_Ceratobasidiaceae_AY634129 uncultured_Ceratobasidiaceae_AY634163 uncultured_Ceratobasidiaceae_DQ182419 uncultured_Ceratobasidiaceae_HM141007 uncultured_Ceratobasidiaceae_HM141017 uncultured_Ceratobasidiaceae_HM141029 uncultured_Ceratobasidiaceae_HM141032 uncultured_Ceratobasidiaceae_HM141034 uncultured_Ceratobasidiaceae_HM141039 uncultured_Ceratobasidiaceae_HM141046 uncultured_Ceratobasidium_FJ809765 uncultured_Ceratobasidium_FJ809766 uncultured_Ceratobasidium_FJ809767 uncultured_fungus_DQ093780 uncultured_fungus_EF433959 'vouchered mycorrhizae (Basidiomycota) AB303044' 'vouchered mycorrhizae (Basidiomycota) AB303051' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M8193] TITLE Tulasnella; LINK TAXA = Taxa1; DIMENSIONS NCHAR=671; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Ceratobasidium_sp._UAMH_9844_DQ068772 -------------------------GACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTT-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCAT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGTCACTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGCCCGAAATGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCCGACGTGGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Ceratobasidium_sp._UAMH_9845_DQ068773 --------------------CTT-GGACGTTCTATCTC--CATC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCCA---GTCTGTGTTACCTC---------CTC--G-G-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTA--CAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGCTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTCGAGTTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTCCTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Ceratobasidium_sp._UAMH_9846_DQ068770 ----------------------T-GGACGTTCGCTTATTCCGTT--GTCCTC-AGGACGTTAAGCTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGTAAAACCCGTCGCT------CTGTGTTACCTCT----------------GAGGCACACGTTAAAGATTGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTAT--AAACTTTTTACAACCGGTAGCGA-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCCT-----TTTT--CCAAA---GGACCCGAGTTCGGAGTCCTCGGTCC-TCT----GGATCGTGTTC-TCTTAGATGCGTCGCACCGATCGCCT-GATGGGT-C-TCTAATGCCTAAG-CGTGGAGT------TC-CTTCAGAGTCCGAGACGTGCTTGACCGGGTGTTG--AGCTCGCGTCACCAAGTCTGC------CTTAACAAGCAG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Epulorhiza_anaticula_EU218891 -------------------------------------------------------------------------CAGAGG-ATAAACCGCCGTCCTT-----------------------------GTGTTACCTTC---------------CGG--CACACGTTAAAGATCGCTCTGCG-TTG-TGAGTATAA-ACC-GTTGTAATGAA---ATCTACAACCGGTAGCAT-TGGATCCCTTGGCATGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--TGCACC----GCGCTCTAAACCAGCC-CGGTATGCCCCTTTGAGCGTCATTTTTGTTCTTCGG----GAGCCTTACGCACTTCGGTGC-----TGGCCCGAGTTCGGAGTCCTCGGTTT-CTTGG---AACCGTGTTC-TCTTAGATCCAGCACGCTGACCATCCCGGCGGGT-CCTCTAA-GCTTGAG-TGCAGAGG------CC-TTCTAGTGGGTGAA--GCGTCCGACAGCGGCTTG--AGCGC-TGTCACCAAGTCCCTCG---TCTCTCGACTTGGGTACTACAA-ATCATGACCTC-ATTGGGG-TAGGACAACCCGC 'Epulorhiza sp. 3-4Ll13-1p AM040890' ------------GTAATCGTCTT-TGACGTTCTATTTC--CATC--GTCCTCTGGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGG{CT}-TAAACGGTCGCTTT--GCCTGTGTTACCTC---------{CT}TT--G-G-AGGCACACGTTAAAGAT{CT}GTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTCTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGCTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGCTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTTCTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Epulorhiza_sp._Ag3b_AJ313436 GAAAGGATCATAGTAATCGTCTT-TGACGTTCTAT-TC--TGTC--GTCCTT-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGTG------CTGTGTTACCTC---------TCC--G-G-AGGCACACGTTAAAGAACGTTCCGCA-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTT-ACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCTCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGC-GAA---AGACCCGAGTTCGGAGTCCTCGGTCT-TTT----GGATCGTGTTC-TCTTAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTCTGGGTTTGAGACGCGCTTGACCGGCCATTG--GGCTTGCGTCACCAAGTCCACAT-CCTTTGGGATGGTGG-TACTACAAC-GCATGACCTC-ATCGGGG-TAGGACAACCCGC Epulorhiza_sp._Am9_AJ313444 GGAAGGATCATAGTAATCGTCTT-TGACGTTCTTTTTC--CGTC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGGCAGAGGT-AAATCCGTC--C------TTGTGTTACCTC---------TAC---CG-AGGCACACGTTAAAGATCGTTCCGCA-TTG-TGAGTCTGACACCAGTTGTA---AAAACCATTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGTAC--TGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTC------TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTT----GGATCGTGTTC-TCTTAGATGCATCGCGCCGATCGCCT-GATGGGTCACTCTGATGCCTGAG-CGTGGAGT------CC--CTCGGAGTC-GAGACGCGCCTGACCGGGTGTTG--AGCTCGCGTCGCCAAGTCCGCGTTCCTTTGGGACGTCGGGTACTACAAC-ACATGACCTC-ATCGGGG-TAGGACAACCCGC Epulorhiza_sp._B1_AJ313445 GGAAGGATCATAGTAATCGTCTT-TGACGTTCTATCTC--CATC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCAAT----GCCTGTGTTACCTC---------TTC--G-G-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-ATCTTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGTTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGC------CC--CTTTGAGCTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTTCTGGACGTCGG-TACTACAAC-ACATGACCCC-ATTGGGG-TAGGACAACCCGC Epulorhiza_sp._B4_AJ313441 GGAAGGATCATAGTAATCGTCTT-TGACGTTCTATTTC--CATC--GTCCTC-AGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCAAT----GCCTGTGTTACCTC---------TTC--G-G-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-ATCTTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGTTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGCTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTTCTGGACGTCGG-TACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC 'Epulorhiza sp. C6 CH06X1-1 EF393629' GCAAGGATCATAGTAATCGTCTT-TGACGTTCTATTTC--CATC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGC-TAAACGGTCGCTTT--GCCTGTGTTACCTC---------TTT--TCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTCTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGTTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGCTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTTCTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Epulorhiza_sp._CBS_189.90_DQ278944 GGAAGGATCATAGTAATCGTCTC-TGACGCACTTGCTAC----C--GTCCAC-CGGACGCTAAGACGCTCTGACGAAGA-GGATAACTCGTCCGCA-----------------------------GTGTTACCTCC---------------GGG--CACACGTTAAAGATCGCTCTG{CT}G-TTG-TGAGTCTCAAACC-GTTGTAA-AAC----ACTACAACCGGTAGCAT-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTTCACCTTCGT----GAGCCGT-TGTGCACCTGCACTC---TGGCCCGAGTTCGGAGTCCTCGGTCC-TCCTCTG-GACCGTGTTC-TCTTAGATCCAGCACGCTATGCATCCTGGCGGGT-TCTCTAATGCCTGAG-CGCAGAGA------CC-CGTTCGCGTTGAGAGCGT-TCCGACCGCGACGTGTGAGCGCGCGTCAGCAAGGCCCG-----------CTTGCGGGTACTACACTA-CATGACCTC-ATTGGGG-TAGGACAACCCGC Epulorhiza_sp._Ec1B_AJ313456 -------------------------------ATGTGCTGGCGCT--------TTGCATGT-GCACTCC--TTAACACAAT-TACACAC--CTG-TGAACCT-CGAACCGTGTCTGT--GCTGATCCCGTTAGG--GAGAGGTGCGCGCG-CGTTCTTACTTTACAAAACCCT---GTTAACTAAAGCTCTAGAAAGTGTTGCATTAATA----AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCC----TCTGGTATTCCGGAG--GGCATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCTAACATTTT-----GTTA----AT---GGTCTTATGGGTGAAGCCTG-TGGTCTAGCG----AGGCCGCGGG---TTGTAATCCTTAGGACCAAAGTGTTAG--AGATTGGACTTGAGTTT----TGTTGGCC-----CGT--T----GGGTCAA--CTGACTC-GAAATTGATTAGTGATGCGTGATCCCTTG---GGTCCATCTCGGCGTGATAAG--TTGAT-CGC------------------------------- Epulorhiza_sp._Ep_Sst_07_EU418851 ------------------------------GATGTGCTGGCG---TTGATT--CGCATGT-GCACTCC--TTAACACAAC-CACACACACCTGGTGAACCT-CGAACCGCGC-----------TCCTCCAGGG--GATGCGCGTTCAA--C-------CTTTACAAAACCCA---TTTGATCAGAGCTCTGGAACGA-GACGCTAAAAGTT--AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCC----TCTGGTATTCCGGAG--GGTATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCCAACGTTTT-----GTTA----AA---GGTCTTGTTGACTTGTCCTGCCGGCCTAGCG----AGGCTGCTG----CGAC-TGTTGCGAGGCTGAAGCGTTGG--AGCTTGGACCTGAGCTC----TGTTGGCC-----TTC--CC---AGGTCGA--CTGGCTA-GAAATGCATCAGCGATGAC--GTCCCTTG---GGTCCATCTCGGCGTGATAAG--TTGAT-CGT------------------------------- Epulorhiza_sp._Nq_AJ313446 GGAAGGATCATAGTAATCGTCTT-TGACGTTCTATTTC--CATC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGC-TAAACGGTCGCTTT--GCCTGTGTTACCTC---------TTT--TCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTCTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCCAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGTTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGCTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTTCTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Epulorhiza_sp._Onv4.3_AJ313449 GGAAGGATCATAGTAATCGTCTT-TGACGTGCTGTTTC--CGTC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACAGAGGT-AAAGCCGTC---------CTGTGTTACCTC---------TTT-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTT----GGATCGTGTTC-TCTTAGATGCGTCGCGCCGATCGCCT-GATGGGTCACTCTAATGCCTGAG-CGTGGAGT------CC--CTCGGAG-CTGAGAGGCGCTTGACCGAGTGTTG--AGCTCGCGTCGCCAAGTCCGCA--CGTCTTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCCG Epulorhiza_sp._RO_02_AB369933 --------------------------------GTTGCTGCTGG------TTCTTACAAGT-GCACGCC--GTGTCTTTCT-TATCCAC-CCCACCGTGCATC-CCGGCGCGCC----------TCGTCTTTCGACGGGGGGCGG-TCC----GTTTTTT-ACACCTTATCTT--TTGTAACCG-AGCGAATGAAATT-GATTTAACAA-----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-TTCGCTT-----CTGA--TTGC--AAAGGTCTTGTGTTCGGCGAAGTCGTCTATCG----AGGCGGCGGTA-GCTGAACCTGGACTTG--GAAGTGTATT-GGTCTTGGACTTGAGCGTCT--CGTCGGTC-----CGC--TT---GGATCGA--CCCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- Epulorhiza_sp._Ss_AJ313438 GGAAGGATCATAGTAATCGTCTT-TGACGTTCGCTTTCTCCTTC--GTCCTC-GGGACGTGAAGCTGCTCTGGTCGAGG-ATAAATGACCCCTCTGACCGAGGC-GGACCCGTCG----------GTGTTACCTC---------TCC----GGAGGCACACGGTAAAGATCGTTCCGCG-TTG-TGAGTCTGACACCAGTTGTAACCAACTTTTTTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTTTTCCTTCGG----GAGTCTG-----CGCTT-TGGCC---AGACCCGAGTTCGGAGTCCTCGGTCC-TCCC---GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCCAATGCCTGAG-CGTGGAGG------TC-CTCGGGAGCTTGAGAGGCGTTTGACCGGGTGGTG--AGCCCGCGTCGCCAAGTCCGC----CCTTTGGGGACCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Epulorhiza_sp._UAMH_5430_EU218890 ------------------------------GATGTGCTGGCG---TTCGTT--CGCATGT-GCACTCC--TTAACACAAC-CACACACACCTG-TGAACCT-CGAACCGCG------------TCCCCCAGGG--GTCGTGCGTTCAA--C-------CTTTACAAAACCCA---TTTGATCAGAGCTCTGGAACGA-GACGCTAAAAGTT--AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCC----TCTGGTATTCCGGAG--GGTATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCCAATGTTTT-----GTCA----A----GGTCTTGTCGACTCGTCCCACCGGCCTAGCG----AGGCTGCTG----CGAC-CGTCGCAAGGCTGAAGCGTTGG--AGCTTGGACTTGAGCTC----TGTTGGCC-----TTT--CC---AGGTCGA--CTGGCTA-GAAATGCATCAGCGATGAC--GTCCCTTG---GGTCCATCTCGGCGTGATAAG--TTGAT-CGT------------------------------- Epulorhiza_sp._Van44_AJ313443 GGAAGGATCATAGTAAACGTCTT-TGACGCACTTCGTT-CCGTC--GTCCTC-CGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGC-TAACCCGTCGCGT---CTCCGTGTTACCGT--------------CCG-CGGCACACGTTAAAGAGTGTTCCGCA-TTG-TGAGTCT--TGCTGGTTGTAAT-AAACTGTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTACAT-CCTTCGG----GAGTCTC-----CTTTGCT--GG---AGACCCGAGTTCGGAGTCCTCGGTCC-TTTG---GGACCGTGTTC-TCTCAGATGCATCGCGCCGATCGCTTTGATGGGTCACTCTAATGCCTGAG-CGTGGAGT------CC--CTCTGAAGTCGAGACGCGCTTGACCGGGTGGTG--AGCCCGTGTCGGCAAGTCCATGT-CCGTAAGGACGTCTG-TACTACAACCACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_albida_AY373294 ----------------------------------------GGAAACCTGCGGAAGGATCAT-AGTTATGGAGAGGTCAGCCTTTCAAGGGCCCCTCGTCGCACTCTGGATGCAATGCGC--CTGATCGCGCTAGTCTTGGTCCTTCGGA--GCCTCGACACACCCTTTGA-AATCCA-ACCCA-TGCTTACGA-ACGAAAACACA--AGAGAATT-ACAACCAGCAGCGT-TGGATCCCTTGGCATGTCA-TTCGATGAAG-ACCGTT-GCAA-AATGCGATAA-GTGGTGTGATATGCAAGTCCAAAACTTATACGTGAACCATCGAATTG--TTGAACGCAC--TGCATC-----GAGCCTTACCCAGGAACGATACGCCCCAGTGAGCGTCATT--ACGTCTTCGC------GACTTGTCGTCTTCTTGATGA--CCTGTCCGGGTTCGGGATTCAC----GGCCCCTTGGGGTCGCGCTT-CCTCAGAAACATGGACGCATGCGGCCTGAAGGTGT---CCTTGTCATGAA-TGTCAAG---GTCGCTTCTTGAGGGCTTGCCATGCAAGATCGATCTC--------CGATCAAA--GGCAACCGCTTTG-------GCGGGCGCA-ACTTCTACACATGACCTC-ACGGGGGTGGG-ATGACCCGC Tulasnella_asymmetrica_DQ388047 -----------------------------------------------------------------------------------------------------------------------------CGACGCTAGTCTTGG--TCTCCGG--ACCTCGACA--ACCTTTGT-AATCCGTAATCA-TGCCTAT----TCATAACCAA--AGAGATTTTACAACCAGTAGCGT-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-AATGCGATAA-GTGGTGTGATATGCAAGTCCAAAACTTATACGTGAACCATCGAATTG--TTGAACGCAC--TGCATC-----GATCCTTACCCAGGAACGATACGCCCTATTGAGCGTCATT--ATGTCTTCGC------GAC--GTCGACTCTTTGCCGAGTCTCGTCCGGGTTCGGGATTCAT----GGCCCT-CGCGGTCGCGCTT-CCTTAGATGCATTGATGCGCCGACGCGAACGGTGA---CCTTGTCATGAA-TGTCGAG---GTGTGCCGGCGAGCGTTTGT-GCGCGAGATCCTTTGCTCGCCATCGGATCAGACCTGCGACCGTCCCGCAAGGGTTCGGAAGCGGACTTCTACACATGACCTC-AAGGGGGTGGG-ACGACCCGC Tulasnella_bifrons_AY373290 GGAAGGATCATAGTAATCGTCTT-TGACGTTC-TTTTT-CCGTC--GTCCAC-GGGACGTTAACGTGCTCTGGTCGAGG-ATAAATGACCCCTCTGACCGAGGTAAAACCCGTCGCT------CTGTGTTACCTCCAAAAAATTTTTTTACCGAGGCACACCTTAAAGATCGTTCCGCA-TTG-TGAGTCTAACACCAGTTGTAT--AAACTTTTTACAACCGGTAGCGA-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCCT-----TTT---ACAAA---GGACCCGAGTTCGGAGTCCTCGGTCC-CA----TGGATCGTGTTC-TGTTAGATGTCTCGCACCAGTCGCCT-GATCGGT-CCTATAATGCCTAAG-CGTGGAGT------TC-CTTCA-AGTCTGACACGTGCTCGACCGGGTCTTG--AGCTCG?GTCACCAAGTCTGC------CT-CACAAGCAG-TACTACAAC--------------------------------- Tulasnella_calospora_AY373298 GGAAGGATCATAGTAATCGTCTT-TGACGTTCTGT-TC--CGTC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACTGAGGT-TAAGCGGTCG--------CTGTGTTACCTC---------TTT--TCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTT-ACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATT-TATTCCTTCGG----GAGTCTT-----TCCTTGC-GAA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTCTGGAGTAGAGACGTGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTTGGGACGGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_calospora_AY643804 --AAGGATCATAGTAATCGTCTT-TGACGTTCGCTTATTCCGTT--GTCCTT-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAATGACCCCTCTGACCGAGGTAAAACCCGTCGCT------CTGTGTTACCTCTT---------------GAGGCACACGTTAAAGATCGTTCCGCA-TTG-TGAGTCTAACACCAGTTGTAT--AAACTTTTTACAACCGGTAGCGA-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCCT-----TTTT--ACAAA---GGACCCGAGTTCGGAGTCCTCGGTCC-TCT----GGATCGTGTTC-TCTTAGATGCGTCGCACCGATCGCCT-GATGGGT-C-TCTAATGCCTAAG-CGTGGAGT------TC-CTTCAGAGTCCGAGATGTGCTTGACCGGGTGTTG--AGCTCGTGTCACCAAGTCTGC------CTCA-CAAGCAG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_calospora_DQ388041 GGAAGGATCATAGTAATCGTCTT-TGACGTTCTGT-TC--CGTC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAGCGGTTG--------CTGTGTTACCTC---------TCT--TTG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACAAGTTGTA---AAC-TTTT-ACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATT-TATTCCTTCGG----GAGTCTT-----TCCTTGT-GAA---AGACCCGAGTTCGGAGTCCTCGGTC--TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTCTGGAGTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTTTGGGACGGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_calospora_DQ388042 ----------------TCGTCTT-TGACGTTCTGT-TC--CGTC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCGGTCG--------CTGTGTTACCTC---------TTG--TCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACA--ACTTGTA---AAC-TTT--ACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATT-TATTCCTTCGG----GAGTCTT-----TCCTTGC-GGA---AGACCCGAGTTCGGAGTCCTCGGTC--TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTCTGGAGTTGAGACGTGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTTTGGGACGGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_calospora_DQ388045 GGAAGGATCATAGTAATCGTCTT-TGACGTTCTGT-TC--CGTC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAGTGGTCG--------CTGTGTTACCTC---------TTG--TCG-AGGCACACGTTAAAGATCATTCCGCG-TTG-TGAGTCTAACA--ACTTGTA---AAC-TTTT-ACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATT-TATTCCTTCGG----GAGTCTT-----TCCTTGC-GAA---AGACCCGAGTTCGGAGTCCTCGGTC--TTT----GGATCGTGTTC-TCT{CT}AGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTCTGGAGTTGAGACGTGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTTTGGGA{CT}GGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_calospora_EF393631 GCAAGGATCATAGTAATCGTCTT-TGACGTTCTGT-TC--CGTC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAGTGGTCG--------CTGTGTTACCTC---------TTG--TTG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACA--CTTTGTA---AAC-TTTT-ACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATT-TATTCCTTCGG----GAGTCTT-----TCCTTGT-GAA---AGACCCGAGTTCGGAGTCCTCGGTC--TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTCTGGAGTTGAGACGTGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTTGGGACGGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_danica_AY373297 GGAAGGATCATAGTAATCGTCTT-TGACGC---CGCTATCAAAC--GTCCGC-CGGACG?TAAGCCGCTCTGGCAGAGG-ATAAACCGCCGCCA-------------------------------GTGTTACC?TC---------------CGGGGCACACGTTAAAGATCGCTCTGCG-TTG-TGAGTCTCA-ACC-GTTGTAAATAA---AACTACAACCGGTAGCAT-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTTGTTCTTCGT----GAGCCTTACGCATTCGCGTGCGC---TGGCCCGAGTTCGGAGTCCTCGGTCC-TCCCG---GACCGTGTTC-TCTCAGATGCAGCACGCCCTCCACCTCGACGGGT-CCTCTCATGCCTGAG-CGCAGAGG------CC-CGACGCAGCGTG?G--GCGTCCGACCGCGACCTG--AGCGCGCGTCACCAAGTCCC---------CTTCACCGGGGTGCTACAA-TGCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_deliquescens_AY373291 ---------------ATCGT{CG}TT-TGACGTTCTGT-TC--CGTC--GTCCTAAGGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACTGAGGT-TAAGCGGTCG--------CTGTGTTACCTC---------TTT--TCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTT-ACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATT-TATTCCTTCGG----GAGTCTT-----TCCTTGC-GAA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTCTGGAGTAGAGACGTGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTTGGGACGGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_eichleriana_AY373292 GCCGGGTGAGCCCTCTGGGCTT-CACATCCCTTCGTGTGATCCTCGTGGTCACGTTAATTGGAGCGAG--AGGTCATCCTCCGCCCTG-CGGTCTGGACGTTCGCGTCGGGTCCTCTC---CGCATCGCCCCCACCGAACATGCATAAA-----TACATGGGGCGGGCCTCTGGCCAGACTTA-ACTACACAACTATCGAGATCATACAGTTTTATACAACTGGTAGCGT-TGGATCCCTCGGCATGGCTATCG-ATGA-AGAGCGCG-GCCA-GCTGCGAAAT-GTGATGTGAATTGCAACTCAAAGCGGTTATCGTGAATCATTGACTAC--TTGAACGCA--TTGCACCGC---C---CTTTTGGGAGT--GGTACGCCCGATTGAGTGTCATAATCTC-TTCAGGCCCCTCGGTCTT----GGTCGTTCGCTCGACGGCCGCAGATGCGCTGCAACCCATCTTCCAC--AGGTGGCGGAG-GC{AG}CTTTTGCGG------GAGACTCTGGTGG{CT}TCTGGCTTCGAGGCTGCA-CGGCGATC-----CC-----------GCCG--CGCGCCTTCAGATGCATTAGCGGTCGATCCTGGTCAGACAAGTTCGACTCCACGTGATGATATCATGTTCGT------------------------------- Tulasnella_irregularis_EU218889 -------------------------------------------------------------------------------------------------------------------------------------------------ACACACGTTAAAGAA-GCGAAATGC-ACAGACCGTACC-GTCTATACG---AGCCTTGAC--AAGTGACTTACAACCGGTAGCGT-TGGATCCCTTGGCACGCCG-ATCGATGAAG-ACCGTT-GCAA-ACTGCGATAA-GTGGTGTGATGCGCAAGTCTAAAACTTATAAGTGAATCATCGAATCG--TTGAACGCAC--TGCACC-----TGTCC-TATCCGGACC-GGTATGCCCCTTTGAGCGTCATTA-AAC---------------CTTCGGCACCCGCCGG------GTTCGGG--GTCCACCCCTGCCGTCT--TTGCGGCGGGGGCGTTC-CCTCAGATGCATT--GC---GAGGGCCGAGCCCGACGACCGCGTCCACCG-TGTCATG--AGACATGCGCGGCGGTGCGGCGA-ACGGGAGGCGCCCGGGACGTCGTCCGCAGA-----GAGACCGTCCG----AAGCA--CACCCTTTTTTAAATGTGACCTC-ACTGGGGTAAG-ACTACCCGC Tulasnella_pruinosa_DQ457642 ------------------------------------------GAACCTGCGGAAGGATCATCAGTTATGGAGAGGTCAGCCTT-CACGGGCCCCTCGTCACACTCTGGATGCAATGCGG--T--AACACGCTAGTCTTGG--CCTCCGG--GTCTCGACACAAC-TTTGA-TATCCA-TCTCA-AATGCCTAT-TCGATTTTACA--AGAGAATT-ACAACCAGTAGCGT-TGGATCCCTTGGCATGTCA-TTCGATGAAG-ACCGTT-GCAA-AATGCGATAA-GTGGTGTGATATGCAAGTCCAAAACTTATACGTGAACCATCGAATTG--TTGAACGCAC--TGCATC-----GAGCCTTACCCAGGAACGATACGCCCCATTGAGCGTCATT--ATGTCTTCGA------GACCTGTCGTTTTTTT--CGA--CTTGTCCGGGTTCGGGATTCAC----AGCTCC----GGCTGCGCTT-CCTCAGATACATGGATGCGCACGGTTTGAAGGTGT---CCTTGTCATGAA-TGTCGAG---GT--GTGCCTAAGGAC-CGTTGTGCAAGATCTTCCGCTCACCGGTCGATCAGC--TGCAAACGCTTCG-------GCGGATGCG-ACTTCTACACATGACCTC-ACGGGGGTGGG-ACGACCCGC 'Tulasnella sp. 07033-45.II.2 HM196800' GCCGGGTGGGCCCTCTGGGCTTTCACATCCCTTCTTGTGACCTC---GGTCACGTTAAATGGAGTGAG--AGGTCACCCTCCACCCCG-CTGTCGAGACGTTCGTTTCGGGTCTCGGCAG-TGTGT-GCCCCTACCGAACAAGCATAAA-----TACATGGGGCAGGCCTCTGGCCAGATGTA--CTTCACAACTATCGAGATAATACAGTTTTATACAACTGGTAGCGT-CGGATCCCTCGGCATGGCTATCG-ATGA-AGAGCGCG-GCCA-GCTGCGAAAT-GTGATGTGAATTGCAACTCAAAGCGGTTATCGTGAATCATTGACTAC--TTGAACGCA--TTGCACCGC---C---CTCTCGGGAGT--GGTACGTCCGATTGAGTGTCATAATCCA-TTCAGGCCCTCTGGTTCC----GGTCGTTCGTTCGGCGACTGTCTGTGTGCTGCAAGCTGTCCTCTAT--GGGCGGTGGAC-GTGCAAAGGCAG------GGTTCTACTGTGGCTCTGGCTTCGAGGCTTCA-TGGCGATC-----TATC---------GTCA--CGGGCCTTTAGATGCATTAGCGGTCGTCCTTGTTCATACAAGTTTGACTCCACGTGATGAGATCATGTCGTG------------------------------- Tulasnella_sp._169_AY373301 GGAAGGATCATAGTAATCGTCTT-TGACGTTCGCTTTT-CCGTC--GTCCTC-GGGACATTAAGGTGCTCTGGTCGAGG-ATAAATGACCCCTCTGACCGAGGTTAAACCTGTCGCT------CTGTGTTACCTCCAAAAA-TTTTTTTACCGAGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTAT--AAACTTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTTGG----GAGTCCT-----TT----ACAA----GGACCCGAGTTCAGAGTCCTCGGTCC-GACC--TGGATCGTGTTC-TCTTAGATGCGTCGCACCGATCGCCT-GATGGGT-CCTCTAATGCCTAAG-CGTGGAGT------TC-CTTCAGAGTCCGACACGTGCTTGACCGGGTCTTG--AGCCTGTGTCACCAAGTCTGC------CT-AACAAGCAG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._233_AY373287 GGAAGGATCATAGTAATCGTCTT-TGACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTT-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGTCGCTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGCCCGAAACGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCTGACGTGGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._238_AY373288 GGAAGGATCATAGTAATCGTCTT-TGACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTT-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGTCGCTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGCCCGAAACGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCTGACGTGGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._245_AY373282 GGAAGGATCATAGTAATCGTCTT-TGACGTTCGCTTTTTCCGTT--GTCCTC-GGGACGTTAATGCGCTCTGGTCGAGG-ATAAATGACCCCTCTGACCGAGGTAAAACCCGTCGCT------CTGTGTTACCTCGAAAAAATTTTTCTTCCGAGGCACACGTTAAAGATCGTTCCGCA-TTG-TGAGTCTAACACCAGTTGTAT--AAACTTTTTACAACCGGTAGCGA-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCCT-----TTT---ACAA----GGACCCGAGTTCAGAGTCCTCGGTCC-TCTTC-TGGATCGTGTTC-TCTTAGATGCGTCGCACCGATCGCCT-GATGGGT-CCTCTAATGCCTAAG-CGTGGAGT------TC-CTTCAGAGTCCGAGACGTGCTTGACCGGGTTTTG--AGCTCGCGTCACCAAGTCTGC------CTTAACCGGCAG-GACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._AL1_Tul_1 GGAAGGATCATAGTAATCGTCTT-TGACGTTCTATCTC--CATC--GTCCTC-GGGACGTTAGGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCTTT--GCCTGTGTTACCTC---------TTT--G-G-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTCTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTTCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGCTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGCTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTTCTAGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._AL1_Tul_2 GGAAGGATCATAGTAATCGTCTT-TGACGTTCTATCTC--CATC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCTTT--GCCTGTGTTACCTC---------TCT--G-G-AGGCACACGTTAAAGATCGCTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTCTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACACAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGCTCGGGGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGCTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTTCTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._AL10_isolated_Tul_1 GGAAGGATCATAGTAATCGTCTT-TGACGTTCTAT-TC--CATC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCTT---GCCTGTGT-ACCTC---------CTG--G-G-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTA--CAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGCT-GGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCT-AGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTCGAGTTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTCTTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._AL10_isolated_Tul_2 GGAAGGATCATAGTAATCGTCTT--GACGTTCGCTTT---CGTC--GTCCTC-GGGACATTAAGGTGCTCTGGTTGAGG-ATAAATGACCCCTCTGACCGAGGTTAAACCTGTCGCT------CTGTGTTACCTCCAAAAAAATTTTTTACCAAGGCACACGTTAAAGATCGTTCTGCG-TTG-TGAGTCTAACACCAGTTGTAT--AAACTTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCCT-----TT----ACAA----GGACCCGAGTTCGGAGTCCTCGGTCC-TCT----GGATCGTGTTC-TCTTAGATGCGTCGCACCGATCGCCT-GATGGGT-CCTCTAATGCCTAAG-CGTGGAGT------TC-CTTCAGAGTCCGACACGTGCAAGACCGGGTCTTG--AGCCTGTGTCACCAAGTCTGC------CT-AACAAGCAG-TACTACAAC-CCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._AL11_Tul GGAAGGATCATAGTAATCGTCTATCGACGCACTTGCTACAAACC--GTCCGT-CGGACGTTAAGCCGCTCTGGCAGAGG-ATAAACGGCCTCCCT------------------------------GTGTTACCTCT---------------AGGGGCACACGTTAAAGAACGCTCCGCA-TCG-TGAGTCTGACACC-GTTGTGATAACC--AAATACAACCGGTAGCAT-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTATTTCGTTCGCC----GAGCCT--CGCCTTTGGGCGTCT---GGCTCCGAGCTCGGAGTCCTCGGTCC-CCTCGTGGGGCCGTGTTC-TCTCAGATCCAGCGCGTCGACCCTCCGGGTGGGC-TCTCTCATGCCTGAG-TGTGGAGG------CC-CCCC-GT-CCAGGCTCGCGCCCGACGACCACCTG--AGCGTCCGTCAACAAGCATCC--------CCTCCGGGGGGCGCTACAACATCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._AL12_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTCTGT-TC--CGTC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACTGAGGT-TAAGCGGTCG--------CTGTGTTACCTC---------TTT--TCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTT-ACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATT-TATTCCTTCGG----GAGTCTT-----TCCTTGC-GAA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTCTGGAGTTGAGATGCGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCAT-CCTTTGGGACGGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._AL13_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTCTGT-TC--CGTC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACTGAGGT-TAAGCGGTCG--------CTGTGTTACCTC---------TTT--TCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCCAACACCAGTTGTA---AAC-TTTT-ACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATT-TATTCCTTCGG----GAGTCTT-----TCCTTGC-GAA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTCTGGAGTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTTGGGACGGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._AL13_isolated_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTCTGT-TC--CGTC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACTGAGGT-TAAGCGGTCG--------CTGTGTTACCTC---------TTT--TCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCCAACACCAGTTGTA---AAC-TTTT-ACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATT-TATTCCTTCGG----GAGTCTT-----TCCTTGC-GAA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTCTGGAGTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTTGGGACGGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._AL14_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTCTGT-TC--CGTC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACTGAGGT-TAAGCGGTCG--------CTGTGTTACCTC---------TTT--TCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTT-ACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATT-TATTCCTTCGG----GAGTCTT-----TCCTTGC-GAA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTCTGGAGTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTTGGGACGGTGG-TACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._AL2_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTCTAT-TC--CGTC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCTT---GCCTGTGTTACCTC---------TTT--G-G-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTCTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCCT-----TCCTTGCTGAA---AGACCCGAGTTCGGAGTCCTCGGTCC-TCT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGCTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTCTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._AL4_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTCTAT-TC--CGTC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAATGGTCGCTG-----CTGTGTTACCTC---------TTT--CCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---A-C-TTTTTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGC-GAA---AGACCCGAGTTCGGAGTCCTCGGTC--TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC-TTTCTGGGTTTGAGACGTGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTTGCGATGTCGG-TACTACAAC-GCATGACCTC-ATCGGGG-TAGGACAACCCGC Tulasnella_sp._AL6_Tul ------------------------------GATGTGCTGGCGGC-TTAACACCCGCATGT-GCACTCC--TTAACACAAT-CACACAC--CTG-TGAACCT-CGAACCGTGTCTGTGCGCTGATCCCGTAAGG-AGATGCGTGCACGCG-CGTTCTTACTTTACAAAACCCT---GTTAACTAAAGCTCTAGAAAGTGTTGGTTAATAA----AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCC----TCTGGTATTCCGGAG--GGCATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCTAACATTTT-----GTTA----AC---GGTCTTGTGGGTGAAGCCTG-TGGTCTAGCG----AGATTGCAGG---TTGTAATCCTTGGGACTAAAGTGTTGG--AGATTGGACTTGAGTTT----TGTTGGCC-----TGC--TA---GGGTCGA--CTGACTC-GAAATTGATTAGCGATGCGTGATCCATTG---GGTCCATCTCGGCGTGATAAG--TTGAT-CGC------------------------------- Tulasnella_sp._AL7_Tul ------------------------------GATGTGCTGGCGGC-TTAACACCCGCATGT-GCACTCC--TTAACACAAT-CACACAC--CTG-TGAACCT-CGAACCGTGTCTGTGCGCTGATCCCGTAGGG-AGATGCGTGCACGCG-CGTTCTTACTTTACAAAACCCT---GTTAACTAAAGCTCTAGAAAGTGTTGGTTAATAA----AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCC----TCTGGTATTCCGGAG--GGCATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCTAACATTTT-----GTTA----AC---GGTCTTGTGGGTGAAGCCTG-TGGTCTAGCG----AGATTGCAGG---TTGTAATCCTTGGGACTAAAGTGTTGG--AGATTGGACTTGAGTTT----TGTTGGCC-----TGC--TA---GGGTCGA--CTGACTC-GAAATTGATTAGCGATGCGTGATCCATTG---GGTCCATCTCGGCGTGATAAG--TTGAT-CGC------------------------------- Tulasnella_sp._BOP8_isolated_Tul --------------------------------GCCGTTGCTGG------TTATTACAAGT-GCACGTC--GTGTCTTTCTTCATCCAC-CCCTCTGTGCAT-CTGGGCGTGTC---------------TTT-----GGACGCGT-TCCC-AAACTTTACATTACAAAACCGTCT-TGTACTGGTAGAACGTGCTTGCAA-ACCAATTAA----TA--CAACTATCAACAA-CGGATCTCTTGGCATCCCACT-CGATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CGGTGAATCATCGAATCT--TTGAACGCACCTTGCACCCT---T-TGGTATTCCGAAG--GGTATGCCCGGTTGAGTATTATAATCAA-CTCAAGCCT-CTGATTTT----CTAA--TTGC--AAAGGCGTGACGACCGACGAAGCCATTCACAACG--GGGTGGCGGTA-GTTGGAGTTTTGCTTG--GAACTTCAGA-GGTATTGGACTTGAGCGCAC---GTCGGTT-----TAATCTT--TA-ACCGA--CCCGCTTGAA-ATGCATTAGCTGACGA-CCGCACGACACGGTT-TCACTCGACGCGATAAGCC-TATT-CGT------------------------------- Tulasnella_sp._CP0835.VIII.2_HM196783 GCCGGGTGGGCCCTCTGGGCTTTCACACCCCTTCTTGTGACCTC---GGTCACGTTAAATGGAGTGAG--AGGTTACCCTCCACCCTG-CTGTCGAGACGTTCGTTTCGGGTCTCGGCAG-TGTGT-GCCCCCACCGAACATGCATAAA-----TATATGGGGCAGGCCTCTGGCCAGATGTA--CTTCACAACTATCGAGATAATACAGTTTTATACAACTGGTAGCGT-CGGATCCCTCGGCATGGCTATCG-ATGA-AGAGCGCG-GCCA-GCTGCGAAAT-GTGATGTGAATTGCAACTCAAAGCGGTTATCGTGAATCATTGACTAC--TTGAACGCA--TTGCACCGC---C---CTCTCGGGAGT--GGTACGTCCGATTGAGTGTCATAATCCA-TTCAGGCCCCTTGGTTCC----AGTCGTTCGCTCGGCAACTGTCTGTGTGCTGCAAGCTGTCCTCTAT--GGGCGGCGGAT-GTGCAAAGACAT------GGTTCTACTGTGGCTCTGGCTTCGAGGCTTCA-TGGCGACC-----TATC---------GTCA--CGGGCCTTTAGATGTATTAGCGGTCGTCCTTGTTCATACAAGTTTGACTCCACGTGATGAGATCATGTCGTG------------------------------- 'Tulasnella sp. GV-69 DQ834405' GGAAGGATCATAGTAATCGTCTT-TGACGTGCTGTTTC--CGTC--GTCCTC-GGGACGTTAAGGCGCTCTGGTTGAGG-ATAAACGACCCCTCTGACAGAGGT-AAAGCCGTC---------CTGTGTTACCTC---------TTT-GCCGGAGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTT----GGATCGTGTTC-TCTTAGATGCGTCGCGCCGATCGCCT-GATGGGTCACTCTAATGCCTGAG-CGTGGAGT------CA----------------------------------------------------------------------------------------------------------------------- Tulasnella_sp._MCU66440 ------ATTGTTCGGGAAGCTGATGCCTGCTCCGGCGTGTGCTCGCTTCCTGCAATCCATC?ATACACCTGTGCACACTTTGTCGAGAAGAGAAGGAACGAACGGAAATCCGAAAGGGA--TCCTGAACGC-AAACGCTCTTCTCACACACATAAACTCTTG??AAAAAT-CTTGAACGTGAC-CGCGAGCCGCAAGGCCGTAAT--AATCATAATACAACTTTTAACAA-CGGATCTCTTGGCTCTCGC-ATCG??GA?G-AACGCA-GCGA-AATGCGATAC-GTAATGTGAATTGCAGAATT---------CAGTGAATCATCGAATTT--TTGAACGCACCTTGCGCT-----CCTTGGTATTCCGAGG-AGCACGCCTGTTCGAGTGTCGTGA-AGCTCTCAAGCTG-GTCGCTTTATTGTCGATTGCAG----GCTTGGAC-GTGGACTCTGACGTTTTCGCAAGAGAA?GACTGGTC---TAAAATACATT-AGC---TGACCCTTGTTGTGGAT--TCGGTTCTACT-CGACGTGATAAATATCTATCGTCGAG-GACATCCCCAGGGATGGCCGGACTCGCCTCGGGACGCTTCTAATCGTGTTCTT---GGACA--CAACTTT?TCAA-ATTTGACCTCGAATCAGGTGG?-ACTACCCGC Tulasnella_sp._OF1_Tul_1 GGAAGGATCATAGTAATCGTCTT-TGACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTC-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCACCGATCGCCT-GATGGGTCACTCTAATGCCTAAG-CGTAGAGT------CC--CTCGGAGTCCGAGACGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCCAACGTGGCGG-TACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._OF1_Tul_2 --------------------------------GCCGTTGCTGG------TTATTACAAGT-GCACGTC--GTGTCTTTCTTCATCCAC-CCCTCTGTGCAT-CTGGGCGTGTC---------------TTT-----GGACGCGT-TCCC-AAACTTTACATTACAAAACCGTCT-TGTACTGGTAGAACGTGCTTGCAA-ACCAATTAA----TA--CAACTATCAACAA-CGGATCTCTTGGCATCCCACT-CGATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCCT---T-TGGTATTCCGAAG--GGTATGCCCGGTTGAGTATTATAATCAA-CTCAAGCCT-CTGATTTT----CTAA--TTGC--AAAGGCGTGACGACCGACGAAGCCATTCACAACG--GGG-GGCGGTA-GTTGGAGTTTTGCTTG--GAACTTCAGA-GGTATTGGACTTGAGCGCAC---GTCGGTT-----TAATCTT--TA-ACCGA--CCCGCTTGAA-ATGCATTAGCTGACGA-CCGCACGACACGGTT-TCACTCGACGCGATAAGCC-TATT-CGT------------------------------- Tulasnella_sp._OF10_Tul --------------------------------GCCGTTGCTGG------TTATTACAAGT-GCACGTC--GTGTCTTTCTTCATCCAC-CCCTCTGTGCAT-CTGGGTGTGTC---------------TTT-----GGACACGT-TCCC-AAACTTTACATTACAAAACCGTCT-TGTACTGGTAGAACGTGCTTGCAA-ACCAATTAA----TA--CAACTATCAACAA-CGGATCTCTTGGCATCCCACT-CGATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCCT---T-TGGTATTCCGAAG--GGTATGCCCGGTTGAGTATTATAATCAA-CTCAAGCCT-CTGATTTT----CTAA--TTGC--AAAGGCGTGACGACCGACGAAGCCATTCACAATG--GGGTGGCGGTA-GTTGGAGTTTTGCTTG--GAACTTCAGA-GGTATTGGACTTGAGCGCAC---GTCGGTT-----TAATCTT--TA-ACCGA--CCCGCTTGAA-ATACATTAGCTGACGA-CCGCACGACACGGTT-TCACTCGACGCGATAAGCC-TATT-CGT------------------------------- Tulasnella_sp._OF2_Tul --------------------------------GCCGTTGCTGG------TTATTACAAGT-GCACGTC--GTGTCTTTCTTCATCCAC-CCCTCTGTGCAT-CTGGGCGTGTC---------------TTT-----GGACGCGT-TCCC-AAACTTTACATTACAAAACCGTCT-TGTACTGGTAGAACGTGCTTGCAA-ACCAATTAA----TA--CAACTATCAACAA-CGGATCTCTTGGCATCCCACT-CGATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCCT---T-TGGTATTCCGAAG--GGTATGCCCGGTTGAGTATTATAATCAA-CTCAAGCCT-CTGATTTT----CTAA--TTGC--AAAGGCGTGACGACCGACGAAGCCATTCACAACG--GGGTGGCGGTA-GTTGGAGTTTTGCTTG--GAACTTCAGA-GGTATTGGACTTGAGCGCAC---GTCGGTT-----TAATCTT--TA-ACCGA--CCCGCTTGAA-ATGCATTAGCTGACGA-CCGCACGACACGGTT-TCACTCGACGCGATAAGCC-TATT-CGT------------------------------- Tulasnella_sp._OF3_Tul --------------------------------GCCGTTGCTGG------TTATTACAAGT-GCACGTC--GTGTCTTTCTTCATCCAC-CCCTCTGTGCAT-CTGGGCGTGTC---------------TTT-----GGACGCGT-TCCC-AAACTTTACATTACAAAACCGTCT-TGTACTGGTAGAACGTGCTTGCAA-ACCAATTAA----TA--CAACTATCAACAA-TGGATCTCTTGGCATCCCACT-CGATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCCT---T-TGGTATTCCGAAG--GGTATGCCCGGTTGAGTATTATAATCAA-CTCAAGCCT-CTGATTTT----CTAA--TTGC--AAAGACGTGACGACCGACGAAGCCATTCACAATG--GGGTGGCGGTA-GTTGGAGTTTTGCTTG--GAACTTCAGA-GGTATTGGACTTGAGCGCAC---GTCGGTT-----TAATCTT--TA-ACCGA--CCCGCTTGAA-ATACATTAGCTGACGA-CCGCACGACACGGTT-TCACTCGACGCGATAAGCC-TATT-CGT------------------------------- Tulasnella_sp._OF4_Tul --------------------------------GCCGTTGCTGG------TTATTACAAGT-GCACGTC--GTGTCTTTCTTCATCCAC-CCCTCTGTGCAT-CTGGGCGTGTC---------------TTT-----GGACGCGT-TCCC-AAACTTTACATTACAAAACCGTCT-TGTACTGGTAGAACGTGCTTGCAA-ACCAATTAA----TA--CAACTATCAACAA-CGGATCTCTTGGCATCCCACT-CGATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCCT---T-TGGTATTCCGAAG--GGTATGCCCGGTTGAGTATTATAATCAA-CTCAAGCCT-CTGATTTT----CTAA--TTGC--AAAGGCGTGACGACCGACGAAGCCATTCACAACG--GGGTGGTGGTA-GTTGGAGTTTTGCTTG--GAACTTCAGA-GGTATTGGACTTGAGCGCAC---GTCGGTT-----TAATCTT--TA-ACCGA--CCCGCTTGAA-ATGCATTAGCTGACGA-CCGCACGACACGGTT-TCACTCGACGCGATAAGCC-TATT-CGT------------------------------- Tulasnella_sp._OF5_Tul --------------------------------GCCGTTGCTGG------TTATTACAAGT-GCACGTC--GTGTCTTTCTTCATCCAC-CCCTCTGTGCAT-CTGGGCGTGTC---------------TTT-----GGACGCGT-TCCC-AAACTTTACATTACAAAACCGTCT-TGTACTGGTAGAACGTGCTTGCAA-ACCAATTAA----TA--CAACTATCAACAA-CGGATCTCTTGGCATCCCACT-CGATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCCT---T-TGGTATTCCGAAG--GGTATGCCCGGTTGAGTATTATAATCAA-CTCAAGCCT-CTGATTTT----CTAA--TTGC--AAAGGCGTGACGACCGACGAAGCCATTCACAACG--GGGTGGCGGTA-GTTGGAGTTTTGCTTG--GAACTTCAGA-GGTATTGGACTTGAGCGCAC---GTCGGTT-----TAATCTT--TA-ACCGA--CCCGCTTGAA-ATGCATTAGCTGACGA-CCGCACGACACGGTT-TCACTCGACGCGATAAGCC-TATT-CGT------------------------------- Tulasnella_sp._OF6_Tul --------------------------------GCCGTTGCTGG------TTATTACAAGT-GCACGTC--GTGTCTTTCTTCATCCAC-CCCTCTGTGCAT-CTGGGCGTGTC---------------TTT-----GGACGCGT-TCCC-AAACTTTACATTACAAAACCGTCT-TGTACTGGTAGAACGTGCTTGCAA-ACCAATTAA----TA--CAACTATCAACAA-CGGATCTCTTGGCATCCCACT-CGATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCCT---T-TGGTATTCCGAAG--GGTATGCCCGGTTGAGTATTATAATCAA-CTCAAGCCT-CTGATTTT----CTAA--TTGC--AAAGGCGTGACGACCGACGAAGCCATTCACAACG--GGGTGGCGGTA-GTTGGAGTTTTGCTTG--GAACTTCAGA-GGTATTGGACTTGAGCGCAC---GTCGGTT-----TAATCTT--TA-ACCGA--CCCGCTTGAA-ATGCATTAGCTGACGA-CCGCACGACACGGTT-TCACTCGACGCGATAAGCC-TATT-CGT------------------------------- Tulasnella_sp._OF7_Tul_1 ----------------------------------------------------------------GCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGA?GT-TAAACGGTCGCCA---GTCTGTGTTACCTC---------CTC--G-G-AGGCACACGTTAAAGATCGTTCCGCGGTTG-TGAGTCTAACACCAGTTGTA---AAC-TTTAA-CAACCGGCAGCGCCTGGATCCCTTGGCACGTCA-TTCGATGAAGGACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCACAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGCTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTCGAGTTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTCTTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._OF7_Tul_2 --------------------------------GCCGTTGCTGG------TTATTACAAGT-GCACGTCT-GTGTCTTTCTTCATCCAC-CCCTCTGTGCATACTGGGCGTGTC---------------TTTT----GGACGCGTGTCCC-AAACTTTACATTACAAAACCGTCTCTGTACTGGTAGAACGTGCTTGCAATACCGATTTA----TATACAACTATCAACAA-CGGATCTCTTGGCATCCCACTACGATGATGGAACGCA-GCGACATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCCT---TCTGGTATACCGAAG--GGTATGCCCGGTTGAGTATTATAATCAA-CTCAAGCCTACTGATTTT----CTGACATTGCATAAGAGCGTGACGACCGACGAAGCCATTCACAACG--GGGTGGTGGTA-GTTGGAGTTTTGCTTG--GAACTTCAGA-GGTATTGGACTTGAGCGCAC---GTCGGTT-----TAATCTT--TA-ACCGA--CCCGCTTGAATATGCATTAGCTGACGA-CCGCACGACACGGTT-TCACTCGACGCGATAAGCC-TATT-CGT------------------------------- Tulasnella_sp._OF8_Tul --------------------------------GTCGCTGCTGG------TTCTTACAAGT-GCACACC--GTGTCTTTCT-TATCCAC-CCCACTGTGCATCACCGGTACAGC---------------TTTC----GAGCGTAG-TCC----TTTTACACACAACACATTGTAATTGAATTAG-AACGTGCGCGAA---TGATAATAAT----CATACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCGTATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATTACAGTGAATCATCGAATCTATTTGAACGCACCTTGCACCCT---C-TGGTATTCCGGAG--GGTATGCCCGGTTGAGTATTATGATCAA-CTCAAGCCT-TTGGTTTT----CTAA--TTGC--TAAGGTCAGATGCTCGGCGAAGCCGTCTGTAG----GGACGGTGGTA-GCTGAAGTCCGACTTGTGAATTCCTAAT-GGCATTGGACTTGAGCGTG---TGTCGGTC-----TCTAATTGAGAGATCGG--CTCGCTTGAA-ATGCATTAGCTGGCCGACCCCGCCTTACGGTT-CCACTCGACGTAGTAAGTTTTATT-CGT------------------------------- Tulasnella_sp._OF9_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTCTAT-TC--CGTC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCTG-----CTGTGTTACCTC---------TTT--CCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---A-C-TTTTTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGC-GAA---AGACCCGAGTTCGGAGTCCCCGGTC--TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC-TTTCTGGGTTTGTGACGTGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTTGCGACGTCGG-TACTACAAC-GCATGACCTC-ATCGGGG-TAGGACAACCCGC Tulasnella_sp._OF9_isolated_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTC-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACGACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGG-TCACTCTAATGCCTAAG-CGCGGAGT------CC--CTCGGAGTCCGAGATGCGCTTGACCGGGTGTTG--AGCCCGTGTCACCAAGTCCGCA--CGTCCAACGTGGCGG-TACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._OP1_Tul --------------------------------GTTGCTGCTGG------TTCTTACAAGT-GCACGCC--GTGTCTTTCT-TATCCAC-CCCACTGTGCATC-TCGGCGCGCT----------CCGCCTCTGG--TGGGCGCGG-TCC----ATTTT---ACACTACATCTT--TTGTAACGA-AGCGAATGAAAT--ATTATAATAA-----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-CCCGCTT-----CTAA--TTGC--AAAGGTCCTGCGTCCGGCGAAGCTGTCTATCG----AGGCGGTGGTA-GCTGGACTTGGGCTTG--GAAGCGTGTT-GGTCTTGGACTTGAGCGTGC--TGTCGGTC-----CTC--TT--TGGATCGA--CTCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- Tulasnella_sp._OP2_Tul --------------------------------GTTGCTGCTGG------TTCTTACAAGT-GCACGCC--GTGTCTTTCT-TATCCAC-CCCACTGTGCATC-TCGGCGCGCT----------CCGCCTCTGG--TGGGCGCGG-TCC----ATTTT---ACACTACATCTT--TTGTAACGA-AGCGAATGAAAT--ATTATAATAA-----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-CCCGCTT-----CTAA--TTGC--AAAGGTCCTGCGTCCGGCGAAGCTGTCTATCGG---AGGCGGTGGTA-GCTGGACTTGGGCTTG--GAAGCGTGTT-GGTCTTGGACTTGAGCGTGC--TGTCGGTC-----CTC--TT--TGGATCGA--CTCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- Tulasnella_sp._OP3_Tul -------------------------------CTTCGGGGTAGAT-----CTCCCACCCTTTGTATACT--ATACCTTTGTTGCTTTGG-CGGGCCGCCTAGC---TACTGGCT----------TCGGC--------TGGTAAGTGCCC----GCCAGAGAACCCAAAACCCTGAAT-TATTAGTGTCGTCTGAGTAAAATATTTAATA-----TTTAAAACTTTCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-CCCGCTT-----CTAA--TTGC--AAAGGTCCTGCGTCCGGCGAAGCTGTCTATCG----AGGCGGTGGTA-GCTGGACTCGGGCTTG--GAAGCGTGTT-GGTCTTGGACTTGAGCGTGC--TGTCGGTC-----CTC--TT--TGGATCGA--CTCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- Tulasnella_sp._OP4_Tul_1 GGAAGGATCATAGTAATCGTCTT-TGACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGGTATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTC-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCC-TAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGG-TCACTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGTCCGAGATGCGCTTGACCGGGTGTTG--AGCCCGTGTCACCAAGTCCGCA--CGTCCAACGTGGCGG-TACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._OP4_Tul_2 --------------------------------GTTGCTGCTGG------TTCTTACAAGT-GCACGCC--GTGTCTTTCT-TATCCAC-CCCACTGTGCATC-TCGGCGCGCT----------CCGCCTCTGG--TGGGCGCGG-TCC----ATTTT---ACACTACATCTT--TTGTAACGA-AGCGAATGAAAT--ATTATAATAA-----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-CCCGCTT-----CTAA--TTGC--AAAGGTCCTGCGTCCGGCGAAGCTGTCTATCG----AGGCGGTGGTA-GCTGGACTTGGGCTTG--GAAGCGTGTT-GGTCTTGGACTTGAGCGTGC--TGTCGGTC-----CTC--TT--TGGATCGA--CTCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- Tulasnella_sp._OP5_Tul_1 --------------------------------GTTGCTGCTGG------TTCTTACAAGT-GCACGCC--GTGTCTTTCT-TATCCAC-CCCACTGTGCATC-TCGGCGCGCT----------CCGCCTCTGG--TGGGCGCGG-TCC----ATTTT---ACACTACATCTT--TTGTAACGA-AGCGAATGAAAT--ATTATAATAA-----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-CCCGCTT-----CTAA--TTGC--AAAGGTCCTGCGTCCGGCGAAGCTGTCTATCG----AGGCGGTGGTA-GCTGGACTTGGGCTTG--GAAGCGTGTT-GGTCTTGGACTTGAGCGTGC--TGTCGGTC-----CTC--TT--TGGATCGA--CTCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- Tulasnella_sp._OP5_Tul_2 -------------------------------CTTCGGGGTAGAT-----CTCCCACCCTTTGTATACT--ATACCTTTGTTGCTTTGG-CGGGCCGCCTAGC---TACTGGCT----------TCGGC--------TGGTAAGTGCCC----GCCAGAGAACCCAAAACCCTGAAT-TATTAGTGTCGTCTGAGTAAAATATTTAATA-----TTTAAAACTTTCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-CCCGCTT-----CTAA--TTGC--AAAGGTCCTGCGTCCGGCGAAGCTGTCTATCG----AGGCGGTGGTA-GCTGGACTCGGGCTTG--GAAGCGTGTT-GGTCTTGGACTTGAGCGTGC--TGTCGGTC-----CTC--TT--TGGATCGA--CTCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- Tulasnella_sp._OP6_Tul --------------------------------GTTGCTGCTGG------TTCTTACAAGT-GCACGCC--GTGTCTTTCT-TATCCAC-CCCACTGTGCATC-TCGGCGCGCT----------CCGCCTCTGG--TGGGCGCGG-TCC----ATTTT---ACACTACATCTT--TTGTAACGA-AGCGAATGAAAT--ATTATAATAA-----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-CCCGCTT-----CTAA--TTGC--AAAGGTCCTGCGTCCGGCGAAGCTGTCTATCG----AGGCGGTGGTA-GCTGGACTTGGGCTTG--GAAGCGTGTT-GGTCTTGGACTTGAGCGTGC--TGTCGGTC-----CTC--TT--TGGATCGA--CTCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- Tulasnella_sp._OP9_Tul_1 --------------------------------GTTGCTGCTGG------TTCTTACAAGT-GCACGCC--GTGTCTTTCT-TATCCAC-CCCACCGTGCATC-CCGGCGCGTC----------TCGTCTTTCGACGGGGGGCGG-TCC----GTTTTTT-ACACCTTACCTT--TTGTAACCG-AGCGAATGAAATT-GATTTAACAA-----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-TTCGCTT-----CTGA--TCGC--AAAGGTCTTGCGTCCGGCGAAGTCGTCTATCG----AGACGGTGGTA-GCTGAACCTGGACTTG--GAAGCGTATT-GGTCTTGGACTTGAGCGTCT--CGTCGGTC-----CGC--TT---GGATCGA--CCCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- Tulasnella_sp._OP9_Tul_2 --------------------------------GTTGCTGCTGG------TTCTTACAAGT-GCACGCC--GTGTCTTTCT-TATCCAC-CCCACCGTGCATC-CCGGCGCGTC----------TCGTCTTTCGACGGGGGGCGG-TCC----GTTTTTT-ACACCTTACCTT--TTGTAACCG-AACGAATGAAATT-GATTTAACAA-----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAC--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-TTCGCTT-----CTGA--TCGC--AAAGGTCTTGCGTCCGGCGAAGTCGTCTATCG----TTACGGTGGTA-GCTGAACCTGGACTTG--GAAGCGTATT-GGTCTTGGACTTGAGCGTCT--CGTCGGTC-----CGC--TT---GGATCGA--CCCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- 'Tulasnella sp. PB-01 DQ834406' GGAAGGATCATAGTAATCGTCTT-TGACGTTCTATCTC--CATC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAAGGACCCCTCTGACCGAGGT-TAAGCGGTCGCTT---GCCTGTGTTACCTC---------TCC--G-G-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-ATCTTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGGA---AGACCCGAGCTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGCTTGAGACGCGCTTGACCGGCCGTTG--GGCTTGTGTCACCAAGTCCGCGT-CCTTCTGGACGT?GG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV1_Tul -------------------------GACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTC-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGTCACTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGTCCGAGATGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCCAACGTGGCGG-TACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV1_isolated_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTC-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGTCACTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGTCCGAGATGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCCAACGTGGCGG-TACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV10_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTAC-TC---------TTC-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGCCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGTCACTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGTCCGAGACGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCCAACGTGGCGG-TACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV11_Tul GGAAGGATCATAGTAATCGTCTA-CGACGCACTTGCTACAAACC--GTCCGT-CGGACGTTAAGCCGCTCTGGCAGAGG-ATAAACGGCCTCCCT------------------------------GTGTTACCTCT---------------AGGGGCACACGTTAAAGAACGCTCCGCA-TCG-TGAGTCTGACACC-GTTGTGATAACC--AAATACAACCGGTAGCAT-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTATTTCGTTCGCC----GAGCCT--CGCCTTTGGGCGTCT---GGCTCCGAGCTCGGAGTCCTCGGTCC-CCTCGTGGGGCCGTGTTC-TCTCAGATCCAGCGCGTCGACCCTCCGGGTGGGC-TCTCTCATGCCTGAG-TGTGGAGA------CC-CCCCCGTGCCAGGCTCGCGCCCGACGACGACCTG--AGCGTCCGTCAACAAGCATCC--------CCTCCGGGGGGCGCTACAACATCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV12_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTC-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TGGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGTCACTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGTCCGAGACGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCCAACGTGGCGG-TACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV13_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTC-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGTCACTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGTCCGAGACGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCCAACGTGGCGG-TACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV14__Tul -----------------------------------------------------------TTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCTG-----CTGTGTTACCTC---------TTT--CCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGCA---A-C-TTTTTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-AC-GTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGC-GAA---AGACCCGAGTTCGGAGTCCCCGGTC--TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CCCTTTCTGGGTTTGTGACGTGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTTGCGACGTCGG-TACTACAAC-GCATGACCTC-ATCGGGG-TAGGACAACCCGC Tulasnella_sp._SV14_Tul ------------------------------GATGTGCTGGCGGC-TTAACACCCGCATGT-GCACTCC--TTAACACAAT-CACACAC--CTG-TGAACCT-CGAACCGTGTCTGTGCGCTGATCCCGTAGGG-AGATGCGTGCACGCG-CGTTCTTACTTTACAAAACCCT---GTTAACTAAAGCTCTAGAAAGTGTTGGTTAATAA----AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCC----TCTGGTATTCCGGAG--G-CATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCTAACATTTT-----GTTA----AC---GGTCTTGTGGGTGAAGCCTG-TGGTCTAGCG----AGATTGCGGG---TTGTAATCCTTGGGACTAAAGTGTTGG--AGATTGGACTTGAGTTT----TGTTGGCC-----TGC--TA---GGGTCGA--CTGACTC-GAAATTGATTAGCGATGCGTGATCCATTG---GGTCCATCTCGGCGTGATAAG--TTGAT-CGC------------------------------- Tulasnella_sp._SV15_isolated_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTACGTTTC--CGTT-TGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTT-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGTCACTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGTCCGAGACGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCA-------------------------------------------------------------- Tulasnella_sp._SV16_Tul_1 GGAAGGATCATAGTAATCGTCTT-TGACGTTCTATCTC--CATC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCTT---GCCTGTGTTACCTC---------TTT--G-G-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTCTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGTTCGGAGTCCTCGGTCC-TCT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGCTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTCTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV16_Tul_2 GGAAGGATCATAGTAATCGTCTT-TGACGTTCGCTTTT-CCGTC--GTCCTC-GGGACATTAAGGTGCTCTGGTTGAGG-ATAAATGACCCCTCTGACCGAGGTTAAACCTGTCGCT------CTGTGTTACCTCCAAAAAAATTTTTTACCAAGGCACACGTTAAAGATCGTTCTGCG-TTG-TGAGTCTAACACCAGTTGTAT--AAACTTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCCT-----TT----ACAA----GGACCCGAGTTCGGAGTCCTCGGTCC-TCTC--TGGATCGTGTTC-TCTTAGATGCGTCGCACCGATCGCCT-GATGGGT-CCTCTAATGCCTAAG-CGTGGAGT------TC-CTTCAGAGTCCGAGATGTGCTTGACCGGGTCTTG--AGCCTGTGTCACCAAGTCTGC------CT-AACAAGCAG-TACTACAAC-CCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV17_isolated_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTCGCTTTT-CCGTC--GTCCTC-AGGACATTAAGGTGCTCTGGTCGAGG-ATAAATGACCCCTCTGACCGAGGTTAAACCTGTCACT------CTGTGTTACCTCCAAAAAAATTTTTTACCAAGGCACACGTTAAAGATCGTTCCGAG-TTG-TGAGTCTAACACCAGTTGTAT--AAACTTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCCT-----TT----ACAA----GGACCCGAGTTCGGAGTCCTCGGTCC-TCT----GGATCGTGTTC-TCTTAGATGCGTCGCACCGATCGCCT-GATGGGT-CCTCTAATGCCTAAG-CGTGGAGT------TC-CTTCAGAGTCCGACACGTGCAAGACCGGGTCTTG--AGCCTGTGTCACCAAGTCTGC------CT-AACAAGCAG-TACTACAAC-CCATGACCTC-ATTGGGGGTAGGACAACCCGC Tulasnella_sp._SV18_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTCTAT-TC--CGTC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAATGGTCGCTG-----CTGTGTTACCTC---------TTT--G-G-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---A-C-ATTTTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGC-GAA---AGACCCGAGTTCGGAGTCCTCGGTC--TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--TTCTGGGTTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTTGCAACGTCGG-TACTACAAC-GCATGACCTC-ATCGGGG-TAGGACAACCCGC Tulasnella_sp._SV18_isolated_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTCTAT-TC--CGTC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAATGGTCGCTG-----CTGTGTTACCTC---------TTT--G-G-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---A-C-ATTTTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGC-GAA---AGACCCGAGTTCGGAGTCCTCGGTC--TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--TTCTGGGTTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTTGCAACGTCGG-TACTACAAC-GCATGACCTC-ATCGGGG-TAGGACAACCCGC Tulasnella_sp._SV2_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTC-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAGGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCACCGATCGCCT-GATGGGTCACTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGTCCGAGACGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCCAACGTGGCGG-TACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV20_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTC-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGTCACTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGTCCGAGACGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCCAACGTGGCGG-TACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV21_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTC-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGTCACTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGTCCGAGACGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCCAACGTGGCGG-TACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV3_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTC-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGTCACTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGTCCGAGACGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCCAACGTGGCGG-TACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV4_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTCTAT-TC--CGTC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCTG-----CTGTGTTACCTC---------TTT--CCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---A-C-TTTTTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGC-GAA---AGACCCGAGTTCGGAGTCCTCGGTC--TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC-TTTCTGGGTTTGAGACGTGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTTGCGACGTCGG-TACTACAAC-GCATGACCTC-ATCGGGG-TAGGACAACCCGC Tulasnella_sp._SV5_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTCTAT-TC--CGTC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCTG-----CTGTGTTACCTC---------TTT--CCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---A-C-TTTTTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGCTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGTTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTCTTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV6_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTCTATCTC--CATC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCCA---GTCTGTGTTACCTC---------CTC--G-G-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTA--CAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATATGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGCTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGTTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTCTTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV6_isolated_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTCTATCTC--CATC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCCA---GTCTGTGTTACCTC---------CTC--G-G-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTA--CAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATATGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGCTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGTTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTCTTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV7_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTAC-TC---------TTC-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGCCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGTCACTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGTCCGAGACGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCCAACGTGGCGG-TACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV8_Tul_1 GGAAGGATCATAGTAATCGTCTT-TGACGTTCTATCTC--CATC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCTTC--GCCTGTGTTACCTC---------CTC--G-G-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTA--CAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGGCCCGAGCTCGGAGTCCTCGGTCC-TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGCTTGAAACGCGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTCTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV8_Tul_2 GGAAGGATCATAGTAATCGTCTT-TGACGTTCTAT-TC--CGTC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCTG-----CTGTGTTACCTC---------TTT--CCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---A-C-TTTTTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGCTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGTTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTCTTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV8_isolated_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTCTATCTC--CATC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCTTC--GCCTGTGTTACCTC---------CTC--G-G-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTA--CAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGGCCCGAGCTCGGAGTCCTCGGTCC-TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGCTTGAAACGCGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTCTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV9_Tul GGAAGGATCATAGTAATCGTCTA-CGACGCACTTGCTACAAACC--GTCCGT-CGGACGTTAAGCCGCTCTGGCAGAGG-ATAAACGGCCTCCCT------------------------------GTGTTACCTCT---------------AGGGGCACACGTTAAAGAACGCTCCGCA-TCG-TGAGTCTGACACC-GTTGTGATAACC--AAATACAACCGGTAGCAT-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTATTTCGTTCGCC----GAGCCT--CGCCTTTGGGCGTCT---GGCTCCGAGCTCGGAGTCCTCGGTCC-CCTCGTGGGGCCGTGTTC-TCTCAGATCCAGCGCGTCGACCCTCCGGGTGGGC-TCTCTCATGCCTGAG-TGTGGAGA------CC-CCCCCGTGCCAGGCTCGCGCCCGACGACGACCTG--AGCGTCCGTCAACAAGCATCC--------CCTCCGGGGGGCGCTACAACATCATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_sp._SV9_isolated_Tul GGAAGGATCATAGTAATCGTCTT-TGACGTTACGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTC-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGTGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGTCACTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGTCCGAGACGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCCAACGTGGCGG-TACTACAAC-ACATGACCTC-ATTGGGG-TAGGACAACCCGC Tulasnella_tomaculum_AY373296 GCCGGGTGGGCCTTC-GGGCTT-CACATCCCTTCGTGTGACCTC---GGTCACGTTAATTGGAGCGAG--AGGTCATCCTCCGCCCCG-CGGCTGGGACGATCGAGTCGGGTCCCGTCG--TGTATCGCTCCTACCGAACAGGCATAAA-----TAAACGGGGCAGGCCCTTGGCCAGACACATGTCACATAACTATCGAGATCATACAGTTTTATACAACTGGTAGCGT-TGGATCCCTCGGCATGGCTATCG-ATGA-AGAGCGCG-GCCA-GCTGCGAAAT-GTGATGTGAATTGCAACTCAAAGCGGTTATCGTGAATCATTGACTAC--TTGAACGCA--TTGCACCGC---C---CTTTTGGGAGT--GGTACGCCCGATTGAGTGTCATAATCTCCTTCAGGCCTGATGGTCTC----GGCCGTTCGTTCGGTGACCGCTCGCGTGCTGCAAACCATCTTTCTG--AGGTGGCAGAG-GCGCGTTGGCGG------GAGATGTGTTAGGTTCTGGTTTCGAGGCTGCA-CGGCATCC-----CCT----------GTCG--CGTGCCTTCAGATGCATTAGCGGTCT-TCCTTGTCAGACAAGTTTGACTCCACGTGATGATATCATGTTCGT------------------------------- Tulasnella_violea_DQ457643 ----------------------------------------------------------------TTATGGAGAGGTCAGCCTT-CACCGGCCCCTCGTCACACTCTGGATGCAATGCGC--CTGATCGCGCTAGTCTTGGCTCTTTGGA--GCCTCGACACACCCTTTGA-AATCCA-ACCCA-TGCTTATGA-ACGAAAACACA--AGAGAATT-ACAACCAGCAGCGT-TGGATCCCTTGGCATGTCA-TTCGATGAAG-ACCGTT-GCAA-AATGCGATAA-GTGGTGTGATATGCAAGTCCAAAACTTATACGTGAACCATCGAATTG--TTGAACGCAC--TGCATC-----GAGCCTTACCCAGGAACGATACGCCCCATTGAGCGTCATT--ATGTCTTCGC------GACTTGTCGTCTTTTTGACGA--CCTGTCCGGGTTCGGGATTCAC----GGCCCCTCGGGGTCGCGCTT-CCTCAGAAACATGGACGCATGCAGCCTGAAGGTGT---CCTTGTCATGAA-TGTCGAG---GTCGCTTCTTGAGGGCTCGCCATGCAAGATCGGTCTC--------CGATCAAA--GGCAACCGCTTCG-------GCGGGCGCA-ACTTCTACAC------------------------------ 'fungal sp. 5OL1-9B1 AM697921' ------------GTAATCGTCTT-TGACGTTCTATCTC--CATC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCCA---GTCTGTGTTACCTC---------CTC--G-G-AGGCACACGTTAAAGATCGTTCCG{CT}G-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTA--CAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGCTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTCGAGTTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTCTTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC fungal_sp._AP2_AY643806 --AAGGATCATAGTAATCGTCTT-TGACGTTCTGT-TC--CGTC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAGTGGTCG--------CTGTGTTACCTC---------TTG--TCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACA--AATTGTA---AAC-TTTT-ACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATT-TATTCCTTCGG----GAGTCTT-----TCCTTGC-GAA---AGACCCGAGTTCGGAGTCCTCGGTC--TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTCTGGAGTTGAGACGTGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTTTGGGACGGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC 'mycorrhizal fungus O-19 ex Dactylorhiza incarnata AJ549130' ---AGGATCATAGTAATCGTCTT-TGACGTTCTATTTC--CATC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGC-TAAACGGTCGCTTT--GCCTGTGTTACCTC---------TTT--G-G-AGGCACACGTTAAAGATTGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTCTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGCTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGCTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTTCTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC 'mycorrhizal fungus O-2 ex Orchis laxiflora ssp. palustris AJ549133' ---AGGATCATAGTAATCGTCTT-TGACGTTCTATTTC--CATC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGC-TAAACGGTCGCTTT--GCCTGTGTTACCTC---------TTT--G-G-AGGCACACGTTAAAGATTGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTCTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGCTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGCTTGAGACGCGCTTGACCGGCCGTTG--GGCTCGCGTCACCAAGTCCGCGT-CCTTCTGGACGTCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC mycorrhizal_fungus_VIIf5_ex_Orchis_laxiflora_ssp._palustris_AJ549126 ------------GTAATCGTCTT-TGACGTTCTATTTC--CATC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-TAAACGGTCGCTTT--GCCTGTGTTACCTC---------CTT--G-G-AGGCACACGTTAAAGATTGTTCCGCG-TTG-TGAGTCTAACACCAGTTGTA---AAC-TTTCTACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGG----GAGTCTT-----TCCTTGCTGAA---AGACCCGAGCTCGGAGTCCTCGGTCC-TTT----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTTTGAGCTTGAGACGCGCTTGACCGGCCGTTG--GGCTTGCGTCACCAAGTCCGCGT-CCTTCTGGACGTCGG-TACTACAAC-GCA----------------------------- 'mycorrhizal fungus XII-1 ex Orchis morio AJ549127' ------------GTAATCGTCTT-TGACGTTACGTTTC--CGTTGCGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGTCAAAGCCGTCTCC------CTGTGTTACCTC---------TTCAGCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGTCACTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGTCCGAGACGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCCAACGTGGCGG-TACTACAAC-ACA----------------------------- uncultured_Scleroderma_HM196776 AACCCGATCGTCCGGGAGGGGGAAAACCCCCCCCTTCCGGGCTTTCGACC------CTTTCAACACCCTTGTGCACTCGCTGT--AGGTCCCTCGGGATCTACG----TCTCCCTTCGA--ACTCGCATGT-CTACAGAAT----GTATGCTTCGCGTCTCGGCCTCGAC-CCTCAGGGT----CTTGCGTCG-AAGACCGTAAA--AAAATGAATACAACTTTCAGCGA-CGGATCTCTTGGCTCTCGC-ATCGATGAAG-AACGCA-GCGA-ATCGCGATAA-GTAATGTGAATTGCAGATTTT--------CCGTGAATCATCGAATCT--TTGAACGCACCTTGCGCT-----CCTCGGTATTCCGAGG-AGCATGCCTGTTCGAGTGTCATCG-AAATATCGAATCG-AA-GCTTGGACCTCGGTCCGAGCTTCGTTCGGACAGTGGGAGTCTGCGGGCGAGCTTTGCTACGTCCGCTCTCCTCAAAAGCATT-AGCGGTGGACGCCAGCCTCGCATGGCACGGCCTCTT-CGACGTCGTAATGATC-GTCGCGGGCTGGAAGTGCGAGGCAGGACCGACCACGCTTCCCTAGACTTGCGAGCCCGTAAC----GGCCG--CGCCCCCATCGATGCTTGACCTCGAATCAGGTAGG-ACTACCCGC uncultured_Tulasnella_AY192460 ----------------------------------------------------------------------------------------------------GACCCATTGCAATGCCGTG--TTCTGCACGTTAAACATAGTCGTGTTGGCTTCGGACACACGTTAAAGAC-GCGAAAAAGCCC-TGTTTACGAATCTAATGTGA---AAGAACTTTACAACCAATGACGT-TGGATCCCTTGGCATGCCTGATCGATGAAG-ACCGTT-GCCA-ACTGCGATAA-GTGGTGTGATGCGCAAGTCTAAAACTTATAAGTGAACCATCGAATTG--TTGAACGCAC--TGCACC-----GAGCTCTACCCGAGCACGGTATGTCCCATTGAGCGCTATTA-ATGTCTTCGA----GAGGGCTGATCTTTGGTTGG-----CACCCGGGT--TCGGAGTCCACAGTGCCCTTGCACTGCGTTCTCTC-----AGATGGATT-TGAA-TGGTGTCTGGTTGCAC----TGGAACCTCTA-TGTCATG---AGAATGCATGGAGTGCCCGTTAAGCGCCTGATGCCTGGGACAGCACAGATG-------ATGGCTGTCCA-----AGCA--TGCTTAATTGAGAATGTAGCCTC-ACTGGGACAAG-ACAACCCGC uncultured_Tulasnella_AY192485 ------------------------------------------------------------------------------------GAGGGTGAAAGCCCATGACCCATTGCAATGCCGTG--TTCTGCACGTTAAACATA-TTGTGTTGGCTTTGGACACACATTAAAGAC-GC-AAAAAGCCC-TGTTTATGAGTCTAATGTAA---AAGAACTTTACAACCAATGACGT-TGGATCCCTTGGCATGCCTGATCGATGAAG-ACCGTT-GCCA-ACTGCGATAA-GTGGTGTGATGCGCAAGTCTAAAACTTATAAGTGAACCATCGAATTG--TTGAACGCAC--TGCACC-----GAGCTCTACCCGAGCACGGTATGTCCCATTGAGCGCTATTA-A{CT}GTCTTCGA----GAGGGCTAATCTTTGATTGG-----CACCCGGGT--TC{AG}GAGTCCACAGTGCCCTTGCACTGCGTTCTCTC-----AGATGGATT-TGAA-TGGTGTC{CT}GGTTGCAC----CGGAACCTCTA-TGTCATG---AGAATGCATGGAGTGTCTGTTAAGTGCCCGATGCCTGGGGCAGCACAGATG-------GTGGCTGTCCA-----AGCA--TTGTCAATTGAGAATGTAGCCTC-ACTGGGACAAG-ACAACCCGC uncultured_Tulasnella_DQ178069 ----------------------------------------------------------------------AAGGGAGCGCCGGTCGCTCCCGTT-C--GCAACCCATCTTCACATTGGA--CCGGTGGCGTTTCGCCTTCACGGC----GTCCCACCG-ATCAGCCATGC-GTTTCTTGGTCA-CCGTCTATACACTTTTTCAGT--TGAAAATACACAACTGGTAGCAT-TGGATCCCTTGGCATGCCA-TTCGATGAAG-ACCGTA-GCAA-ATTGCGATAA-GTGGTGTGATATGCGAGTCCAAAACTTATACGTGAACCATCGAATTG--TTGAACGCAT--CGCATC-----GAGCTTTGCCCAAGCACGATATGCCCCATTGAGCGTCATT--ACGTCTTCGA-----GAGAG-GAGCCTCT--------TCCGCTCTC{AG}AGTTCGGGA{CT}TCTT----G-GTCTCACCGACCACGCTT-CCTCAGATGCATC-CGCGTCGCACGCACGTCGCGC-T-CCTTGTCGTGAA-CTTCAAGGCGCCGCGCT-CGAGCTGGCACGCTTTCGCTCGGCCCTACA{CG}GGTCGCCGAACAGCACCG-GCG-GTGCCTTG---GCAC---TCGCCCCTCCC-GACATGACCTC-ACGGGGGCAAG-ACGACCCGC uncultured_Tulasnella_DQ178074 ----------------------------------------------------------------------------------------------------------GGATGCAATGCGT--T--AACTCGCTAGTCTTGGTCACTCTGGTGGTCTTGACAAAAC-TTTGT-AATCCA-ACTTA-TGCCTAT----TTGAAATACA--AGAGAATT-ACAACCAGTAGCGT-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-AATGCGATAA-GTGGTGTGATATGCAAGTCCAAAACTTATACGTGAACCATCGAATCG--TTGAACGCAC--TGCATC-----GAGCCTTACCCAGGAACGATACGCCCCATTGAGCGTCATT--ATGTCTTCGT------GAC-TGTCATTTATTT---GG--CCTGTCCGGGTTCGGGATTCAC----AGCTTTGATTAGCTGCGCTT-CCTTAGATACATGGATGCACTACAGCTGAAGGTGT---CCTTGTCATAAA-TGTCGAG---GT---TTTCCAAAAGCTTAG-ATGCAAGATTGCTCTTGTGCAGAGTAATCAAA--TGCGACCACTTCAT-----TGCGGAAGCA-GCTTCTAAACATGACCTC-ACGGGGGTGGG-ATGACCCGC uncultured_Tulasnella_DQ178085 GGAAGGATCATAGTAATCGTCTT-TGACGTTCGCTTTT-CCGTC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAGCGACCCCTCTGACCGAGGTGAAACCCGTCTCT------CCGTGTTACCTTGAGAAACTCTTTTTTCCGAGGCACACGTTAAAGATTGTTCCGCG-TTG-TGAGTCTAACATCGGTTGCAT--AAACTTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCCT-----TTT---ACAA----GGACCCGAGCTCGGAGTCCTCGGTCC-TCTC--TGGATCGTGTTC-TCTCAGATGCCTCGCGCCGATCGCCT-GATGGGT-CCTCTAATGCCTAAG-CGTGGAGT------TC-CTTCA--GTCCGAGACGCGCT{CT}GACCGGGTCTTG--AGCCTGCGTCATCAAGTCTGC------CT-AACCAGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC uncultured_Tulasnella_DQ178086 GGAAGGATCATAGTAATCGTCTT-TGACGTTCGCTTTT-CCGTC--GTCCTC-GGGACGTTAAGGTGCTCTGGTCGAGG-ATAAGCGACCCCTCTGACCGAGGTGAAACCCGTCTCT------CCGTGTTACCTTGAGAAACTCTTTTTTCCGAGGCACACGTTAAAGATTGTTCCGCG-TTG-TGAGTCTAACATCGGTTGCAT--AAACTTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCCT-----TTT---ACAA----GGACCCGAGCTCGGAGTCCTCGGTCC-TCTC--TGGATCGTGTTC-TCTCAGATGCCTCGCGCCGATCGCCT-GATGGGT-CCTCTAATGCCTAAG-CGTGGAGT------TC-CTTCA--GTCCGAGACGCGCT{CT}GACCGGGTCTTG--AGCCTGCGTCATCAAGTCTGC------CT-AACCAGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC uncultured_Tulasnella_DQ178115 ------------------GTCTT-TGACGCACTTGCTGC----C--GTCCTC-GGGACGTTAAGG{CT}GCTCTGGCCGAGG-ATAAACCGCCGCCTCCCA---------------------------GTGTTACCTCCC-------------CGGAGGCACACGTTAAAGAACGCTCCGCG-TTG-TGAGTCTGA-ACC-GTTGTAAAAAC----ACTACAACCGGTAGCAT-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--TGCACC----GCGCCCTAAACCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTTGTCCTTCGT----GAGCCT--CGTTTCCGAACG-------GGCCCGAGTTCGGAGTCCTCGGTCC-TC-----GGATCGTGTTC-TCTCAGAATCAGCGCGCCGTTCGCTCTGGCGGGT-TCTCCAATGCTTGAG-CGCGGAGA------CC-TTCCTGCGGGTGTG--GCGTCCGAC{CT}GCGACCTG--AGCGCGCGTCACCAAGTCCCT-------------CTTGGGCACTACAA-TTCATGACCTC-ATTGGGG-TAGGACAACCCGC uncultured_Tulasnella_HM196813 GCCGGGTGGGCCCTCTGGGCTTTCACACCCCTTCTTGTGACCTC---GGTCACGTTAAATGGAGTGAG--AGGTCACCCTCCACCCTG-CTGTCGAGACGTTCGTTTCGGGTCTCGGCAG-TGTGT-GCCCCTACCGAACAAGCATAAA-----TACATGGGGCAGGCCTCTGGCCAGATGTA--CTTCACAACTATCGAGATAATACAGTTTTATACAACTGGTAGCGT-CGGATCCCTCGGCATGGCTATCG-ATGA-AGAGCGCG-GCCA-GCTGCGAAAT-GTGATGTGAATTGCAACTCAAAGCGGTTATCGTGAATCATTGACTAC--TTGAACGCA--TTGCACCGC---C---CTCTCGGGAGT--GGTACGTCCGATTGAGTGTCATAATCCA-TTCAGGCCCTCTGGTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ uncultured_Tulasnellaceae_AY634122 GGAAGGATCATAGTAATCGTCTT-TGACGTT{AG}CGTTTC--CGTT-CGTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCCGTCTCC------CTGTGTTACCTC---------TTT-GCCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTA-CACCAGTTGTA---ACA-CTTTTACAACCGGTAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAC--CGCACC----GCGCCCTAACCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGG----GAGTCTT-----TTCGT----TA---AGACCCGAGTTCGGAGTCCTCGGTC--TTC----GGATCGTGTTC-TCTCAGATGCGTCGCGCCGATCGCCT-GATGGGTCGCTCTAATGCCTAAG-CGTGGAGT------CC--CTCGGAGCCCGAAACGCGCTTGACCGGGTGTTG--AGCCCGCGTCACCAAGTCCGCA--CGTCTGACGTGGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC uncultured_Tulasnellaceae_AY634123 GGAAGGATCATAGTAATCGTCTT-TGACGTTCTGT-TC--CGTC--GTCCTC-GGGACGTTAAGGCGCTCTGGTCGAGG-ATAAACGACCCCTCTGACCGAGGT-AAAGCGGTCG--------CTGTGTTACCTC---------TTG--TCG-AGGCACACGTTAAAGATCGTTCCGCG-TTG-TGAGTCTAACC--ATTTGTA---AAC-TTTT-ACAACCGGCAGCGC-TGGATCCCTTGGCACGTCA-TTCGATGAAG-ACCGTT-GCAA-ATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTG--TTGAACGCAT--TGCACC----GCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATT-TATTCCTTCGG----GAGTCTT-----TCCTTGC-GAA---AGACCCGAGTTCGGAGTCCTCGGTC--TTT----GGATCGTGTTC-TCTTAGATGCGTCGCGCCGATCGCCT-GATGGGT-ACTCTAATGCCTGAG-CGTGGAGT------CC--CTCTGGAGTTGAGACGTGCTTGACCGGCCGTTG--GGCTCGTGTCACCAAGTCCGCGT-CCTTTGGGACGGCGG-TACTACAAC-GCATGACCTC-ATTGGGG-TAGGACAACCCGC uncultured_Tulasnellaceae_AY634130 ------------------------------GATGTGCTGGCC---TTAAACAAGCAATGT-GCACTCC--TGATCTCAACACTAACACACCTG-TGAACCT-CGGACCCGAC-----------CCTCTTAGCTGAGTGCCGTGTTCCAT-TT------TATTACAAAAACC----TTTGAGCCAATGTCTGGAAAGTAAAACTTAATGT----AATACAACCATCAGCAA-CGGACCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAGTCT--TTGAACGCACCTTGCACCC----TCTGGTATTCCGGAG--GGTATGCCCGGTTGAGAGTTTTGAATAT-CTCAATTTCAATGCTTT-----GTTA----ACA-AGGCTTTTTCAGAGGACCTTCCTTGTCTAGCG----AGACAATTGGG-TTGGACTCGATCAAGTCTGAGGTGTTGA--AACTTGGACTTGAGCTC----CGTTGGCC-----CTT--T----AGGTTGA--CCGGCTT-GAAATGCATTAGCGATGTCTGACCAAGGT----GTCCTGATTGGCGTGATAAGCATTGAT-CGT------------------------------- uncultured_Tulasnellaceae_AY634131 -----------------------------TTCCGTAGGTGAACCTGCGGAAGGATCATAGTTGTCTGAATAAGGGAGCGCAGGTCGCTCCCGTTTC--ACAACCCCATTTC-TATTGGA--CCGGCGGTGTTCCAT-TCCATGGT----GACCGGTCGG{AT}TCA{CG}CCA{GT}GG-GATTCTGGG{AC}C{AT}-TT{AC}{CT}{CT}{CT}T{AT}GAAATAAAACAGT--T-----TACACAACTGGTAGCAT-TGGATCCCTTGGCACGCCA-TTCGATGAAG-AACGTT-GCAA-ACTGCGATAA-GTGATGTGAAATGCGAGTCCAAAACTTATACGTGAATCATCGAATCT--TTGAACGCAT--TGCATC-----GAGCTTTGCCCAAGCACGATATGCCCCATTGAGCGTCCTT--AAGTCTTTGG-----GAATG-ATGTATTTATTTGCA-TTCATTACCAAGTCCGGGTTTCAT----G-GCTTCACCG-TCACGTTA-CCTTAGATGCATTACGCGTCGCACTACAGTTGCGC-T-CCTTGTTGTACA-CTTCAAGGCGCTTCCTAATGCGTTATCGCACTTACGCTCAACGCCTTTGGCTGA--GAGCAGAACCGTGTT-CCGTCCTC---GGATGGTTCACCCTTCCTTGACTTAACCTC-ACGGGGGCAAG-ACGACCCGC uncultured_Tulasnellaceae_DQ925497 ------------------------ATGTTGTCCATGGCAGCCTCTCCCGAGATGCGCCCTAAAGGTTGCTCTTGGTGAGTTGGTTATCCACACCTCTGAAAGTGCACTGTCATGGCGCA--CGTTAAATGGACTGAGAGCTCAGCTCCAGCC{AG}CATGGCAGCTGCCATGT-ATTTC-AAACCC-TGATCTCGACTATCACGTTGT--ATTAAATTTACAACCAGTAGCAT-TGGATCCCTTGGCACGTCA-TTCGATGAAG-AACGTA-GCAA-TCTGCGATAA-GTGGTGTGATATGCAAGTCCACAGCTTATACGTGAACCAT-GAATCT--TTGAACGCAC--TGCACTATCCGGACGACTCCCCCGTGATAATATGCCCCATTGAGTGTCATTT-ATACATTCGG-----ACGTTTGTG{CT}GTTAATTCACA-CTTCCGGACGAGTCTGAGGCCCACATTCG-CCCCTAGTGAATGCGTCC-CTCGAGATCTATTAGCCAAACCATGTCTGTCTGGTGT-CCATCCTGTGA----TGACTTTGCAGGTGGATTAGC{CT}GGCGC-TTTACGACTGGTGGCTCATAACTGCCTGATGGCAACCTG-----GCCTCT---GTGC---CAACACCTCGT--ACATGACCTC-AGTGGGGTAAGGATTACCCGC uncultured_Tulasnellaceae_DQ925503 ------------------------------GATGCGCTGGCA----------CTGCAGGT-GCGCTCC--T---CTCAAT--ATTCATTCCAA--ACACCCGTGCACTTTATTTTTG---AAGATAGGTCGGACTATTGTTCGCCTTCTTCAATCTTATTTTACATACCCCA-----CGACCAGAGCTTTTGTTGAATGTAATCGTATATT--AATACAACCATCAGCAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGACTTGCAG--------AACA-CAGTGAATCAT-GAATCT--TTGAACGCACCTTGCACCC----TCTAGTATTCTGGAG--GGTATGCCCGGTTGAGTGTCATGAAATT-CTCAAACCTTCAATTTT-----ATTA------------------------------------------------------------------------TTGTCGGTCTTG--GATTTGGA----AGTCT----TGTCGGCC-----TGG--T-------TCGA--CTCTTCC-GAAATGCATTAGCTGGATTTGACC--TTG---GGTCTCCTTTGACGTGATAAGT-TTGAT-CGT------------------------------- uncultured_Tulasnellaceae_DQ925536 ------------------------------GATGTGCTGGCAGGCTTAACACCTGCATGT-GCACTCC--TTAACACAAT-TACACAC--CTG-TGAACCT-CGAACCGTGTCTGCATGCTGATCCCGTAGGGGAGATGCGTGTGCGCG-CGTTCTTACTTTACAAAACCCT---GTTAATTAAAGCTCTAGAAAGTGTTGGTTAATAA----AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCAT-GAATCT--TTGAACGCACCTTGCGCCC----TCTGGTATTCCGGAG--GGCATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCTAACGTTTT-----GTTA----AC---GGTCTTGTGGGTGAAGCCTG-TGGTCTAGCG----AGATCGCAGG---TTGTAATCCTTAGGACTGAAGTGTTAG--AGATTGGACTTGAGTTT----TGTTGGCC-----CGC--T-----GGTCGA--CTGACTC-GAAATTGATTAGCGATGCGTGATCCATTG---GGTCCATCTCGGCGTGATAAG--TTGAT-CGC------------------------------- uncultured_Tulasnellaceae_DQ925537 ------------------------------GATGTGCTGGCAGGCTTAACACCTGCATGT-GCACTCC--TTAACACAAT-TACACAC--CTG-TGAACCT-CGAACCGTGTCTGCATGCTGATCCCGTAGGGGAGATGCGTGTGCGCG-CGTTCTTACTTTACAAAACCCT---GTTAATTAAAGCTCTAGAAAGTGTTGGTTAATAA----AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCAT-GAATCT--TTGAACGCACCTTGCGCCC----TCTGGTATTCCGGAG--GGCATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCTAACGTTTT-----GTTA----AC---GGTCTTGTGGGTGAAGCCTG-TGGTCTAGCG----AGATCGCAGG---TTGTAATCCTTAGGACTGAAGTGTTAG--AGATTGGACTTGAGTTT----TGTTGGCC-----CGC--T-----GGTCGA--CTGACTC-GAAATTGATTAGCGATGCGTGATCCATTG---GGTCCATCTCGGCGTGATAAG--TTGAT-CGC------------------------------- uncultured_Tulasnellaceae_DQ925552 --------------------------------GTTGCTGCTGG------TTCTTACAAGT-GCACGCC--GTGTCTTTCT-TATCCAC-CCCACCGTGCATC-CCGGCGCGCC----------TCGTCTTTCGACGGGGGGCGG-TCC----GTTTTTTTACACCTTACCTT--TTGTAACCG-AGCGAATGAAATT-GATTTAACAA-----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-TGCGCTT-----CTGA--TTGC--AAAGGTCTTGCGTTCGGCGAAGTCGTCTATCG----AGGCGGCGGTA-GCTGAACCTGGACTTG--GAAGTGTATT-GGTCTTGGACTTGAGCGTCT--CGTCGGTC-----CGC--CT---GGATCGA--CCCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- uncultured_Tulasnellaceae_DQ925554 --------------------------------GTTGCTGCTGG------TTCTTACAAGT-GCACGCC--GTGTCTTTCT-TATCCAC-CCCACCGTGCATC-CCGGCGCGCC----------TCGTCTTTCGACGGGGGGCGG-TCC----GTTTTTT-ACACCTTACCTT--TTGTAACCG-AGCGAATGAAATT-GATTTAACAA-----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-TTCGCTT-----CTGA--TCGC--AAAGGTCTTGCGTTCGGCGAAGTCGTCTATCG----AGGCGGCGGTA-GCTGAACCTAGACTTG--GAAGTGTATT-GGTCTTGGACTTGAGCGTCT--CGTCGGTC-----CGC--TT---GGATCGA--CCCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- uncultured_Tulasnellaceae_DQ925555 --------------------------------GTTGCTGCTGG------TTCTTACAAGT-GCACGCC--GTGTCTTTCT-TATCCAC-CCCACCGTGCATC-CCGGCGCGCC----------TCGTCTTTCGATGGGGGGCGG-TCC----GTTTTTT-ACACCTTACCTT--TTGTAACCG-AGCGAATGAAATT-GATTTAACAA-----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-TTCGCTT-----CTGA--TTGC--AAAGGTCTCGCGTTCGGCGAGGTCGTCTATCG----AGACGGCGGTA-GCTGAACCTGGACTTG--GAAGTGTATT-GGTCTTGGACTTGAGCGTCT--CGTCGGTC-----CTC--TT---GGATCGA--CCCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- uncultured_Tulasnellaceae_DQ925557 --------------------------------GTTGCTGCTGG------TTCTTACAAGT-GCACGCC--GTGTCTTTCT-TATCCAC-CCCACCGTGCATC-CCGGCGCGCC----------TCGTCTTTCGATGGGGGGCGG-TCC----GTTTTTT-ACACCTTACCTT--TTGTAACCG-AGCGAATGAAATT-GATTTAACAA-----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-TTCGCTT-----CTGA--TTGC--AAAGGTCTCGCGTTCGGCGAGGTCGTCTATCG----AGACGGCGGTA-GCTGAACCTGGACTTG--GAAGTGTATT-GGTCTTGGACTTGAGCGTCT--CGTCGGTC-----CTC--TT---GGATCGA--CCCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- uncultured_Tulasnellaceae_DQ925564 --------------------------------GTTGCTGCTGG------TTCTTACAAGT-GCACGCC--GTGTCTTTCT-TATCCAC-CCCACCGTGCATC-CCGGCGCGCC----------TCGTCTTTCGACGGGGGGCGG-TCC----GTTTTTT-ACACCTTACCTT--TTGTAACCG-AGCGAATGAAATT-GATTTAACAA-----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-TTTGCTT-----CTGA--TTGC--AAAGGTCTTGTGTTCGGCGAAGTCGTCTATCG----AGGCGGCGGTA-GCTGAACCTGGACTTG--GAAGTGTATT-GGTCTTGGACTTGAGCGTCT--CGTCGGTC-----CGC--TT---GGATCGA--CCCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- uncultured_Tulasnellaceae_DQ925576 ---------------------------------TTGCTGCTGG------TTCTAACAAGT-GCACGCC--GCGTCTTTCTACGTCCAC-CCCACCGTGCACG-CCGGTACGCC----------GAA----------AGGCGTAG-TCC----ATTATTT---ACAACACCTT--TTGTAAT-G-AGCGAATGAAAAA-TGTTAATCAAA----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCTT---C-TGGTATTCCGGAA--GGTATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-CTCGCTT-----CTGA--TCGC--AAAGGTCGTACGTTCGGCGAAACCGTCTGTAG----GGACGGCGGTA-GCTGAAGTGTGGCTTG--GAAGCTTGAC-GGTGTTGGACTTGAGCGT----TGTCGGTC-----T----TT--CGGATCGA--CTCGTTTGAA-ATGTATTAGCTGGCGA--CCCGCCTCACGGTT-CCACTCGGCGTAATAAGTCTT-TT-CGT------------------------------- uncultured_Tulasnellaceae_DQ925593 --------------------------------GCCGATGCTGG------TTCTTACAAGT-GCACGCCG-TTGTCTTTCTT-ATCCAC-CCCACCGTGCAT-CTCGACGCGTC---------------TGT-----TGACGTGG---------TCTTTTAACACAAAACCGTAA-TGTAATAGTAGAACGTGCGCACGATA{CT}A{CT}AATAA----AATACAACTATCAACAA-CGGATCTCTTGGCATCCCACT-CGATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCCT---T-TGGTATTCCGAAG--GGTATGCCCGGTTGAGTATTATGATCAA-ATCAAGCCT-TTGGTTTT----CTGA--TTGC--AAAGACTTAACGTACGACGAAGCCGTCCA--GCG--GGGCGGCGGTA-GTTGGAGTTTTGTTTG--GAATCTCAAA-GGATTTGGACTTGAGCGCAC---GTCGGTC-----TGAACTT--CAGATCGA--CCCGCTTGAA-ATGCATTAGCTGACGA-CCGCGCCGTACGGTT-ACACTTGACGTGATAAGTC-TATT-CGT------------------------------- uncultured_Tulasnellaceae_DQ925595 --------------------------------GCCGATGCTGG------TTCTTACAAGT-GCACGCCG-TTGTCTTTCTT-ATCCAC-CCCACCGTGCAT-CTCGACGCGTC---------------TGT-----TGACGTGG---------TCTTTTAACACAAAACCGTAA-TGTAATAGTAGAACGTGCGCATAACATATAATAA----AATACAACTATCAACAA-CGGATCTCTTGGCATCCCACT-CGATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCCT---T-TGGTATTCCGAAG--GGTATGCCCGGTTGAGTATTATGATCAA-ATCAAGCCT-TTGGTTTT----CTGA--TTGC--AAAGACTTAACGTACGAC{AG}AAGCCGTCCA--GCG--GGGCGGCGGTA-GTTGGAGTTTTGTTTG--GAATCTCAAA-GGATTTGGACTTGAGCGCAC---GTCGGTC-----TGAACTT--CAGATCGA--CCCGCTTGAA-ATGCATTAGCTGACGA-CCGCGCCGTACGGTT-ACACTTGACGTGATAAGTC-TATT-CGT------------------------------- uncultured_Tulasnellaceae_DQ925597 --------------------------------GCCGATGCTGG------TTCTTACAAGT-GCACGCCG-TTGTCTTTCTT-ATCCAC-CCCACCGTGCAT-CTCGACGCGTC---------------TGT-----TGACGTGG---------TCTTTTAACACAAAACCGTAA-TGTAATAGTAGAACGTGCGCAC{AG}ATA{CT}A{CT}AATAA----AATACAACTATCAACAA-CGGATCTCTTGGCATCCCACT-CGATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCCT---T-TGGTATTCCGAAG--GGTATGCCCGGTTGAGTATTATGATCAA-ATCAAGCCT-TTGGTTTT----CTGA--TTGC--AAAGACTTAACGTACGACGAAGCCGTCCA--GCG--GGGCGGCGGTA-GTTGGAGTTTTGTTTG--GAATCTCAAA-GGATTTGGACTTGAGCGCAC---GTCGGTC-----TGAACTT--CAGATCGA--CCCGCTTGAA-ATGCATTAGCTGACGA-CCGCGCCGTACGGTT-ACACTTGACGTGATAAGTC-TATT-CGT------------------------------- uncultured_Tulasnellaceae_DQ925599 --------------------------------GTCGCTGCTGG------TTCTTACAAGT-GCACACC--GTGTCTTTCT-TATCCAC-CCCACTGTGCATC-CCGGTAC-GC---------------TCTC----GAGCGTAG-TCC----TTTTACACAAAAC-CATTGTAATTGAATTAG-AACGTGCGCGA----TAATAA--AT----AGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCCT---C-TGGTATTCCGGAG--GGTATGCCCGGTTGAGTATTATGATCAA-CTCAAGCCT-TTGGTTTT----CTAA--TTGC--AAAGGTCGGATGCTCGGCGAAGCCGTCTGTAG----GGACGGTGGTA-GCTGAAGTTCGACTTG-GAATTCCTAAT-GGCATTGGACTTGAGCGTG---TGTCGGTC-----TCTAATT-AGAGATCGG--CTCGCTTGAA-ATGCATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGACGTAGTAAGTCTTATT-CGT------------------------------- uncultured_Tulasnellaceae_DQ925600 --------------------------------GTCGCTGCTGG------TTCTTACAAGT-GCACACC--GTGTCTTTCT-TATCCAC-CCCACTGTGCATC-CCGGTAC-GC---------------TCTC----GAGCGTAG-TCC----TTTTACACAAAAC-CATTGTAATTGAATTAG-AACGTGCGCGA----TAATAA--AT----AGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCCT---C-TGGTATTCCGGAG--GGTATGCCCGGTTGAGTATTATGATCAA-CTCAAGCCT-TTGGTTTT----CTAA--TTGC--AAAGGTCGGATGCTCGGCGAAGCCGTCTGTAG----GGACGGTGGTA-GCTGAAGTTCGACTTG-GAATTCCTAAT-GGCATTGGACTTGAGCGTG---TGTCGGTC-----TCTAATT-AGAGATCGG--CTCGCTTGAA-ATGCATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGACGTAGTAAGTCTTATT-CGT------------------------------- uncultured_Tulasnellaceae_DQ925629 ----------------------------------ATGCGCTGGT-----TCTTCACAAGT-GCACACC--GTCTGTTTCTTCATTCAC-CCCA-TGTGCACA-CTGATGCGTC----------GCTGGTA-----GTTTGGCAGCTTC----ACCTTATTTTACACAAACTCT-TTGTATTTG-AATGTCTTGATGAAATAATAATGA-----AATACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCTT---C-CAGTCCTCTGGAG--GGTATGCCCGGTTGAGTATTATGATCAC-ATCAAACCT-ATGATTTT----CTTA--TTGC--AAAGACCGATGCTCTGACGAAAGCACTCATTG----GGGTGCTGGTA-GTTGGTGCTTGGTTTG--GAGGATCATTGGGTCTTGGACTTGAGCACTT---GTTGGTT-----CCC--TC--TGGATCAA--CTTGCTTGAA-ATGAATTAGCTGGCGACCTGCCTTCAATGGTTACCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- uncultured_Tulasnellaceae_DQ925633 ----------------------------------TTGTGCTGGT-----TCTTCACAAGT-GCACACC--GT-TATTTCTTCATTCAC-CCCA-TGTGCACC-T--ATGCGTT----------GCCGGT------GTTTACCGGCTTC----GCCTTATTTTACACAAACTCT-TTGTATT-G-AATGTCTTGACGAAATAATAATAA-----AATACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCTT---C-CAGTACTCTGGAG--GGTATGCCCGGTTGAGTATTATGATCAC-ATCAAACCT-ATGATTTT----CTTA--TTGC--AAAGGCCAATGCTCTGACGAAAGCACTCATCG----GGGTGCTAGTA-GTTGCTGCTTGGTTTG--GAAGATCATTAGGTCTTGGACTTGAGCACT----GTTGGTT-----CCC--TC--TGGATCAA--CTTGCTTGAA-ATGAATTAGCTGGCGACCTGCCTTCAATGGTTACCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- uncultured_Tulasnellaceae_DQ925644 ------------------------------GATGTGCTGGCGGT-GTCA-TGCCGCATGT-GCACTCC--CTTAACCAAT-CC-ACACACCTG-TGAACCT-CGGACCTCGCCCGCT------TCCTCTCGGA--GGTGGGCTTGTGTT-C----TTACCATACAAAACCCA---ATAGAGTT-AGCTCTGGAATCA--GTGTTGTAATTT--AAAACAACCATCAGCAA-CGGATCTCTTGGCATCCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCC----TCTGGTATTCCGGAG--GGCATGCCCGGTTGAGTGTCATGAATAT-CTCAAACCTGGTGCTTT-----TGT------------------------------------------------------------------------TTTGAAGCGCCAG--GGCTTGGACTTGAGCTT----TGTTGGTG-----ACC--T------GTCGA--CTTGCTC-GAAATGAATCAGTGATGCACGATCCCTTGTCGGGTCCGTCTCAGCGTGATAAG--TTGAT-CGC------------------------------- uncultured_Tulasnellaceae_DQ925658 ------------------------------GATGTGCTGGCGGC-CTAAACGCCGCATGT-GCACTCC---TTAACCAAC-CTTACACACCTG-TGAACCT-CGGACCTCGTCTGCC------TCTGTTTGGA--GGTGGGCTTGTGTT-C----TTACCATACAAAACCCA---GTCGAGTT-AGCTCTGGAATG{CT}--GCGTTGTAATTA--AAAACAACCATCAGCAA-CGGATCTCTTGGCATCCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCC----TCTGGTATTCCGGAG--GGCATGCCCGGTTGAGTGTCATGAATAT-CTCAAACCCGATGCTTT-----T--------------------------------------------------------------------------TTTGAAGTGCCGG--GGCTTGGACTTGGGCTT----TGTCGGCG-----ACC--T------GTCGA--CT{CT}GCTC-GAAATTGATCAG{CT}GACGCACGATCCCTTGTCGGGTCCGTCTCAGCGTGATAAG--TTGAT-CGC------------------------------- uncultured_Tulasnellaceae_DQ925661 -------------------------------ATGTGCTGGCG---TTCGTT--CGCACGT-GCACTCC--TTAACACAAC-CACACACACCTG-TGAACCT-CGAACCGCG------------TCCCCCAGGG--GATGTGCGTTCAA--C-------CTTTACAAAACCCA---TTTGATCGAAGCTCTGGAACGA-GACGCTAAAAGTT--AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCC----TCTGGTATTCCGGAG--GGTATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCCAATGTTTT-----GTCA----AA---GGTCTTGTCGACTCGTCCCGCCGGTCTATCG----AGGCTGCTG----CGAC-TGTCGCAAGGCTGAAGCGTTGG--AGCTTGGACTTGAGCTC----TGTCGG{CT}C-----TTC--TC---AGGTCGA--CTGGCTA-GAAATGCATCAGCGATGAC--GTCCCTTG---GGTCCATCTCGGCGTGATAAG--TTGAT-CGT------------------------------- uncultured_Tulasnellaceae_DQ925664 -------------------------------ATGTGCTGGCG---TTCGTT--CGCACGT-GCACTCC--TTAACACAAC-CACACACACCTG-TGAACCT-CGAACCGCG------------TCCCCCAGGG--GATGTGCGTTCAA--C-------CTTTACAAAACCCA---TTTGATCGAAGCTCTGGAACGA-GACGCTAAAAGTT--AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCC----TCTGGTATTCCGGAG--GGTATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCCAATGTTTT-----GTCA----AA---GGTCTTGTCGACTCGTCCCGCCGGTCTATCG----AGGCTGCTG----CGAC-TGTCGCAAGGCTGAAGCGTTGG--AGCTTGGACTTGAGCTC----TGTCGGTC-----TTC--TC---AGGTCGA--CTGGCTA-GAAATGCATCAGCGATGAC--GTCCCTTG---GGTCCATCTCGGCGTGATAAG--TTGAT-CGT------------------------------- uncultured_Tulasnellaceae_EF433954 -------------------------------ATGTGCTGGCG---TCTAACACCGCATGT-GCACTCC--ATAACACATT-TACACAC--CTG-TGAACCT-CGGACCGCGTTGTC-------CTCTCCAGGGATGGCGTGCGTTCAAA-C-------CTTTGCAAAACCC----TTTGAAACAAGCTCTGGAAAGTTGACGCT-ATAGTT--AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCC----TCTGGTATTCCGGAG--GGCATGCCCGGTTGAGTGTCATGAATAT-CTCAACCCCAACGCTTT-----GTTT----GA---AAGTCCCTTGATGTG-CCAGCTGGCCTAGCG----AGGCTGCTG----TAGCATTCCTTGTGACTGAAGCGCTGG--GGCTTGGACTTGAGCTC----TGTTGGCC-----TTT-------GTGTCGA--CTGGCTT-GAAATTGATCAGCAATGCGTGATCCCTTG---GGTCCATCTCGGCGTGATAAG--TTGAT-CGT------------------------------- uncultured_Tulasnellaceae_EU195344 --------------------------------GTTGTTGCTGG------TTCTTACAAGT-GCACGCCTGGCGCGTTCTCCCATCCAC-CCCTCTGTGCATC-GTGACGCGTC----------TCGC--------GGGACGCGG-TCC-----TTT----ATAC--TACCCTT-TTGTAATTG-AGCGAACGCGATATAACGTATTAAA----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCGCTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCTT---T-TGGTATTCCGAAA--GGTACGCCCGGTTGAGTATTATGAACAC-CTCAATCCA-ACGGTCT-----CTGA--TTGC--AAAGGTCCCATGTTCGGCGAAGCCCTTCTGTG----GAGGGGTGGTA-GCTGAAGTCGGACTTG--GAGGCCTGTT-GGACTTGGACTTGAGCGACGACTGTCGGTC-----CGC--TT---GGATCGA--CTCGCTCGAA-ATGCATTAGCTGGCGA--CCCGTCTTACGGTT-CCACTCGACGTAGTAAGTTCTATTTCGTTGAGGACGCCTCTCCGGAGGTGGCCGTCGGG uncultured_Tulasnellaceae_EU583690 ------------------------------GAGTTGCGTGTGCT----GCTGGTCTAAAGAGCACGCC--GCGCTTCTTA----TCAC-CCCACCG-GCACC-TTGGCGCGTC----------T------------GGACGCGG-----------TCATTACACCATACCTTT-TTGTATCGA--GCGAACGTCTTG---TATAAAATA----CGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCATGCGA-ATT-CGATAA-GTTACGTGACTTGTAG--------ATTT-CTTTGAATCATCGAATCT-TTGGAACGCACCTTGCACCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ uncultured_Tulasnellaceae_EU583696 ---------------------------------------------------------------------------------------------------------------------CTCGCATCCCTTAGGG--GTTGTGCGTTCTAC-C--------TTTACAAATCCCAA--TTTGAGAAGAGCTCTGGAACGA-GTCGCTAAAAGTT--AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-ATAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAA--------AATT-CCGTGAATCATCGAATCT--TTTAACGCACCTTGCACCC----TCTGGGATTCCGGAG--GGGATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCCAATGTTTT-----GTCA----A----GGTCTTGTC{AG}ACTCTCCCTGCTGGCCTAAC{GT}----{AG}GGCTGCTGC-----GACTGTTGCGAGGTTGAATCGTTGG--AGCTTGGACTTGAGCTT----TGTTGGCC-----TTC--TC---AGGTTGA--CTGGCTA-GAAATT-ATCA------------------------------------------------------------------------------------ uncultured_Tulasnellaceae_EU583697 --------------------------------GTTGCTGCTGG------TTCTTACAAGT-GCACGCC--GCGTCTTTCTTAATCCAC-CCCACCGTGCACT-TCGGCGCGTC----------TTA----------GGACGCGG-TCC----ATTT----ACACCATACCTTT-TTGTAATCG-AGCGAACGTCTTGTAATAAA-TAA-----CGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCTT---T-TGGTATTCCGAAA--GGTATGCCCGGTTGAGTATTATGAACAT-CTCAATCCT-CTGGCTT-----CTGA--TCGC--AAAGGTTGCACGTTCGGCGAAGTCGTCTGTCG----GGACGACGGTA-GCTGAAGTGCGACTTG--GAAGCCTGTT-GGACTTGGACTTGAGCGACA--CGTCGGTC-----CTC--CA---CGATCGA--CCCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTTCTATT-CGTCGAGGACGCCTCTTTCGAGGTGGCCGAAAAG uncultured_Tulasnellaceae_EU583698 -----------------------------------------------------------------GCC--GCGTCTTTCTTAATCCAC-CCCACCGTGCACT-TCGGCGCGTC----------TTA----------GGACGCGG-TCC----ATTT----ACACCATACCTTT-TTGTAATCG-AGCGAACGTCTTGTAATAAA-TAA-----CGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCTT---T-TGGTATTCCGAAA--GGTATGCCCGGTTGAGTATTATGAACAT-CTCAATCCT-CTGGCTT-----CTGA--TCGC--AAAGGTCGCACGTTCGGCGAAGTCGTCTGTCG----GGACGACGGTA-GCTGAAGTGCGACTTG--GAAGCCTGTT-GGACTTGGACTTGAGCGACA--CGTCGGTC-----CTC--CA---CGATCGA--CCCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTTCTATT-CGTCGAGGACGCCTCTTTCGAGGTGGCCGAAAG- uncultured_Tulasnellaceae_EU583702 --------------------------------------------------------------------AGGAGCCCTTCT----CCAC-CCGAACGGGCACA-TCGGCGCTTT----------TTA----------GGACGCGGGCC-----ATTT----ACACCATACCTTT-TTGCAACCG-AGCGAACGTTTT--GTAATAAATAA----CGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCC-ATGA-ACAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCTT---T-TGGTATTCCGAAA--GGTATGCCCGGTTGAGTATTATGAACAT-CTCAATCCT-CTGGCTT-----CTGA--TCGC--AAAGGTTGCACGTTCGGCAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- uncultured_Tulasnellaceae_EU583718 -------------------------------------------------CACCCGCATGT-GCACTCG--TTAACACAAT-CACACAC--CTG-TGAACCT-CGAACCGTGTCTGTGCGCTGATCCCGTAGGG-AGATGCGTGCGCGCG-CGTTCTTACTTTACAATACCCT---GTTAACTAAAGCTCTAGAAAGTGTTGGTTAATAA----AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCC---TCTGGTATTCCGGAG--GGCATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCTAACATTTTT----GTTA----AA---CGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- uncultured_Tulasnellaceae_EU909163 --------------------------------------GGCGGCGTTAGCACCC-TATGT-GCACTCC--TTAACACAAT-CACACAC--CTG-TGAACCTGCGAACCGTGTCTGTGCGCTGATCCCGTAGGG-AGATGCGTGCGCGCG-CGTTCTTACTTTACAAAACCCT---GTTAACTAAAGCTCTAGAAAGTGTTGGTTAATAA----AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCC----TCTGGTATTCCGGAG--GGCATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCTAACATTTT-----GTTA----AC---GGTCTTGTGGGTGAAGCCTG-TGGTCTAGCG----AGATTGCAGG---TTGTAATCCTTGGGACTAAAGTGTTGG--AGATTGGACTTGAGTTT----TGTTGGCC-----TGC--TA---GGGTCGA--CTGACTCTGAAATTGAT-AGCGATGCGTGATCCATTG---GGTCCATCTCGGCGTGATAAG--TTGAT-CGC------------------------------- uncultured_Tulasnellaceae_GQ907254 ------------------------------GATGTGCTGGCG---TTGATT--CGCATGT-GCACTCC--TTAACACAAC-CACACACACCTG-TGAACCT-CGAACCGTG------------TCCTCCAGGG--GATGCGTGTTCAA--C-------CTTTACAAAACCCA---TTTGATCAGAGCTCTGGAACGA-GACGCTGAAAGTT--AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCC----TCTGGTATTCCGGAG--GGTATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCCAATGTTTT-----GTTA----AA---GGTCTTGTCGACTCGTCCTGCCGGCCTAGCG----AGGCTGCTG----TGAC-TGTTGCGAGGCTGAAGCGTTGG--AGCTTGGACCTGAGCTC----TGTTGGCC-----TTC--CC---AGGTCGA--CTGGCTA-GAAATGCATCAGCGATGAC--GTCCCTTG---GGTCCATCTCGGCGTGATAAG--TTGAT-CGT------------------------------- uncultured_Tulasnellaceae_GQ907258 --------------------------------GTTGCTGCTGG------TTCTTACAAGT-GCACGCC--GCGTCTTTCTTAATCCAC-CCCACCGTGCACT-TCGGCGCGTC----------TTA----------GGACGCGG-TCC----ATTT----ACACCATACCTTT-TTGTAATCG-AGCGAACGTCTTGTAATAAAATAA-----CGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCTT---T-TGGTATTCCGAAA--GGTATGCCCGGTTGAGTATTATGAACAT-CTCAATCCT-CTGGCTT-----CTGA--TCGC--AAAGGTTGCACGTTCGGCGAAGTCGTCTGTCG----GGACGGCGGTA-GCTGAAGTGCGACTTG--GAAGCCTGTT-GGACTTGGACTTGAGCGACA--CGTCGGTC-----CTC--CA---CGATCGA--CCCGCTTGAA-ATGTATTAGCTGGCAA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTTCTATT-CGTCGAGGACGCCTCTTTCGAGGTGGCCGAAA-G uncultured_Tulasnellaceae_GQ907263 ------------------------------GATGTGCTGGCG---TTCGTT--CGCATGT-GCACTCC--TTAACACAAC-CACACACACCTG-TGAACCT-CGAACCGCG------------TCCCCCAGGG--GATGTGCGTTCAA--C-------CTTTACAAAACCCA---TTTGATCGAAGCTCTGGAACGA-GACGCTAAAAGTT--AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GTGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCC----TCTGGTATTCCGGAG--GGTATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCCAATGTTTT-----GTTA----AA---GGTCTTGACGACTCGTCCCGCCAGTCTAACG----AGGCTGCTG----CGAC-TGTTGCAAGGCTGAAGCATTGG--AGCTTGGACTTGAGCTC----TGTCGGCC-----TTC--TC---AGGTCGA--CTGGCTA-GAAATGCATCAGCGATGAC--GTCCCTTG---GGTCCATCTCGGCGTGATAAG--TTGAT-CGT------------------------------- uncultured_Tulasnellaceae_GQ907266 --------------------------------GTTGTTGCTGG------TTCTTACAAGT-GCACGCCCGGCGCGTTCTCCCATCCAC-CCCTCTGTGCATC-GTGACGCGTC----------TCGC--------GGGACGCGG-TCC-----TTT----ATAC--TACCCTT-TTGTAATTG-AGCGAACGCGATATAACGTATTAAA----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCGCTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCTT---T-TGGTATTCCGAAA--GGTACGCCCGGTTGAGTATTATGAACAC-CTCAATCCA-ACGGTCT-----CTGA--TTGC--AAAGGTCCCATGTTCGGCGAAGCCCTTCTGTG----GAGGGGTGGTA-GCTGAAGTCGGACTTG--GAGGCCTGTT-GGACTTGGACTTGAGCGACGACTGTCGGTC-----CGC--TT---GGATCGA--CTCGCTCGAA-ATGCATTAGCTGGCGA--CCCGTCTTACGGTT-CCACTCGACGTAGTAAGTTCTATTTCGTTGAGGACGCCTCTCCGGAGGTGGCCGTCGGG uncultured_Tulasnellaceae_GQ907271 ------------------------------GATGTGCTGGCG---TTCGTT--CGCATGT-GCACTCC--TTAACACAAC-CACACACACCTG-TGAACCT-CGAACCGCAT------------CCCTTAGGG--GTCGTGCGTTCAA--C-------CTTTACAAAACCCA---TTTGATGAGAGCTCTGGAACGA-GACGCTAAAAGTT--AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCC----TCTGGTATTCCGGAG--GGTATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCCAATGTTTT-----GTCA----A----GGTCTTGTCGACTCGTCCTGCTGGCCTAGCG----AGGCTGCTG----TGAC-TGTTGCGAGGCTGAAGCGTTGG--AGCTTGGACTTGAGCTC----TGTTGGCC-----TTC--CG---AGGTCGA--CTGGCTA-GAAATGCATCAGCGATGAC--GTCCCTTG---GGTCCATCTCGGCGTGATAAG--TTGAT-CGT------------------------------- uncultured_Tulasnellaceae_GQ907278 --------------------------------GTTGCTGCTGG------TTCTTACAAGT-GCACGCC--GTGTCTTTCT-TATCCAC-CCCACTGTGCATC-TCGGCGTGCT----------CCGTCTCTGG--CGGGCGCGG-TCC----ATTTT---ACACCGCATCTT--TTGTAACGA-AGCGAATGAAAT--CTTATAATAA-----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-TGCGCTT-----CTGA--TTGC--AAAGGTCCTGCGTCCGGCGAAGCTGTCTATCG----AGGCGGTGGTA-GCTGGACTTGGGCTTG--GAAGCGTGTT-GGTCTTGGACTTGAGCGTGC--TGTCGGTC-----CTC--TT--TGGATCGA--CTCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGC------------------------------- uncultured_Tulasnellaceae_GQ907279 --------------------------------GTTGATGCTGGG-----TTCTTACAAGT-GCACGCC--GTGTCTTTCT-TATCCAC-CCCACCGTGCATC-CCGGCGCGCC----------TCGTCTTTCGACGGGGGGCGG-TCC----GTTTTTTTACACCTTACCTT--TTGTAACCG-AGCGAATGAAATT-GATTTAACAA-----TGTACAACTATCAACAA-CGGATCTCTTGGCATCCCACTCG-ATGA-AGAACGCA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCGCCCT---C-TGGTATTCCGGAG--AGCATGCCCGGTTGAGTATTATGATCAT-CTCAAACCT-TTCGTTT-----CTGA--TTGC--AAAGGTCTTGCGTTTGGCGAAGTCGTCTATCG----AGACGGTGGTA-GCTGAACTTGGACTTG--GAAGCGTATT-GGTCTTGGACTTGAGCGTCT--CGTCGGTC-----CGC--TT---GGATCGA--CCCGCTTGAA-ATGTATTAGCTGGCGA--CCCGCCTTACGGTT-CCACTCGGCGTAGTAAGTCTTATT-CGT------------------------------- uncultured_mycorrhizal_fungus_ex_Ophrys_sphegodes_AJ549122 ------------------------------GATGTGCTGGC----TTCGTT--CGCATGT-GCACTCC--TTAACACAAC-CACACACACCTG-TGAACCT-CGAACCGCGT-----------TCCCCTAGGG--GTCGTG{CT}GTTCAA--C-------CTTTACAAAACCCA---{AT}TTGATCAGAGCTCTGGAACGA-GACGCTAAAAGTT--AAAACAACCATCAGCAA-CGGATCTCTTGGCATTCCAATCG-ATGA-AGAACGTA-GCGA-ATTGCGATAA-GTAATGTGAATTGCAG--------AATT-CAGTGAATCATCGAATCT--TTGAACGCACCTTGCACCC----TCTGGTATTCCGGAG--GGTATGCCCGGTTGAGTGTCATGAATAT-CTCAACTCCAATGTTTT-----GTCA----AA---GGTCTTGTCGACTCGTCCTGCCGGCCTAGCG----AGGCTGCTG----TGAC-TGTTGCGAGGCTGAAGCATTGG--AGCTTGGACTTGAGCTC----TGTTGGCC-----TTC--CC---AGGTCGA--CTGGCTA-GAAATGCATCAGCGATGAC--GTCCCTTG---GGTCCATCTCGGCGTGATAAG--TTGAT-CGT------------------------------- ; END; BEGIN CODONS; CODONPOSSET * UNTITLED (CHARACTERS = Tulasnella) = N: 1-671; CODONPOSSET CodonPositions (CHARACTERS = Tulasnella) = N: 1-671; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M8194] TITLE Sebacina; LINK TAXA = Taxa2; DIMENSIONS NCHAR=650; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Geastrum_schmidelii_EU784247 GAA-GTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAAAGATGATAG-----GGTTTGAGCTCTTTG-------TGTGCTCG---ACTCTTACTCTTATCCATTACACACCTT-----TGTGCACCATGGG-----ACGAATTAAAGTCC----------CCTTATTTACAATAAAGACCCAGTTA------TAT-GCATGTTGTTATACG---CTCTACGGAGTA-----ATGTACAACTTTCAACAACGG-ATCTCTTGGCTTTCGCATCGATGAAGAACGCAGCGAACGTGCGAAACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCGT-GAAAT----ACTCAATTTCAATTTT----------GAAATTGGATTTGGGTGCT-GTTGTGGACAT--TCTACAACTCATCCTAAATGCATTAGCG-A--TCTGCCTCTGATC-ACA-TGCAATGTGATAA-GAA--------AAAA-AGCATTGTAAGGATCGGGGTTTAAT----ATTTGCTTCTAACCGTCGAAAGACAAAGCGC---------ATA-TA---TATGTCA- Sebacina_epigaea_AJ966754 GA-TTACGAA-TGGTTGC--CGTCTGTGCTGGCCAGA-------A-CTGGCA-AGTGCACGGCGGTGG-----CTTT-CAT-CCA--ATACCCC-TGTGAACC-----TTTGGCCTCTTGC----------------------TAGC--------------TTC---GGCCGGCAG-----AGGAATTTT--ACACAAACTCGAAT-----GTAAT-GAAATATATT-GTCGT--GCGCAAGCACT-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTCCCGAT-CTT---GGTT--GGGAGCGGTGGACTTGGGTGTT-GCTGCTTACC------GTGGCTCACCTCAAATGGATTCGTGCATCTCT-TGGTTGGAC-ATAGTACGGCGTGATAA-GTGTCTTCGCCGG---CGCCTCACTT-TGAGGGTGGCCGAT--CGGG-AGCTCTGTGC-TTCTAA---CCGTCCTC-------GGACGACA--ACT-GACAA Sebacina_helvelloides_AJ966750 -----------------C--CTTCTGTGCTGGCT------------CCGGCA-AGTGCACGTTGGTGA------CTTTCATTCCC--AACACCCTTGTGAAC-C----TTTGGCCTCTTGC----------------------TAGC--------------CTC---GGCTGGCAG-----AGGATTTAC--ACACAGACTCGAAT-----GTAATGAAAAACCTCTTGTTGT--GCGCAAGCACG-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACT-TCTAATTCGTTTTGGATTAGGAGCGGTGGACTTGGGTGT-TGCTGCTTTAGT----TGTGGCTCACCTCAAATGAGTTAGTACAACTCT-TGGTTGGAC-ATAGTACGGCGTGATAA-GTGTCTTCGCCGGCGCCTCCTCACAA-GGAGGGTGGCCGATC-GGG--AGCTCTGTGCT-TCAAA---CCGTCTTC-------GGACAAT---?TCTGACAA Sebacina_incrustans_AJ966753 GA-TTGTGAATCGGTTGC--CTCCTGTGCTGGCT------------TTTGCA-AGTGCACGGTGGTGA------CTTTCATCC-----ACCCCCTTGTGAAC-C----TTTGGCCTCTTGC----------------------TGGC--------------TTT---GGTTGGCAG-----AGGATTTTT--ACACAAACTCGAAT-----GTAAT-GAGAAATACT-GTTGT--GCGCAAGCACG-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCTGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTCTCAATCCTTTGGGTTG---GGAGTGGTGGACTTGGGCAT-TGCTGCTTTACT-----GCAGCTTGCCTCAAATGCATTAGTGCAACTCC-AGGTTGGAC-ATAGTACGGCGTGATAA-GTGTCTTCGCCGG---CACCTCGCAA-G-AGGGTGACTGATC-AGG--AGCTCTGTGCT-TCAAA---CCGTCTTC-------GGACAAT--CATCTGACAA Sebacina_sp._AL7 GA-TTT-GAA-CGGTCGC--CTCCTGTGCTGGCCCGCCCCCCCCGGTGGGTACTGTGCACGCTGGTCG-----GCTTTCATCCCA--ACACCCC-TGTGCAC-A----TTTGACCTTGCGC----------------------TGGC--------------TCC---GGCTGGCAC-----GAGGGATTT--ACACAAACTCGCAT-----GTAAT-GAAATCTATC-GCTGT--GCGCAAGCACA-----AATGTACAACTTTCAACAACGG-ATCCCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ACGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATTATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTCTTCCTGTTTTGCGACGGGGGGAGCGGTGGACTTGGATGTGTGCTGCTTGACC-----GCGGCTCATCTGAAATGCATTAGTGCACCGTT-GGGTTGGGC-ATAGTACGGCGTGATAA-GTATCTTCGCCGG---CACCTCGCAA-G-AGGGTGTTCGATC-CTT-CCGCTCTGCGCT-CCAAA---CCGT-CTCCGCGCGGGGACAATATCATTTGACAA Sebacina_sp._SV1 GA-TTGCGAA-TCGTTGT--CTTCAGTGCTGGCCAGC--------TCTGGCA-AGTGCACGTTGGCGG-----CTTTTCAT-CCA--ATACCCC-TGTGAACCC----TTTGGCCCCTTGC----------------------TGGC--------------TTT---GGCTGGCAG-----AGGATTTTTTTACACCCGCTCGAAT-----GTAAT-GAAATT-ATT-GTTGT--GCGCAAGCACT-----ACTGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTTCTGATC-TTTTGG-TC--GGGAGCGGTGGACTTGGGTGTT-GCTGCTTTACT-----GTGGCTCACCTCAAATGCATTAGTGCAACTCT-TGGTTGGAC-ATAGTACGGCGTGATAA-GTATCTTCGCCGG---CACCTCGCAA--GAGGGTGGCTGAT--CAGG-AGCTCTGTGCTTTCCAA---CTGTCTTC-------AGACAACA--ACT-GACAA Sebacina_sp._SV3 GA-TTGCGAA-TCGTTGT--CTTCAGTGCTGGCCAGC--------TCTGGCA-AGTGCACGTTGGCGG-----CTTTTCAT-CCA--ATACCCC-TGTGAACCC----TTTGGCCCCTTGC----------------------TGGC--------------TTT---GGCTGGCAG-----AGGATTTTTTTACACCCGCTCGAAT-----GTAAT-GAAATT-ATT-GTTGT--GCGCAAGCACT-----ACTGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTTCTGATC-TTTTGG-TC--GGGAGCGGTGGACTTGGGTGTT-GCTGCTTTACT-----GTGGCTCACCTCAAATGCATTAGTGCAACTCT-TGGTTGGAC-ATAGTACGGCGTGATAA-GTATCTTCGCCGG---CACCTCGCAA--GAGGGTGGCTGAT--CAGG-AGCTCTGTGCTTTCCAA---CTGTCTTC-------AGACAACA--ACT-GACAA Sebacina_sp._SV6 AACTTCAAAGTCGG-CCAAAGGTTGTTGCTGGTGATTA--------TTCACA-TGTGCACGCCTTTG-------GTCGCAAATCCACACACACC-TGTGCATC-----TATGACTCGAGGT----------------------------------------TGTAATGACTGAG--------AGTAACTTTTATACACTCTTGTAT-----GTAATGGAATGTCTTTTTGTGC--TATAATGTACAA----TATAAACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCATTGTAATCTCACTTCTACAACTTTATTGTTGT---TTGAATGTGGACTTGGATGTT-GCCGTTTTATCA-----CGGCTCGTCTTAAATGCCTGAGTGTACCCTGTTTT-GCAGC-GTA-TCCAGTGTAATAA-ACAT-TTCACTAGAGTTGGT---CGAAAGACCGCGTTGACT--ATATGGGCTCTATGCTTCAAA----CCGTCTGCCATGT--GGACAATT--TCTTGACAA Sebacina_sp._SV7 GA-TTT-GAA-CGGTCGCGCCTCCTGTGCTGGCCCGCC--------TGGGTACTGTGCACGCTGGCCG-----GCTTTCATCCCA--ACACCCCCTGTGCACCA----TTTGACCTTGCGC----------------------TGGC--------------TCC---GGCTGGCAC-----GAGGGATTT--CCACAAACTCGCAT-----GTAAT-GAAATCTATA-GCCGT--GCGCAAGCACG-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTCTTCCTGTTTTGCGACGGGGGGAGCGGTGGACTTGGATGCGTGCTGCTTGACC-----GTGGCTCATCTGAAATGCATTAGTGCACCGTT-GGGTTGGGC-ATAGTACGGCGTGATAA-GTATCTTCGCCGG---CACCTCGCAA-G-AGGGTGTTCGATC-CTTGCCGCGCTGCGCTGCCAAA---CCGTGCTCCGCGCGGGGACAAT--CGTTTGACAA Sebacina_sp._SV9 GA-TTT-GAA-CGGTCGCGCCTCCTGTGCTGGCCCGCC--------TGGGTACTGTGCACGCTGGCCG-----GCTTTCATCCCA--ACACCCCCTGTGCACCA----TTTGACCTTGCGC----------------------TGGC--------------TCC---GGCTGGCAC-----GAGGGATTT--CCACAAACTCGCAT-----GTAAT-GAAATCTATA-GCCGT--GCGCAAGCACG-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTCTTCCTGTTTTGCGACGGGGGGAGCGGTGGACTTGGATGCGTGCTGCTTGACC-----GTGGCTCATCTGAAATGCATTAGTGCACCGTT-GGGTTGGGC-ATAGTACGGCGTGATAA-GTATCTTCGCCGG---CACCTCGCAA-G-AGGGTGTTCGATC-CTTGCCGCGCTGCGCTGCCAAA---CCGTGCTCCGCGCGGGGACAAT--CGTTTGACAA Sebacina_sp._src835_DQ974770 GA-TTACGAA-TGGTTGC--CTTCAGTGCTGGCCAGA-------ACCTGGCA-AGTGCACGTCGGTGA-----CTTT-CAT-CCA--ATACCC--TGTGAACC-----TTTGGCCTCTTGC----------------------TAGC--------------TTC---GGCCGGCAG-----AGGAATTTT--ACACAAACTCGAAT-----GTAAT-GAAATTTATT-GTCGT--GCGCAAGCACT-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTCCCGAT-CTTTTGGATT--GGGAGCGGTGGACTTGGGTGTT-GCTGCTTGCC------GTGGCTCACCTCAAATG?ATCAGTGCA?CTCT-TGGTTGGAC-ATAGTACGGCGTGATAA-GTGTCTTCGCCGG---CACCTCACTT-AGAGGGTGGCCGAT--CGGG-AGCTCTGTGC-TTCAAA---CCGTCTTC-------GGACAACA--A-------- Sebacina_vermifera_AF202728 GAA-TCGT-A--AGCCGG-TCGACCGTGCTGGCGGCAA----------CGCA-CGTGCACGTCGATCG-----CAAACCAA-TCC--ACACACC-TGTGAACG-----TATGGCCTCTCGG----------------------GTCC--------------TTTCGGACTCGGGGC-----AAAACCCATTTTTAC----TCTGATC----GTAAAGGAATGT-CTTTGCCTA--AAGC--GCAAA-----AGCAAACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCATTGTAATCTCACCCCCGGAATCT-TTTC-------TGGGGAGTGGACTTGGACGTT-GCAGTGTCA--------CGGCTCGTCTGGAATGTCTCAGTGCTACCCCGCCCGTCGGC-GTA-TACAGTGTGATAA-GTATCTTCACTGGTC-AGCTTCCTCG--GAGGCGCGCTCTCG-GACGGATCGGTGTGCTGCCAA----CCGTCTTC-------GGACAATA--CTCTGACGA Sebacina_vermifera_DQ983815 GAA-TCGT-A--AG{CT}CGG-TCGACCGTGCTGGCGGCAA----------CGCA-CGTGCACGTCGAT{CT}G-----CAAACCAA-TCC--ACACACC-TGTGAACG-----TATGGCCTCTCGG----------------------GTCC--------------TTT{CT}GGACTCGGGGC-----AAAACCCATTTTTAC----TCTGATC----GTAAAGGAATGT-CTTTGCCTA--AAGC--GCAAA-----AGCAAACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCATTGTAATCTCACCCCCGGAATCT-TTTC-------TGGGGAGTGGACTTGGACGTT-GCCGTGTCA--------CGGCTCGTCTGGAATGTCTCAGTGCTACCCCGCCCGTCGGC-GTA-TACAGTGTGATAA-GTATCTTCACTGGTC-AGCTTCCTC{AG}--GAGGCGCGCTCTCG-GACGGATCGGTGTGCTGCCAA----CCGTCTTC-------GGACAATA--CTCTGACGA Sebacinaceae_sp._B18_AJ549198 GA-TTGCGAA-TCGTTGT--CTCCAGTGCTGGCCAGGTCA----CTCTGGCA-AGTGCACGTCGACAG-----CTTT-CAT-CCA--ATACCC--TGTGAACC-----TTTGGCCTCTTGC----------------------TAGC--------------TTC---GGCGAGCAG-----AGGATTTT---ACACCCACTCGAAT-----GTAAT-GAAATT-ATT-GTTGT--GCACAAGCACT-----AATATACAACTTTCAACAACG--ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTTCCGATT-GTTTGGATC--GGGAGCGGTGGACTTGGGTGTT-GCTGCGTTACT-----GTGGCTCACCTTAAATGCATTAGTGCACCTTT-CGGTTGGAC-ATAGTACGGCGTGATAA-GTGTCTTCGCCGG---CACCTCCTCACAGAGGGTGGCCGAT--CGGG-AGCTCTGTGC-TTCAAA---CCGTCTTC-------GGACAACA--ACT-GACAA Sebacinaceae_sp._F_JLP_1380_AY296259 GA-TTGCGAA-TGGTCGC--CTTCGGTGCTGGC------------TCTTGCA-AGTGCACGTTGGTGG-----CTTT-CAT-CCA--ATACCCC-TGTGAACC-----TTTGGCCTCTTGC----------------------TAGC--------------TTC---GGCTGGCAG-----AGGATTTTT--ACACA--CTCGAAT-----GTAAT-GAAAACTATT-GTCGT--GCGCAAGCACT-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTCTCTGGTCCTTTGGATTCAGGGAGCGGTGGACTTGGGTGTTTGCTGCTTTCCTG----GTGGCTCACCTCAAATGCGTTAGTGCACCTCT-TGGTTGGAC-ATAGTACGGCGTGATAA-GTATCTTCGCCGG---CACCTCGCAA--GAGGGTGGCCGAT--TGGG-AGCTCTGTGCTTTCAAA---CCGTCTTC-------GGACAATC--TTT-GACAA Sebacinaceae_sp._kz24_EF372401 GA-TTGCGAA-TGGTTGC--CTTCGGTGCTGGC------------TCTTGCA-AGTGCACGTTGGTGG-----CTTT-CAT-CCA--ATACCCTTTGTGAACC-----TTTGGCCTCTTGC----------------------TAGC--------------TTC---GGCTGGCAG-----AGGATTTTT--ACACACACTCGAAT-----GTAAT-GAAAACTATT-GTCGT--GCGCAAGCACT-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTCTCCGATCCTATGGATTCGGGGAGCGGTGGACTTGGGTGTT-GCTGCTTTCCTT----GTGGCTCACCTCAAATGCGTCAGTACACCTCT-TGGTTGGAC-ATAGTACGGCGTGATAA-GTGTCTTCGCCGG---CACCTCGCAA--GAGGGTGGCCGATC-TGGG-AGCTCTGTGCTTTCAAA---CCGTCTTC-------GGACAATT--TCT-GACAA fungal_sp._CC2_AY643802 GAA-TCAA-A--AGTCGG-TCGACCGTGCTGGCGGAAA----------CGCA-CGTGCACGTCGGTCG-----CAAACCAA-TCC--ACACACC-TGTGAACG-----TATGGCCTTTCGG----------------------GTCT--------------CTC--GACTCGGGGG-----CAAACCATTTTTTACCCACTCTGATC----GTAAAGGAATGT-CTTTGCCTA--AAGC--GCAAA-----AGCAAACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTCGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCATTGTAATCTCACCCCCGGAATTTATTTT-------CTGGGAGTGGACTTGGACGCT-GCCGTGTCA--------CGGCTCGTCTGGAATGTCTCAGTG-TGCCCCGCCCGTCGGT-GTT-AACAGTGTGATAG-ATATCTTCACTGGTT--GCCTCTCCG--GAGGCGCGCTCTCG-GATGGATC-GTGTGCT?CCAA----CCGTCTTC-------GGACAATA--CTCTGACAA uncultured_Basidiomycota_HM241745 GAGTTCAAA---AGTCGG-TCGACCGTGCTGGCGGAGA----------CGCA-TGTGCACGTCGGTCG-----CGAACCA--TCC--ACACACC--GTGAACC-----TATGGCCTGGGGT----------------------TTGA--------------GTTCAGACCCTGGGC--------ACCA-TTTTTAC--ACTCTGTTC----GTAAAGGAATGT------CTTA--TATC--ATATA-----AACATACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCATTGTAATCTCACCCC-GAAATCT--TTT-------TTTGGAGTGGACATGGACGCT-GCCGTGTTGCA------TGGCTCGTCTCGAACGTCTTAGTA-TGCCCCGCCCGTCGGT-GTA-GACAGCGTGATAA-GTATCTTCGCTGGTCAAGCCTCTCCG--GAGGCGCACC-TCG-AGCATGGAAGCCTGCTGCCAA----CCGTCTTT-------TGACAAC---CTTTGACAA uncultured_Basidiomycota_HM241756 GAGTTCAAA---AGTCGG-TCGACCGTGCTGGCGGAGA----------CGCA-TGTGCACGTCGGTCG-----CGAACCA--TCC--ACACACC--GTGAACC-----TATGGCCTGGGGT----------------------TTGA--------------GTTCAGACCCTGGGC--------ACCA-TTTTTAC--ACTCTGTTC----GTAAAGGAATGT------CTTA--TATC--ATATA-----AACATACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCATTGTAATCTCACCCC-GAAATCT--TTT-------TTTGGAGTGGACTTGGACGCT-GCCGTGTTGCA------TGGCTCGTCTCGAACGTCTTAGTA-TGCCCCGCCCGTCGGT-GTA-GACAGCGTGATAA-GTATCTTCGCTGGTCAAGCCTCTCCG--GAGGCGCACCCTCG-AGCATGGAAGCCTGCTGCCAA----CCGTCTTT-------TGACAAC---CTTTGACAA uncultured_Basidiomycota_HM241758 GAA-TTTCCA--AGTCGG-TCGACCGTGCTGGCGGAA-----------CGCA-CGTGCACGTCGGTCG-----CAAACCAA-TCC--ACACACC-TGTGAACG-----TATGGCCTCTCGG----------------------GTCT--------------CT---GACCCGGGGG-----CAAACCATTTTTCGC--ACTCTGATA----GTAAAGGAATGTTCTTTGCCTA--ATAC--GCAAA-----AGCAAACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTCGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCATTGTAATCTCACCCCCGAAATCTTTTTT-------TTGGGAGTGGACTTGGACGCT-GCCGTGTCA--------CGGCTCGTCTCGAACGTCTCAGTG-TACCCCGCC-GTCGGC-GTCAAACAGTGTGATAA-GTATCTTCACTGGTT-AGTCTCTCCG--GAGGTGCGCTCTCG-GATGGTG--GTGTGCTGCCAA----CCGTCCTC-------GGACAATA--CTCTGACAA uncultured_Basidiomycota_HM241759 GAA-TTTACA--AGTCGG-TCGACCGTGCTGGCGGAAA----------CGCA-CGTGCACGTCGGTCG-----CAAACCAA-TCC--ACACACC-TGTGAACG-----TATGGCCTTTGGG----------------------TCCT--------------CTC--GGACCTGGGG-----CAAACCATTTTTCAC--ACTCTGACA----GTAAAGGAATGTTCTTTGCCTA--AAAC--GCAAA-----AGCAAACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTCGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCATTGTAATCTCACCCCCGGAAT-TCTTTT-------CTGGGAGTGGACTTGGACGCT-GCCGTGTCAA-------TGGCTCGTCTCGAACATCTCAGTG-TACCCCGCC-GTCGGC-GTATAACAGTGTGATAA-GTATCTTCACTGGTTGAGCCTCTCTG--GAGGCGCGCTCTCG-GATGGTGT-GTGTGCTGCCAA----CCGTCTTC-------GGACAATA--CTTTGACAA uncultured_Basidiomycota_HM241760 GAA-TCAA-A--AGTCGG-TCGACCGTGCTGGCGGAAA----------CGCA-CGTGCACGTCGGTCG-----CAAACCAA-TCC--ACACACC-TGTGAACG-----TATGGCCTTTCGG----------------------GTCT--------------CTC--GACTCGGGGG-----CAAACCATTTTTTACCCACTCTGATC----GTAAAGGAATGT-CTTTGCCTA--AAGC--GCAAA-----AGCAAACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTCGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCATTGTAATCTCACCCCGGGAATTTATTTT-------CTGGGAGTGGACTTGGATGCT-GCCGTGTCA--------CGGCTCGTCTGGAATGTCTCAGTG-TGCCCCGCCCGTCAGT-GTT-AACAGTGTGATAG-ATATCTTCACTGGTT--GCCTCTCCG--GAGGCGCGCTCTCG-GATGGATC-GTGTGCTGCCAA----CCGTCTTC-------GGACAATA--CTCTGACAG uncultured_Sebacinaceae_AJ879655 GA-TTGCGAA-TCGTTGT--CTTCAGTGCTGGCCAGC--------TCTGGCA-AGTGCACGTTGGCGG-----CTTTTCAT-CAA--ATACCCC-TGTGAACC-----TTTGGCCTCTTGC----------------------TGGC--------------TTT---GGCTGGCAG-----AGGATTTTTT-ACACCCGCTCGAAT-----GTAAT-GAAATT-ATT-GTTGT--GCGCAAGCACT-----ACTGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTTCTGATC-TTTTGGGTC--GGGAGCGGTGGACTTGGGTGTT-GCTGCTTTACT-----GTGGCTCACCTCAAATGCATTAGTGCAACTCT-TGGTTGGAC-ATAGTACGGCGTGATAA-GTATCTTCGCCGG---CACCTCGCAA--GAGGGTGGCTGAT--CAGG-AGCTCTGTGCTTTCCAA---CTGTCTTC-------AGACAACA--ACT-GACAA uncultured_Sebacinaceae_AY286193 GA-TTGCGAA-TCGTCGC--CTTCAGTGCTGGCCGGC-------TTC-GGCA-AGTGCACGTCGGTGA-----CTTT-CAT-CCA--ATACCC--TGTGCACC-----TTTGGCCTCTTGC----------------------TAGC--------------TTC---GGCCGGCAG-----AGGATTTTT--ACACACACTCGAAT-----GTAAT-GAAATTTATT-GTCGT--GCGCAAGCACT-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACTCTCCCGATACTTTTGGATC--GGGAGTGGTGGACTTGGGTGCT-GCTGCTTAACT-----GTGGCTCGCCTCAAATGAAGTAGTGCAACTCT-CGGTTGGAC-ATAGTACGGCGTGATAA-GTATCTTCGCCGG---CGCCTCATT--CGAGGGTGGCCGAT--CGGG-AGCTCTGTGC-TTCAAA---CCGTCTTC-------GGACAATA--TCT-GACAA uncultured_Sebacinaceae_AY452678 GA-TTGCGAA-TCGC-GT--CTCCAGTGCTGGCCAGGTCA----CTCTGGCA-AGTGCACGGAGACAG-----CTTT-CAT-CCA--ATACCC--TGTGAACC-----TTTGGCCTCTTGC----------------------TAGC--------------TTC---GGCGAGCAG-----AGGATTTT---ACACCCACTCGAAT-----GTAAT-GAAATT-ATT-GTTGT--GCACACGCACT-----ACTATACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTTCCGATT-GTTTGGATC--GGGAGCGGTGGACTTGGGTGTT-GCTGCGTAACT-----GTGGCTCACCTTAAATGCATTAGTGCACCTTT-CGGTTGGAC-ATAGTACGGCGTGATAA-GTGTCTTCGCCGG---CACCTCCTCACAGAGGGTGGCCGAT--CGGG-AGCTCTGTGC-TTCAAA---CCGTCTTC-------GGACAACA--ACT-GACAA uncultured_Sebacinaceae_AY452680 -------------------------------------------------TGAGGGCACAGGTAGGGGA-----CTTT-CAT-TCA--ACACCC--TGTGAACC-----TTTGGCCTATTGC----------------------TAGC--------------TTC---GGCTGGCAG-----AGGATTTTT--ACACACACTCGAAT-----GTAAT-GAAATT-ATT-GTCGT--GCGCAAGCACT-----TATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTTCTGATCCTTTGGATTT---GGAGCGGTGGACTTGGGTGTT-GCCACTTGACG-----GTGGCTCACCTCTAATGCATTAGTGCAACTCC-TGGTTGGACCATAGTACGGCGTGATAA-GTGTCTTCGCCGG---CACCTCGTGA--GAGGGTGGCCGAT--CGAG-AGCTCTGTGCTTTCAAA---CCGTCCTT---GCAAGGACAATG--ACT-GACAA uncultured_Sebacinaceae_AY634132 GAA-GTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAAACTTCAAGTCGGCTGTTCTGTGCTGGTGGCAACACATGTGCACGTTCAGTCGCAATCCACACACCTGTGCACTTTGACTCTGAGCACCGCCGGT-AACACGGCAGAAGGTTTGAGATGAAGGTCTTAACCCCGGTACTCGAGTAGTTTACACACTCT-GTATGTAATAGAATGTAACTGTACAATGTACAACTATAAACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACCCCAACACCTTTATT----------GGTGTTGGATGTGGACTTG-GATGTTGTCGTGTTCAACGACTCGTCTTAAATGCCTGAGTG-TACCCTGCTTTGCAGC-GTA-T-CAGTGTGATAA-ACATCTTCACTGTTA-AGTCTT-TCGGGACACGCTTGTGTT----GTAGGCTCTATGCTTTCCAACCGTCCTCTGG---------ACAATC---TCTGACAA uncultured_Sebacinaceae_DQ273405 AACCTCAAAGTCGGCTTTGTCATCTGTGCTGGTGGAGA----------CACA-TGTGCACGTCGACAA-----AGTCGCAAACCC-CACACACC-TGTGCATC-----TATGACTCTGAGTACCGCT----------------TTGCA------TGGGCCGTCAAATGCCCTGGTACTC--GAGTAACTTTCACACACTCT-GAAT-----GTAATGGAATGTCTATT-GTAC---AATGTACAAC-----CAAAAACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACTACAACCGCTTTTTTGTGGT---T-GCATGTGGACTTGGATGTT-GCCGTGTAACAA----ACGGCTTGTCTGAAATGCCTGAGTGTACCCTGCTTT-GCGGC-GTA-TTCGGTGTGATAA---ATCTTCACCGGAGTTGAC--CCTCAGGGTCGCGTCTGCTTGACATGG-CTCTATGCTTCCAA----CCGTCCTGACA----AGACAATC--T-TTGACAA uncultured_Sebacinaceae_EF077512 GA-TTTTGAT-TTGTTAC--CTTCTGTGCTGGCTC-----------CGGGCA-TGTGCACATTGGTGA-----CTTTTCATGT-A--ATCCCCCTTTTGTGAAC----CTTTGCCTCATGC----------------------TGGC--------------TTT---GGCTGGCCA-----AGAGGATTT--ACACAAACTTGAAT-----GTACCAGAAAGAAATT-GTTGT--GCGCAAGCACT-----AATGTACAACTTTCAACAACGGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAAT-GCAGA-TTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCATTGGTATTCCAAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTCTAATGAATTTT--------GGAGAAGTGGACTTGGGTGT-TGCTGCTTTGCG-----GTGGCTCATCTTAAATATGCTAGTGCAACTCA-TGGTTGGAT-ATAGTACAGCGTGATAA-GTATCCT----------------------------------------------------------------------------------------------- uncultured_Sebacinaceae_EF218817 GA-TTGCGAA-TCGTTGT--CTTCAGTGCTGGCCAGC--------TCTGGCA-AGTGCACGTTGGCGG-----CTTTTCAT-CCA--ATACCCC-TGTGAACC-----TTTGGCCTCTTGC----------------------TAGC--------------TTT---GGCTGGCAG-----AGGATTTTT--ACACCCACTCGAAT-----GTAAT-GAAATT-ATT-GTTGT--GCGCAAGCACT-----ACTGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTTCTGATCCTTTTGGATT--GGGAGCGGTGGACTTGGGTGTT-GCTGCTTTACT-----GCGGCTCACCTCAAATGCATTAGTGCAACTCT-TGGTTGGAC-ATAGTACGGCGTGATAA-GTATCTTCGCCGG---CACCTCGCAA--GAGGGTGGCTGAT--CAGG-AGCTCTGTGCTCTCCAA---CTGTCTTC-------GGACAACA--ACT-GACAA uncultured_Sebacinales_AM181396 AACTTCAAAGTCGG-CCAATAGTTGTTGCTGGTGATTCAT------TTCACA-TGTGCACACTGTCG-------GTCGCAA-TCCACACACACC-TGTGCATC-----TATGACTCGAGGT----------------------------------------TGTAATGACTGAG--------AGTAAATTTTACACACTCTTGTAT-----GTAATGGAATGTCTTTT-GTGC--TATAATGTACAA----TATAAACAACTTTCAACAACGG-ATCCCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCATTGTAATCTCACTTCAACGACTTTATTGTTGT---TTGAATGTGGACTTGGATGTT-GCCGTGTCATTA-----CGGCTCGTCTTAAATGCTTGAGTGTACCCTGTTTT-GCAGT-GTA-TCCAGTGTAATAA-ACAT-TTCACTAGAGTTGGT---CGAAAGACCGCATTTGCT--ATTCAGGCTCTATGCTTCGAA----CCGTCCACTTTGT--GGACAATT--TCTTGACAA uncultured_Sebacinales_DQ182435 GA-TTGCGAA-TCGTCGC--CTTCAGTGCTGGCCGGC-------TTC-GGCA-AGTGCACGTCGGTGA-----CTTT-CAT-CCA--ATACCC--TGTGCACC-----TTTGGCCTCTTGC----------------------TAGC--------------TAC---GGCCGGCAG-----AGGATTTTT--ACACACACTCGAAT-----GTAAT-GAAATTTATT-GTCGT--{CG}CTCAAGCACT-----AATGTACGACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGGA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACTCTCCCGATACTTTTGGATC--GGGAGTGGTGGACTTGGGTGCT-GCTGCTTCCCT-----GTGGCTCGCCTCAAATGAAGCAGTGCAACTCTTCGGTTGGAC-ATAGTACGGCGTGATAA-GTATCTTCGCCGG---CGCCTCATTT-CGAGGGTGGCCGAT--CGGG-AGCTTCTTGT-T------------------------------------------ uncultured_Sebacinales_EF030946 GA-TTGCGAA-TTGTTGC--CTTCAGTGCTGGT-----------TTC-GGCA-AGTGCACGTCGGTGA-----CTTT-CAT-CCA--ATACCC--TGTGCACC-----TTTGGCCTCTTGC----------------------TAGC--------------TTC---GGCCGGCAG-----AGGATTTT---ACACAAACTCGAAT-----GTAAT-GAAATTTATT-GTCGT--GCGCAAGCACT-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTCCCAATGCTTTTGGATT--GGGAGCGGTGGACTTGGGTGTT-GCTGCTTTACT-----GTGGCTCACCTTAAATGGAGTAGTGCAACTCT-TGGTTGGAC-ATAGTACGGCGTGATAA-GTATCTTCGCCGG---CGCCTCACT--AGAGGGTGGCTGAT--C{AG}G--AGCTCTGTGC-TTCAAA---{CT}TGTCTTC-------GGACAATC--TTT-GACAA uncultured_Sebacinales_EF417824 GA-TTGCGAA-TCGTTGT--CTCCAGTGCTGGCCAGTCC-----TTCTGGCA-AGTGCACGTTGGCGG-----CTTTTCAT-CCA--ATACCCC-TGTGAACC-----TTTGGCCTCTTGC----------------------TAGC--------------CTT---GGCCGGCAG-----AGGAATTTT--ACACCCACTCGAAT-----GTAAT-GAAATT-ATT-GTTGT--GCGTAAGCACT-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTTCTGATC-CTTTGGATT--GGGAGCGGTGGACTTGGGTGTT-GCTGCTTTGCG-----GTGGCTCGCCTCAAATGCATTAGTGCAACTCT-TGGTTGGAC-ATAGTACGGCGTGATAA-GTGTCTTCGCCGG---CACCTCGCAA--GAGGGTGGCTGAT--CAGG-AGCTCTGTGCCTCCAACGGTCTGTCTTC-------AGACAACA--ACTTGACAA uncultured_ectomycorrhizal_fungus_AY277943 GA-TTACGAA-CGGTCGC--CGTCTGTGCTGGCCAGA-------ATCTGGCA-AGTGCACGTCGGTGG-----CTTT-CAT-CCA--ATACCC--TGTGAACC-----CTTGGCCT-TTGC----------------------TAGC--------------TTC---GGCCGGCAG-----AGGAATTT---ACACAAACTCGAAT-----GTAAT-GAAATATATT-GTTGT--GCGCAAGCACT-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTCCCGAT-CTT---GGTT--GGGAGCGGTGGACTTGGGTGCT-GCTGCTTACC------GTGGCTCACCTCAAATGGATTCGTGCATCTCT-TGGTTGGAC-ATAGTACGGCGTGATAA-GTATCTTCGCCGG---CGCCTCACTC--GAGGGTGGC{CT}GAT--CGGG-AGCTCTGTGC-TTCTAA---CCGTCTCC-------GGACAACA--ACT-GACAA 'uncultured endomycorrhiza ex Neottia nidus-avis AF440647' GA-TTGCGAA-TTGTTAC--CTTCTGTGCTGGCCGGC-------TTC-GGCA-AGTGCACGTCGGTGA-----CTTT-CAT-CCA--ATACCC--TGTGCACC-----TTTGGCCTCTTGC----------------------TAGC--------------TTC---GGCCGGCAG-----AGGATTTT---ACATAAACTCGAAT-----GTAAT-GAAATT-ACT-GTCGT--GCGCAAGCACT-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTCCTAATGCTTTTGGATT--GGGAGCGGTGGACTTGGGTGTT-GCTGCTTTACT-----GCGGCTCGCCTCAAATGGAGTAGTGCAACTCT-CGGTTGGAC-ATAGTACGGCGTGATAA-GTGTCTTCGCCGG---CGCCTCATT--AGAGGGTGGCCGAT--CGGG-AGCTCTGTGC-TTCAAA---CCGTCTTC-------GGACAACA--TCT-GACAA 'uncultured endomycorrhiza ex Neottia nidus-avis AF440648' GA-TTGCGAA-TCGTTGC--CTTCAGTGCTGGCCGGC-------TTC-GGCA-AGTGCACGTCGGTGA-----CTTT-CAT-CCA--ATACCC--TGTGCACC-----TTTGGCCT-TTGC----------------------TAGC--------------TTC---GGCCGGCAG-----AGGATTTT---ACATAAACTCGAAT-----GTAAT-GAAATTTATT-GTCGT--GCGCAAGCACT-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTCCTAATGCTTTTGGATT--GGGAGCGGTGGACTTGGGTGTT-GCTGCTTTACT-----GTGGCTCACCTCAAATGGAGTAGTGCAACTCT-CGGTTGGAC-ATAGTACGGCGTGATAA-GTGTCTTCGCCGG---CGCCTCATT--CGAGGGTGGCCGAT--CAGG-AGCTCTGTGC-TTCAAA---CCGTCTTC-------GGACAACA--TCT-GACAA 'uncultured endomycorrhiza ex Neottia nidus-avis AF440651' GA-TTGCGAA-TCGTTGT--CTTCAGTGCTGGCCAGC--------TCTGGCA-AGTGCACGTTGGCGG-----CTTTTCAT-CCA--ATACCCC-TGTGAACC-----TTTGGCCTCTTGC----------------------TAGC--------------TTT---GGCTGGCAG-----AGGATTTTTT-ACACCCACTCGAAT-----GTAAT-GAAATT-ATT-GTCGT--GCGCAAGCACT-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTTCTGATC-CTTTGGATT--AGGAGCGGTGGACTTGGGTGCT-GCTGCTTTACT-----GTGGCTCACCTCAAATGCATTAGTGCAACTCT-TGGTTGGAC-ATAGTACGGCGTGATAA-GTGTCTTCGCCGG---CACCTCGCAA--GAGGGTGGCTGAT--CGGG-AGCTCTGTGCCTTCCAA---CTGTCTTC-------AGACAACA--ACT-GACAA 'uncultured endomycorrhiza ex Neottia nidus-avis AF440652' GA-TTGCGAA-TCGTTGT--CTCCAGTGCTGGCCAGGTCA----CTCTGGCA-AGTGCACGGAGACAG-----CTTT-CAT-CCA--ATACCC--TGTGAACC-----TTTGGCCTCTTGC----------------------TAGC--------------TTC---GGCGAGCAG-----AGGATTTT---ACACCCACTCGAAT-----GTAAT-GAAATT-ATT-GTTGT--GCACACGCACT-----ACTATACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTTCCGATT-GTTTGGATC--GGGAGCGGTGGACTTGGGTGTT-GCTGCGTAACT-----GTGGCTCACCTTAAATGCATTAGTGCACCTTT-CGGTTGGAC-ATAGTACGGCGTGATAA-GTGTCTTCGCCGG---CACCTCCTCACAGAGGGTGGCCGAT--CGGG-AGCTCTGTGC-TTCAAA---CCGTCTTC-------GGACAACA--ACT-GACAA 'uncultured endomycorrhiza ex Neottia nidus-avis AF440656' GA-TTGCGAA-TCGTTGT--CTTCAGTGCTGGCCAGC--------TCTGGCA-AGTGCACGTTGGCGG-----CTTTTCAT-CCA--ATACCCC-TGTGAACC-----TTTGGCCTCTTGC----------------------TAGC--------------TTT---GGCTGGCAG-----AGGATTTTTT-ACACCCACTCGAAT-----GTAAT-GAAATT-ATT-GTCGT--GCGCAAGCACT-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTTCTGATC-CTTTGGATT--AGGAGCGGTGGACTTGGGTGCT-GCTGCTTTACT-----GTGGCTCACCTCAAATGCATTAGTGCAACTCT-TGGTTGGAC-ATAGTACGGCGTGATAA-GTGTCTTCGCCGG---CACCTCGCAA--GAGGGTGGCTGAT--CGGG-AGCTCTGTGCCTTCCAA---CTGTCTTC-------AGACAACA--ACT-GACAA uncultured_fungus_AJ875396 AACTTCAAAGTCGG-CCAAAGGTTGTTGCTGGTGATTA--------TTCACA-TGTGCACGCCTTTG-------GTCGCAAATCCACACACACC-TGTGCATC-----TATGACTCGAGGT----------------------------------------TGTAATGACTGAG--------AGTAACTTTTATACACTCTTGTAT-----GTAATGGAATGTCTTTTTGTGC--TATAATGTACAA----TATAAACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACGCCCGTTTGAGTGTCATTGTAATCTCACTTCTACAACTTTATTGTTGT---TTGAATGTGGACTTGGATGTT-GCCGTTTTATCA-----CGGCTCGTCTTAAATGCCTGAGTGTACCCTGTTTT-GCAGC-GTA-TCCAGTGTAATAA-ACAT-TTCACTAGAGTTGGT---CGAAAGACCGCGTTGACT--ATATGGGCTCTATGCTTCAAA----CCGTCTGCCATGT--GGACAATT--TCTTGACAA uncultured_mycorrhiza_ex_Hexalectris_revoluta_sp._F_AY243532 GA-TTGCGAA-TCGTTGC--CTTCTGTGCTGGCCAGT-------TTCTGGCA-AGTGCACGTCGGTGA-----CTTT-CAT-CCA--ATACCC--TGTGAACC-----TTTGGCCTCTTGC----------------------TAGC--------------TTC---GGCCGGCAG-----AGGAATTTT--ACACAAACTCGAAT-----GTAAT-GAAATCTATT-GTCGT--GCGCAAGCACT-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCG-TGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCAAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTCCCGAT-CTTTC-GATT--GGGAGCGGTGGACTTGGGTGTT-GCTGCTTACCT-----GTGGCTCACCTCAAATAGATCAGTGCACCTCT-TGGTTGGAC-ATAGTACGGCGTGATAAAGTGTCTTCGCCCG----GCCCTACTT-TGAGGGTGGCCGAT--CGGG-AGCTCTGTGC-TTCAAA---CCGTCTTC-------GGACAATG--ACT-GACAA uncultured_mycorrhiza_ex_Hexalectris_spicata_sp._E_AY243531 GA-TTGCGAA-TCGTTGT--CTTCAGTGCTGGCCAGC--------TCTGGCA-AGTGCACGTTGGCGG-----CTTTTCAT-CCA---TACCCC-TGTGAACC-----TTTGGCCTCTTGC----------------------TAGC--------------CTT---GGCCGGCAG-----AGGAATTTTT-ACACCCACTCGAAT-----GTAAT-GAAATT-ATT-GTTGT--GCGTAAGCACT-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGCATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTTCTGATC-TTTTGGATT--GGGAGCGGTGGACTTGGGTGTT-GCTGCTTTGCG-----GTGGCTCGCCTCAAATGCATTAGTGCAACTCT-TGGTTAGAC-ATAGTACGGCGTGATAA-GTATCTTCGCCGG---CACCTCGCAA--GAGGGTGGCTGAT--CAGG-AGCTCTGTGCTTCCAACAGTCTGTGTTC-------AGACAACA--ACT-GACAA uncultured_mycorrhizal_fungus_ex_Dactylorhiza_incarnata_AJ549120 ---ATGAACTTCAAGTCGGTCGTCTGTGCTGGTGGTAA----------CACA-TGTGCACGTCGAC----------CGCAAATCC--ACACACC-TGTGCACC-----TTTGACTTTGGGATCCGCTGGTTGGCTTGTCTGACTTGCAGCTGGTTGACTTGTGTGTCGGCCTGGGTCTC--AGGGTATTTTTACACACTCT-GAAT-----GTAATGGAATGTCC-CT-GTGC---ATAACACGCA-----TAATAACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCACCGATGAAGAACGCAGCGAA-ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTACACCCGTTTGAGTGTCATTGTAATCTCACTCTGACAGCTTTT--GTTGT---C-AGATGTGGACTTGGACCCT-GTCGTATAACCA-----TGACTGGTCTCAAATGCATGAGTGCACCCTGCTTTTGCAGC-GTT-GTCAGTGTGATAA-GCATCTTCACTGATACAAGCTCCCTCTGGGACACGTCTGCATATGGTGGGCTCTGTGCTTCCAA----CTGTCTGTG-------GACAACC--T-TTGACAA uncultured_sebacinaceous_ectomycorrhiza_ERF3_AY093438 GA-TTTTGAA-TCGTTAC--CATCTGTGCTGGCT------------CTCGCA-AGTGCACGTAGGTGA------CTTTCAT--CC--AACACCCTTGTGAAC-C----TTTGGCCTCTTGC----------------------TGGC--------------TTC---GGCCGGTAG-----AGGATTTAC--ACACAAACTCGAAT-----GTAATGAAAAGACCCT-GTTGT--GCGCAAGCACT-----AATGTACAACTTTCAACAACGG-ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA-ATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCTCGTTTGAGTGTCATTGTACTCTCACACTCTCCAATTCGAATTGG----GGAGCAGTGGACTTGGGTGT-TGCTGCTTCACTG---TCAGGCTCACCTCAAAAGTGTTAGTATAACTCT-TAGTTAGAC-ATAATACGGCGTGATAA-GTGTCTTCGCTG----TGCCTCGCAA-G-AGGGTG-CTAATC-GAG--AGCTCTATGCT-TCAAA---CTGTCTTC-------GGACAAT---CTCTGACAA ; END; BEGIN CODONS; CODONPOSSET * UNTITLED (CHARACTERS = Sebacina) = N: 1-650; CODONPOSSET CodonPositions (CHARACTERS = Sebacina) = N: 1-650; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M8192] TITLE Ceratobasidium; LINK TAXA = Taxa3; DIMENSIONS NCHAR=776; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cantharellales_sp._UAMH_5437_EU218893 TACTGAATGAA----?TTGGAGCT--GGTT-GT-GCTGGCATTAATT------------TGCA-----------TGTGCACGCCTCTCCT-------TCATCC---ACACA-CAC---CTGTGCACCTGTG-AGATGGGGAG--------------------CTTCGGCG----------------ACCCGTCTA------------------CTTTC----ACACAAAATCATTTTAAA----AACCTGAATGTATC--TGATGTAA--AACATCT------TAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGA-AGTCCGAGGAGCATGCCTGTTTGAGTATCATGA--AATTATCAAGA---GCATCTTTT-----------GTTCATTCAATT----GATGTG----CCTTGGATGTGGGGG--TT-----GCAGATT-CAC-GTCTGCTCCTCTTAAAT?CATTAGCTGGATCTC-TGTT---A-GCTTGGTT-CCACTCAGCGTGATAAGT--ATCATTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCAGG--AT---TTCAGAT-GAGCCGC-TTCTA-ACCGT--CCCT----CTGGGACA-TAACCC----ATTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_albasitensis_AJ427399 -----AATGAA----TATAG-AGTTGGTT--GTCGCTGGCTCCTCC------------GGGA---------GCATGTGCACGCTTTCTCT------TTCATCC-ACACACAC------CTGTGCACTTGTG-AGACGGA-----------GGACCGTA--------------------------AAAAAGTCTT------------CCGTCTATTAAA--CCACACAAACCC-CATTGTATTT-AAATTGAATGTAAT-T-GATGTAA--CGCATCATT--AGA-A-CTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT--AAATCTTTT-----------GTTAATTCAACT----GGTTT----GCTTTGGATTTGGAGGT--TTT---GCAGATTTCACAGTCTGCTCCTCTTAAATAAATTAGCTGGATCTC-AGTA--TATGCTT-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACTGT-----------------AAAAGGTG-GCCAGGAAA----TGCAGAT-GAACCGC-TTCTA-ATAGT--CCATTAA-ATTGGACAAATTACAA---ATTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_anceps_AJ427402 TATCGAATGAA----TGTGGAGTC--GGTT-GTAGCTGGTCTTTTT--AACCGG---AAGACA-----------TGTGCACGCCTTCTCT-----CT-CATCC-ACACACA-C-----CTGTGCACCTGTG-AGACGG---------------AGGACTTC-------GCGAGAGGTC-------T-TCCGTCTGCC-----------------AATA-----CATAAACTCATATCTATTTA-AACCTGAATGTAAT-TTGATGTAA--CGCATCT-----ATAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTATCAAAA--CAAGTCCTTC-----------GTTGATTCGAGGT--CGACTTTT--GTTTTGGACTTGGAGG-CTT-----GCAGATTTCAC-GTTTGCTCCTCTCAAATAAATTAGCTGGATCTC-CGTG---A-ACTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACACTC-T-------------T-AAAAAAAGTGGCCGG---GGT--CGCAGAT-GAACCGC-TTCCA-ACGGT--CTATTAG-ATTAGACAACGACAT----T--TATGAT------------------------------ Ceratobasidium_angustisporum_AJ427403 -ATTGAATGAA----TGTAGAGTT--GGTT-GTCGCTGGCC-----TTTGTTGG-------CA-----------TGTGCACGCCTTCTCT------TTCATCC---ACACA-CAC---CTGTGCACCTGTG-AGACGGAGAGAG---------CTCGCCCTTTTGCGAGGATGTTTTC-------TCTCCGTCTG-----------------CCATTA-----CACAAACTCAT-TGTAT-TT-AATTTGAATGTCAT--TGATGTAA--CGCATCT-----ATAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCACCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTATCAAAA--CAAACCTTTT-----------GTTAATTCGATT---GGTTTTTG--GTTTTGGACTGGAAGGTCTTTTTTTGCGGATT-CAC-GTCTGCTCCTCCTAAAAATATTAGCTGGATCTC-AGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCATTCGCTGAGG-ACACCC-G-------------TAAAAAAGGTG-GCCGGG--AA---CGCAGAT-GAACCGC-TTCCA-ATAGTGTCCATTGA-ATTGGACAA--CACA----CTTTATGAT------------------------------ Ceratobasidium_bicorne_AF200514 AAGAAAATGAA----TCTAG-AGTCGGTT--GTCGCTGGCCCTCC-------------GGG-----------CATGTGCACGCCTTCTCTTTTTCATCCACAC-ACACACACACACACCTGTGCATTTGTG-AGACGGG-----------AGGGTCTATTTT-------------------ATTATGGACCTTT------------TCGTCTATTAAAACCCACACAAACTC--ATTTATTTT-GAACCGAATGTAAT-T-GATGTAG--CACATCATT--TGA-A-CTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCCCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGC--AAGCCTTTT-----------GTTAATTCAATC----GGTCTTCTTGCTTTGGACTTGGAGGC-TT-----GCAGATTTCACACTCTGCTCCTCTTAAATTCATTAGCTGGATCTC-GGTA--TATGCTC-GGTTCCACTCGGCGTGATAAGTAAATCACTCGTCGAGG-ACACTGTT---------------AAAAAGGTG-GCCGGGAAA----TGCAGAC-GAACCGC-TTCCA-ATGGT--CTATTGA-ATTAGACAA-TAC------TCTTAAGATCTCTGATCTC-AAATCAGGCAGGACTACCC Ceratobasidium_cereale_AJ302009 --ATGAATGAA----TGTAGAGTC--GGTT-GTAGCTGGGTCTTTT--AATCG----AGGCCA-----------TGTGCACGCCTTCTCT-----TT-CATCC-ACACACA-C-----CTGTGCACCTGTTTAGACGGTCGAAGGAA-----AAAGTCTTTCTCGCGAGAGAGAGGCT-------GGCTCCTTTTCC-------------GTCCAATA-----CATAAAATCTTATATATCT--AATCAGAATGTAAT-C-GATGTAAA-CGCATCT-----ATAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCACGCCTGTTTGAGTATCATGA--AATTCTCAAAG--CAAGTCTTTT-----------GTTAATTCAA--C--TGGCTTTT--GTTTTGGATTTGGAGGTCTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATGCATTAGCTGGATCTC-TATA---A-AACCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACACTC-T-------------TGCAAAAGGGTGGCCGG---ATT--CATGGAT-GAACCGC-TTCTA-ACGGT--CTATTAG-ATTAGACAAACACAC----T-TTATGAT------------------------------ Ceratobasidium_cornigerum_AJ301902 --TTGAATTTA---ATGTAGAGTTG-GTT--GTAGCTGGCTTTT---------CTGT-GGGG---------GCGGGTGCACACCTTCTCT------TTCAT-CCACACACACC------TGTGAACCTGTG-AGACAG-------------AGGAC-----------GTAAAA---------AAGTC-----TT------------CTGTCTACTTAAT-TCATATAAAATC-AATTTAATTT-AAAACGAATGTAAT--GGATGTAA--CGCATC-----TAA-TACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAGT--AAATCTTTT-----------GTTAATTCAATT----GGTTTC--TACTTTGGTATTGGAGGT-TATT---GCAGCTTCA--CACCTGCTCCTCTTTG-TGCATTAGCTGGATCTC-AGTG-TTATGCTT-GGTTCCACTCAGCGTGATAAGTT-ATCTATCGCT-AGG-AC---ACT-------------GTAAAAGG-TG-GCCAAGGTAAA--TGCAGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAA-GATTAAAT-TTTTATGAT------------------------------ Ceratobasidium_papillatum_AJ427401 -ATTGAATGAA----TGTAGAGT--CGGTT-GTAGCTGGTCTTCC-----------AAAGACA-----------TGTGCACGCC-TTCTC-----TTTCATCC-ACACAC---CC---CTGTGCACTTGTT-AGACGGATGA---TTGTT----TCCCTTTTATTACGGGACGG-----------TTTCCGTCTG------------------CTAAC----ACATAAAA-CCATATTAATTAAAT-CTGAATGTAAT-T-GATGTAA--CGCATCT------AATACAAAGTTTCAACAACGGATCTT-TGGGTTTTCGCATCGATAAAAAACGCAGCAAAATGCA-ATAAGTAATGTAAATGGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGC-AAG-TCTTTT-----------GTTAATTCAA-TC---GGCTTTG--T-TTTGGACTTGGGGGTTT------GCAGATCCACGTC--TGCTCCTCTTAAATGCATTAGCTGGAT-CTCCATG---A-ACTTGGTT-CCACTCGGCGTGATAAGT--ATCATTCGCTGAGG-ACACCT-G-------------TAAAAA-GGTG-GCC-AGGGTTG----AGGAT-GAGCCGC-TTCTAA-CGGT--CCATTTA-ATTGGACAGTTAA------ATTTATGAT------------------------------ Ceratobasidium_ramicola_AJ427404 -ATTGAATGAA----CTTAGAGTCG-GTT--GTCGCTGGCTGTTCTTT-----------GCA---------GCATGTGCACGCCTTCTCT------TTTCATCCACACACACCC----CTGTGCACTTGTG-AGACTGGAGA------CCG----------------------TA-------AA-AAGT--------------CTTCAGTCTGCTAAAT-TCATATACAAACTCATTTAATT--GAACTGAATGTAC--TTGATGTAA--CGCATCAT---TAA--ACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGC--ATACCTTTT-----------GTTAATTCGACT----GGCCTT---GCTTTGGATTTGGAGGT-CTTT---GCAGATGTCACAGTCTGCTCCTCTTAAATAAATTAGCTGGATCTC-AGTA-T-ACACTT-GGTTCCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-AC---ACTG------------T-AAA-AGGTG-GCCAGG--CAA--TGCAGAT-GAACCGC-TTCTA-ATAGT--CCATTCA-CTTGGACAATT-----AC-ATTTATGAT------------------------------ 'Ceratobasidium sp. AG-A EU152858' TATTGAATGAA----CTTAGAGTCG-GTT--GACGCTGGCTGTCTTTT-----------GCA---------GCATGTGCACGCCTTCTCT------TTTGATCCACACACACCC----CAGTGCACTTGTG-AGACTGGAGG------CCG----------------------TA-------AAGAAGC--------------CTTCAGTCTGCTAAAT-TCATATACAAAGTCATTTAATT--GAACTGAATGTAC--TTGATGTAA--CGCATCAT---TGA--ACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT--AAACCTTTT-----------GTTAATTCAACT----GGTCTT---GCTTTGGACTTGGAGGT-CTTT---GCAGATGTCACAGTCTGCTCCTCTTAAATAAATTAGCTGGATCTC-AGTA-T-ACACTT-GGTTCCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-AC---ACTG------------T-AAATAGGTG-GCCAGG--CAA--TACAGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATT-----AC-ATTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC 'Ceratobasidium sp. AG-B(o) DQ279057' ---------AA----CTTGGGGTTG-GTT--GTCGCTGGCTGTCTTTG-----------GCA---------GCATGTGCACGCCTTCTCC------TTTCATCCACACAC--CC----CTGTGCACCTGTG-AGACTGGAGG------CCGAATTTCCT--------TTTAACTAG------GGAAAGAGAGAGAGGT---CGCCTCCGTCTA-TAAAT-TCATATACAAACTCATTTAATT--GAACTGAATGTAC--TTGATGTAA--CGCATCAT---TAA--ACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT--AAACCTTTT-----------GTTAATTCAATT----GGCCTT---GCTTTGGATTTGGAGGT-GTT-------AATTCAATTGGCCTTGCTTTGGATTTGGAGGTGCTGGATCTC-AGTA-T-ACACTT-GGTTCCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-AC---ACTG------------T--AAAAGGTG-GCCAGG--CAA--TGCAGAT-GAACCGC-TTCTA-ATAGT--CCATTCA-CTTGGACAATT-----AC-ATTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC 'Ceratobasidium sp. AG-Ba DQ279059' ---------AA----TGTAGAGTTTGGGTT-GTAGCTGACCTCTC-----------AGAGGTA-----------TGTGCACACCCTTCTC-----TTTCATCC-ACACAC--CCC---CTGTGCACTTGTG-AGACAGAGG---CCTTTTAGTCTTTCTCGCGAGAGAGAGGCTGG--------CTCCTTTTCCG------------------TCATC----ACATAAAATCTAATTTAATTAAAT-CTGAATGTAAT-TTGATGTAA--CGCATCT------AATACAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGC-AA-GTCTTTT--------GTTGTTAATTCAACTTAAAGTCTGCG--C-TTTGGATTTGGAGGTTTT-----GCAGATTTAAATTTCTGCTCCTCTTAAATGCATTAGCTGGAT-CTCCATG---A-ACTTGGTT-CCACTCGGCGTGATAAGTT-ATCACTCGCTGAGG-ACACCC-G-------------TAAAAAAGGTG-GCC-AGGCCCT----AGGAT-GAGCCGC-TTCTAA-TAGT--CCATTAG-CTTGGACAAATTAA-----ATTTCTGATCT--GATCTC-AAATCAGGTAGGACTACCC 'Ceratobasidium sp. AG-Bb DQ279058' ---------AA----TGTAGAGTC--GGTT-GTAGCTGGCCTTTCCT---CCCAGGGAGGGCA-----------TGTGCACACC-TTCTC-----TTTCATCC-ACACACACCCC---CTGTGCACTTGTG-AGACGGAGGAGGCATTTT--TTTTCCTTTAACTAGGAATCAAG---------GTTTCTGTCTA------------------TCGTC----ACATAAAATCTAATTTATTTAAAAACTGAATGTAAA-TGGATGTAA--CACATCTT----AAATACAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTATCAAAGC-AAAGTCTTTTTTTTTGTTGTTGTTAATTCAACTTAAAGTCTGCG--C-TTTGGATTTGGAGGTTTT-----GCAGATTTAAATTTCTGCTCCTCTTAAATGCATTAGCTGGAT-CTCTATG---A-ACTTGGTT-CCACTCGGCGTGATAAGTT-ATCACTCGTCGAGG-ACACCC-G-------------TAAAAAAGGTG-GCC-AGGATTTTTCAAGGAT-GAGCCGC-TTCTAAATAGT--CCATTGA-CTTGGACAAA---------ATTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC 'Ceratobasidium sp. AG-C DQ279046' ---------AA----TGTAG-AGTTGGTT--GTCGCTG-CCCTCTT------------GGG-----------CATGTGCACGCCTTCTCT------TTCATCC-ACACACAC------CTGTGCACTTGTG-AGACGGA-----------GGGCTTT---------------------------AATTAGTCTT------------CCGTCTACTTAA--TCACACAAACTC--ATTT-AATT-AAATTGAATGTAAT-T-GATGTAA--CGCATCATT--AGA-A-CTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT--AAATCTTTT-----------GTTAATTCAACT----GGTTT----GCTTTGGACTTGGAGGT-CTTT---GCAGATTTCAC-CTCTGCTCCTCTTAAATTCATTAGCTAGATCTC-AGTA--TATGCTT-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACCTT-----------------AAAAAGTG-GCCAAGAAA----TACAGAT-GAACCGC-TTCTA-ATAGT--CTATTAA-GTTAGACAATTAA-------TTTAAGATCT--GATCTC-AAATCAGGTAGGACTACCC 'Ceratobasidium sp. AG-D DQ279060' ---------AA----TGTAGAGTC--GGTT-GTAGCTGGGTCTTTT--AATCG----AGGCCA-----------TGTGCACACCTTCTCT-----TT-CATCC-ACTCACA-C-----CTGTGCACCTGTTTAGACGGTGGAAGGAA-----AAAGTCTTTCTCGCGAGAGAGAGGCC-------GGCTCCTTTTCCC------------GTCCAATA-----CATAAAATCTTATATATTT--AATCAGAATGTAAT-C-GATGTAAA-CGCATCT-----ATAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCACGCCTGTTTGAGTATCATGA--AATTCTCAAAG--CAAGTCTTTT-----------GTTTATTCAA--T--TGG-TTTC--ATTTTGGACTTGGAGGTCT------GCAGATT-CAC-GTCTGCTCCTCTTAAATTCATTAGCTGGATCTC-TATA---A-AACCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACGCTC-T-------------TGAAAAAGGGTGGCCGG---ATT--CATGGAT-GAACCGC-TTCTA-ACGGT--CTATTAG-ATTAGACAAACACAC----T-TTATGATCT--GATCTC-AAATCAGGTGGGACTACCC 'Ceratobasidium sp. AG-E DQ279013' ----------A---ATGTAGAGTTG-GTT--GTAGCTGGCCCTTGGATTAATTTCTT-GGGG---------GCATGTGCACACCTTCTCT------TTCATCCCACACACACC------TGTGAACCTGTG-AGATAGTAG-------TTGGGGAC-----------TTTAAT---------GGACCCAC--TT------------CTGTCTACTTAAT-TCATATAAAATC-AATTTAATTT-AAAACGAATGTAAT--GGATGTAA--CGCATC-----TAA-TACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAGT--AAATCTTTTT----------GTTAACTCAATT----GGTTTC--TACTTTGGTATTGGAGGT-CTTT---GCAGCTTCA--CACCTGCTCCTCTTTG-TTCATTAGCTGGATCTC-AGTG-TTATGCTT-GGTTCCACTCAGCGTGATAAGTT-ATCTATCGCTGAGG-AC---ACT-------------GTAAAAGG-TG-GCCAAGGTAAA--TGCAGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATTAAT-TTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC 'Ceratobasidium sp. AG-F DQ279014' TAGAGATTTGG---TTGTAGCTGGC-CCT--TCAA-------TTTAACTG-TTGTT--GGGC---------ATGTGCACAC-CTTTCTCT------TTCATCC-ACACACACC------TGTGCACTTGTG-AGACAGCT---------TGGAGGA-----------CTTTATT--------GGACTCCT---T------------CTGTCTACTTAAT-CCACACAAACTC-AATTTATTTT-AAACTGAATGTATTTT-GATGTAA--CGCATC-----TAA-TACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAGTTAAAATCTTTT-----------GTTAATTCAATT----GGTTT---TGCTTTGGTATTGGAGGTCTATT---GCAGCTTCA--CACCTGCTCCTCTTTG-TTCATTAGCTGGATCTC-AGTG-TTATGCTT-AGTTCCACTCGGCGTGATAAGTT-ATCTATCGCTGAGG-AC---ACT-------------GTAAAAAG-TG-GCCAAGGTAAA--TGCAGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAA--T----AC-TTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC 'Ceratobasidium sp. AG-G DQ102402' TATTGAATGAA----TGTAG-AGTTGGTT--GTCGCTGGCCCTTTC------------GGGG---------GTATGTGCACGCCTTCTCT------TTCATCC-ACACACAC------CTGTGCACTTGTG-AGACGGA-----------GGGCTTT---------------------------AATTAGTCTT------------CCGTCTATTCAA--CCACACAAACTC--ATTGTATTT-AAACTGAATGTAAT-T-GATGTAA--CGCATCATT--AGA-A-CTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT--AAATCTTTT-----------GTTAATTCAACT----GGTTTT---GCTTTGGACTTGGAGGT-CTTT---GCAGATTTCAC-GTCTGCTCCTCTTAAATGCATTAGCTGGATCTC-AGTA--TATGCTT-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACTGT-----------------AAAAGGTG-GCCAGGAAA----TACAGAT-GAACCGC-TTCTA-ATAGT--CTATTAA-GTTAGACAATTAA------TTTTAAGATCT--GATCTC-AAATCAGGTAGGACTACCC 'Ceratobasidium sp. AG-H DQ279065' ---------AG----CATGGAGTT--GGTT-GT--CCTGCCCCTTC---ACTGG-----GGCA-----------TGTGCACGCCTTCTCT-----ATTCATCC---ACACA-CAC---CTGTGAACTTGTG-AGACGGATAGTAGTCCTGGCATGTGCTCGCTTCCGACAATCTTATC-------CATACACCTGTGCACACTGTGAGGGCACCTATA-----CATAAACTCCAGTA-AA-TA-AATTTGAATGTCAT-TTGATGTAA--CGCATCT-----ATAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAA--TAAATCTTTT-----------GTTCATTCGATC----GATTTT---ATTTTGGACTTGGAGG-TCT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTCATTAGCTGGATCTC-TATA---A-ACTTGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCAGG--AT---TGTGGAA-GAACTGC-TTCCA-ATATT--CCATTCA-CTTGGACAATATAC-------TTATGATCT--GATCTC-AAATCAGGTAG-ACTACCC 'Ceratobasidium sp. AG-I DQ102444' TATTGAATGAA----CATGGAGTTT-GGTT-GTTGCTGGCCCCTTT---ATTGG-----GGCA-----------TGTGCACACCTCCTCT-----ATTCATCC---ACACA-CAC---CTGTGAACTTGTG-AGACGGATAGTAG--------------CCCTCTCGGGGGCGAGGTC-------CGT----CTG------------------CTATA-----CATAAACTCCAGTA-TA-TA-AATTTGAATGTCAT-TTGATGTAA--CACATCT-----ATAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCCTCAAAA--TAAATCTTTT-----------GTTCATTCGATC----GATTTT---ATTTTGGACTTGGAGG-TCT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTCATTAGCTGGATCTG-TATG---A-ACTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TATT-AT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAAACTAC-------TTATGATCT--GATCTC-AA-TCAGGTAGGACTACCC 'Ceratobasidium sp. AG-K DQ279056' ---------AA----CTTGGAGTCG-GTT--GTCGCTGGCTGTCTTATTT--------GGCA---------GCATGTGCACGCCTTCTCT------TTTCATCCACACACACCC----CTGTGCACTTGTG-AGACTGGAGA------CCGG---------------------TAT------AAAAAGC--------------TTTCAGTCTGCTAAAT-CCATATATAAACCCATTTAATT--GAACTGAATGTAAA-TTGATGTAA--CGCATCTT---TAA--ACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT--AAACCTTTT-----------GTTAATTCAACT----GGTCTTT--GCTTTGGATTTGGAGGC-CTTT---GCAGATGTCACAGTCTGCTCCTCTTAAATAAATTAGCTGGATCTC-AGTA-T-ACACTT-GGTTCCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-AC---ACTG------------TTAAAAAGGTG-GCCAGG--CAA--TGCAGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAAATT--AAAA-ATTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC 'Ceratobasidium sp. AG-L AF354093' -----------------------TTGGTT--GTCGCTGGCCCTCTT------------GGG-----------CATGTGCACGCCTTCTCT------TTCATCC-ACACACAC------CTGTGCACTTGTG-AGACGGA-----------GGGCTTT---------------------------AATTAGTCTT------------CCGTCTACTTAA--TCACACAAACTC--ATTT-AATT-AAATTGAATGTAAT-T-GATGTAA--CGCATCATT--AGA-A-CTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT--AAATCTTTT-----------GTTAATTCAACT----GGTTT----GCTTTGGACTTGGAGGT-CTTT---GCAGATTTCAC-GTCTGCTCCTCTTAAATGCATTAGCTGGATCTC-AGTA--TATGCTT-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACCTT-----------------AAAAAGTG-GCCAAGAAA----TACAGAT-GAACCGC-TTCTA-ATAGT--CTATTAA-GTTAGACAATTAA-------TTTAAGATCT--GATCTC-AAATCAGGTAGGACTACCC 'Ceratobasidium sp. AG-O DQ279045' ----------A----TGTAG-A-TTGGTT--GTCGCTGGCC-TTTC------------GGGG---------GCATGTGCACGCCTTCTCT------TTCATCC-ACACACAC------CTGTGCACTTGTG-AGACGGA-----------GGGACTTT--------------------------AATTAGTCTT------------CCGTCTACTTAA--TTACACAAACTC--ATTT-AATT-AAATTGAATGTAAT-T-GATGTAA--CGCATCATT--AGA-A-CTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT--AAATCTTTT-----------GTTAATTCAACT----GGTTTT---ACTTTGGACTTGGAGGT-CTTT---GCAGATTTCAC-GTCTGCTCCTCTTAAATGCATTAGCTGGATCTC-AGTA--TATGCTT-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACTGT-----------------AAAAAGTG-GCCAGGAAA----TGCAGAT-GAACCGC-TTCTA-ACAGT--CTATTAA-GTTAGACAATTAA-------TTTAAGATCT--GATCTC-AAATCAGGTAGGACTACCC 'Ceratobasidium sp. AG-P DQ279015' TGAGGAGTTGG---TTGTAGCTGTT-GCC--TTGGGATTTTTTTTAATTAATTATTCCGGAC---------AAATGTGCACGCCTTCTCT------TTCATCC-ACACACACC------TGTGCACTTGTG-AGGCAGATGG------CTGGAGTT-----------CTTTATTAATTTATTGAACTCCTAACT------------CTGTCTACTTAAT-TTACACACACTC-TATTTAATTT-AAACTGAATGTAATT--GATGTAA--CGCATC-----TAA-TACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAGT--AAACCTTTT-----------GTTAATTCAATT----GGTTTC--TACTTTGGTATTGGAGGT-TATT---GCAGCTTCA--CACCTGCTCCTCTTTG-TGCATTAGCTGGATCTC-AGTG-TTATGCTT-GGTTCCACTCAGCGTGATAAGT--ATCTATCGCTGAGG-AC---ACT-------------GTAAAAAGGTG-GCCAAGGTAAA--TGCAGAT-GAACCGC-TTCCA-ACAGT--CCATTGA-CTTGGACAA--ATTAAAT-TTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC 'Ceratobasidium sp. AG-Q DQ279061' ---------AA----TGTAGAGTT--GGTT-GTAGCTGG-CCTTTT--AATCG----AGGC-A-----------TGTGCACGCCTTCTCT-----TTTCATCC-ACACACA-CAC---CTGTGCACCTGTT-GGACGG--GCTGGGA-----AAAGCTCTCC------GGGGGGGTAC-------GGTCCGTCTATC-----------------GCTA-----CATAAACTCTTATATATTTTTAATCAGAATGTAAT-C-GATGTAAAACGCATCT-----ATAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCACGCCTGTTTGAGTATCATGA--AATTCTCAAAG--CAAGTCTTTT-----------GTTAATTCAA--C--TGGCTTTT--GCTTTGGATTTGGAGGTCTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATGCATTAGCTGGATCTC-TTTA---A-ACTTGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACACCC-T-------------TTAAAAAAGGTGGCCAGGGAATT--TATAGAT-GAACCGC-TTCTA-ATAGT--CTATTGA-ATTAGACAAACATAC----TATTATGATCT--GATCTC-AAATCAGGTGGGACTACCC Ceratobasidium_sp._AL1_Cer TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTTTAACCGG--GGGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGAA-----------CCCCTCTCCGGGGGGGAAAGA-------GGTCCGTCTG------------------CTATAT---ACATAAACTCCTGAATAA-TA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCAAAT---TGATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAGGT--ATCACTCGCCGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._AL10_Cer TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTTTAACCGGAGGGGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGAA-----------CCCCTCTCCGGGGGGGAAAGA-------GGTCCGTCTG------------------CTATAT---ACATAAACTCCTGAATAA-TA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGC-----------ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCGATTT--CGATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GATG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCCGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._AL11_Cer TATTGAATGAA----TTTAGGAGTTGGTTT-GATGCTGGCCG-ACAACC-----CCAAGGGC----------ATTGTGCACGCCTTCTCC-----TT-CATCC-ACACACAC------CTGTGCACTTGTG-AGACGC------------GAGGATT----------------------------AATTTTCCT------------CCGTCTACTAAT---CACACAAACTC-A-TTGTAATT-GAACTGAATGTAAT-T-GATGTAA--CACATCATT--TGA-A-CTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCATCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGAGCAAATCTCAAAGT--CAATTCCTT-------------------AATT----GGTTTT---GCTTTGGACTTGGAGGT--CTT---GCAGATTTCACAGTCTGCTCCTCTTAAATGCATTAGCTGGATCTC-AGTAATTATGCTT-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACTGTT---------------AAAAAGGTG-GCCAGGAAAA---TACTGATTGAACCGC-TTCTA-ACGGT--CTATTAA-GTTAGACAATTGACCC------TTAAGTTT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._AL3_Cer_1 TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTT-AACCGG---GGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGA-------------CCCTCTCCGGGGGGGAAAG---------GTCCGTCTG------------------CTATA-----CATAAACTCCTGAATAAATA-AATCAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCGATT----GATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._AL3_Cer_2 TATTGAATTAAA---TCTAG-GGTTGGCA--GTTGCTGGCCCCCCCTCCATTCATTTGGGGGGTTGGGGCAATATGTGCACGCCTTCTCTATTTTTTTCACCC-ACACACAC------CTGTGCACTTGTG-AGATGGG-----------AGGGGC-------------------------------AACCCTT------------CCATCTATTAA------CACAAACTC--ATATATTTT-AAACTGAATGTAAT-T-GATGTAA--CGCATCATT--TGA-A-CTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGTGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTATCAAAGA--AAGTCTTTT-----------GTTAACTCAATC----GACT------CTTTGGACTTGGAGGT-CTCT---GCAGATTTAACCTTCTGCTCCTCTTAAATGCATTAGCTGGATCTC-AGTA--CATGCTC-GGTTCCACTCGGCGTGATAAGTA--TCACTCGGTGAGG-ACACTTCTTTTTTGTTTT-ACAAAAAAAGGTG-GCCGGGAAA----TACAGAT-GAACCGC-TTCTA-ACAGT--CTATTAA-ATTAGACAAATAA------TTTTAAGATCT--GATCTC-AAACCAGGTAGGACTACCC Ceratobasidium_sp._AL4_Cer_1 TATCGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCTGC------------AAAGGCAT----------CGTGCACGCC-TTCTC-----TTTCATCC-ACACAC--CCC----TGTGCACTTGTG-AGACGGAGG---CTTATTTC--TCCCTTAAC------GGGAGAT------TGGTTTCCGTCTG------------------CTACT----ACACAAACTC-ATATATTTTTAAT-CTGAATGTAAT-C-GATGTAA--CACATCT-----ATATACAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT-AAA-T-CTTT----------TGTTAATTCAATG----GACTTTG--CTT-TGGACTTGGAGGTCT------GCAGAT-TCACAGTCTGCTCCTCTTAAATGCATTAGCTGGAT-CCCAGTG---A-GCTTGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACACCC-G-------------TAAAAAAGGTG-GCC-AGGATTG----CAGGT-GAACCGC-TTCTAA-TGGT--CTATTGG-TTTAGACAATAAAT------TTAACGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._AL4_Cer_2 TATCGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCTGC------------AAAGGCAT----------CGTGCACGCC-TTCTC-----TTTCATCC-ACACAC--CCC----TGTGCACTTGTG-AGACGGAGG---CTTATTTC--TCCCTTAAC------GGGAGAT------TGGTTTCCGTCTG------------------CTACT----ACACAAACTC-ATATATTTCTAAT-CTGAATGTAAT-C-GATGTAA--CACATCT-----ATATACAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT-AAAAT-CTTT----------TGTTAATTCAATG----GACTTTG--CTT-TGGACTTGGAGGTCT------GCAGAT-TCACAGTCTGCTCCTCTTAAATGCATTAGCTGGAT-CCCAGTG---A-GCTTGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACGCCC-G-------------TAAAAAAGGTG-GCC-AGGATTG----CAGGT-GAACCGC-TTCTAA-TGGT--CTATTGG-TTTAGACAATAAAT------TTAACGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._AL5_Cer_1 TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTTTAACCGG--GGGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGAA-----------CCCCTCTCCGGGGGGGAAAGA-------GGTCCGTCTG------------------CTATAT---ACATAAACTCCTGAATAA-TA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCAAAT---CGATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCCGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._AL5_Cer_2 TATTGAATGAA----TTTAGGAGTTGGTTT-GATGCTGGCCG-ACAACC-----CCAAGGGC----------ATTGTGCACGCCTTCTCC-----TT-CATCC-ACACACAC------CCGTGCACTTGTG-AGACGCC-----------GAGGATT----------------------------AATTTTCCT------------CCGTCTACTAAT---CACACAAACTC-A-TTGTAATT-GAACTGAATGTAAT-T-GATGTAA--CACATCATT--TGA-A-CTAAGTTCCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCATCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGAGCAAATCTCAAAGT--CAATTCCTT-------------------AATT----GGTTTT---GCTTTGGACTTGGAGGT-TCTT---GCAGATTTCACAGTCTGCTCCTCTTAAATGCATTAGCTGGATCTC-AGTAATTATGCTT-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACTGTT---------------AAAAAGGTG-GCCAGGAAAA---TACTGATTGAACCGC-TTCTA-ACGGT--CTATTAA-GTTAGACAATTGACCC------TTAAGTTT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._AL8_Cer TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTT-AACCGG---GGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGA-------------CCCTCTCCGGGGGGGAAAG---------GTCCGTCTG------------------CTATA-----CATAAACTCCTGAATAAATA-AATTAGAATGTAAT--CGATGTAA--CGCATCC-----TTAAATTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAAA-TAAATCTTTT-----------GTTCACTCGATT----GATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._AL8_isolated_Cer TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTT-AACCGG---GGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGA-------------CCCTCTCCGGGGGGGAAAG---------GTCCGTCTG------------------CTATA-----CATAAACTCCTGAATAAATA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCGATT----GATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAGGT--ATCACTCGCCGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._AL9_Cer_1 TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTTTAACCGG-GGGGG-CA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGAA-----------CCCCTCTCCGGGGGGGAAAGA-------GGTCCGTCTG------------------CTATAT---ACATAAACTCCTGAATAA-TA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCAAAT---CGATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCCGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTATATAGT--CCATTGA-CTTGGAC--------------------------------------------------- Ceratobasidium_sp._AL9_Cer2 TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTTTAACCGG-GGGGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGAA-----------CCCCTCTCCGGGGGGGAAAGA-------GGTCCGTCTG------------------CTATAT---ACATAAACTCCTGAATAA-TA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCAAAT---CGATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCCGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACGATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._BRAL9_Cer_1 TATCGAACGAA----TGTGGAGTCC-GGTT-GTAGCTGGCCTGC------------AAAGGCA-----------TGTGCACGCC-GACTC-----TTTCATCC-ACACAC--CCC----TGTGCACTCGTG-AGACGGAGG---CTTATTTCCTTCCCTTTCGTTTAGGGAGGGAT------CGGTTTCCGTCTG------------------CCGTT----ATACAAACTC-AATTGATT-TAAT-CGGAATGTAAT-T-GATGCAA--CGCATCTAATAGATATACAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTATCAAAGC-AAACT-ATTT----------TGTTAATTCAACT----GCCTTTG--CTT-TGGACTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Ceratobasidium_sp._BRAL9_Cer_2 TATCGAACGAA----TGTGGAGTCC-GGTT-GTAGCTGGCCTGC------------AAAGGCA-----------TGTGCACGCC-GACTC-----TTTCATCC-ACACAC--CCC----TGTGCACTCGTG-AGACGGAGG---CTTATTTCCTTCCCTTTCGTTTAGGGAGGGAT------CGGTTTCCGTCTG------------------CCGTT----ATACAAACTC-AATTGATT-TAAT-CGGAATGTAAT-T-GATGCAA--CGCATCTAATAGATATACAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATTAGTTATGTGAATTGCAGAATTCAGTGGATCATC-GAATCTTTGGACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTATCAAAGC-AAACTTATTT----------TGTTAACTCAACT----GCCTTTG--CTT-TGGACTTGGGGGCCT------GCAGATTTCACAGTCTGCTCCTCTTAAACGCATTAGCTGGATTCTCGGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACACCCGT-------------TAAAAAAGGTG-GCC-AGGCTCG----CGGAT-GAACCGC-TTCCAA-CGGT--CCATTGA-CTTGGACGACGAAT-----TT--AAGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._CAAL8_Cer TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTT-AACCGG---GGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGA-------------CCCTCTCCGGGGGGGAAAG---------GTCCGTCTG------------------CTATA-----CATAAACTCCTGAATAAATA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCGATT----GATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._FPUB_168_EF536969 ----------A----TGTAG-AGTTGGTT--GTCGCTGGCCCTTTC------------GGGG---------GTATGTGCACGCCTTCTCT------TTCATCC-ACACACAC------CTGTGCACTTGTG-AGACGGA-----------GGGCTTT---------------------------AATTAGTCTT------------CCGTCTATTCAA--CCACACAAACTC--ATTGTATTT-AAACTGAATGTAAT-T-GATGTAA--CGCATCATT--AGA-A-CTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT--AAATCTTTT-----------GTTAATTCAACT----GGTTTT---GCTTTGGACTTGGAGGT-CTTT---GCAGATTTCAC-GTCTGCTCCTCTTAAATGCATTAGCTGGATCTC-AGTA--TATGCTT-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACTGT-----------------AAAAGGTG-GCCAGGAAA----TACAGAT-GAACCGC-TTCTA-ATAGT--CTATTAA-GTTAGACAATTAA------TTTTAAGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._JTO048_AF472285 -----------------------TG-GTT--GTAGCTGGCCTCCT-------TG--T--GGG---------GCATGTGCACACCTTCTCT------TTCATCC-ACACACACC------TGTGAACTTGTG-AGACAG-------GGAAAGGGGGC-----------CTTAATTG-------GCTTTTATTTTTCC----------CTGTCTACTTAAT-TTACACAAACTC-ATTT-ATTTT-AAACTGAATGTAA--TTGATGTAA--CGCATCATT--TAAT-ACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCATCTTGCGCTCCTTGGC-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT-AAA--TCTTTT----------GTTAATTCAATT----GACTTT---ACTTTGGACTTGGAGGT-CTTT---GCGGATTAA--TATCTGCTCCTCTTAAATTTATTAGCTGGATCTC-AGTA-T-ATGCTT-GGTTCCACTCGGCGTGATAAGTT-ATCACTCGCTGAGG-AC---ACC-------------GTAA-AAGGTG-GCCAGG--AAA--TACAGAT-GAACCGC-TTCTA-ATAGT--CTATTAA-ATTAGACAA-----TTA----------------------------------------- Ceratobasidium_sp._JTO116_AF472299 ----------------------TC--GGTT-GTAGCTGGCCTCCTC----------G-AGGCA-----------TGTGCACACC-TTCTC-----TTTCATCC-ACACAC---CC---CTGTGCACTTGTG-AGACGGAGG-----TTTT----GTCCTTTAAATAGGATGGG------------CCTCCGTCTG------------------CTATC----ACATAAAATCCAATTAATTTAAAA-TTGAATGTAAT-C-GATGTAA--CACATCT------AATACAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGC-AA-GTCTTTT-----------GTTAATTCAATC----GGCTCTG--C-TTTGGACTTGGGGGTCT------GCAGATTCACGT--CTGCTCCTCTTAAATGCATTAGCTGGAT-CTCC-TG---A-ACTTGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCCGAGG-ACACCC-G-------------TAAAAA-GGTG-GCC-AGGATTG----AGGAT-GAGCCGC-TTCTAA-TGGT--CCATTAG-CTTGGACAATTA---------------------------------------------- Ceratobasidium_sp._JTO124_AF472301 -----------------------T--GGTT-GTAGCTGGCCTCCCT----------G-AGGCA-----------TGTGCACGCC-TTCTC-----CTTCATCC-ACACAC---CC---CTGTGCACCTGTG-AGACGGAGG-----CGTT----TTCCTTTAATCGGGATGG-------------TCTCCGTCTA------------------CTATC----ACATAAAATCTAATTTATTTAAAA-CTGAATGTAAT-C-GATGTAA--CGCATCT------AATACAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGC-AA-GTCTTTT-----------GTTAATTCAATC----GGCTTTG--C-TTTGGACTTGGGGGTTT------GCAGATTCACGT--CTGCTCCTCTTAAATGCATTAGCTGGAT-CTCCATG---A-ACTTGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACACCC-G-------------TAAAAA-GGTG-GCC-AGGCTTA----AGGAT-GAGCCGC-TTCTAA-TAGT--CCATTAG-CTTGGACAATTT---------------------------------------------- Ceratobasidium_sp._JTO162_AF472302 -----------------------CT-GGTT-GTAGCTGGCCTTC------------ATTGGCA-----------TGTGCACGCCCGTCTC-----TTTCATCC-ACACAC--CCC---ATGTGCACTTGTG-AGACGGAGA---CTTGCTTC------------------------------GGGTCTCTGTCTG------------------TCATT----ACACAAACTC-ATATTAGTTTAAT-CAGAATGTCAT-T-GATGTAAA-CGCATCT-----ATATACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAGAGT-AGATC--TTT----------TGTTCATTCAATT----GACTCTG--CTTCTGGACTTGGAGGCCT------GCAGAT-GCA-AGTCTGCTCCTCTTAAATGCATTAGCTGGAT-CTCAGTC---A-GCCTGGTT-CCACTCGGCGTGATAAGT--ATCATTCGCTGAGG-ACACCC---------------TCCAAAGGGTG-GCCCAGGAGTA----CAGAT-GAACCGC-TTCTAA-TAGT--CTATTCG-GTTAGACAAGCA---------------------------------------------- Ceratobasidium_sp._JTO163_AF472303 -----------------------CT-GGTT-GTTGCTGGCCTTC------------ATTGGCA-----------TGTGCACGCCTTTCTC-----TTTCATCC-ACACAC--CCC---ATGTGCACTTGTG-AGACGGAGA---CTTGTTTC------------------------------GGGTCTCTGTCTG------------------TCATT----ACACAAACTC-ATATCAATTTAAT-TGGAATGTCAT-T-GATGTAAA-CGCATCT-----ATATACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTCGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAGAGT-AGATC--TTT----------TGTTCGTTCAATG----GACTCTG--CTTCTGGACTTGGGGGTCT------GCAGAT-GCA-AGTCTGCTCCTCTTAAATGCATTAGCTGGAT-CTCAGTG---A-GCCTGGTT-CCACTCGGCGTGATAAGT--ATCATTCGCTGAGG-ACACCC---------------CCCAAAGGGTG-GCC-AGGAGTA----CGGAT-GAACTGC-TTCTAA-TAGT--CTATTGA-GTTAGACAAGCA---------------------------------------------- Ceratobasidium_sp._OF10_isolated_Cer ----------------------------------------------------------------------------------------------------CAC-AACAACAC------TTGTGCTCTTGTA-AGATGGA-------------GGGC-------------------------------AACCCTT------------CCATCTATTAA------CACAAACT---ATATATTTT-AAACTGAATGTAAT-T-GATGTAA--CGCATCATT--TGA-A-CTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTATCAAAGA--AAGTCTTTT-----------GTTAACTCAATC----GACT------CTTTGGACTTGGAGGT-CTCT---GCAGATTTAACCTTCTGCTCCTCTTAAGTGCATTAGCTGGATCTC-AGTA--TATGCTC-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACTTCTTTTTTGTTTT-ACAAAAAAAGGTG-GCCGGGAAA----TACAGAT-GAACCGC-TTCTA-ACAGT--CTATTAA-ATTAGACAAATAA------TTTTAAGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._OF2_Cer_1 TATTGAATGAA----TTTAGGAGTTGGTTT-GATGCTGGCCG-ACAACC-----CCAAGGGC----------ATTGTGCACGCCTTCTCC-----TT-CATCC-ACACACAC------CTGTGCACTTGTG-AGACGC------------GAGGATT----------------------------AATTTTCCT------------CCGTCTACTAAT---CACACAAACTC-A-TTGTAATT-GAACTGAATGTAAT-T-GATGTAA--CACATCATT--TGA-A-CTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCATCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGAGCAAATCTCAAAGT--CAATTCCTT-------------------AATT----GGTTTT---GCTTTGGACTTGGAGGT-TCTT---GCAGATTTCACAGTCTGCTCCTCTTAAATGCATTAGCTGGATCTC-AGTAATTATGCTT-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACTGTT---------------AAAAAGGTG-GCCAGGAAAA---TACTGATTGAACCGC-TTCTA-ACGGT--CTATTAA-GTTAGACAATTGACCC------TTAAGTTT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._OF2_Cer2 TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTT-AACCGG---GGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGA-------------CCCTCTCCGGGGGGGAAAG---------GTCCGTCTG------------------CTATA-----CATAAACTCCTGAATAAATA-AATCAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCGATT----GATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._OF2_isolated_Cer TATTGAATTAAA---TCTAG-GGTTGGCA--GTTGCTGGCCCCCCCTCCATTCATTTGGGGGGTTGGGGCAATATGTGCACGCCTTCTCTATTTTTTTCATCC-ACACACAC------CTGTGCACTTGTG-AGATGGG-----------AGGGGC-------------------------------AACCCTT------------CCATCTATTAA------CACAAACTC--ATATATTTT-AAACTGAATGTAAT-T-GATGTAA--CGCATCATT--TGA-A-CTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGTGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTATCAAAGA--AAGTCTTTT-----------GTTAACTCAATC----GACT------CTTTGGACTTGGAGGT-CTCT---GCAGATTTAACCTTCTGCTCCTCTTAAATGCATTAGCTGGATCTC-AGTA--TATGCTC-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACTTCTTTTTTGTTTT-ACAAAAAAAGGTG-GCCGGGAAA----TACAGAT-GAACCGC-TTCTA-ACAGT--CTATTAA-ATTAGACAAATAA------TTTTAAGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._OF3_Cer_2 TATTGAATTAAA---TCTAG-GGTTGGCA--GTTGCTGGCCCCCCCTCCATTCATTTGGGG--TTGGGGCAATATGTGCACGCCTTCTCTATTTTTTTCATCC-ACACACAC------CTGTGCACTTGTG-AGATGGG-----------AGGGGC-------------------------------GACCCTT------------CCATCTATTAA------CACAAACTC--ATATATTTT-AAACTGAATGTAAT-T-GATGTAA--CGCATCATT--TGA-A-CTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ACTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTATCAAAGA--AAGTCTTTT-----------GTTAACTCAATC----GACT------CTTTGGACTTGGAGGT-CTCT---GCAGATTTAACCTTCTGCTCCTCTTAAATGCATTAGCTGGATCTC-AGTA--TATGCTC-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACTTCTTTTTTGTTTTTACAAAAAAAGGTG-GCCGGGAAA----TACAGAT-GAACCGC-TTCTA-ACAGT--CTATTAA-ATTAGACAAATAA------TTTTAAGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._OF8_isolated_Cer TATTGAATTAAA---TCTAG-GGTTGGCA--GTTGCTGGCCCCCCCTCCATTCATTTGGGG--TTGGGGCAATATGTGCACGCCTTCTCTATTTTTTTCATCC-ACACACAC------CTGTGCACTTGTG-AGATGGG-----------AGGGGC-------------------------------GACCCTT------------CCATCTATTAA------CACAAACTC--ATATATTTT-AAACTGAATGTAAT-T-GATGTAA--CGCATCATT--TGA-A-CTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTATCAAAGA--AAGTCTTTT-----------GTTAACTCAATC----GACT------CTTTGGACTTGGAGGT-CTCT---GCAGATTTAACCTTCTGCTCCTCTTAAATGCATTAGCTGGATCTC-AGTA--TATGCTC-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACTTCTTTTTTGTTTTTACAAAAAAAGGTG-GCCGGGAAA----TACAGAT-GAACCGC-TTCTA-ACAGT--CTATTAA-ATTAGACAAATAA------TTTTAAGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._OP1_Cer TATTGAATGAA----CATGGAGTT--GGTT-GTTGCTGGCCCCTTT---ATTGG-----GGCA-----------TGTGCACACCTCCTCT-----ATTCATCC---ACACA-CAC---CTGTGAACTTGTG-AGACGGATAGTAG--------------CCCTCTCGGGGGCGAGGTC-------CGT----CTG------------------CTATA-----CATAAACTCCAGTA-TA-TA-AATTTGAATGTCAT-TTGATGTAA--CACATCT-----ATAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCCTCAAAA--TAAATCTTTT-----------GTTCATTCGATT----GATTTT---ATTTTGGACTTGGAGG-TCT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTCATTAGCTGGATCTG-TATG---A-ACTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TATT-AT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAAATTAC-------TTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._OP2_Cer TATTGAATGAA----CATGGAGTT--GGTT-GTTGCTGGCCCCTTT---ATTGG-----GGCA-----------TGTGCACACCTCCTCT-----ATTCATCC---ACACA-CAC---CTGTGAACTTGTG-AGACGGATAGTAG--------------CCCTCTCGGGGGCGAGGTC-------CGT----CTG------------------CTATA-----CATAAACTCCAGTA-TA-TA-AATTTGAATGTCAT-TTGATGTAA--CACATCT-----ATAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCCTCAAAA--TAAATCTTTT-----------GTTCATTCGATT----GATTTT---ATTTTGGACTTGGAGG-TCT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTCATTAGCTGGATCTG-TATG---A-ACTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TATT-AT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAAATTAC-------TTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._OP7_isolated_Cer TATTGAATGAA----TTAAGAGTTG-GTT--GTTGCTGGCCTTC------------C--GGG---------GCATGTGCACACCTTCTCT------TTCATCC-ACACACACC------TGTGCACTTGTG-AGACAG-----------GGAGGGC-----------CTTCATTG-------G---------CTTT----------TTCC-TGTCTATT-TTACACAAACTC-ATTT-ATTTT-AAACTGAATGTAA--TTGATGTAA--CGCATCATT--TAA-TACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT-AAA--CCTTTT----------GTTAATTCAATT----GGTTCT---GCTTTGGACTTGGAGGT-CTTT---GCGGATTAA--CATCTGCTCCTCTTAAATTTATTAGCTGGATCTC-AGTA-T-ATGCTT-GGTTCCACTCGGCGTGATAAGTT-ATCACTCGCTGAGG-AC---ACT-------------GTAA-AAGGTG-GCCAGG--AAA--TACAGAT-GAACCGC-TTCTA-ATAGT--CTATTAA-ATTAGACAA-----TTCA-TTTTAAGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._OP8_isolated_Cer TATTGAATGAA----TTAAGAGTTG-GTT--GTTGCTGGCCTTC------------C--GGG---------GCATGTGCACACCTTCTCT------TTCATCC-ACACACACC------TGTGCACTTGTG-AGACAG-----------GGAGGGC-----------CTTCATTG-------G---------CTTT----------TTCCCTGTCTATT-TTACACAAACTC-ATTT-ATTTT-AAACTGAATGTAA--TTGATGTAA--CACATCATT--TAAATACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT-AAA--CCTTTT----------GTTAATTCAATT----GGTTCT---GCTTTGGACTTGGAGGT-CTTT---GCGGATTAA--CATCTGCTCCTCTTAAATTTATTAGCTGGATCTC-AGTA-T-ATGCTT-GGTTCCACTCGGCGTGATAAGTT-ATCACTCGCTGAGG-AC---ACT-------------GTAA-AAGGTG-GCCAGG--AAA--TACAGAT-GAACCGC-TTCTA-ATAGT--CTATTAA-ATTAGACAA-----TTCA-TTTTAAGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._SV11_Cer TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTTTAACCGG-GGGGG-CA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGAA-----------CCCCTCTCCGGGGGGGAAAGA-------GGTCCGTCTG------------------CTATAT---ACATAAACTCCTGAATAA-TA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GT-CACTCAAAT---CGATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCCGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._SV11_isolated_Cer TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTTTAACCGG--GGGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGAA-----------CCCCTCTCCGGGGGGGAAAGA-------GGTCCGTCTG------------------CTATAT---ACATAAACTCCTGAATAA-TA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCAAAT---CGATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCGCTCGCCGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._SV19_isolated_Cer TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTTTAACCGG--GGGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGAA-----------CCCCTCTCCGGGGGGGAAAGA-------GGTCCGTCTG------------------CTATAT---ACATAAACTCCTGAATAA-TA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCAAAT---TGATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCCGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCC--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._SV21_Cer TATTGAATTTA---ATGTAGAGTTG-GTT--GTAGCTGGCCCTTGGATTAATTTCTT-GGGG---------GCATGTGCACACCTTCTCT------TTCATCCCACACACACC------TGTGAACCTGTG-AGATAGTAG-------CTGGGGAC-----------TTTAAT---------GGACCCAC--TT------------CTGTCTACTTAAT-TCATATAAAATC-AATTTAATTT-AAAACGAATGTAAT--GGATGTAA--CGCATC-----TAA-TACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAGT--AAATCTTTT-----------GTTAACTCAATT----GGTTTC--TACTTTGGTATTGGAGGC-CATT---GCAGCTTCA--CACCTGCTCCTCTTTG-TTCATTAGCTGGATCTC-AGTG-TTATGCTT-GGTTCCACTCAGCGTGATAAGTT-ATCTATCGCTGAGG-AC---ACT-------------GTAAAAGG-TG-GCCAAGGTAAA--TGCAGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CCTGGACAATAAATTAAT-TTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._SV3_Cer TATTGAATTTA---ATGTAGAGTTG-GTT--GTAGCTGGCCCTTGGATTAATTTCTT-GGGG---------GCATGTGCACACCTTCTCT------TTCATCCCACACACACC------TGTGAACCTGTG-AGATAGTAG-------CTGGGGAC-----------TTTAAT---------GGACCCAC--TT------------CTGTCTACTTAAT-TCATATAAAATC-AATTTAATTT-AAAACGAATGTAAT--GGATGTAA--CGCATC-----TAA-TACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAGT--AAATCTTTT-----------GTTAACTCAATT----GGTTTC--TACTTTGGTATTGGAGGC-CATT---GCAGCTTCA--CACCTGCTCCTCTTTG-TTCATTAGCTGGATCTC-AGTG-TTATGCTT-GGTTCCACTCAGCGTGATAAGTT-ATCTATCGCTGAGG-AC---ACT-------------GTAAAAGG-TG-GCCAAGGTAAA--TGCAGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CCTGGACAATAAATTAAT-TTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._SV6_Cer TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTTTAACCGG-GGGGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGAA-----------CCCCTCTCCGGGGGGGAAAGA-------GGTCCGTCTG------------------CTATAT---ACATAAACTCCTGAATAA-TA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCAAAT---CGATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCCGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._SV8_Cer_1 TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTTTAACCGG--GGGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGAA-----------CCCCTCTCCGGGGGGGAAAGA-------GGTCCGTCTG------------------CTATAT---ACATAAACTCCTGAATAA-TA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGGACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCAAAT---CGATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCCGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._SV8_Cer_2 TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTTTAACCGG--GGGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGAA-----------CCCCTCTCCGGGGGGGAAAGA-------GGTCCGTCTG------------------CTATAT---ACATAAACTCCTGAATAA-TA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCAAAT---CGATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCCGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._UAMH_5443_EU218894 TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTT-AACCGG---GGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGA-------------CCCTCTCCGGGGGGGAAAG---------GTCCGTCTG------------------CTATA-----CATAAACTCCTGAATAA-TA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCGATT----GATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Ceratobasidium_sp._aurim1217_DQ093646 TATTGAATTTA---ATGTAGAGTTG-GTT--GTAGCTGGCCCTTGGATTAATTTCTT-GGGG---------GCATGTGCACACCTTCTCT------TTCAT-CCACACACACC------TGTGAACCTGTG-AGATAGTAG-------TTGGGGAC-----------TTTAAT---------GGACCCAC--TT------------CTGTCTACTTAAT-TCATATAAAATC-AATTTAATTT-AAAACGAATGTAAT--GGATGTAA--CGCATC-----TAA-TACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAGT--AAATCTTTT-----------GTTAACTCAATT----GGTTTC--TACTTTGGTATTGGAGGC-CATT---GCAGCTTCA--CACCTGCTCCTCTTTG-TTCATTAGCTGGATCTC-AGTG-TTATGCTT-GGTTCCACTCAGCGTGATAAGTT-ATCTATCGCTGAGG-AC---ACT-------------GTAAAAGG-TG-GCCAAGGTAAA--TGCAGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATTAAT-TTTTATGATCT--GATCTCCAAATCAGGTAGGACTACCC Ceratobasidium_sp._olrim908_AY787667 -----------------------------------------CCTTC---ACCGG-----GGCA-----------TGTGCACGCCTCCTCT-----ATTCATCC---ACACA-CAC---CTGTGAACTTGTG-AGACGGATAGTAG------------CTCCTTTCGGGGGGCGAGGTC-------CGT----CTG------------------CTATA-----CATAAACTCCAATATAA-TA-AATTCGAATGTAATGCTGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTCGTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCCTCAAAA--TAAATCTTTC-----------GTTCATTCGATT----GATTTT---ATTTTGGACTTGGAGG-TCT-----GCAGATTTCACAGTCTGCTCCTCTTAAATTTATTAGTTGGATCTC-AGTG---A-ACTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTGTGCCGGG--GT---TGCAGAC-GAACCGC-TTCTA-ATA---------------------------------------------------------------------- 'Ceratorhiza oryzae-sativae EF429314' TAATGAATGAA----TGTAGAGTC--GGTT-GTAGCTGGCCTTTCCT---CCCAGGGAGGGCA-----------TGTGCACACC-TTCTC-----TTTCATCC-ACACACACCCC---CTGTGCACTTGTG-AGACGGAGGAGGCATTTTAATTTCCTTTTAACTAGGGAAAGAGAGAGAGGTCGCCTCCGTCTA------------------TCGTC----ACATAAAATCTAATTTATTTAAAAACTGAATGTAAA-TGGATGTAA--CACATCTT----AAATACAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTATCAAAGC-AAAGTCTTTTTTTTTGTTGTTGTTAATTCAACTTAAAGTCTGCG--C-TTTGGATTTGGAGGTTTT-----GCAGATTTAAATTTCTGCTCCTCTTAAATGCATTAGCTGGAT-CTCTATG---A-ACTTGGTT-CCACTCGGCGTGATAAGTT-ATCACTCGTCGAGG-ACACCC-G-------------TAAAAAAGGTG-GCC-AGGATTTTTCAAGGAT-GAGCCGC-TTCTAAATAGT--CCATTGA-CTTGGACAAA---------ATTTATGATCT--GATCTC-CAATCAGGTAGGACTACCC Ceratorhiza_sp._UAMH_6440_EU218895 TATCGAATGAA----TGTGGGGTCC-GGTT-GTTGCTGGCCTGC------------AAAGGCA-----------TGTGCACACC-TCTTC-----TCTCATCC-ACACAC--CCC----TGTGCACTTGTG-AGACGGAGG---CTCATTTTCTTCCCTTTTGTTTAGGGAGGGAT------CGGTTTCCGTCTG------------------CCATT----ATACAAACTC-AAATAATT-TAAT-TTGAATGTAAT-T-GACGCAA--CGCGTCTGATAAATATACAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTATCAAAGC-AAATA-TTTT----------CGTTAATTCGACT----GCCTTTG--CTT-TGGACTTGGGGGCCT------GCAGATCTCACAGTCTGCTCCTCTTAAATGCATTAGCTGGATTCTCAGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACACCCGT-------------TAAAAA-GGTG-GCC-AGGCTTG----CAGAT-GAACTGC-TTCCAA-CGGT--CTATTGAACTTAGACAATGAAT-----TTTTACGATCT--GATCTC-------------------- Rhizoctonia_sp._162a_AY586182 ----GAATTTA---ATGTAGAGTTG-GTT--GTAGCTGGCCCTTGGATTAATTTCTT-GGGG---------GCATGTGCACACCTTTTTT------TTCATTCCACACACACC------TGTGAACCTGTG-AGATAGTAG-------TTGGGGAC-----------TTTAAT---------GGACCCAC--TT------------CTGTCTACTTAAT-TCATATAAAATC-AATTTAATTT-AAAACGAATGTAAT--GGATGTAA--CGCATC-----TAA-TACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAGT--AAATCTTTT-----------GTTAACTCAATT----GGTTTC--TACTTTGGTATTGGAGGC-CATT---GCAGCTTCA--CACCTGCTCCTCTTTG-TTCATTAGCTGGATCTC-AGTG-TTATGCTT-GGTTCCACTCAGCGTGATAAGTT-ATCTATCGCTGAGG-AC---ACT-------------GTAAAAGG-TG-GCCAAGGTAAA--TGCAGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATTAAT-TTTTATGATCT--GATCTC-AAATCAGGTAG-------- Rhizoctonia_sp._269_AJ419931 TATTGAATGAA----TGTAGAGTC--GGTT-GTCGCTGGTCCTTTC------GG----GGGCA-----------TGTGCACGCCTTCTCT------TTCATCC---ACACA-CAC---CTGTGCACTCGTG-AGACGGAAG--------------------CCTTCGGG----------------CGTCCGTCTG------------------CTTTA-----CATAAACTCATATAATA--T-AATTTGAATGTAAT--TGACGTAA--CACATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTATCAAAA--TAAGTCTTTT-----------GTTCATTCGATT----GACTTTT--ATTTTGGACTAGGAGG-TCT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATAAATTAGCTGGATCTC-AGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATCGT--CCATTTA-CTTGGACAGCAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC 'Rhizoctonia sp. 3-4Ll20-5p AM040889' --TTGAATGAA----TGTA{AG}-AGTTGGTT--GTCGCTGGCCCTTTC------------GGGG---------GCATGTGCACGCCTTCTCT------TTCATCC-ACACACAC------CTGTGCACTTGTG-AGACGGA-----------GGACTTTT--------------------------AATTAGTCTT------------CCGTCTACTTAA--TCACACAAACTC--ATTTTAATT-AAACTGAATGTAAT-T-GATGTAA--CGCATCATT--AGA-AACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT--AAATCTTTT-----------GTTAATTCAACT----GGTTT----GCTTTGGACTTGGAGGT-CTTT---GCAGATTTCAC-ATCTGCTCCTCTTAAATGCATTAGCTGGATCTC-AGTA--TATGCTT-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACTGTT---------------AAAAAGGTG-GCCAGGAAA----TACAGAT-GAACCGC-TTCTA-ATAGT--CTATTAA-GTTAGACAATAAAA-----TTTTAAGATCT--GATCTC-AAATCAGGTAGGACTACCC 'Rhizoctonia sp. 85-387/Na AF200519' AAGAAAATGAA----TCTAG-AGTCGGTT--GTCGCTGGCCCTCC-------------GGG-----------CATGTGCACGCCTTCTCTTTTTCATCCACAC-ACACACAC------CTGTGCATTTGTG-AGACGGG-----------AGGGTCTATTTT-------------------ATTATGGACCTTT------------TCGTCTATTAAAACCCACACAAACTC--ATTTATTTT-GAACCGAATGTAAT-T-GATGTAG--CACATCATT--TGA-A-CTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCCCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGC--AAGCCTTTT-----------GTTAATTCAATC----GGTCTTCTTGCTTTGGACTTGGAGGC-TT-----GCAGATTTCACACTCTGCTCCTCTTAAATTCATTAGCTGGATCTC-GGTA--TATGCTC-GGTTCCACTCGGCGTGATAAGTAAATCACTCGTCGAGG-ACACTGTT---------------AAAAAGGTG-GCCGGGAAA----TGCAGAC-GAACCGC-TTTCA-ATGGT--CTATTGA-ATTAGACAA-TAC------TCTTAAGATCTCTGATCTC-AAATCAGGCAGGACTACCC Rhizoctonia_sp._Oss2_AJ318425 TAATGAATGAA----TGTAGAGTC--GGTT-GTAGCTGGCCTCCCC----------GGAGGCA-----------TGTGCACGCC-TGCTC-----TTTCATCC-ACACAC---CC---CTGTGCACTTGTG-AGACGGAGG-----TCTT----TTCCTTTAAATAGGATGG-------------TCTCCGTCTG------------------CTATC----ACATAAAATCTAATTTATTTAAAA-CCGAATGTAAT-CTGATGTAA--CGCATCT------AATACAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGC-AA-GTCTTTT-----------GTTAATTCAATC----GGCTCTG--C-TTTGGACTTGGGGGCTT------GCAGATTCACGT--CTGCTCCTCTTAAATACATTAGCTGGAT-CTCCATG---A-ACTTGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACACCC-G-------------TGAAAA-GGTG-GCC-AGGCTTG----AGGAT-GAGCCGC-TTCTAA-TAGT--CCATTAG-CTTGGACAATTT-------ATTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Rhizoctonia_sp._Pha1_AJ318423 TAATGAATGAA----TGTAGAGTC--GGTT-GTAGCTGGCCTCCCC----------GGAGGCA-----------TGTGCACGCC-TGCTC-----TTTCATCC-ACACAC---CC---CTGTGCACTTGTG-AGACGGAGG-----TCTT----TTCCTTTAAATAGGATGG-------------TCTCCGTCTG------------------CTATC----ACATAAAATCTAATTTATTTAAAA-CCGAATGTAAT-CTGATGTAA--CGCATCT------AATACAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGC-AA-GTCTTTT-----------GTTAATTCAATC----GGCTCTG--C-TTTGGACTTGGGGGCTT------GCAGATTCACGT--CTGCTCCTCTTAAATACATTAGCTGGAT-CTCCATG---A-ACTTGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACACCC-G-------------TGAAAA-GGTG-GCC-AGGCTTG----AGGAT-GAGCCGC-TTCTAA-TAGT--CCATTAG-CTTGGACAATTT-------ATTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC Thanatephorus_cucumeris_AF354059 --TTGAATTTATTAATGAGGAGTTGAGTT--GTAGCTGGCCTTTTAAC-----ATT---GGC---------ATGTGCACAC-TCTTCTCT------TTCATCC-ACACACCCC------TGTGCACTTGTG-AGACAGTCAAGGTCCTTTGGGGTTGGGGGGCAGAGCTTTATTGCAAAACCCTTTTTCCCCTTTTGC---CTTTGCTGTCTACTCAA?-TTATACACACTCTAATTAA?TTT-AAAACGAATGTAATT--GATGTAA--CGCATC-----TAA-TACTAAGTT-CAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAGC--AAACCTTTT-----------GTTAATTCAATC----GGTCTCT-TGCTTTGGTATTGGAGGT-CTTT---GCAGCTTCA--CACCTGCTCCTCTTTG-TTCATTAGCTGGATCTC-AGTG-TTATGCTT-GGTTCCACTCGGCGTGA?AAGTT-ATCTATCGCTGAGG-AC---ACC-------------GTAAAAAAGTG-GCCAAGGTAAA--TGCAGAC-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAAT?A---AAT-TTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC fungal_sp._PN1_AY643803 TATTGAATGTA----AACGGAGTT--GGTT-GTAGCTGGCCTCTTT---ACTGG-----GGCA-----------TGTGCACGCCTTCTCT-----GTTCATCC---ACACA-CAC---CTGTGAACTTGTG-AGACGGGTAG-----------------CCCCCTCGGGGGC--CGTC-------CGT----CTG------------------CTACA-----CATAAACTCTTATA-TA-TA-AATTTGAATGTAAT--TGATGTAA--CGCATCT-----ATAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AACCTTCAAAA--TAAATCTTTT-----------GTTCATTCAATT----GATTTT---ATTTTGGACTTGGAGG-TCT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-AGTA---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--GT---TGCAGAT-GAACTGC-TTCTA-ATAGT--CCATTCA-CTTGGACAATTTAT-------TTATGATCT--GATCTC-AAATCAGGTAGGACTACCC fungal_sp._PO1_AY643805 TATTGAATGTA----AATGGAGTT--GGTT-GTTGCTGGCCCTTTC---ATTGG-----GGCA-----------TGTGCACGCCTTCTCT-----ATTCATCC---ACACA-CAC---CTGTGAACTTGTG-AGACGGATAG-----------------CCCTCTC--GGGGGTCGTC-------CGT----CTG------------------CTATA-----CATAAACTCCAGTA-TA-TA-AATCTGAATGTAAT--TGATGTAA--CGCATCT-----ATAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTT------------GTTCATTCGATT----GATTTT---GTTTTGGACTTGGAGG-TCT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-AGTG---A-ACTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--GT---TGCAGAT-GAACCGC-TTCTA-ATA??--?TATTTA-CTTAGACAATTTAT-------TTATGATCT--GATCTC-AAATCAGGTAGGACTACCC 'mycorrhizal fungus VII-17d ex Dactylorhiza incarnata AJ549123' ---TGAATAAA----TTTAGAGTTG-GTT--GTTGCTGGCTTTAA-------TACCT--GAA---------GCATGTGCACACCTTCTCT------TTAATCC-ACACACCCC------TGTGAACTTGTG-AGGCAGTAAG---GGAGAGAGGTC-----------TTTAACCG-------GGCCTGATCCTTTG----------CTGCCTGCTTAAT-T-ACACAAACTC-ATTTTATTTT-AAACTGAATGTAAA-TTGATGTAA--CGCATCATT--TAATTACAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT-AAAATCTTTTT----------GTTAATTCAATT----GGTTTG---ACTTTGGACTTGGAGGT-CTTT---GCAGATTTAATTATCTGCTCCTCTTAAATTTATTAGCTGGATCTC-AGTA-T-ATGCTT-GGTTCCACTCGGCGTGATAAGTT-ATCACTCGCTGAGG-AC---ACTT------------GTAATAAAGTG-GCCAGG--AAA--TGCAGAT-GAACCGC-TTCTA-ATGGT--CTATTAA-ATTAGACAAA--ATTTAA-TTTCAAGA------------------------------- uncultured_Basidiomycota_AY833047 TATTGAATGAA----CATGGAGTT--GGTT-GTTGCTGGCCCCTTT---ATTGG-----GGCA-----------TGTGCACACCTCCTCT-----ATTCATCC---ACACA-CAC---CTGTGAACTTGTG-AGACGGATAGTAG--------------CCCTCTCGGGGGCGAGGTC-------CGT----CTG------------------CTATA-----CATAAACTCCAGTA-TA-TA-AATTTGAATGTCAT-TTGATGTAA--CACATCT-----ATAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCCTCAAAA--TAAATCTTTT-----------GTTCATTCGATT----GATTTT---ATTTTGGACTTGGAGG-TCT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTCATTAGCTGGATCTG-TATG---A-ACTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TATT-AT-GAACCGC-TTCT--------------------------------------------------------------------------- uncultured_Basidiomycota_AY970109 TATTGAATGAA----TTTAGGAGTTGGTTT-GATGCTGGCCG-ACAACC-----CCAAGGGC----------ATTGTGCACGCCTTCTCC-----TT-CATCC-ACACACAC------CTGTGCACTTGTG-AGACGC------------GAGGATT----------------------------AATTT-CCT------------CCGTCTACTAAT---CACACAAACTC-A-TTGTAATT-GAACTGAATGTAAT-T-GATGTAA--CACATCATT--TGA-A-CAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCATCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGAGCAAATCTCAAAGT--CAATTCCTT-------------------AATT----GGTTTT---GCTTTGGACTTGGAGGT--CTT---GCAGATTTCACAGTCTGCTCCTCTTAAATGCATTAGCTGGATCTC-AGTAATTATGCTT-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACTGTT---------------AAAAAGGTG-GCCAGGAAAA---TACTGATTGAACCGC-TTCTA-ACGGT--CTATTAA-CTTAGACAATTGACCCC-----TTAAGTTT--GATCTC-AAATCAGGTAGGACTACCC uncultured_Ceratobasidiaceae_AY634119 TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTT-AACCGG---GGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTTTGAACTTGTG-AGACGGATTTCGA-------------CCCTCTCCGGGGGGGAAAG---------GTCCGTCTG------------------CTATA-----CATAAACTCCTGAATAA-TA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCGATT----GATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC uncultured_Ceratobasidiaceae_AY634120 TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTT-AACCGG---GGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGA-------------CCCTCTCCGGGGGGGAAAG---------GTCCGTCTG------------------CTATA-----CATAAACTCCTGAATAA-TA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCGATT----GATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA------------------------------------------- uncultured_Ceratobasidiaceae_AY634126 TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTT-AACCGG---GGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGA-------------CCCTCTCCGGGGGGGAAAG---------GTCCGTCTG------------------CTATA-----CATAAACTCCTGAATAAATA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCGATT----GATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC uncultured_Ceratobasidiaceae_AY634127 TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTT-AACCGG---GGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGA-------------CCCTCTCCGGGGGGGAAAG---------GTCCGTCTG------------------CTATA-----CATAAACTCCTGAATAAATA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCGATT----GATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC uncultured_Ceratobasidiaceae_AY634128 TATTGAATGAA----CATGGAGTT--GGTT-GTTGCTGGCCCCTTT---ATTGG-----GGCA-----------TGTGCACACCTCCTCT-----ATTCATCC---ACACA-CAC---CTGTGAACTTGTG-AGACGGATAGTAG--------------CCCTCTCGGGGGCGAGGTC-------CGT----CTG------------------CTATA-----CATAAACTCCAGTA-TA-TA-AATTTGAATGTCAT-TTGATGTAA--CACATCT-----ATAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCCTCAAAA--TAAATCTTTT-----------GTTCATTCGATT----GATTTT---ATTTTGGACTTGGAGG-TCT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTCATTAGCTGGATCTG-TATG---A-ACTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TATT-AT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAAATTAC-------TTATGATCT--GATCTC-AAATCAGGTAGGACTACCC uncultured_Ceratobasidiaceae_AY634129 TATCGAATGAA----CGTGGAGTCT-GGTT-GTAGCTGGCCTGC------------AAAGGCA-----------TGTGCACACC-GCCTC-----CCTCATCC-ACACAC--CCC----TGTGCACTCGTG-AGACGGAGG---CATATCTTCTTCCCTTTTGTTTGGGGAGAGAT------CGGTTTCCGTCTG------------------CCATT----ATACAAACTC-AATTGATG-TAAT-TCGAATGTAAT-C-GACGCAA--CGCGTCTAATAAATATACAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTCGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTATCAGAGC-AAATA--TTT----------TGTTAATTCAACT----GCCTTTG--CTT-TGGACTTGGGGGCCT------GCAGATTTCACAGTCTGCTCCTCTTAAACGCATTAGCTGGATTCTCAGTG---A-GCTTGGTT-CCACTCGGCATGATAAGT--ATCACTCGCTGAGG-ACACCCGT-------------TGAAAAAGGTG-GCC-AGGCTTG----CGGAT-GAACCGC-TTCCAA-CGGT--CTATTGA-CTTAGACAATGAAT-----TT--ACGATCT--GATCTC-AAATCAGGTAGGACTACCC uncultured_Ceratobasidiaceae_AY634163 TATTGAATGAA----TTTAG-AGTTGGTT--GTTGCTGGCCCCACAAAA-----GCAAGGGG----------CAAGTGCACGCCTTCTCT-----TTTCATCC-ACACACAC------CTGTGCACTTGTG-AGACG-------------GAGGATTT-----------------------GAAAAAAAGTCCT------------CTGTCTACTAAT---CACACAAACTC-AATTGTACTT-TAACTGAATGTAAT-TTGATGTAA--CACATCATT--GGA-A-CAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAGTGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGAGCAAATCTCAAAGT--CGAACCTTTT----------GTTAATTCAATT----GGTTTTC--GCTTTGGACTTGGAGGT--CTT---GCAGATTTCACCGTCTGCTCCTCTTAAATGCAGTAGCTGGATCTC-AGTA-TTATGCTT-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACTGGT---------------AAAAAGGTG-GCCAGGAAAAA--TACCGATTGAACCGC-TTCTA-ACGGT--CTATTAA-CTTAGACAATTACCCCC--CCCTTAAGTTT--GATCTC-AAATCA------------- uncultured_Ceratobasidiaceae_DQ182419 TATTGAATGAA----TTTAGGAGTTGGTTTTGATGCTGGCC---------------AAGGGC----------AATGTGCACGCCTTCTCC-----TT-CATCC-ACACACAC------CTGTGCACTTGTG-AGATG-------------GAGGATT----------------------------AATTT-CCT------------CCGTCTACTAAT---CACACAAACTC-A-TTGTACTT-GAACTGAATGTAAT-T-GATGTAA--CACATCATT--TGA-AACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGTTATTCCTTGGAGCATGCCTGTTTGAGTATCATGAGCAAATCTCAAAGT--CGATTCCTTTT---------GTTAATTCAATT----GGTTTTTT-GCTTTGGACTTGGAGGC--CTT---GCAGATTTCAC-GTCTGCTCCCCTTAAATGCATTAGCTGGATCTC-AGTA-TTATGCTTTGGTTCCACTCGGCGTGATAATTA--TCACTCGCTGAGG-ACACTGTT---------------AAAAAGGTG-GCCAGGAAAA---TACTGATTGAACCGC-TTCTA-ATGGT--CTATTAA-GTTAGACAACT-ACCC------TTAAGTTT--GATCTC-AAATCAGGTAGGACTACCC uncultured_Ceratobasidiaceae_HM141007 TAATGAATGCA----ATCAGAGTC--GGTT-GTCGCTGGCCTCTTC---ATCGA-----GGCA-----------TGTGCACGCCTTCCCT-----GTTCATCC---ACACA-CAC---{AG}TGTGCACTTGTG-AGACGGATTGA---------------CCCTCTCGGGGGACG-------------GTCCGTCTA------------------T{CT}ATA-----CATAAACTCCAGTA-AATAA-AATTTGAATGTCAT-TTGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAA--TA{CT}ATCTTTT-----------GCACACGCGATT----GATTTT---ATTTTGGACTTGGAGGTCTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCAC-TGTG---A-ACTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAAGGTGGCCGGG--AT---TGCTGTA-GAACCGC-TTCTA-ATAGT--CTATTAG-ATTAGACAA-ATATA-----TTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC uncultured_Ceratobasidiaceae_HM141017 TATTGAATGAA----TGTCTAGAA-TGGTT-GTAGCTGGTCTTCC-----------AAAGGCA-----------TGTACACACCATTCTC-----TTTCATCC-ACACAC---CC---CTGTGCACTTGTA-AGACGGA-GG---CTGTT-----CTCTTTTATTA-GAGACGT-----------TTCCCGTCTG------------------CTAAC----ACATAAAAATCATAT-AATTAAAT-TTGAATGTAAT-T-GATGTAA--CGCATCT------AATACAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAGAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGC-AAGGTCTTTT-----------GTTAATTCAACTG---GGCTTTG--CATTTGGATTTGGAGGTT-------GCAGATTCACGTC-CTGCTCCTCTTAAATGAATTAGCTGGAT-CTCCATG---A-ACTTGGTTTCCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACACCC-G-------------TAAAAAAGGTG-GCC-AGGCTTA----AGGAT-GAGCCGC-TTCTAA-CAGT--CCTTTCA-ATTGGACAACATA------ATTTATGAT------------------------------ uncultured_Ceratobasidiaceae_HM141029 TATTGAATTTA---ATGTAGAGTTG-GTT--GTAG---CTGGCCCAATGTAATGTTT-GGGC---------A--TGTGCACACCTTCTCT------TTCATCCCGTACACACC------TGTGCACCTGTG-AGACAGAAG--------TGGGACT-----------TTTAATTTA---ATTTAATTGGACCCT------------CTGTCTACTCAAT-CCACACAAACTC-AATTTAATTT-AAAATGAATGTAACTTGGATGTAA--CGCATC-----TAA-TACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAGC--AAATCTTTT-----------GTTAGCTCAATT----GGTTC---TGCTTTGGTATTGGAGGT-TATT---GCAGCTTCA--CACCTGCTCCTCTTTG-TGCATTAGCTGGATCTC-AGTG-T-ATGCTT-GGT-CCACTCAGCGTGATAAGT--ATCTATCGCTGAGA-AC---TGT-------------ACA----G-TG-GC--AGATAA---TGCA-AT-GA--CGC-TTC-----ACG--TCATTCA-CTTGGACA-------------------------------------------------- uncultured_Ceratobasidiaceae_HM141032 TATTGAATTTA---ATGTAGAGTTG-GTT--GTAG---CTGGCCCAATTTAATACTT-GGGC---------A--TGTGCACACCTTCTCT------TTCATCC-ACACACACC------TGTGCACCTGTG-AGACAGAAG--------TGGGACT-----------TTCAATTAA---ATTTGATTGGACCCT------------CTGTCTACTCAAT-CCACACAAACTC-AATTTATTTT-AAAATGAATGTAACCTGGATGTAA--CGCATC-----TAA-TACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAGT--AAACCTTTT-----------GTTAATTCAATT----GGTTC---CACTTTGGTATTGGAGGT-TATT---GCAGCTTCA--CACCTGCTCCTCTTTG-TGCATTAGCTGGATCTC-AGTG-TTATGCTT-GGTTCCACTCAGCGTGATAAGT--ATCTATCGCTGAGG-AC---ACC-------------GTAACAGG-TG-GCCAAGGTAAA--TGCAGAT-GAACCGC-TTCCA-ACAGT--CCATTTA-ATTGGACAA--T----AT-TCTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC uncultured_Ceratobasidiaceae_HM141034 TATTGAATGAA----TTTAGGAGTTGGTTT-GATGCTGGCCG-ACAACC-----CCCAGGGC----------AT-GTGCACGCCTTCTCC-----TT-CATCC-ACACACAC------CTGTGCACTTGTG-AGACG-------------GAGGATT----------------------------AATTT-CCT------------CCGTCTACTAAT---CACACAAACTC-A-TTGTAATT-GAACTGAATGTAAT-T-GATGTAA--CACATCATT--TGA-A-CTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCATCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGAGCAAATCTCAAAGT--CAATTCCTT-------------------AATT----GGTTTT---GCTTTGGACTTGGAGGT--CTT---GCAGATTTCACAGTCTGCTCCTCTTAAATGCATTAGCTGGATCTC-AGTAATTATGCTT-GGTTCCACTCGGCGTGATAAGTA--TCACTCGCTGAGG-ACACTGTT---------------AAAAAGGTG-GCCAGGAAAT---TACTGATTGAACCGC-TTCTA-ACGGT--CTATTAA-GTTAGACAATTGACCCC-----TTAGTTTG--GAACCC-------------------- uncultured_Ceratobasidiaceae_HM141039 TATTGAATGTA----AATGGAGTT--GGTT-GTTGCTGGTCCCTTC---ATTGG-----AACA-----------TGTGCACGCCTCCTCT-----ATTCATCC---ACACA-CAC---CTGTGAACTTGTG-AGACGGATAG-----------------CCCTCTTCGGGGGGTCGTC-------CGT----CTG------------------CTATA-----CATAAACTCCAGTA-TA-TA-AATTTGAATGTAAT--CGATGTAA--CGCATCT-----ATAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCATTCGATT----GATTTTT--ATTTTGGACTTGGAGG-TCT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-AGTG---A-ACTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--GT---TGCAGAC-GAACCGCCTTCTA-ATAGT--CTATTCA-CTT------------------------------------------------------- uncultured_Ceratobasidiaceae_HM141046 TATTGAATGAA----TGTAGAGTT--GGTT-GTCGCTGGCC--TCTTTTTGGGG-------CA-----------TGTGCACACCTTCTCT------TTCATCC---ACACA-CAC---CTGTGCACCTGTG-AGACGGAGAG-----------CTTGCCCTTTCGCGAGGGTGTTTT---------CTCCGTCTG-----------------CCAATA-----CACAAACTCATAT---T-AT-AATTTGAATGTAAT--CGATGTAA--CGCATCT-----ATAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAA--CAAATCTTTT-----------GTTAATTCGATT---GGTTTC----GTTTTGGACTTGGAGGTTTT-----GCGGATT-CAC-GTCTGCTCCTCTTAAAAACATTAGCTGGATCTC-AGTG---A-ACTCGGTT-CCACTCGGCGTGATAAGT--ATCAATCGCTGAGG-ACACCC-G-------------TAAAAAAGGTG-GCCGGG--AT---TGCAGAT-GAACCGC-TTCTA-ATAGT--CTATTGA-ATTAGACAA--TATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC uncultured_Ceratobasidium_FJ809765 TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTTTAACCGG--GGGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGAA-----------CCCCTCTCCGGGGGGGAAAGA-------GGTCCGTCTG------------------CTATAT---ACATAAACTCCTGAATAA-TA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCAAAT---TGATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTC-GGTG---A-GCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCCGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC uncultured_Ceratobasidium_FJ809766 TATCGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCTGC------------AAAGGCAT----------CGTGCACGCC-TTCTC-----TTTCATCC-ACACAC--CCC----TGTGCACTTGTG-AGACGGAGG---CTTATTTC--TCCCTTAAC------GGGAGAT------TGGTTTCCGTCTG------------------CTACT----ACACAAACTC-ATATATTTTTAAT-CTGAATGTAAT-C-GATGTAA--CACATCT-----ATATACAAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT-AAA-T-CTTT----------TGTTAATTCAATG----GACTTTG--CTT-TGGACTTGGAGGTCT------GCAGAT-TCACAGTCTGCTCCTCTTAAATGCATTAGCTGGAT-CCCAGTG---A-GCTTGGTT-CCACTTGGCGTGATAAGT--ATCACTCGCTGAGGCACACCCCG-------------TAAAAAAGGTG-GCC-AGGATTG----CAGGT-GAACCGC-TTCTAA-TGGT--CTATTGG-TTTAGACAATAAAT------TTAACGATCT--GATCTC-AAATCAGGTAGGACTACCC uncultured_Ceratobasidium_FJ809767 TATTGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCCCTTTTTAACCGG-GGGGGGCA-----------TGTGCACGCCTTCTCT-----TTTCATCC-ATACACA-CAC---CTGTGAACTTGTG-AGACGGATTTCGAA-----------CCCCTCTCCGGGGGGGAAAGA-------GGTCCGTCTG------------------CTATAT---ACATAAACTCCTGAATAA-TA-AATTAGAATGTAAT--CGATGTAA--CGCATCT-----TTAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTCGGAGCATGCCTGTTTGAGTATCATGA--AATCTTCAAAA--TAAATCTTTT-----------GTTCACTCAAAT---CGATTTT---ATTTTGGACTTGGAGG-CTT-----GCAGATT-CAC-GTCTGCTCCTCTTAAATTTATTAGCTGGATCTCCGGTG---A-GCTCG-TT-CCACTCGGCGTGATAAGT--ATCACTCGCCGAGG-ACAC-----------------TGTAAAAGGTG-GCCGGG--AT---TGCGGAT-GAACCGC-TTCTA-ATAGT--CCATTGA-CTTGGACAATAAATA----CTTTATGATCC--GATCTC-AAATCAGGTAGGACTACCC uncultured_fungus_DQ093780 TAATGAATGAA----CATAGAGTC--GGTT-GTAGCTGGCCTGC------------AAAGGCA-----------CGTGCACGCC-TTCTC-----TTTCATCC-ACACAC--CCC----TGTGCACCCGTG-AGACGGAGG---CTTGTTTC--TTTCCTTTCATTTGGGGGGGAT------TTGTTTCCGTCTG------------------CTACT----ACACAAACTC-ATATATTT--AAT-CCGAATGTAAT-T-GATGTAA--CACATCT-----ATATACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGGATAAGTAATGTGAATTGCAGACTTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGC-GAA-T-CTTT----------CGTTAACTCGATG----GACTTTG--CTT-TGGACTTGGAGGTCT------GCGGAT-TCACAGTCCGCTCCTCTCAAATGCATTAGCTGGAT-CTCAGTG---A-GCTTGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACACCC-G-------------TAAAAAAGGTG-GCC-AGGGTCG----CAGGT-GAACCGC-TTCTAA-TGGT--CTATTGA-TTTAGACAATAAATCTTTATTTAATGATCT--GATCTC-AAATCAGGTAGGACTACCC uncultured_fungus_EF433959 TATTGAATGAA----TGTAGAGTT--GGTT-GTCGCTGGCCATTTATTTTTTGG-------CA-----------TGTGCACACCTTCTCT------TTCATCC---ACACA-CAC---CTGTGCACCTGTG-AGATGGAGAGCTT--------CTTGCCCTTTTGTTAGGGTGTTTT--------TCTCCGTCTG-----------------CCAATA-----CACAAACTCATATATAA-TT-AATTTGAATGTAAT--CGATGTAA--CGCATCT-----ATAAACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCACCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTATCAAAA--CATACCTTTT-----------GTTCATTCAACT---GGTTTTTG---TTTTGGACTTGGAGGCCTT-----GCGGATT-CAC-GTCTGCTCCTCTTAAAAATATTAGCTGGATCTC-AGTG---AAGCTCGGTT-CCACTCGGCGTGATAAGT--ATCACTCGCTGAGG-ACACCC-T-------------TAAAAAAGGTG-GCCGGG--ATT--CGCAGAT-GAACCGC-TTCCA-ATAGT--CCATTAG-ATTGGACAAA-CATA----CTTTATGATCT--GATCTC-AAATCAGGTAGGACTACCC 'vouchered mycorrhizae (Basidiomycota) AB303044' TATTGAATGAA----TCTAGAGTTG-GTT--GTTGCTGGCTTCT------------T--CAG---------GCATGTGCACACCTTCTCT------TTCATCC-ACACACACCC----CTGTGCACTTGTC-AGATTGGAGG---GCTGGAATTAT-----------TATTATTA-------TTATTTTTTCTAAC----------CTTCCATCTGCTA-TTACACAAACTC-AATTTAATTT-AAACTGAATGTAA--TTGATGTAA--CACATC-----TAA-TACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCATCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT-AAA--TATTTT----------GTTAATTCATTT----GGTTT----ACTTTGGATTTTGGAGG-CTTT---GCAGATTTTACAATCTGCTCCTCTTGAATATATTAGCTGGATCTC-AGTA-T-ATACTT-GGTTCCACTTGGCGTGATAAGT--ATCATTCGCTGAGG-ACCCCACCC------------ATAAAAAGGTG-GCCAAG--GAA--TACAGAT-GAACTGC-TTCTA-ATAGT--CTATTAA-ATTAGACAA----TTAAA-TTTCAAGATCT--GATCTC-AAATCAGGTAGGACTACCC 'vouchered mycorrhizae (Basidiomycota) AB303051' TATTGAATGAA----TCTAGAGTTG-GTT--GTTGCTGGCTTCT------------T--CAG---------GCATGTGCACACCTTCTCT------TTCATCC-ACACACACCC----CTGTGCACTTGTC-AGATTGGAAT---GCTGGAATAAA-----------T-TTTTCT-------TTTTTTTTTCTAAC----------CTTCCATCTGCTA-TTACACAAACTC-AATTTAATTT-AAACTGAATGTAA--TTGATGTAA--CACATC-----TAA-TACTAAGTTTCAACAACGGATCTC-TTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCG-ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC-GAATCTTTGAACGCATCTTGCGCTCCTTGGT-ATTCCTTGGAGCATGCCTGTTTGAGTATCATGA--AATTCTCAAAGT-AAA--TATTTT----------GTTAATTCATTT----GGTTT----ACTTTGGATTTTGGAGG-CTTT---GCAGATTTTACAATCTGCTCCTCTTGAATATATTAGCTGGATCTC-AGTA-T-ATACTT-GGTTCCACTTGGCGTGATAAGT--ATCACTCGCTGAGG-ACCCCACCC------------ATAAAAAGGTG-GCCAAG--GAA--TACAGAT-GAACTGC-TTCTA-ATAGT--CTATTAA-ATTAGACAA----TTAA--TTTCAAGATCT--GATCTC-AAATCAGGTAGGACTACCC ; END; BEGIN CODONS; CODONPOSSET * UNTITLED (CHARACTERS = Ceratobasidium) = N: 1-776; CODONPOSSET CodonPositions (CHARACTERS = Ceratobasidium) = N: 1-776; END; BEGIN TREES; TITLE Tulasnella; LINK TAXA = Taxa1; TRANSLATE 1 Epulorhiza_sp._RO_02_AB369933, 2 Epulorhiza_sp._Ag3b_AJ313436, 3 Epulorhiza_sp._Ss_AJ313438, 4 Epulorhiza_sp._B4_AJ313441, 5 Epulorhiza_sp._Van44_AJ313443, 6 Epulorhiza_sp._Am9_AJ313444, 7 Epulorhiza_sp._B1_AJ313445, 8 Epulorhiza_sp._Nq_AJ313446, 9 Epulorhiza_sp._Onv4.3_AJ313449, 10 Epulorhiza_sp._Ec1B_AJ313456, 11 uncultured_mycorrhizal_fungus_ex_Ophrys_sphegodes_AJ549122, 12 mycorrhizal_fungus_VIIf5_ex_Orchis_laxiflora_ssp._palustris_AJ549126, 13 'mycorrhizal fungus XII-1 ex Orchis morio AJ549127', 14 'mycorrhizal fungus O-19 ex Dactylorhiza incarnata AJ549130', 15 'mycorrhizal fungus O-2 ex Orchis laxiflora ssp. palustris AJ549133', 16 'Epulorhiza sp. 3-4Ll13-1p AM040890', 17 'fungal sp. 5OL1-9B1 AM697921', 18 uncultured_Tulasnella_AY192460, 19 uncultured_Tulasnella_AY192485, 20 Tulasnella_sp._245_AY373282, 21 Tulasnella_sp._233_AY373287, 22 Tulasnella_sp._238_AY373288, 23 Tulasnella_bifrons_AY373290, 24 Tulasnella_deliquescens_AY373291, 25 Tulasnella_eichleriana_AY373292, 26 Tulasnella_albida_AY373294, 27 Tulasnella_tomaculum_AY373296, 28 Tulasnella_danica_AY373297, 29 Tulasnella_calospora_AY373298, 30 Tulasnella_sp._169_AY373301, 31 uncultured_Tulasnellaceae_AY634122, 32 uncultured_Tulasnellaceae_AY634123, 33 uncultured_Tulasnellaceae_AY634130, 34 uncultured_Tulasnellaceae_AY634131, 35 Tulasnella_calospora_AY643804, 36 fungal_sp._AP2_AY643806, 37 Ceratobasidium_sp._UAMH_9846_DQ068770, 38 Ceratobasidium_sp._UAMH_9844_DQ068772, 39 Ceratobasidium_sp._UAMH_9845_DQ068773, 40 uncultured_Tulasnella_DQ178069, 41 uncultured_Tulasnella_DQ178074, 42 uncultured_Tulasnella_DQ178085, 43 uncultured_Tulasnella_DQ178086, 44 uncultured_Tulasnella_DQ178115, 45 Epulorhiza_sp._CBS_189.90_DQ278944, 46 Tulasnella_calospora_DQ388041, 47 Tulasnella_calospora_DQ388042, 48 Tulasnella_calospora_DQ388045, 49 Tulasnella_asymmetrica_DQ388047, 50 Tulasnella_pruinosa_DQ457642, 51 Tulasnella_violea_DQ457643, 52 'Tulasnella sp. GV-69 DQ834405', 53 'Tulasnella sp. PB-01 DQ834406', 54 uncultured_Tulasnellaceae_DQ925497, 55 uncultured_Tulasnellaceae_DQ925503, 56 uncultured_Tulasnellaceae_DQ925536, 57 uncultured_Tulasnellaceae_DQ925537, 58 uncultured_Tulasnellaceae_DQ925552, 59 uncultured_Tulasnellaceae_DQ925554, 60 uncultured_Tulasnellaceae_DQ925555, 61 uncultured_Tulasnellaceae_DQ925557, 62 uncultured_Tulasnellaceae_DQ925564, 63 uncultured_Tulasnellaceae_DQ925576, 64 uncultured_Tulasnellaceae_DQ925593, 65 uncultured_Tulasnellaceae_DQ925595, 66 uncultured_Tulasnellaceae_DQ925597, 67 uncultured_Tulasnellaceae_DQ925599, 68 uncultured_Tulasnellaceae_DQ925600, 69 uncultured_Tulasnellaceae_DQ925629, 70 uncultured_Tulasnellaceae_DQ925633, 71 uncultured_Tulasnellaceae_DQ925644, 72 uncultured_Tulasnellaceae_DQ925658, 73 uncultured_Tulasnellaceae_DQ925661, 74 uncultured_Tulasnellaceae_DQ925664, 75 'Epulorhiza sp. C6 CH06X1-1 EF393629', 76 Tulasnella_calospora_EF393631, 77 uncultured_Tulasnellaceae_EF433954, 78 uncultured_Tulasnellaceae_EU195344, 79 Tulasnella_irregularis_EU218889, 80 Epulorhiza_sp._UAMH_5430_EU218890, 81 Epulorhiza_anaticula_EU218891, 82 Epulorhiza_sp._Ep_Sst_07_EU418851, 83 uncultured_Tulasnellaceae_EU583690, 84 uncultured_Tulasnellaceae_EU583696, 85 uncultured_Tulasnellaceae_EU583697, 86 uncultured_Tulasnellaceae_EU583698, 87 uncultured_Tulasnellaceae_EU583702, 88 uncultured_Tulasnellaceae_EU583718, 89 uncultured_Tulasnellaceae_EU909163, 90 uncultured_Tulasnellaceae_GQ907254, 91 uncultured_Tulasnellaceae_GQ907258, 92 uncultured_Tulasnellaceae_GQ907263, 93 uncultured_Tulasnellaceae_GQ907266, 94 uncultured_Tulasnellaceae_GQ907271, 95 uncultured_Tulasnellaceae_GQ907278, 96 uncultured_Tulasnellaceae_GQ907279, 97 uncultured_Scleroderma_HM196776, 98 Tulasnella_sp._CP0835.VIII.2_HM196783, 99 'Tulasnella sp. 07033-45.II.2 HM196800', 100 uncultured_Tulasnella_HM196813, 101 Tulasnella_sp._MCU66440, 102 Tulasnella_sp._AL1_Tul_1, 103 Tulasnella_sp._AL1_Tul_2, 104 Tulasnella_sp._AL10_isolated_Tul_1, 105 Tulasnella_sp._AL10_isolated_Tul_2, 106 Tulasnella_sp._AL11_Tul, 107 Tulasnella_sp._AL12_Tul, 108 Tulasnella_sp._AL13_isolated_Tul, 109 Tulasnella_sp._AL13_Tul, 110 Tulasnella_sp._AL14_Tul, 111 Tulasnella_sp._AL2_Tul, 112 Tulasnella_sp._AL4_Tul, 113 Tulasnella_sp._AL6_Tul, 114 Tulasnella_sp._AL7_Tul, 115 Tulasnella_sp._BOP8_isolated_Tul, 116 Tulasnella_sp._OF1_Tul_1, 117 Tulasnella_sp._OF1_Tul_2, 118 Tulasnella_sp._OF10_Tul, 119 Tulasnella_sp._OF2_Tul, 120 Tulasnella_sp._OF3_Tul, 121 Tulasnella_sp._OF4_Tul, 122 Tulasnella_sp._OF5_Tul, 123 Tulasnella_sp._OF6_Tul, 124 Tulasnella_sp._OF7_Tul_1, 125 Tulasnella_sp._OF7_Tul_2, 126 Tulasnella_sp._OF8_Tul, 127 Tulasnella_sp._OF9_isolated_Tul, 128 Tulasnella_sp._OF9_Tul, 129 Tulasnella_sp._OP1_Tul, 130 Tulasnella_sp._OP2_Tul, 131 Tulasnella_sp._OP3_Tul, 132 Tulasnella_sp._OP4_Tul_1, 133 Tulasnella_sp._OP4_Tul_2, 134 Tulasnella_sp._OP5_Tul_1, 135 Tulasnella_sp._OP5_Tul_2, 136 Tulasnella_sp._OP6_Tul, 137 Tulasnella_sp._OP9_Tul_1, 138 Tulasnella_sp._OP9_Tul_2, 139 Tulasnella_sp._SV1_isolated_Tul, 140 Tulasnella_sp._SV1_Tul, 141 Tulasnella_sp._SV10_Tul, 142 Tulasnella_sp._SV11_Tul, 143 Tulasnella_sp._SV12_Tul, 144 Tulasnella_sp._SV13_Tul, 145 Tulasnella_sp._SV14__Tul, 146 Tulasnella_sp._SV14_Tul, 147 Tulasnella_sp._SV15_isolated_Tul, 148 Tulasnella_sp._SV16_Tul_1, 149 Tulasnella_sp._SV16_Tul_2, 150 Tulasnella_sp._SV17_isolated_Tul, 151 Tulasnella_sp._SV18_isolated_Tul, 152 Tulasnella_sp._SV18_Tul, 153 Tulasnella_sp._SV2_Tul, 154 Tulasnella_sp._SV20_Tul, 155 Tulasnella_sp._SV21_Tul, 156 Tulasnella_sp._SV3_Tul, 157 Tulasnella_sp._SV4_Tul, 158 Tulasnella_sp._SV5_Tul, 159 Tulasnella_sp._SV6_isolated_Tul, 160 Tulasnella_sp._SV6_Tul, 161 Tulasnella_sp._SV7_Tul, 162 Tulasnella_sp._SV8_isolated_Tul, 163 Tulasnella_sp._SV8_Tul_1, 164 Tulasnella_sp._SV8_Tul_2, 165 Tulasnella_sp._SV9_isolated_Tul, 166 Tulasnella_sp._SV9_Tul; TREE PAUP_1 = [&R] (((97:0.466761,101:0.322913):0.400675,(((25:0.05315,27:0.08664):0.046339,(100:0.0,(98:0.023647,99:0.005903):0.0):0.103254):1.431259,((55:0.244109,(33:0.246447,((71:0.049552,72:0.025713):0.14142,((88:0.019507,(10:0.056623,((56:0.0,57:0.0):0.030226,(89:0.004017,(146:0.003671,(113:0.001831,114:0.0):0.0):0.001841):0.0):0.003062):0.0):0.105422,(77:0.097318,(84:0.075366,((92:0.010774,(73:0.0,74:0.0):0.008248):0.014854,((82:0.007632,90:0.007275):0.013292,(80:0.013123,(11:0.001976,94:0.010299):0.0033):0.004621):0.001971):0.012224):0.068413):0.032086):0.009361):0.043512):0.186686):0.359258,(83:0.366632,((131:0.0,135:0.0):0.228148,((69:0.027245,70:0.016117):0.241263,(((65:0.004074,(64:0.0,66:0.0):0.001949):0.052656,((118:0.003858,120:0.003861):0.003847,(125:0.016042,(121:0.001917,(115:0.001917,(123:0.0,(122:0.0,(117:0.0,119:0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.110479):0.132469,((126:0.019866,(67:0.0,68:0.0):0.003264):0.125406,(((78:0.0,93:0.00192):0.118549,(87:0.100365,(86:0.0,(85:0.0,91:0.003891):0.003911):0.005356):0.050258):0.050477,(63:0.093519,((95:0.012732,(136:0.0,(134:0.0,(133:0.0,(129:0.0,130:0.0):0.0):0.0):0.0):0.007718):0.033155,((137:0.0,138:0.007817):0.005962,(96:0.007781,((60:0.0,61:0.0):0.007862,((1:0.001943,62:0.001941):0.00194,(58:0.00389,59:0.003884):0.0):0.001928):0.004043):0.0):0.04052):0.030664):0.004988):0.025345):0.032488):0.0):0.0):0.0):0.109776):0.0):1.981973):0.4669105,(79:0.170953,((18:0.005794,19:0.032013):0.433774,(((54:0.762566,(34:0.23996,40:0.105982):0.252547):0.187519,(49:0.108304,(41:0.130302,(50:0.080205,(26:0.02483,51:0.00722):0.063352):0.027615):0.067421):0.502188):0.262515,((44:0.038834,((45:0.135306,(28:0.046389,81:0.109564):0.027785):0.019788,(106:0.00375,(142:0.0,166:0.0):0.0):0.15787):0.027725):0.135392,(5:0.09069,(((42:0.0,43:0.0):0.030835,((20:0.020576,(35:0.009209,37:0.012293):0.00504):0.004931,(23:0.031697,(30:0.010238,(149:0.003337,(105:0.0,150:0.008605):0.003512):0.008939):0.010938):0.004879):0.015088):0.057689,(3:0.083753,((6:0.035312,((9:0.0,52:0.004636):0.014045,(147:0.003868,((38:0.004015,(31:0.0,(21:0.0,22:0.0):0.0):0.003295):0.003879,((127:0.007186,(132:0.00179,(139:0.0,(13:0.001871,140:0.0):0.0):0.0):0.0):0.001816,(156:0.0,(155:0.0,(154:0.0,(144:0.0,((116:0.001784,153:0.001787):0.001784,(165:0.001784,(143:0.001784,(141:0.0,161:0.0):0.001791):0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.005519):0.0):0.032553):0.015707):0.015843,((2:0.035106,(46:0.010988,(((32:0.0073,47:0.001932):0.003719,(76:0.010991,(36:0.001827,48:0.00192):0.0):0.001813):0.005546,(110:0.003619,((24:0.001897,29:0.0):0.003736,(107:0.003619,(108:0.0,109:0.0):0.001807):0.0):0.0):0.005602):0.0):0.00947):0.002336,(((151:0.0,152:0.0):0.00556,((112:0.003554,157:0.0):0.001758,(128:0.0,145:0.001962):0.003588):0.003576):0.00903,(((158:0.0,164:0.0):0.004496,(104:0.001077,((159:0.0,160:0.0):0.003512,(17:0.0,(39:0.003595,124:0.002204):0.0):0.0):0.007215):0.008318):0.001851,(((162:0.0,163:0.0):0.011675,(53:0.013889,(4:0.004977,7:0.003873):0.00735):0.003928):0.002159,((111:0.003522,148:0.0):0.005275,((102:0.005252,103:0.007017):0.0,((8:0.001744,75:0.001742):0.003525,((12:0.005409,16:0.0):0.0,(14:0.0,15:0.0):0.0):0.001808):0.005462):0.0):0.003961):0.004595):0.013798):0.0):0.03012):0.005248):0.003045):0.025321):0.040727):0.812516):0.278868):0.389704):0.4669105); END; BEGIN TREES; TITLE Sebacina; LINK TAXA = Taxa2; TRANSLATE 1 Sebacina_vermifera_AF202728, 2 'uncultured endomycorrhiza ex Neottia nidus-avis AF440647', 3 'uncultured endomycorrhiza ex Neottia nidus-avis AF440648', 4 'uncultured endomycorrhiza ex Neottia nidus-avis AF440651', 5 'uncultured endomycorrhiza ex Neottia nidus-avis AF440652', 6 'uncultured endomycorrhiza ex Neottia nidus-avis AF440656', 7 uncultured_mycorrhizal_fungus_ex_Dactylorhiza_incarnata_AJ549120, 8 Sebacinaceae_sp._B18_AJ549198, 9 uncultured_fungus_AJ875396, 10 uncultured_Sebacinaceae_AJ879655, 11 Sebacina_helvelloides_AJ966750, 12 Sebacina_incrustans_AJ966753, 13 Sebacina_epigaea_AJ966754, 14 uncultured_Sebacinales_AM181396, 15 uncultured_sebacinaceous_ectomycorrhiza_ERF3_AY093438, 16 uncultured_mycorrhiza_ex_Hexalectris_spicata_sp._E_AY243531, 17 uncultured_mycorrhiza_ex_Hexalectris_revoluta_sp._F_AY243532, 18 uncultured_ectomycorrhizal_fungus_AY277943, 19 uncultured_Sebacinaceae_AY286193, 20 Sebacinaceae_sp._F_JLP_1380_AY296259, 21 uncultured_Sebacinaceae_AY452678, 22 uncultured_Sebacinaceae_AY452680, 23 uncultured_Sebacinaceae_AY634132, 24 fungal_sp._CC2_AY643802, 25 uncultured_Sebacinales_DQ182435, 26 uncultured_Sebacinaceae_DQ273405, 27 Sebacina_sp._src835_DQ974770, 28 Sebacina_vermifera_DQ983815, 29 uncultured_Sebacinales_EF030946, 30 uncultured_Sebacinaceae_EF077512, 31 uncultured_Sebacinaceae_EF218817, 32 Sebacinaceae_sp._kz24_EF372401, 33 uncultured_Sebacinales_EF417824, 34 Geastrum_schmidelii_EU784247, 35 uncultured_Basidiomycota_HM241745, 36 uncultured_Basidiomycota_HM241756, 37 uncultured_Basidiomycota_HM241758, 38 uncultured_Basidiomycota_HM241759, 39 uncultured_Basidiomycota_HM241760, 40 Sebacina_sp._AL7, 41 Sebacina_sp._SV1, 42 Sebacina_sp._SV3, 43 Sebacina_sp._SV6, 44 Sebacina_sp._SV7, 45 Sebacina_sp._SV9; TREE PAUP_1 = [&R] ((23:0.262897,34:0.553376):0.388477,(((7:0.172019,(26:0.103264,(14:0.036809,(9:0.0,43:0.0):0.027349):0.137667):0.036834):0.22541,((35:0.002287,36:0.0):0.094579,((1:0.002311,28:0.0):0.046302,((24:0.0,39:0.008911):0.018526,(37:0.023118,38:0.033475):0.025811):0.017655):0.069077):0.274069):0.012642,((40:0.010903,(44:0.0,45:0.0):0.015122):0.114681,(30:0.189199,((12:0.069255,(11:0.016915,15:0.08857):0.067173):0.01681,((20:0.011059,32:0.01868):0.029032,(((17:0.026926,(27:0.007556,(13:0.009676,18:0.018524):0.020734):0.01148):0.01121,((19:0.0,25:0.026651):0.028961,(29:0.020781,(2:0.013544,3:0.004335):0.009394):0.002112):0.013444):0.019697,(22:0.081351,((8:0.0,(5:0.0,21:0.002138):0.010892):0.054796,((16:0.007386,33:0.010117):0.021564,((4:0.0,6:0.0):0.014865,(31:0.006503,(10:0.00274,(41:0.0,42:0.0):0.002173):0.008369):0.005127):0.002311):0.013564):0.012069):0.003831):0.018956):0.020312):0.042077):0.0473):0.374261):0.388477); END; BEGIN TREES; TITLE Ceratobasidium; LINK TAXA = Taxa3; TRANSLATE 1 Ceratobasidium_sp._AL1_Cer, 2 Ceratobasidium_sp._AL10_Cer, 3 Ceratobasidium_sp._AL11_Cer, 4 Ceratobasidium_sp._AL3_Cer_1, 5 Ceratobasidium_sp._AL3_Cer_2, 6 Ceratobasidium_sp._AL4_Cer_1, 7 Ceratobasidium_sp._AL4_Cer_2, 8 Ceratobasidium_sp._AL5_Cer_1, 9 Ceratobasidium_sp._AL5_Cer_2, 10 Ceratobasidium_sp._AL8_Cer, 11 Ceratobasidium_sp._AL8_isolated_Cer, 12 Ceratobasidium_sp._AL9_Cer_1, 13 Ceratobasidium_sp._AL9_Cer2, 14 Ceratobasidium_sp._BRAL9_Cer_1, 15 Ceratobasidium_sp._BRAL9_Cer_2, 16 Ceratobasidium_sp._CAAL8_Cer, 17 Cantharellales_sp._UAMH_5437_EU218893, 18 Ceratobasidium_albasitensis_AJ427399, 19 Ceratobasidium_anceps_AJ427402, 20 Ceratobasidium_angustisporum_AJ427403, 21 Ceratobasidium_bicorne_AF200514, 22 Ceratobasidium_cereale_AJ302009, 23 Ceratobasidium_cornigerum_AJ301902, 24 Ceratobasidium_papillatum_AJ427401, 25 Ceratobasidium_ramicola_AJ427404, 26 'Ceratobasidium sp. AG-A EU152858', 27 'Ceratobasidium sp. AG-B(o) DQ279057', 28 'Ceratobasidium sp. AG-Ba DQ279059', 29 'Ceratobasidium sp. AG-Bb DQ279058', 30 'Ceratobasidium sp. AG-C DQ279046', 31 'Ceratobasidium sp. AG-D DQ279060', 32 'Ceratobasidium sp. AG-E DQ279013', 33 'Ceratobasidium sp. AG-F DQ279014', 34 'Ceratobasidium sp. AG-G DQ102402', 35 'Ceratobasidium sp. AG-H DQ279065', 36 'Ceratobasidium sp. AG-I DQ102444', 37 'Ceratobasidium sp. AG-K DQ279056', 38 'Ceratobasidium sp. AG-L AF354093', 39 'Ceratobasidium sp. AG-O DQ279045', 40 'Ceratobasidium sp. AG-P DQ279015', 41 'Ceratobasidium sp. AG-Q DQ279061', 42 Ceratobasidium_sp._aurim1217_DQ093646, 43 Ceratobasidium_sp._FPUB_168_EF536969, 44 Ceratobasidium_sp._JTO048_AF472285, 45 Ceratobasidium_sp._JTO116_AF472299, 46 Ceratobasidium_sp._JTO124_AF472301, 47 Ceratobasidium_sp._JTO162_AF472302, 48 Ceratobasidium_sp._JTO163_AF472303, 49 Ceratobasidium_sp._olrim908_AY787667, 50 Ceratobasidium_sp._UAMH_5443_EU218894, 51 'Ceratorhiza oryzae-sativae EF429314', 52 Ceratorhiza_sp._UAMH_6440_EU218895, 53 fungal_sp._PN1_AY643803, 54 fungal_sp._PO1_AY643805, 55 'mycorrhizal fungus VII-17d ex Dactylorhiza incarnata AJ549123', 56 Ceratobasidium_sp._OF10_isolated_Cer, 57 Ceratobasidium_sp._OF2_Cer_1, 58 Ceratobasidium_sp._OF2_Cer2, 59 Ceratobasidium_sp._OF2_isolated_Cer, 60 Ceratobasidium_sp._OF3_Cer_2, 61 Ceratobasidium_sp._OF8_isolated_Cer, 62 Ceratobasidium_sp._OP1_Cer, 63 Ceratobasidium_sp._OP2_Cer, 64 Ceratobasidium_sp._OP7_isolated_Cer, 65 Ceratobasidium_sp._OP8_isolated_Cer, 66 Rhizoctonia_sp._162a_AY586182, 67 Rhizoctonia_sp._269_AJ419931, 68 'Rhizoctonia sp. 3-4Ll20-5p AM040889', 69 'Rhizoctonia sp. 85-387/Na AF200519', 70 Rhizoctonia_sp._Oss2_AJ318425, 71 Rhizoctonia_sp._Pha1_AJ318423, 72 Ceratobasidium_sp._SV11_Cer, 73 Ceratobasidium_sp._SV11_isolated_Cer, 74 Ceratobasidium_sp._SV19_isolated_Cer, 75 Ceratobasidium_sp._SV21_Cer, 76 Ceratobasidium_sp._SV3_Cer, 77 Ceratobasidium_sp._SV6_Cer, 78 Ceratobasidium_sp._SV8_Cer_1, 79 Ceratobasidium_sp._SV8_Cer_2, 80 Thanatephorus_cucumeris_AF354059, 81 uncultured_Basidiomycota_AY833047, 82 uncultured_Basidiomycota_AY970109, 83 uncultured_Ceratobasidiaceae_AY634119, 84 uncultured_Ceratobasidiaceae_AY634120, 85 uncultured_Ceratobasidiaceae_AY634126, 86 uncultured_Ceratobasidiaceae_AY634127, 87 uncultured_Ceratobasidiaceae_AY634128, 88 uncultured_Ceratobasidiaceae_AY634129, 89 uncultured_Ceratobasidiaceae_AY634163, 90 uncultured_Ceratobasidiaceae_DQ182419, 91 uncultured_Ceratobasidiaceae_HM141007, 92 uncultured_Ceratobasidiaceae_HM141017, 93 uncultured_Ceratobasidiaceae_HM141029, 94 uncultured_Ceratobasidiaceae_HM141032, 95 uncultured_Ceratobasidiaceae_HM141034, 96 uncultured_Ceratobasidiaceae_HM141039, 97 uncultured_Ceratobasidiaceae_HM141046, 98 uncultured_Ceratobasidium_FJ809765, 99 uncultured_Ceratobasidium_FJ809766, 100 uncultured_Ceratobasidium_FJ809767, 101 uncultured_fungus_DQ093780, 102 uncultured_fungus_EF433959, 103 'vouchered mycorrhizae (Basidiomycota) AB303044', 104 'vouchered mycorrhizae (Basidiomycota) AB303051'; TREE PAUP_1 = [&R] (((18:0.027306,(37:0.013045,(27:0.110366,(25:0.017837,26:0.022786):0.0):0.015923):0.134318):0.03532,(((21:0.0,69:0.002054):0.12014,(56:0.033334,(61:0.0,(60:0.002035,(5:0.008202,59:0.0):0.004105):0.0):0.0):0.070569):0.053057,((((30:0.007287,38:0.0):0.017071,(39:0.019591,(68:0.007689,(34:0.0,43:0.0):0.014103):0.0):0.0):0.014192,(89:0.044026,(90:0.015051,(95:0.015783,(82:0.004401,(3:0.0,(9:0.004403,57:0.0):0.0):0.0):0.0):0.011014):0.029877):0.091856):0.011358,(((103:0.002603,104:0.016774):0.155422,((44:0.039259,55:0.073707):0.01097,(64:0.0,65:0.002288):0.039306):0.033344):0.004706,((33:0.058567,40:0.049474):0.069547,((93:0.050045,94:0.015032):0.069964,(80:0.095528,(23:0.034562,(32:0.002061,((42:0.0,66:0.005816):0.0,(75:0.0,76:0.0):0.003818):0.001803):0.018435):0.030041):0.006637):0.002447):0.126957):0.089376):0.004705):0.018427):0.0862195,((17:0.241469,(((24:0.061454,92:0.056872):0.03145,((28:0.065622,(29:0.009227,51:0.010163):0.048633):0.042727,(45:0.032601,(46:0.030158,(70:0.0,71:0.0):0.013467):0.0):0.012285):0.037564):0.092085,((47:0.020047,48:0.030737):0.107414,((101:0.049649,(6:0.0,(7:0.004128,99:0.002064):0.0):0.017338):0.034558,((14:0.0,15:0.014647):0.02717,(52:0.030066,88:0.031468):0.016862):0.067754):0.011316):0.002493):0.114332):0.010522,((19:0.080244,(41:0.058845,(22:0.008123,31:0.017677):0.041962):0.070364):0.087968,((97:0.030398,(20:0.034617,102:0.035743):0.011285):0.064918,(67:0.054308,((53:0.032982,(49:0.040767,((54:0.011559,96:0.017502):0.015204,(35:0.079807,((36:0.004373,81:0.0):0.0,(87:0.0,(62:0.0,63:0.0):0.0):0.0):0.021417):0.024989):4.08E-4):0.013578):0.049451,(91:0.110975,(50:0.0,(83:0.002061,((4:0.0,58:0.0):0.002048,(86:0.0,(10:0.004142,((85:0.0,(16:0.0,84:0.0):0.0):0.0,(2:0.001955,(11:0.002048,((1:0.001963,98:0.0):0.001961,((74:0.001961,100:0.0):0.001946,((12:0.0,13:0.0):0.001958,(77:0.0,(72:0.0,(79:0.0,(8:0.0,(73:0.001959,78:0.001959):0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.00394):0.0):0.002206):0.0):0.0):0.0):0.0):0.0):0.03775):0.014957):0.034185):0.038213):0.013792):0.032609):0.0862195); END;