#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 21:18 GMT TreeBASE (cc) 1994-2008 Study reference: Jabaily R.S., & Sytsma K.J. 2010. Phylogenetics of Puya (Bromeliaceae): Placement, Major Lineages, and Evolution of Chilean Species. American Journal of Botany, 97(2): 337–356. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S11314] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=59; TAXLABELS Aechmea_nudicaulis Ananas_comosus Ananas_nanus Billbergia_euphemiae Billbergia_laxiflora Bromelia_agavifolia Bromelia_balansae Bromelia_flemingii Cryptanthus_bromelioides Cryptanthus_dorothyae Deinacanthon_urbanianum Greigia_sp. Neoregelia_cruenta Ochagavia_elegans Orthophytum_gurkenii Pepinia_sanguinea Pitcairnia_orchidifolia Portea_fosteriana Puya_alpestris_1 Puya_alpestris_2 Puya_angusta Puya_angusta_2 Puya_bicolor Puya_boliviensis_1 Puya_boliviensis_2 Puya_castellanosii Puya_chilensis_1 Puya_chilensis_2 Puya_coerulea_1 Puya_compacta Puya_dasylirioidea Puya_dyckioides Puya_ferreyrae Puya_ferruginea_1 Puya_ferruginea_2 Puya_ferruginea_3 Puya_gilmartiniae Puya_goudotiana Puya_hamata Puya_harmsii Puya_herrerae Puya_lanata Puya_lineata Puya_macrura Puya_mima Puya_nana Puya_nitida_2 Puya_nutans Puya_obconica Puya_pygmaea Puya_raimondii Puya_raimondii_1 Puya_santosii Puya_trianae Puya_ultima Puya_venusta_1 Puya_venusta_2 Puya_wrightii Puya_yakespala ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=74; TAXLABELS Aechmea_nudicaulis Ananas_comosus Ananas_nanus Billbergia_euphemiae Billbergia_laxiflora Bromelia_agavifolia Bromelia_balansae Bromelia_flemingii Bromelia_pinguin Cryptanthus_bromelioides Cryptanthus_dorothyae Deinacanthon_urbanianum Deuterocohnia_longipetala Deuterocohnia_meziana Dyckia_pseudococcinea Fernseea_itatiaiae Fosterella_albicans Greigia_sp. Hechtia_lundelliorum Neoregelia_cruenta Ochagavia_carnea Ochagavia_elegans Ochagavia_lindleyana Orthophytum_gurkenii Pepinia_sanguinea Pitcairnia_feliciana Pitcairnia_maidifolia Pitcairnia_orchidifolia Portea_fosteriana Puya_alpestris_1 Puya_alpestris_2 Puya_angusta Puya_angusta_2 Puya_berteroniana Puya_bicolor Puya_boliviensis_1 Puya_boliviensis_2 Puya_castellanosii Puya_chilensis_1 Puya_chilensis_2 Puya_coerulea_1 Puya_coerulea_2 Puya_compacta Puya_dasylirioidea Puya_dyckioides Puya_ferreyrae Puya_ferruginea_1 Puya_ferruginea_2 Puya_ferruginea_3 Puya_gilmartiniae Puya_goudotiana Puya_hamata Puya_harmsii Puya_herrerae Puya_lanata Puya_lineata Puya_macrura Puya_mima Puya_mirabilis Puya_nana Puya_nitida_1 Puya_nitida_2 Puya_nutans Puya_obconica Puya_pygmaea Puya_raimondii Puya_raimondii_1 Puya_santosii Puya_trianae Puya_ultima Puya_venusta_1 Puya_venusta_2 Puya_wrightii Puya_yakespala ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M8217] TITLE PhyC; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1048; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aechmea_nudicaulis -------------------------------GGGAATAT-TCCTTTACTGTGTGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAGGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCTGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAATGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGCTTGGTGGTTTGCCATCACACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGGTATGCTTGTGAGTTCCTGTTGCAG-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTACTTCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTCATGGATCTTGTTAAGTGCCACGGCGCGGCACTTT-ATTACAGAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTGTCATGATGGGTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTTCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCCGATAGGGATGATGAGGGACGGAAAATGCATCCACGGTCTTCGT-- Ananas_comosus ATCTCTAGG-CT-ACAG-TCTTTACCCAG?TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGTTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCCACTGATATCCCGCAGGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCACCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCATGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGGTATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAA-GGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGCGCAGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTTCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCCGATAGGGATGACGAGGGACGGAAAATGCATCCGCGGTCTTCGTTC Ananas_nanus ATCTCTAGG-CT-ACAG-TCTTTACCCAG-GGGGAATAT-TCCTTTACTGTGCGATG-TTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGTTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTTTCTCGGCTTGCACTATCCTGCCACTGATATCCCGCAGGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGGTATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGCGCAGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGTCGTGGCTTTTAGAGTATCATGATGGGTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTTCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCCGATAGGGATGACGAGGGACGGAAAATGCATCCGCGGTCTTCGTT- Billbergia_euphemiae ---------------------TTACCCAG-{CT}GGGAATAT-TCCTTTACTGTGTGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTT{AT}TCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAGGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCTGCCGGTCAAGGTAATACAGGATAAGAGACTGGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAATGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGCTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGGTATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCT{GT}CGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTCATGGATCTTGTTAAGTGCCACGGCGCGGCACTTT-ATTACAAAA{AG}-TCAATTTTGGCTTCTTGGAACTACACCTTCTGA{GT}TCGCAGATAAAGGATATTGTGG{CT}GTGGCTTTTAGAGTG{CT}CATGATGGGTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCAATTAAGATTACTTCAAACGGATTTTATGTTTTGGTTTCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCCGATAGGGATGATGAGGGACGGAAAATGCATCCACG---------- Billbergia_laxiflora ATCTCTAGG-CT-ACAG-TCTTTACCCGG-TGGGAATAT-TCCTTTACTGTGTGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAGGCTTCGAGGTTTCTTTTTTTGAAGAACAAAGTGAGGATGATTTG{CT}GATTGCACTGCTCTGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACC{AG}GCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGG{AC}TTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGGTATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTTCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTCATGGATCTTGTTAAGTGCCACGGCGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTGTCATGATGGGTC{AT}ACAGGGTTGAGCACCGACAG{CT}TTGGCAGAAGCCGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTTCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGA{AT}CCGGCCGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCATT- Bromelia_agavifolia ATCTCTAGG-CT-ACAG-TCTTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGCGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACCGATATCCCGCAGGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTC?AC{AG}TTGAGAGCTCCTCATGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAATTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGCGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGACTCGCAGATAAAGGACATAGTGGCGTGGCTTTTAGAGTATCATGATGGTTCTACAGGCTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCAATTAGGATTACTTCAAA-GGATTTTATGTTTTGGTTTCGATCCCACACTG{AC}AAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACC{AG}GCCGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCGTT- Bromelia_balansae ------------------------------------------------------------------TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGCGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACCGATATCCCGCAGGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTGAGAGCTCCTCATGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAAAGTGTTCAGTATTCAGCTGAACAAAGAGGTAGAATTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGT{CT}AAGTGCCACGGCGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGACTCGCAGATAAAGGACATAGTGGCGTGGCTTTTAGAGTATCATGATGGTTCTACAGGCTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCAATTAGGATTACTTCAAA-GGATTTTATGTTTTGGTTTCGATCCCACACTGCAAAGGAGATTAAA------------------------------------------------------------------------- Bromelia_flemingii ATCTCTAGG-CT-ACAG-TCTTTACCCAGCTGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGCGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACCGATATCCCGCAGGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTGAGAGCTCCTCATGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAGCCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCC{AG}AGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAATTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTCAAGTGCCACGGCGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGACTCGCAGATAAAGGACATAGTGGCGTGGCTTTTAGAGTATCATGATGGTTCTACAGGCTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGTGCTTCTGCTTT{GT}GGAG?CGCAGTCTGTGGCAT{CG}GCCGCAATTAGGATTACTTCAAA-GGATTTTATGTTTTGGTTTC{GT}ATCCCACACTG--------------------------------------------------------------------------------------- Cryptanthus_bromelioides ----------------------------G-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCACGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAGGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCCGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCATGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAGGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGCTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGGTATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGCGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTGATGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCTGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCGATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTTCGATCCC?C{AG}CTGC-------------------------------------------------------------------------------------- Cryptanthus_dorothyae ATCTCTAGG-CT-TCAG-TCTTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCACGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAGGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCCGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCATGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAGGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGCTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGGTATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGCGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTGATGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCTGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCGATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTTCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCCGATAAGGATGACGAGGGACGGAAAATGCATCCGCGGTCTTCGT-- Deinacanthon_urbanianum --------------------------------GGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACCGGGTACGACCGGGTGATGGCTTACATGTTCCACGAAGACGAGCACGGCCAAGTAATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCA{AG}GCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGGTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGACGAGGAAGAAACCGGCAGCGACCAACAACAGCACATGGCGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCCCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATATTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGCGCGGCGCTTT-ATTACAAGAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTG{CG}C{CT}TTTAGAGTATCATGATGGCTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCCGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCGTT- Greigia_sp. ------AGG-TT-ACAG-TCTTTACCCAG-TGGGAACAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCACGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGCGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGTTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGGTATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTCATGGATCTTGTTAAGTGCCACGGCGCGGCACTTT-ATTACAGAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTTGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGCTCTACAGGGTTGAGTACCGACAGCTTGGCAGAAGCCGGTTATCCCGGTGCTTCTGATTTGGGAGACGCAGTCTGCGGCGTGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCCGATAGGGATGATGAGGGACAAAAAATGCATCCGCGGTCTTCGTT- Neoregelia_cruenta ---------------------------------------------------------------------------------------------------------------------------------------------TATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCC{AG}CAGGCCTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCTGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCC?CTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGAGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGGTATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGTTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTTCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGCGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCACAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTGTCATGATGC{AG}TCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCTGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTTCGATCCCAC{AT}CTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCCGATAGGGTTGATGAGGGACGGAAAATGCATCCGCGGTCTTCGTT- Ochagavia_elegans ATCTCACGG-TT-ACAG-TCTTTACCCAG-TGGGA{AG}TAT-TCCTTTACTGTGTGATGTTT{AT}-GGT-TCGGGAGGTGAGCGAGCTTACCGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCACGGCGAAGTAATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAGGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCCGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGTTCTATTGCCTCCCTCGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGGTATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTCATGGATCTTGTTAAGTGCCACGGCGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTTGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGCTCTACAGGGTTGAGTACCGACAGCTTGGCAGAAGCCGGTTATCCCGGTGCTTCTGATTTGGGAGACGCAGTCTGTGGCATGGCCGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCCGATAGGGATGATGAGGGACGAAAAATGCATCCGCGGTCT------ Orthophytum_gurkenii --------------------------------------------------------------GGT???GGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCACGGCGAAGTTATAGCCGAGTGTAGGAGATCGGACCTGGACCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAGGCTTCGAGGTTTCTTTTCATGAAGAACAAGGTGAGGATGATTTGCGATTGCACCGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTGAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTCGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCGGCGACCAACAGCAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCGCTCAGGTATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGCGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTCGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTTCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCCGATAGGGACGATGAGGGACGGAAAATGCATCCGCGGTCTTCGTT- Pepinia_sanguinea ---------------------------------GAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTTAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGCAGGAGATCGGATTTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTACGATTGCACTGCTCCGCCAGTCAAGGTGATACAGGACAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCATGGCTGCCACGCTCAGTATATGGCTAATATGGGTTCTATCGCCTCCCTTGTCATGTCTGTTACCATTAATGAGGATGAGGAAGAAATCGGTGATGACCAACAACAACACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCGTATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGACGCTCCCATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTCGTTAAGTGCCACGGCGCGGCACTTT-ATTATAGAAA-TCAATTTTGGCTTCTTGGGACTACACCTTCTGAGTCTCAGATAAAGGATATTGTGGCGTGGCTTTTGGAGTATCATGATGGCTCTACAGGGTTGAGCACCGACAGCTTGGGAGAAGCCGGTTATCCTGGTGCTTCTGCTTTGGGAGATGTAGTCTGTGGCATGGCCGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTTCGATCCCACACTGCGAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGA?CCGGCCGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCATT- Pitcairnia_orchidifolia --------------CAG-TCTTTACCCAG-{CT}GGGAATAT-TCCTTTACTGTGCGATG{CT}{CT}{CT}??GGT-TCGGGAGGTTAGCGAGCTTACGGGG{GT}ACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGCAGGAGATCGGATTTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTACGATTGCACTGCTCCGCCAGTCAAGGTGATACAGGACAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGTTCTATCGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAATCGGCGATGACCAACAACAACACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCGTATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGACGCTCCCATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTCGTTAAGTGCCACGGCGCGGCACTTTTATTATAGAAA-TCAATTTTGGCTTCTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Portea_fosteriana ATCTCTAGG-CT-ACAG-TCTTTACCCAG-TGGGAATAT-TCCTTTGCTGTGCGA{CT}GTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAGGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCTGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCCGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCT{CT}GTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGCTTGGTGGTTTGCCATCACACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGGTATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAAGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACACTTCTTTGTGATATGCTTCTTCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGCGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGT{GT}GTGTGGCTTTTAGAGTGTCATGATGGGTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTTCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCAGCCGATAGGGATGATGAGGGACGGAAAATGCAT--------------- Puya_alpestris_1 -------------------------------GGGAACAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATTTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGTGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTACATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCGCTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTGTTGGTATTTTCGCTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGCTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCTGGTTATCCCCGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCCGATAGGGATGATGAGGGACGGAAAATGCATCCGAGGTCTTCGTT- Puya_alpestris_2 ATCTCAAGG-TT-ACAGATCTTTACCCAG-TGGGAACAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATTTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGTGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCGCTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTGTTGGTATTTTCGCTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puya_angusta -----------------------------------------CCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTGTTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCATGGTGCAGCACTTT-ATTACAAAAA-TCATTTTTGGCTTCTTGGAACTACACCTTCTGAGTCACAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGCTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCTGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGC--------------------------------------------------------------------------------------------------------------------------------------------- Puya_angusta_2 --------------------------------------------------------------------------------------------ACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATC{CT}TGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGG{AG}AGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAA{AG}GAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCT{AG}TTGGTATTTTC{AT}CTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTAC{AC}GGGTTGAGCACCGACAGCTTGGCAGAAGCCGG{CT}TATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGA{AG}CCGGCTGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCGT-- Puya_bicolor ATCTCAAGG-TT-ACAG-TCCTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCACGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTATGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGATGATGAGGGGCGGAAAATGCATCCGCGGTCTTCGTT- Puya_boliviensis_1 -------------------------------GGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTG{CT}GATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTC?ACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTC{CT}GTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGG{AG}AGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCC{AG}CTCAGATATGC{GT}TGTGAGTTCCTGTTGCAA-GTGTTCAG{CT}ATTCAGCTGAACAAGGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTGTTGGTATTTTCTCTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTC{CT}TGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGCTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGCTATCCCGG{CT}GCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGG{AC}GAT?A-A-TGGGGTGGAGCTAAAAATGAACCGGC---------------------------------------------- Puya_boliviensis_2 ATCTCAAGG-TT-ACAG-TCCTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCAACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGAAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCGTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAGGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTGTTGGTATTTTCTCTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGCTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCGTT- Puya_castellanosii -------------------------------GGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCAGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCT?CCGGGTTGAGC?CCG?CAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAG??????ATGGGGTGGAGCTAAAAATGAACCA------------------------------------------------ Puya_chilensis_1 ATCTCAAGG-TT-ACAG-TCCTTACCCAG-TGGG{AC}ATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCAACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGAAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCGTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAGGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTGTTGGTATTTTCTCTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGCTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCGT-- Puya_chilensis_2 ---------------------TTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCAACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGAAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCGTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAGGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTGTTGGTATTTTCTCTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puya_coerulea_1 ---------------------------------------------------GCGATGTTTT{AT}GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGG{CT}GAAGTTATAGCCGAGTGTAGGAGATCGGATTTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGTGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCGCTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTGTTGGTATTTTCGCTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCA{AT}GATGGCTCTACAG{AG}GTTGAGCACCGACAGCTTGGCAGAAGCTGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TG{GT}GGTGGAGCTAAAAATGAACCGGCCGATAGGGATGATGAGGGACGGAAAATGCATCCGAGGTCTTCGTT- Puya_compacta ------------------------CCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTATGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGA---------------------------------------------------- Puya_dasylirioidea -------------------CCTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTATGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGATGATGAGGGGCGGAAAATGCATCCGCGGTCTTCGT-C Puya_dyckioides ATCTCAAGG-TT-ACAG-TCCTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGAGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCAGCACTTT-ATT{AG}CAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGA??ATGAGGGACGGAAAATGCATCCGCGGTCTTCGTT- Puya_ferreyrae -------------------CCTTACCCAG-?GGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCAGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAACTGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGATGATGAGGGACGG------------------------ Puya_ferruginea_1 ------AGG-TT-ACAG-TCCTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAGCCGGCTGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCGT-- Puya_ferruginea_2 ------------------------------TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGAAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTC-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAGCCGGCTGATAGGGATGATGTGGGACGGAAAATGCATTC------------- Puya_ferruginea_3 ------------------------------TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAGCCGGCTGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCGTT- Puya_gilmartiniae ---------------------------------------------------------------------------GAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAG????AGCCGAGTG{CT}AGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCAACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGAAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCGTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAGGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTGTTGGTATTTTCTCTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGCTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCGT-- Puya_goudotiana ATCTCAAGG-TT-ACAG-TCCTTACCCAG-?GGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTATGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGG{GT}CTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGA?GATGAGGGGCGGAAAATGCATCCGCGGTCTTCGTT- Puya_hamata ----------------------------------AATAT-TCCTTTACTGTGCGA{CT}GTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGG{CT}GAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTATGTGATATGCTTCTGCGAGATGCTCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puya_harmsii ATCTCAAGG-TT-ACAG-TCCTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAA{CT}GAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATAC{AG}AGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGC{AG}GCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGA{AG}CCGGCTGATAGGG?TG?TGAGGGACGGAAAATGCATCCGCGGTCTTCGT-- Puya_herrerae ATCTCAAGG-TT-ACAG-TCCTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCATGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAGCCGGCTGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCGT-- Puya_lanata ATCTCAAGG-TT-ACAGATCCTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGAGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCCGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCAGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGATGATGAGGGACGGAAAA-------------------- Puya_lineata ATCTCAAGG-TT-ACAG-TCCTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCACGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTATGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGATGATGAGGGGCGGAAAATGCATCCGCGGTCTTCGTT- Puya_macrura -----------------------------------------------------------------------------------------------------------------------------------------AAGTTATAGCCGAGTGTAGGAGATCGGAT?TGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATC{CT}TGTCCGGCTCGACGTTAAGAGCTCCTCACGG{CT}TGCCACGCTCAGTATATGG{CT}TAATATGGGCTCTATTGCCTCCCTTGTCATGTC{CT}GTTACCATTAACGAGGATGAGGAAGAAACCGGCA{GT}TGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAG{CT}ATTCAGCTGAACAAAGAGGTAGAGTTA{CG}AGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCT{AG}TTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCA{CT}GGTGC{AG}GCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGG{CG}TCTAC{AC}GGGTTGAGCACCGACAGCTTGGCAGAAGC{CT}GGTTATCCCGG{CT}GCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGC{CT}GCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTA?A-TGGGGTGGAGCTAAAAATGAACC{AG}GCTGATAGGGATGATGAGGGACGGAAAATGCATCCG{AG}GGTCT------ Puya_mima -----------------------------------------------------------------------------------------------------TGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATTTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGTGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCATTGACCAACAACAGCACATGGGGAGGAAGCT{CT}TGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTACAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTGTTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCATGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCACAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGCTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCTGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAGA-TGGGGTGGAGCTAAAAATGAACCAGCT?ATAGGGATGATGAGGGACG{AG}AAAA-------------------- Puya_nana AT{CT}TCAAGG-TT-ACAG-TCCTTACCCAG-TGGGAATAT-TCCTTT{AG}CTGTG{CT}GATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGAGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACC{AG}GCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAG{CG}AAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCAGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCGTT- Puya_nitida_2 ------AGG-TT-ACAG-TCCTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCACGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTATGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGATGATGAGGGGCGGAAAATGCATCCGCGGTCTTCGT-- Puya_nutans ATCTCAAGG-TT-ACAG-TCCTTACCCAG-TGGGAATAT-TCCTTTACTGTGC?ATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGG?TGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATAC{AG}AGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTATGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGATGATGAGGG{AG}CGGAAAATGCATCCGCGGTCTTC---- Puya_obconica -----------------------------------------------------------------------------------------------------TGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTATGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGATGATGAGGGGCGGAAAATGCATCCGCG---------- Puya_pygmaea -----------T-ACAG-TCCTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTATGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGATGATGAGGGGCGGAAAATGCATCCGCGGTCTTCGT-- Puya_raimondii --------------------CTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTCCCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAGCCGGCTGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCGT-- Puya_raimondii_1 ATCTCAAGG-TT-ACAG-TCCTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAGCCGGCTGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCGTT- Puya_santosii ATCTCAAGG-TT-ACAG-TCCTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCC{GT}TATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAACTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCAGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCGT-- Puya_trianae ATCTCAAGG-TT-ACAG-TCCTTACCCAG?TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCA{AG}CTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTATGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGC{AG}GCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGATGATGAGGGGCGGAAAATGCATCCGCGGTCTTCGTT- Puya_ultima ATCTCAAGG-TT-ACAG-TCCTTACCCAG-TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCCCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCAGCACTTT-ATTACAAAAA?TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puya_venusta_1 ATCTCAAGG-TT-ACAG-TCTTTACCCAG-?GGGAACAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGG?GAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATTTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGTGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCGCTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTGTTGGTATTTTCGCTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGCTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCTGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCCGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCGTT- Puya_venusta_2 ATCTCAAGG-TT-ACAG-TCTTTACCCAG-TGGGAACAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATTTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGTGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCGCTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTGTTGGTATTTTCGCTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puya_wrightii ------------------------------TGGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTAC{CG}GGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGAGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCCGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCAGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCG{AG}C?CTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAACCGGCTGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTCTTCGTT- Puya_yakespala -------------------------------GGGAATAT-TCCTTTACTGTGCGATGTTTT-GGT-TCGGGAGGTGAGCGAGCTTACGGGGTACGATCGGGTGATGGCTTACATGTTCCACGAAGACGAGCATGGCGAAGTTATAGCCGAGTGTAGGAGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAA-GTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAG-ACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTT-ATTACAAAAA-TCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAA-GGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAA-TGGGGTGGAGCTAAAAATGAGCCGGCTGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGTC------- ; END; BEGIN CODONS; CODONPOSSET * UNTITLED (CHARACTERS = PhyC) = N: 1-1048; CODONPOSSET CodonPositions (CHARACTERS = PhyC) = N: 1-1048; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M8216] TITLE cpDNA; LINK TAXA = Taxa2; DIMENSIONS NCHAR=2571; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aechmea_nudicaulis AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGCGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTGACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATA-----------------------------------------AATCTTGGTTAAAATCCTTCAATGTCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTTGTTCCTATATAATTCTTATGTATCTGAATGTGAATTTTTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAGGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAATAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTAGTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTGCAAACTTGTTCTGAATTTGAACCTTTCA-TTT-CAATTTAGAATTTATATATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCTTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCGGAACA-----AGCTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GACGGCGG-ATGTC Ananas_comosus AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGCGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAAA--TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGGAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT-AATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTGACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTGCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCTTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GACGGCGG-ATGTC Ananas_nanus AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGCGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAAA--TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGGAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTGACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTGCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCTTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GACGGCGG-ATGTC Billbergia_euphemiae AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGCGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAA----------------------------------------------------------TCTATCTTAATTGGAATCTTACTTGACTATAGTATTTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCCGGCCCTGCACAAATATG-TCCA--CGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATA---------------------------------------------------------------------------------------------------------------CACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGTGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCCC-TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTAGTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTAATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTGCAAACTTGTTCTGAATTTGAACCTTTCA-TTT-CAATTTAGAATTTATATATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCTTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCGGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GACGGCGG------ Billbergia_laxiflora AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACAGTATACATAGATACATGATCTAGTATGTTTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGCGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATACAAAAACAAAAA-TGTCACTCCTTCAAATAAATTAGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTGACTATAGTATCTGAAGTATACTATCTAAG---------------------------TATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGTGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTTACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTAGTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTGCAAACTTGTTCTGAATTTGAACCTTTCA-TTT-CAATTTAGAATTTATATATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTAACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCTTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCGGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GACGGCGG-ATGTC Bromelia_agavifolia AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACAGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAAAA-TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATTTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTTCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCTTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCCTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGGT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAGGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCGGTCGGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-----ATATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAG-GATGGCGG-ATGTA Bromelia_balansae AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTTGATGTATCTATGTATACAGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCAGAGTTCTGAAAAAAAAAA-TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATTTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAT-GCTCGTATCAGGAAAGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCTTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCCTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGGT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCGGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCAGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-----ATATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAG-GATGGCGG-ATGTA Bromelia_flemingii AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACAGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAAAAATTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATTTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTTCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCTTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCCTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGGT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCAAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCGGTCTGATCCAATTGTATTGTTGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTC-AAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-----ATATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAG-GATGGCGG-ATGTA Bromelia_pinguin GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACAGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAAT----TGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAAAA-TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATTTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATTTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GCTCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCTTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCCTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGGT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCGGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-----ATATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAG-GATGGCGG-ATGTA Cryptanthus_bromelioides GGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACGTAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGCGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCTGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTAGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCTTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATTCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTAGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATTAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT--ATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTAGTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGCGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACCCTTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTGCAAACTTGTTCTGAATTCGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATGCTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCTTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCGGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-G------------- Cryptanthus_dorothyae AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACGTAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGCGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCTGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTAGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATACCGTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCTTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATTCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTAGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATTAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTAGTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGCGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACCCTTTTTT--GTTATTTCTTTCTATAGAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTGCAAACTTGTTCTGAATTCGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATGCTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCTTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCGGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GACGGCGG-ATGTC Deinacanthon_urbanianum AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAGGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGCCTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TCCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTAGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTTTTTACGATTAACATCTTCTGT------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCGTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Deuterocohnia_longipetala GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGG--TAATCTCTATTTTATTCCTACGAATAGAATAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACAGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATTAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCTGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCTAATAAATTTGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGTAACCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATGATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGTA-----------------GTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTTTCATTACTCCGAAGAAATCAATTGACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATACAATTCTTATGTATCTGAATGCGAATT?GTATTCGTTTTTCTTCGTAAACAATCTTCTTA????CGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTT{CT}TGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATAT?ATTTTCATTTT?GGTCTCA?CCACACAGG?TTCATATAAACC-AATTA?CAAACTATTCCTTCT?TTTT?TGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCT?ATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACTGTATCGGGACACCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAATGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATTAT-GAATTTTACTAC-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTAACAATTTCGAAAAATTTGACTTTTCAAACTTGTTCCGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAACGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTAAAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCCTCATTA-CTATAGAA-GATGGCGG-ATGTA Deuterocohnia_meziana AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGG--TAATCTCTATTTTATTCCTACGAATAGAATAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACAGTATACATAGATACATGATCTAGTATGTCTACTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATTAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCTGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGGCACTCCTTCTAATAAATTAGAATTGTGAGACATATTAAGATGCAATCTGAGTTCTGAAAAAAA----TTCTATTTTAATGTTATTAATTGGATCTAATAAA--------------------------------------------------CTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATTTAAGTATCTGGCC-----------------------------------------------------------------------------------------------------------------------------------------TTGGAAATCCTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGTAATAGTCTCATTACTCCGACGAAATCCATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTCTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTC?GGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TTTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCACATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACTGTATCGGGACACCCCATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAATGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAAGTGAGTACTTTT---------------------T-CTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTGATTCCTCAGCCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTTTGATACACTTTTCATCGAAATAGTTTTAACAATTTCGAAAAATTTGACTTTTCAAACTTGTTCCGAATTTGAACCTTTCAATTTATAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAAGGAATTAATCCTTTCTTCTCGAGCTTCAT-------------------------------------TAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Dyckia_pseudococcinea GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGG--TAATCTCTATTTTATTCCTACGAATAGAATAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACAGTATACATAGATACATGATCTAGTATGTCTACTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATTAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCTGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTGAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGGCACTCCTTCTAATAAATTAGAATTGTGAGACATATTAAGATGCAATCTGAGTTCTGAAAAAAA----TTCTATTTTAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGTAACCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATTTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATGATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGAAAGGAAGAAAATGCGGATATATGTGATAGATATACTAATACCCTATCCTATCCATTTGGAAATCCTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGTAATAGTCTCATTACTCCGACGAAATCCATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTCTTTTCAGAAAACTCTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AGTTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TTTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCACATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACTGTATCGGGACACCCCATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAATGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAAGTGAGTACTTTTT-CTTCTTCCTTACAGAAAAATTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTGATTCCTCAGCCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACGTACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTTTGATACACTTTTCATCGAAATAGTTTTAACAATTTCGAAAAATTTTACTTTTCAAACTTGTTCCGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAACGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTAAAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCCTCATTA-CTATAGAA-GATGGCGG-ATGTA Fernseea_itatiaiae AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCAAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAGGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCG----------------------------------------------------GTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTATGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTTTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAA------AAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCAAAAAATAAT-GAATTTTACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCGTTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTGCAAACCTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTACCTATAGAA-GATGGCGG-ATGT- Fosterella_albicans GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGG--TAATCTCCATTTTATTCTTACGAATAGAATAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAGGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATTAAATCCTTTCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCTAATAAATTAGAATTGTGAGACATATTAAGATTCCATCTGAGTTCTGAAAAGAA----TTCAATTTCAATCTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TTGTAACCTT-----ACTTTACTATAGTATAGTATCTGAAATATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATGATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAGTGCGGATATTTGTGTCAGATATACTAATACCCTATCCTATCCATTTTGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATGCAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AGGTGGAAA-TGCTACTTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTATGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACTGTATCGGGACACCCTATTAGTAAGCCGGT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAATGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTCGAATTGATTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCAAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTAAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCGTCGAAATAGTTTTACCAATTTCCAAAA-TTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTTGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAACCAAGAGCATCCTCATTA-CTATAAAA-GATGGCGG-ATGTA Greigia_sp. ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TATGTATCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTTGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTTTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATGGAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACTTTATGGTTCTTCACAGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAA------AAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACCCTTTTGTTTGTCTCATTTCCAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCTTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTAGAAAAATTGGACTTTTCAAACTTGTTCTGAATTAGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Hechtia_lundelliorum ------------------------------------------------------------------------------------------------------------------------GAATCCATATTTTGATGTATCTATGTATACGGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTTATGTCCGAATAAAATAAAGTGTTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATTAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTAATGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGC{AG}TTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATT{AC}TTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTT{AC}TAATAAATTCGAATTGTGAGCCATATTAAGATTCAAT{AC}TGAGTT{AC}TGAAAAAAAAAA-TTCTATTTCAATGTTATTAATTGGATCTAATAAATAGGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTCTCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATGATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTTGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTTGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTTTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACTGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGAACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGCTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAATGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATCATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAGGTAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTTAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTTTGTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCGATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATCATGTACTATTTACTTATAA-----CCCAACACAAATAAGGTTCCGGGCAGAACAGAACAAACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Neoregelia_cruenta AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCCGCTTGTGAAATAAAGACTAACCTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGCGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAAA--TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTGACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGTGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTGTAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGAAAAAGC-AATTCTGGCTTCAAAGGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAACCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCCC-TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTTAGTACTCTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTAGTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAACGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTGCAAACTTGTTCTGAATTTGAACCTTTCA-TTT-CAATTTAGAATTTATATATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCTTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCGGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GACGGCGG-ATGTC Ochagavia_carnea AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCGGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCCTATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTTGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAA---TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTCAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGG----------------------------------------------------------------------CAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTAGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATTGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCTAAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT--TATATATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATG---------- Ochagavia_elegans AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCCTATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTACCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAATTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTCAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAA----------------------------------------------------------AATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTAGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTAGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCGAGGAAAAGC-AATTCTGGCTTCAAAAGGAACTCATCTTTTGATGAAG-AAGTGGAAA-TGGTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACAGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTG---------------------------------------------------------------------TTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTATGATCCAATTGT-----TGAGACAATTGAAAATTGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT--TATATATAGTAAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Ochagavia_lindleyana GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCCTATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTGGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAA---TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTCAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGG--------------------------------------------TATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT--------------CCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATTGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT--TATATATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATG-- Orthophytum_gurkenii GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCCAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCAAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCCCCATGATGGATTTTATTACAATTTTGACTAAGTGCGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTTCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTTCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCATAATTTTTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAAGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTAGTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACCCTTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTGCAAACTTGTTCTGAATTTGAACCTCTCAATTTAGAATTTATAT------TATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCTTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCGGAACA-----AACTATGTCGAGCCAAGAGCATCTTCAAAA-CTATAGAA-GACGGCGG-ATGTC Pepinia_sanguinea AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATTAAATCCCTCCATGATGGAATTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCTAATAAATTAGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGTAACCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATGATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-AATAAACAATGCCCCCCCC-TAGAAACGTATAAGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTGACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGGCAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTTGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACCCTTTTTT--ATTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGACAAATTTGACTTTTCGAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTAACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Pitcairnia_feliciana AGACCGGGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATTAAATCCCTCCATGATGGAATTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCGTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGGATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCTAATAAATTAGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-----------TTGTAACCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATGATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATA---------GATATACTAATACCCTATCCTATCCATTTGGAAATCTT?GT?CAAATCCTTCAATGCCGGATCCAAGATGTTCCGTCTTTACATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTACGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTGCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCGCGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACTGTATCGGGACACCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAATGCCCCCC---TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGTAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTTTAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-ATTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGATCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAACCTAACCCAACACAAATTAGGTTCCGGGCAGAACAGAACAAACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Pitcairnia_maidifolia AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAAATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATTAAATCCCTCCATGATGGAATTTATTACAATTTTGATTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCTAATAAATTTGAATCGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGTAACCCTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATGATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTTGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTACGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATGGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACTGTATCGGGACACCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT-AATAAACAATGCCCCCCCC-TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGGCAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-ATTATTTTATTTCTTATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTGACTTTTCGAACTTGTTCTGAATTTGAACCTTTCAATTTCGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTAACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACGGAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Pitcairnia_orchidifolia AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATTAAATCCCTCCATGATGGAATTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCTAATAAATTAGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTACTAAATAAGATTATCTTAA-TCTATCTTAATTGTAACCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATGATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTACGAAGAAATCTATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTGGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTTTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTTCTTGAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATGGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACTGTATCGGGACACCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAATGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCGT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGGCAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-ATTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTTACTTTTCGAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTAACTAACCCTAGATTCTTTCCCTTGAAAAATGAATGAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCCTCATTA-CTATAGAA-GATGGCGG-ATGTA Portea_fosteriana AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACAGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTAGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGCGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTTACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATA---------------------------------------------------------------------------------------TTGCATTTATTGCGATTCTTTCTCC?CGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTAT{CT}TACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTAT{CT}CCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTA----ATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTTAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTAGTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTCGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTGCAAACTTGTTCTGAATTTGAACCTTTAAATTGAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCTTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCGGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GACGGCGG-ATGTC Puya_alpestris_1 -----------------------C-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAACAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAGCAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTGAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAATTAAGATTATCTTAA-----------TTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAAT---------------AGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGGGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGGTTCTGGAACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATTTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT--ATAAACAACGCCCCCCCC-TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGATAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTCGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_alpestris_2 GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAACAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAGCAAAAA-TGTCACTCCTTCAAAAAAATTCGAATTGTGAGACATATTGAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAATTAAGATTATCTTAA-----------TTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAAT---------------AGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGGGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGGTTCTGGAACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT-AATAAACAACGCCCCCCCCCTAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGATAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTCGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCTGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_angusta GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTTGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCTGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_angusta_2 GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTGAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_berteroniana --------------------------------------------------------------------------------------------------------------------ATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAGCAAAAA-TGTCACTCCTTCAAAAAAATTCGAATTGTGAGACATATTGAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAATTAAGATTATCTTAA-----------TTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGACCATATACCGTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATTCTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAAT---------------AGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGGGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGGTTCTGGAACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTAGCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCG------------------AATAAACAACGCCCCCCCC-TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGATAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTCGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_bicolor GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCAAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAA---TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT---TAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCAAAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_boliviensis_1 ----------------ACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT--ATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTTTTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_boliviensis_2 GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAG--------------------TATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTT-??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Puya_castellanosii ----------------ACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTTATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGA---------------- Puya_chilensis_1 ----------------ACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAACAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAGCAAAAA-TGTCACTCCTTCAAAAAAATTCGAATTGTGAGACATATTGAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAATTAAGATTATCTTAA-----------TTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAAT---------------AGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGGGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGGTTCTGGAACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT-AATAAACAACGCCCCCCCCCTAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGATAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTCGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_chilensis_2 GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAACAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAGCAAAAA-TGTCACTCCTTCAAAAAAATTCGAATTGTGAGACATATTGAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAATTAAGATTATCTTAA-----------TTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAAT---------------AGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGGGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGGTTCTGGAACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTAGCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATT-GGTCGGATATGTAGAAATCTTT-AATAAACAACGCCCCCCCC-TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGATAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTCGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_coerulea_1 ------GAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAACAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAGCAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTGAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAATTAAGATTATCTTAA-----------TTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAAT---------------AGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGGGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGGTTCTGGAACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTTTTGATCGATTTGGTCGGATATGTAGAAATCTTT-AATAAACAACGCCCCCCCCCTAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGATAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACTTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTCGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_coerulea_2 GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAACAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAGCAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTGAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAATTAAGATTATCTTAA-----------TTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATACCGTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAAT---------------AGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGGGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGGTTCTGGAACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATTTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAA---------------------CCCC--TAGAAACGTATAGGAGGTTTTTT??????????CTCGAGAAAAATGATTCTAATTTCT-GTATATAATAG?AAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGATAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTCTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTG?GATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTCGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_compacta GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCCCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCAAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTTGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACTGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_dasylirioidea AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCAAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTTATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAA---TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCT????TCTATCTTAATTGGAATCTTACTTTA??ATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATATTATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATA------------ATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT-AATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCAAAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCAG-ATGTA Puya_dyckioides ------------------------CGGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTTGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTACTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTTATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTC Puya_ferreyrae GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTGAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_ferruginea_1 AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGGCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAAA--TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCAGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATA------------------------------------------------------ATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC?AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG?AAGTGGAAA?TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC?AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTC?-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_ferruginea_2 GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCCGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTTTTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_ferruginea_3 GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCCGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_gilmartiniae ----------------------------------------------ATCTCTATTTTATTCCTACGAACAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAGCAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTGAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAATTAAGATTATCTTAA-----------TTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAAT---------------AGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGGGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGGTTCTGGAACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT-AATAAACAACGCCCCCCCC-TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAATAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGATAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTCGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_goudotiana GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCAAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAA---TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCAAAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_hamata GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCAAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTTGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTT-AAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_harmsii ----------------------------------------GGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAA---TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTTATTGAATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------T-CTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGG-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTC Puya_herrerae GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTTGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCTGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_lanata GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCAAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTTTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_lineata GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCAAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAAA--TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCAAAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_macrura GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTGAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_mima GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCCAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAGAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT-AATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTTTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACCCTTTTT---GTTATTTCTTTCTATTTAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATG-A Puya_mirabilis --C--GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTCTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCCATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTTATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT---------------------------------------TTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-A---- Puya_nana AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTCTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCACATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTTATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCG-TTTGGTCGGATATGTAGAAATCTTT-AATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTC Puya_nitida_1 GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCAAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTGACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAAGATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_nitida_2 GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCAAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAATTCTGAAAAAAAA---TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-TTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTTAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_nutans GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCAAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATACCGTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTTGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACTGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT-AATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_obconica GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCAAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGCTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAAGATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_pygmaea ----------------ACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCCCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCAAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTTGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACTGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_raimondii GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTGAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_raimondii_1 GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAA--------TATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTTGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCTGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTTGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AA?TATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_santosii GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCAAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAA---TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCAAAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_trianae GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCAAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAAAA--TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCAAAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_ultima AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTTGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT--ATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGGCATTTATTGAGCTGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_venusta_1 -----------------------------------CCCAGGGGGTAATCTCTATTTTATTCCTACGAACAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAGCAAAAA-TGTCACTCCTTCAAAAAAATTCGAATTGTGAGACATATTGAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAATTAAGATTATCTTAA-----------TTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAAT---------------AGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGGGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGGTTCTGGAACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT-------------CCCCCCC-TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGATAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTCGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGAA Puya_venusta_2 GACC-GGAG-CTATCAACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAACAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCCCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAGCAAAAA-TGTCACTCCTTCAAAAAAATTCGAATTGTGAGACATATTGAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAATTAAGATTATCTTAA-----------TTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTATCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAAT---------------AGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGGGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGGTTCTGGAACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAGAACATCTTATAGTAGTGTACCGTAATTATTTTCAGAAAACTTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAACTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTAAATAAACAACGCCCCCCCCCTAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTGGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGATAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCATTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTTT-GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTTGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTCGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_wrightii AGACC-GGAGCTATCAACCAC-TC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTGAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATA---------------------------------------------------CAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGC-TTTATTGCGATTC-TTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGT-CCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTCATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGGAAGCCGATTCTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT-AATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTA Puya_yakespala ----------------ACCA-CTC-GGCCATCTCTCCCAGGGG-TAATCTCTATTTTATTCCTACGAATAGAACAT-GACCATATGATACACTAACTATCTGTAGAAACATCCCAGATGCGAATCCATATTTCGATGTATCTATGTATACTGTATACATAGATACATGATCTAGTATGTCTGCTTGTGAAATAAAGACTAAACTCCCTCCGAGTTCATGTCCGAATAAAATAAAGTGGTAATAAGTTCTAAAGAAAAGAATCAATTGATTCATGATAAAATCCCTCCATGATGGATTTTATTACAATTTTGACTAAGTGAGGGATCAAATGTATAGTTCATTTGTTGGTA----------------------GCTTGGAGGATTAGAAACATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTCATCAGTCTTACTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGGTTGGTCAAGTAACAAGAATGTTGTATTTTCCGGTACATCATTATGGATTGGATTAGTCTTTTTGGTAGCTATTCTTAATTCTCTCATTTCTTAAACTTATTTGGTATTTCCCCGATCCAAAAACAAAAA-TGTCACTCCTTCAAATAAATTCGAATTGTGAGACATATTAAGATTCAATCTGAGTTCTGAAAAAAA----TTCTATTTCAATGTTATTAATTGGATCTAATAAATAAGATTATCTTAA-TCTATCTTAATTGGAATCTTACTTTACTATAGTATCTGAAGTATACTATCTAAGTTTTACTTTTT-ACTATACTATCTAAGTACCTGGCCCTGCACAAATATGATCCAGCCGCATATATGATATATAATATATGT-CATAT-ATGTGTGGAC-ATATAC-GTGCGTATCAGGAAGGAAGAAAATGCGGATATATGTGTCAGATATACTAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCAATTTACGTTTTTTCAAAAGAAAATAAAAGACTATTTTGGTTCCTATATAATTCTTATGTATCTGAATGCGAATTTGTATTCGTTTTTCTTCGTAAACAATCTTCTTATTTACGATTAACATCTTCTGG------AACCTTTCTT---GAGCGAATACAGTTCTATGGAAAAATAAAACATCTTATAGTAGTGTACCATAATTATTTTCAGAAAACCTTATGGTTCTTCACGGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGC-AATTCTGGCTTCAAAAGGGACTCATCTTTTGATGAAG-AAGTGGAAA-TGTTACCTTGTCAATCTCTGGCAATATTATTTTCATTTTTGGTCTCAACCACACAGGATTCATATAAACC-AATTATCAAACTATTCCTTCTATTTTCTGGGTTATATTTCAAGTGTACTAAGAAATCCTTTGGTGGTAAGGAATCAAATGTTGGAGAATTCATTTCTAATAGAAATTGGTATTAAGAAATTCGATACCATAGTCCCAGTTATTCCTCTTATTGGATCATTGTCTAAAGCTAAATTTTGTACCGTATCGGGACATCCTATTAGTAAGCCGAT-CTGGACCGATTTATCAGATTGTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTT--ATAAACAACGCCCCCCC--TAGAAACGTATAGGAGGTTTTTTCCTCATACGGCTCGAGAAAAATGATTCTAATTTCT-GTATATAATAGCAAGTAGATCCATAAAATCAT-GAATTTTACTAT-GATTTGAATTGAGTACTTTT---------------------TTCTTCTTCCTTACAGAAAAAGGAAGAAATCTCATTCATACTCATAACTCAAGTTGGGTAATTCTGACAAGAAAATCCTTAGACATTTATTGAGCCGTCTCTAAACTCTTTTGTTTGTCTCATTTCGAATCTATTTTTATTCCTCAGTCTGATCCAATTGT-----TGAGACAATTGAAAATAGTGTTTCCTTGTTTCGGAATCCTTTATCTTTGCTTTGTGAAATCGTTGGGTTTAGACATTACCTCGGGGATCCTTATTCCTTTCAAAATGGCAGCAACATACC-TTTTTT--GTTATTTCTTTCTATATAAATAGAATACGAACGATTGATTCCCTTGTGATACACTTTTCATCGAAATAGTTTTACCAATTTCGAAAAATTGGACTTTTCAAACTTGTTCTGAATTTGAACCTTTCAATTTAGAATTTATAT-------ATAGTGAGGATATACTTACAAAGTTGGTCTAACTTATTGATTTTCACTAACCCTAGATTCTTTCCCTTGAAAAATGAATCAATCCTTTCTTCTCGAGCTTCATAATGTACTATTTACTTATAA-----CCCAACACAAATTAGGTTCCGGGCAGAACA-----AACTATGTCGAGCCAAGAGCATCTTCATTA-CTATAGAA-GATGGCGG-ATGTC ; END; BEGIN SETS; CHARSET rps16 (CHARACTERS = cpDNA) = 1745-2571; CHARSET trnS_trnG (CHARACTERS = cpDNA) = 1-925; CHARSET trnK_matK (CHARACTERS = cpDNA) = 926-1744; END; BEGIN TREES; TITLE PhyC; LINK TAXA = Taxa1; TRANSLATE 1 Aechmea_nudicaulis, 2 Ananas_comosus, 3 Ananas_nanus, 4 Billbergia_euphemiae, 5 Billbergia_laxiflora, 6 Bromelia_agavifolia, 7 Bromelia_balansae, 8 Bromelia_flemingii, 9 Cryptanthus_bromelioides, 10 Cryptanthus_dorothyae, 11 Deinacanthon_urbanianum, 12 Greigia_sp., 13 Neoregelia_cruenta, 14 Ochagavia_elegans, 15 Orthophytum_gurkenii, 16 Pepinia_sanguinea, 17 Pitcairnia_orchidifolia, 18 Portea_fosteriana, 19 Puya_alpestris_1, 20 Puya_alpestris_2, 21 Puya_angusta, 22 Puya_angusta_2, 23 Puya_bicolor, 24 Puya_boliviensis_1, 25 Puya_boliviensis_2, 26 Puya_castellanosii, 27 Puya_chilensis_1, 28 Puya_chilensis_2, 29 Puya_coerulea_1, 30 Puya_compacta, 31 Puya_dasylirioidea, 32 Puya_dyckioides, 33 Puya_ferreyrae, 34 Puya_ferruginea_1, 35 Puya_ferruginea_2, 36 Puya_ferruginea_3, 37 Puya_gilmartiniae, 38 Puya_goudotiana, 39 Puya_hamata, 40 Puya_harmsii, 41 Puya_herrerae, 42 Puya_lanata, 43 Puya_lineata, 44 Puya_macrura, 45 Puya_mima, 46 Puya_nana, 47 Puya_nitida_2, 48 Puya_nutans, 49 Puya_obconica, 50 Puya_pygmaea, 51 Puya_raimondii, 52 Puya_raimondii_1, 53 Puya_santosii, 54 Puya_trianae, 55 Puya_ultima, 56 Puya_venusta_1, 57 Puya_venusta_2, 58 Puya_wrightii, 59 Puya_yakespala; TREE c._Fig._4 = [&R] ((16:0.004338,17:0.0):0.0148725,(((6:0.0,(7:0.0,8:0.002157):0.0):0.01095,(15:0.014946,(13:0.008064,(18:0.008208,(5:0.002962,(1:0.005143,4:0.001014):0.002024):0.001965):9.19E-4):0.003895,((2:0.001834,3:0.003085):0.002982,(9:0.0,10:0.0):0.010938):0.001922):8.6E-4):0.002537,((11:0.012611,(12:0.007262,14:0.006882):0.008227):9.66E-4,((45:0.007973,20:0.002316,57:0.002316,56:0.002316,(19:0.00203,29:0.0):0.0033299999999999996):0.004381,((24:0.001105,(25:0.0,(27:0.0,(28:0.0,37:0.0):0.0):0.0):0.0):0.009965,(21:0.005694,((35:0.0046165,22:7.4225E-4,51:0.0014845,34:4.865E-4,36:4.865E-4,59:4.865E-4,41:0.0014615,52:4.865E-4,40:0.0):4.865E-4,(26:0.002177,55:0.001317,33:0.0,53:0.001461,(32:0.0,46:2.4375E-4,(44:0.00236,(42:0.0,58:0.0):4.875E-4):4.875E-4):9.74E-4):0.004949125,(54:9.78E-4,(48:0.0,((30:0.0,(39:0.0,(49:0.0,50:0.0):0.0):0.0):0.0,38:9.73E-4,31:9.73E-4,43:0.001949,(23:0.0,47:0.0):0.001949):4.885E-4):4.885E-4):0.008858125):0.001040125):0.00208025):0.0041605):0.001325):0.001758):0.0148725); END; BEGIN TREES; TITLE cpDNA; LINK TAXA = Taxa2; TRANSLATE 1 Aechmea_nudicaulis, 2 Ananas_comosus, 3 Ananas_nanus, 4 Billbergia_euphemiae, 5 Billbergia_laxiflora, 6 Bromelia_agavifolia, 7 Bromelia_balansae, 8 Bromelia_flemingii, 9 Bromelia_pinguin, 10 Cryptanthus_bromelioides, 11 Cryptanthus_dorothyae, 12 Deinacanthon_urbanianum, 13 Deuterocohnia_longipetala, 14 Deuterocohnia_meziana, 15 Dyckia_pseudococcinea, 16 Fernseea_itatiaiae, 17 Fosterella_albicans, 18 Greigia_sp., 19 Hechtia_lundelliorum, 20 Neoregelia_cruenta, 21 Ochagavia_carnea, 22 Ochagavia_elegans, 23 Ochagavia_lindleyana, 24 Orthophytum_gurkenii, 25 Pepinia_sanguinea, 26 Pitcairnia_feliciana, 27 Pitcairnia_maidifolia, 28 Pitcairnia_orchidifolia, 29 Portea_fosteriana, 30 Puya_alpestris_1, 31 Puya_alpestris_2, 32 Puya_angusta, 33 Puya_angusta_2, 34 Puya_berteroniana, 35 Puya_bicolor, 36 Puya_boliviensis_1, 37 Puya_boliviensis_2, 38 Puya_castellanosii, 39 Puya_chilensis_1, 40 Puya_chilensis_2, 41 Puya_coerulea_1, 42 Puya_coerulea_2, 43 Puya_compacta, 44 Puya_dasylirioidea, 45 Puya_dyckioides, 46 Puya_ferreyrae, 47 Puya_ferruginea_1, 48 Puya_ferruginea_2, 49 Puya_ferruginea_3, 50 Puya_gilmartiniae, 51 Puya_goudotiana, 52 Puya_hamata, 53 Puya_harmsii, 54 Puya_herrerae, 55 Puya_lanata, 56 Puya_lineata, 57 Puya_macrura, 58 Puya_mima, 59 Puya_mirabilis, 60 Puya_nana, 61 Puya_nitida_1, 62 Puya_nitida_2, 63 Puya_nutans, 64 Puya_obconica, 65 Puya_pygmaea, 66 Puya_raimondii, 67 Puya_raimondii_1, 68 Puya_santosii, 69 Puya_trianae, 70 Puya_ultima, 71 Puya_venusta_1, 72 Puya_venusta_2, 73 Puya_wrightii, 74 Puya_yakespala; TREE c._Fig._3 = [&R] (19:0.004533,(((17:0.018357,(13:0.002999,(14:0.004202,15:0.002376):0.008408):0.002641):6.36E-4,(26:0.004338,(27:0.006333,(25:0.002372,28:0.003768):0.0):0.001233):0.003388):0.002101,((50:4.28E-4,((41:8.43E-4,(30:0.0,42:4.2E-4):4.16E-4):0.0,(39:0.0,(71:4.28E-4,((31:4.16E-4,72:0.0):0.0,(34:4.4E-4,40:0.0):4.17E-4):0.0):0.0):4.16E-4):0.0):0.002973,((24:0.008611,((18:0.006719,23:0.002148):0.0,((9:0.002899,(7:0.002897,(6:8.22E-4,8:4.12E-4):0.0):0.0):0.003736,((21:0.002159,22:0.003971):0.001722,(16:0.003436,(12:0.005046,((2:0.0,3:0.0):8.21E-4,((10:4.05E-4,11:4.18E-4):0.004146,(29:0.002152,((1:0.002966,4:0.001333):0.0,(5:0.002506,20:0.003279):0.0):0.002059):0.0):8.18E-4):0.001544):0.0):5.17E-4):0.0):0.002465):0.0):8.24E-4,((58:0.001653,((52:0.0,(63:0.0,(43:0.0,65:0.0):4.11E-4):4.11E-4):4.11E-4,(55:4.12E-4,((62:0.001237,(61:4.12E-4,64:4.1E-4):4.12E-4):0.0,(51:0.0,(68:0.0,(56:0.0,(35:0.0,69:0.0):0.0):0.0):0.0):4.11E-4):0.0):0.0):4.1E-4):0.0,((59:8.46E-4,((45:8.4E-4,(53:8.43E-4,74:4.19E-4):0.0):4.17E-4,(38:0.0,(44:0.002096,(70:0.001241,(60:0.001658,(47:0.001375,73:8.5E-4):0.0):0.0):0.0):0.002321):0.0):0.0):5.77E-4,(((36:4.18E-4,37:0.0):0.0,(67:4.13E-4,(32:0.0,54:0.0):0.0):8.25E-4):0.0,((48:4.11E-4,49:0.0):4.11E-4,(66:0.0,(57:0.0,(33:0.0,46:0.0):0.0):0.0):4.11E-4):0.0):0.0):4.1E-4):0.002484):8.13E-4):0.001671):0.004533); END;