#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 13:12 GMT TreeBASE (cc) 1994-2008 Study reference: Okane I., Srikitikulchai P., Tabuchi Y., Sivichai S., & Nakagiri A. 2011. Recognition and characterization of four Thai-xylariaceous fungi inhabiting various tropical foliages as endophytes by DNA sequences and host plant preference. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S11436] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=206; TAXLABELS Daldinia_sp_BCC21002 Nemania_bipapillata_GQ470221 Nemania_cf_bipapillata_BCC_18739 Nemania_cf_bipapillata_BCC_18763 Nemania_cf_bipapillata_BCC_18787 Nemania_cf_bipapillata_BCC_18790 Nemania_cf_bipapillata_BCC_18791 Nemania_cf_bipapillata_BCC_18859 Nemania_cf_bipapillata_BCC_18873 Nemania_cf_bipapillata_BCC_18891 Nemania_cf_bipapillata_BCC_20926 Nemania_cf_bipapillata_BCC_20928 Nemania_cf_bipapillata_BCC_20929 Nemania_cf_bipapillata_BCC_20944 Nemania_cf_bipapillata_BCC_20948 Nemania_cf_bipapillata_BCC_20950 Nemania_cf_bipapillata_BCC_20953 Nemania_cf_bipapillata_BCC_20954 Nemania_cf_bipapillata_BCC_20981 Nemania_cf_bipapillata_BCC_20983 Nemania_cf_bipapillata_BCC_20993 Nemania_cf_bipapillata_BCC_20996 Nemania_cf_bipapillata_BCC_21001 Nemania_diffusa_BCC_18724 Nemania_diffusa_BCC_18726 Nemania_diffusa_BCC_18732 Nemania_diffusa_BCC_18745 Nemania_diffusa_BCC_18751 Nemania_diffusa_BCC_18754 Nemania_diffusa_BCC_18767 Nemania_diffusa_BCC_18769 Nemania_diffusa_BCC_18776 Nemania_diffusa_BCC_18793 Nemania_diffusa_BCC_18804 Nemania_diffusa_BCC_18805 Nemania_diffusa_BCC_18853 Nemania_diffusa_BCC_18855 Nemania_diffusa_BCC_18858 Nemania_diffusa_BCC_18860 Nemania_diffusa_BCC_18863 Nemania_diffusa_BCC_18866 Nemania_diffusa_BCC_18868 Nemania_diffusa_BCC_18871 Nemania_diffusa_BCC_18887 Nemania_diffusa_BCC_18889 Nemania_diffusa_BCC_18890 Nemania_diffusa_BCC_18892 Nemania_diffusa_BCC_18893 Nemania_diffusa_BCC_18895 Nemania_diffusa_BCC_18896 Nemania_diffusa_BCC_18899 Nemania_diffusa_BCC_18900 Nemania_diffusa_BCC_18901 Nemania_diffusa_BCC_18907 Nemania_diffusa_BCC_20842 Nemania_diffusa_BCC_20846 Nemania_diffusa_BCC_20847 Nemania_diffusa_BCC_20931 Nemania_diffusa_BCC_20938 Nemania_diffusa_BCC_20943 Nemania_diffusa_BCC_20945 Nemania_diffusa_BCC_20946 Nemania_diffusa_BCC_20947 Nemania_diffusa_BCC_20959 Nemania_diffusa_BCC_20960 Nemania_diffusa_BCC_20965 Nemania_diffusa_BCC_20967 Nemania_diffusa_BCC_20969 Nemania_diffusa_BCC_20970 Nemania_diffusa_BCC_20980 Nemania_diffusa_BCC_20982 Nemania_diffusa_GQ470220 Xylaria_cubensis_BCC_1027 Xylaria_cubensis_BCC_1069 Xylaria_cubensis_BCC_1144 Xylaria_cubensis_BCC_1218 Xylaria_cubensis_BCC_1219 Xylaria_cubensis_BCC_1223 Xylaria_cubensis_BCC_1224 Xylaria_cubensis_BCC_1225 Xylaria_cubensis_BCC_1227 Xylaria_cubensis_BCC_1255 Xylaria_cubensis_BCC_1282 Xylaria_cubensis_BCC_1303 Xylaria_cubensis_BCC_1315 Xylaria_cubensis_BCC_18721 Xylaria_cubensis_BCC_18723 Xylaria_cubensis_BCC_18725 Xylaria_cubensis_BCC_18727 Xylaria_cubensis_BCC_18728 Xylaria_cubensis_BCC_18730 Xylaria_cubensis_BCC_18733 Xylaria_cubensis_BCC_18735 Xylaria_cubensis_BCC_18736 Xylaria_cubensis_BCC_18740 Xylaria_cubensis_BCC_18744 Xylaria_cubensis_BCC_18748 Xylaria_cubensis_BCC_18749 Xylaria_cubensis_BCC_18757 Xylaria_cubensis_BCC_18758 Xylaria_cubensis_BCC_18759 Xylaria_cubensis_BCC_18760 Xylaria_cubensis_BCC_18761 Xylaria_cubensis_BCC_18762 Xylaria_cubensis_BCC_18764 Xylaria_cubensis_BCC_18765 Xylaria_cubensis_BCC_18766 Xylaria_cubensis_BCC_18768 Xylaria_cubensis_BCC_18770 Xylaria_cubensis_BCC_18773 Xylaria_cubensis_BCC_18774 Xylaria_cubensis_BCC_18775 Xylaria_cubensis_BCC_18779 Xylaria_cubensis_BCC_18782 Xylaria_cubensis_BCC_18783 Xylaria_cubensis_BCC_18785 Xylaria_cubensis_BCC_18792 Xylaria_cubensis_BCC_18794 Xylaria_cubensis_BCC_18795 Xylaria_cubensis_BCC_18799 Xylaria_cubensis_BCC_18801 Xylaria_cubensis_BCC_18802 Xylaria_cubensis_BCC_18803 Xylaria_cubensis_BCC_18854 Xylaria_cubensis_BCC_18856 Xylaria_cubensis_BCC_18857 Xylaria_cubensis_BCC_18864 Xylaria_cubensis_BCC_18865 Xylaria_cubensis_BCC_18867 Xylaria_cubensis_BCC_18872 Xylaria_cubensis_BCC_18874 Xylaria_cubensis_BCC_18875 Xylaria_cubensis_BCC_18876 Xylaria_cubensis_BCC_18877 Xylaria_cubensis_BCC_18878 Xylaria_cubensis_BCC_18879 Xylaria_cubensis_BCC_18880 Xylaria_cubensis_BCC_18881 Xylaria_cubensis_BCC_18883 Xylaria_cubensis_BCC_18884 Xylaria_cubensis_BCC_18885 Xylaria_cubensis_BCC_18888 Xylaria_cubensis_BCC_18894 Xylaria_cubensis_BCC_18897 Xylaria_cubensis_BCC_18898 Xylaria_cubensis_BCC_18903 Xylaria_cubensis_BCC_18904 Xylaria_cubensis_BCC_18906 Xylaria_cubensis_BCC_20839 Xylaria_cubensis_BCC_20840 Xylaria_cubensis_BCC_20841 Xylaria_cubensis_BCC_20848 Xylaria_cubensis_BCC_20927 Xylaria_cubensis_BCC_20939 Xylaria_cubensis_BCC_20942 Xylaria_cubensis_BCC_20956 Xylaria_cubensis_BCC_20957 Xylaria_cubensis_BCC_20958 Xylaria_cubensis_BCC_20961 Xylaria_cubensis_BCC_20962 Xylaria_cubensis_BCC_20963 Xylaria_cubensis_BCC_20964 Xylaria_cubensis_BCC_20966 Xylaria_cubensis_BCC_20968 Xylaria_cubensis_BCC_20977 Xylaria_cubensis_BCC_20984 Xylaria_cubensis_BCC_20985 Xylaria_cubensis_BCC_20988 Xylaria_cubensis_BCC_20991 Xylaria_cubensis_BCC_20994 Xylaria_cubensis_BCC_21003 Xylaria_cubensis_GQ502702 Xylaria_grammica_BCC_1002 Xylaria_grammica_BCC_1013 Xylaria_grammica_BCC_1035 Xylaria_grammica_BCC_1053 Xylaria_grammica_BCC_1102 Xylaria_grammica_BCC_1170 Xylaria_grammica_BCC_1175 Xylaria_grammica_BCC_1321 Xylaria_grammica_BCC_18729 Xylaria_grammica_BCC_18746 Xylaria_grammica_BCC_18755 Xylaria_grammica_BCC_18756 Xylaria_grammica_BCC_18788 Xylaria_grammica_BCC_18789 Xylaria_grammica_BCC_18797 Xylaria_grammica_BCC_18886 Xylaria_grammica_BCC_20843 Xylaria_grammica_BCC_20932 Xylaria_grammica_BCC_20934 Xylaria_grammica_BCC_20935 Xylaria_grammica_BCC_20936 Xylaria_grammica_BCC_20941 Xylaria_grammica_BCC_20949 Xylaria_grammica_BCC_20972 Xylaria_grammica_BCC_20974 Xylaria_grammica_BCC_20975 Xylaria_grammica_BCC_20978 Xylaria_grammica_BCC_20979 Xylaria_grammica_BCC_20987 Xylaria_grammica_BCC_20995 Xylaria_grammica_BCC_20998 Xylaria_grammica_BCC_20999 Xylaria_grammica_BCC_21000 Xylaria_grammica_GQ487704 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M9182] TITLE Tubulin; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1141; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Daldinia_sp_BCC21002 TGGCAAACCATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTATGTATTTTCGATTGTTAATTATCAC-TATCGTCCAGAATATCGAACTGACCATTAAT--TAATAGTTACAACGGAACTTCGGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAATGAGGTATGAATTTACGGTCA---TGGATGAGATTTTGGTAGTACTAAT----TACCCCCATGGG---CACAGGCATCTGGTAACAAGTACGTCCCTCGTGCTGTCCTCGTCGACCTCGAGCCCGGTACCATGGACGCCGTCCGTGCTGGTCCTTTCGGCCAGCTTTTCCGACCCGACAACTTCGTTTTCGGTCAGTCCGGTGCCGGAAACAACTGGGCCAAGGGTCACTACACTGAGGGTGCTGAGTTGGTTGACAACGTCCTTGATGTCGTTCGTCGTGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTCGGTGGTGGTACTGGTGCCGGTATGGGTACCCTGTTGATCTCCAAGATCCGTGAGGAGTTCCCCGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCCCCCAAGGTTTCCGACACCGTCGTTGAGCCTTACAATGCCACCCTCTCCGTCCACCAGCTGGTTGAGAACTCCGACGAGACCTTCTGTATCGACAACGAGGCTCTGTACGACATTTGCATGCGTACGCTCAAGCTATCTAACCCCTCCTACGGTGACCTGAACCACCTGGTCTCCGCCGTCATGTCCGGCGTCACCACTTGCTTGCGTTTCCCCGGTCAGCTAAACTCTGATCTGCGCAAGCTTGCCGTCAACATGGTTCCTTTCCCTCGTCTCCACTTCTTCATGGTCGGCTTCGCTCCCCTGACCAGCCGTGGCGCTCACTCTTTCCGTGCCGTCACCGTTCCCGAGTTGACTCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTTCCGACTTCCGAAACGGTCGCTACCTGACGTGCTCGGCCATCTTGTATGATAAATACCCCTCAAATCCCTACGTATTACCTATTCGCTAACTTTT--TACTCT--------AGCCGTGGCAAGGTCTCCATGAAGGAAGTTGAAGACCAGATGCGCAA Nemania_bipapillata_GQ470221 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTTT-ATAGCAGCG-AGGAGAGCTAGAGAGGGCATGGTATTCAACTGAC-ATGCATTGGAACAGGTACAATGGAACCTCAGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAGT-TTAGCAATTC--ACCTACGGTTTGTAGAACCTCGGTTCTAA--TAGTGTGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCTGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTCCGAGCTGGTCCTTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTACACTGAGGGTGCTGAGCTCGTTGACAACGTGCTCGATGTCGTTCGTCGCGAGGCTGAGGGCTGCGACTGCCTGCAGGGTTTCCAAATCACCCACTCCCTCGGTGGTGGTACCGGTGCCGGTATGGGTACTCTGCTGATTTCCAAGATTCGCGAGGAATTCCCTGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCTAAGGTCTCGGACACCGTTGTCGAGCCCTATAATGCCACCCTCTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGTATTGACAATGAGGCTCTGTACGATATCTGCATGCGCACACTGAAGCTATCCAACCCTTCATACGGTGATCTCAACCACCTTGTCTCCGCTGTGATGTCTGGTGTAACCACCTGCTTGCGATTCCCTGGTCAGCTGAACTCTGATCTCCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTTGGCTTTGCTCCCCTCACTAGCCGTGGCGCTTATTCTTTCCGCGCTGTCACTGTTCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGCTACCTCACATGCTCTGCCATCTTGTAAGA-TACA-TTTTCCCC-TGTAACG-TG-GA-T-AGTTGCTAACTTGA--TGTTCTA----AATAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_18739 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAATTCGACGGAGGGCATGATCGTCGGCTGAC-ATTTAT-GTAACAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAATGAGGTACGCAAGT-TTGTCAATTC--ACTTACGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCCGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTCCGTGCTGGTCCTTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTCGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAACTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACCACTTGCCTACGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAGCAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACCGCTTCTTTTC-CGCTTCG-TATGA-T-GGTTGCTAATTGTA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_18763 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAACTCGACGGAGGGTATGATCGTCGGCTGAC-ATCTAT-GTAACAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTATTTCAATGAGGTAAGCAAGT-TTGTCAATTC--ACTTAGGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCTGTCCTCGTCGATTTGGAACCTGGTACTATGGATGCCGTCCGTGCCGGTCCCTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTTGGTGGTGGCACTGGTGCTGGTATGGGTACTCTACTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAGCTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACCACTTGCCTGCGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAACAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACTGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTATA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_18787 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAATTCGACGGAGGGCATGATCGTCGGCTGAC-ATTTAT-GTAACAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAATGAGGTACGCAAGT-TTGTCAATTC--ACTTACGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCCGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTCCGTGCTGGTCCTTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCCCTCGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAACTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACCACTTGCCTACGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAGCAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACCGCTTCTTTTC-CGCTTCG-TATGA-T-GGTTGCTAATTGTA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_18790 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAATTCGACGGAGGGCATGATCGTCGGCTGAC-ATTTAT-GTAACAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAATGAGGTACGCAAGT-TTGTCAATTC--ACTTACGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCCGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTCCGTGCTGGTCCTTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTCGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAACTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACTTGCCTACGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAGCAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACCGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTGTA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_18791 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAATTCGACGGAGGGCATGATCGTCGGCTGAC-ATTTAT-GTAACAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAATGAGGTACGCAAGT-TTGTCAATTC--ACTTACGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCCGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTCCGTGCTGGTCCTTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTCGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAACTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACTTGCCTACGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAGCAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACCGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTGTA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_18859 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAATTCGACGGAGGGCATGATCGTCGGCTGAC-ATTTAT-GTAACAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAATGAGGTACGCAAGT-TTGTCAATTC--ACTTACGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCCGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTCCGTGCTGGTCCTTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTCGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAACTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACCACTTGCCTACGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAGCAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACCGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTGTA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_18873 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAATTCGACGGAGGGCATGATCGTCGGCTGAC-ATTTAT-GTAACAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAATGAGGTACGCAAGT-TTGTCAATTC--ACTTACGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCCGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTCCGTGCTGGTCCTTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTCGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAACTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACTTGCCTACGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAGCAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACCGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTGTA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_18891 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAATTCGACGGAGGGCATGATCGTCGGCTGAC-ATTTAT-GTAATAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAATGAGGTACGCAAGT-TTGTCAATTC--ACTTACGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCCGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTCCGTGCTGGTCCTTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTCGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTGCACCAACTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACCACTTGCCTACGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAGCAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACCGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTGTA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_20926 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAATTCGACGGAGGGCATGATCGTCGGCTGAC-ATTTAT-GTAACAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAATGAGGTACGCAAGT-TTGTCAATTC--ACTTACGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCCGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTCCGTGCTGGTCCTTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTCGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAACTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACTTGCCTACGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAGCAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACCGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTGTA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_20928 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAACTCGACGGAGGGTATGATCGTCGGCTGAC-ATCTAT-GTAATAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTATTTCAATGAGGTAAGCAAGT-TTGTCAATTC--ACCTAGGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCTGTCCTCGTCGATTTGGAACCTGGTACTATGGATGCCGTCCGTGCCGGTCCCTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTTGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAGCTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACCACTTGCCTGCGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAACAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACTGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTATA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_20929 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAATTCGACGGAGGGCATGATCGTCGGCTGAC-ATTTAT-GTAATAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAATGAGGTACGCAAGT-TTGTCAATTC--ACTTACGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCCGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTCCGTGCTGGTCCTTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTCGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAACTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACCACTTGCCTACGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAGCAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACCGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTGTA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_20944 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAACTCGACGGAGGGTATGATCGTCGGCTGAC-ATCTAT-GTAATAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTATTTCAATGAGGTAAGCAAGT-TTGTCAATTC--AGTTACGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCTGTCCTCGTCGATTTGGAACCTGGTACTATGGATGCCGTCCGTGCCGGTCCCTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTCGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAGCTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACCACTTGCCTGCGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAACAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACTGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTATA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_20948 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAACTCGACGGAGGGTATGATCGTCGGCTGAC-ATCTAT-GTAATAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTATTTCAATGAGGTAAGCAAGT-TTGTCAATTC--ACTTAGGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCTGTCCTCGTCGATTTGGAACCTGGTACTATGGATGCCGTCCGTGCCGGTCCCTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTTGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAGCTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACCACTTGCCTGCGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAACAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACTGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTATA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_20950 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAATTCGACGGAGGGCATGATCGTCGGCTGAC-ATTTAT-GTAACAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAATGAGGTACGCAAGT-TTGTCAATTC--ACTTACGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCCGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTCCGTGCTGGTCCTTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTCGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAACTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACTTGCCTACGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAGCAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACCGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTGTA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_20953 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAACTCGACGGAGGGTATGATCGTCGGCTGAC-ATCTAT-GTAATAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTATTTCAATGAGGTAAGCAAGT-TTGTCAATTG--ACTTAGGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCTGTCCTCGTCGATTTGGAACCTGGTACTATGGATGCCGTCCGTGCCGGTCCCTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTTGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAGCTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACCACTTGCCTGCGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAACAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGCCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACTGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTATA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_20954 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAACTCGACGGAGGGTATGATCGTCGGCTGAC-ATCTAT-GTAATAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTATTTCAATGAGGTAAGCAAGT-TTGTCAATTC--AGTTACGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCTGTCCTCGTCGATTTGGAACCTGGTACTATGGATGCCGTCCGTGCCGGTCCCTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTCGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAGCTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACCACTTGCCTGCGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAACAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACTGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTATA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_20981 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAATTCGACGGAGGGCATGATCGTCGGCTGAC-ATTTAT-GTAACAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAATGAGGTACGCAAGT-TTGTCAATTC--ACTTACGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCCGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTCCGTGCTGGTCCTTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTACTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTCGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAACTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACCACTTGCCTACGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAGCAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACCGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTGTA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_20983 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAATTCGACGGAGGGCATGATCGTCGGCTGAC-ATTTAT-GTAACAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAATGAGGTACGCAAGT-TTGTCAATTC--ACTTACGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCCGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTCCGTGCTGGTCCTTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTCGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAACTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACTTGCCTACGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAGCAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACCGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTGTA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_20993 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAATTCGACGGAGGGCATGATCGTCGGCTGAC-ATTTAT-GTAACAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAATGAGGTACGCAAGT-TTGTCAATTC--ACTTACGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCCGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTCCGTGCTGGTCCTTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCCCTCGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAACTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACCACTTGCCTACGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAGCAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACCGCTTCTTTTC-CGCTTCG-TATGA-T-GGTTGCTAATTGTA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_20996 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAATTCGACGGAGGGCATGATCGTCGGCTGAC-ATTTAT-GTAACAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAATGAGGTACGCAAGT-TTGTCAATTC--ACTTACGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCCGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTCCGTGCTGGTCCTTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCCCTCGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAACTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACCACTTGCCTACGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAGCAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACCGCTTCTTTTC-CGCTTCG-TATGA-T-GGTTGCTAATTGTA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_cf_bipapillata_BCC_21001 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGCGTGTATGTCT-ATAGAATCT-AGAAACTCGACGGAGGGTATGATCGTCGGCTGAC-ATCTAT-GTAATAGCTACAACGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTATTTCAATGAGGTAAGCAAGT-TTGTCAATTC--ACTTAGGCTTTATAGAACCCAGGTTCTAACGCAATGGGATATTTAGGGTGCTGGCAACAAATATGTTCCTCGCGCTGTCCTCGTCGATTTGGAACCTGGTACTATGGATGCCGTCCGTGCCGGTCCCTTCGGTCAACTTTTCCGACCCGATAACTTCGTTTTCGGTCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTCGTTGACAATGTGCTTGACGTCGTTCGTCGGGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTTGGTGGTGGCACTGGTGCTGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTCCCGGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCAGATACCGTTGTCGAGCCCTACAACGCCACCCTCTCCGTGCACCAGCTGGTTGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCCCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCGTACGGTGATCTCAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACCACTTGCCTGCGTTTCCCTGGTCAGCTGAACTCTGATCTGCGCAAGTTGGCTGTGAACATGGTGCCCTTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTTCTCCCCTTACCAGCCGTGGCGCATACTCATTCCGCGCTGTCACTGTTCCCGAGTTGACTCAACAAATGTTTGATCCTAAGAACATGATGGCCGCCGCTGATTTCCGTAACGGTCGTTACCTGACGTGCTCTGCTATTTTGTAAGA-ACTGCTTCTTTTT-CGCTTCG-TATGA-T-GGTTGCTAATTATA--CACTCTG----AATAGCCGTGGCAAAGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18724 TGGCAACAAATTTCTGGCGAGCATGGTCTCGACGGCAGTGGTGTGTATGTTT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGGGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTTGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGCTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAATGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCTAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGACAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-AATTCCTCTTTCC-CATTACGGTATGA-TTAGTCCCTAACTTGA--TTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18726 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCGGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACAC--GGGAATATTTAGGGTGCCGGAAACAAGTATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGTACAATGGATGCTGTCCGTGCTGGTCCTTTTGGGCAACTCTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGCTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGTATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTAGTCGAGAACTCCGACGAGACCTTCTGCATTGACAATGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTGACCACATGCTTGCGTTTCCCTGGCCAGCTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTACCTGACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-ATAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18732 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGCAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18745 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18751 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTAAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18754 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCGGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACAC--GGGAATATTTAGGGTGCCGGAAACAAGTATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGTACAATGGATGCTGTCCGTGCTGGTCCTTTTGGGCAACTCTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGCTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGTATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTAGTCGAGAACTCCGACGAGACCTTCTGCATTGACAATGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTGACCACATGCTTGCGTTTCCCTGGCCAGCTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTACCTGACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-ATAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18767 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTAAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18769 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCCATTC--ACCTCTGATTTATGGAATCAATATTCTAACACAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGTACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTTTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18776 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTAAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18793 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGCGTGTACGTCT-ATAGCAACC-ATAAAATCCAGGGAGAGAAGGAGAGTCGACTGAC-ATGCAT-GGAACAGCTACAATGGAACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCGATTC--AACTCCGATTTACGGAATCAATCTTCTAACGCGGG-TGGTATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATCTAGAGCCTGGTACCATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTCTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGAGCTGGCAACAACTGGGCAAAGGGACATTACACTGAGGGTGCTGAGCTCGTCGACAACGTTCTCGATGTCGTTCGTCGCGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTTGGTGGTGGTACTGGTGCCGGTATGGGTACTCTCCTGATCTCCAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCCCCCAAGGTCTCGGACACCGTTGTCGAGCCCTATAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAATTCCGACGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTAAAGCTGTCCAACCCCTCTTACGGTGATCTAAACCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTACGTTTCCCTGGCCAACTCAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGCGCTGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-ACTCTCTCTTTCC-CGCTGCAGTATAA-TTAGTTACTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18804 TGGCAACAAATTTCTGGCGAGCATGGTCTCGACGGCAGTGGTGTGTATGTTT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATATGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTGAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGCAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18805 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGTAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGGATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTTGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGCTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAATGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCTAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGACAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-AATTCCTCTTTCC-CATTACGGTATGA-TTAGTCCCTAACTTGA--TTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18853 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGAAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCCATTC--GCCTCTGATTTATGGAATCAATATTCTAACACAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGTACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTATACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTCTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTACCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-ATTTACTATTCCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CCCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18855 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTAAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18858 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGATTTATGGGATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCTGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTCCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCTCTATATGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTGAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-ATTTGCTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18860 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGATTTATGGGATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCTGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTCCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCTCTATATGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTGAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-ATTTGCTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18863 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCCC-ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGTATTGACAATGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGACAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-AATTCCTCTTTCC-CATTACGGTATGA-TTAGTCCCTAACTTGA--TTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18866 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGTAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTTGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGCTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAATGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTTTCTAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGACAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-AATTCCTCTTTCC-CATTACGGTATGA-TTAGTCCCTAACTTGA--TTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18868 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCCGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACTGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18871 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTAAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18887 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACTAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAAGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCCGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCCCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACTGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18889 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTAAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18890 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGATTTATGGGATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCATTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGCTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAATGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCTAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGACAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCATTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-AATTCCTCTTTCC-CATTACGGTATGA-TTAGTCCCTAACTTGA--TTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18892 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGAGAGTCAACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGATTTATGGGATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCTGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTCCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCTCTATATGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTGAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-ATTTGCTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18893 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGGGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGGTTTATGGAATCAATATTCTAACGCAGGGGAATATGTAGGGTGCTGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGCTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAATGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGACAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-AATTCCTCTTTCC-CATTACGGTATGA-TTAGTCCCTAACTTGA--TTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18895 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTAAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTTCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18896 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCA-TTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTAAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18899 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTAAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18900 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATAAAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCTGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGATATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18901 TGGCAACAAATTTCTGGCGAGCATGGTCTCGACGGCAGTGGTGTGTATGTTT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGCTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAATGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTGAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGACAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTTATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-AATTCCTCTTTCT-CATTACGGTATGA-TTAGTCCCTAACTTGA--TTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_18907 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGTAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTTGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGCTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAATGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCTAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGACAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAATTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-AATTCCTCTTTCC-CATTACGGTATGA-TTAGTCCCTAACTTGA--TTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20842 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCCATTC--ACCTCTGATTTATGGAATCAATATTCTAACACAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGTACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGCGGTACTGGTGCCGGTATGGGTACTCTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-ATTTACTATTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--TACTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20846 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGTAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGAGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCTGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTCCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTAAAGCTGTCCAACCCCTCGTACGGTGATCTGAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-ATTTGCTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20847 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGTAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGAGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCTGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTCCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTAAAGCTGTCCAACCCCTCGTACGGTGATCTGAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-ATTTGCTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20931 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCCATTC--ACCTCTGATTTATGGAATCAATATTCTAACACAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGTACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCCAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTATCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGTCAACTTAACTCTGATCTTCGCAAGTTAGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-ATTCACTCTTTCC-AACTACAGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20938 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCGGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACAC--GGGAATATTTAGGGTGCCGGAAACAAGTATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGTACAATGGATGCTGTCCGTGCTGGTCCTTTTGGGCAACTCTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGCTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGTATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTAGTCGAGAACTCCGACGAGACCTTCTGCATTGACAATGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTGACCACATGCTTGCGTTTCCCTGGCCAGCTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTACCTGACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-ATAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20943 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAGTATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAGGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTCTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCTGTCATGCCCTCTCCCAAGGTCTCGGACACTGTTGTCGAGCCTTACAACGCCACCCTTTCCGTTCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-ATTTACTATTTCC-CACTACGGTATGA-TTAGTCACTAACTTGA--CCCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20945 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGAAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGTAAAC-CTACCCATTC--GCCTCTGATTTATGGAATCAATATTCTAACACAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGTACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTATACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTCTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAATGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-ATTTACTATTCCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CCCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20946 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTAAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20947 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTAAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20959 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTTCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTAAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20960 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCTAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGATTTATGGAATCAATATTCTAACGTAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTTGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGCTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAATGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCTAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGACAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-AATTCCTCTTTCC-CATTACGGTATGA-TTAGTCCCTAACTTGA--TTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20965 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAACC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGCCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20967 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCGACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATTC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCTACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGCCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGCGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ATTTACTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20969 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGTAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTTGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGCTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAATGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCTAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGACAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-AATTCCTCTTTCC-CATTACGGTATGA-TTAGTCCCTAACTTGA--TTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20970 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCCATTC--ACCTCTGATTTATGGAATCAATATTCTAACACAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGTACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGTTAATCTCCAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTATCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGTCAACTTAACTCTGATCTTCGCAAGTTAGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-ATTCACTCTTTCC-AACTACAGTATGA-TTAGTCCCTAACTTGA--CTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20980 TGGCAACAAATTTCTGGCGAGCATGGTCTCGACGGCAGTGGCGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACCAATCC--ACCTCTGATTTATGGAATCAATATTCTAACGCAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGCTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAATGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGCGTCACCACATGCTTGCGTTTCCCTGGACAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-AATTCCTCTTTCC-CACTACGGTATGA-TTAGTCCCTAACTTGA--TTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_BCC_20982 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGTGTGTATGTCT-ACAGCAACC-ATACAATCCAGGGAGAGCAGGAGAGTCGACTGAC-TTGCAT-GGAACAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCAAAC-CTACTAATCT--ACTTCTGATTTATGGAATCAATATTCTAACGTAGGGGAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGCACAATGGATGCTGTCCGTGCTGGTCCTTTTGGCCAACTTTTCCGACCCGATAACTTCGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGTGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACTGGTGCCGGTATGGGTACTTTGCTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCTTACAATGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAATGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCCTCGTACGGTGATCTAAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGTTTGCGTTTCCCTGGACAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGTGCCGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTGACCTGCTCTGCCATTTTGTAAGA-AATTCTTCTTTCC-CATTACGGTATGA-TTAGTCCCTAACTTGA--TTCTCTA----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Nemania_diffusa_GQ470220 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAGTGGCGTGTATGTCT-ATAGCAATC-ATAAAATCCAGCGAGGGCAGGAGAGTCGACTGAC-ATAAAT-GGAATAGCTACAATGGAACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGTACGCGAAC-CTACCAATTC--ACCTCCGGTTTATGGAATCAATATTCTAACGCGGGGTAATATTTAGGGTGCCGGAAACAAATATGTTCCTCGCGCCGTGCTCGTCGATTTAGAGCCTGGTACCATGGATGCTGTCCGTGCCGGTCCTTTCGGCCAACTTTTCCGACCCGATAACTTTGTTTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGACATTACACTGAGGGTGCTGAGCTTGTCGACAACGTTCTCGATGTCGTTCGTCGCGAAGCTGAGGGCTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGCACTGGTGCCGGTATGGGTACTCTGCTAATCTCTAAGATTCGCGAGGAGTTTCCTGACCGCATGATGGCCACCTTCTCCGTTATGCCCTCTCCCAAGGTCTCGGACACCGTTGTCGAGCCCTATAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTCTGCATTGACAACGAGGCTCTATACGACATTTGCATGCGTACTTTGAAGCTGTCCAACCCTTCGTACGGTGATCTGAATCACCTTGTCTCCGCTGTCATGTCTGGTGTCACCACATGCTTGCGTTTCCCTGGTCAACTTAACTCTGATCTTCGCAAGTTGGCTGTGAACATGGTGCCTTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTTGCTCCTCTTACGAGCCGTGGTGCGCACTCTTTCCGCGCTGTCACCGTCCCTGAGTTGACTCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCGCTGACTTCCGTAACGGTCGCTATCTAACCTGCTCTGCCATTTTGTAAGA-ACTAGCCCTTTCT-CGCTGCGATATGA-TCAGTCTCTAACTTAA--CTCTTTG----AATAGCCGCGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_1027 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_1069 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGGACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_1144 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGCGCTGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTTATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAT-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_1218 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATATGCATGCGTACCCTGAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCCATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATATTTTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCTATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_1219 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACATGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCTTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_1223 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ACTTGGAACGTGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGCTATAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCGAA-TC-ACTGCCGTTACATAT-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAATATGTCCCTCGCGCTGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTAAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_1224 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTACGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-AATGCCGTTACATAC-ACAAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCTGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGTCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_1225 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TGAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATTCTTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_1227 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TGAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_1255 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGGATGTGGCAACGTGATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCCGCATAT-TTTATAGCTAACTGTA--TACTCTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_1282 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCA-TTGGC-----ATATGGAACGTGGCAACGGCATTGGTCAACTGAC-ATAGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTAGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAGCCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAACTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_1303 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACCGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCTCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATGGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_1315 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGGATGTGGCAACGTGATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCCGCATAT-TTTATAGCTAACTGTA--TACTCTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18721 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTGCATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCTAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAT-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18723 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCC---ATATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTACGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTTCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18725 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGCGCTGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAATTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18727 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TGAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTGACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTCC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18728 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACATGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGTTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCAAA-TC-ACCGCCGTTACATAC-ACGAACCTTCTAAC--GATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCGTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18730 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCAT---ATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTACGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTTCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTGCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATAT-CTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18733 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGCGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCATATGGCGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTGGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18735 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACCGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATTTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18736 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTTCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCCATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATATTTTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18740 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTGACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18744 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTGCATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCCATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATATTTTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18748 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-AATGCCGTTACATAC-ACAAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCTGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGTCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18749 TGGCAACAAATTTCGGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-GTGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATGC----CACCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACAAGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCATTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACGTGCTCTGCCATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATATTTTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18757 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18758 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTACGTCT-TTAGC-----ATTTGGAACGCGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCTGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTTATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCCGCATAT-GTTATAGCTAACTGTA--TACTCTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18759 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTAGAACGTGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGTTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCAAA-TC-ACCGCCGTTACATAC-ACGAACCTTCTAAC--GATGGGGATTTTAGGGTGCGAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGTTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18760 TGGCAACAAATTTCTGGCGAGCACGGTCTTGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGGATGTGGCAACGTGATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18761 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACATGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGTTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----TGCCAAA-TC-ACCGCCGTTACATAC-ACGAACCTTCTAAC--GATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGTTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18762 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ACTTGGAACGTGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGCTATAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCGAA-TC-ACTGCCGTTACATAT-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAATATGTCCCTCGCGCTGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAAGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTAAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18764 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACGTGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGTTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCAAA-TC-ACCGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACTTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGGAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18765 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGGATGTGGCAACGTGATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCTAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAT-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18766 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TGGGT-----ATCTAGAACGTGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGCTACAACGGAACCTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACCGAGGGTGCTGAGCTGGTTGACAACGTCCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCTTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATTTGCATGCGCACCCTGAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAATTGGCTGTCAACATGGTGCCATTCCCCCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTATGA-AAACACCC-TTTC-CCCTGCTGCACAG-TTTATAGCTAACTGTA--TACTTTC----ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18768 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TGGGC-----ATCTGGAACGTGGCGACGGGACTGGTCGACTGAC-AAGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAACGCATGAGCGTTTACTTCAACGAGGTAGATACCTTCCGCCAAA-TC-ACTGCCGTTATATAT-ACAAATCTTCTAACATGATGGGGATTTCAGGGTGCCAACAACAAGTATGTCCCTCGCGCCGTGCTCGTCGACTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGCCACTACACCGAGGGTGCTGAGCTGGTTGACCAGGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCCGAGCTGACCCAGCAGATGTTTGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACCTGACATGCTCTGCTATCTTGTAAGA-AAATACCCTTTTC-CCCTGCAGCACAG-CTTATCGCTAACTGTA--CACTTTC----ACTAGCCGTGGCAAGGTTTCTATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18770 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TGGGT-----ATCTAGAACGTGGCAACGGCATTGGTCAACTGAC-ATGGGT-GAAACAGCTACAACGGAACCTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCAAA-TC-ACTGCCGTTGCATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACCGAGGGTGCTGAGCTGGTTGACAACGTCCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTACTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCTAAGGTCTCCGACACCGTCGTCGAGCCTTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATTTGCATGCGTACCCTGAAGCTATCCAACCCCTCATACGGCGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTATGA-AAACACCC-TCTC-CCCTGCAGCCCAG-TTTATAGCTAACTGTA--TACTTTC----ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18773 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACATGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGTTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCAAA-TC-ACCGCCGTTACATAC-ACGAACCTTCTAAC--GATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGTTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18774 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TCAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTCAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCTAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAT-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18775 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGCGCTGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTTGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCCGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18779 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18782 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCATTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTACGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTTCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTGCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATAT-CTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18783 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-CC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAATGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCCATCTTGTAAGA-AAACACCCTCTTC-CCCTGCAGCATATTTTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18785 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGTTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGGACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGTACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18792 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCCGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCCATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATATGTTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18794 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTGCATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18795 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TGAAC-----ATTTGGAAC-TGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTTAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCTGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCCGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGCGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCTAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18799 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCTTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18801 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACGTGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGTTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCAAA-TC-ACCGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCGTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18802 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGGATGTGGCAACGTGATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18803 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAAATC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCTGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18854 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACACAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCATTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18856 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTAGAACGTGGCAATGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TT-ACTGCCGTTACATAC-ATGAACCTTCTAACACGATGGGGAATTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTTCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18857 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TGGGT-----ATCTAGAACGTGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGCTACAACGGAACCTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCAAA-TC-ACTGCCGTTGCATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACCGAGGGTGCTGAGCTGGTTGACAACGTCCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCTTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATTTGCATGCGTACCCTGAAGCTATCCAACCCCTCATACGGCGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTATGA-AAACGCCC-TCTC-CCCTGCAGCCCAG-TTTATAGCTAACTGTA--TACTTTC----ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18864 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCCGTCCGTGCTGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCCGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18865 TGGCAACAAATTTCCGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TGGGC-----ATCTGGAACGTGGCGACGGGACTGGTCGACTGAC-AAGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATACATACCGCCAAA-TC-ACTGCCGTTATATAT-ACAAATCTTCTAACATGATGGGGATTTCAGGGTGCCAACAACAAGTATGTCCCTCGCGCCGTGCTCGTCGACTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGCCACTACACCGAGGGTGCTGAGCTGGTTGACCAGGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCCGAGCTGACCCAGCAGATGTTTGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACCTGACATGCTCTGCTATCTTGTAAGA-AAACAACCTTTTC-CCCTGCAGCACAG-CTTATCGCTAACTGTA--CACTTTC----ACTAGCCGTGGCAAGGTTTCTATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18867 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCCATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATATTTTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18872 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTAGAACGTGGCAATGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACTTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCCATCTTGTAAGA-GAACACCCTTTTC-CCCTGCAGCATATTTTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18874 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGCGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCTGGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18875 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCATTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTACGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTTCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTGCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATAT-CTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18876 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGCGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18877 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TCAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATTACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18878 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTGCATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCTAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAT-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18879 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACATGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGTTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCAAA-TC-ACCGCCGTTACATAC-ACGAACCTTCTAAC--GATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCGTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18880 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-AATGCCGTTACATAC-ACAAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCTGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGTCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18881 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACGTGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATGG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAATATGTCCCTCGCGCTGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGCCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAGCATCCTTCCC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18883 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGACATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCTGTTACATAC-ACGAGCCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTAGAACCCGGTACTATGGATGCTGTCCGTGCCGGTCCCTTTGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18884 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCATCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTTATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCGGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18885 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCCATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATATTTTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18888 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGTAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACAAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTCCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCCATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATATTTTTATAGCTAACTGTA--TACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18894 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18897 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGCGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCGAA-TC-ACTGCCGTTGCATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAATATGTCCCTCGCGCTGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGCCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18898 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACGTGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGTTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCAAA-TC-ACCGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCGTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18903 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-AATGCCGTTACATAC-ACAAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCTGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGTCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18904 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_18906 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCAT---ATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTACGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTTCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTGCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATAT-CTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20839 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCCGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCGGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20840 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGCTTGGCATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGCGCTGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTTGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20841 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACATGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGTTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCAAA-TC-ACCGCCGTTACATAC-ACGAACCTTCTAAC--GATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGTTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20848 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-AATGCCGTTACATAC-ACAAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCTGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGTCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20927 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACTTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAATATCCTTTTC-CCCTGAAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20939 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACATGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGTTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCAAA-TC-ACCGCCGTTACATAC-ACGAACCTTCTAAC--GATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGTTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20942 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-AATGCCGTTACATAC-ACAAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCTGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGTCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20956 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCGAA-TC-ACTGCTGTTACATAC-ACGAGCCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGAACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20957 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TGGGT-----ATCTAGAACGTGGCAACGGCATTGGTCAACTGAC-ATGGGT-GAAACAGCTACAACGGAACCTCCGAGCTCCAGCTAGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCAAA-TC-ACTGCCGTTGCATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACCGAGGGTGCTGAGCTGGTTGACAACGTCCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTACTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCTAAGGTCTCCGACACCGTCGTCGAGCCTTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATTTGCATGCGTACCCTGAAGCTATCCAACCCCTCATACGGCGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTATGA-AAACACCC-TCTC-CCCTGCAGCCCAG-TTTATAGCTAACTGTA--TACTTTC----ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20958 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TCAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACCGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCTGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGATCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AGACATCCTTTTC-CCATGCAGCACAT-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20961 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TGAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCGAA-TC-ACTGCCGTTACATAT-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAATATGTCCCTCGCGCTGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGCCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCTGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTCTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20962 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TGAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCGAA-TC-ACTGCCGTTACATAT-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAATATGTCCCTCGCGCTGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGCCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCTGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTCTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20963 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGAGGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCCGTCCGTGCTGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20964 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TGGGC-----ATCTGGAACGTGGCGACGGGACTGGTCGACTGAC-AAGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATACATACCGCCAAA-TC-ACTGCCGTTATATAT-ACAAATCTTCTAACATGATGGGGATTTCAGGGTGCCAACAACAAGTATGTCCCTCGCGCCGTGCTCGTCGACTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGCCACTACACCGAGGGTGCTGAGCTGGTTGACCAGGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCCGAGCTGACCCAGCAGATGTTTGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACCTGACATGCTCTGCTATCTTGTAAGA-AAATACCCTTTTC-CCCTGCAGCACAG-CTTATCGCTAACTGTA--CACTTTC----ACTAGCCGTGGCAAGGTTTCTATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20966 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCATCTAACACGATGGGGATTTTAGGGTGCTAACAACAAATATGTCCCTCGCGCTGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGCCATTATACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCTCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTATACACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20968 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGTGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTGCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCCATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATATTTTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20977 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGACATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAAGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTCGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACGTGCTCTGCCATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATATTTTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20984 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TGAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAT-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20985 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGCGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACTGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20988 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCCGTCCGTGCTGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20991 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACATGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGTTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCAAA-TC-ACCGCCGTTACATAC-ACGAACCTTCTAAC--GATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGTTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_20994 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TGGGT-----ATCCAGAACGTGGCAACGGCATTGGTCAACTGAC-ATGGAT-GAAACAGCTACAACGGAACCTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAC----CGCCAAA-TC-ACTGCCGTTGCATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACCGAGGGTGCTGAGCTGGTTGACAACGTCCTCGATGTTGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCTTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATTTGCATGCGCACCCTGAAGCTATCCAACCCCTCATACGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTCACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAATTGGCTGTCAACATGGTGCCATTCCCCCGTCTGCACTTCTTCATGGTGGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTATGA-AAACACCC-TTTC-CCCTGCTGCACAG-TTTATAGCTAACTGTA--TACTTTC----ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_cubensis_BCC_21003 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGCAATGGAGTGTATGTCT-TTAGC-----ATTTGGAACGTGGCAACGGCATTGGTCGACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTCCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-AATGCCGTTACATAC-ACAAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCTGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGTTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCCGCCGTCATGTCTGGTGTTACTACCTGTCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACATCCTTTTC-CCCTGCAGCACAG-CTCATAGCTAACTTTA--CACTTTC----GCTAGCCGTGGCAAGGTTTCCATGAAGGAGGTCGAGGACCAGATGCGAAA Xylaria_cubensis_GQ502702 TGGCAACAAATTTCTGGCGAGCACGGTCTCGACGGTAATGGAGTGTATGTCT-TTGGC-----ATTTGGAACGTGGCATCGGCATTGGTCAACTGAC-ATGGAT-GAAACAGCTACAACGGAACTTCCGAGCTTCAGCTGGAGCGCATGAGCGTTTACTTCAACGAGGTAGATAG----CGCCAAA-TC-ACTGCCGTTACATAC-ACGAACCTTCTAACACGATGGGGATTTTAGGGTGCTAACAACAAGTATGTCCCTCGTGCCGTGCTCGTCGATTTGGAACCCGGTACCATGGATGCTGTCCGTGCCGGTCCCTTCGGTCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCTGAGCTGGTTGACAACGTTCTCGATGTCGTCCGTCGCGAGGCTGAAGGCTGTGACTGCCTTCAGGGTTTCCAGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTGCTGATCTCCAAGATCCGCGAGGAGTTCCCTGACCGCATGATGGCTACCTTCTCCGTCATGCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCAGACGAGACCTTCTGTATTGACAACGAGGCTCTGTACGACATCTGCATGCGTACCCTGAAGCTGTCCAACCCCTCATATGGTGACTTGAACCACCTTGTCTCTGCCGTCATGTCTGGTGTTACTACCTGCCTGCGTTTCCCTGGCCAGCTTAACTCTGACCTGCGCAAGTTGGCTGTCAACATGGTGCCATTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCGCCTCTCACTAGTCGTGGTGCTCACTCTTTCCGTGCTGTCACGGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCTGCTGATTTCCGCAACGGTCGTTACTTGACATGCTCTGCTATCTTGTAAGA-AAACACCCTTTTC-CCCTGCAGCATAT-TTTATAGCTAACTGTA--TACTTTC----ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_1002 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGTATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACTAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCGATTGTTAACTAATACTTTTTTTT---ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_1013 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCGATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCATCGGGCT--GCGCGCGCCCCGTGCGACAAACATTCTGATAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGTCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTTGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTTACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTTCGTGCCGTCACGGTTCCTGAGCTAACCCAGCAAATGTTCGACCCCAAGAACATGATGGCCGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCTATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCGTAG-TCGATTATTAACTTATACTTTTTTTCT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAAGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_1035 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTAAACCATCTTGTCTCCGCTGTCATGTCTGGCGTCACCACCTGCCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTT--AGCGTAG-TCGATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_1053 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTAGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCAGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGTATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCGATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_1102 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATGGCGTCGATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAACGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCC-ATCGAGCC--GCGCGCGCCTCGTGCGACAAACATTCTGATAT--TGAGTTTCCTAGGGTGCTAATAACAAGTATGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTTCGTGCTGGTCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCTGTCCACCAGCTAGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGATTTGAACCACCTTGTCTCTGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTAGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTCACCAGCCGTGGTGCTCACTCTTTCCGCGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCTATCTTGTAAGA-ATTTGCCCTTTGCACCTTTGAGCGTGG-TCGATTGTTAACTTGTACCTTTTTCT---ACCAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_1170 TGGCAACAGATTTCCGGCGAACACGGTCTCGACGGCAGTGGCGTGTAAGTCTTATAGCATCT-AGGAATGGCGTCGATGAGGGAACAGTCGACTGAC-ACTCTT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACTCC-ATCGGGCCCCGCGCGCGCCTCGTGCGACAAACATTCTGATAT--TGAGTTTCCTAGGGTGCTAATAACAAGTATGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCTGGTACTATGGATGCCGTTCGTGCTGGTCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGCGACTTGAACCACCTTGTCTCTGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCCGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTCACCAGCCGTGGTGCTCACTCTTTCCGCGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCCAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCTATCTTGTAAGA-ATTTGCCCTTTGCACCTTTTAGCGTGG-TTGATTGTTAACTTGTACTTTTTTCT---ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_1175 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTAGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTTTTCGGCCAGTCAGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGTATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCGATTGTTAACTAATACTTTTTTTT---ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_1321 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTTTCTAACCCCTCATACGGTGACTTAAACCATCTTGTCTCCGCTGTCATGTCTGGCGTCACCACCTGCCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCGTGG-TCGATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_18729 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTAAACCATCTTGTCTCCGCTGTCATGTCTGGCGTCACCACCTGCCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCGTGG-TCGATTGTTAACTAATACTTTTTTTTTT-ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_18746 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTAGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGTCCCTTTGGCCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCGATTGTTAACTAATACTTTTTTTTTTTACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_18755 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTAAACCATCTTGTCTCCGCTGTCATGTCTGGCGTCACCACCTGCCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCTTTTGCGCCTTTTAGCGTGG-TCGATTGTTAACTAATACTTTTTTTT---ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_18756 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-GGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTAAACCATCTTGTCTCCGCTGTCATGTCTGGCGTCACCACCTGCCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCGTGG-TCGATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_18788 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGTATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACTAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCAATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_18789 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTAGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCAGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCGATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_18797 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTAAACCATCTTGTCTCCGCTGTCATGTCTGGCGTCACCACCTGCCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGCGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCGTGG-TCGATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_18886 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTAAACCATCTTGTCTCCGCTGTCATGTCTGGCGTCACCACCTGCCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCGTGG-TCGATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_20843 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGTATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACTAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCAATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_20932 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCCAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGCCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTTCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGTATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCAATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_20934 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCCAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCAGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCTGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCAATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_20935 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTAAACCATCTTGTCTCCGCTGTCATGTCTGGCGTCACCACCTGCCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTTCCCTTTGCGCCTTTTAGCGTGG-TCGATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_20936 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-GGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTAAACCATCTTGTCTCCGCTGTCATGTCTGGCGTCACCACCTGCCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCGTGG-TCGATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_20941 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTAGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGTATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCAATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_20949 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGTATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACTAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCAATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_20972 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTAAACCATCTTGTCTCCGCTGTCATGTCTGGCGTCACCACCTGCCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCTTTTGCGCCTTTTAGCGTGG-TCGATTGTTAACTAATACTTTTTTTT---ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_20974 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTAGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCGATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_20975 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTAAACCATCTTGTCTCCGCTGTCATGTCTGGCGTCACCACCTGCCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCGTGG-TCGATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_20978 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGTATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCGATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_20979 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTAGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCAGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCGATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_20987 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTAGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGTATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCAATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_20995 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGTATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACTAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCAATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_20998 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCGTACGGTGACTTAAACCATCTTGTCTCCGCTGTCATGTCTGGCGTCACCACCTGCCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTCCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCGTGG-TCGATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_20999 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCCAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCAGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCGATTGTTAACTAATACTTTTTTTTTT-ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_BCC_21000 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTACTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCTAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAGTTCCCCGACCGTATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACTAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCAATTGTTAACTAATACTTTTTTTTT--ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA Xylaria_grammica_GQ487704 TGGCAACAGATTTCCGGCGAGCACGGTCTCGATGGCAGTGGCGTGTAAGTCT-ATGGCATCT-AGGAATAGCGTCCATGAGGGAACAGTCGACTGAC-ACTCGT-GGAACAGGTACAATGGAACCTCTGAGCTTCAGCTGGAGCGCATGAGTGTTTATTTCAATGAGGTA-ACAACCCCCGTCGGGCT--GCGCGCGCCTCGTGCGACAAATATTCTGACAT--TGAGTTTCCCAGGGTGCTAATAACAAGTACGTCCCTCGTGCGGTCCTCGTCGATTTGGAGCCCGGTACTATGGATGCCGTCCGTGCTGGCCCCTTTGGTCAGCTCTTCCGACCCGACAACTTCGTCTTCGGCCAGTCAGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCTGAGCTAGTCGACAACGTTCTCGACGTCGTTCGTCGCGAGGCTGAGGGTTGCGACTGCCTCCAGGGTTTCCAGATCACCCACTCGCTCGGTGGTGGTACCGGCGCCGGTATGGGTACTCTACTAATCTCCAAGATTCGCGAAGAATTCCCCGACCGCATGATGGCCACCTTCTCCGTTATGCCTTCCCCCAAGGTCTCGGATACCGTTGTCGAGCCTTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAAAACTCCGATGAGACCTTCTGCATTGACAACGAGGCCCTGTACGATATCTGCATGCGTACCTTGAAGCTATCTAACCCCTCATACGGTGACTTGAACCATCTTGTCTCCGCCGTCATGTCTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTTAACTCTGACCTGCGCAAATTGGCTGTGAACATGGTGCCCTTCCCTCGTCTACACTTCTTCATGGTCGGCTTTGCCCCTCTTACCAGCCGTGGTGCTCACTCTTTCCGTGCCGTCACGGTTCCCGAGCTAACCCAGCAAATGTTCGACCCTAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGCCGTTACCTCACATGCTCTGCCATCTTGTAAGA-ATTTGCCCTTTGCGCCTTTTAGCATGG-TCGATTGTTAACTAATACTTTTTTTTTT-ACTAGCCGTGGCAAGGTTTCCATGAAGGAGGTTGAGGACCAGATGCGAAA ; END; BEGIN TREES; TITLE Tubulin_result; LINK TAXA = Taxa1; TRANSLATE 1 Xylaria_grammica_BCC_1053, 2 Xylaria_grammica_BCC_1175, 3 Xylaria_grammica_BCC_20979, 4 Xylaria_grammica_BCC_18789, 5 Xylaria_grammica_BCC_20974, 6 Xylaria_grammica_BCC_20941, 7 Xylaria_grammica_BCC_20987, 8 Xylaria_grammica_BCC_18788, 9 Xylaria_grammica_BCC_20949, 10 Xylaria_grammica_BCC_20995, 11 Xylaria_grammica_BCC_21000, 12 Xylaria_grammica_BCC_20843, 13 Xylaria_grammica_BCC_20978, 14 Xylaria_grammica_BCC_1002, 15 Xylaria_grammica_BCC_20999, 16 Xylaria_grammica_GQ487704, 17 Xylaria_grammica_BCC_20934, 18 Xylaria_grammica_BCC_20932, 19 Xylaria_grammica_BCC_18746, 20 Xylaria_grammica_BCC_18755, 21 Xylaria_grammica_BCC_20972, 22 Xylaria_grammica_BCC_18886, 23 Xylaria_grammica_BCC_18729, 24 Xylaria_grammica_BCC_20975, 25 Xylaria_grammica_BCC_18797, 26 Xylaria_grammica_BCC_18756, 27 Xylaria_grammica_BCC_20936, 28 Xylaria_grammica_BCC_1321, 29 Xylaria_grammica_BCC_20935, 30 Xylaria_grammica_BCC_20998, 31 Xylaria_grammica_BCC_1035, 32 Xylaria_grammica_BCC_1013, 33 Xylaria_grammica_BCC_1102, 34 Xylaria_grammica_BCC_1170, 35 Nemania_cf_bipapillata_BCC_20944, 36 Nemania_cf_bipapillata_BCC_20954, 37 Nemania_cf_bipapillata_BCC_20948, 38 Nemania_cf_bipapillata_BCC_21001, 39 Nemania_cf_bipapillata_BCC_20928, 40 Nemania_cf_bipapillata_BCC_20953, 41 Nemania_cf_bipapillata_BCC_18763, 42 Nemania_cf_bipapillata_BCC_18787, 43 Nemania_cf_bipapillata_BCC_20993, 44 Nemania_cf_bipapillata_BCC_20996, 45 Nemania_cf_bipapillata_BCC_18739, 46 Nemania_cf_bipapillata_BCC_18891, 47 Nemania_cf_bipapillata_BCC_20929, 48 Nemania_cf_bipapillata_BCC_18859, 49 Nemania_cf_bipapillata_BCC_20981, 50 Nemania_cf_bipapillata_BCC_18790, 51 Nemania_cf_bipapillata_BCC_18791, 52 Nemania_cf_bipapillata_BCC_18873, 53 Nemania_cf_bipapillata_BCC_20950, 54 Nemania_cf_bipapillata_BCC_20983, 55 Nemania_cf_bipapillata_BCC_20926, 56 Nemania_bipapillata_GQ470221, 57 Nemania_diffusa_BCC_20969, 58 Nemania_diffusa_BCC_18907, 59 Nemania_diffusa_BCC_18866, 60 Nemania_diffusa_BCC_18805, 61 Nemania_diffusa_BCC_18890, 62 Nemania_diffusa_BCC_18724, 63 Nemania_diffusa_BCC_18901, 64 Nemania_diffusa_BCC_18863, 65 Nemania_diffusa_BCC_20980, 66 Nemania_diffusa_BCC_20982, 67 Nemania_diffusa_BCC_20960, 68 Nemania_diffusa_BCC_18893, 69 Nemania_diffusa_BCC_18868, 70 Nemania_diffusa_BCC_18887, 71 Nemania_diffusa_BCC_18745, 72 Nemania_diffusa_BCC_20967, 73 Nemania_diffusa_BCC_20965, 74 Nemania_diffusa_BCC_18900, 75 Nemania_diffusa_BCC_18751, 76 Nemania_diffusa_BCC_18896, 77 Nemania_diffusa_BCC_18855, 78 Nemania_diffusa_BCC_18871, 79 Nemania_diffusa_BCC_18889, 80 Nemania_diffusa_BCC_20947, 81 Nemania_diffusa_BCC_18776, 82 Nemania_diffusa_BCC_20946, 83 Nemania_diffusa_BCC_18899, 84 Nemania_diffusa_BCC_18767, 85 Nemania_diffusa_BCC_20959, 86 Nemania_diffusa_BCC_18895, 87 Nemania_diffusa_BCC_18732, 88 Nemania_diffusa_BCC_18804, 89 Nemania_diffusa_BCC_18769, 90 Nemania_diffusa_BCC_18858, 91 Nemania_diffusa_BCC_18860, 92 Nemania_diffusa_BCC_18892, 93 Nemania_diffusa_BCC_20846, 94 Nemania_diffusa_BCC_20847, 95 Nemania_diffusa_BCC_20943, 96 Nemania_diffusa_BCC_18853, 97 Nemania_diffusa_BCC_20945, 98 Nemania_diffusa_BCC_20842, 99 Nemania_diffusa_BCC_20931, 100 Nemania_diffusa_BCC_20970, 101 Nemania_diffusa_BCC_18726, 102 Nemania_diffusa_BCC_20938, 103 Nemania_diffusa_BCC_18754, 104 Nemania_diffusa_GQ470220, 105 Nemania_diffusa_BCC_18793, 106 Xylaria_cubensis_BCC_20963, 107 Xylaria_cubensis_BCC_20988, 108 Xylaria_cubensis_BCC_18864, 109 Xylaria_cubensis_BCC_18803, 110 Xylaria_cubensis_BCC_18854, 111 Xylaria_cubensis_BCC_18856, 112 Xylaria_cubensis_BCC_20839, 113 Xylaria_cubensis_BCC_18799, 114 Xylaria_cubensis_BCC_1219, 115 Xylaria_cubensis_BCC_1069, 116 Xylaria_cubensis_BCC_18904, 117 Xylaria_cubensis_BCC_18779, 118 Xylaria_cubensis_BCC_18757, 119 Xylaria_cubensis_BCC_20956, 120 Xylaria_cubensis_BCC_18883, 121 Xylaria_cubensis_BCC_18785, 122 Xylaria_cubensis_BCC_18880, 123 Xylaria_cubensis_BCC_18903, 124 Xylaria_cubensis_BCC_21003, 125 Xylaria_cubensis_BCC_20848, 126 Xylaria_cubensis_BCC_18748, 127 Xylaria_cubensis_BCC_20942, 128 Xylaria_cubensis_BCC_1224, 129 Xylaria_cubensis_BCC_18723, 130 Xylaria_cubensis_BCC_18876, 131 Xylaria_cubensis_BCC_18740, 132 Xylaria_cubensis_BCC_1303, 133 Xylaria_cubensis_BCC_18735, 134 Xylaria_cubensis_BCC_18721, 135 Xylaria_cubensis_BCC_18878, 136 Xylaria_cubensis_BCC_18765, 137 Xylaria_cubensis_BCC_18802, 138 Xylaria_cubensis_BCC_1027, 139 Xylaria_cubensis_BCC_18774, 140 Xylaria_cubensis_BCC_20958, 141 Xylaria_cubensis_BCC_18877, 142 Xylaria_cubensis_BCC_1227, 143 Xylaria_cubensis_BCC_20984, 144 Xylaria_cubensis_BCC_18727, 145 Xylaria_cubensis_BCC_18775, 146 Xylaria_cubensis_BCC_20840, 147 Xylaria_cubensis_BCC_18725, 148 Xylaria_cubensis_BCC_18881, 149 Xylaria_cubensis_BCC_20966, 150 Xylaria_cubensis_BCC_20985, 151 Xylaria_cubensis_BCC_18894, 152 Xylaria_cubensis_BCC_18733, 153 Xylaria_cubensis_BCC_1223, 154 Xylaria_cubensis_BCC_18762, 155 Xylaria_cubensis_BCC_1144, 156 Xylaria_cubensis_BCC_18884, 157 Xylaria_cubensis_BCC_1282, 158 Xylaria_cubensis_GQ502702, 159 Xylaria_cubensis_BCC_18728, 160 Xylaria_cubensis_BCC_18879, 161 Xylaria_cubensis_BCC_18801, 162 Xylaria_cubensis_BCC_18898, 163 Xylaria_cubensis_BCC_18764, 164 Xylaria_cubensis_BCC_20841, 165 Xylaria_cubensis_BCC_20939, 166 Xylaria_cubensis_BCC_20991, 167 Xylaria_cubensis_BCC_18773, 168 Xylaria_cubensis_BCC_18761, 169 Xylaria_cubensis_BCC_18759, 170 Xylaria_cubensis_BCC_18749, 171 Xylaria_cubensis_BCC_20977, 172 Xylaria_cubensis_BCC_18872, 173 Xylaria_cubensis_BCC_18867, 174 Xylaria_cubensis_BCC_18744, 175 Xylaria_cubensis_BCC_1255, 176 Xylaria_cubensis_BCC_1315, 177 Xylaria_cubensis_BCC_18760, 178 Xylaria_cubensis_BCC_20961, 179 Xylaria_cubensis_BCC_20962, 180 Xylaria_cubensis_BCC_18897, 181 Xylaria_cubensis_BCC_18758, 182 Xylaria_cubensis_BCC_18874, 183 Xylaria_cubensis_BCC_1225, 184 Xylaria_cubensis_BCC_18795, 185 Xylaria_cubensis_BCC_18794, 186 Xylaria_cubensis_BCC_20927, 187 Xylaria_cubensis_BCC_18906, 188 Xylaria_cubensis_BCC_18730, 189 Xylaria_cubensis_BCC_18782, 190 Xylaria_cubensis_BCC_18875, 191 Xylaria_cubensis_BCC_18885, 192 Xylaria_cubensis_BCC_20968, 193 Xylaria_cubensis_BCC_1218, 194 Xylaria_cubensis_BCC_18783, 195 Xylaria_cubensis_BCC_18736, 196 Xylaria_cubensis_BCC_18792, 197 Xylaria_cubensis_BCC_18888, 198 Xylaria_cubensis_BCC_18766, 199 Xylaria_cubensis_BCC_20994, 200 Xylaria_cubensis_BCC_18770, 201 Xylaria_cubensis_BCC_20957, 202 Xylaria_cubensis_BCC_18857, 203 Xylaria_cubensis_BCC_18768, 204 Xylaria_cubensis_BCC_18865, 205 Xylaria_cubensis_BCC_20964, 206 Daldinia_sp_BCC21002; TREE PAUP_1 = [&R] (206:0.114626,(((205:0.0,(203:0.002812,204:0.001857):0.001859):0.017075,(((198:0.0,199:0.003767):0.003817,(202:9.21E-4,(200:0.0,201:9.36E-4):0.002844):0.003809):0.010128,((197:0.005615,((195:0.001875,196:0.001876):9.22E-4,(191:0.0,(192:9.29E-4,(193:0.001862,194:0.002794):0.0):0.0):0.0):0.0):8.35E-4,(((157:0.005651,158:0.004697):0.0,(((162:0.0,163:0.002811):0.0,(161:0.0,(159:0.0,160:0.0):9.39E-4):9.31E-4):9.36E-4,(169:0.002836,(168:9.38E-4,(167:0.0,(166:0.0,(164:0.0,165:0.0):0.0):0.0):0.0):9.36E-4):9.44E-4):0.003756):0.001865,(((173:0.0,174:0.001861):9.3E-4,(172:0.003728,(170:0.006662,171:0.002822):9.05E-4):0.0):9.28E-4,((182:0.00375,(181:0.005537,(180:0.002603,(178:0.0,179:0.0):0.004004):0.004814):0.001079):0.0,((177:9.31E-4,(175:0.0,176:0.0):0.002821):0.004724,(((183:9.26E-4,184:0.005662):9.42E-4,(185:9.31E-4,186:0.002805):0.0):0.0,(((187:0.0,188:0.0):0.0,(189:0.0,190:0.0):0.0):0.004877,(129:0.002924,((128:9.32E-4,(127:0.0,(126:0.0,(125:0.0,(124:0.0,(122:0.0,123:0.0):0.0):0.0):0.0):0.0):0.0):0.004802,((138:0.0,((134:0.0,135:0.0):9.24E-4,(136:0.0,137:0.002812):0.003783):0.001885):9.32E-4,((151:9.32E-4,(150:9.32E-4,(((148:0.005699,149:0.003831):0.001852,(147:9.32E-4,(145:9.31E-4,146:0.0):9.38E-4):0.0):9.43E-4,(152:0.001888,(156:0.002942,(155:0.00106,(153:0.0,154:9.3E-4):0.008446):8.91E-4):0.002745):9.25E-4):0.0):9.43E-4):0.0,(((132:0.001874,133:9.38E-4):9.31E-4,((130:9.32E-4,131:9.34E-4):9.37E-4,((141:9.34E-4,(139:0.002808,140:0.004718):9.45E-4):5.0E-4,(144:0.001868,(142:0.0,143:9.32E-4):0.0):8.71E-4):4.92E-4):0.0):0.0,((121:0.00281,(119:0.001884,120:0.004711):0.00187):0.0,(117:0.0,((109:0.0,(107:0.0,(106:9.33E-4,108:9.32E-4):0.0):9.32E-4):9.35E-4,((118:0.0,(111:0.005643,116:0.0):0.0):0.0,((112:0.001867,115:9.32E-4):0.0,(110:0.00187,(113:0.0,114:9.31E-4):9.32E-4):0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.0):8.49E-4):0.0):0.007807):0.001744):0.0):9.45E-4):0.0):0.0):0.003907):0.009726):0.011251):0.060969,(((33:0.00852,34:0.007372):0.003796,(32:0.009321,((31:9.09E-4,(30:0.00181,(28:9.06E-4,(25:9.03E-4,(29:9.05E-4,(24:0.0,(23:0.0,(22:0.0,((20:0.0,21:0.0):9.04E-4,(26:0.0,27:0.0):9.03E-4):0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.002883,(19:0.002592,(18:0.00363,((14:0.0,(12:0.0,(11:0.0,(10:0.0,(8:0.0,9:0.0):0.0):0.0):0.0):9.03E-4):9.03E-4,((17:0.00181,(15:0.0,16:0.001808):0.0):0.002721,((13:0.0,(6:0.0,7:0.0):0.001808):0.0,(5:0.0,((1:0.0,2:9.03E-4):9.03E-4,(3:0.0,4:0.0):0.0):9.04E-4):0.001809):0.0):0.0):0.0):0.001035):8.81E-4):0.00738):0.007833):0.131955,((56:0.072505,(((35:0.0,36:0.0):9.21E-4,(41:0.001821,(40:0.001825,(39:9.09E-4,(37:0.0,38:0.0):0.0):0.0):0.0):0.001821):0.011829,((55:0.0,(54:0.0,(53:0.0,(52:0.0,(50:0.0,51:0.0):0.0):0.0):0.0):0.0):0.001822,((45:0.0,(44:0.0,(42:0.0,43:0.0):0.0):9.1E-4):9.1E-4,(49:9.1E-4,(48:0.0,(46:9.09E-4,47:0.0):9.1E-4):0.0):0.0):0.0):0.002205):0.071501):0.016528,(105:0.02892,(104:0.025591,((103:0.0,(101:0.0,102:0.0):0.0):0.01108,((65:0.003709,(66:0.006388,(68:0.003642,(64:0.001809,(63:0.00547,(67:0.002731,(61:0.002735,(60:9.04E-4,(62:0.003633,(59:9.05E-4,(57:0.0,58:9.03E-4):0.0):0.0):0.0):0.001819):9.05E-4):9.06E-4):0.0):0.0):0.0):8.53E-4):0.006139,((99:0.0,100:0.0):0.008401,((95:0.0073,(98:0.002734,(96:9.05E-4,97:0.001816):0.003713):0.001943):0.002719,(((93:0.0,94:0.0):0.002742,(92:9.06E-4,(90:0.0,91:0.0):0.0):0.001822):0.00463,((87:7.8E-4,88:0.004692):0.001828,(89:0.00376,(((69:0.0,70:0.002722):0.001812,(74:0.002727,(72:0.0,(71:0.0,73:0.002729):0.0):0.0):0.0):0.0,(86:9.04E-4,(84:0.0,(83:0.0,(82:0.0,(81:0.0,(80:0.0,(79:0.0,(78:0.0,(77:0.0,(76:0.0,(75:0.0,85:9.04E-4):0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.0):9.04E-4):7.89E-4):0.0):0.003798):7.53E-4):0.0):0.001157):0.0):0.018543):0.002629):0.067931):0.0708):0.058342):0.114626):0.0; END;