#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 8:51 GMT TreeBASE (cc) 1994-2008 Study reference: Burge D.O. 2011. Molecular phylogenetics of Garrya (Garryaceae). MadroƱo, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S11765] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=24; TAXLABELS Aucuba_japonica_DOB_363 Eucommia_ulmoides_AY650006 Garrya_buxifolia_DOB_1160 Garrya_elliptica_DOB_382 Garrya_elliptica_DOB_386 Garrya_flavescens_DOB_1036 Garrya_flavescens_DOB_370 Garrya_flavescens_DOB_419 Garrya_fremontii_DOB_1148 Garrya_fremontii_DOB_353 Garrya_fremontii_DOB_362 Garrya_glaberrima_DOB_1025 Garrya_glaberrima_DOB_1216 Garrya_glaberrima_DOB_1225 Garrya_grisea_DOB_778 Garrya_laurifolia_DOB_1218 Garrya_laurifolia_DOB_1252 Garrya_lindheimeri_DOB_750 Garrya_ovata_DOB_1221 Garrya_veatchii_DOB_1041 Garrya_veatchii_DOB_378 Garrya_wrightii_DOB_1239 Garrya_wrightii_DOB_1253 Garrya_wrightii_DOB_934 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M9891] TITLE ITS_for_Garryaceae; LINK TAXA = Taxa1; DIMENSIONS NCHAR=696; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aucuba_japonica_DOB_363 TCGAACCTAC----------------------AAAGTTAACAGCGAACCTAT-------CAACACATCGAGTGAGGC--ACGGGGGG--TGCGTTCGGTCTCTCCTCCCTTGCCACACGTCGAGACGCACCA-TCCGGTGTGTTCTCGGCAAAACAACGAACCCCGGCGCGATTCGCGTCAAGGAACTAAA-----------ACACAAGAGCTTTCCTCGCCATGCCCCGTTT----ACGGTGCGCTTGGGA-GGCGTCGGCTTCTTTTGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTACGCTAAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCACACCCA-ACCCCGTGCCCCCTTATGGGGTCAT--GGATGTTTGGGG--GTGGAGAATGGCCTCCCGTGCGCT-ACCATGTGCGGTTGGCCCAAGATAAAGTCCCTTTCGTCGGACATCACGACAAGTGTTGGTTGC---AAAACTAATTTATA-------------TTGTCGTAACGGATACCGTCGACGGGTGACAGTCAC----GTGACCCTGATGCACACTGTGCTAC-----------AA Eucommia_ulmoides_AY650006 GTGAACCTGCGGAAGGATCATTGTCGAAGCCTAAATCTGACCGCGAACCCGTTTACAACCGACGGAGCGAGGGAGACGGACGGCGGGCGACCG-CCGACCGATCCTCCCT---CCCACGTC------------CCC----------------AACAACAAACCCCGGCGCAGGTCGCGCCAAGGAAGTATATTATTACCGGGATGCCGGCGTCTTC--CGTCGTGCTCCGTCC----GCGGTCCGCACACGG-GACGCCGGCGTCTTCCGAACGAACAAACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACCCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTCCCAAAACCC-TGCCCCACCAGTGG-------GGGGGTTGGGGGGAGCGGAGATTGGCCTCCCGTGCGCCCGGCGTGCGCGGCTGGCTGAAAACAGAGACGACGGCAACGGACGTCACGACTAGCGGTGGTCGTACGATAGCCAATGCATGAGTTTAAGCATCCGTGCCGTCTTCGACCCCCACGAGAGCCCCCGAGCTCCATTGCGACCCCAGGTCAGGCGGGACTACCCGCTGAATTTAA Garrya_buxifolia_DOB_1160 TCGAACCTAC----------------------AAAGCAAACCGCGAACCTAT---CGAATAACACATCGAGTGAGGC--ACGGGGGGGTCGCGTTCGGT{AC}GCTCCTCCCCTGCCCCACGTCGAGACGCACCTCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTTCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGATGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCCAGACCCCGCGCCCCT{CT}CGGGGGGTCCCGCGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCACCGCGTGCGGTTGGCCCAAGAACCAGTCCCCTTCGACGGACACCGCGACAAGTGTTGGTTGAA--AAGACCGATGTATA------------CGTGTCGCGATGGATCCCGTCGACGGTCGACGATCGC----ATGACCCTGACGCACACCGTGCTAC-----------GA Garrya_elliptica_DOB_382 TCGAACCTAC----------------------AAAGCAAACCGCGAACCTAT---CGAATAACGCATCGAGTGAGGC--ACGGGGGGGTCGCGTTCGGTCGCTCCTCCCCTGCCCCACGTCGAGACGCACCTCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTTCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGATGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCAT{CT}GCGTCGCCCCCAGACCCCGCGCCCCTCCGGGGGGTCCCGCGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCACCGCGTGCGGTTGGCCCAAGAACCAGTCCCCTTCGACGGACACCGCGACAAGTGTTGGTTGAA--AAGACCGATGTATA------------CGTGTCGCGATGGATCCCGTCGACGGTCGACGATCGC----ATGACCC{CT}GACGCACACCGTGCTAC-----------GA Garrya_elliptica_DOB_386 TCGAACCTAC----------------------AAAGCAAACCGCGAACCTAT---CGAATAACGCATCGAGTGAGGC--ACGGGGGGGTCGCGTTCGGTCGCTCCTCCCCTGCCCCACGTCGAGACGCACCTCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTTCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGATGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCAGACCCCGCGCCCCTCCGGGGGGTCCCGCGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCACCGCGTGCGGTTGGCCCAAGAACCAGTCCCCTTCGACGGACACCGCGACAAGTGTTGGTTGAA--AAGACCGATGTATA------------CGTGTCGCGATGGATCCCGTCGACGGTCGACGATCGC----ATGACCCTGACGCACACCGTGCTAC-----------GA Garrya_flavescens_DOB_1036 TCGAACCTAC----------------------AAAGCAAACCGCGAACCTAT---CGAATAAC{AG}CATCGAGTGAGGC--ACGGGGGGGTCGCGTTCGGTCGCTCCTCCCCTGCCCCACGTCGAGACGCACCTCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTTCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGATGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCAGACCCCGCGCCCCTCCGGGGGGTCCCGCGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCACCGCGTGCGGTTGGCCCAAGAACCAGTCCCCTTCGACGGACACCGCGACAAGTGTTGGTTGAA--AAGACCGATGTATA------------CGTGTCGCGATGGATCCCGTCGACGGTCGACGATCGC----ATGACCCTGACGCACACCGTGCTAC-----------GA Garrya_flavescens_DOB_370 TCGAACCTAC----------------------AAAGCAAACCGCGAACCTAT---CGAATAACACATCGAGTGAGGC--ACGGGGGGGTCGCGTTCGGTCGCTCCTCCCCTGCCCCACGTCGAGACGCACCTCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTTCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGATGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCAT{CT}GCGTCGCCCCCAGACCCCGCGCCCCTCCGGGGGGTCCCGCGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCACCGCGTGCGGTTGGCCCAAGAACCAGTCCCCTTCGACGGACACCGCGACAAGTGTTGGTTGAA--AAGACCGATGTATA------------CGTGTCGCGATGGATCCCGTCGACGGTCGACGATCGC----ATGACCCTGACGCACACCGTGCTAC-----------GA Garrya_flavescens_DOB_419 TCGAACCTAC----------------------AAAGCAAACCGCGAACCTAT---CGAATAACACATCGAGTGAGGC--ACGGGGGGGTCGCGTTCGGTCGCTCCTCCCCTGCCCCACGTCGAGACGCACCTCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTTCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGATGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCAT{CT}GCGTCGCCCCCAGACCCCGCGCCCCTCCGGGGGGTCCCGCGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCACCGCGTGCGGTTGGCCCAAGAACCAGTCCCCTTCGACGGACACCGCGACAAGTGTTGGTTGAA--AAGACCGATGTATA------------CGTGTCGCGATGGATCCCGTCGACGGTCGACGATCGC----ATGACCCTGACGCACACCGTGCTAC-----------GA Garrya_fremontii_DOB_1148 TCGAACCTAC----------------------AAAGCAAACCGCGAACCTAT---CGAATAACACATCGAGTGAGGC--ACGGGGGGGTCGCGTTCGGT{AC}GCTCCTCCCCTGCCCCACGTCGAGACGCACCTCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTTCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGATGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCCAGACCCCGCGCCCCT{CT}CGGGGGGTCCCGCGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCACCGCGTGCGGTTGGCCCAAGAACCAGTCCCCTTCGACGGACACCGCGACAAGTGTTGGTTGAA--AAGACCGATGTATA------------CGTGTCGCGATGGATCCCGTCGACGGTCGACGATCGC----ATGACCCTGACGCACACCGTGCTAC-----------GA Garrya_fremontii_DOB_353 TCGAACCTAC----------------------AAAGCAAACCGCGAACCTAT---CGAATAAC{AG}CATCGAGTGAGGC--ACGGGGGGGTCGCGTTCGGTCGCTCCTCCCCTGCCCCACGTCGAGACGCACCTCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTTCCTCG{CT}CGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGATGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCAT{CT}GCGTCGCCCCCAGACCCCGCGCCCCTCCGGGGGGTCCCGCGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCACCGCGTGCGGTTGGCCCAAGAACCAGTCCCCTTCGACGGACACCGCGACAAGTGTTGGTTGAA--AAGACCGATGTATA------------CGTGTCGCGATGGATCCCGTCGACGGTCGACGATCGC----ATGACCCTGACGCACACCGTGCTAC-----------GA Garrya_fremontii_DOB_362 TCGAACCTAC----------------------AAAGCAAACCGCGAACCTAT---CGAATAACACATCGAGTGAGGC--ACGGGGGGGTCGCGTTCGGTCGCTCCTCCCCTGCCCCACGTCGAGACGCACCTCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTTCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGATGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCCAGACCCCGCGCCCCTCCGGGGGGTCCCGCGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCACCGCGTGCGGTTGGCCCAAGAACCAGTCCCCTTCGACGGACACCGCGACAAGTGTTGGTTGAA--AAGACCGATGTATA------------CGTGTCGCGATGGATCCCGTCGACGGTCGACGATCGC----ATGACCCTGACGCACACCGTGCTAC-----------GA Garrya_glaberrima_DOB_1025 TCGAACCTAC----------------------AAAGCAAACTGCGAACCTAT---CTAATAACGCATCGAGTGAGGC--ACGGGGGGATCGCGTTCAGTCGCTCCTCCCCTGCCCCACGTCGGGACGTGCCGCCCCGGGGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTCCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGACGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCCCGACCCCGCGCCCCTCCGGGGG-TCCCGTGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCATCGCGTGCGGTTGGCCCAAGAACCGGTCCCCTTCGACGGACACCGCGACAAGTGTTGGTTGAA--AAAACCGATGTGTA------------CGTGTCGCGATGGATCCCGTCGACGGCGGACGATCGC----ATGACCCCGACGCACACCGTGCTAC-----------GA Garrya_glaberrima_DOB_1216 TCGAACCTAC----------------------AAAGCAAACTGCGAACCTAT---CTAATAACGCATCGAGTGAGGC--ACGGGGGGATCGCGTTCAGTCGCTCCTCCCCTGCCCCACGTCGGGACGTGCCGCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTCCCTCG{CT}CGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGACGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCCCGACTCCGCGCCCCTCCGGGGG-TCCCGTGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCATCGCGTGCGGTTGGCCCAAGAACCGGTCCCCTTCGACGGACACCGCGACAAGTGTTGGTTGAA--AAAACCGATGTGTA------------CGTGTCGCGATGGATCCCGTCGACGG{CT}GGACGATCGC----ATGACCCCGACGCACACCGTGCTAC-----------GA Garrya_glaberrima_DOB_1225 TCGAACCTAC----------------------AAAGCAAACTGCGAACCTAT---CTAATAACGCATCGAGTGAGGC--ACGGGGGGATCGCGTTCAGTCGCTCCTCCCCTGCCCCACGTCGGGACGTGCCGCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTCCCTCG{CT}CGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGACGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCCCGACTCCGCGCCCCTCCGGGGG-TCCCGTGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCATCGCGTGCGGTTGGCCCAAGAACCGGTCCCCTTCGACGGACACCGCGACAAGTGTTGGTTGAA--AAAACCGATGTGTA------------CGTGTCGCGATGGATCCCGTCGACGGTGGACGATCGC----ATGACCCCGACGCACACCGTGCTAC-----------GA Garrya_grisea_DOB_778 TCGAA-CTAC----------------------AAAGCAAACTGCGAACCTAT---CTAATAACGCATCGAGTGAGGC--ACGGGGGGATCGCGTTCAGTCGCTCCTCCCCTGCCCCACGTCGGGACGCGCCGCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTCCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGACGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCCCGACCCCGCGCCCCTCCGGGGG-TCCCGTGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCACCGCGTGCGGTTGGCCCAAGAACCTGTCCCCTTAGACGGACACCGCGGCAAGTGTTGGTTGAA--AAAACCGATGTGTA------------CGTGTCGCGATGGATCCCGTCGACGGTGGACGATCGC----ATGACCCTGACGCACACCGTGCTAC-----------GA Garrya_laurifolia_DOB_1218 TCGAACCTAC----------------------AAAGCAAACTGCGAACCTAT---CTAATAACGCATCGAGTGAGGC--ACGGGGGGATCGCGTTCAGTCGCTCCTCCCCTGCCCCACGTCGGGACGTGCCGCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTCCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGACGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCCCGACTCCGCGCCCCTCCGGGGG-TCCCGTGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCATCGCGTGCGGTTGGCCCAAGAACCGGTCCCCTTCGACGGACACCGCGACAAGTGTTGGTTGAA--AAAACCGATGTGTA------------CGTGTCGCGATGGATCCCGTCGACGG{CT}GGACGATCGC----ATGACCCCGACGCACACCGTGCTAC-----------GA Garrya_laurifolia_DOB_1252 TCGAACCTAC----------------------AAAGCAAACTGCGAACCTAT---CTAATAACGCATCGAGTGAGGC--ACGGGGGGATCGCGTTCAGTCGCTCCTCCCCTGCCCC{AT}CGTCGGGACG{CT}GCCGCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTCCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGACGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCCCGACCCCGCGCCCCTCCGGGGG-TCCCGTGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCATCGCGTGCGGTTGGCCCAAGAACCTGTCCCCTTAGACGGACACCGCGGCAAGTGTTGGTTGAA--AAAACCGATGTGTA------------CGTGTCGCGATGGATCCCGTCGACGG{CT}GGACGATCGC----ATGACCCTGACGCACACCGTGCTAC-----------GA Garrya_lindheimeri_DOB_750 TCGAACCTAC----------------------AAAGCAAACTGCGAACCTAT---CTAATAACGCATCGAGTGAGGC--ACGGGGGGATCGCGTTCAGTCGCTCCTCCGCTGCCCCACGTCGGGACGCGCCGCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTCCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGACGTTGGCTTCTTTCGT---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCCCGACCCCGCGCCCCTCCGGGGG-TCCCGTGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCACCGCGTGCGGTTGGCCCAAGAACCTGTCCCCTTCGACGGACACCGCGGCAAGTGTTGGTTGAA--AAAACCGATGTGTA------------CGTGTCGCGATGGATCCCGTCGACGGTGGACGATCGC----ATGACCCTGACGCACACCGTGCTAC-----------GA Garrya_ovata_DOB_1221 TCGAACCTAC----------------------AAAGCAAACTGCGAACCTAT---CTAATAACGCATCG{AT}GTGAGGC--ACGGGGGGATCGCGTTCAGTCGCTCCTCCGCTGCCCCACGTCGGGACGCGCCGCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTCCCTCGCCGTGCCCCCGTCCA{CT}GACGGTGTGCCCGGGGAGACGTTGGCTTCTTTCGT---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCCCGACCCCGCGCCCCTCCGGGGG-TCCCGTGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCACCGCGTGCGGTTGGCCCAAGAACCTGTCCCCTTCGACGGACACCGCGGCAAGTGTTGGTTGAA--AAAACCGATGTGTA------------CGTGTCGCGATGGATCCCGTCGACGGTGGACGATCGC----ATGACCCTGACGCACACCGTGCTAC-----------GA Garrya_veatchii_DOB_1041 TCGAACCTAC----------------------AAAGCAAACCGCGAACCTAT---CGAATAACACATCGAGTGAGGC--ACGGGGGGGTCGCGTTCGGTCGCTCTTCCCCTGCCCCACGTCGAGACGCACCTCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTTCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGATGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCCAGACCCCGCGCCCCTCCGGGGGTTCCCGCGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCACCGCGTGCGGTTGGCCCAAGAACCAGTCCCCTTCGACGGACACCGCGACAAGTGTTGGTTGAA--AAGACCGATGTATA------------CGTGTCGCGATGGATCCCGTCGACGGTCGACGATCGC----ATGACCCCGACGCACACCGTGCTAC-----------GA Garrya_veatchii_DOB_378 TCGAACCTAC----------------------AAAGCAAACCGCGAACCTAT---CGAATAACGCATCGAGTGAGGC--ACGGGGGGGTCGCGTTCGGTCGCTCCTCCCCTGCCCCACGTCGAGA{AC}GCACCTCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTTCCTCG{CT}CGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGATGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCAT{CT}GCGTCGCCCCCAGACCCCGCGCCCCTCCGGGGGGTCCCGCGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCACCGCGTGCGGTTGGCCCAAGAACCAGTCCCCTTCGACGGACACCGCGACAAGTGTTGGTTGAA--AAGACCGATGTATA------------CGTGTCGCGATGGATCCCGTCGACGGTCGACGATCGC----ATGACCC{CT}GACGCACACCGTGCTAC-----------GA Garrya_wrightii_DOB_1239 TCGAACCTAC----------------------AAAGCAAACTGCGAACCTAT---CTAATAACGCATCGAGTGAGGC--ACGGGGGGATCGCGTTCAGTCGCTCCTCCCCTGCCCC{AT}CGTCGGGACGCGCCGCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTCCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGACGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCCCGACCCCGCGCCCCTCCGGGGG-TCCCGTGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCA{CT}CGCGTGCGGTTGGCCCAAGAACCTGTCCCCTTAGACGGACACCGCGGCAAGTGTTGGTTGAA--AAAACCGATGTGTA------------CGTGTCGCGATGGATCCCGTCGACGGTGGACGATCGC----ATGACCCTGACGCACACCGTGCTAC-----------GA Garrya_wrightii_DOB_1253 TCGAACCTAC----------------------AAAGCAAACTGCGAACCTAT---CTAATAACGCATCGAGTGAGGC--ACGGGGGGATCGCGTTCAGTCGCTCCTCCCCTGCCCCACGTCGGGACGCGCCGCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTCCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGACGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCCCGACCCCGCGCCCCTCCGGGGG-TCCCGTGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCG{CT}TCACCGCGTGCGGTTGGCCCAAGAACCTGTCCCCTTAGACGGACACCGCGGCAAGTGTTGGTTGAA--AAAACCGATGTGTA------------CGTGTCGCGATGGATCCCGTCGACGGTGGACGATCGC----ATGACCCTGACGCACACCGTGCTAC-----------GA Garrya_wrightii_DOB_934 TCGAACCTAC----------------------AAAGCAAACTGCGAACCTAT---CTAATAACGCATCGAGTGAGGC--ACGGGGGGATCGCGTTCAGTCGCTCCTCCCCTGCCCCACGTCGGGACGCGCCGCCCCGGTGTGTTCCCGACAGAACAACGAACCCCGACGCGATCCGCGTCAAGGAACTAAA----------AACACGAGAGCCTCCCTCGCCGTGCCCCCGTCCACGACGGTGTGCCCGGGGAGACGTTGGCTTCTTTCGA---AACAAA-AATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCCAAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCCCGACCCCGCGCCCCTCCGGGGG-TCCCGTGGACGTCTGGGG--GTGGAAGATGGCCTCCCGTGCGCTCACCGCGTGCGGTTGGCCCAAGAACCTGTCCCCTTAGACGGACACCGCGGCAAGTGTTGGTTGAA--AAAACCGATGTGTA------------CGTGTCGCGATGGATCCCGTCGACGGTGGACGATCGC----ATGACCCTGACGCACACCGTGCTAC-----------GA ; END; BEGIN TREES; TITLE Bayesian_majority_rule_consensus; LINK TAXA = Taxa1; TRANSLATE 1 Eucommia_ulmoides_AY650006, 2 Aucuba_japonica_DOB_363, 3 Garrya_veatchii_DOB_1041, 4 Garrya_veatchii_DOB_378, 5 Garrya_elliptica_DOB_382, 6 Garrya_fremontii_DOB_353, 7 Garrya_elliptica_DOB_386, 8 Garrya_flavescens_DOB_1036, 9 Garrya_buxifolia_DOB_1160, 10 Garrya_fremontii_DOB_1148, 11 Garrya_flavescens_DOB_370, 12 Garrya_flavescens_DOB_419, 13 Garrya_fremontii_DOB_362, 14 Garrya_glaberrima_DOB_1025, 15 Garrya_glaberrima_DOB_1225, 16 Garrya_laurifolia_DOB_1218, 17 Garrya_glaberrima_DOB_1216, 18 Garrya_lindheimeri_DOB_750, 19 Garrya_ovata_DOB_1221, 20 Garrya_laurifolia_DOB_1252, 21 Garrya_wrightii_DOB_1239, 22 Garrya_wrightii_DOB_1253, 23 Garrya_grisea_DOB_778, 24 Garrya_wrightii_DOB_934; TREE CON_50_MAJ_RULE = [&R] (1:0.452956,2:0.081877,(3:0.007067,4:0.001885,5:0.001857,6:0.001739,7:0.001914,8:0.001838,9:0.001783,10:0.00182,11:0.001816,12:0.001771,13:0.001804,((14:0.003805,(15:0.001887,16:0.001866,17:0.001805)0.87:0.00358)0.99:0.008193,((18:0.001864,19:0.001773)1.00:0.005702,(20:0.003366,21:0.00179,22:0.001828,23:0.001793,24:0.001876)0.92:0.003622)0.93:0.005293)1.00:0.030697)0.99:0.080619); END; BEGIN TREES; TITLE Maximum_parsimony_strict_consensus; LINK TAXA = Taxa1; TRANSLATE 1 Eucommia_ulmoides_AY650006, 2 Aucuba_japonica_DOB_363, 3 Garrya_veatchii_DOB_1041, 4 Garrya_veatchii_DOB_378, 5 Garrya_elliptica_DOB_382, 6 Garrya_fremontii_DOB_353, 7 Garrya_elliptica_DOB_386, 8 Garrya_flavescens_DOB_1036, 9 Garrya_buxifolia_DOB_1160, 10 Garrya_fremontii_DOB_1148, 11 Garrya_flavescens_DOB_370, 12 Garrya_flavescens_DOB_419, 13 Garrya_fremontii_DOB_362, 14 Garrya_glaberrima_DOB_1025, 15 Garrya_glaberrima_DOB_1225, 16 Garrya_laurifolia_DOB_1218, 17 Garrya_glaberrima_DOB_1216, 18 Garrya_lindheimeri_DOB_750, 19 Garrya_ovata_DOB_1221, 20 Garrya_laurifolia_DOB_1252, 21 Garrya_wrightii_DOB_1239, 22 Garrya_wrightii_DOB_1253, 23 Garrya_grisea_DOB_778, 24 Garrya_wrightii_DOB_934; TREE MP_STRICT_CON = [&R] (1,2,((3,4,5,6,7,8,9,10,11,12,13),((14,(15,16,17)),((18,19),(20,21,22,23,24))))); END; BEGIN TREES; TITLE 'Maximum likelihood "best" result'; LINK TAXA = Taxa1; TRANSLATE 1 Eucommia_ulmoides_AY650006, 2 Aucuba_japonica_DOB_363, 3 Garrya_veatchii_DOB_1041, 4 Garrya_veatchii_DOB_378, 5 Garrya_elliptica_DOB_382, 6 Garrya_fremontii_DOB_353, 7 Garrya_elliptica_DOB_386, 8 Garrya_flavescens_DOB_1036, 9 Garrya_buxifolia_DOB_1160, 10 Garrya_fremontii_DOB_1148, 11 Garrya_flavescens_DOB_370, 12 Garrya_flavescens_DOB_419, 13 Garrya_fremontii_DOB_362, 14 Garrya_glaberrima_DOB_1025, 15 Garrya_glaberrima_DOB_1225, 16 Garrya_laurifolia_DOB_1218, 17 Garrya_glaberrima_DOB_1216, 18 Garrya_lindheimeri_DOB_750, 19 Garrya_ovata_DOB_1221, 20 Garrya_laurifolia_DOB_1252, 21 Garrya_wrightii_DOB_1239, 22 Garrya_wrightii_DOB_1253, 23 Garrya_grisea_DOB_778, 24 Garrya_wrightii_DOB_934; TREE ML_GARLI_BEST = [&R] (1:0.428109,2:0.072231,(3:0.005082,6:0.0,9:0.0,10:0.0,11:0.0,12:0.0,13:0.0,((4:0.0,5:0.0,7:0.0,8:0.0):0.001685,((14:0.001698,(15:0.0,16:0.0,17:0.0):0.001688):0.005716,((18:0.0,19:0.0):0.003423,(20:0.001697,21:0.0,22:0.0,23:0.0,24:0.0):0.001693):0.002935):0.026906):0.001699):0.074171); END;